University of Nevada, Reno Protein Therapy for Muscular Dystrophy

University of Nevada, Reno

Protein Therapy for Muscular Dystrophy and Other Muscle Diseases

A Dissertation submitted in partial fulfillment of the requirements for the degree for Doctor of Philosophy in Cellular and Molecular Pharmacology and Physiology

Pam M. Van Ry

Dr. Dean J. Burkin/Dissertation Advisor

August, 2014

THE GRADUATE SCHOOL

We recommend that the dissertation prepared under our supervision by

PAM M. VAN RY

Entitled

Protein Therapy For Muscular Dystrophy And Other Muscle Diseases

be accepted in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Dean J Burkin, Advisor

Normand LeBlanc, Committee Member

Maria Valencik, Committee Member

Cherie Singer, Committee Member

Patricia Berninsone, Graduate School Representative

David W. Zeh, Ph. D., Dean, Graduate School

August, 2014

Abstract

Despite the exponential advancements in understanding the underlying cause of muscular diseases, there has been little progress in developing an effective treatment which results in the quality of life treatment options desperately needed for patients and families. The muscular dystrophies are a group of progressive degenerative muscle wasting diseases that vary in age of onset, phenotype, cause, severity and life span. Over 90 years ago protein therapy was used to treat diabetes. Today there are over 130 proteins or peptides approved by the US Food and Drug Administration (FDA) for clinical use in almost every field of medicine. Protein therapies have proven to be advantageous and effective since insulin was first used. This work shows that laminin-111 therapy can increase regeneration of skeletal muscle and encourages activation and formation of de novo skeletal muscle. Recombinant

Galectin-1 therapy in dystrophic muscle was able to stabilize myofibers functionally through increases in members of the utrophin glycoprotein complex and α7β1 integrin. This thesis demonstrates that protein replacement therapy is a viable treatment option for muscle disease and will translate into measurable quality of life changes for patients and families.

Dedication

To my husband, Kevin who believed in me even when I didn’t, To my children for putting up with the process And to my parents, who love learning.

iii

Acknowledgement

I would like to thank my advisor and mentor, Dr. Dean Burkin for his guidance and support. He has always encouraged me to investigate, develop and follow through on my own ideas and experiments. As a member of his lab I have benefited from the research network he has built both at UNR and worldwide. Dr. Burkin is an excellent example of what a principal investigator should be. He loves the research he is involved in and is able to pass on this enthusiasm to his students. He is a loyal advocate on behalf of his students and helps them develop into independent scientists. The experience and training that

I have received in his lab has been invaluable.

I would also like to thank my dissertation committee, Dr. Normand

Leblanc, Dr. Cherie Singer, Dr. Patricia Berninsone, and Dr. Maria Valencik for their time, expertise and guidance. I especially would like to thank Dr. Cherie

Singer for allowing me to do my first research rotation in her lab. She was beyond patient with me as I transitioned from being a chemist knowing very little about biology to a research scientist.

I would like to thank past and present members of the Burkin Lab:

Jachinta Rooney, Ryan Wuebbles, Jinger Doe, Margaret Elorza, Senny Wong,

Monica Rice, Apurva Sarathy, Pricilla Hansen, Susan Alaei, Tim Gruner, Megan

Keys, Ashley Tarchione, Annmarie Vogedes, Danielle Sagura, Tyler Van Ry

Rebecca Evans and Vivian Cruz. I have loved getting to know each of you. I

iv cherish the fun times and friendships I have developed with you over the past few years. I would especially like to thank Dr. Ryan Wuebbles for tirelessly answering questions and for pushing me to become a better scientist. Dr.

Wuebbles edited manuscripts, gave advice and was a mentor that expected a high level of performance.

I would also like to thank members of Lab Animal Medicine: University of

Nevada-Reno, for their help and expertise in performing animal work.

I would like to Dr. Heather Burkin, Dr. Berninsone, Dr. Bradley Hodges and Apurva Sarathy for taking the time to critically read, edit and provide helpful scientific suggestions for my manuscripts.

I would like to express my sincere thanks to the faculty and staff of the

Pharmacology Department. You are truly an incredible group of people and I am honored to have gotten to know you. The happy, helpful support of this department made this journey less arduous. To all my fellow students that I have gotten to know and who have helped me on this journey, thank you and you can do it.

Lastly, I would like to thank my best friend and husband, Kevin, my children, Josh and Autumn and my extended family for all their love and support.

Table of Contents

Abstract…………………………………………………………………………………..i

Dedication……………………………………………………………………………….ii

Acknowledgements…………………………………………………………………..iii

Chapter 1: Muscle diseases: Current therapies and the bumpy road to find a protein therapy……………………………………………………………………….1

Chapter 2: Laminin-111 improves muscle repair in a mouse model of merosin-deficient congenital muscular dystrophy…………………………….52

Abstract…………………………………………………………………………………53 Introduction……………………………………………………………………………..54 Material and Methods…………………………………………………………………56 Results………………………………………………………………………………….62 Discussion………………………………………………………………………………75

Chapter 3: Galectin-1 protein therapy improves muscle pathology and function in the mdx mouse model of Duchenne muscular dystrophy……102

Abstract………………………………………………………………………………..103 Introduction……………………………………………………………………………105 Material and Methods………………………………………………………………..106 Results………………………………………………………………………………...111 Discussion…………………………………………………………………………….120 Supplemental Materials and Methods……………………………………………..124

Chapter 4: The role of LARGE on α7 Integrin Glycosylation ……………...146 Abstract………………………………………………………………………………..147 Introduction……………………………………………………………………………149 Material and Methods………………………………………………………………..153 Results………………………………………………………………………………...156 Discussion…………………………………………………………………………….160

Chapter 5: Conclusions and Future Directions ……………………………...176

Appendix A: Methods for diagnosing, prognosing and treating muscular dystrophy…………………………………………………………………………….186

Bibliography……………………………………………………………………...….292

List of Figures

Chapter 1: Muscle diseases: Current therapies and the bumpy road to find a protein therapy

Figure 1: Skeletal muscle organization with Dystrophin glycoprotein complex and the α7β1 integrin complexes ……………………………………45

Figure 2: Lack of key skeletal muscle protein complexes leads to sarcolemmal rupture…………………………………………………..47

Figure 3: Protein therapeutic development for muscle diseases…………….49

Chapter 2: Laminin-111 improves muscle repair in a mouse model of Merosin Deficient Congenital Muscular Dystrophy

Figure 1: Experimental design and timeline for examining muscle regeneration following laminin-111 treatment….…………………...82

Figure 2: Laminin-111 delivered intramuscularly to laminin-α2 deficient muscle increases myofiber area and number after CTX- induced injury.………………………………………………………….86

Figure 3: Laminin-111 treatment of dyW-/- mice accelerates expression of embryonic myosin heavy chain after CTX- induced damage……...... 88

Figure 4: Laminin-111 treatment of laminin-α2 deficient muscle increases the size of eMyHC positive myofiber after CTX-induced injury ………90

Figure 5: Laminin-111 treatment enhanced levels of α7A, α7B, and β1D integrin in laminin-α2 deficient mice after CTX-induced injury …...92

Figure 6: Laminin-111 treatment of laminin-α2 deficient mice increased total muscle area and reduced fibrosis after CTX-induced injury..…….94

Figure 7: Laminin-111 treatment of laminin-α2 deficient mice increases early and late stage markers of muscle regeneration……………………96

vii

Figure 8: Weekly laminin-111 treatment of laminin-α2 deficient muscle was necessary to maintain regeneration 10 and 28 days post injury….98

Figure 9: Weekly laminin-111 treatment of dyW-/- laminin-α2 deficient mice increases total TA area, myofiber number and reduces fibrosis after CTX injury. ……………………………………………………………..98

Supplemental Figure S1: Laminin-111 treatment decreased fibrosis after CTX damage…………………………………...99

Supplemental Figure S2: Laminin-111 treatment improves mobility of dyW-/- mice after CTX injury………………….100

Chapter 3: Galectin-1 protein therapy improves muscle pathology and function in the mdx mouse model of Duchenne muscular dystrophy

Figure 1: Critical ECM proteins are increased in hDMD myotubes with rMsGal-1 treatment…………………………………………………..130

Figure 2: Increased Galectin-1 in serum and tissue of mice receiving systemic rMsGal-1 treatment……………………………………….132

Figure 3: Physiological improvement in activity, strength and weight observed in rMsGal-1 treated mdx mice………………………………………134

Figure 4: rMsGal-1 treatment prevents kyphosis in mdx mice……………..135

Figure 5: Reduced muscle pathology in mdx mice treated with rMsGal-1………………………………………………………………136

Figure 6: rMsGal-1 treated mdx mice have increased UGC and α7β1 integrin protein complexes localized to the sarcolemma in skeletal muscle…………………………………………………………………138

Supplemental Figure S1: MsGal-1 delivered intramuscularly to dystrophin deficient muscle decreased Centrally Located Nuclei…………………….140

Supplemental Figure S2: rMsGal-1 treatment enhanced levels of α7B and β1D integrin in mouse skeletal……...…141

viii

Supplemental Figure S3: hDMD myoblast have increased levels of α7B integrin and β-DG with rMsGal-1 treatment………………………………………143

Supplemental Figure S4: Myofibers in mdx mice treated with rMsGal-1 were less hypertrophic………………………145

Chapter 4: The role of LARGE on α7 Integrin Glycosylation

Figure 1: Known Glycosylation of α-dystroglycan and proposed glycosylation pathway of α7 integrin………………………………………………166

Figure 3: LARGE promotes glycosylation of α7 integrin in myogenic cells…………………………………………………………………….170

Figure 4: Hyperglycosylation of α7 integrin causes protein stabilization in WT and α7KO rescued cells……………………………………………..172

Figure 5: A model of a proposed mechanism of how α7 integrin is increased and stabilized by LARGE overexpression in myogenic cells…………………………………………………………………….174

Chapter 5: Conclusions and Future Directions

Figure 1: Proposed modles of stabilization mechanisms for Laminin-111, Galectin-1 and LARGE Therapy……………………………………162

Appendix A: Methods for diagnosing, prognosing and treating muscular dystrophy

Figure 1: Bar graphs illustrating transcription of Lgals1 and Lgals3 are altered in the dyW -/- mouse ….…………………………………….………...277

Figure 2: Digital images and bar graphs illustrating Western blotting studies for Galectin-1 in the dyW -/- and wild-type mice at 4- and 8-weeks of age…………………….……………………………………………….278

Figure 3: Digital image of Western blotting results for Galectin-3 in the dyW -/- and wild-type mice at 4- and 8-weeks of age ...... 279

Figure 4: Digital images and bar graphs illustrating Western blotting studies for Galectin-3 in the serum dyW -/- and wild-type mice at 4- and 8- weeks of age……………………………………………………….…280

Figure 5: Series of digital images of Galectin-3 immunofluorescence on 4- and 8-week dyW -/- and wild-type mice………...…………………..281

Figure 6: Bar graphs illustrating transcription of Lgals1 and Lgals3 were altered in the mdx mouse……………………………………………282

Figure 7: Bar graphs and digital images of Western blotting results for Galectin-1 in mdx and wild-type mice at 2-, 5- and 10-weeks of age……………………………………………………..………………283

Figure 8: Bar graphs and digital images of Western blotting results for Galectin-3 in the mdx and wild-type mice at 5- and/or 10-weeks of age.…………………………………………………………………….284

Figure 9: Bar graphs and digital images of Western blotting studies for Galectin-3 in the serum of mdx and wild-type mice at 5- and 10- weeks of age.…………………………………………………………285

Figure 10: Series of digital images of Galectin-3 immunofluorescence on 5- and 10-week mdx and wild-type mice...... 286

Figure 11: Digital image of a Western blot study for Galectin-3 levels in the muscle of the golden retriever muscular dystrophy (GRMD) dog model of DMD………………………………………………………...287

Figure 12: Digital image of Galectin-1 fractions eluted from Talon affinity columns.…………………………………………………………….…288

Figure 13: Graph and table illustrating Galectin-1 treatment decreases muscle damage in mdx mice ………………………………………………..289

Figure 14: Graph, table and digital image illustrating Galectin-1 treatment increases α7 integrin ……………………………………………..…290

List of Tables

Chapter 1: Muscle diseases: Current therapies and the bumpy road to find a protein therapy

Table 1: Dystrophies and Myopathies and their Defect……………………..50

Table 2: Types of Therapy for Muscle Diseases……………………………..51

Appendix A: Methods for diagnosing, prognosing and treating muscular dystrophy

Table 1: Changes in gene expression in dyW-/- mice………………………..291

Table 2: Primer sequences for the mousse extracellular matrix genes…..291

Table 3: Galectin3 serum levels in wild-type and mdx mice ………………260

Table 4: Galectin-3 serum analysis of MDC1A patients compared to age matched controls.………………………………………………….....261 Table 5: Average Serum Levels of Galectin-3 in various patient populations...... 262

Table 6: Changes in gene expression in dyW-/- mice………………………..268

Chapter 1

Introduction

Muscle diseases: Current therapies and the bumpy road to finding a

protein therapy

Introduction

Despite the exponential advancements in understanding the underlying cause of muscle diseases, there has been little progress in developing desperately needed and effective treatments to improve the quality of life for patients and families. The muscular dystrophies are a group of progressive degenerative muscle wasting diseases that vary in age of onset, phenotype, cause, severity and life span. This heterogeneous family of disease is caused by either spontaneous or inherited gene mutations resulting in a complete lack of or mis- regulation of important muscle proteins. Loss of key proteins results in the loss of entire protein complexes giving rise to myofiber fragility and dystrophies of varying severity (Fig. 1, Table 1). Histopathological changes that result in destabilization of muscle fibers include fibrosis, asymmetrical muscle fibers, centrally located nuclei, inflammatory cell infiltration and fatty cell replacement. In addition to the degenerative aspect of muscular dystrophy, myofibers have a defect in the repair/regeneration machinery at work in normal muscle. The ability of skeletal muscles to regenerate is dependent upon satellite cells located adjacent to myofibers (Fig. 1). Satellite cells are quiescent cells that are activated upon receiving distress signals. Once activated satellite cells proliferate, commit to the myogenic cell linage to repair and replace damage muscles (1-3).

Muscular dystrophy is generally classified by clinical presentation for example, by the extent and distribution of muscle weakness, age of onset, rate of progression,

3 severity of symptoms, and pattern of inheritance or primary defect (Table 1). An ideal treatment for this set of diseases would address both degeneration and repair of existing muscle and regeneration of de novo muscle fibers. This review will give an overview of several types of dystrophies and myopathies summarizing current research to uncover the primary cause and mechanism of each type (Table 1). We will also describe general symptoms, histological changes and methods of diagnosis. Finally, currently used and newly explored therapeutic approaches will be summarized (Table 2).

Duchenne and Becker Muscular Dystrophy

Duchenne muscular dystrophy (DMD) is named after Guillaume Duchenne who described 13 boys with clinical symptoms of degenerative skeletal muscle weakness and premature death (4). Twenty-eight years ago it was determined that genetic mutations in the gene dystrophin were responsible for this X-linked recessive disease (4). The dystrophin gene codes for a 427kDa protein which links the cells cytoskeleton through the sarcolemmal proteins to the basal lamina

(Fig. 1 & 2) (5-7). Patients with Becker muscular dystrophy (BMD) also have mutations in the dystrophin gene, but have less severe symptoms (5). Variations in phenotype coincide with the type, size and region of the dystrophin mutation.

For example the reading frame of the dystrophin gene is not disrupted in BMD

(8). However in more severe types of DMD the Dp71 region is disrupted resulting

4 in brain abnormalities and a corresponding degenerative phenotype (9-12).

Although DMD and BMD are usually inherited diseases, approximately 25% of cases are due to spontaneous mutations in the dystrophin gene (13).

There are three stabilizing protein complexes in skeletal muscle; they are the dystrophin glycoprotein complexes (DGC), the utrophin glycoprotein complex

(UGC) and the α7β1 integrin (Fig. 1 & 2). The DGC is a complex of proteins whose members include the sarcoglycans (SG-α, β, δ and γ), the dystroglycans

(DG-α and β), dystrobrevins, sarcospan (SSPN) and the syntrophins (14-21).

The C-terminus of dystrophin binds to a group of proteins which include neuronal nitric oxide synthase (nNOS), α-syntrophin, α-dystrobrevin, and β-DG resulting in important connections to cytoskeletal actin (22, 23). Due to the lack of dystophin the DGC is unable to assemble at the sarcolemma which causes a lack of structural and mechanical strength needed for muscle contractions (24, 25). This myofiber instability results in sarcolemmal rupture, fibrosis, necrosis and the eventual death of patients (Fig. 2).

The utrophin glycoprotein complex (UGC) is homologous to the DGC, and utrophin is able to replace and bind to the same dystrophin-associated proteins as dystrophin (Fig. 2) (26-28). Utrophin is normally expressed in the postsynaptic membrane of neuromuscular junction and myotendinous junctions in adult skeletal muscles (29). In dystrophic muscle of DMD patients and mdx mice, a mouse model for DMD with the same gene mutation, there is physiological up-

5 regulation of utrophin throughout skeletal muscle fibers (30, 31). Utrophin levels increase with age in DMD patients and initial biopsy levels can be used to predict the time to the non-ambulatory stage of DMD (32). Loss of both dystrophin and utrophin in mdx mice leads to more severe muscular dystrophy with animals dying prematurely by 20 weeks of age (33, 34)

Another compensatory skeletal muscle protein is the α7β1 integrin (Fig.

2). It is the predominant laminin-binding integrin in cardiac and skeletal muscle

(35). The α7β1 integrin is a heterodimeric protein that participates in inside-out and outside-in signaling (36, 37). The α7β1 integrin is localized at junctional and extra-junctional sites in skeletal muscle like utrophin; α7 integrin is increased in skeletal muscle of dystrophic mice and patients (38). Enhanced transgenic expression of the α7 integrin in the skeletal muscle of severely dystrophic mice improves muscle pathology and increases lifespan (39, 40). Conversely, loss of the α7 integrin in mdx mice results in a severely dystrophic phenotype and reduced viability with mice dying prematurely by 4 weeks of age (41, 42).

Due to the progressive nature of DMD, clinicians assess patients by pre- symptomatic or symptomatic stage presentations (43). Unless there is a genetic history or abnormal blood test, initial pre-symptomatic signs of DMD are delayed walking and speech, which are often overlooked (43). In the early ambulatory stage (2-5 years of age), family members usually report Gowers’ maneuver, waddling gait, toe walking, difficulty running and general clumsiness (43). Clinical

6 signs at this stage include increased levels of serum creatine kinase and transaminases (43). By the late ambulatory stage patients have usually been diagnosed by polymerase chain reaction (PCR) or muscle biopsy followed by immunohistological stains for dystrophin and other myofiber indicators. The final three stages of DMD are late ambulatory, early non-ambulatory and late non- ambulatory. In the progression through these stages, patients experience increased difficulties in self-sufficient ambulation. Patients will begin to present with scoliosis, joint contractures, cardiopulmonary abnormalities and dysphagia.

Facioscapulohumeral Muscular Dystrophy

Facioscapulohumeral muscular dystrophy (FSHD) is the third most common myopathy with a prevalence of 1:15,000 to 1:20,000 (44-46). FSHD is autosomal dominant and its name is derived from a pattern of progressive irreversible weakness to the face (facio), shoulder girdle (scapula), upper arm

(humeral), pectoral and abdominal muscles (47). There are three variants of

FSHD which differ in genetic defect and time of onset, FSHD1, FSHD2 (or 1B) and infantile FSHD (IFSHD). Although the underlying genetic cause of FSHD has been pinpointed (48, 49), the mechanism underlying this cause is still widely debated (49-52).

FSHD1 is caused by the shortening (contraction or deletion) of a subset of

D4Z4 macrosatellite repeats located in the subtelomeric region of chromosome

4q (52). In other words, FSHD1 is D4Z4 contraction-dependent and in greater than 95% of the cases caused by a decrease in the number of the polymorphic

D4Z4 macrosatellite repeat array, with a threshold of 10 or fewer repeats on one chromosome (53, 54). The correlation of disease severity and the number of repeats at this locus has been well established (55). In healthy individuals, there are approximately 11-100 D4Z4 repeats (56). Each 3.3kb tandem repeat has a double homeobox transcription factor (DUX4) open reading frame (53, 57). One of the pathomechanisms proposed for FSHD1 is dysregulation of the germline transcription factor DUX4 (53, 58). DUX4 transcripts become inappropriately stabilized due to a polyadenylation telomeric sequence which triggers aberrant gene expression in FSHD muscle and expression of several classes of retrotransposons (58). Some researchers propose that D4Z4 contraction causes proximal elements to interact on chromosome 4 through spreading (59) or looping mechanisms (60, 61). These associations are hypothesized to cause transcriptional upregulation of genes with myopathic potential, such as FRG1,

FRG2 and ANT1 (61). The FRG1 gene is only 120 kb from the D4Z4 repeats, and encodes a highly conserved nuclear protein that may play a role in RNA biogenesis (62-64). FRG1 is upregulated in FSHD muscle, which is attributed to the lack of transcriptional repression complexes located on the D4Z4 repeats (59,

60, 62, 65). Transgenic overexpression of FRG1 in mice causes increased myopathy (59). Although this exciting result seems to point to FRG1 as a point of

8 interventions, other research groups have been unable to repeat these results

(66). Thus we are left still exploring treatment targets for FSHD.

Results from a recent study showed that cis-hypomethylation is responsible for the transcription and stabilization of DUX4 (48, 67). Patients diagnosed with hypomethylation without D4Z4 contractions are categorized as having FSHD2 (68). In FSHD2 both alleles are hypomethylated and studies suggest that mutations in Structural Maintenance of Chromosomes Flexible

Hinge Domain-Containing (SMCHD1) protein may be the cause (49). Only 4% of

FSHD patients have IFSHD (51). These patients follow a pattern of genetic inverse relation of disease severity and D4Z4 repeats, showing a very low number of repeats (51, 55).

The histopathological manifestations in FSHD affected muscle are indistinguishable from other myopathies, with only a few exceptions (69). FSHD muscle exhibits fiber size variation with a greater percentage of small angular fibers (70), inflammatory cell infiltrate (71), fibrosis (69, 71) and slow muscle fiber dominance (70, 72). Additionally researchers have reported reorganization of the

M-domains of costameres (73), rimmed vacuoles (74), elevated levels of caspase-3 (75) and elevated levels of FGF and FGF receptor 4 levels (76) specifically in FSHD muscle.

The penetrance of FSHD is 95% with males displaying clinical signs in their second decade and women by the third (77). As indicated by its name,

9 phenotypic weakness due to atrophy usually starts with the face, followed by the scapula, upper-arms, abdominal and foot-extensors (47). There is a wide range of progression and severity in FSHD. Being unable to reach above shoulder level is one on the most common symptoms reported to clinicians (47). Other phenotypic manifestations can include weakness in foot dorsiflexion which leads to foot drop, scapular winging, weakness in lower abdominal muscles causing lumbar lordosis, and Beevor’s sign caused by lower abdominal muscles becoming weaker than the upper (56, 65). The symptomatic display of Beevor’s sign is fairly specific for FSHD (78). Other non-muscle symptoms may include retinal telangiectasias in 60% of patients (79, 80), high-frequency hearing loss in

70% of patients (80), and, rarely, mental retardation and epilepsy (76, 81). Most patients have a normal life expectancy, but will suffer with severe fatigue and loss of ambulation which correlates with the size of D4Z4 repeats (82). Although clinical diagnosis of FSHD is straightforward due to genetic autosomal dominance and its distinct pattern of muscle degeneration, highly specific molecular confirmation can be obtained through analysis of D4Z4 repeat size differences (47).

Myotonic Dystrophy

Myotonic dystrophy (DM) is autosomal dominant disease that can be divided into two distinct types: DM1 and DM2 (83, 84). Both types have similar

10 symptoms but are the result of different mutations and can be distinguished through DNA testing (84). Generally DM affects multiple systems and organs throughout the body, unlike other MDs which predominately affect muscles.

Patients display cardiac conduction abnormalities, posterior iridescent cataracts, endocrine dysregulation, and a wide range of cognitive impairment (85). The

DM1 phenotype was first described in 1909, but the cause of the myopathy was not uncovered until 1992 by several research groups (86-88).

DM is a disease in which there is a marked expansion of CTG repeats in the 3’ untranslated region of the dystrophia myotonica protein kinase (DMPK) gene on chromosome 19q (86-88). Symptomatic patients have greater than 100

CTG repeats, however, mild forms of DM1 have been observed with 51-99 repeats (85). The DMPK gene is not itself responsible for DM (89). The mis- regulation occurs after transcription of the CTG repeats which form ds-CUG trinucleotide RNA hairpin structures (89). These hairpin structures sequester nuclear proteins like human Muscleblind-like and hnRNP N alternative splicing factors (90, 91). Children of patients are usually more severely affected than their parents due to a phenomenon called anticipation. Anticipation causes a congenital form of DM with greater than 1000 CTG repeats if inherited from their mother (83, 92, 93). Overall mutant ds-UGC hairpins causes DM through altered gene transcription, alternative splicing and aberrant translation of genes resulting in gene silencing (90). Aberrant splicing of genes including the insulin receptor,

11 chloride channel CLCN1 and groups of other genes is responsible for the clinical symptoms in DM1 (89).

DM2 originally named proximal myotonic myopathy (PROMM), displays similar less severe symptoms than DM1 (84). DM2 patients are usually non- symptomatic until the sixth or seventh decade of life and display greater distal weakness than proximal weakness. DM2 is caused by an enlargement of a

CCTG tetranucleotide repeat located in intron 1 of zinc finger protein 9 (ZNF9) on chromosome 3 (94, 95). Similar to the mechanism responsible for DM1, translation of this tetranucleotide forms a hairpin structure that binds important splicing regulatory proteins (84, 94, 95).

DM1 can be confirmed through genetic tests such as PCR and southern blotting, but family history and patient symptoms should provide enough evidence for accurate diagnosis (96). The wide range of usually mild symptoms along with late onset of disease in DM2 makes clinical diagnosis extremely difficult (84, 96). PCR and southern blotting often cannot be accurately used for diagnosis either due to the increased mutation size and/or somatic instability

(96). A complicated three-step PCR protocol has been suggested as a diagnostic tool, but thus far muscle biopsy is essential for absolute diagnosis for DM2 (84,

97).

Histopathologies of both DM1 and DM2 have similar characteristics to all

MDs including centrally located nuclei, size variation and fatty replacement of

12 myofibers. DM1 and DM2 have specific myofiber characteristics that allow accurate diagnosis through biopsy alone (84, 92). DM1 muscle fibers have a higher occurrence of ring finger fibers with sarcoplasmic masses (96). DM2 samples display severely atrophic fibers with pyknotic nuclear clumps, which can be seen in pre-symptomatic patients (96). Nuclear clumps will only be observed in the end-stages of DM1 (98). DM2 predominantly affects type 2 fast myofibers, while atrophic fibers of DM1 patients predominantly express type 1 slow myosin

(92, 99-101).

There are four main types of DM1 which are separated by specific clinical features and age on onset: congenital, childhood, adult, and late onset

(asymptomatic). The main characteristics of Congenital Myotonic Dystrophy

(CDM) are hypotonia, respiratory complications, bilateral talipes in 50% of cases, joint contractures, cerebral atrophy and ventricular enlargement (96, 102, 103).

Pulmonary failure is the primary cause of death in these patients (96). Childhood and adult DM1 have similar clinical presentations only differing in severity and age on onset (1-10 or 10-30 years respectively) (96). Major clinical features include: weakness (presenting initially in the face), myotonia, conduction defects and cognitive defects and/or learning abnormalities (96). Additionally, adult DM1 patients will display insulin resistance and have a high rate of respiratory failure

(100, 104).

There is a higher prevalence of DM2 in the European population. Due to the milder nature, wider range of symptoms and late onset (after the age of 70 years) (84, 96), many cases of DM2 are misdiagnosed or undiagnosed (105).

Patients may present with varying degrees of proximal weakness and myotonia, cataract abnormalities in electrophysiology and pulmonary insufficiency (86, 96).

There are rarely occurrences of cognitive impairment in DM2 (96). Additional symptoms that may increase over time include: hypogonadism, glucose intolerance, excessive sweating and dysphagia (84, 92, 93, 96, 97, 106).

Limb-Girdle Muscular Dystrophy

Until recently, Limb-Girdle muscular dystrophy (LGMD) was a diagnosis given to patients after excluding predominant characteristics of DMD/BMD,

FSHD, DM, metabolic and other neuromuscular disorders (107). Generally

LGMD is comprised of a large heterogeneous group that displays predominantly proximal weakness in limb muscles. With the advancements in molecular diagnostics and next generation sequencing panels, the list of LGMDs continues to grow and new classifications are made frequently (108). LGMD is divided into two main categories based on inheritance, LGMD1, which is autosomal dominant, and LGMD2, which is autosomal recessive. Sub-classifications within

LGMD1 and 2 are designated by adding a letter correlating to the gene mutation

14 involved. According to the current literature there are 31 mutated loci that have been identified, 8 autosomal dominant and 23 autosomal recessive (109).

LGMD1 is rare and occurs in only 10% of all LGMD cases (109). The complication in diagnosing/classifying a specific type of LGMD1 is increased because some of the gene mutations for specific sub-classifications overlap with other myopathies (for example: myotilin, lamin A/C or caveolin 3). The dominant feature of LGMD1 is the vertical dominant transmission pattern of inheritance, with the exception of lamin A/C mutation. LGMD1A-E patients display cardiomyopathy, asymptomatic elevation of creatine kinase, myalgias and cramps, rippling muscle disease, distal myopathy and prolonged QT syndrome

(107). Cellular and protein defects result in destabilization of myofibers during contractions and relaxation similar to those described previously with DMD (107,

109). Disorganization of the postsynaptic membrane and mis-regulation of myoblast differentiation may also be present with LGMD1 (107).

LGMD2 is autosomal recessive with an overall prevalence of 1:15,000

(110). A common characteristic of some LGMD2 is a higher frequency within a specific population (111) LGMD2A in La Reunion Island (107), LGMD2C in North

Africa (112) and LGMD2I in Scandinavia and England (113, 114). Regional, ethnic clusters are attributed to carrier distribution and inheritance (109). A wide variety of mutations are responsible for LGMD2. Some of the more prominent causes are mutations in genes encoding calpain-3, dysferlin, any one of the

15 sarcoglycans and mutations in glycosyltransferases that cause hypoglycosylation of α-dystroglycan (107, 115).

Disease onset typically occurs between the ages of 10-30 (116). In addition to general proximal weakness, some of the symptoms associated with

LGMD2 are scapular winging, early contractures, scoliosis and hypertrophy of the calf and deltoid (107). Histological and cellular defects are nearly indistinguishable from LGMD1 and DMD, the only exception being in the glycosylation defects previously mentioned. Most cases require a biopsy, DNA diagnostics and immunofluorescent staining for specific proteins (107). For an in depth review of the LGMD see review by Nigro and Savarese (109)

Congenital Muscular Dystrophies

Congenital muscular dystrophies (CMDs) are made up of a diverse group of genetic diseases that have an onset occurring at or near birth. CMDs are subdivided according to the function of proteins that are affected (117). The first group, which comprises over 50% of diagnosed CMDs, are referred to as the dystroglycanopathies (118). The dystroglycanopathies have defects which cause the hypoglycosylation of α-DG and include genes encoding: protein O-mannosyl transferase-1 and -2 (POMT1 and POMT2) (119, 120), protein O-linked mannose

β-1,2-N-acetylglucosaminyltransferase (POMGnT1) (121), LARGE (122), fukutin

(123), fukutin related protein (FKRP) (124, 125), β-1,3-N-

16 acetylgalactosaminyltransferase 2, isoprenoid synthase domain containing

(ISPD) protein (126), dolichyl-phosphate-mannosyltransferase subunits 2 and 3

(DPM2 and 3) (127, 128), dolichol kinase, glycosyltransferase-like domain containing (GTDC2) (129) and transmembrane protein 5 (TMEM5) (130). A second class of CMD patients have mutations in genes for vital extracellular matrix proteins in skeletal muscle (Fig. 2). They include Ullrich CMD (131) with a mutation in collagen VI (131), Merosin deficient congenital dystrophy with laminin-α2 misregulation (132), ITGA7 with a α7 integrin mutation (42, 133), the selenoprotein N, 1 (SEPN1) gene causing rigid spine muscular dystrophy and

CMDs with yet to be identified causes (117).

A wide range of symptoms are found in CMD patients, but generally all present with hypotonia and weakness which progress with varying degrees, joint contractures, normal-elevated levels of serum creatine kinase and myopathic changes on electromyogram (117, 134). Overall CMDs are more severe than

MDs that present later in life. Pulmonary and/or cardiac dysfunction associated with muscle weakness is a common problem in this set of diseases (134). Unlike some of the previously described MDs, diagnosis of CMDs requires phenotypic and historical clinical assessment coupled with DNA, protein, bio-molecular and histological analysis (117). Histological analysis on muscle biopsies display similar features to those observed in DMD biopsies (131, 134).

Rare muscular dystrophies and other genetic myopathies

There is a large group of patients classified with rare muscular dystrophies and genetic myopathies, the description of which is beyond the scope of this paper. An example of one of the less prevalent classes of muscular dystrophies is Emery-Dreifuss muscular dystrophies (EDMD). This rare class of MD is characterized by variations of inheritance, severity of disease and clinical symptoms (125). Generally patients with EDMD present with early contractures that are out of proportion to the degree of weakness displayed (135).

Oculopharyngeal muscular dystrophy (OPMD) is caused by an expanded GCN repeat region of the polyadenylate-binding protein nuclear 1 gene with a mechanism similar to myotonic dystrophy and FSHD (134). OPMD patients are usually asymptomatic until their fifth decade of life at which time they present with ptosis and dysphagia (134). Symptoms for the distal myopathies can present between 20-50 years of age (134). Proximal weakness is displayed in the calf or tibialis anterior and dorsiflection resulting in foot-drop (134). The extent and variation in cause and symptoms for rare MD continues to grow as research is continued in the field.

Other genetic myopathies include: congenital myopathies, congenital myasthenic syndromes and the metabolic myopathies. Congenital myopathies differ from CMDs in their non-progressive nature (131). Congenital myopathies are named for prominent histological features such as centrally located nuclei,

18 nemaline rods, and congenital fiber type disproportion (CFTD) (131, 134).

Congenital myasthenic syndromes are caused by mutations of proteins expressed at neuromuscular junctions causing fluctuation weakness. There is significant overlap of expression of these proteins within skeletal muscle which causes symptomatic and histological likeness to other congenital myopathies and muscular dystrophies (134). Lipid metabolic disorder, glycogen metabolic disorder and mitochondrial disorder are the main categories that make up the metabolic myopathies. Metabolic myopathies are difficult to diagnose. In addition to the degenerative muscle weakness that increases with activities, there are underlying progressive central nervous system and other organ system degenerative symptoms as seen in most mild forms of muscular dystrophies

(134).

Currently explored/published therapeutics

The wide spectrum of severities, symptoms and causes of the myopathies/dystrophies leads to complexity of diagnosis and treatment (Table 1).

Despite the overwhelming amount of research and advances that have been made in determining the underlying causes and mechanisms for this heterogeneous group of muscle diseases, currently there are no cures. The usual clinical approach taken to treat muscle disease is to treat inflammation, muscle degeneration and palliatively address progressive symptoms of the

19 disease (108, 136, 137). Due to the multifaceted nature of these diseases a large number of approaches are being used currently (Table 2). Several of the more prevalent forms of muscle disease such a DMD and BMD have defined standards of care (43, 108, 137). Standard care measures aim to maintain quality of life and optimize longevity. In most cases this requires an extensive team of physicians to regularly monitor conditions such as contractures, nutritional requirements due to dysphagia or general weakness and cardiopulmonary function (137). The main therapeutic approaches to muscle disease currently used and in development are pharmacological, cell, gene and protein therapies

(Table 2) (138).

Pharmacological therapy

Once a diagnosis has been achieved, there are several pharmacological approaches that can be employed. The continual injurious cycle of muscle degeneration/regeneration, instability due to mutations, lack of integral proteins and gene dysregulation results in an influx of calcium, cellular death and an overactive inflammatory response. Non-steroidal anti-inflammatory drugs such as ibuprofen, nabumetone or isosorbide dinitrate (a NO donor vasodilator) have shown positive effects in patients and are able to decrease the levels of proinflammatory/fibrotic agents such as TGF-β (139). Corticosteroids have been used to combat necrosis, inflammation, and have shown an ability to improve

20 long-term stability resulting in improved muscle strength (136, 140). The two main glucocorticoids being used currently are prednisone (141-143) and deflazacort (141, 144, 145). Two other pharmacological agents being studied due to their ability to affect events upstream of the inflammatory response to calcium influx either used alone or together are α-methyprednicolone and/or taurine (146,

147).

Research continues on pharmacological approaches that attempt to stabilize key proteins through up-regulation of compensatory skeletal muscle proteins or compounds that induce ribosomal read-through of premature stop codons. Nabumetone is an example of a small molecule which activates the production of utrophin a homolog of dystrophin (148). Examples of read-through compounds that are being researched for their ability to produce bioactive dystrophin for patients with DMD and BMD are RTC13, RTC14 (149) and ataluren (also named PTC124) (150).

Several research groups have found or are looking for small molecule compounds that enhance one or more of the crucial sarcolemmal proteins that cause muscular dystrophy. Pharmacological agents such as ghrelin, testosterone, growth hormone, myostatin inhibitors and vitamin D are being explored by researchers for sarcopenia (138, 151). Research using pharmacological means to block secreted inflammatory chemokines and cytokines such as interleukins, interferon gamma, tumor necrosis factor alpha

21 and proteolysis inducing factor have resulted in only mild to poor ameliorative effects (138, 152). Overall glucocorticoids continue to provide the best long term

(greater than 3 years) clinical results in DMD (136) when using pharmacological means showing improvements in ambulation, cardiopulmonary function and quality of life and survival (136, 140). However, these drugs produce numerous negative side effects and the promising results seen in DMD patients are not usually observed in patients with other myopathies (120, 142, 144, 145, 153,

154).

Gene therapy

Initially gene therapies began with the goal to replace dystrophin in DMD patients. Gene delivery using adeno-associated viruses (AAV) or lentivirus containing micro or mini-dystrophin (155, 156), mini-utrophin (157), mini-agrin

(158, 159), myostatin inhibitors (MRPO) (160), α and γ-sarcoglycan (161) , follistatin (162) and several others have been successfully used to treat various dystrophic animal models. Recently researchers have been able to overcome the size limitation of AAV delivery by engineering a set of tri-AAV vectors with specific recombination signals to produce full size dystrophin in mdx4cv mice

(163). The two main problems that must be faced with AAV or letiviral gene delivery are: 1) T-cell mediated immune response either to the virus or the non- self gene; 2) thus far delivery has only resulted in minimal restoration of the

22 targeted gene in small areas of skeletal muscle (164). This is why viral gene therapy may not be the best course of action when searching for a quality of life changing treatment for muscle disease.

Some muscular dystrophies, like DMD and BMD, are caused by deletions of a single or multiple exons within the gene dystrophin. An antisense mediated exon skipping therapy can be used to produce full-length dystrophin (165).

Through this pre-mRNA manipulation, defective reading frames are restored

(154). Exon-skipping can be accomplished through the delivery of 2’O-methyl- ribo-oligonucleoside-phosphorothioate (2’OMe) and phosphorodiamidate morpholino oligomers (PMOs) (166-168). Both 2’OMe oligomer

(PRO051/GSK2402968, ProsensaTherapeutics) and PMOs, specifically PMO

(AVI-4658/Eteplirsen®; AVI BioPharma Inc.), have thus far shown efficacy (169-

172). Eteplirsen® results show dystrophin expression in 60-100% of muscle fibers and this PMO is now beginning testing in the IIb double-blind, placebo controlled multiple dose efficacy trials (http://www.clinicaltrials.gov). The main drawback of exon-skipping therapeutics is that they are delivered intramuscularly and, thus far, only the muscles being injected are showing improvement. Since most myopathies and dystrophies affect multiple muscles throughout the body the scope of this therapeutic is not broad enough to make significant quality of life changes.

Cell therapy

Cell based therapies are based on the use of non-diseased myogenic cell precursors such as embryonic stem (ES) cells, induced pluripotent stem (iPS) cells, satellite cells, skeletal myogenic precursors (SMPS), fibro-adipogenic progenitors (FAPs), mesoangioblasts (MABs) and skeletal muscle progenitors

(SP). Although the names of these cell therapies seem to suggest overlap, extensive research on stem cells in skeletal muscle has allowed identification of specific stem cell subpopulation markers which allows for distinction between groups (138, 173-175). Each of these subpopulations has unique characteristics that give them specific therapeutic potential (176). The basic idea of cell-based therapies is that quiescent cells from healthy individuals will replace diseased quiescent cells during the myofiber repair/regeneration cycle (138, 177, 178).

Transplantation of various types of quiescent cells allows myofibroblasts to fuse and form healthy myofibers (176, 179). This procedure is either done on naïve muscle, pharmacologically pretreated muscle or irradiated muscle, to destroy diseased satellite cells (176). Due to the repetitive degeneration/regeneration cycle in many muscle diseases, the satellite cell pool located underneath the basal lamina of skeletal muscle becomes depleted and unable to replace damaged myofibers (1, 3, 175). Lack of proper repair causes fibrosis and build- up of fatty infiltrates (138). In theory cell replacement therapy could replace and add to the depleted or dysregulated cells (180).

Skeletal myogenic precursors (SMPS) are distinct members of the satellite cell pool (181). Intramuscular injection of immunodeficient mdx mice has shown that SMPS are able to regenerate up to 94% of the treated muscle by increasing the satellite pool leading to increased contractile force (182). Injection of SP cells into the femoral artery of mdx mice provided evidence that SP therapy is able to contribute systemic regeneration of 30% of myofibers and can replenish up to

75% of satellite pool (183). Thus far MABs have been the most successful cell based therapy, showing systemic delivery with preclinical results in the Golden

Retriever muscular dystrophy (GRMD) dogs and immunodeficient mdx mice.

These pre-clinical trials resulted in regeneration of 50% of muscle tested and an increase in muscle contractility (184, 185). MABs are currently being used in a

Phase I/II clinical trial in DMD patients (EudraCT Number: 2011-000176-33).

There are several obstacles that need to be overcome in the development of cell therapies: (1) host immune rejection and the development of graft-versus-host disease (186); (2) scalability of a homogeneous group of injectable myogenic capable cells (187); (3) limited migratory ability of cells (188); and (4) legal/ethical concerns (178).

RNA Therapy

Micro-RNA therapy in the field of muscle disease is just beginning to emerge. The discovery of thousands of micro inhibitory RNAs (miRNAs) and their

25 involvement in embryogenesis and both cardiac and skeletal myogenesis has opened the possibility of using of these miRNAs as therapeutics. Some of the miRNAs that are highly expressed in skeletal muscle are miR-1, miR-133a, miR-

133b, miR-206, miR-208, miR-208b, miR-486 and miR-499 (189). New miRNAs involved in myogenesis continue to be discovered, for example miR-669 targets the 3’ untranslated region of myoD which directly affects pluripotent cells’ ability to proceed to the myogenic pathway (190). A long term study using intraventricular AAV delivery of miR-669 into sgcb-null mice showed reduction in dystrophic histology and improved cardiac function (191). The promising research from this study mark miRNA therapies in muscle disease as an exciting new field which needs further research.

Protein Therapy

Over 90 years ago insulin was purified and used to treat diabetes type I

(DM-1) (192). Now there are over 130 proteins or peptides approved by the US

Food and Drug Administration (FDA) for clinical use, with several others in the process of development (193). Proteins therapies have proven to be advantageous and efficacious since insulin was first used. One of the advantages of protein therapies over pharmacological therapies is that proteins are highly specific and have a defined set of functions thus producing less off target effects (193). Second, most proteins are already produced physiologically

26 thus an immune response is less likely to occur (193). Third, research has shown that clinical development and FDA approval time for protein therapeutics is faster than small molecule development by more than a year (194). Fourth, the specific defined natures of proteins are ideal for patent attainment. Advancements in the production of recombinant proteins have provided a means to manufacture large quantities of inexpensive purified proteins (193). Protein therapies can be divided into groups by function: 1) enzymatic, also known as enzyme replacement therapy (ERT) or regulatory activity proteins, 2) proteins with targeting activities that interfere with molecules or organisms, 3) protein vaccines, 4) protein diagnostics. The number of protein therapeutics is growing daily and proteins are now used in almost every field of medicine.

Myozyme

In 2006 Myozyme© human recombinant acid α-glucosidase (GAA or rhAGLU) was approved by the FDA as a protein enzyme replacement therapy

(ERT) for infantile onset Pompe disease (IOPD, Patent #WO2013134530) (195).

J.C. Pompe first described Pompe disease in 1932 (195). The patient was a 7 month old girl with cardiomyopathy and with considerable glycogen accumulation in vacuoles in all tissues sampled (195). Pompe disease was the first recognized lysosomal storage disorder and is classified as a metabolic myopathy caused by

GAA deficiency (195). GAA deficiency causes glycogen build-up in lysosomes of

27 all tissue, but chiefly in skeletal muscle (196). The prevalence of Pompe disease varies based on ethnicity and geography (197, 198). Infantile onset Pompe disease (IOPD) is usually detected soon after birth and is severely progressive with average morbidity at 8.7 months of age if left untreated (199). Late onset

Pompe disease (LOPD) has a range of diagnosis from <1 to 78 years of age

(195). LOPD has a slower progression with no cardiac phenotype; however proximal weakness results in wheelchair confinement and eventual pulmonary failure (196, 200). In 2010 Lumizyme© by Genzyme was approved for use in

LOPD (201).

Research in the field of protein ERT from 1965-1980 was largely unsuccessful due to the use of non-human enzymes (202). While most research groups gave up on the idea of using ERT, Brady et al. continued and were the first to provide proof of principle that ERT was possible in a patient with Gaucher disease (203). The principle behind the treatment of Gaucher disease and

Pompe disease with GAA is based on the ability of lysosomes to engulf exogenous proteins through endocytosis (204). A series of experiments using cell lines from patients with Pompe disease were conducted using recombinant

GAA (205). The successful in vitro studies were quickly followed by transgenic and in vivo recombinant treatment (205). As pharmaceutical companies became involved, problems such as scalability of recombinant GAA were soon resolved.

In 1998 Phase I clinical trials began and by 2001 recombinant GAA was being

28 used in Phase II/III trials (205). The pathway paved by Myozyme from bench top to patient, is a model for protein therapies that are being developed for muscle diseases (Fig. 3).

Laminin-111

Protein therapies that stabilize and strengthen myofibers are ideal in the search for treatments that will result in substantial quality of life changes. The basement membrane surrounds and connects muscle fibers, Schwann cells and fat cells (206, 207). ECM proteins, like collagen IV, nidogen/entactin, agrin, biglycan, perlecan, elastin, fibrillin, fibronectin and laminin forms bridges between myofibers providing stability and strength (206, 208). Laminins are secreted into the ECM and help to form a sheath around and between muscle fibers. Laminins are also located at myotendinous and neuromuscular junctions, along with numerous other tissue types including nerve, skin, kidney, lung, and the vasculature (209). (206, 210). Laminins are vital for embryonic development and organogenesis (207). Thus far there are 16 distinct forms of laminin heterotrimers which are named according to their heterotrimeric chains (α, β,and γ) (211).

Laminins not only play a role in structure, but are able to modulate cellular functions such as adhesion, differentiation migration, phenotype stabilization, maintenance, apoptosis or survival and myogenesis (206). In adult skeletal

29 muscle the two predominant laminin isoforms are laminin-211 and laminin-221

(210).

Laminin-211 or -221 is able to bind a variety of receptors, but the dominant laminin receptor in adult cardiac and skeletal muscle is the α7β1 integrin (35, 39, 42). A muscle’s ability to regenerate or form de novo muscle is determined by the activation and proliferation of normally quiescent satellite cells followed by their subsequent differentiation into mature myofibers (1-3, 175).

Signals induced by muscle injury or disease in the laminin-rich basal lamina activate proximally located satellite cells (212). The α7 integrin is upregulated in

DMD patients and mdx mice. However, mdx mice have a less sever phenotype than mdx/α7-/- mice. Transgenic studies in the mdx/α7-/- mouse show that loss of

α7 integrin causes early onset muscular dystrophy death between 2-4 weeks of age (42). These mice have a significant decrease in laminin-α2 which is one of the contributing factors to muscle fragility in this mouse model (42). This study shows the interaction between α7 integrin and laminins are vital for skeletal muscle regeneration and repair (42). This study also suggest that α7β1 integrin and dystrophin have complementary roles in skeletal muscle stabilization and maintenance (42)

In 1979 Timpl et al. discovered and isolated an ECM molecule secreted by

Engelbreth-Holm-Swarm tumors (EHS) (213). The previously unidentified molecule was laminin-111 which is predominantly expressed embryonically in

30 epithelium (207). Laminin-111 is the embryonic form of adult skeletal muscle laminin-211/221 and can be found in placenta, kidney, liver, testis, ovaries and blood vessels (209). Purified EHS laminin-111 can now be purchased commercially. Intramuscular injections with the readily available purified EHS laminin-111 into mdx/α7-/- provide proof of principle that laminin-111 can be delivered throughout the treated muscle and can reestablish muscle repair and regeneration (42). Building on this result, the possibility of systemic delivery was investigated in the mdx (DMD) and the dyW-/- (MDC1A) mouse models for MD

(214, 215). Systemic injection was successful in both models, with mice showing histological and functional improvements (214, 215). Several mechanisms of action may be responsible for the success of laminin-111 therapy, which include: increases in key sarcolemmal proteins, protection from injury and restoration of a functional ECM satellite cell regenerative environment (212, 214-216). Additional benefits unseen in other replacement therapies include the lack of immune response to the therapy and its ability to provide benefit after disease onset

(212). These can be attributed to the presence of endogenous laminin-111 found embryonically and in several tissues (207, 214, 215). For these reasons laminin-

111 has the potential to be a very successful protein therapy.

In 2007 a patent application for laminins was filed (Patent #US8193145

B2). Soon after, the University of Nevada-Reno partnered with Prothelia in the development of laminin-111 as a protein replacement. Through the support of

Prothelia by grants from the National Institute of Health, Parent Project Muscular

Dystrophy and Struggle Against Muscular Dystrophy (SAM), laminin-111 was awarded Orphan Drug status for the use in DMD and MDC1A in 2011 by the

FDA. Recently, Alexion Pharmaceuticals has begun a collaborative effort to continue preclinical research with laminin-111 (PRT-01) and accelerate its development to a therapeutic (217). Laminin-111 protein replacement appears to be an excellent therapeutic candidate. The main obstacle that needs to be overcome for this therapy is production of significant quantities of purified human recombinant laminin-111. This is a significant obstacle primarily due to laminin-

111’s heterotrimetric nature and its relatively large molecular mass of 900kDa

(214). Once this obstacle is overcome, laminin-111 has possible therapeutic value in several muscle diseases (Fig. 3).

Biglycan

Biglycan is another protein found in the ECM currently in development as a potential therapeutic for muscle diseases. Biglycan belongs to the class 1 small leucine-rich proteoglycans (SLRPs) and the gene encoding biglycan is located on the X chromosome (218, 219). Biglycan a ubiquitous 42kDa protein that has one or two glycosaminoglycan (GAG) side chains bound to its leucine-rich repeats

(220, 221). Some of the known receptors for biglycan in skeletal muscle include key members of the DGC: α-DG (222) and α- and γ-sarcoglycan, dystrobrevin,

32 syntrophin and nNOS (Fig. 2) (219). Interestingly, biglycan is able to bind to two

α-DG through its carboxy-terminal and this activity does not require the glycosylated form of biglycan (222). Biglycan is involved in muscle, tendon and bone development and signaling (223). Unlike some proteins, biglycan’s non- glycosylated form is able to functionally attach through the N-terminus of its core protein as a ligand (221). Non-glycosylated biglycan is found in cartilage and intervertebral discs (224). The functionality of both forms of biglycan has caused researchers to refer to it as a “part time” proteoglycan (219).

Biglycan plays a structural role in the ECM in bone formation, muscle integrity and synapse stability at the neuromuscular junctions (219). Results show it has a role as an innate immunity receptor and activator of inflammasome

(219). Although biglycan is not essential for embryogenesis, it is highly developmentally regulated in the embryonic period of tendon and skeletal muscle development (223).

Studies in mdx mice reveal a physiological upregulation of biglycan (222).

Results from experiments in biglycan knockout mice show biglycan regulates expression and localization of α- and γ-sarcoglycan (225), dystrobrevin, syntrophin, and nNOS (226). Mercado et al. used purified core recombinant biglycan injected intramuscularly to rescue the mild histopathology of biglycan null mice (226). In vitro or in vivo treatments with recombinant human biglycan

(rhBGN) increases utrophin expression in dystrophic muscle resulting in less

33 pathological markers for disease, an increase in sarcolemmal stabilizing proteins, less susceptibility to contraction-induced injury and an increase in muscle strength (227). Additionally, treatment with rhBGN was shown to stabilize synapses through the extracellular binding of biglycan to the receptor tyrosine kinase MuSK (228). Non-glycosylated rhBGN is commercially available and has been shown to be active for up to three weeks after delivery (227). Thus far rhBGN has nott produced any immunogenic or other off target side effects (226-

228). Combined, these results provide ample evidence that biglycan is a good candidate as a protein replacement therapy for muscle disease.

In 2010 Dr. Justin Fallon, a researcher at Brown University, collaborated with several technology research development firms to form Tivorsan

Pharmaceuticals. In 2011 a patent for TVN-102, a proprietary optimized clinical form of hrBGH, was filed (U.S. Patent #EP2571514 A1). Recent data from the

Parent Project for Muscular Dystrophy 2013 Annual Conference, presented by

Dr. Joel Braunstein of Tivorsan Pharmaceuticals, showed TVN-102 treatment was able to achieve the same results as those previously reported (229).

According to Dr. Braunstein, Tivorsan plan for the development of TVN-102 are

(1) finish pre-clinical work, (2) file for Investigational New Drug application with the U.S. FDA, (3) start Phase 1 trials (229). Through grants from the NIH, PPMD, and Charley’s Fund, TVN-102 is part way down the road to becoming a viable therapeutic in the fight against muscle diseases (Fig. 3) (229).

TAT-Utrophin

Laminin-111 and biglycan protein replacement therapy both provide stability largely through increasing the amount of ECM connecting muscles weakened by disease leading to a host of other benefits. TAT-Utrophin provides cytoskeletal support which causes downstream advantages in muscle stabilization (230). Utrophin’s role in muscle diseases like DMD and BMD has been described extensively in this paper and other research (21, 26, 31-34, 116,

231-234). Utrophin expression can be enhanced using transgenic full length or mini-utrophin (33, 233, 235, 236), pharmacological agents like Nabumetone (148,

237) or using AAV gene delivery (157, 238). However, a protein replacement therapy approach may eliminate some of the disadvantages of the previously explored therapies.

Replacement of dystrophin has induced humoral or cytotoxic immune responses in mdx mice and in DMD/BMD patients (154). However, because of the sequence similarity between utrophin and dystrophin, utrophin is an excellent therapeutic target in DMD and BMD. Utrophin’s ability to stabilize entire protein complexes broadens its therapeutic value to nearly all muscle diseases (136).

The homology of utrophin to dystrophin allows binding to complementary proteins with nearly identical results to dystrophin (27, 31, 232). Intramuscular injections of AAV mediated gene transfer of mini-utrophin in mdx mice and in the Golden

Retriever dog model for MD shows a significant reduction of dystrophic

35 phenotype with sustained expression of mini-utrophin for approximately 60 days

(157, 238). Two drawbacks of this treatment are that animals have to be given immunosuppressing drugs like cyclosporine to mitigate immune responses to both the virus and transgene; and second, intramuscular injections limit the area that can be treated.

The production of murine recombinant TAT-utrophin (TAT-Utr) and TAT- micro-utrophin (TAT-µUtr) addresses both of these problems (230). By using the protein transduction domain of the HIV-1 TAT protein instead of the AAV, the need for immune suppression in mdx mice was alleviated. The TAT protein allows the recombinant protein to travel through the cell membrane into the cytoplasm (239, 240). Several research groups have shown TAT fusion protein delivery is a viable option in all tissue types (239, 240). When injected systemically, flag tagged TAT-Utr and TAT-µUtr migrated to the skeletal muscle, kidney, brain and liver (230). Although both recombinant proteins were able to rescue dystrophic histology, TAT-µUtr provided greater improvements in contractile force (230). Using a more severe mouse model for MD the mdx:utr-/- mouse model, Call et. al obtained results that mirrored those observed in the mdx mouse (241). The results from the TAT-µUtr protein replacement research show a promising start toward efficacy. Inventors Ervasti and Sonnemann from the University of Minnesota Medical School filed for a U.S. patent in 2010 (Patent

#US8409826 B2). In our search for evidence showing the development of TAT-

µUtr as a therapeutic, we did not find any recent progress in the way of funding or pharmaceutical collaborations. TAT-Utr replacement therapy seems to be stalled at this stage of development despite its pre-clinical promising results.

MG53

Mitsugumin53 (MG53) is a tripartite interaction motif (TRIM) protein, also known as TRIM72 (242). MG53 is preferentially expressed in cardiac and skeletal muscle (242, 243). The protein therapeutics reviewed thus far address structural deficiencies in the ECM between muscle fibers (laminin-111 and biglycan) or intracellularly to restore connections through transmembrane proteins to the ECM (TAT-Utr). Protein therapy using recombinant MG53 is able to facilitate cell membrane repair which can be used in any number of conditions requiring membrane repair (242). In vitro studies using green fluorescent protein fused to MG53 and recombinant human MG53 (rhMG53) in myogenic and a variety of non-myogenic cells prior to damage provided proof of concept that

MG53 treatment can both protect and aid in repair (242). Subcutaneous or intravenous treatments with rhMG53 were able to reduce muscle damage, increase repair and provide protection in mdx mice (242, 244).

The mechanism by which rhMG53 operates is only beginning to be elucidated (242, 244, 245). When membrane damage occurs, endogenous cytoplasmic MG53 attaches to phosphatidylserine on the interior plasma

37 membrane and on intracellular vesicles. The oligomerization MG53 mediated repair occurs in response to exposure of the interior of the cell to the oxidative extracellular environment (246). Members of the repair complex include: annexin

V, caveolin-3, polymerase 1, transcription release factor (PTRF), and dysferlin

(244, 247, 248). Recent studies have shown that non-muscle myosin IIa is involved in MG53 mediated recruitment of vesicles leading to membrane repair

(249). The increase in Ca2+ at the point of damage aids in the fusion of recruited intracellular vesicles to repair damaged membrane (244). Suppositions as to the mechanism of action for rhMG53 include a positive feedback loop initiated with the release of MG53 into the oxidative extracellular space (242). This mechanism would explain the MG53-phosphatidylserine interaction initiating repair of the initially damaged cell and the repair of neighboring cell surfaces (242).

Additionally, this proposed action would account for the protection of neighboring cells and would reduce the proinflammatory response (242). Research to prove this hypothesized mechanism still needs to be done.

In order to provide efficacy and proof of concept, δ-sarcoglycan-deficient

TO-2 hamsters, a model for LGMD and congestive heart failure, were treated with rhMG53 (250). Results supported those observed in the mdx mouse with additional improvements in heart functions (250). This study also provided mechanistic evidence for MG53 protection through activation of the Akt (protein kinase B)-ERK (extracellular signal-regulated kinase) survival pathway and by

38 inhibition of the pro-apoptotic protein Bax (250). In a recent paper by Song et. al,

MG53 was shown to be an E3 ligase that targets the insulin receptor and insulin receptor substrate 1 (IRS1) leading to a negatively regulated mechanism for increased myogenesis (251). This research provides another mechanism for

MG53 mediated repair in muscle and may broaden its possible uses as a therapeutic in metabolic syndromes involving insulin resistance (251, 252).

Building on this research it was recently shown that during skeletal myogenesis focal adhesion kinase (FAK) is a second target of MG53 leading to ubiquitination

(252). In 2007 a patent for MG53 was filed in the US (Patent # US7981866 B2).

There does not appear to be any industrial or pharmaceutical collaboration with research groups underway to produce rhMG53. However CycLex Co., a

Japanese biomedical company recently released purified recombinant human

MG53/TRIM72 as a product for purchase and use in research. New discoveries clarifying the role and mechanism of MG53 continue to come to light as research progresses in this field. MG53’s potential to repair cell membranes makes it an intriguing new protein therapeutic; however, because of its general application in a broad range of diseases, the direction of MG53 research seems to be spread in multiple directions. While this does provide new incentive, it may not be the most beneficial way to bring this protein therapy to patients suffering specifically with myopathies or dystrophies. The development of rhMG53 for the use as a treatment for muscle disease generally or for a specific muscle disease would

39 require a research group specializing in muscle disease and the collaboration of industry (Fig. 3).

Rationale and Significance

A number of factors complicate the search for a cure for muscle diseases.

First, due to the heterogeneous nature of these diseases diagnosis requires expertise and experience that may not be readily available, resulting in many undiagnosed or misdiagnosed patients (134). Progress in the field of genetic medicine has greatly improved the accuracy of diagnosis, which is the first step in determining a treatment plan for patients. However, many of the tools for diagnosis still require invasive measures such as muscle biopsies followed by

DNA, protein, bio-molecular, and histological analysis (117, 131, 134).

Additionally, the equipment and personnel required to properly use these improved diagnostic tools are inaccessible to a majority of patients throughout the world. Less invasive, accurate, widely available diagnostic tools such as serum or urine biomarkers still need to be found and developed for many of these diseases.

Second, once patients are accurately diagnosed, very few muscle diseases have an accepted standard of care plan in place. Unfortunately, even the ones that do, such as DMD/BMD, do not include a cure and consist of addressing symptoms with an emphasis on palliative measures (43, 108, 137).

Cumulative research has resulted in increases in life expectancy and small quality of life improvements for some of the myopathies using pharmacological, gene, cell, RNA and protein replacement therapy (Table 1). Protein replacement therapy is a proven avenue with over 130 FDA approved drugs on the market to treat a wide variety of diseases (193). Among the growing number of approved drugs available are Myozyme and Lumizyme. The development of Myozyme and

Lumizyme for use in the treatment of Pompe disease should serve as a roadmap for other protein replacement therapies. Research showing the proximal cause of

Pompe disease followed by preclinical and clinical trials, collaborative academic and industrial based research and grant support resulted in drug treatment with proven benefits for patients and families. The innovative research using biglycan, laminin-111, TAT-Utr and MG53 has led to the progression of these recombinant proteins toward their destination of providing a treatment for muscle diseases

(Fig. 3). If the pathway paved by the development of Myozyme and Lumizyme is followed, a treatment with efficacious measurable quality of life changes could be right around the corner for many muscle diseases.

Summary

The main hypothesis of this dissertation is that the development of protein replacement therapy for treatment of muscular dystrophy will result in a treatment with substantial quality of life improvements for patients suffering with muscle

41 diseases. This dissertation will identify three possible protein therapeutics and characterize their effectiveness as treatments using mouse and human cell lines and two mouse models for muscular dystrophy.

Chapter 2 explores the regenerative benefits of using laminin-111 replacement therapy in a mouse model for merosin-deficient congenital dystrophy (MDC1A), the dyW-/- mice. The dyW-/- mouse and MDC1A patients lack laminin-α2, and present with muscle weakness, demyelinating neuropathy, failed muscle regeneration and decreased life expectancy (253). The efficacy of using laminin-111 as a treatment has been proven in mdx mice, the mouse model for duchenne muscular dystrophy, in α7-/- mice, the mouse model for α7 congenital myopathy and in dyW-/- mice (214-216). However, the ability of laminin-111 treatment to restore failed regeneration was left unanswered. To investigate the role of laminin-111 treatment in regeneration, dyW-/- mice were pre-treated with laminin-111 or PBS followed by injection with cardiotoxin to induce muscle damage. Laminin-111 treatment prior to injury resulted in increased myofiber size and number over PBS controls. The α7 integrin has been shown to be a major disease modifier and changes in α7β1 integrin/extracellular matrix interactions result in changes in sarcolemmal stability (42, 216, 253, 254). The α7β1 integrin levels were increased in mice treated with laminin-111. There was an increase in the number and size of eMyHC positive fibers and an increase in Pax7 and myogenin. The increase in these myogenic markers demonstrate that laminin-

111 protein therapy can both increase repair and provide a positive environment for de novo muscle formation. Together these results indicate laminin-111 protein therapy not only decreases the pathology in dyW-/- mice but is also able to improve the timing, rate and repair capacity.

Chapter 3 focuses on the use of Galectin-1 as a protein replacement therapy in the duchenne muscular dystrophy mouse model. Galectins are a family of lectins with an affinity for β-galactoside and have a wide range of biological activities including cell attachment, differentiation, migration, chemotaxis, proliferation, polarity, apoptosis, and immune response. Galectin-1 is normally found in skeletal muscle and plays a role in muscle repair. Galectin-1 has been shown to interact with ECM proteins and with key members of all three skeletal muscle stabilizing complexes, the DGS, UGC and the α7β1 integrin.

Together these observations indicate Galectin-1 may serve as a therapeutic for

DMD. To test this hypothesis, recombinant mouse Galectin-1 was produced using a bacterial expression system and used to treat myogenic cells. Our results show recombinant Galectin-1 increased protein levels of α7β1 integrin and β-DG in mouse and human myoblasts and myotubes. Our in vivo studies showed mdx mice treated with recombinant Galectin-1 exhibited improved muscle histology and a significant increase in body weight, improved muscle strength, decreased muscle fatigue, and reduced kyphosis. Immunoblots and immunoflurescent analysis show increased correctly localized levels of the DGC, UGC and α7β1

43 integrin. Together our results demonstrate for the first time that galectin-1 is an exciting new protein therapeutic for the treatment of DMD and given the scope of improvements could be beneficial in other muscle diseases.

In chapter 4, the ability of (like-N-acetyl glycosyltransferase) LARGE to alter α7 integrin expression is explored. LARGE, a protein glycosyltransferases is known to add functional glycan moieties to α-DG in vitro and in vivo, and can modulate protein structure and function (255-260). The possible pathways, mechanisms, and affect LARGE has on the glycosylation of α7β1 integrin and its effects on laminin binding through the α7β1 integrin are unknown. In this study we tested the hypothesis that LARGE glycosylates the α7β1 integrin in skeletal muscle. Our results show that overexpression of LARGE in C2C12 cells increased α7 integrin glycosylation and resulted in elevated levels of α7 integrin.

These results indicate that the α7β1 integrin is a target for LARGE-mediated glycosylation and drugs that target LARGE glycosylation or treatment using recombinant LARGE may be therapeutic in the treatment of muscular dystrophy through elevated α7 integrin and α-DG levels.

In chapter 5 conclusions and future directions are discussed. The regenerative benefits of laminin-111 protein therapy are provided in the MDC1A model. Offering two mechanisms through which laminin-111 therapy is working: first, replacement of missing basal lamina and reinforced structure of existing muscle, and second, re-establishment of laminin-integrin interactions necessary

44 for muscle regeneration. Given the importance of regeneration in muscle diseases, muscle injury and trauma and muscle loss associated with aging, laminin-111 protein therapy may have broader benefits than just muscle diseases. Galectin-1 protein therapy had a broad and impactful effect on its ability to decrease biomolecular and phenotypic markers for muscle disease.

Although much research still needs to be done using recombinant galectin-1 treatment, the unexpected positive results from this study provide proof of principle evidence supporting recombinant Galectin-1 as a protein replacement therapy. For the first time evidence was provided showing LARGE overexpression as a way to regulate α7 expression. Granted, this is just a small step in proving recombinant LARGE as a viable protein replacement therapy and it remains to be an intriguing therapeutic option. Together the data generated in pursuit of my Ph.D. demonstrates the importance of continued research and development of protein therapeutics which will provide quality of life changes for patients and families suffering with muscle dystrophy and other muscle diseases.

Figure 1. Skeletal muscle organization with Dystrophin glycoprotein complex and the α7β1 integrin complexes. Skeletal muscles are made of bundles of myofibrils that are surrounded by the sarcolemma. Myofibrils are composed of individual myofibers that are multinucleated. Satellite cells are quiescent cells found adjacent to myofibers and will differentiate into myofibers after they receive danger or stress signals. The main stabilizing muscle complexes in skeletal muscle are the Dystrophin glycoprotein complex and the

α7β1 integrin complex. These complexes found in the sarcolemma, stabilize and connect myofibers.

Figure 2. Lack of key skeletal muscle protein complexes leads to sarcolemmal rupture. In Duchenne muscular dystrophy and several other muscular dystrophies, lack of or mutations in members of the Dystrophin glycoprotein complex or the α7β1 integrin complex will result in mis-regulation and aggregation of these complexes at the sarcolemma. Myofibers without these key connections between cyctoskeletal actin through transmembrane proteins complexes (DG-α and β, SG-α, β, δ and γ, SSPN, α7β1 integrin) to the extracellular matrix are susceptible to contraction induced injury. In DMD dystrophin is replaced by its homologe utrophin to form the Utrophin glycoprotein complex.

Figure 3. Protein therapeutic development for muscle diseases. The successful development of protein therapeutics is being spurred on by the successful approval of Myozyme© and Lumizyme© for use as a cure for Pompe disease. Laminin-111, biglycan,TAT-utrophin and MG53 are at various stages of development on their path to becoming protein replacement therapies for use in the battle against muscle disease.

Table 1: Dystrophies and Myopathies Primary Defect Duchenne and Beckers Muscular Dystrophy Dystrophin Facioscapulohumeral muscular dystrophy D4Z4 Repeats Myotonic Dystrophy CTG/CCTG Repeats Limb-Girdle Muscular Dystrophy Sarcolemmal Proteins Congenital Muscular Dystrophies Glycosyltransferases Sarcolemmal Proteins Mitocondria, GCN Other genetic myopathies Repeat

Table 2: Types of Therapy for Muscle Diseases Therapy Examples nabumetone, isosorbide dinitrate, prednisone, deflazacort, Pharmacological α-methylprednicolone, taurine, RTC13, RTC14 (145) and ataluren (PTC124) micro or mini-dystrophin, mini-utrophin, mini-agrin, Gene myostatin inhibitors, MRPO, α and γ-sarcoglycans , follistatin embryonic stem (ES) cells, induced pluripotent stem (iPS) cells, satellite cells, skeletal myogenic precursors (SMPS), Cell fibro-adipogenic progenitors (FAPs), mesoangioblasts (MABs) skeletal muscle progenitors (SP) and skeletal myogenic precursors (SMPS) RNA (possible miR-1, miR-133a, miR-133b, miR-206, miR-208, miR- targets) 208b, miR-486, miR-499 and miR-669 Protein Myozyme© human recombinant acid α-glucosidase, laminin-111, biglycan, TAT-Utrophin, MG53

Chapter 2

Laminin-111 improves muscle repair in a mouse model of Merosin

Deficient Congenital Muscular Dystrophy

ABSTRACT

Merosin-deficient congenital muscular dystrophy type 1A is a severe and fatal muscle wasting disease with no cure. MDC1A patients and the dyW-/- mouse model exhibit severe muscle weakness, demyelinating neuropathy, failed muscle regeneration and premature death. We have recently shown that laminin-111, a form of laminin found in embryonic skeletal muscle, can substitute for the loss of laminin-211/221 and prevent muscle disease progression in the dyW-/- mouse model. What is unclear from these studies is if laminin-111 can restore failed regeneration to laminin-α2 deficient muscle. To investigate the potential of laminin-111 protein therapy to improve muscle regeneration, laminin-111 or phosphate buffered saline (PBS) treated laminin- α2 deficient muscle was damaged with cardiotoxin and muscle regeneration quantified. Our results show laminin-111 treatment promoted an increase in myofiber size and number, and an increased expression of α7β1 integrin, Pax7, myogenin and embryonic myosin heavy chain, indicating a restoration of the muscle regenerative program.

Together our results show laminin-111 restores muscle regeneration to laminin-

α2 deficient muscle and further supports laminin-111 protein as a therapy for the treatment of MDC1A.

INTRODUCTION

Merosin-deficient congenital muscular dystrophy type 1A (MDC1A) is a devastating genetic disease that results in muscle weakness from birth. MDC1A is caused by mutations in the LAMA2 gene, which results in loss of laminin-

211/221 (merosin) from the basal lamina of skeletal and cardiac muscle (261).

MDC1A patients experience muscle atrophy, impaired muscle regeneration, increased muscle apoptosis, fibrosis and progressive muscle loss (209, 262).

Most MDC1A patients are severely affected within the first year of life and never achieve independent ambulation (262). As the disease progresses, MDC1A patients exhibit joint contractures, respiratory complications, scoliosis, feeding difficulties, limited eye movement, dysmyelinating neuropathy, and seizures (132,

263-265). Palliative interventions such as physical therapy, cough assist and spinal fusion are the only available treatments, yet MDC1A patients remain susceptible to respiratory failure and premature death as early as the first decade of life (263, 266).

Understanding of the pathophysiology of MDC1A has led to novel treatment approaches including anti-apoptotic therapies, regeneration enhancers and restoration of the missing basal lamina. Studies using mouse models of

MDC1A have shown that transgenic expression of laminin- α1 (208, 267, 268), laminin- α2 (269, 270), mini-agrin (158, 271), GalNAc transferase (272), insulin- like growth factor 1(273), α7 integrin (253), and Bcl-2 (274) can reduce or prevent

55 disease progression. Pharmacological interventions with doxycycline and omigapil, which inhibit apoptotic pathways, and 3-methyladenine, which blocks autophagy, have also been shown to improve preclinical outcomes including improved survival and reduced muscle pathology (209, 274-276). Together these studies indicate therapies that restore interactions between the muscle and extracellular matrix and/or normalized muscle survival signaling pathways may be beneficial in the treatment of this devastating muscle wasting disease.

The regenerative capacity of muscle is dependent on the activation and proliferation of normally quiescent satellite cells followed by their subsequent differentiation into mature myofibers. Satellite cells are located proximal to muscle fibers within the laminin-rich basal lamina and become activated by cues induced by muscle injury or disease. Signaling between laminins and their cognate receptors such as the α7β1 integrin are among the environmental cues necessary for satellite cells to proliferate and repair damaged muscle. Loss of laminin-211/221 in MDC1A patients and MDC1A mouse models also results in a secondary loss of the α7β1 integrin and a reduced ability of satellite cells to be activated, proliferate and support efficient muscle repair (270, 277). Together, these observations indicate the importance of the laminin-rich microenvironment for muscle repair.

Recently, we have shown that laminin-111 can act as a protein substitution therapy for laminin- α2 deficiency in mice (215). Our studies showed

56 that dyW-/- mice treated with laminin-111 exhibit reduced muscle pathology, apoptosis, fibrosis, maintained muscle strength and mobility and dramatically increased lifespan (215). What is unclear from these studies is whether the therapeutic effect of laminin-111 is due, in part, to a restoration of the muscle regeneration program.

In this study, we examined muscle repair in laminin-111 treated dyW-/- muscle following cardiotoxin (CTX)-induced muscle injury. Our results show laminin-111 treatment improved the timing and extent of muscle repair and regeneration in laminin- α2 deficient muscle and provides further evidence for the therapeutic potential of laminin-111 protein therapy for MDC1A and other muscle diseases in which regeneration is defective.

MATERIALS AND METHODS

Animals

All experiments involving mice were performed under an approved protocol from the University of Nevada, Reno Institutional Animal Care and Use

Committee. The dyW+/- mice were a gift from Eva Engvall via Paul Martin (The

Ohio State University, Columbus, OH). For this study dyW+/- mice, which are heterozygous at the lama2 locus, were bred to produce male dyW-/- and dyW+/+

(wild-type) animals, which were then used experimentally. Experimental procedures were performed once mice were 21 days of age. To reduce

57 experimental bias, investigators assessing and quantifying experimental outcomes were blinded to the treatment and control groups following recently published guidelines (278).

Laminin-111

Engelbreth-Holm-Swarm (EHS) derived natural mouse laminin-111

(Invitrogen Life Technologies, Grand Island, NY) was thawed overnight at 4ºC. At day -3 mice were injected intramuscularly (IM) into the left tibialis anterior (TA) muscle with either 100µL sterile PBS or 100µL 1500 nM EHS laminin-111 in

PBS. The right TA muscles were injected with 100µL sterile phosphate buffered saline (PBS) and served as controls. Day 0 mice were not injected with CTX and served as non-injury controls (Figure 1A and 1B).The muscles were harvested either at 0, 4, 10 and 28 days after cardiotoxin (CTX) injection for analysis.

CTX-Induced Muscle Injury

TA muscles were damaged at day 0, three days after laminin or PBS treatments by IM injection of 100µL of a 10µmol/L CTX solution (C3987; Sigma,

St. Louis, MO) in PBS. At 4, 10, or 28 days post-CTX induced injury, the mice were euthanized and TA muscles harvested for analysis. Skeletal muscles were dissected and flash frozen in liquid nitrogen cooled isopentane. The tissues were stored at -80ºC until used for analysis.

Histology

Hematoxylin and Eosin (H&E) staining of TA muscle was done as previously described (216). H&E stained slides were used for day 0, 4 and 10 analyses. Average cross-sectional area (CSA) and total number of myofibers were counted at 200X magnification under bright field microscopy using a Zeiss

Axioskop 2 Plus fluorescent microscope, Zeiss AxioCam HRc digital camera, and

Axiovision 4.8 software. The total number of muscle fibers was determined by counting fibers in a minimum of 6 fields of view. A minimum of 800 muscle fibers per TA muscle were counted, with at least four TA muscle sections from each genotype, treatment and time point represented. Analysis of average CSA was quantified from a minimum of 3100 muscle fibers per group per time point and was quantified as previously described (216). Results are reported as the average fiber CSA of all muscle fibers circled for each time point and treatment.

CSA was measured using Axiovision 4.8 software. All the areas in the peak increment were used to determine the average peak fiber area.

TA muscle sections were stained with Sirius Red to measure fibrosis in the muscle tissue. Sections on slides were fixed in 100% ethanol and then hydrated through an alcohol series (95% and 80% ethanol) and rinsed in tap water. The sections were stained with Sirius Red (0.1% in Picric acid solution saturated aqueous, Rowley Biochemical Institute, Danvers, MA) for 30 minutes followed by two washes in acidified water. The sections were dehydrated through

59 an alcohol series, rinsed in xylene and mounted with DEPEX Mounting media

(Electron Microscopy Science, Hatfield, PA) (279). Images of each TA for each time point and treatment group were captured and analyzed using Axiovision 4.8 software. Areas of red in the TA were considered fibrotic. Circled fibrotic areas were added together and any non-fibrotic fibers within the fibrotic area were subtracted from the calculated area. The percentage of muscle fibrosis was quantified in treated and control muscles as a percentage of total TA muscle area.

Sirius red slides were used for average and peak CSA calculations of day

10B and day 28B (B=Booster treatments with laminin-111) from mice injected weekly with laminin-111. Three composite images representing three whole TA sections taken at 100x magnification were used for analysis. All muscle fibers within an entire TA were used to determine the average CSA and total number of myofibers.

Immunofluorescence

TA muscles were embedded in Tissue-Tek OCT and 10µm cryosections were cut using a Leica CM 1850 cryostat (Leica, Wetzal,Germany). Sections were placed on pre-cleaned Surgipath slides (Surgipath Medical Industries,

Richmond, IL) and fixed using methanol, acetone, and/or 4% paraformaldehyde

(PFA). The Mouse on Mouse (M.O.M.) kit was used with all mouse antibodies

60 according to package instructions (FMK-2201, Vector Laboratories). Laminin-α1 chain was detected using a rat anti-mouse laminin-α1 monoclonal antibody

(MAB1903; EMD Millipore Corporation, Billerica, MA, 1:50) overnight followed by a FITC-conjugated goat anti-rat-IgG secondary antibody (1:5000; Li-Cor

Biosciences).

Embryonic myosin heavy chain (eMyHC) was detected using bovine anti- mouse myosin heavy chain 2B antibody (BF-F3; Developmental Studies

Hybridoma Bank, Iowa City, IA, 1:30) overnight followed by fluorescein isothiocyanate (FITC)-conjugated anti-mouse-IgG secondary antibody. These slides were also treated with tetramethylrhodamine labeled wheat germ agglutinin (WGA, 1:250, Molecular Probes, Invitrogen detection technologies,

Eugene, OR). The percentage of eMyHC positive myofibers, average CSA, and peak CSA eMyHC was calculated for each time point and treatment group.

The α7 integrin was detected using the rat monoclonal antibody CA5.5

(1:1000; Sierra Biosource, Morgan Hill, CA) for 1 hour at room temperature. β1D integrin was detected using the mouse anti-mouse β1D integrin monoclonal antibody (1:25; MAB1900; EMD Millipore Corporation, Billerica, MA) overnight followed by a FITC-conjugated anti-mouse-IgG secondary antibody (1:5000; Li-

Cor Biosciences). Slides were mounted using Vectashield Hard Set with DAPI

(Vector Laboratories Inc., Burlingame, CA).

Images were captured using a Zeiss Axioskop 2 Plus fluorescent

61 microscope, Zeiss AxioCam HRc digital camera, and Axiovision 4.8 software or an Olympus FluoviewFV1000 Laser scanning biological confocal microscope using the Olympus micro FV10-ASW 3.1 software. Representative images for publication were taken at 400X using the Olympus FluoviewFV1000 Laser scanning biological confocal microscope.

Western Blotting

The TA muscles from male mice were dissected, macerated, and protein extracted in RIPA as previously described (215). Protein was quantified using the

Pierce BCA Protein Assay kit (Thermo Scientific, Rockford, IL) according to manufacturer’s directions and separated using 8% or 16% SDS PAGE, and transferred to nitrocellulose membranes. The α7B integrin was detected with a

1:1000 dilution of rabbit anti-α7B (B2 347) polyclonal antibody overnight. 7A integrin was detected using a 1:1000 dilution of rabbit anti-α7A (CDB 345) antibody overnight. The β1D integrin was visualized using a 1:1000 rabbit anti-

β1D-antibody (a gift from Woo Keun Song, Gwanju Institute for Science and

Technology, South Korea). Pax7 was detected using a 1:500 dilution of rabbit anti-Pax7-antibody (AVIVA Systems Biology, San Diego, CA) overnight.

Myogenin was visualized using a 1:500 rabbit polyclonal antibody (Santa Cruz

Biotechnology, M-225, SC-576) overnight. All primary antibodies were detected using a goat anti-rabbit-IgG secondary antibody (1:5000, Li-Cor Biosciences) for

1 hour. Prior to blocking all immunoblots were treated with Swift Membrane Stain

(G. Biosciences, St. Louis, MO) to normalize for sample loading. Band intensities for all antibodies were determined using ImageJ software and normalized to bands visualized using Swift Membrane Stain.

Statistical Analysis

All statistical analysis was performed using GraphPad Prism 5 software.

Averaged data is reported as the mean +/- the standard error of the mean (SEM).

Comparison for two groups was performed using a Students t-test and between multiple groups using Bonferroni post-test with two-way ANOVA on ranks for nonparametric data. For non-paired tests such as fiber size, the Students unpaired t-test with Welsh’s correction and between groups Kruskal-Wallis test or

Dunn’s multi comparative test. P< 0.05 was considered statistically significant.

RESULTS

Laminin-111 improves muscle repair in laminin- α2 deficient mice after

CTX-induced injury

Recent studies have shown that laminin-111 protein therapy can substitute for the loss of laminin-211/221 and ameliorate the progression of disease in the dyW-/- mouse (215). One pathological component of laminin- α2 deficiency is a profound delay in the ability to regenerate skeletal muscle (158,

271). The muscle regeneration that occurs in various muscular dystrophies can be ongoing and to quantify any deficiencies in regeneration, toxins such as cardiotoxin (CTX) or notexin are often used to reset the cycle of degeneration and regeneration to a defined moment. To investigate whether the therapeutic effect of laminin-111 is also due to restored muscle regeneration, we pretreated

TA muscle of laminin- α2 null mice with either laminin-111 or PBS, artificially induced muscle degeneration with CTX three days later, and assessed the timing and extent of muscle regeneration using histological and morphological measurements.

Three week-old dyW-/- mice (day 3) were injected intramuscularly (IM) with

100µL of 1500nM Engelbreth-Holm-Swarm (EHS) laminin-111 or PBS. Three days later, the tissue from day 0 mice was harvested (Figure 1A), and mice for subsequent day 4 and 10 analyses were injected IM with CTX to induce muscle damage (Figure 1). To ensure delivery of EHS laminin-111 to TA muscles, cryosections were stained for laminin-α1 and imaged at 400X using high- resolution confocal microscopy (Figure 2A-F). Following laminin-111 treatment, the laminin-α1 chain was localized within the basal lamina of all TA muscles injected with laminin-111. No laminin-α1 was evident in PBS treated muscles, consistent with previous reports (215).

During muscle regeneration increased synthesis of the contractile apparatus within nascent myotubes increases the myofiber cross sectional area

(CSA, Figure 2G-L). While CSA of myofibers is dependent on fiber orientation and should be used cautiously, the high number of myofibers quantitated and the small error bars indicate that in this case the measurements are valid. Muscle cryosections stained by Hematoxylin and Eosin (H&E) demonstrated that by day

0 (before CTX injection) laminin-111 treated TA muscle demonstrated an average myofiber CSA of 1032µm2, while myofibers treated with PBS were 988

µm2 (Figure 2G, J,& M). By day 4 (4 days after CTX injection) laminin-111 and

PBS treated muscle demonstrated an average CSA of 1803µm2 and 1442µm2, respectively (Figure 2H & K). At 10 days after CTX injection, the average CSA was lower in both treatment groups, 877µm2 for laminin-111 and 769µm2 for PBS

(Figure 2I, L, & M).

Compared to PBS treated muscle, the increase in average CSA was marginally higher in laminin-111 treated muscle at day 0 and had increased 25% by day 4. The average CSA in laminin-111 treated muscle had declined 10 days after CTX to a 14% increase in CSA compared to PBS treated muscle (Figure

2N).

The lack of sustained effect in average and peak CSA in laminin-111 treated muscle, following CTX injury, may be attributable to the severity of disease in this mouse model or the need for multiple laminin-111 treatments. The artificially harsh conditions and inflammation following CTX injury may have also accelerated the degradation of injected laminin-111.

Not only was the average and peak size of myofibers increased after laminin-111 therapy and CTX injury, there was also a dramatic 100% increase in the number of myofibers by day 4 (Figure 2N). By day 10, when comparable values for average and peak CSA were noted in laminin-111 and PBS treated muscles, laminin-111 treatment resulted in an 800% increase in the number of myofibers (Figure 2N). These results indicate that the therapeutic effect of laminin-111 protein substitution in laminin-α2 deficient muscle is due, in part, to improved size of individual myofibers, but also increased survival of laminin- α2 deficient muscle.

Laminin-111 increases muscle regeneration in laminin-α2 deficient muscle.

Embryonic myosin heavy chain (eMyHC) is transiently expressed during muscle development and is used as a marker for nascent myofiber creation during muscle regeneration. As myofibers further differentiate, eMyHC becomes replaced by adult myosin heavy chain (215). On day 0, before CTX injury, laminin- α2 deficient TA muscle injected with PBS demonstrated that 14% of myofibers were eMyHC positive (Figure 3A), indicating that persistent regeneration is ongoing in dyW-/- muscle. By day 4, following CTX injection, 54% of PBS treated myofibers were eMyHC positive which had decreased to 9% by day 10 – levels that were observed pre-CTX (Figure 3B & 3C).

In contrast, muscles treated with laminin-111 at day 0 (before CTX injury) demonstrated 31% eMyHC positive myofibers, indicating that laminin-111 treatment rapidly increases the pool of differentiating myofibers (Figure 3D). By day 4, the number of eMyHC positive myofibers in laminin treated muscle had increased to 86% of all myofibers, representing a 59% increase above PBS treated muscles (Figure 3E & 3J). By day 10 eMyHC positive myofibers in laminin-111 treated muscle had declined to 16%, representing a 77% increase above PBS treatment levels (Figure 3F & 3J). The biphasic appearance of eMyHC myofibers in both PBS and laminin-111 treated muscles is consistent with the transient expression of eMyHC in regenerating myofibers and that myofiber differentiation was near completion. The increase in eMyHC positive myofibers following laminin-111 treatment (even before CTX injury) demonstrates that laminin-111 protein increases the regenerative capacity of laminin- α2 null muscle.

We next examined if the improved muscle regeneration as a result of laminin-111 treatment resulted in larger eMyHC positive myofibers. To examine this, we measured the area of eMyHC positive myofibers in wild-type TA muscle treated with PBS and dyW-/- TA muscles treated with either PBS or 1500nM laminin-111. At day 0, the average CSA of eMyHC fibers in dyW-/- muscle following treatment with PBS and laminin-111 was 279µm2 and 360µm2, respectively (Figure 4A). Wild type TA muscle possess a normal repair capacity,

67 and the average CSA of eMyHC positive myofibers of 910.0µm2 following PBS treatment was much larger than dyW-/- muscle treated with PBS or laminin-111

(Figure 4A). At day 0, there was no statistical difference in the peak CSA of eMyHC fibers either treated with PBS or laminin-111 (Figure 4B), and both were only 42% the size of wild-type fibers prior to injury.

At 4 days post-CTX, the average and peak CSA of myofibers from dyW-/- mice treated with laminin-111 approached wild-type levels, (Figure 4C & 4D).

The average CSA of eMyHC positive fibers treated with laminin-111 were 89% of the average CSA of wild type PBS treated eMyHC fibers (Figure 4C). Peak CSA of eMyHC fiber treated with laminin-111 were indistinguishable from the CSA observed in wild-type mice (Figure 4D). The average CSA for PBS treated tissue was 283µm2, 363µm2 for laminin-111 treated tissue, and 410µm2 for wild type tissue (Figure 4C). Laminin-111 treated laminin- α2 null muscle had a peak CSA of 251µm2, while PBS treated tissue was 153µm2 (Figure 4D). The area of eMyHC fibers at peak CSA treated with PBS was 60.7% the area of peak eMyHC found in wild-type muscle, while tissue treated with laminin-111 was nearly identical (250.4µm2 in laminin-111 treated versus 252.2µm2 in PBS treated,

Figure 4D). Compared to PBS treated dyW-/- muscle, the improvement in average

CSA of eMyHC positive myofibers following laminin-111 treatment seen at day 4 was only minimally evident by day 10, and there was no statistical difference of peak CSA of eMyHC fibers (Figure 4E & 4F). The decline in the efficacy of

68 laminin-111 seen at day 10 may be due to rapid matrix turnover in muscle.

Nonetheless, these data show that laminin-111 treatment restored regenerative capacity to laminin-α2 deficient muscle prior to CTX induced injury by increasing the percentage and the average CSA of eMyHC fibers.

Laminin-111 increases α7β1 integrin in CTX-damaged dyW-/- muscle

The α7β1 integrin is a laminin receptor and is expressed on satellite cells and adult muscle (40, 216, 254). The α7 integrin knockout mouse exhibits reduced laminin- α2 expression and upon CTX challenge has a defect in muscle regeneration that is similar to the dyW-/- and dy3k mouse models of MDC1A (216,

254). Loss of laminin-α2 in dyW-/- and dy3K mouse models, also results in a secondary reduction of sarcolemmal localization of α7β1 integrin which likely exacerbates the muscular dystrophy phenotype (117, 277, 280). Therefore, laminins and the α7β1 integrin have a cooperative relationship that is critical for effective muscle regeneration and sarcolemmal integrity (116, 215, 253, 281).

To examine whether laminin-111 protein therapy could restore sarcolemmal localization of the α7β1 integrin in laminin- α2 null muscle, integrin localization was examined in TA muscles treated with 1500nM laminin-111 or

PBS before and after CTX damage. Immunofluorescence revealed TA muscle treated with laminin-111 before or after CTX had an increase in sarcolemmal localization of both α7 and β1D integrin compared to PBS treated muscle (Figure

5A-5I). The results indicate treatment with laminin-111, a high affinity ligand for the α7β1 integrin, increased the membrane localization of the α7β1 integrin in laminin-2 deficient muscle. This data is consistent with earlier data in which transgenic laminin- α1 expression in dy3k mice restores sarcolemmal α7β1 integrin (282). In addition, increased levels of α7β1 integrin in TAs treated with laminin-111 were more uniform in size and had less atrophic muscle fibers.

To confirm our immunofluorescence results, western analysis of the α7A,

α7B and β1D integrins was performed on TA tissue treated with PBS or laminin-

111 either prior to CTX damage (day 0) or 4 and 10 days post CTX induced- damage. From day 0, 4 and 10 day time points laminin-111 treatment resulted in greater protein levels of α7A, α7B and β1D; 1.8, 1.4 and 2.0 fold increase in α7A,

α7B and β1D integrin protein, respectively at day 0, a 1.7, 1.2 and 2.1 fold increase for α7A, α7B and β1D integrin respectively at day 4 and a 1.5, 1.3 and

1.8 fold increase in α7A, α7B, β1D integrin at day 10 (Figure 5J-5L). Together these data show that laminin-111 treatment in dyW-/- muscle before damage stabilizes the α7β1 integrin at the sarcolemma. Given the presence of α7B on satellite cells and myofibers, and the presence of α7A and β1D on mature fibers only, the laminin-111 treatment appears to target both satellite cells and mature myofibers.

Laminin-111 treatment increased total TA area in laminin-α2 deficient muscle

We previously demonstrated that as few as three weekly systemic intraperitoneal injections of laminin-111 to dyW-/- mice resulted in more individual myofibers in the triceps brachii and a larger overall muscle area, indicating that laminin-111 promotes de novo muscle generation and/or is mitigating the loss of myofibers due to laminin- α2 deficiency. To clarify this result, we quantified the total average TA area at all time points and treatments. At day 0, 4 and 10 the average total area of TA muscles treated with PBS was 65,000µm2, 57,500µm2 and 73,600µm2 ,respectively while the average total area of TA muscles treated with laminin-111 was 107,000µm2, 70,000µm2 and 117,00 µm2, respectively

(Figure 6G). Overall, all TAs treated with laminin-111, before or after CTX damage were larger than PBS controls resulting in a 65%, 22% and 59% increase in total TA area at day 0, 4 and 10, respectively (Figure 6G). The results substantiate our earlier findings and suggest that laminin-111 promotes de novo muscle generation in laminin- α2 deficiency.

Laminin-111 treatment reduces fibrosis in laminin-α2 deficient muscle

The persistent cycles of degeneration and regeneration that occur in muscular dystrophies, including MDC1A, are also accompanied by chronic inflammation which ultimately results in the deposition of fibrotic matrices (215,

253, 283). In order to determine the effects of laminin-111 treatment on fibrosis in laminin- α2 deficient muscle before and after CTX-induced injury, TA muscle was stained with Sirius Red as previously described (174, 284). The fibrotic area of

PBS treated TA muscle at day 0, 4 and 10 was 15%, 56% and 22%, respectively

(Figure 6A-6F &6H, Supplemental Figure S1). In contrast, treatment with laminin-

111 reduced these fibrotic areas in the TA muscle at days 0 and 4 to 8.5% and

39%, respectively (Figure 6D, 6E, 6H). However, by day 10 the fibrotic area of

PBS and laminin-111 treated TA muscle were similar (Figure 6C, 6F, 6H).

These results indicate that laminin-111 has an immediate impact on muscle fibrosis and following CT injury can mitigate further fibrotic accumulations in laminin- α2 deficient muscle. However, by 10 days the anti-fibrotic effect of laminin-111 had waned. Alternatively, the result suggests that laminin- α2 deficient muscle exhibits some capacity to minimize fibrotic accumulations.

Laminin-111 increases Pax7 and myogenin in laminin- α2 null muscle after damage

Satellite cells express the paired box transcription factor Pax7 and are normally quiescent. Induced to proliferate by muscle damage or disease, satellite cells continue to express Pax7 in addition to the myogenic regulator factor (MRF)

MyoD. As satellite cells further differentiate into myotubes, Pax7 expression is reduced and MyoD expression is replaced by expression of the MRF myogenin

(1, 3, 175). Thus, Pax7 and myogenin mark the early and late stages of satellite cell-based muscle regeneration, respectively and were measured to ascertain whether laminin-111 enhanced the early or late stages of myogenesis in laminin-

α2 deficient muscle.

Compared to PBS treated muscle, laminin-111 treated muscle resulted in a 1.7, 2.4 and 1.4 fold increase in Pax7 protein 0 (before CTX), 4 and 10 days post-CTX injection (Figure 7A). The decline in Pax7 at day 10 in PBS and laminin-111 treated groups is consistent with terminal differentiation. At day 0, prior to CTX injury, there were no significant differences in myogenin expression in laminin-111 or PBS treated tissue (Figure 7B), indicating that laminin-111 is acting upon recently activated (myogenin negative) satellite cells rather than nascent myotubes exhibiting aborted terminal differentiation (216). Following

CTX, however, laminin-111 treated muscle exhibited a 2.5 and 3-fold increase in myogenin at day 4 and 10, respectively compared to PBS treatment (Figure 7B), indicating that laminin-111 increased the pool of satellite cells available for terminal differentiation. The increase in Pax7 and myogenin following laminin-111 treatment and CTX injection is consistent with the positive mitogenic effect laminin-111 is known to provide to proliferating myoblasts (216).

Mobility is improved in dyW-/- mice in which the TA muscles were treated with laminin-111

Mobility observations of dyW-/- mice treated once with either laminin-111 or

PBS IM injected and injured 3 days later with CTX, demonstrated that animals treated with laminin-111 exhibited more effective use of the treated leg than the leg treated with PBS (Supplemental Figure 2S). It was also observed that the leg of mice receiving IM treatments with laminin-111 in the TA muscle showed decreased joint contractures, and hind limb neuropathy than PBS-treated dyW-/- mice of the same age (Supplemental Figure S2). Together these data show laminin-111 improved muscle repair of the TA muscle, despite damage by CTX, and this translated into improved overall muscle function after CTX-induced damage.

Weekly laminin-111 therapy sustains muscle regeneration in laminin-α2 deficient muscle

The effectiveness of a single dose of laminin-111 on regeneration of laminin-α2 deficient muscle had waned 10 days after CTX injection (Figure 2H).

Activation of matrix metalloproteases in laminin- α2 deficient muscle may have increased the turnover of active laminin-111 in muscle by day 10, and in this study, inflammation as a result of the CTX injection may also have promoted further turnover of the injected laminin-111. To test this idea, additional laminin-

111 protein was injected at 4, 11, 18 and 25 days post-CTX damage in order to boost the amount of active laminin-111 in the muscle (Figure 1B, B=Booster treatments with laminin-111).

There was only a 44µm2 difference in average CSA between treatment groups at day 10 with one dose of laminin-111 (Figure 2G). Day 10 TAs that received a boost of laminin-111 at 4 days post-CTX (Figure 8A: day 10B), resulted in a 360µm2 increase in average CSA, representing an 8.3 fold increase versus treatment groups treated only once prior to injury (Figure 8A). The increase in average CSA observed at day 10 following weekly injections continued to be evident at day 28.

By 10 days after CTX injury, the peak CSA of muscle treated once with laminin-111 was nearly identical to the PBS treated fibers. However, by 10 days after CTX injury those muscles injected weekly with laminin-111 exhibited a peak

CSA area which was significantly higher than the PBS treated tissue.

Furthermore, by day 28 post CTX the peak CSA area in laminin-treated muscle remained larger while the peak CSA in weekly PBS injected muscles exhibited a decrease (Figure 8B). In addition to having larger fibers in the laminin-111 treated muscles, there was also a greater number of fibers compared to the PBS treated tissue (Figure 9C).

There was a similar trend in total TA area observed in both day 10 treatment groups (Figure 6G and Figure 9A). The total TA area of day 10B

75 weekly laminin-111 treated tissue was 1.3 fold larger than those treated with PBS and 1.5 fold larger at day 28B. Total TA area at day 28 with weekly treatments of laminin continued to be larger than controls and was also larger than either of single treatment day 10 laminin treated TAs (Figure 9A, 6G, S1). The improvements with weekly laminin-111 injections are also evident in further reduced fibrosis at 10 and 28 days post CTX injury. Although no statistical difference was measured in percent fibrosis in the day 10 mice that received only one treatment, there was a significant difference in both the day 10 weekly injected group and the day 28 group (Figure 9B, 6H). The percent fibrosis of the

PBS weekly injected mice increased from day 10B to day 28B. This result is expected due to the severe progressive nature of this disease; however it was surprising to see a continued decrease in fibrosis in the laminin-111 treated tissue from day 10B to day 28B (Figure 9B). This data provides evidence that weekly injections in laminin- α2 deficient muscle are necessary to maintain the efficacy of laminin-111 in muscle regeneration and indicate the half-life for laminin-111 activity in laminin- α2 deficient muscle under these experimental conditions of between 3-7 days.

DISCUSSION

MDC1A is a progressive muscle wasting disease caused by the absence of laminin-211/221 due to defects in the LAMA2 gene. Laminin-211/221 is a

76 component of the basal lamina and critical for normal muscle function. There is no cure or approved therapy for MDC1A and only palliative treatment options are available. Recently, we have shown that systemic delivery of laminin-111 protein targets skeletal muscle and reduces the progression of disease in the dyW-/- mouse model of MDC1A (215).

In the current study, we show that laminin- α2 deficient muscle treated with laminin-111 protein before CTX injury increased the regenerative capacity of skeletal muscle; measured as increased average CSA, α7β1 integrin, Pax7 and myogenin expression, and ultimately increased myofiber number. Importantly, laminin-111 appears to increase de novo myogenesis.

This result is consistent with previous in vitro and in vivo studies, which show increased contact between satellite cells and myofibers and the extracellular matrix increases satellite cell proliferation and migration, and decreases programmed cell death, myofiber loss, fat deposition, and fibrosis in the laminin-α2 deficient muscle (158, 270, 285). The peak activity of PBS and laminin-111 protein treatment for myogenic repair and regeneration in laminin- α2 deficient muscle was 4 days after CTX damage. At 10 days after CTX damage, the repair capacity in laminin- α2 null muscle was diminished indicating reduced myogenic activity of laminin-111 in the muscle or alternatively a completed cycle of differentiation.

The reduced activity of a single injection of laminin-111 10 days after CTX injection is likely due to the accelerated turnover of the extracellular matrix by proteases and inflammatory infiltrates during degeneration. The α7β1 integrin and α-dystroglycan are the predominant laminin receptors on adult skeletal muscle. This study showed that laminin-111 protein therapy is able to restore sarcolemmal integrity in laminin-α2 deficient muscle through increased levels and sarcolemmal localization of α7β1 integrin. Sarcolemmal α-dystroglycan is not appreciably reduced in dyW-/- animals, yet the interaction of laminin-111 with the dystroglycan-dystrophin glycoprotein complex likely synergizes with the α7β1 integrin to reinforce muscle integrity (116, 281) The affinity of α7β1 integrin for laminin-111 has been shown to be stronger than α-dystroglycan (286-289). The increased level of α7β1 integrin affects not only sarcolemmal organization, but also the earlier stages of myogenesis such as satellite cell proliferation and migration; and ultimately the regenerative capacity of skeletal muscle (1, 254).

Mini-agrin also promotes regeneration in MDC1A mouse models, but appears to do so without enhancement of the α7β1 integrin (271). Importantly, the improvement in muscle regeneration in the dyW-/- mouse by mini-agrin is not accompanied by an increase in the number of myofibers as seen following laminin-111 treatment (159). The α7 integrin KO mouse exhibits a mild myopathy, but is otherwise healthy and fertile (216). However, following CTX injection into the TA, the α7 integrin KO mouse exhibits a profound defect in

78 muscle regeneration that mimics what occurs in MDC1A mouse models (216).

Despite the absence of α7 integrin and a mildly reduced composition of laminin-

211/211, the injected laminin-111 was also able to rescue the regenerative defect in α7 KO mice. These observations indicate that existing α-dystroglycan perhaps with assistance from up-regulated α6β1 integrin can rescue the regenerative defect in these mice. Overall, our results indicate that matrix interactions are generally important for muscle regeneration, but the cooperative interaction between -dystroglycan and the α7β1 integrin, perhaps at differing stages of myogenesis, are crucial for normal muscle regeneration.

Previous research has shown that changes in α7β1 integrin expression in dyW-/- muscle can alter the organization/deposition of extracellular matrix proteins and enzymes that regulate those proteins (253). These results indicate increased α7β1 integrin due to laminin-111 protein therapy may be a major contributing factor to sarcolemmal and basal lamina stability.

The increased number of eMyHC positive myofibers in laminin- α2 null muscle after laminin-111 treatment observed in this study demonstrates the ability of laminin-111 protein therapy to improve the repair capacity of existing muscle and provide an environment for de novo muscle formation (1, 158, 174).

Our results indicate laminin-111 protein therapy not only decreases the pathology of laminin-α2 deficient mice (215), but improves the timing, rate, and repair capacity which may explain improvements in muscle disease observed with

79 systemic delivery of the protein. The percentage of eMyHC in laminin-111 treated muscle was nearly normalized to wild-type levels 4 days after CTX damage.

This supports the idea that laminin-111 may confer a protective effect by providing new mechanical linkages between the extracellular matrix and the sarcolemma (215). This is consistent with other studies which show that loss of contact between myofibers through the basal lamina and extracellular matrix initiates programed cell death in laminin-α2 deficient muscle; and that the restoration of contact through laminin-111 treatment in dyW-/- mice leads to reduction of apoptosis, muscle degeneration, and myofiber loss (158).

The myogenesis and regenerative capacity of skeletal muscle is dependent on the interactions of satellite cells in muscle and the laminin rich basal lamina (1, 174, 290). During activation, satellite cells express transcription factors Pax3, Pax7, MyoD, myogenin and MRF4. We have previously shown that the loss of α7 integrin leads to reduced satellite cell activation and myoblast differentiation in response to muscle injury (215, 253). In this study we demonstrate laminin-111 treatment results in increased expression of Pax7 and myogenin which are markers for satellite cell activation (40, 173, 175). Myogenin is expressed after cells have committed to differentiation into muscle cells, while

Pax7 is required for satellite cell maintenance and activation (173-175).

Myogenin is expressed after Pax7 and MyoD and is therefore an excellent marker for myogenesis and muscle repair (173-175). In muscle receiving one

80 treatment with laminin-111, Pax7 and myogenin were dramatically increased at day 4 and day 10, indicating an increase in satellite cell activation and myogenic repair capacity. These results indicate laminin-111 can act to replace the loss of laminin-211/221 in the basal lamina to improve satellite cell activation and repair.

The effect of laminin-111 treatment was also visually apparent by observing the mobility of dyW-/- mice treated with laminin-111 or PBS. The movement and use of the legs in which the TA muscle was treated with laminin-

111 and then subjected to CTX damage was closer to wild type, while the legs in which the TA muscle was treated only with PBS and subjected to damage exhibited reduced mobility and use. This result is consistent with our previous study demonstrating improved mobility and activity following systemic treatment with laminin-111.

Together, this study indicates that laminin-111 protein therapy possesses two mechanisms of action that are relevant to normal muscle function but also necessary for effective treatment of MDC1A; 1] restoration of the defective basal lamina reinforced muscle adhesion of existing muscle and mitigation of the secondary manifestations of laminin- α2 deficiency, and 2] restoration of the laminin-integrin microenvironment is necessary for the expansion and terminal differentiation of satellite cells and thus effective muscle regeneration. Given the importance of the laminin-integrin relationship in muscle regeneration and adult muscle stability, laminin-111 protein therapy may also benefit other muscle

81 diseases that exhibit defective muscle repair including Fukuyama muscular dystrophy (FCMD), Fukutin-Related Muscular Dystrophy (LGMD2I),

Dysferlinopathy (LGMD2B) and Dystroglycanopathy (MDC1D). In addition laminin-111 protein therapy may be useful in the treatment of severe muscle injury and trauma or muscle loss associated with aging or chronic disease.

Figure 1. Experimental design and timeline for examining muscle regeneration following laminin-111 treatment. All mice were injected intramuscularly (IM) beginning at 21 days of age. The left tibialis anterior (TA) muscle was injected with 100µL of laminin-111 (Lam-111) in PBS, the right TA muscle was injected with 100µL sterile phosphate buffered saline (PBS) and served as the control. (A) Three days after a one time treatment of either laminin-

111 or PBS, animals were sacrificed (Sac) and muscles from day 0 were harvested and served as non-injury controls. Cardiotoxin (CTX) was injected into the remaining groups and harvested 4 and 10 days later for analysis. (B) Mice received 100µL of laminin-111 in PBS in the left TA and PBS in the right TA.

Three days after treatment the muscles were injured with CTX injection (day 0) followed by additional laminin-111 or PBS treatments 4, 11, 18 and 25 days after

CTX injury. LAM-111 or PBS injection; black filled arrows, CTX; day 0, Sac; white arrowheads.

Figure 2. Laminin-111 delivered intramuscularly to laminin-α2 deficient muscle increases myofiber area and number after CTX-induced injury. TA muscle cryosections from PBS treated (A-C) and laminin-111 treated (D-F) mice, before CTX (A, D) and 4 days (B, E) and 10 days (C, F) after CTX, were immunostained with antibodies to laminin-α1 chain. Scale bar = 50 μm. PBS treated (G-I) and laminin-111 treated (J-L) TA muscle cryosections were H&E stained before CTX (G, J) and 4 days (H, K) and 10 days (I, L) after CTX followed by quantitation of the average myofiber (M) cross sectional area, and

(N) numbers of myofibers before and after CTX. PBS treatment; white bars, laminin-111 treatment; black bars. Scale bar = 100μm (G-L). Day 0 laminin-111 and PBS treatment; n=4 each. Day 4 and day 10; CTX injury of laminin-111 and

PBS treatments; n=5 each timepoint and treatment. Statistical analysis used was unpaired t-test with Welch’s correction between two groups and Kruskal-Wallis test between groups. ***p<0.0001, *p<0.05.

Figure 3. Laminin-111 treatment of dyW-/- mice accelerates expression of embryonic myosin heavy chain after CTX-induced damage. High resolution confocal microscopic images of TA muscle PBS treated (A-C) and laminin-111 treated (D-I) mice, before CTX (A, D, G) and 4 days (B, E, H) and 10 days (C, F,

I) after CTX, were immunostained with antibodies to embryonic myosin heavy chain (eMyHC) (A-F) Negative controls include the use of secondary antibody alone (G-I) Anti-eMyHC antibody detects regenerating muscle fibers (green), all nuclei are stained with DAPI (blue), and myofibers are outlined with tetramethylrhodamine wheat germ agglutinin (red). Scale bar = 50μm. (J)

Quantification of the percentage of eMyHC positive myofibers following laminin-

111 and PBS treatment. Day 0 laminin-111 and PBS treatments; n=4 mice each.

Day 4 and 10 laminin-111 and PBS treatments; n=5 mice each timepoint and treatment. Statistical analysis used was Bonferroni post-test with two-way

ANOVA on ranks for nonparametric data. *p<0.05 between treated and control,

***p<0.001 between time points.

Figure 4. Laminin-111 treatment of laminin-α2 deficient muscle increases the size of eMyHC positive myofiber after CTX-induced injury. Average (A,

C, E) and peak (B, D, F) CSA of TA muscle of dyW-/- mice treated with PBS

(white bars), laminin-111 (black bars), and non-treated wild type dyW+/+ mice

(hatched bars) measured in μm2 of myofibers positive for eMyHC. Day 0 laminin-

111 and PBS treatment; n=4 (A, B), Day 4 (C, D) and 10 (E, F) laminin-111 and

PBS treatment; n=5 each timepoint and treatment. Statistical analysis used was one way between two groups and Kruskal-Wallis test between groups.

Figure 5. Laminin-111 treatment enhanced levels of α7A, α7B, and β1D integrin in laminin-α2 deficient mice after CTX-induced injury. TA muscle cryosections from PBS treated (A-C) and laminin-111 treated (D-I) mice, before

CTX (A, D, G) and 4 days (B, E, H) and 10 days (C, F, I) after CTX, were immunostained with antibodies to α7 integrin (A-F) or β1D integrin (G-I). Scale bar = 50 μm. Immunoblot detection of α7A (J), α7B (K), or β1D (L) integrin of protein extracted from TA muscles treated with PBS (white bars) and laminin-111

(black bars) before and after CTX. Levels of α7, α7B and β1D were normalized to Swift staining of a total protein housekeeping band. **p<0.01, ***p<0.001 using Bonferroni post-test with two-way ANOVA on ranks for nonparametric data. n=4 for all time points and treatment groups.

Figure 6. Laminin-111 treatment of laminin-α2 deficient mice increased total muscle area and reduced fibrosis after CTX-induced injury. A:

Representative pictures of TA muscle treated with PBS (A-C) or laminin-111 (D-

F), before CTX (A & D) and 4 days (B & E) and 10 days (C & F) after CTX, were stained with Sirius red. Red area considered fibrosis is indicated with white arrows. For pictures of whole TA sections see Figures S1. Total muscle area (G) and fibrosis (H) were quantified. *p<0.05, ***p<0.001 significant different from

PBS control treated tissue at all timepoints using Bonferroni post-test with two- way ANOVA on ranks for nonparametric data.

Figure 7. Laminin-111 treatment of laminin-α2 deficient mice increases early and late stage markers of muscle regeneration. Protein extracts of TA muscle treated with PBS (white bars) or laminin-111 (black bars), at day 0

(before CTX) and 4 and 10 days after CTX were assayed by immunoblot for

Pax7 (A) and myogenin (B) protein. Protein levels were normalized to Swift stain of total protein. *p<0.05, ***p<0.001, n=4 for all time points and treatments using

Bonferroni post-test with two-way ANOVA on ranks for nonparametric data.

Figure 8. Weekly laminin-111 treatment of laminin-α2 deficient muscle was necessary to maintain regeneration 10 and 28 days post injury. Average myofiber (A) CSA of Sirius red stained TA sections of day 10 or day 28 TA muscles following weekly injections of laminin-111 (black bars) or PBS (white bars). Average (B) and peak (C) CSA of myofibers stained for embryonic myosin heavy chain (eMyHC) of day 10 TA muscles following weekly injections of dyW-/- mice with laminin-111 (black bars) or PBS (white bars), or untreated WT mice

(hatched bars). Average (D) and peak (F) CSA of myofibers stained for embryonic myosin heavy chain (eMyHC) of day 28 TA muscles following weekly injections of dyW-/- mice with laminin-111 (black bars) or PBS (white bars), or untreated WT mice (hatched bars). Unpaired t-test with Welch’s correction between two groups and between multiple groups the Kruskal-Wallis test was used for average and peak CSA. For each treatment group day 10B; n=6, and day 28B; n=3 mice. ***p<0.001, ns; not significant.

Figure 9. Weekly laminin-111 treatment of dyW-/- laminin-α2 deficient mice increases total TA area, myofiber number and reduces fibrosis after CTX injury. Total area of the TA (A), percent fibrosis (B), and number of myofibers

(C) of Sirius red stained TA sections of day 10 or day 28 TA muscles following weekly injections of laminin-111 (black bars) or PBS (white bars). Total TA area and percent fibrosis were calculated using Bonferroni post-test with two-way

ANOVA on ranks for nonparametric data. Unpaired t-test with Welch’s correction was used between two groups and the Kruskal-Wallis test was used between multiple groups and for the number of fibers. *p<0.05, ***p<0.001. For each treatment group day 10B; n=6, and day 28B; n=3 mice.

Supplemental Figure S1: Laminin-111 treatment decreased fibrosis after

CTX damage. A: TA muscle treated with PBS (A-C) or laminin-111 (D-F), before CTX (A & D) and 4 days (B & E) and 10 days (C & F) after CTX, were stained with Sirius red. Red area considered fibrosis indicated with white arrows.

In addition to decreased fibrosis muscle tissues treated with laminin-111 showed less atrophic fibers, tighter muscle fiber junctions, less fatty infiltrate, and more uniform size of muscle fibers. n=4 mice, n=6 mice for day 10B and n=3 mice in each treatment group.

100

Supplemental Figure S2: Laminin-111 treatment improves mobility of dyW-/- mice after CTX injury. Movie showing untreated dyW-/- mouse and wild-type littermate. Movie showing a dyW-/- mouse treated once with either laminin-111 or

PBS IM and injured 3 days later with CTX. This mouse was part of the day 10 post CTX group. The dyW-/- mouse was able to use its left leg (treated with laminin-111) more than its right leg (treated with PBS).

Human Molecular Genetics website: hmg.oxfordjournals.org.

101

Reprinted from Human Molecular Genetics, 2014, Vol. 23, No. 2 383–396

DOI:10.1093/hmg/ddt428

102

Chapter 3

Galectin-1 protein therapy improves muscle pathology and function in

the mdx mouse model of Duchenne muscular dystrophy

103

ABSTRACT

Duchenne Muscular Dystrophy (DMD) is a fatal neuromuscular disease caused by mutations in the dystrophin gene, leading to the loss of a central component of the sarcolemmal dystrophin glycoprotein complex (DGC). Galectin-

1 is a small 14kDa protein normally found in skeletal muscle and has been shown to be a modifier of immune response, muscle repair and apoptosis.

Recently Galectin-1 was shown to be increased in the muscle of mouse and dog models of DMD. Together these results led us to hypothesize that Galectin-1 may serve as a modifier of disease progression in DMD. To test this hypothesis, recombinant mouse Galectin-1 (rMsGal-1) was produced and used to treat myogenic cells and the mdx mouse model of DMD. Galectin-1 treated mdx mice had reduced muscle pathology and improved muscle function. Further, we show these improvements were mediated in increased levels of utrophin and α7β1 integrin to maintain sarcolemmal integrity. Together our results demonstrate for the first time that Galectin-1 is an exciting new protein therapeutic for the treatment of DMD.

104

Significance Statement

Duchenne Muscular Dystrophy (DMD) is a devastating neuromuscular disease that currently has no cure. The average life expectancy for boys born with DMD is ~25 years of age. Palliative measures are the only treatment options available for patients. Galectin-1 is a small protein naturally found in skeletal muscle, known to be involved in muscle repair and inflammation. Systemic

Galectin-1 treatment in a mouse model for DMD resulted in increased activity, strength, weight, and decreased spinal deformation. The improvements in muscle phenotype were mediated by increases in protein complexes that stabilize the muscle cell membrane. Together these results provide evidence that

Galectin-1 may represent a powerful novel therapeutic for DMD and other forms of muscular dystrophy.

105

INTRODUCTION

Duchenne muscular dystrophy (DMD) is a common X-linked muscular dystrophy affecting 1 in 3,500 male births. DMD patients suffer from severe, progressive muscle wasting with clinical symptoms first detected from 2 to 5 years of age. As the disease progresses patients are confined to a wheelchair in their teens and die in their early twenties from cardiopulmonary failure. DMD patients and mdx mice (the mouse model for DMD) have mutations in the gene encoding dystrophin. These mutations result in the absence of dystrophin, a

427kDa cytoskeletal protein located under the sarcolemma of muscle fibers

(291). Through the N-terminal region, dystrophin interacts with F-actin of the cell cytoskeleton (292). The C-terminal region of dystrophin interacts with a transmembrane protein complex composed of α- and β-dystroglycans, dystrobrevins, α- and β-syntrophins and sarcoglycans (293). The absence of dystrophin results in a pronounced decrease in dystrophin-associated proteins in the skeletal muscle of DMD patients and mdx mice (19). In DMD patients, the compromised dystrophin linkage system causes muscle fibers to detach from the laminin rich basal lamina during muscle contraction leading to progressive loss of muscle integrity and function (291).

Galectin-1 is a small 14kDa non-glycosylated protein encoded by the LGALS1 gene. Galectin-1 is expressed by many different tissues with concentration dependent monomeric and homodimeric structures determining glycoside

106 binding affinities. Although Galectin-1 binding dynamics are complex, the native dimeric form has been shown to preferentially bind immobilized extended glycans

(294). This binding has been shown to induce diverse physiological activities including cell migration, cell growth, angiogenesis, and immune tolerance (295).

In skeletal muscle, Galectin-1 plays a role in the conversion of dermal fibroblasts to myogenic cells during muscle repair (296). It also directly interacts with both laminin and the α7β1 integrin to modulate myoblast fusion during muscle repair

(297, 298). Together, the activities of Galectin-1 in skeletal muscle make it an intriguing protein therapeutic candidate for the treatment of DMD patients.

In this study, we assessed the therapeutic potential of Galectin-1 treatment in dystrophin deficient mdx mouse model of DMD. We show that recombinant mouse Galectin-1 (rMsGal-1) protein can be delivered systemically and treatment improved activity and muscle strength in mdx mice. Mice treated with rMsGal-1 exhibited reduced skeletal muscle pathology and kyphosis. Further, we show rMsGal-1 treatments led to elevated levels of two integral sarcolemmal complexes for dystrophin deficient skeletal muscle; the utrophin glycoprotein complex (UGC) and α7β1 integrin. Together, our preclinical data indicates that

Galectin-1 protein has exciting therapeutic potential for the treatment of DMD.

MATERIALS AND METHODS

Recombinant Mouse Galectin-1 Production

107

The mouse Galectin-1 cDNA was produced using reverse transcriptase

(Superscript III, Invitrogen) from mouse muscle total RNA (Trizol, Invitrogen) followed by PCR using Platinum Taq Supermix (Invitrogen). This PCR product was then subcloned into the pGEM T-Easy vector, sequenced, compared to

NCBI database sequence, and finally cloned into the pET23b vector (EMD

Millipore) in frame with the 6x His-Tag. This vector was then transfected into

Rosetta E.coli (EMD Millipore), grown and induced with 0.4 mM IPTG (Invitrogen) to express mGalectin-1. Galectin-1 was then purified as described in the pet vector handbook using the cobalt Talon Metal Affinity Resin (Clontech 635502).

Tissue Culture

C2C12 myoblasts and myotubes were grown as previously described

(214) α7 integrin β-gal +/- myoblasts were originally isolated and maintained as described (214). Human DMD myoblast and myotubes were originally isolated and maintained as described (299).

Recombinant mouse Galectin-1 in vitro Treatment

C2C12 and human DMD myoblasts were treated with various amounts of recombinant mouse Galectin-1 (rMsGal-1) for 48 and prepared as previously described (214).

108

Mouse maintenance and treatments

All mdx and C57BL10 (WT) mouse housing and experiments were performed under an approved protocol from the University of Nevada, Reno

Institutional Animal Care and Use Committee under guidelines set forth by NIH.

Intraperitoneal (IP) treatments were started at 10 days of age and given weekly with either 20mg/kg/weekly rMsGal-1 or with corresponding volume of PBS as controls.

ELISA

Mouse Galectin-1 DuoSet ELISA development kit (R & D Systems) was used to determine the levels of mGalectin-1 in serum of mdx and C57/BL10 (WT) mice following manufacturer’s directions. Half-life was determined using

GraphPad Prism 5 software non-linear curve fit one phase decay with the plateau constrained at 394 (pg/mL average non-injected). As mGalectin-1 concentration peaked at 2 hours; only points at or beyond 2 hours were used to determine curve.

Physiological assays

Mouse grip strength was determined using a SDI Grip Strength System and a Chatillon Digital Force Gauge tensometer as described in SI and (215).

109

Functional parameters were assessed using the Opto-Varimex-4 System with

Auto-track v4.96 software for a 30 minute time period (Columbus Instruments).

Mouse digital radiography

Digital radiography was performed on 10 week old mdx mice using a

Sound-eklin tru/Digital radiography machine. Spinal curvature was assessed using the Kyphotic Index (KI) measurement as described in (300). Measurements from the radiographs were taken using both the Sound-eklin eSeries software (to draw 90̊ angles, lines and scale bars) and Image J software to convert measurements to micrometers.

Histology and Immunohistochemistry

Tissues were prepared for histological and immunofluorescence as previously described (42) for detailed description refer to SI Material and

Methods. Pictures of an entire TA muscle were taken at 100x using a Zeiss

Axioskop 2 Plus fluorescent microscope, Zeiss AxioCam HRc digital camera, and

Axiovision 4.8 software or an Olympus FluoviewFV1000 Laser scanning biological confocal microscope using the Olympus micro FV10-ASW 3.1 software. Compiled images were used to reconstruct a view of the entire TA muscle. This compilation was used for calculating CLN, number of fibers and minimum Feret’s diameter. There was a minimum of n=3 mice for each treatment

110 group and n>6,200 fibers counted. IP treated H&E slides were used for qualitative assessment of treated tissue. Antibodies used for immunofluorescence and conditions are given in SI Material and Methods.

Western Blotting

Protein concentrations from myoblast, myotubes, mouse TA tissue were isolated and extracted as previously described (216). Protein was quantified and analyzed as previously described (253). The source and conditions of antibodies used are listed in SI Material and Methods. Band intensities for all antibodies were determined using ImageJ software and normalized to bands visualized using either Swift Membrane Stain, Ponceau S, α-tubulin or GAPDH (as indicated on graphs).

Statistical analysis

All statistical analysis was performed using GraphPad Prism 5 software.

Averaged data are reported as the mean ± the standard error of the mean (SEM).

Individually reported data points were reported at mean ± standard deviation.

Comparison for two groups was performed using a Student’s t-test and between multiple groups using one-way ANOVA of variance with Bonferroni post-test.

P<0.05 was considered statistically significant.

111

RESULTS

Production of recombinant mouse Galectin-1

Since Galectin-1 has been shown to be up-regulated in the skeletal muscle preclinical model of DMD (301), we hypothesized that it may serve as a modifier of disease progression in DMD. Recombinant mouse Galectin-1

(rMsGal1) was made with a C-terminal 6x Histidine tag for purification purposes using the pET23b vector (Fig 1A).

Intramuscular injections of rMsGal-1 reduces muscle pathology in mdx mice

As an initial assessment of the efficacy of rMsGal-1 on skeletal muscle we performed intramuscular (IM) injections in the tibialis anterior (TA) of mdx mice.

Ten day old mdx mice were injected with 1.5µg (n=4) or 150µg (n=3) rMsGal-1 in one TA and a corresponding volume of PBS in the contralateral TA. Muscle tissues were collected between 5 weeks of age, cryosectioned and analyzed for centrally located nuclei (CLN) by Hematoxylin and Eosin (H&E) staining. CLN is an indicator of previous muscle damage and repair in mdx muscle. Although no significant difference was observed with rMsGal-1 treatment of 1.5µg relative to the PBS treated control, a significant reduction in fibers containing CLN was observed using 150µg (~16% reduction) rMsGal-1 treatment (Fig. S1). These

112 data suggests that Galectin-1 acts in a dose-dependent fashion to improve myofiber integrity and prevent muscle damage in the mdx mouse model of DMD.

Galectin-1 increases utrophin and α7β1 integrin protein complexes in mouse and DMD myogenic cells

Since Galectin-1 has been implicated in muscle cell repair, we hypothesized that the decreased CLN observed in rMsGal-1 treated mdx mice might be due to enhanced sarcolemmal stability and levels of either the utrophin glycoprotein complex (UGC) or α7β1 integrin protein complexes. To investigate whether rMsGal-1 treatment altered the levels of these sarcolemmal protein complexes, we treated C2C12 myoblasts and myotubes using increasing concentrations of rMsGal-1. After a 48 hour treatment with 20μM rMsGal-1, western blot analysis of C2C12 myoblasts and myotubes displayed a 1.7-fold increase in α7B (Fig. S2A & B, n=3). C2C12 myotubes also displayed an increase in β-DG at concentrations above 2μM of rMsGal-1 (Fig. S2D, n=3).

Finally, a dramatic increase in β1D integrin levels observed with rMsGal-1 concentrations above 100nM (9.6-fold; 20μM) in C2C12 myotubes relative to

PBS-treated controls (Fig. S2C).

Next, we assessed the effects of rMsGal-1 treatments on the sarcolemmal proteins in human DMD (hDMD) myoblasts and myotubes using western blot analysis. In hDMD myoblasts treated with 4.8μM rMsGal-1 we found a 2.3-fold

113 increase in α7B Integrin and 1.6-fold increase in β-DG relative to PBS treatments alone (Fig. S3B & E). However, protein levels of β1A integrin and α-DG were not significantly altered in hDMD myoblasts compared to PBS (Fig. S3C & D). A

0.8µM rMsGal-1 treatment of hDMD myotubes led to elevated levels of α7B

Integrin (1.6-fold) α7A integrin (5.6-fold) and β1D Integrin (1.8-fold) relative to

PBS (Fig. 1D, quantitated and graphed in 1E-G). A slightly higher treatment of 4

µM rMsGal-1 was needed to increase the levels of β-DG (1.4-fold) relative to

PBS treated controls (Fig. 1D, quantitated in 1H). Together, these in vitro experiments show that rMsGal-1 treatment leads to the stabilization and/or elevation of α7β1 integrin and utrophin protein complexes in skeletal muscle.

rMsGal-1 protein demonstrates a pharmacokinetic and pharmacodynamic profile in mdx mice that supports systemic delivery for the treatment of

DMD

Since Galectin-1 is a small 14kDa protein, we predicted intraperitoneal

(IP) injections would be an effective delivery method and ensure bioavailability of the rMsGal-1 to skeletal muscle of mdx mice. We began by evaluating mdx mouse serum pharmacokinetics (PK) of the rMsGal-1 after a single 20mg/kg IP injection (n>3/time point). ELISA was used to assess total mGalectin-1 serum levels prior to injection and 10 time-points between at 0.5 to 26 hours post- treatment (Fig. 2A). Maximum mGalectin-1 levels were not observed until ~2

114 hours post-injection, suggesting a slow uptake into serum when delivered by IP.

Serum clearance was determined from the maximum at two hours onward. From this clearance data we determined a serum half-life (t1/2) for galectin-1 to be 1.07 hours (Fig. 2A). This study suggests that rMsGal-1 can be effectively administered systemically into the mdx mouse.

Next, the skeletal muscle level of total mGalectin-1 was examined in mdx mice treated weekly from 10 to 70 days of age with 20mg/kg rMsGal-1 or PBS.

Total mGalectin-1 levels in the tibialis anterior (TA) were assessed by western blot analysis and displayed a 1.4-fold increase in mGalectin-1 levels in rMsGal-1 treated mice (Fig 2B). As the final injection had occurred approximately 7 days prior to sacrifice, we believe this represents the minimum level of total mGalectin-

1 elevation in skeletal muscle using this treatment regime. Immunofluorescence using an anti-mGalectin-1 antibody on TA cryosections confirmed increased total

Galectin-1 levels with rMsGal-1 treatments. The mGalectin-1 was localized mainly to the extracellular matrix (ECM) in the rMsGal-1 treated skeletal muscle

(Fig. 2C), a pattern of localization also observed in non-treated WT TA sections

(Fig. 2C). Together, these data confirm increased total mGalectin-1 levels in the skeletal muscle of rMsGal-1 treated mdx mice relative to PBS treated controls.

Tissue distribution of the systemically delivered rMsGal-1 protein was assessed using an anti-His tag antibody and immunofluorescence. The presence of rMsGal-1 was determined using cryosections of the brain, diaphragm, heart,

115 liver, kidney, gastrocnemius, and TA (Fig. 2D). The protein therapeutic was observed in all skeletal muscles probed (diaphragm, TA, and gastrocnemius) of rMsGal-1 treated mice and was appropriately localized to the ECM (Fig. 2D). We also observed rMsGal-1 localization in hippocampal region of the brain and slightly elevated levels in the liver (Fig 2D). This suggests that rMsGal-1 crosses the blood-brain barrier and may have potential therapeutic value for the alleviation of cognitive deficiencies associated with DMD. We did not observe presence of rMsGal-1 localization in the heart or kidney of treated mdx mice (Fig

2D). Together, these data show that can be systemically delivered to the skeletal muscle and central nervous system tissue affected in DMD.

rMsGal-1 treatment improves activity levels and functional strength of mdx mice

In order to assess the effect of rMsGal-1 treatments on the pathology of mdx mice, treatments of either 20 mg/kg/week (n=8) or an identical volume of

PBS (n=5) were administered systemically by weekly IP injections beginning at

10 days of age. As functional strength and activity levels are the most critical measurable outcomes for DMD patients (302), individual mouse weight, activity, and grip strength data was collected at 10 weeks of age after which mice were sacrificed and tissues collected. Non-treated wild-type C57BL10 (n=27) mice were included in all functional studies in order to compare our treatment to

116 normal activity and strength levels. Activity levels were measured using an Opto-

Varimex-4 system for 30 minutes and functional grip strength was assessed by tensometer. The rMsGal-1 treated mdx mice displayed a significant increase in distance traveled (Fig. 3A), large ambulatory time (Fig. 3C), vertical sensor breaks (stand-ups) (Fig. 3D), and strength (Fig 3E). Conversely, there was a decrease in the overall resting (non-active) time of rMsGal-1 treated animals compared to PBS treated mice (Fig. 3B). Mice treated with rMsGal-1 showed increased body mass over PBS controls, matching the WT weight gain pattern, and was significantly increased between 5-6 weeks of age (Fig. 3F). Together, these data show that the rMsGal-1 protein treatment led to functional improvements in activity and muscle strength at 10-weeks of age in mdx mice.

rMsGal-1 prevents kyphosis in mdx mice

Dystrophic patients and mdx mice have spinal curvature abnormalities which correlate to disease progression (300, 303). In order to determine if treatment with rMsGal-1 improved kyphosis relative to controls, left lateral radiographs were taken for rMsGal-1 (n=8) and PBS (n=5) treated mdx mice at

10 weeks of age (Fig. 4A). Spinal curvature was assessed using the Kyphotic

Index (KI) measurement following previously described procedures (300). A significant increase in KI was observed in rMsGal-1 (4.44) treated mdx mice compared to PBS (3.59) controls (Fig. 4B), where a higher KI number is

117 indicative of decreased kyphosis. Although previous studies have not been examined mice as young as 10 weeks, a KI of ~4.4 was maintained by WT C57-

BL10 control mice from 4 to 18 months of age (300). These data suggests that the rMsGal-1 treated mdx mice maintained their paraspinal muscle strength and spinal curvature through 10-weeks of age.

Improved skeletal muscle pathology in mdx mice treated with rMsGal-1 protein.

Next we wanted to confirm that the physiologic effects observed in the mdx mice treated with 20 mg/kg/week rMsGal-1 were a result of improvements to skeletal muscle integrity. The TA muscles from untreated C57-BL10 and mdx mice treated with either rMsGal-1 or PBS analyzed for the presence of CLN (Fig.

5A). Fibrosis and inflammation for the TA tissues were observed using the H&E stained sections, with only minor differences between mdx treatment groups (Fig.

5A). This is not surprising, as 10 week old mdx skeletal muscle does not typically present with significant fibrosis or inflammation. Regeneration of the muscle fibers was assessed by examining the percentage of CLN (Fig. 5A). A significant

2-fold decrease in CLN percentage was observed in the rMsGal-1 treated mdx

TA muscle (22.7 %) compared to those treated with PBS (45.9 %, WT 0.7 %, Fig.

5B). To examine the extent of sarcolemmal integrity at the time of sacrifice,

Evans blue (EBD) positive fibers were counted and expressed as a percentage

118 of total number of fibers in an entire TA section. We found a ~2-fold decrease in the percentage of myofibers with EBD uptake with rMsGal-1 (15.0%) treatment compared to PBS (28.4%) treated animals (Fig. 5C; WT 3.0%). Finally, the minimum Feret’s diameter was used to assess hypertrophy in the mdx treatment groups. We found the average fiber diameter for the rMsGal-1 (34.6m) treated mdx mice was only slightly lower than PBS-treated animal (35.2m) (Fig. S4).

However, mice treated with rMsGal-1 had the greatest percentage of fibers in the

21-30μm range (Fig. 5D) and suggests a more normal distribution of fiber size was observed in the rMsGal-1 treated mdx mice compared to controls. These data indicates that rMsGal-1 treatment improves the stability and decreased hypertrophy of muscle fibers.

Dystrophic mice treated with rMsGal-1 have increased UGC and α7β1 integrin complexes in skeletal muscle

To investigate the mechanism underlying the improvements in mdx mice we examined if rMsGal-1 increased sarcolemmal stabilizing complexes in skeletal muscle. Western analysis was used to quantify α- and β-dystroglycan

(DG), α7A and α7B integrin, utrophin (Utr), α- β-, δ- and ε-sarcoglycans (SG), sarcospan (SSPN), and β1D integrin (Fig. 6A). The rMsGal-1 treatment led to an average protein increase in α- and β-dystroglycans (DG) and α7A and α7B integrin of 1.4, 1.7, 1.4, and 1.6-fold respectively (Fig. 6C, 6G, 6I & 6J). rMsGal-1

119 treatment led to elevated utrophin, SGs (α-, β-, δ- and ε-SGs), SSPN, and β1D integrin protein of 3.0, 2.7, 5.4, 2.5, 3.6, 4.4 and 3.1-fold respectively (Fig. 6B,

6E, 6H, 6K, 6F, 6L & 6D). While it is unclear whether these elevated proteins are a result of protein/complex stabilization or altered signaling leading to transcriptional activation, the fact that UCG and α7β1 integrin receptor complexes are increased with rMsGal-1 treatments suggest sarcolemmal stabilization is a contributing factor in the mechanism action.

Increased sarcolemmal localization of UGC and α7β1 integrin complexes in mdx muscle treated with rMsGal-1

To determine whether the increased levels of the UGC and α7β1 integrin complexes were localized to the sarcolemma, immunofluorescence (IF) of key members of these protein complexes was performed. Results show increased sarcolemmal localization of utrophin (Fig. 6M & N), α-DG (Fig. 6O & P), β-DG

(Fig. 6Q & R), α7 integrin (Fig. 6S & T), α-SG (Fig. 6U &V), β-SG (Fig. 6W & X),

β1D integrin (Fig. 6Y & Z) in rMsGal-1 treated mdx mice compared to PBS treated animals. This study confirms that rMsGal-1 treatment of mdx mice leads to increased sarcolemma localization of the UGC and α7β1 integrin protein complexes in mdx mice.

120

DISCUSSION

Duchenne muscular dystrophy is a fatal neuromuscular disease for which there is currently no cure and limited treatment options (304). Current treatments for DMD involve the daily use of glucocorticoids (prednisone or deflazacort) which have only transient benefits by improving muscle strength. However, high dose, long-term steroid treatment is associated with numerous negative side effects (140). Several novel approaches are being developed for the treatment of

DMD including gene replacement, exon skipping, gene repair and use of embryonic and adult muscle stem cells (134, 138, 146). These approaches face challenges including the large size of the dystrophin gene, immune response, efficient stem cell engraftment and feasibility in treating all muscles affected in

DMD. Targeting disease modifiers including Utrophin, GalNac, Biglycan and

α7β1 integrin have shown promise as potential therapeutics for DMD (40, 229,

305).

Biologics are an exciting new therapeutic area for DMD. Recently protein therapy using TAT-utrophin, biglycan, MG53 and laminin-111 have shown efficacy in DMD preclinical models (230, 242). In this study, we have identified

Galectin-1 as a novel protein therapeutic for DMD. Galectin-1 is a non- glycosylated 14kDa protein which can be produced and purified in large quantities using a bacterial expression system. In the mouse, pharmacokinetic analysis showed that serum levels of mGalectin-1 after systemic IP delivery of

121 rMsGal-1 peaked at 2 hours and that the serum half-life was approximately 1 hour. Immunofluorescence revealed mGalectin-1 is expressed in the muscle with higher levels near blood vessels. These results suggest that in the mouse,

Galectin-1 is rapidly cleared from the serum compartment of mdx mice and translocates across from blood vessels to the basal lamina where it accumulates within the muscle extracellular matrix. Our results show Galectin-1 can be delivered systemically to all major skeletal muscles affected in DMD.

Galectin-1 has been previously reported to regulate myogenic fusion

(306). Galectin-1 competes for laminin-binding on myogenic cells and promotes fusion of myoblasts (306). In this study we show that rMsGal-1 treated mice exhibit reduced percentage of myofibers containing centrally located nuclei and

Evans blue dye indicating the action of Galectin-1 was to protect muscle from further damage. Given its known role in muscle repair, it is possible the presence of exogenous Galectin-1 would promote more efficient myogenic fusion although this is unclear from the current study.

Our results indicate Galectin-1 protein therapy protects the sarcolemma of dystrophin-deficient muscle from progressive damage. The percentage of Evans blue positive myofibers were significantly lower in Galectin-1 treated mdx mice compared to animals treated with PBS. Utrophin and α7β1 integrin are protein complexes known as DMD disease modifiers and these complexes act in part through sarcolemmal stabilization. Studies have shown sarcospan, a component

122 of the UGC and DGC, can act to link utrophin and α7β1 integrin complexes in skeletal muscle (116). We show that Galectin-1 acts to increase levels of both utrophin and α7β1 integrin complexes in mdx mice. In addition, we observed increased sarcospan levels in Galectin-1 treated mdx mice suggesting treatment promotes a sarcospan mediated formation of α7β1 and utrophin macromolecular complexes that would act to protect myofibers from contraction induced muscle injury and prevent progressive muscle disease.

Investigations of novel therapies should use health related quality of life

(HrQOL) measures to determine the efficacy of potential DMD therapeutics (307,

308). For patients in the ambulatory stage of DMD, the primary goal reported to healthcare providers is to maintain ambulation for as long as possible (43, 137,

309). The 6 Minute Walking Distance (6MWD) is considered one of the most relevant endpoint measures for ambulatory DMD patients and has a strong correlation to self-reported HrQOL (307). In this study we show that Galectin-1 protein therapy improved the activity of mdx mice compared to PBS treatment.

This included increased distance traveled and ambulatory time. Galectin-1 treatment was shown to improve overall muscle strength to wild-type levels compared to PBS treated animals. Together, these data indicate Galectin-1 treatment may have a positive impact on the HrQOL measures that include maintaining muscle strength and ambulation in DMD patients.

123

Spinal deformity or kyphosis is a major clinical problem for DMD patients which is caused by degeneration of the musculature supporting the vertebral column (300, 303). Severe kyphosis in DMD patients can cause chest compression limiting respiratory function as well as reducing patient mobility often resulting in wheelchair confinement (303). Loss in respiratory function due to severe kyphosis in DMD patients is thought to be caused by reduced lung and chest wall compliance that restricts diaphragm and ribcage activity (310).

Progressive and severe kyphosis is therefore a major contributing factor to the increased morbidity due to respiratory dysfunction observed in DMD patients

(310). The mdx mouse also exhibits progressive spinal deformity which can be measured using X-ray imaging (300). In our study we show that Galectin-1 treated mdx mice exhibited an improved kyphotic index compared to PBS mice.

These results indicate Galectin-1 treatment slows progressive spinal deformity in the mdx mouse model which may improve respiratory outcome measures for

DMD patients.

DMD patients exhibit changes in the CNS as a result of loss of dystrophin

(304). These include neuronal loss, neurofibrillary tangles and changes in the blood-brain barrier. Recent studies show prednisone treatments are able to alleviate blood-brain barrier fragility in mdx mice (311). Our results show rMsGal-

1 could be detected in the brain of mdx mice after treatment indicating the exogenous protein was able to cross from the blood compartment into the brain

124 parenchyma. Although these studies did not examine if the presence of rMsGal-1 in the brain improved CNS preclinical outcomes, the presence of rMsGal-1 may help re-establish components of the dystrophin-associated protein complex and restore pathways involved in CNS function.

In this study we have identified galectin-1 as a novel small protein therapeutic for the treatment of DMD. There are still numerous questions that remain to be answered concerning the therapeutic potential of Galectin-1: (1)

Can recombinant Galectin-1 protein therapy prevent cardiomyopathy associated with DMD disease? (2) Will long term Galectin-1 protein therapy prevent DMD muscle disease? (3) Will Galectin-1 be effective after disease onset? (4) Can recombinant Galectin-1 manufacturing be scaled up to treat DMD patients? (5)

Can Galectin-1 improve muscle repair and engraftment of myogenic cells? (6)

Can Galectin-1 improve CNS function in DMD patients? Although future research is needed to elucidate these questions, this study indicates Galectin-1 may represent a powerful novel therapeutic for DMD and may have applications to other muscle diseases including merosin deficient congenital muscular dystrophy, Fukuyama muscular dystrophy or collagen VI muscular dystrophy.

SUPPLEMENTAL INFORMATION MATERIALS AND METHODS

Production of recombinant mouse Galectin-1

125

The purified rMsGal-1 protein was dialyzed into PBS to prepare for therapeutic treatment of myogenic cells and mice. Purity was assessed by running samples on SDS-PAGE gels and staining with Ponceau S (Fig. 1B) and rMsGal-1 identity confirmed by western blotting (Fig. 1C). This method of rMsGal-1 production and purification resulted in a protein with an estimated purity of >95% (Fig. 1B & C).

Tissue Culture

C2C12 myoblasts were grown and maintained in DMEM without phenol red (GIBCO, Grand Island, NY), 20% FBS (Atlanta Biologicals, Lawrenceville,

GA), 0.5% chick-embryo extract (CEE, Seralab, West Sussex, UK), 1% L- glutamine (GIBCO, Grand Island, NY) and 1% penicillin/streptomycin (PS)

(GIBCO, Grand Island, NY). All myoblasts were maintained below 70% confluence until use in assay. C2C12 myoblasts were differentiated into myotubes in DMEM without phenol red (GIBCO, Grand Island, NY), 1% horse- serum, and 1% Penicillin/Streptomycin (P/S) + L-Glutamine. All cells were maintained in Heracell 150i tissue culture (Thermo Scientific) incubators at 37ºC with 5% CO2.

Mouse maintenance and treatments

126

Genotype of mdx mice were verified as described (312) or by dystrophin immunofluorescence on all mdx mice. Between 1.5µg-150µg of Galectin-1 was delivered into the left mouse tibialis anterior (TA) muscle by intramuscular (IM) injection with an equal volume of PBS delivered to the right at 10 days of age.

Mice were then sacrificed at 4-5 weeks of age and the TA muscles were removed for use in other experiments.

Physiological assays

Grip strengths were performed six times with 30 second rest periods between pulls with the investigator blinded to treatment groups. This assay was repeated for three consecutive days; pulls were averaged and normalized to body weight. The three highest measurements were averaged to determine strength per gram of body weight.

Histology and Immunohistochemistry

Using a Leica CM1850 cryostat 10-μm sections of Tissue-TEK Optimal cutting Temperature compound (Sakura Finetek USA Inc.) embedded TA muscles from mice were placed on Surgipath microscope slides (Surgipath Medical

Industries). Hemotoxylin and eosin (H&E) staining and CLN was performed on IM treated mice as previously described (214) and images were taken using an

127

Olympus Fluoview FV1000 Laser Confocal Microscope. Muscle sections from IP injected mice were post stained with Evans blue dye (EBD, Sigma) and Oregon

Green-488 labeled wheat germ agglutinin conjugates (WGA, W6748, 1:250,

Molecular Probes, Invitrogen detection technologies).

For immunofluorescence assessment sections were placed on pre- cleaned Surgipath slides (Surgipath Medical Industries, Richmond, IL) and fixed using methanol, acetone, 4% paraformaldehyde (PFA) and/or 4% formaldehyde.

The Mouse on Mouse (M.O.M.) kit was used with all mouse antibodies according to the package instructions (FMK-2201, Vector Laboratories). Mouse primary antibodies were applied overnight followed by a fluorescein isothiocyanate

(FITC)-conjugated rabbit-anti-mouse-IgG secondary antibody (1:5000; Li-Cor

Biosciences). All other sections were blocked in 5% bovine serum albumin (BSA,

Fisher Scientific) and allowed to incubate overnight at 4ºC. Antibodies were diluted in 1% BSA, except α7 integrin (CA5.5) which was applied for 1 hour at room temperature. The following primary antibodies were used: FITC-α7 (CA5.5,

1:1000, Sierra Biosource), Galectin-1 (LGALS, Aviva System Biology 1:500), 6x

His-Tag (Thermo Scientific, 1:25), β1D integrin (1900 Millipore, 1:40), α- dystroglycan (IIH6 4C, 1:25, DSHB), β-dystroglycan H-242 (sc-28535, 1:25), α- sarcoglycan, (IVD3(1) A9 c, DSHB,1:100), β-sarcoglycan H-98 (sc-28279, 1:25),

γ-sarcoglycan Z-24 (sc-133984, 1:20), δ-sarcoglycan H-55 (sc-28281, 1:20), ε- sarcoglycan H-67 (sc-28282, 1:50, all sc antibodies are from SantaCruz

128

Biotechnology), sarcospan (gift from Rachelle H. Crosbie-Waston from UCLA,

1:25), dystrophin (MANDRA1 7A10,1:50, DSHB) and utrophin (MANCHO3 8A4;

1:50; DSHB). Secondary antibodies were applied for 1 hour followed by a FITC- conjugated anti-rabbit-IgG (1:5000; Li-Cor Biosciences). All immunofluorescence experiments were performed with secondary only antibody controls in order to test auto-fluorescence. Slides were mounted using Vectashield Hard Set with

DAPI (Vector Laboratories Inc., Burlingame, CA).

Images were captured using a Zeiss Axioskop 2 Plus fluorescent microscope, Zeiss AxioCam HRc digital camera, and Axiovision 4.8 software or an Olympus FluoviewFV1000 Laser scanning biological confocal microscope using the Olympus micro FV10-ASW 3.1 software.

Western Blotting

Immunoblots were probed using the following rabbit or goat polyclonal or mouse monoclonal antibodies: α7A Integrin (313) , α7B Integrin (313), Galectin-

1 (LGALS, Aviva System Biology 1:500), β1D integrin (Rooney et al., 2012) , α- dystroglycan (IIH6 C4, 1:50, DSHB), glyceraldehyde 3-phosphatae dehydrogenase (GAPDH V-18, sc-20357, 1:200), β-dystroglycan H-242 (sc-

28535, 1:200), α-sarcoglycan, (IVD3(1) A9 c, DSHB,1:100), β-sarcoglycan H-98

(sc-28279, 1:200), γ-sarcoglycan Z-24 (sc-133984, 1:100), δ-sarcoglycan H-55

(sc-28281, 1:100), ε-sarcoglycan H-67 (sc-28282, 1:100, all sc antibodies are

129 from SantaCruz Biotechnology), sarcospan (gift from Rachelle H. Crosbie-

Waston from UCLA, 1:5), dystrophin (MANDRA1,1:50, DSHB), utrophin

(MANCHO3, 1:50, DSHB), and α-tubulin. (DM1A, ab7291, Abnova, 1:500).

Primary antibodies were detected using Alexa Fluor 680 goat anti-rabbit IgG,

Alexa Fluor 800 donkey anti-rabbit IgG, Alexa Fluor 800 goat anti-mouse-IgG,

Alexa Fluor 800 or 680 donkey anti-goat-IgG (1:5000, Li-Cor Biosciences or

Molecular Probes, Invitrogen detection technologies) in 2.5% milk, 0.02 %

Sodium Azide solution for 1 hour. Prior to blocking a representative number of immunoblots were treated with Swift Membrane Stain (G. Biosciences) or

Ponceau S stain to normalize for sample loading.

130

131

Figure 1. Critical ECM proteins are increased in hDMD myotubes with rMsGal-1 treatment. rMsGal-1 was cloned into the pET23b vector (A). Purity of rMsGal-1 was determined by Ponceau S (B) and western blot analysis using a

LGALS-1 antibody (C). Human DMD (hDMD) myotubes were plated, differentiated for 5-7 days then treated with either phosphate buffered saline

(PBS=0), 0.8, or 4µM of rMsGal-1. Representative immunoblots show expression levels for α7B integrin, α7A integrin, β1D integrin and β-DG integrin. (D).

Quantification of immunoblots using imageJ software for α7B integrin (E), α7A integrin (F), β1D integrin (G) and β-DG integrin (G) are shown. Statistical analysis used was student t-test between treatment groups. (**p<0.01, *p<0.05. n=3 for each concentration and treatment group).

132

133

Figure 2. Increased Galectin-1 in serum and tissue of mice receiving systemic rMsGal-1 treatment. Pharmacokinetics of rMsGa-1 using serum taken from mdx mice at 0, 0.5, 1, 2, 2.5, 3, 4, 5, 6 and 24 hours after injection with either 20 mg/kg rMsGal-1 or PBS. n=7 for 0.5, 2 and 6 hours, n=4 for 1 hour and n=3 for 2.5, 3, 5 and 24 hours. For PBS treated mice n=3 for 0, 0.5, 1, 2, 4 and

24 hours (A). Immunoblot quantification of TA lystate from dystrophic muscle treated with PBS or 20 mg/kg/week with rMsGal-1 and probed with LGALS-1 antibody (B). High resolution confocal microscopic images using TA muscle of rMsGal-1 treated mice versus controls were immunostained with an anti-LGALS-

1 antibody (C). Immunofluorecence labeling using an anti-His-Tag verified rMsGal-1 was delivered systemically to the brain, diaphragm, liver, gastrocnemius and TA of mice receiving a 10 week treatment (D). Scale bar =

100μm. (*p<0.05 and **p<0.01).

134

Figure 3. Physiological improvement in activity, strength and weight observed in rMsGal-1 treated mdx mice. Activity levels of rMsGal-1 and PBS treated mdx mice and WT mice were measured for distance traveled (A), resting time (B), large ambulatory time (C) and vertical sensor breaks recorded (D).

There were improvements in all activity levels measured in rMsGal-1 treated mice with the greatest difference being a 2.2 fold increase in distance traveled

(A). For (A-D) n=5 for PBS mice, n=8 for rMsGal-1 mice and n=27 for WT mice.

Strength/gram of body weight was measured and found to be similar to WT mice. n=6 for PBS mice, n=4 for rMsGal-1 mice and n=19 for WT mice (E). Body weight of rMsGal-1 over PBS treated animals. n=5 for PBS mice, n=8 for rMsGal-

1 mice and n=14 for WT mice (F). (*p<0.05 and **p<0.01).

135

Figure 4. rMsGal-1 treatment prevents kyphosis in mdx mice. Left lateral radiographs taken at 10 weeks of age indicate an improved KI for rMsGal-1 treated mice. n=4 for PBS mice and n=8 for rMsGal-1 mice. (**p<0.01).

136

137

Figure 5. Reduced muscle pathology in mdx mice treated with rMsGal-1. TA muscle cryosections from mdx mice treated with PBS or rMsGal-1 and untreated

WT mice were stained with hematoxylin and eosin, immunostained with wheat germ agglutinin (WGA) or WGA and Evans blue dye (A). Subjects from each treatment group were analyzed for the presence of dystrophin to insure disease genotype (A, bottom). Centrally located nuclei (CLN), EBD and minimum Feret’s diameter analysis were performed using the same composite TA image. rMsGal-

1 treatment resulted in a decrease in CLN (PBS n=4, rMsGal-1 n=6, WT n=3 mice) (B). A post stain with EBD indicated a decrease in EBD positive fibers (C). rMsGal-1 treated mice had a minimum Feret’s Diameter percent myofiber curve which shifted left toward less hypertrophic myofibers (n=4 mice, n=6 mice and n=3 mice) (D). Scale bar=100μm. (*p<0.05, ***p<0.001, ***p<0.0001).

138

139

Figure 6. rMsGal-1 treated mdx mice have increased UGC and α7β1 integrin protein complexes localized to the sarcolemma in skeletal muscle.

Immunoblot analysis of α- and β-dystroglycans (DG), α7A and α7B integrin, utrophin (Utr), α- β-, δ- and ε-sarcoglycans (SG), sarcospan (SSPN), and β1D integrin. Representative example immunoblots are shown for each protein tested

(A). All immunoblots were quantified using Image J analysis software and were normalized as indicated on graphs. (*p<0.05, **p<0.01).

140

Supplemental Figure S1: rMsGal-1 delivered intramuscularly to dystrophin deficient muscle decreased Centrally Located Nuclei. Centrally Located

Nuclei (CLN) was assessed on H&E stained cryosections of mdx TAs receiving a one-time treatment PBS or rMsGal-1 treatment. A treatment of 150µg resulted in significant decreases in CLN. 1.5µg rMsGal-1 n=4 and for 150 µg rMsGal-1 n=3, contralateral legs were injected with PBS n=8. Statistical analysis used was

Student’s paired t-test *p<0.05.

141

142

Supplemental Figure S2: rMsGal-1 treatment enhanced levels of α7B and

β1D integrin in mouse skeletal. C2C12 myoblasts were plated and treated with either phosphate buffered saline (PBS) 0.1, 0.2, 2 or 20 µM of rMsGal-1. Cells were then lysed after 48 hours and assayed by immunoblot analysis for α7B integrin (A). C2C12 myotubes were differentiated for 3-5 days then treated, lysed after 48 hours and assayed by immunoblot analysis for α7B integrin (B), β1D integrin (C) and β-DG integrin (D). All protein levels of were normalized to α- tubulin. Statistical analysis used was two-way ANOVA and unpaired Student’s t- test to compare specific concentrations between treatments. n=3 for each concentration and treatment group. *p<0.05, **p<0.01.

143

144

Supplemental Figure S3: hDMD myoblast have increased levels of α7B integrin and β-DG with rMsGal-1 treatment. Human DMD (hDMD) myoblasts were plated and treated with either phosphate buffered saline (PBS=0) or a 48 hour treatment of 4.8 µM of rMsGal-1. Representative immunoblots show levels of expression for α7B integrin, β1A integrin, α and β-DG (A). Quantification of immunoblots using image j software for α7B integrin (B), β1A integrin (C), α-DG

(D) and β-DG integrin (E) are shown. All protein levels of were normalized to α- tubulin. n=2 for each treatment group.

145

Supplemental Figure S4. Myofibers in mdx mice treated with rMsGal-1 were less hypertrophic. TA muscle cryosections from mdx mice treated with

PBS or rMsGal-1 and untreated WT mice were immunostained with wheat germ agglutinin (WGA) and DAPI Centrally located nuclei (CLN), EBD and minimum

Feret’s diameter analysis were performed using the same composite TA image. rMsGal-1 treatment resulted in a decrease in CLN (PBS n=4, rMsGal-1 n=6, WT n=3 mice) There was a significant decrease in minimum Feret’s diameter over both PBS treated (PBS n=3 mice, rMsGal-1 n=6 mice and WT n=3 mice). Scale bar=100 μm. Statistical analysis used was unpaired Student’s t-test between two groups and one-way ANOVA test between groups with Bonferroni post-test.

*p<0.05, ***p<0.001, ***p<0.0001.

146

Chapter 4

The role of LARGE on α7 integrin glycosylation

147

ABSTRACT

Duchenne Muscular Dystrophy (DMD) is an X-linked severely degenerative neuromuscular disease. Boys affected with this disease will be wheelchair bound by 12 years of age and die by the third decade of life. DMD is caused by a lack of dystrophin which provides a link to cytoskeletal actin through the dystrophin glycoprotein complex (DGC) to extracellular matrix (ECM) proteins. Defects in any part of the DGC causes decreased sarcolemmal integrity and loss of ECM binding which results in severe damage to muscle cells. In skeletal and cardiac muscle, a second transmembrane laminin receptor α7β1 integrin is a glycoprotein which has been shown to alleviate disease in mouse models for DMD. Previous studies have shown that the α7β1 integrin was up regulated in response to the lack of functional α-dystroglycan (α-DG), a critical part of DGC in skeletal muscle. LARGE (like-N-acetyl glycosyltransferase), a protein glycosyltransferase, has been shown to mediate glycosylation of α-DG in vitro and in vivo, and can modulate protein structure and function. The pathways, mechanisms, and effect LARGE has on the glycosylation of α7β1 integrin and its effects on laminin binding through the α7β1 integrin are unknown. In this study we tested the hypothesis that LARGE glycosylates the α7β1 integrin in skeletal muscle. Our results show that overexpression of LARGE in C2C12 cells increased α7 integrin glycosylation and resulted in elevated levels of α7 integrin.

These results indicate that the α7β1 integrin is a target for LARGE-mediated

148 glycosylation and that drugs that target LARGE glycosylation may be therapeutic in the treatment of muscular dystrophy through elevated α7 integrin and α-DG levels.

149

INTRODUCTION

Duchenne Muscular Dystrophy (DMD) affects 1 in every 3,600 new born boys (43). Treatment options for this disease are limited to glucocorticoid such as prednisone and deflazacort (142, 145). There is no cure for this disease that affects nearly 20,000 children born annually worldwide (304, 314). Patients suffering with DMD have severe, degenerative muscle weakness followed by wheelchair confinement and cardiopulmonary failure (315). DMD patients and mdx mice have mutations in the dystrophin gene, resulting in the absence of the

427kDa protein (16, 40, 291, 316). Two-thirds of the mutations that cause DMD are due to intragenic deletions and/or duplications (7, 317)

Dystrophin, a key member of the dystrophin glycoprotein complex (DGC), is known to interact with F-actin through its N-terminus (292) and with syntrophins and β -dystroglycan (β-DG) via its C-terminus (318). Another member of the DGC is α-dystroglycan (α-DG), a peripheral membrane protein that is able to bind to several ECM proteins (319) in which glycan moieties comprise up to two-thirds of the molecular mass (18, 320). The DGC is found around myofibers in skeletal muscle and at myotendinous and neuromuscular junctions (19). In both mdx mice and in DMD patients there is a mis-regulation of the DGC resulting in decreased binding to ECM like laminin (321, 322). Loss of laminin binding decreases sarcolemma integrity, the cell’s ability to communicate

150 through interaction with the ECM and results in myofiber fragility and defects in myofiber repair mechanisms (293).

The α7β1 integrin is another laminin receptor found in skeletal and cardiac muscle (40). There are several splice variants of α7 integrin that are differentially expressed (35). The α7 integrin is expressed at myotendinous and neuromuscular junctions and around the sarcolemmal membrane (254). The

α7β1 integrin has been shown to be a major disease modifier (323). Embryonic loss of α7 integrin results in vascular defects and partial embryonic lethality in mice (254, 324). Loss of α7 integrin in mdx mice causes increased disease severity and premature death (41, 42). In humans, mutations in α7 integrin cause congenital myopathy (323, 325). Conversely, transgenic overexpression of α7 integrin will improve both histological markers of disease and lifespan in severely dystrophic mice (39, 40, 299).

The α7β1 integrin and α-DG are vital laminin transmembrane receptor proteins. The complementary functional role of α7β1 integrin to α-DG leads to the assumption that it may be glycosylated through the same or a similar glycosylation pathway. There are several genes that are purported to participate in the glycosylation of α-DG (326, 327). They are protein-O-mannosyltransferase

1 (POMT1), protein-O-mannosyltransferase 2 (POMT2), protein-O-manose beta-

1,2-N acetylglucosaminyltransferase (POMTGnt1), fukutin, fukutin related protein

(FKRP), and a like-N-acetylglucosaminyltransferase (LARGE, Fig. 1) (117, 266,

151

328, 329). β-1,3-N-acetylglucosaminyl-transferase Fukutin, FKRP and LARGE have been identified as putative Golgi glycosyltransferases (117, 266, 328, 329).

Unlike many of the other glycosyltransferases with only one catalytic domain,

LARGE is predicted to have two putative catalytic domains, one related to bacterial alpha glycosyltransferases and the second related to human β-1,3-N- acetylglucosaminyltransferase (258, 330).

LARGE has been shown to be vital to the binding activity of α-DG and the regulation, progression, and genesis of numerous disease states (331, 332). For example patients with insertion or deletions mutations in the LARGE gene have a form of congenital muscular dystrophy type 1D (MDC1D) (122). There are also several LARGE mutant mouse models that have helped to elucidate how LARGE confers functionality to α-DG (333). They are the LARGEmyd myodystrophy mouse, the LARGEenr enervated mouse and the LARGEvls mouse (333). Each model has differing mutations in the LARGE gene (333). The exact pattern, order and degree of glycan moieties add to α-DG is difficult to define because α-DG is highly glycosylated with a predicted molecular weight of 74kDa and an apparent weight between 120-156kDa (258). The central mucin domain of α-DG is known to have O-mannosyl and mucin-O glycans (258). There are also N-linked glycans binding to α-DG (258). Although there are several suggested glycosyltransferases involved in the glycosylation of α-DG, results by Brockington et al. have suggested that LARGE attaches its functional glycan to N-

152

Acetylglucosamine (GlcNAc) without dependence on initial structure (258) A phosphorylated O-mannosyl glycan on the mucin-like domain of α-DG is required for laminin binding (258, 328, 329, 334). Hypoglycosylated proteins, like α-DG are associated with dystroglycanopathies, and result in reduced binding to laminin. Overexpression of LARGE has been shown to not only correct mutations in the LARGE gene itself, but is also able to rescue mutations in POMT1,

POMT2, POMTGnt1, fukutin and FKRP mouse and patient cells (259, 260, 335,

336).

Hypoglycosylated α-DG proteins are unable to bind to β-DG, which in turn binds to dystrophin (334). This prevents correct assembly of DGC. The α7 integrin has five potential glycosylation sites (asparagine-X-ser/threonine), which are in the extracellular domain reported by UniPort (#Q61738, ITA7_MOUSE)

(35, 39, 40, 42, 214, 254, 324, 327, 337, 338). Four of these sites are proposed

N-linked β-N-acetylglycosamine (GalcNAc) glycosylation sites based on sequence data located at amino acids 86,784,988 and 1043 on the ITA7 gene

(UniPort: #Q61738, ITA7_MOUSE). The fifth site located at the amino acid 1023 has been experimentally verified using C2C12 cells (UniPort: #Q61738,

ITA7_MOUSE) (339). The mechanisms by which these sites are glycosylated are yet to be elucidated. In this study we tested the hypothesis that LARGE glycosylates α7 integrin in skeletal muscle. Our results show that overexpression of LARGE in C2C12 cells increased α7 integrin glycosylation and resulted in

153 elevated levels of α7 integrin transcript and protein. These results indicate that

α7β1 integrin is a target for LARGE-mediated glycosylation and drugs that target

LARGE glycosylation may be therapeutic in the treatment of muscular dystrophy through stabilization of α7 integrin.

MATERIAL AND METHODS

Tissue Culture

C2C12 myoblasts were grown as previously described (214). 24 hours after plating C2C12 cells were transfected using Lipofectamine 2000 reagent

(Invitrogen/Life Technologies, #11668-019). Transfections were optimized by using between 2.5-14.5µg of LARGE DNA and between 6-12µL of Lipofectamine

2000 according to the manufacturing instructions. Optimum transfections were considered to be 80% expression of EGFP 48 hours after transfections. This was achieved using 4µg of LARGE+EGFP DNA and 8µL Lipofectimine 2000 in Opti-

MEM Reduced Serum Medium (Invitrogen/Life Technologies, #31985-062).

Control cells were transfected with identical amounts of EGFP DNA and

Lipofectimine as treated cells were. Cell media was changed after 48 hours. Cell lysate from transfected cells were separated using the Qproteome Total

Glycoprotein Kit (Qiagen, #37541) and used according to manufactures protocol.

154

Stable cell lines were created using purified linearized LARGE, EGFP and

LARGE+EGFP DNA as described above with the addition that stably transfected cell were selected using G418 and were analyzed by immunofluorescence. After

96 hours cell colonies with a high expression of EGFP were treated with trypsin and moved to 24 well plates. Once cells were 70% confluent they were divided and passed. Live cells were visualized using a Nikon Eclipse TS100 microscope with a SPOT RT3 camera (Diagnostic Instruments, Inc.) and SPOT software 5.0.

Primary cell lines were established using embryonic skeletal muscle tissue from C57BL6 (WT) and α7KO mice. Derivation of α7KO mice is described previously (216). Rescue of the α7KO cells was accomplished by cloning the Rat

ITG7 gene into the pCDJ-cmv-gfp+puro lentiviral packaging vector (Systems

Biosciences Inc., #CD513B-1). 293FT cells were transfected with the lenti-α7 plasmid packaging mix from Invitrogen (pPACK HIV Lentiviral Packaging

System, Systems Biosciences, #LV500A-1) following manufactures suggested protocol. The lenti-α7 virus was used to transduce α7KO cells using

Lipofectamine and the Invitrogen packaging mix following manufactures protocol, after which cells were selected using puromycin (1 µg/mL) for 2-3 days. Single colonies were isolated, expanded and screened for α7 integrin expression by western blot analysis.

155

Quantitative real-time PCR (qRTPCR)

Total RNA from C2C12 cell transfected with EGFP or LARGE+EGFP were isolated using Trizol (Invitrogen, Grand Island, NY) followed by DNase treatment

(Promega, Madison, WI), and cDNA was made with random hexamers (IDTDNA) and Superscript III (Invitrogen, Grand Island, NY) using standard procedures.

Quantitative real-time PCR was performed using Quanta Perfecta SYBR-Green with ROX Master Mix and was run and analyzed as previously described (253).

The primers against ITGA7 were described in Doe et al. The forward primer used for LARGE was CCTAGACACCGACATCACCTTTGCA and the reverse primer used for LARGE was ACCCTCCTTGTACACGATGTGGTAG.

Western Blotting

C2C12 myoblasts were lysed using RIPA buffer (50mM HEPES pH 7.4,

150mM NaCl, 1mM Na3VO4, 10mM NaF, 0.5% Triton X-100, 0.5% NP50, 10% glycerol, 2mM PMSF, and a 1:200 dilution of Protease Inhibitor Cocktail Set III) and protein concentrations were determined using the Pierce BCA Assay kit

(Thermo Scientific). Equal amounts of protein were loaded into 8% SDS-PAGE gels and separated under standard unreduced conditions. Proteins were then transferred to nitrocellulose (GE Healthcare Life Sciences Whatman) and probed using a rabbit polyclonal antibody for α7B integrin (313) and α-tubulin (DM1A, ab7291, Abnova, 1:500) or GAPDH (V-18, sc-20357, 1:1000) overnight at 4̊ C.

156

Primary antibodies were detected using Alexa Fluor 680 goat anti-rabbit IgG and

Alexa Fluor 800 goat anti-mouse-IgG (1:5000, Li-Cor Biosciences or Molecular

Probes, Invitrogen detection technologies) in 2.5% milk, 0.02 % Sodium Azide solution for 1 hour. Band intensities for α7B were determined using ImageJ software and normalized to bands visualized using α-tubulin. Fold increase was determined by averaging data for LARGE+EGFP relative amounts divided by

EGFP relative amounts (n=6 plates or wells transfected for each group.)

Statistical analysis

GraphPad Prism 5 software was used for all statistical analysis performed.

Individually reported data points were reported at mean ± standard deviation.

Comparison for two groups was performed using a Student’s t-test and between multiple groups using one-way ANOVA of variance with Bonferroni post-test.

P<0.05 was considered statistically significant.

Results

LARGE promotes an increase in α7 integrin transcript and protein levels in transiently expressing myogenic cells.

Since overexpression of LARGE is known to increase binding of laminin and restore expression of α-DG, we hypothesized that it might have similar effects on α7 integrin (260). Thus, the effect of overexpressing LARGE on

157 transcript levels of LARGE and α7 integrin transcript was evaluated by qRT-PCR using total RNA isolated from transiently enhanced green fluorescent protein

(EGFP) expressing or LARGE+EGFP overexpressing C2C12 cells (Fig. 2A).

Cells transfected with 4µg of LARGE had a 43 fold increase in LARGE transcript levels and a 4.3 fold increase in ITGA7 transcription (Fig. 2B & C).

Total α7 integrin protein levels were determined by immunoblot analysis of protein isolated from C2C12 cell transiently transfected with either pEGFP parent vector, LARGE or LARGE+EGFP vector (Fig. 2A). Densitometry analysis of

α7B/tubulin bands showed that there was a 3.3 fold increase in α7B integrin protein levels in cells treated with the LARGE+EGFP vector over pEGFP parent control vector (Figure 2D). A comparison of cells transfected with LARGE vector alone or the LARGE+EGFP resulted in similar increases over control (data not shown, Fig. 2A vector map). Therefore, the rest of the experiments reported used

LARGE+EGFP for ease of visually assessing transfection efficiency through fluorescence. These data show that sufficient expression of LARGE will result in a significant increase of α7 integrin transcript and protein.

LARGE promotes glycosylation of α7 integrin in myogenic cells.

To determine if increases in α7 integrin transcript and protein in LARGE overexpressing cells was at least in part due to the glycosylation of α7 integrin, cell lysates from transiently EGFP expressing and LARGE overexpressing

158

C2C12 cells were analyzed using the Qproteome Total Glycoprotein Kit. This kit allows proteins to be separated by the type of glycan moiety being added to α7B integrin that LARGE overexpressing cells had versus controls. After cell lysates were separated using columns and elution buffers associated with specific glycan moieties. The eluted fractions were analyzed using a α7B integrin antibody on immunoblots and quantified using ImageJ software (http://imagej.nih.gov). There was an 8.8 fold increase in the amount of protein eluted with the mannose binding buffer for cells overexpressing LARGE versus control cells (Fig. 3A & C).

The other fractions (no column, flow through or sialic acid type) were nearly identical in the LARGE overexpressing cells and the control cells (Fig. 3A-C).

These data show that α7 integrin is glycosylated with a mannose or high mannose type N glycan, α1,3, or α1-6 linked high mannose moiety.

Increased expression of LARGE stabilizes α7 integrin expression.

In order to determine if LARGE overexpression is stabilizing transcript or protein levels, C57BLK6 wild type (WT) cell and α7 integrin knock-out cells rescued with the expression of rat ITGA7 using a CMV promoter (α7KO+α7) were transfected with EGFP or LARGE+EGFP. In this set of experiments we assumed that the endogenous α7 integrin promoter and the CMV promoter used to rescue the α7KO cells are not co-regulated. After 96 hours of transfection, lysates were analyzed for α7B integrin expression relative to GAPDH (Fig. 4A).

159

ImageJ quantification showed a nearly identical increase in α7B integrin expression in cells from C57BLK6 (WT) mice as was observed in C2C12 cells

(3.3 fold, Fig. 4 & Fig. 2D, respectively). However, α7KO+α7 cells transfected with either EGFP or LARGE+EGFP resulted in a 5.6 fold increase in α7B integrin expression (Fig. 4B). The changes in α7 integrin in the α7KO+α7 cells cannot be due to the endogenous promoter of α7 integrin or proteins that act on that promoter. The additional 2.3 fold increase in α7 integrin measured in α7KO+α7 cells transfected with LARGE+EGFP over C2C12 or WT cell transfected with

LARGE+EGFP can only be attributed to post-transcriptional changes in the expression of the rat α7 integrin. These results suggest that the stabilization of

α7B integrin protein is a result of protein modification through LARGE glycosylation.

EGFP expression in myogenic LARGE overexpressing cells appears in the

Golgi.

LARGE+EGFP fusion cells were used for the visualization of LARGE expression in a live cell model using C2C12 cells. All three vectors were linearized and used to produce LARGE overexpressing stable cells with and without EGFP fused at the N-terminus (Fig. 2). By qualitative observation transient and stable expressing LARGE+EGFP fusion cells show increased expression in the ER and Golgi area, which has been reported in previous

160 literature (255, 330, 340) (Fig. 5, arrows). Further experiments were planned to confirm co-localization of EGFP due to LARGE+EGFP expression with known

Golgi and/or ER markers, however EGFP was no longer apparent after approximately passage 5 or 6. Co-localization would have possibly shown where in the cell the stabilizing actions of LARGE were occurring.

Discussion

Duchenne muscular dystrophy (DMD), an X-linked recessive disease is the most common form of muscular dystrophy by incidence, but second in prevalence due to reduced life expectancy (43). DMD is caused by deletions or point mutations in the dystrophin gene which results in a lack of dystrophin (5).

Dystrophin is a major member of the DGC which is responsible for skeletal muscle stabilization and cell signaling (19, 31). The α-DG is a key link in a chain of proteins that connects dystrophin in the cell cytoskeleton through the cell membrane to the ECM (18, 19, 322). Hypoglycosylation of α-DG causes decreased ECM binding, muscle instability and disease (122, 326, 327, 333).

Conversely, hyperglycosylated α-DG through LARGE overexpression leads to increased binding to β-DG causing increased stability to myofibers (39, 40, 258) and increased laminin binding (260). Studies have proposed that the α7β1 integrin may compensate for reduced laminin-binding to α-DG in LARGEmyd skeletal muscle (257). Overexpession of LARGE causes glycosylation of

161 additional non-α-DG proteins in muscle and neural stem cells (260, 341). The glycosylation of this yet to be identified protein conferred/restored laminin binding

(260). LARGE overexpression is able to correct glycosylation defects of α-DG caused by mutations in other glycosyltransferases (342) and can modify both N- and O-glycans (256). In this study we show that overexpression of LARGE increases the transcript and protein levels of α7 integrin. Results show that the increased level of α7 integrin in LARGE overexpressing cells was due to increased levels of mannose or high mannose type N glycan, α1,3, or α1-6 linked high mannose moieties. Through use of α7KO+α7 cells we were able to show that the increased expression of α7 is due to post translational protein stabilization. These data provide evidence that α7 integrin levels can be altered by glycosylation which opens another door to possible therapeutics for muscular dystrophies.

This study was initiated to answer the question of whether LARGE, a glycosyltransferase known to glycosylate α-DG (257, 259, 326, 327, 331, 336,

343), had the ability to glycosylate α7 integrin. The fact that α-DG is glycosylated by LARGE had been widely studied. However the correlation between hypoglycosylation of α-DG and disease state in muscular dystrophy has not been established (344). Studies have indicated that there are other glycoproteins besides α-DG that LARGE is able to glycosylate to enhance laminin binding

(260). Specifically, in DG deficient neural stem cells, LARGE glycosylates a non-

162

α-DG protein of approximately 130kDa in size, as detected using VIA4-1 antibody

(an antibody widely used to determine functional glycosylation of α-DG on unidentified carbohydrate epitopes) on immunoblots (260). Furthermore, this study showed that the conferred epitopes resulted in increased laminin binding

(260). In a recent article, Bozzi et al. suggested that because α-DG undergoes extensive and heterogenous glycosylation which involves numerous enzymes and steps, it is unlikely that α-DG is the only target for these enzymes (345).

Additionally, α7 integrin is known to have several glycosylation sites and the upregulation of α7 integrin would have the same or add to the therapeutic affects observed in many of the α-DG LARGE overexpressing hyperglycosylation experiments if α7 integrin was a LARGE substrate (313). Our data support previous suggestions that there is a non-α-DG protein, and we hypothesized that

α7 integrin is the non-α-DG protein.

Previous studies suggested that transcriptional regulation exists between laminin and α7 integrin in skeletal muscle (280). Indeed transgenic overexpression of α7 integrin in the dyW-/- mice restored sarcolemmal α7β1 integrin, reduced muscle pathology, maintained muscle strength and increased survival (253). Conversely mice that lack α7 integrin have unstable sarcolemmal membranes, delayed muscle repair and vascular defects (42, 216, 325). Our results show that ITGA7 transcript was increased by 4.3 fold after LARGE transcript levels were enhanced by 43 fold following over-expression.This was

163 followed by a 3.3 fold increase in α7 integrin protein. These results show a novel mechanism for the increase of α7 integrin transcript and protein.

Multiple lines of evidence suggest that there is a positive feedback regulation of α7 integrin expression (42, 117, 280). Therefore, it is possible that the increased expression and laminin binding of α-DG could cause an increase in α7 by triggering the positive feedback loop (Fig. 5B). To determine if there was a difference in glycosylation associated with the increase in α7 integrin, protein lysates were separated according to their glycan moiety. These separated fractions demonstrated that LARGE overexpression specifically increased α7B integrin glycosylation as a mannose or high mannose type N glycan, α1,3, or α1-

6 linked high mannose moiety. This experiment also shows that there is an increase in α7 integrin protein level associated with the increase in glycosylation.

The α7 integrin promoter is developmentally regulated and transcription in early development has been observed in vascular smooth muscle and the central and peripheral nervous system in addition to skeletal muscles (325). The CMV promoter in the bacterial expression vector used in the stably expressing

α7KO+α7 cell lines is independently regulated. By overexpressing LARGE in both the WT and the α7KO+α7 cell lines, we were able to demonstrate that the increase in α7B observed in C2C12 cell and WT cell derived from C57BL6 cells was independent of the ITGA7 endogenous promoter. Thus, we propose that

164 protein stabilization was achieved through post translational modifications to α7 integrin (Fig. 5B).

There are also several other possible mechanisms that α7 integrin could be upregulated. Recent studies show that sarcospan (SSPN) interacts with α7β1 integrin complex and with the DGC (281). This interaction can result in a SSPN-

DGC complex, a SSPN-α7β1 integrin complex or a mega DGC-SSPN-α7β1(281) integrin complex. By stabilizing one or several members of these protein complexes the entire complex becomes stabilized. LARGE could be stabilizing

α7β1 integrin by glycosylating and stabilizing other members of these complexes

(115, 281, 346, 347). The α-DG is known to be stabilized and upregulated by

LARGE (122, 258, 326, 342, 348). Therefore, the stabilization of α-DG through

LARGE glycosylation could stabilize the mega DGC-SSPN-α7β1 integrin. The interactions of α7β1 integrin with this mega complex could possibly lead to less

α7 integrin degradation and protein stabilization (115, 116, 281). The sarcoglycans which are glycosylated and members of the DGC could also provide stability through mega complex interactions (349). Upstream protein interactions that aid in the assembly of the heterotrimetric α7β1 integrin complex could explain the upregulation of α7integrin. Further research exploring these possibilities needs to be done to pinpoint the true mechanism.

In this study we have shown that overexpression of LARGE is a novel mechanism to increase transcription of α7 integrin and increase stabilized levels

165 of α7 integrin protein either through a positive laminin/α7 integrin feed-back loop and/or through post translational modifications. This short study has opened even more questions that need to be answered: (1) How does LARGE overexpression affect α7KO cells or mice? (2) What other sarcolemmal proteins are affected by LARGE overexpression? (3) Does overexpression of LARGE cause increased laminin binding? (4) What portion of α7 integrin does LARGE interact with? (5) What glycan moiety is being added? (6) Is the α7 integrin

LARGE interaction a natural physiological condition or is this due only to the forced overexpression? (6) Are these LARGE-intergrin interactions observable in

LARGE knock-out mice? (7) If there are changes in α7 integrin in LARGE knockout mice can enhanced α7 integrin expression rescue the disease phenotype in these mice? α7 integrin has been shown to be a major disease modifier; and therefore, novel ways to increase α7 expression are avenues for potential therapeutics for muscle diseases.

166

167

Figure 1: Known Glycosylation of α-dystroglycan and proposed glycosylation pathway of α7 integrin. Two complementary complexes for skeletal muscle work to stabilize the sarcolemma. The first being the DGC which is composed of the Dystroglycans (DG-α and β), sarcoglycans (α, β, γ & δ) and sarcospan; and second, the α71 integrin. The glycosylation of –DG is known to confer stability in muscular dystrophy disease models. Because 7 integrin’s overlapping role in skeletal muscle it is hypothesized that 7 is glycosylated in a similar manner (350).

168

169

Figure 2: Transcript and protein levels of α7 integrin in myogenic mouse cells Overexpressing LARGE is able to enhance ITGA7 transcript leading to increased protein levels of α7 integrin. Myogenic cells were transfected with vectors to identify the effect LARGE overexpression would have on α7 integrin transcript and protein levels (A). To determine the transcript expression induced by transient transfection, RT-PCR analysis showed that with a 40 fold increase in

LARGE transcript in LARGE+EGFP transfected cells there was an accompanied

4.3 fold increase in ITGA7 transcript. Fold increase calculated by dividing average ITGA7 or LARGE transcript levels by average pEGFP transcript levels.

Error bars represent SEM. n=8, ***=p<0.0001 (B & C). Cell lysate from transfected cells was used in immunoblot detection of α7B integrin.

Representative examples of immuoblots are shown for α7B integrin levels.

Immunoblots were quantified using image j analysis software and normalized to

α-tubulin. Statistical analysis used was unpaired t-test. *p<0.05, n=5 plates for

EGFP 96 hrs., n=2 for LARGE+EGFP 24 hrs. and n=4 LARGE+EGFP 96 hrs. * indicates significance compared to controls. (D).

170

171

Figure 3: LARGE promotes glycosylation of α7 integrin in myogenic cells.

Cell lysate from transfected cells were separated by glycan moiety fractions.

Immunoblot detection using an anti-α7B antibody was employed to determine the levels of α7 integrin in each fraction (A). Quantification using Image J analysis software of immunoblots show there is little change in levels of α7B integrin in the flow through (B) and the sialic type of moieties (C). However, there is nearly 9 times more α7B in the a mannose or high mannose type N glycan, α1,3, or α1-6 linked high mannose moiety fraction (C). n=3 plates for EGFP and

EGFP+LARGE transfected cells.

172

173

Figure 4: Hyperglycosylation of α7 integrin causes protein stabilization in

WT and α7KO rescued cells. To investigate the role LARGE overexpression plays on α7 integrin in C57BL6 mice cells and α7 integrin KO cells that were rescued with rat α7 integrin, these cells were transfected with either EGFP or

LARGE+EGFP. Lysate from transfected cells were used in immunoblot analysis and probed for α7B expression (A) and quantified using Image J analysis software (B). n=4 plates for WT:EGFP, n=6 plated for WT:LARGE+EGFP, n=3 plates for α7KO+α7:EGFP, n=3 plated for α7KO+α7:LARGE+EGFP transfected cells. Statistical analysis used was unpaired t-test. *p<0.05, * indicates significance compared to controls.

174

175

Figure 5: A model of a proposed mechanism of how α7 integrin is increased and stabilized by LARGE overexpression in myogenic cells.

C2C12 cells transiently transfected with LARGE+EGFP only fluoresced in the

ER/Golgi region of cells, while EGFP cells fluoresced throughout the cell (A). The two of the possible mechanisms α7 integrin could be increased proposed in this study are through the activation of a positive feed-back loop of increased laminin-

α7 binding or increased α7 glycosylation leading to increased protein stabilization. The results show it could be a combination of both (B).

176

Chapter 5

Conclusions and Future Directions

177

Muscle diseases are heterogeneous with a wide range of symptoms, age of onset, morbidity and primary cause. Generally, muscular dystrophies or myopathies have progressive degenerative muscle histological markers such as fibrosis, myofiber size variation, centrally located nuclei and fatty cell infiltrate.

Sarcolemmal fragility, misregulation of regeneration though satellite cell activation or repair are also characteristics of dystrophies and myopathies.

Correct patient diagnosis for a specific type of disease can sometimes be accomplished simply through historical data and clinical symptoms or polymerase chain reaction (PCR) using a small skin sample (134). However for most cases, diagnosis may require invasive muscle biopsies, followed by DNA, protein and histological analysis (134). Due to years of extensive research in this field, the primary cause of many of these specific diseases has been determined.

One of the major problems faced by patients is the lack of treatment options. Most treatments only address symptoms and are merely palliative. The main therapeutic approaches that are being researched are pharmacological, cell, gene and protein therapies. Pharmacological therapies such as deflazacort and prednisone have been used for years and have resulted in increased life expectancy (140, 143). The drawbacks of high long term treatment using glucocorticoids include increases in blood pressure and cholesterol, acne, ulcers, osteoporosis and adrenal suppression (142, 144, 145, 153, 351). An advance in

AAV delivery has solved one of the major obstacles in gene therapy which was

178 the size limitation of AAV vectors (163). Researchers engineered a set of tri-AAV vectors with specific recombination signals to produce full size dystrophin (163).

However two more major obstacles remain: 1) immune response to the AAV vector and the non-self-gene being delivered and 2) successful systemic delivery. There are a wide variety of cell therapies being explored using specific stem cell populations (176). Cell therapies have the two roadblocks mentioned for gene therapy along with scalability complications and legal/ethical concerns

(178, 187). Of all the therapies being researched, protein therapy is the only one with a 90 year track record of successful use in the medical field (192).

Myozyme© and Lunizyme© are FDA approved for the use as a protein therapeutic for Pompe disease, a metabolic myopathy (195). The road paved by research and development of these two protein therapies demonstrates the possible path others can follow to transition potential protein therapies from bench top to patient. The four main protein therapies that are on this journey are laminin-111, biglycan, TAT-Utrophin (TAT-Utr) and MG53. Laminin-111 and biglycan reinforce connections between myofibers that are weakened or due to muscle diseases. Reestablished connections to extracellular and transmembrane proteins result in increased key stabilizing skeletal muscle protein complexes such as, the dystrophin glycoprotein complex (DGC), the utrophin glycoprotein complex (UGC) and the α7β1 integrin. Through these restored interactions important signaling in apoptosis, regeneration, repair and inflammation through-

179 out the myofiber and muscle are restored. TAT-Utr is able to reestablish the UGC and the α7β1 integrin sarcolemmal stabilizing complexes by facilitating increased cytoplasmic connections to F-actin. Despite the vigorous research of utrophin replacement therapy in the early 2000’s, its development seems to be stuck in the preclinical research phase with no apparent public plans for further development. MG53 therapy is mainly a repair mechanism which is helpful, but at this point would only address repair of muscle disease of existing myofibers.

This dissertation has demonstrated that protein replacement is the best therapeutic option which will result in discernable quality of life changes for a wide range of muscle diseases. Engelbrth-Holm-Swarm laminin-111 treatment of dyW-/- mice, a model for merosin-deficient congenital muscular dystrophy

(MDC1A) resulted in increased myofiber area and number, increased TA area, and decreased fibrosis over PBS treated muscle (Figure 1A). An increase in the number and size of embryonic myosin heavy chain positive fibers along with an increase in Pax7 and myogenin protein in laminin-111 treated muscle indicates an increase in myogenesis. Laminin-111 treatment was also able to correctly localize and increase levels of α7β1 integrin (Fig. 1A). This research shows laminin-111 therapy is able to restore satellite cell myogenesis, protect and reinforce existing myofibers, and improve the timing rate and repair capacity of laminin-α2 deficient skeletal muscle after injury.

180

Several on-going and new grants along with collaborative efforts with

Alexion are contributing to the progress laminin-111 is making toward its goal of becoming an FDA approved recombinant protein treatment for muscle diseases.

Through research funded by a grant from Cure CMD questions regarding pharmacokinetic/pharmacodynamics between EHS-derived mouse laminin-111 and human laminin-111 using the dyW-/- mouse will be answered. This grant will also uncover signaling and transcriptional changes associated with long and short term treatment using both forms of laminin-111. Grants given in 2012 from the Muscular Dystrophy Association to Dr. Dean Burkin and Dr. Ryan Wuebbles have aims leading to the development of laminin-111 as a therapy. One of the questions that these grants will answer is; can laminin-111 therapy prevent or reverse Duchenne muscular dystrophy (DMD) or Becker muscular dystrophy

(BMD) after disease onset. This information is crucial for patients since most patients are diagnosed after disease onset.

One of the biggest roadblocks for laminin-111 protein therapy is the engineering of a scalable process to produce sterile recombinant human laminin-

111 for the use in human trials. EHS laminin-111 a 850kDa heterotrimeric glycosylated protein. The grant awarded to Dr. Wuebbles will address this problem by developing and testing a variety of laminin-111 peptides. A recent grant awarded to the Burkin Lab will investigate transgenic overexpression of laminin-α1 and laminin-α2 in dyW-/- mice in order to determine their possible use

181 as a therapeutic. Results from both of these grants will determine if either a shortened version of the laminin-111 or if one of the trimeric partners can be equally affective as the bulky laminin-111 whole protein. Together this research propels laminin-111 toward the goal of becoming a therapeutic in the hands of patients.

For the first time, research in this dissertation shows proof of principle that

Galectin-1 can be used as a protein therapeutic for DMD (Fig. 1B). In vitro and in vivo treatments increased skeletal muscle stabilizing proteins. The systemic delivery of recombinant mouse Galectin-1 (rMsGal-1) to all major muscles affected in DMD provides evidence for its use as a therapeutic. In addition to histological improvement, rMsGal-1 therapy provided functional benefits in weight, activity, muscle strength and kyphotic index. These improvements suggest Galectin-1 treatment could translate to measurable quality of life changes for patients.

Immunofluorescence images in chapter 3 show that rMsGal-1 was able to cross the blood-brain barrier (BBB) into the brain parenchyma. Since DMD patients have known changes in the central nervous system such as neuronal loss, neurofibrillary tangles and changes in the BBB, this unexpected result opens the door to much needed neurological research in the field (304). In a recent paper prednisone was shown to reverse BBB disease pathology in the mdx mice by correcting mis-regulation of β-DG in the brain and muscle (311).

182

Current studies investigating the possible changes associated with rMsGal-1 in the brain are being conducted. Levels of DGC/UGC proteins along with important

BBB stability markers for pericytes and glial cells are being evaluated.

Additionally, a plan for collaborative research with Dr. Kenneth Hunter measuring behavioral, learning and CNS preclinical outcomes in mdx mice are underway.

This novel research will provide further insight into Galectin-1 as a possible therapeutic for not only DMD/BMD, but also for other CNS diseases.

Based on the functional results reported with rMsGal-1 treatment, ex vivo isometric and eccentric muscle contractions are being carried out through collaboration with Dr. Robert Grange of Virginia Polytechnical Institute. The results from these experiments will reinforce the improvements in grip strength and activity. Kyphosis in muscular dystrophy patients is a major causation of respiratory failure leading to decreases in life expectancy (310). In order to investigate this aspect of muscular dystrophy and the effects of rMsGal-1 treatment, to measure overall lung function whole body plethysmography will be performed weekly on mdx mice. Cytokine and chemokine levels, lung architecture and lung resistance are also important measures that need to be evaluated either on current tissue or on an additional set of mice.

In addition to studies mentioned previously in mdx mice, treatments using other animal models need to be researched using either rMsGal-1 or human recombinant galectin-1. The main advantage galectin-1 therapy has over laminin-

183

111 therapy is that it is a small (14kDa) easily purified and produced protein.

StrykaGen, a small bio-pharmaceutical company, was recently awarded a small business technology transfer (STTR) grant to collaborate with Dr. Burkin’s lab to develop human Galectin-1 as a protein therapy. The results from this research, along with a grant and industry support will propel Galectin-1 research to becoming a treatment for muscular dystrophy.

In chapter 4, exploratory experiments were performed to determine the possible interactions between like-N-acetyl glycosyltransferase (LARGE) and

α7β1 integrin. Our results provide novel evidence that α7β1 integrin levels are increased through overexpression of LARGE (Fig. 1C). The mechanism of this increased transcription and stabilization of α7 integrin protein could be through a positive laminin/α7 integrin feedback loop and/or through post translational modifications. The results from these experiments seemed to open up more questions by revealing α7 integrin as a possible target for LARGE glycosylation.

There are a great number of experimental questions that arise from the results presented in this study.

However the drawbacks of continuing the study outweighed the possible benefits of continuing. First, this study was unfunded and the preliminary data gained and used for submission of a grant did not receive funding. Second,

LARGE is an enzyme exhibiting physiologically low levels of expression making it very difficult to detect. Third, there are not any reliable antibodies available and

184 labs that have made their own LARGE antibodies say they are unreliable. Fourth, due to the size of LARGE, its production and purification for use as a protein replacement therapy has the same problems as stated for laminin-111. For these reasons LARGE is not a good protein replacement therapy candidate.

The results from this dissertation support the hypothesis that protein replacement therapy is leading to a viable treatment for muscle diseases. Taken as a whole, laminin-111 treatment seems to have taken the lead in advancements toward a cure. However, there are scalability production obstacles that laminin-111 thearapy must overcome. The exciting new results shown herein provide proof of concept, efficacy and scalability for the development of Galectin-

1 as a protein therapy. This research shows that protein replacement therapy is a viable treatment option for muscle disease and will translate into measurable quality of life changes for patients and families (Fig. 1).

185

Figure 1: Proposed modles of stabilization mechanisms for Laminin-111,

Galectin-1 and LARGE Therapy. Laminin-111 protein therapy is able to stabilize protein complexes by replacing laminin-211 in skeletal muscle through its interactions with α7β1 integrin, its major receptor in skeletal muscle (A).

Through interactins with transmembrane receptors such as α7β1 integrin and other glycoproteins found in the extracellular matrix, rMsGal-1 is able to stablizie both the α7β1 integrin and the DGC (B). LARGE maybe stabilizing the α7β1 integrin and causing additional laminin binding through increased glycolylation.(C)

186

Appendix A

Patent Application

Methods for Diagnosing, Prognosing and Treating Muscular Dystrophy

187

METHODS FOR DIAGNOSING, PROGNOSING AND TREATING MUSCULAR

DYSTROPHY

CROSS REFERENCE TO RELATED APPLICATION This application claims the benefit of U.S. Provisional Application No. 61/522,507, filed August 11, 2011, which application is incorporated herein in its entirety.

FIELD This disclosure relates to the field of muscular dystrophy and in particular, to methods for diagnosing, prognosing and treating patients with muscular dystrophy, such as merosin deficient congenital muscular dystrophy Type 1A, limb-girdle muscular dystrophy, facioscapulohumeral muscular dystrophy, Beckers muscular dystrophy and Duchenne muscular dystrophy.

ACKNOWLEDGMENT OF GOVERNMENT SUPPORT This invention was made with government support under R01 AR053697 and R21 NS58429 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND The muscular dystrophies are a group of diverse, heritable neuromuscular disorders which represent a group of devastating neuromuscular diseases characterized by primary or secondary skeletal muscle involvement. Duchenne muscular dystrophy (DMD) is an X-chromosome-linked disease and the most common form of muscular dystrophy. DMD affects 1 in 3500 live male births with patients suffering from chronic muscle degeneration and weakness. Clinical symptoms are first detected between the ages of 2 and 5 years and, by the time the patient is in their teens, the ability for independent ambulation is lost. Death typically occurs in the patient before they are 30 years old due to cardiopulmonary failure. Congenital muscular dystrophy (CMD) refers to a group of heritable neuromuscular disorders characterized by muscle weakness at birth or in infancy. Affected infants will present with poor muscle tone and few movements. The quality of life and life span of the child is affected through progressive muscle wasting, respiratory compromise, and spinal rigidity. Merosin deficient congenital muscular dystrophy (MDC1A) is the most common and severe form of congenital muscular dystrophy, accounting for 30-40% of all CMD diagnosed cases. MDC1A is characterized by congenital hypotonia, distinct joint contractures, and a lack of independent ambulation. Feeding tube placement and positive pressure ventilation is often required for the respiratory problems that occur. MDC1A has no cure and patients often die before they reach the age of ten years. Currently there is no cure for either DMD or MDC1A.

188

SUMMARY Muscular dystrophies including MDC1A, DMD, Limb-Girdle muscular dystrophy (LGMD), facioscapulohumeral muscular dystrophy (FHMD), Beckers muscular dystrophy are devastating neuromuscular diseases. In addition to there being no cure for such diseases, there are no non-invasive methods of diagnosing, prognosing or evaluating the efficacy of treatments for such conditions. Currently, serum creatine kinase levels and fine needle biopsies are used as tests for DMD, LGMD, FMD, Beckers muscular dystrophy and MDC1A. However, muscle biopsies are painful, invasive and impractical to perform consistently, and serum creatine kinase levels can vary from day to day in the same patient making, them unreliable indicators of change. A biomarker which can be monitored easily, such as in serum or urine, and that can reliably indicate disease progression is needed. Disclosed herein are muscular dystrophy-associated molecules that can be used as biomarkers to diagnose and/or prognose muscular dystrophy, including DMD, LGMD, FHMD, Beckers muscular dystrophy and/or MDC1A. In some embodiments, the muscular dystrophy-associated molecules can include, consist essentially of, or consist of disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin- α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) or any combination thereof. In some examples, muscular dystrophy-associated molecules include Galectin-1, Galectin-3, Col6A1, Itga3, Iga6, Itga7, Tnc and Timp 1. In some examples, muscular dystrophy- associated molecules include Galectin-1 and Galectin-3. In some examples, muscular dystrophy-associated molecules include Galectin-3 and Tnc. In some examples, the muscular dystrophy-associated molecules include at least Galectin-3 for detecting DMD, LGMD, FHMD, Beckers muscular dystrophy or MDC1A. In some examples, the muscular dystrophy-associated molecules include at least Galectin-3 for detecting DMD. Also disclosed herein are methods of diagnosing or prognosing a subject with muscular dystrophy. In some examples, the method includes detecting at least one of the

189 disclosed muscular dystrophy-associated molecules in a sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy, thereby diagnosing or prognosing the subject with muscular dystrophy. In some examples, the method further includes comparing expression of Galectin-1 or Galectin-3 in the sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy to a control, wherein increased expression of Galectin-1 or Galectin-3 molecules relative to a control indicates that the subject has muscular dystrophy. Further, methods of determining the effectiveness of an agent for the treatment of muscular dystrophy in a subject with muscular dystrophy are disclosed. In some examples, the methods include detecting expression of a muscular dystrophy-associated molecule, such as Galectin-3, in a sample from the subject following treatment with the agent; and comparing expression of the muscular dystrophy-associated molecule, such as Galectin-3, following treatment to a reference value, wherein a decrease in the expression of the muscular dystrophy-associated molecule, such as Galectin-3, following treatment indicates that the agent is effective for the treatment of muscular dystrophy in the subject. Also disclosed are methods of treating muscular dystrophy. In some examples, the method includes administering to the subject with muscular dystrophy an effective amount of an agent that decreases expression or biological activity of a muscular dystrophy-associated molecule thereby treating the muscular dystrophy and increasing the subject’s chance of survival or delaying the onset of one or more signs or symptoms associated with the muscular dystrophy. Methods of treating a subject with galectin or a composition that includes galectin are also disclosed. For example, some embodiments provide methods of improving muscular health, such as enhancing muscle regeneration, maintenance, or repair in a subject by administering to the subject an effective amount of galectin or a composition comprising galectin, including fragments, derivatives, or analogs thereof. In a specific example, the galectin is a complete galectin protein. In further examples, the galectin is selected from Galectin-1, Galectin-3, and combinations thereof. In further examples, the galectin or galectin composition includes a substance at least substantially homologous to

190

Galectin-1 or Galectin-3. In yet further implementations, the galectin or galectin composition comprises a polypeptide at least substantially homologous to the Galectin-1 or Galectin-3. In additional examples, the galectin or galectin composition consists of Galectin- 1, Galectin-3, and combinations thereof. In further examples, the galectin or galectin composition consists of a substance at least substantially homologous to Galectin-1 or Galectin-3. In a specific example, the galectin or galectin composition does not include a galectin fragment, such as including only a complete galectin protein. In yet another example, the galectin or galectin composition consists essentially of Galectin-1, Galectin-3, and combinations thereof. In further examples, the galectin or galectin composition consists essentially of a substance at least substantially homologous to Galectin-1 or Galectin-3. In yet further implementations, the galectin or galectin composition consists essentially of a polypeptide at least substantially homologous to the galectin α1 chain. In a specific example, the galectin or galectin composition does not include a galectin fragment, such as including essentially only a complete galectin protein. Further implementations of the disclosed method include diagnosing the subject as having a condition treatable by administering galectin or a composition comprising galectin, such as by administering Galectin-1, Galectin-3 or a combination thereof or a composition containing Galectin-1, Galectin-3 or a combination. In one example, the subject is diagnosed as suffering from muscular dystrophy, such as LGMD, FHMD, Beckers muscular dystrophy and/or MDC1A. In further instances the condition is characterized by the failure of a subject, or the reduced ability of the subject, to express one or more proteins associated with the formation or maintenance of the extracellular matrix, such as impaired or non-production of a galectin, an integrin, dystrophin, utrophin, or dystroglycan. In a specific embodiment, the present disclosure also provides a method for increasing muscle regeneration in a subject. For example, geriatric subjects, subjects suffering from muscle disorders, and subjects suffering from muscle injury, including

191 activity induced muscle injury, such as injury caused by exercise, may benefit from this embodiment. In yet further embodiments of the disclosed method, the galectin or galectin composition, such as Galectin-1, Galectin-3 or a combination thereof containing composition, is administered in a preventative manner, such as to prevent or reduce muscular damage or injury (such as activity or exercise induced injury). For example, geriatric subjects, subjects prone to muscle damage, or subjects at risk for muscular injury, such as athletes, may be treated in order to eliminate or ameliorate muscular damage, injury, or disease. Implementations of the present disclosure may also be used to promote wound healing. In some examples, a galectin or a composition comprising galectin is administered into or proximate to a wound. In further examples, the substance is administered systemically. Although the substance is typically applied after the wound occurs, the substance is applied prospectively in some examples. In further embodiments, the method of the present disclosure includes administering the galectin or galectin composition, such as Galectin-1, Galectin-3 or a combination thereof containing composition, with one or more additional pharmacological substances, such as a therapeutic agent. In some aspects, the additional therapeutic agent enhances the therapeutic effect of the galectin or galectin composition. In further aspects, the therapeutic agent provides independent therapeutic benefit for the condition being treated. In various examples, the additional therapeutic agent is a component of the extracellular matrix, such as an integrin, dystrophin, dystroglycan, utrophin, or a growth factor. In further examples, the therapeutic agent reduces or enhances expression of a substance that enhances the formation or maintenance of the extracellular matrix. In some examples, the galectin or galectin composition is applied to a particular area of the subject to be treated. For example, the galectin or galectin composition may be injected into a particular area to be treated, such as a muscle. In further examples, the galectin or galectin composition is administered such that it is distributed to multiple areas of the subject, such as systemic administration or regional administration.

192

Galectin, or a composition comprising galectin, such as Galectin-1, Galectin-3, or a combination thereof, can be administered by any suitable method, such as topically, parenterally (such as intravenously or intraperitoneally), or orally. In a specific example, the galectin or galectin composition is administered systemically, such as through parenteral administration, such as stomach injection or peritoneal injection. Although the disclosed methods generally have been described with respect to muscle regeneration, the disclosed methods also may be used to enhance repair or maintenance, or prevent damage to, other tissues and organs. For example, the methods of the present disclosure can be used to treat symptoms of muscular dystrophy stemming from effects to cells or tissue other than skeletal muscle, such as impaired or altered brain function, smooth muscles, or cardiac muscles. Methods of identifying agents for use in treating muscular dystrophy are also provided. In some examples, the method includes contacting a sample with one or more test agents under conditions sufficient for the one or more test agents to decrease the activity of a muscular dystrophy-associated molecule, such as Galectin-1 or galection-3; detecting activity of the muscular dystrophy-associated molecule, such as Galectin-1 or galection-3, in the presence of the one or more test agents; and comparing activity of muscular dystrophy-associated molecule, such as Galectin-1 or galection-3, in the presence of the one or more test agents to a reference value to determine if there is an alteration in expression of the muscular dystrophy-associated molecule, such as Galectin- 1 or galection-3, wherein decreased expression of the muscular dystrophy-associated molecule, such as Galectin-1 or galection-3, indicates that the one or more test agents is of use to treat the muscular dystrophy. The foregoing and other features of the disclosure will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1A and 1B are bar graphs illustrating transcription of Lgals1 and Lgals3 are altered in the dyW -/- mouse. FIG. 1A shows the transcript for Lgals1 (Galectin-1) was

193 significantly increased over wild-type in both 4- and 8-week old animals. FIG. 1B illustrated that the transcript for Lgals3 (Galectin-3) was also significantly increased over wild-type in both 4- and 8-week old animals.**P<0.01, ****P<0.00001. FIGS. 2A-2C are digital images and bar graphs illustrating Western blotting studies for Galectin-1 in the dyW -/- and wild-type mice at 4- and 8-weeks of age. FIG. 2A shows the difference in Galectin-1 protein in the muscles of 4-week old dyW -/- mice was significantly different from wild-type animals. FIG. 2B indicates that the level of Galectin-1 protein in the grostocnemius muscle of 8-week old dyW -/- animals was not significantly different from that measured in wild-type. FIG. 2C shows that there was no difference in Galectin-1 protein in dyW -/- mice at 4- and 8-weeks of age. FIG. 3A is a digital image of Western blotting results for Galectin-3 in the dyW -/- and wild-type mice at 4- and 8-weeks of age. FIG. 3B is a bar graph quantitating the level of Galectin-3 protein in the grostocnemius muscle of 4-week old and 8-week old dyW -/- animals as compared to wild type (control) mice. FIGS. 4A and 4B are digital images and bar graphs illustrating Western blotting studies for Galectin-3 in the serum dyW -/- and wild-type mice at 4- and 8-weeks of age. FIG. 4A shows that there was no significant difference in Galectin-3 protein in the serum of 4-week old dyW -/- mice when compared to wild-type animals. FIG. 4B shows that there was no difference in Galectin-3 protein in dyW -/- mice serum at 4- and 8-weeks of age. FIG. 5 is a series of digital images of Galectin-3 immunofluorescence on 4- and 8-week dyW -/- and wild-type mice. Immunofluorescence was used to evaluate Galectin- 3 levels in the tibialis anterior muscle of mice. Galectin-3 was found to be elevated in 4- week old dyW -/- mice when compared to that in the wild-type mice. Galectin-3 was found to be similar in 8-week dyW -/- mice and wild-type mice. Galectin-3 levels were also found to be similar between 4- and 8-week old dyW -/- mice. Galectin-3 levels appear to increase in the wild-type mice as they age. FIGS. 6A and 6B are bar graphs illustrating transcription of Lgals1 and Lgals3 were altered in the mdx mouse. FIG. 6A shows the transcript for Lgals1 (Galectin-1) is

194 significantly increased over wild-type in both the 5- and 10-week old animals. FIG. 6B illustrates the transcript for Lgals3 (Galectin-3) was significantly increased over wild- type in both 5- and 10-week old animals. FIGS. 7A-7C are bar graphs and digital images of Western blotting results for Galectin-1 in mdx and wild-type mice at 2-, 5- and 10-weeks of age. FIG. 7A indicates no significant difference was observed in Galectin-1 protein in the muscles of 5-week old mdx mice when compared to wild-type animals. FIG. 7B illustrates that the level of Galectin-1 protein in the gastrocnemius muscle of 5-week old mdx animals compared to wild-type were not significantly different. FIG. 7C. shows there was no difference between Galectin-1 protein in the mdx mice at 2- and 5-weeks of age. There was a significant difference between the 2- and 10-week old mice and the 5- and 10-week old mice. FIGS. 8A and 8B are bar graphs and digital images of Western blotting results for Galectin-3 in the mdx and wild-type mice at 5- and/or 10-weeks of age. FIG. 8A shows a significant difference in Galectin-3 protein in the muscles of 5-week old mdx mice when compared to wild-type animals. FIG. 8B indicates that the level of Galectin-3 protein in the gastrocnemius muscle of 5- and 10-weeks of age mdx and wild-type mice and demonstrates that Galectin-3 protein in 10-week old mdx animals was significantly greater than Galectin-3 levels in 5-week old mdx animals. FIGS. 9A and 9B are bar graphs and digital images of Western blotting studies for Galectin-3 in the serum of mdx and wild-type mice at 5- and 10-weeks of age. FIG. 9A shows there was no significant difference in Galectin-3 protein in the serum of 5- week old mdx mice when compared to wild-type animals. FIG. 9B indicates there was no significant difference in Galectin-3 protein between 10-week old mdx mice serum and age-matched wild-type serum. FIG. 10 is a series of digital images of Galectin-3 immunofluorescence on 5- and 10-week mdx and wild-type mice. Immunofluorescence was used to evaluate Galectin-3 levels in the tibialis anterior muscle. Galectin-3 was found to be elevated in 5- and 10- week old mdx mice when compared to that in the wild-type mice. Galectin-3 was found

195 to be elevated in 10-week old mdx mice compared to that in the 5-week old mice while Galectin-3 levels were similar between 5- and 10-week wild-type mice. FIG. 11 is a digital image of a Western blot study for Galectin-3 levels in the muscle of the golden retriever muscular dystrophy (GRMD) dog model of DMD. Elevated levels of Galectin-3 protein are detected in the muscle of GRMD dogs, lanes A and E. Little or no Galectin-3 was observed in unaffected control dog samples, lanes B- D. FIG. 12 is a digital image of Galectin-1 fractions eluted from Talon affinity columns. FIG. 13 is a graph and table illustrating Galectin-1 treatment decreases muscle damage in mdx mice. FIG. 14 is a graph, table and digital image illustrating Galectin-1 treatment increases α7 integrin.

DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS I. Overview of Several Embodiments Disclosed herein are muscular dystrophy-associated molecules that can be used as biomarkers to diagnose and/or prognose muscular dystrophy, including DMD, LGMD, FHMD, Beckers muscular dystrophy and/or MDC1A. In some embodiments, the muscular dystrophy-associated molecules can include, consist essentially of, or consist of disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin- α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) or any combination thereof. In some examples, muscular dystrophy-associated molecules include Galectin-1, Galectin-3, Col6A1, Itga3, Iga6, Itga7, Tnc and Timp 1. In some examples, muscular dystrophy- associated molecules include Galectin-1 and Galectin-3. In some examples, muscular dystrophy-associated molecules include Galectin-3 and Tnc. In some examples, the muscular dystrophy-associated molecules include at least Galectin-3 for detecting DMD,

196

LGMD, FHMD, Beckers muscular dystrophy or MDC1A. In some examples, the muscular dystrophy-associated molecules include at least Galectin-3 for detecting DMD. Disclosed herein are methods of diagnosing or prognosing a subject with muscular dystrophy. In some embodiments, a method of diagnosing or prognosing a subject with muscular dystrophy, comprises detecting expression of one or more of the disclosed muscular dystrophy-associated molecules, such as Galectin-1 or Galectin-3, in a sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy, thereby diagnosing or prognosing the subject with muscular dystrophy. In some embodiments, a method of diagnosing or prognosing a subject with muscular dystrophy, comprises detecting expression of Galectin-1 or Galectin-3 in a sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy, thereby diagnosing or prognosing the subject with muscular dystrophy. In some embodiments, the method further comprises comparing expression of Galectin-1 or Galectin-3 in the sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy to a control, wherein increased expression of Galectin-1 or Galectin-3 molecules relative to a control indicates that the subject has muscular dystrophy. In some embodiments, the muscular dystrophy is MDC1A, LGMD, FHMD, Beckers muscular dystrophy or DMD. In some embodiments, detecting expression comprises detecting Galectin-3. In some embodiments, increased expression of Galectin-3 molecules relative to a control indicates that the subject has a poor prognosis and a decreased chance of survival. In some embodiments, the muscular dystrophy is DMD. In some embodiments, the sample is a blood or urine sample. In some embodiments, expression is measured by real time quantitative polymerase chain reaction, microarray analysis or Western blot analysis. In some embodiments, methods of determining the effectiveness of an agent for the treatment of muscular dystrophy in a subject with muscular dystrophy are disclosed. In some embodiments, the method comprises detecting expression of Galectin-3 in a

197 sample from the subject following treatment with the agent; and comparing expression of Galectin-3 following treatment to a reference value, wherein a decrease in the expression of Galectin-3 following treatment indicates that the agent is effective for the treatment of muscular dystrophy in the subject. In some embodiments, the reference value represents an expression value of the Galectin-3 in a sample from the subject prior to treatment with the agent. In some embodiments, the muscular dystrophy is MDC1A, LGMD, FHMD, Beckers muscular dystrophy or DMD. In some embodiments, an increase or no significant decrease in Galectin-3 following treatment indicates the subject has a poor prognosis and the agent is not effective at treating muscular dystrophy. In some embodiments, decreased expression is measured by real time quantitative polymerase chain reaction, microarray analysis, ELISA or Western blot analysis. In some embodiments, methods of treating muscular dystrophy in a subject are disclosed. In some embodiments, the method comprises administering to the subject with muscular dystrophy an effective amount of an agent that decreases expression or biological activity of Galectin-3, thereby treating one or more signs or symptoms associated with muscular dystrophy increasing the subject’s chance of survival. In some embodiments, the agent reduces the biological activity of Galectin-3. In some embodiments, methods of treating a subject with galectin or a composition that includes galectin are also disclosed. For example, some embodiments provide methods of improving muscular health, such as enhancing muscle regeneration, maintenance, or repair in a subject by administering to the subject an effective amount of galectin or a composition comprising galectin, including fragments, derivatives, or analogs thereof. In a specific example, the galectin is a complete galectin protein. In further examples, the galectin is selected from Galectin-1, Galectin-3, and combinations thereof. In further examples, the galectin or galectin composition includes a substance at least substantially homologous to Galectin-1 or Galectin-3. In yet further implementations, the galectin or galectin composition comprises a polypeptide at least substantially homologous to the Galectin-1 or Galectin-3.

198

In some embodiments, methods of identifying an agent for use in treating muscular dystrophy are disclosed. In some embodiments, the method includes contacting a sample with one or more test agents under conditions sufficient for the one or more test agents to decrease the activity of Galectin-1 or galection-3; detecting activity of Galectin- 1 or galection-3 in the presence of the one or more test agents; and comparing activity of Galectin-1 or galection-3 in the presence of the one or more test agents to a reference value to determine if there is an alteration in expression of Galectin-1 or galection-3, wherein decreased expression of Galectin-1 or galection-3 indicates that the one or more test agents is of use to treat the muscular dystrophy. In some embodiments, decreased expression is measured by real time quantitative polymerase chain reaction, microarray analysis, ELISA or Western blot analysis. In some embodiments, an at least 2-fold, at least 3-fold, or at least 5-fold, decrease in the activity of Galectin-1 or galection-3 in the presence of the one or more test agents as compared to the reference value indicates the one or more test agents is of use to treat muscular dystrophy. In some embodiments, the muscular dystrophy is MDC1A, LGMD, FHMD, Beckers muscular dystrophy or DMD. In some embodiments, the muscular dystrophy is DMD.

II. Terms The following explanations of terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. The singular terms “a,” “an,” and “the” include plural referents unless context clearly indicates otherwise. Similarly, the word “or” is intended to include “and” unless the context clearly indicates otherwise. The term “comprises” means “includes.” Thus, “comprising A or B,” means “including A, B, or A and B,” without excluding additional elements. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar

199 or equivalent to those described herein can be used in the practice or testing of this disclosure, suitable methods and materials are described below. Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19- 854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632-02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8). All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. All sequences provided in the disclosed Genbank Accession numbers are incorporated herein by reference as available on August 11, 2011. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. In order to facilitate review of the various embodiments of this disclosure, the following explanations of specific terms are provided: Administration: To provide or give a subject an agent by any effective route. Exemplary routes of administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes. For example, Galectin, or compositions thereof, also may be administered to a subject using a combination of these techniques. Suitable solid or liquid pharmaceutical preparation forms are, for example, aerosols, (micro)capsules, creams, drops, drops or injectable solution in ampoule form, emulsions, granules, powders, suppositories, suspensions, syrups, tablets, coated tablets, and also preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as binders, coating agents, disintegrants, flavorings, lubricants, solubilizers, sweeteners, or swelling agents are customarily used as

200 described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of various methods for drug delivery, see Langer, “New Methods of Drug Delivery,” Science 249:1527-1533 (1990), incorporated by reference herein to the extent not inconsistent with the present disclosure. Galectin, such as Galectin-1, Galectin-3 or the disclosed compositions or other therapeutic agents of the present disclosure can be formulated into therapeutically-active pharmaceutical compositions that can be administered to a subject parenterally or orally. Parenteral administration routes include, but are not limited to epidermal, intraarterial, intramuscular (IM, and depot IM), intraperitoneal (IP), intravenous (IV), intrasternal injection or infusion techniques, intranasal (inhalation), intrathecal, injection into the stomach, subcutaneous injections (subcutaneous (SQ and depot SQ), transdermal, topical, and ophthalmic. Galectin, such as Galectin-1, Galectin-3 or the disclosed compositions or other therapeutic agent can be mixed or combined with a suitable pharmaceutically acceptable excipients to prepare pharmaceutical compositions. Pharmaceutically acceptable excipients include, but are not limited to, alumina, aluminum stearate, buffers (such as phosphates), glycine, ion exchangers (such as to help control release of charged substances), lecithin, partial glyceride mixtures of saturated vegetable fatty acids, potassium sorbate, serum proteins (such as human serum albumin), sorbic acid, water, salts or electrolytes such as cellulose-based substances, colloidal silica, disodium hydrogen phosphate, magnesium trisilicate, polyacrylates, polyalkylene glycols, such as polyethylene glycol, polyethylene-polyoxypropylene-block polymers, polyvinyl pyrrolidone, potassium hydrogen phosphate, protamine sulfate, group 1 halide salts such as sodium chloride, sodium carboxymethylcellulose, waxes, wool fat, and zinc salts, for example. Liposomal suspensions may also be suitable as pharmaceutically acceptable carriers. Upon mixing or addition of a disclosed composition, or other therapeutic agent, the resulting mixture may be a solid, solution, suspension, emulsion, or the like. These may be prepared according to methods known to those of ordinary skill in the art. The

201 form of the resulting mixture depends upon a number of factors, including the intended mode of administration and the solubility of the agent in the selected carrier. Pharmaceutical carriers suitable for administration of galectin, such as Galectin-1, Galectin-3 or the disclosed compositions or other therapeutic agent include any such carriers known to be suitable for the particular mode of administration. In addition, galectin, such as Galectin-1, Galectin-3 or the disclosed composition or other therapeutic substance can also be mixed with other inactive or active materials that do not impair the desired action, or with materials that supplement the desired action, or have another action. Methods for solubilizing may be used where the agents exhibit insufficient solubility in a carrier. Such methods are known and include, but are not limited to, dissolution in aqueous sodium bicarbonate, using cosolvents such as dimethylsulfoxide (DMSO), and using surfactants such as TWEEN® (ICI Americas, Inc., Wilmington, DE). Galectin, such as Galectin-1, Galectin-3 or the disclosed compositions or other therapeutic agent can be prepared with carriers that protect them against rapid elimination from the body, such as coatings or time-release formulations. Such carriers include controlled release formulations, such as, but not limited to, microencapsulated delivery systems. The galectin, such as Galectin-1, Galectin-3 or other therapeutic agent is included in the pharmaceutically acceptable carrier in an amount sufficient to exert a therapeutically useful effect, typically in an amount to avoid undesired side effects, on the treated subject. The therapeutically effective concentration may be determined empirically by testing the compounds in known in vitro and in vivo model systems for the treated condition. For example, mouse models of muscular dystrophy may be used to determine effective amounts or concentrations that can then be translated to other subjects, such as humans, as known in the art. Injectable solutions or suspensions can be formulated, using suitable non-toxic, parenterally-acceptable diluents or solvents, such as 1,3-butanediol, isotonic sodium chloride solution, mannitol, Ringer’s solution, saline solution, or water; or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid; a naturally

202 occurring vegetable oil such as coconut oil, cottonseed oil, peanut oil, sesame oil, and the like; glycerine; polyethylene glycol; propylene glycol; or other synthetic solvent; antimicrobial agents such as benzyl alcohol and methyl parabens; antioxidants such as ascorbic acid and sodium bisulfite; buffers such as acetates, citrates, and phosphates; chelating agents such as ethylenediaminetetraacetic acid (EDTA); agents for the adjustment of tonicity such as sodium chloride and dextrose; and combinations thereof. Parenteral preparations can be enclosed in ampoules, disposable syringes, or multiple dose vials made of glass, plastic, or other suitable material. Buffers, preservatives, antioxidants, and the like can be incorporated as required. Where administered intravenously, suitable carriers include physiological saline, phosphate-buffered saline (PBS), and solutions containing thickening and solubilizing agents such as glucose, polyethylene glycol, polypropyleneglycol, and mixtures thereof. Liposomal suspensions, including tissue-targeted liposomes, may also be suitable as pharmaceutically acceptable carriers. For topical application, galectin, such as Galectin-1, Galectin-3 or the disclosed compositions or other therapeutic agent may be made up into a cream, lotion, ointment, solution, or suspension in a suitable aqueous or non-aqueous carrier. Topical application can also be accomplished by transdermal patches or bandages which include the therapeutic substance. Additives can also be included, e.g., buffers such as sodium metabisulphite or disodium edetate; preservatives such as bactericidal and fungicidal agents, including phenyl mercuric acetate or nitrate, benzalkonium chloride, or chlorhexidine; and thickening agents, such as hypromellose. If galectin, such as Galectin-1, Galectin-3 or a disclosed composition or other therapeutic agent is administered orally as a suspension, the pharmaceutical compositions can be prepared according to techniques well known in the art of pharmaceutical formulation and may contain a suspending agent, such as alginic acid or sodium alginate, bulking agent, such as microcrystalline cellulose, a viscosity enhancer, such as methylcellulose, and sweeteners/flavoring agents. Oral liquid preparations can contain conventional additives such as suspending agents, e.g., gelatin, glucose syrup, hydrogenated edible fats, methyl cellulose, sorbitol, and syrup; emulsifying agents, e.g.,

203 acacia, lecithin, or sorbitan monooleate; non-aqueous carriers (including edible oils), e.g., almond oil, fractionated coconut oil, oily esters such as glycerine, propylene glycol, or ethyl alcohol; preservatives such as methyl or propyl p-hydroxybenzoate or sorbic acid; and, if desired, conventional flavoring or coloring agents. When formulated as immediate release tablets, these compositions can contain dicalcium phosphate, lactose, magnesium stearate, microcrystalline cellulose, and starch and/or other binders, diluents, disintegrants, excipients, extenders, and lubricants. If oral administration is desired, the galectin, such as Galectin-1, Galectin-3 or a disclosed composition, or other therapeutic substance can be provided in a composition that protects it from the acidic environment of the stomach. For example, Galectin-1, Galectin-3 or a disclosed composition, or other therapeutic agent can be formulated with an enteric coating that maintains its integrity in the stomach and releases the active compound in the intestine. The Galectin-1, Galectin-3 or a disclosed composition, or other therapeutic agent can also be formulated in combination with an antacid or other such ingredient. Oral compositions generally include an inert diluent or an edible carrier and can be compressed into tablets or enclosed in gelatin capsules. For the purpose of oral therapeutic administration, the galectin, such as Galectin-1, Galectin-3, or disclosed composition, or other therapeutic substance can be incorporated with excipients and used in the form of capsules, tablets, or troches. Pharmaceutically compatible adjuvant materials or binding agents can be included as part of the composition. The capsules, pills, tablets, troches, and the like can contain any of the following ingredients or compounds of a similar nature: a binder such as, but not limited to, acacia, corn starch, gelatin, gum tragacanth, polyvinylpyrrolidone, or sorbitol; a filler such as calcium phosphate, glycine, lactose, microcrystalline cellulose, or starch; a disintegrating agent such as, but not limited to, alginic acid and corn starch; a lubricant such as, but not limited to, magnesium stearate, polyethylene glycol, silica, or talc; a gildant, such as, but not limited to, colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; disintegrants such as potato starch; dispersing or wetting agents such as sodium lauryl sulfate; and a flavoring agent such as peppermint, methyl salicylate, or fruit flavoring.

204

When the dosage unit form is a capsule, it can contain, in addition to material of the above type, a liquid carrier, such as a fatty oil. In addition, dosage unit forms can contain various other materials that modify the physical form of the dosage unit, for example, coatings of sugar and other enteric agents. The galectin, such as Galectin-1, Galectin-3 or disclosed composition, or other therapeutic agent can also be administered as a component of an elixir, suspension, syrup, wafer, tea, chewing gum, or the like. A syrup may contain, in addition to the active compounds, sucrose or glycerin as a sweetening agent and certain preservatives, dyes and colorings, and flavors. When administered orally, the compounds can be administered in usual dosage forms for oral administration. These dosage forms include the usual solid unit dosage forms of tablets and capsules as well as liquid dosage forms such as solutions, suspensions, and elixirs. When the solid dosage forms are used, they can be of the sustained release type so that the compounds need to be administered less frequently. Agent: Any protein, nucleic acid molecule (including chemically modified nucleic acids), compound, antibody, small molecule, organic compound, inorganic compound, or other molecule of interest. Agent can include a therapeutic agent, a diagnostic agent or a pharmaceutical agent. A therapeutic or pharmaceutical agent is one that alone or together with an additional compound induces the desired response (such as inducing a therapeutic or prophylactic effect when administered to a subject, including treating a subject with a muscular dystrophy). In some examples, an agent can act directly or indirectly to alter the activity of Galectin-1 and/or Galectin-3. In a particular example, a therapeutic agent (such as a siRNA or antibody to Galectin-1 and/or Galectin-3) significantly reduces the expression and/or activity of a muscular dystrophy associated molecule thereby increasing a subject’s survival time. An example of a therapeutic agent is one that can decrease the activity of a gene or gene product associated with muscular dystrophy, for example as measured by a clinical response (such as an increase survival time or a decrease in one or more signs or symptoms associated with the muscular dystrophy). Therapeutically agents also include organic or other chemical compounds that mimic the effects of the therapeutically effective peptide, antibody, or nucleic acid molecule.

205

A “pharmaceutical agent” is a chemical compound or composition capable of inducing a desired therapeutic or prophylactic effect when administered to a subject, alone or in combination with another therapeutic agent(s) or pharmaceutically acceptable carriers. In a particular example, a pharmaceutical agent significantly reduces the expression and/or activity of a muscular dystrophy associated molecule thereby increasing a subject’s survival time. Antibody: A polypeptide including at least a light chain or heavy chain immunoglobulin variable region which specifically recognizes and binds an epitope of an antigen, such as a muscular dystrophy-associated molecule or a fragment thereof. Antibodies are composed of a heavy and a light chain, each of which has a variable region, termed the variable heavy (VH) region and the variable light (VL) region.

Together, the VH region and the VL region are responsible for binding the antigen recognized by the antibody. Antibodies of the present disclosure include those that are specific for a muscular dystrophy-associated molecule, such as Galectin-1 or Galectin-3. The term antibody includes intact immunoglobulins, as well the variants and portions thereof, such as Fab' fragments, F(ab)'2 fragments, single chain Fv proteins (“scFv”), and disulfide stabilized Fv proteins (“dsFv”). A scFv protein is a fusion protein in which a light chain variable region of an immunoglobulin and a heavy chain variable region of an immunoglobulin are bound by a linker, while in dsFvs, the chains have been mutated to introduce a disulfide bond to stabilize the association of the chains. The term also includes genetically engineered forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL); Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York, 1997. Typically, a naturally occurring immunoglobulin has heavy (H) chains and light (L) chains interconnected by disulfide bonds. There are two types of light chain, lambda λ) and kappa (k). There are five main heavy chain classes (or isotypes) which determine the functional activity of an antibody molecule: IgM, IgD, IgG, IgA and IgE. Each heavy and light chain contains a constant region and a variable region, (the regions are also known as “domains”). In combination, the heavy and the light chain

206 variable regions specifically bind the antigen. Light and heavy chain variable regions contain a "framework" region interrupted by three hypervariable regions, also called “complementarity-determining regions” or “CDRs”. The extent of the framework region and CDRs have been defined (see, Kabat et al., Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services, 1991). The Kabat database is now maintained online. The sequences of the framework regions of different light or heavy chains are relatively conserved within a species. The framework region of an antibody, that is the combined framework regions of the constituent light and heavy chains, serves to position and align the CDRs in three-dimensional space. The CDRs are primarily responsible for binding to an epitope of an antigen. The CDRs of each chain are typically referred to as CDR1, CDR2, and CDR3, numbered sequentially starting from the N-terminus, and are also typically identified by the chain in which the particular CDR is located. Thus, a VH CDR3 is located in the variable domain of the heavy chain of the antibody in which it is found, whereas a VL CDR1 is the CDR1 from the variable domain of the light chain of the antibody in which it is found. An antibody that binds RET will have a specific VH region and the VL region sequence, and thus specific CDR sequences. Antibodies with different specificities (such as different combining sites for different antigens) have different CDRs. Although it is the CDRs that vary from antibody to antibody, only a limited number of amino acid positions within the CDRs are directly involved in antigen binding. These positions within the CDRs are called specificity determining residues (SDRs).

References to “VH” or “VH” refer to the variable region of an immunoglobulin heavy chain, including that of an Fv, scFv, dsFv or Fab. References to “VL” or “VL” refer to the variable region of an immunoglobulin light chain, including that of an Fv, scFv, dsFv or Fab. A “monoclonal antibody” is an antibody produced by a single clone of B-lymphocytes or by a cell into which the light and heavy chain genes of a single antibody have been transfected. Monoclonal antibodies are produced by methods known to those of skill in the art, for instance by making hybrid antibody-forming cells from a

207 fusion of myeloma cells with immune spleen cells. Monoclonal antibodies include humanized monoclonal antibodies. A “polyclonal antibody” is an antibody that is derived from different B-cell lines. Polyclonal antibodies are a mixture of immunoglobulin molecules secreted against a specific antigen, each recognizing a different epitope. These antibodies are produced by methods known to those of skill in the art, for instance, by injection of an antigen into a suitable mammal (such as a mouse, rabbit or goat) that induces the B-lymphocytes to produce IgG immunoglobulins specific for the antigen, which are then purified from the mammal’s serum. A “chimeric antibody” has framework residues from one species, such as human, and CDRs (which generally confer antigen binding) from another species, such as a murine antibody that specifically binds a muscular dystrophy-associated molecule. A "humanized" immunoglobulin is an immunoglobulin including a human framework region and one or more CDRs from a non-human (for example a mouse, rat, or synthetic) immunoglobulin. The non-human immunoglobulin providing the CDRs is termed a “donor,” and the human immunoglobulin providing the framework is termed an “acceptor.” In one example, all the CDRs are from the donor immunoglobulin in a humanized immunoglobulin. Constant regions need not be present, but if they are, they are ly identical to human immunoglobulin constant regions, e.g., at least about 85-90%, such as about 95% or more identical. Hence, all parts of a humanized immunoglobulin, except possibly the CDRs, are substantially identical to corresponding parts of natural human immunoglobulin sequences. Humanized immunoglobulins can be constructed by means of genetic engineering (see for example, U.S. Patent No. 5,585,089). Alteration or modulation in expression: An alteration in expression of a gene, gene product or modulator thereof, such as one or more muscular dystrophy associated molecules disclosed herein, refers to a change or difference, such as an increase or decrease, in the level of the gene, gene product, or modulators thereof that is detectable in a biological sample (such as a sample from a subject at risk or having muscular dystrophy) relative to a control (such as a sample from a subject without a muscular dystrophy) or a reference value known to be indicative of the level of the gene, gene

208 product or modulator thereof in the absence of the disease. An “alteration” in expression includes an increase in expression (up-regulation) or a decrease in expression (downregulation). Analog: A compound which is sufficiently homologous to a compound such that it has a similar functional activity for a desired purpose as the original compound. Analogs include polypeptides having one or more amino acid substitutions compared with a particular substance. At least substantially homologous: A phrase used in the present disclosure, refers to a degree of homology sufficient to produce at least a portion of the activity of a reference material in muscle regeneration, maintenance or repair, or wound healing. In some examples, materials are at least substantially homologous when they are at least about 95%, at least about 98%, or at least about 99% homologous to a reference material. Biological activity: The beneficial or adverse effects of an agent on living matter. When the agent is a complex chemical mixture, this activity is exerted by the substance's active ingredient or pharmacophore, but can be modified by the other constituents. Activity is generally dosage-dependent and it is not uncommon to have effects ranging from beneficial to adverse for one substance when going from low to high doses. In one example, the agent significantly reduces the biological activity of the one or more muscular dystrophy associated molecules disclosed herein which reduces one or more signs or symptoms associated with the muscular dystrophy. Biomarkers: Natural substances produced by the body that are used as indicators of specific biological states. Biomarkers allow conditions, including diseases to be diagnosed, progression of such monitored, as well as to test the efficacy of disease treatments. The muscular dystrophies are one group of diseases with a lack of biomarkers. Serum creatine kinase (a byproduct of muscle breakdown) levels have previously been used as a biomarker for muscular dystrophy but do not accurately follow the progression of the disease. Disclosed herein are biomarkers for muscular dystrophy. In particular examples, the biomarker indicates a particular type of muscular dystrophy to be present or the severity of the condition (e.g., an increase in the level of Galectin-3 indicates a poor prognosis).

209

Contacting: Placement in direct physical association, including both a solid and liquid form. Contacting an agent with a cell can occur in vitro by adding the agent to isolated cells or in vivo by administering the agent to a subject. Control: A sample or standard used for comparison with a test sample, such as a biological sample obtained from a patient (or plurality of patients) without a particular disease or condition, such as a muscular dystrophy. In some embodiments, the control is a sample obtained from a healthy patient (or plurality of patients) (also referred to herein as a “normal” control), such as a normal biological sample. In some embodiments, the control is a historical control or standard value (e.g., a previously tested control sample or group of samples that represent baseline or normal values (e.g., expression values), such as baseline or normal values of a particular gene, gene product in a subject without a muscular dystrophy). In some examples, the control is a standard value representing the average value (or average range of values) obtained from a plurality of patient samples (such as an average value or range of values of the gene or gene products in the subjects without a muscular dystrophy). Decrease: To reduce the quality, amount, or strength of something. In one example, a therapy decreases one or more symptoms associated with the muscular dystrophy, for example as compared to the response in the absence of the therapy. In a particular example, a therapy decreases (also known as down-regulates) the expression of a muscular dystrophy-associated molecule, such as a decrease of at least 10%, at least 20%, at least 50%, or even at least 90% in Galectin-1 or Galectin-3 expression, thereby increasing a subject’s chance of survival. In some examples, a decrease in expression refers to any process which results in a decrease in production of one or more molecules associated with muscular dystrophy, such as Galectin-1 or Galectin-3. A gene product can be RNA (such as mRNA, rRNA, tRNA, and structural RNA) or protein. Therefore, gene downregulation or deactivation includes processes that decrease transcription of a gene or translation of mRNA. Examples of processes that decrease transcription include those that facilitate degradation of a transcription initiation complex, those that decrease transcription initiation rate, those that decrease transcription elongation rate, those that decrease

210 processivity of transcription and those that increase transcriptional repression. Gene downregulation can include reduction of expression above an existing level. Examples of processes that decrease translation include those that decrease translational initiation, those that decrease translational elongation and those that decrease mRNA stability. Gene downregulation includes any detectable decrease in the production of a gene product. In certain examples, production of a gene product decreases by at least 2-fold, for example at least 3-fold or at least 4-fold, as compared to a control (such an amount of gene expression in a normal cell). In one example, a control is a relative amount of gene expression or protein expression in a biological sample taken from a subject who does not have muscular dystrophy, such as DMD or MDC1A. Such decreases can be measured using the methods disclosed herein. For example, “detecting or measuring expression of a gene product” includes quantifying the amount of the gene, gene product or modulator thereof present in a sample. Quantification can be either numerical or relative. Detecting expression of the gene, gene product or modulators thereof can be achieved using any method known in the art or described herein, such as by measuring nucleic acids by PCR (such as RT-PCR) and proteins by ELISA. In primary embodiments, the change detected is an increase or decrease in expression as compared to a control, such as a reference value or a healthy control subject. In some examples, the detected increase or decrease is an increase or decrease of at least two-fold compared with the control or standard. Controls or standards for comparison to a sample, for the determination of differential expression, include samples believed to be normal (in that they are not altered for the desired characteristic, for example a sample from a subject who does not have muscular dystrophy, such as DMD or MDC1A) as well as laboratory values (e.g., range of values), even though possibly arbitrarily set, keeping in mind that such values can vary from laboratory to laboratory. Laboratory standards and values can be set based on a known or determined population value and can be supplied in the format of a graph or table that permits comparison of measured, experimentally determined values. In other examples, the detected increase or decrease is a change rounded down to the nearest whole number (so that both 2.05 and 2.67 are rounded down to 2) of the fold

211 change shown for a gene, gene product or modulator thereof in the Example Section, or is rounded to the nearest whole number (so that 2.05 would be rounded to 2 and 2.67 would be rounded to 3). In other embodiments of the methods, the increase or decrease is of a diagnostically significant amount, which refers to a change of a sufficient magnitude to provide a statistical probability of the diagnosis. The level of expression in either a qualitative or quantitative manner can detect nucleic acid or protein. Exemplary methods include microarray analysis, RT-PCR, Northern blot, Western blot, and mass spectrometry. Derivative: A form of a substance, such as a laminin or portion thereof, which has at least one functional group altered, added, or removed, compared with the parent compound. Diagnosis: The process of identifying a disease, such as muscular dystrophy, by its signs, symptoms and results of various tests. The conclusion reached through that process is also called “a diagnosis.” Forms of testing commonly performed include blood tests, medical imaging, urinalysis, and biopsy. Effective amount: An amount of agent that is sufficient to generate a desired response, such as reducing or inhibiting one or more signs or symptoms associated with a condition or disease. When administered to a subject, a dosage will generally be used that will achieve target tissue/cell concentrations. In some examples, an “effective amount” is one that treats one or more symptoms and/or underlying causes of any of a disorder or disease. In some examples, an “effective amount” is a therapeutically effective amount in which the agent alone with an additional therapeutic agent(s) (for example anti-pathogenic agents), induces the desired response such as treatment of a muscular dystrophy, such as DMD, LGMD, FHMD, Beckers muscular dystrophy or MDC1A. In particular examples, it is an amount of an agent capable of modulating one or more of the disclosed genes, gene products or modulators thereof associated with a muscular dystrophy by least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100% (elimination of the disease to a point beyond detection) by the agent.

212

In some examples, an effective amount is an amount of a pharmaceutical preparation that alone, or together with a pharmaceutically acceptable carrier or one or more additional therapeutic agents, induces the desired response. In one example, a desired response is to increase the subject’s survival time by slowing the progression of the disease. The disease does not need to be completely inhibited for the pharmaceutical preparation to be effective. For example, a pharmaceutical preparation can decrease the progression of the disease by a desired amount, for example by at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100%, as compared to the progression typical in the absence of the pharmaceutical preparation. In another or additional example, it is an amount sufficient to partially or completely alleviate symptoms of the muscular dystrophy within the subject. Treatment can involve only slowing the progression of the disease temporarily, but can also include halting or reversing the progression of the disease permanently. Effective amounts of the agents described herein can be determined in many different ways, such as assaying for a reduction in of one or more signs or symptoms associated with the muscular dystrophy in the subject or measuring the expression level of one or more molecules known to be associated with the muscular dystrophy. Effective amounts also can be determined through various in vitro, in vivo or in situ assays, including the assays described herein. The disclosed therapeutic agents can be administered in a single dose, or in several doses, for example daily, during a course of treatment. However, the effective amount can be dependent on the source applied (for example a nucleic acid molecule isolated from a cellular extract versus a chemically synthesized and purified nucleic acid), the subject being treated, the severity and type of the condition being treated, and the manner of administration. Expression: The process by which the coded information of a gene is converted into an operational, non-operational, or structural part of a cell, such as the synthesis of a protein. Gene expression can be influenced by external signals. For instance, exposure of a cell to a hormone may stimulate expression of a hormone-induced gene. Different

213 types of cells can respond differently to an identical signal. Expression of a gene also can be regulated anywhere in the pathway from DNA to RNA to protein. Regulation can include controls on transcription, translation, RNA transport and processing, degradation of intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization or degradation of specific protein molecules after they are produced. In an example, gene expression can be monitored to diagnosis and/or prognosis a subject with muscular dystrophy, such as predict a subject’s survival time with DMD, LGMD or MDC1A. The expression of a nucleic acid molecule can be altered relative to a normal (wild type) nucleic acid molecule. Alterations in gene expression, such as differential expression, include but are not limited to: (1) overexpression; (2) underexpression; or (3) suppression of expression. Alternations in the expression of a nucleic acid molecule can be associated with, and in fact cause, a change in expression of the corresponding protein. Protein expression can also be altered in some manner to be different from the expression of the protein in a normal (wild type) situation. This includes but is not necessarily limited to: (1) a mutation in the protein such that one or more of the amino acid residues is different; (2) a short deletion or addition of one or a few (such as no more than 10-20) amino acid residues to the sequence of the protein; (3) a longer deletion or addition of amino acid residues (such as at least 20 residues), such that an entire protein domain or sub-domain is removed or added; (4) expression of an increased amount of the protein compared to a control or standard amount; (5) expression of a decreased amount of the protein compared to a control or standard amount; (6) alteration of the subcellular localization or targeting of the protein; (7) alteration of the temporally regulated expression of the protein (such that the protein is expressed when it normally would not be, or alternatively is not expressed when it normally would be); (8) alteration in stability of a protein through increased longevity in the time that the protein remains localized in a cell; and (9) alteration of the localized (such as organ or tissue specific or subcellular localization) expression of the protein (such that the protein is not expressed where it would normally be expressed or is expressed where it normally would not be expressed), each compared to a control or standard. Controls or standards for comparison to a

214 sample, for the determination of differential expression, include samples believed to be normal (in that they are not altered for the desired characteristic, for example a sample from a subject who does not have muscular dystrophy, such as DMD or MDC1A) as well as laboratory values (e.g., range of values), even though possibly arbitrarily set, keeping in mind that such values can vary from laboratory to laboratory. Laboratory standards and values can be set based on a known or determined population value and can be supplied in the format of a graph or table that permits comparison of measured, experimentally determined values. Extracellular matrix: The extracellular structure of a tissue or a layer thereof, including the arrangement, composition, and forms of one or more matrix components, such as proteins, including structural proteins such as collagen and elastin, proteins such as fibronectin and laminins, and proteoglycans. The matrix may comprise fibrillic collagen, having a network of fibers. In some examples, the extracellular matrix is connected to cells through the costameric protein network. Fragment: A portion of a substance, such as galectin. A fragment may be, in some examples, a particular domain or chain of a protein. For example, particular embodiments of the present disclosure involve administering a fragment of galectin, such as a fragment of Galectin-1 or Galectin-3. Fragments may be synthetic or may be derived from larger parent substances. Functional group: A radical, other than a hydrocarbon radical, that adds a physical or chemical property to a substance. Galectins: -galactoside-binding animal lectins that modulate extracellular matrix interactions, cell attachment and differentiation, as well as cancer invasion and metastasis. Fifteen mammalian galectins have been identified thus far, with Galectin-1 and Galectin-3 being two of the most well characterized. Galectin-1 is encoded by the Lgals1 gene, located on chromosome 22q12. Galectin-1, approximately 15 kDa in size, binds to a number of extracellular matrix components, such as laminin, as well as with several integrins, including the α71 integrin. It is present both intracellularly and extracellularly and has been shown to play a role in immunosupression, cell-growth regulation, cell apoptosis and pre-mRNA slicing. Galectin-1 is found in skeletal muscle

215 and has been implicated in the conversion of dermal fibroblasts to muscle due to its competition with laminin for α71 integrin binding. . Galectin-3, about 30 kDa in size, is encoded by the Lgals3 gene, located on chromosome 14q22. This protein has a carboxyl-terminal domain that binds carbohydrates and an amino terminal domain that cross-links carbohydrate and noncarbohydrate ligands. Similar to Galectin-1, Galectin-3 is also found both intracellularly and extracellularly. Intracellularly, Galectin-3 has been shown to regulate the cell cycle and apoptosis. Extracellularly, Galectin-3 works to mediate cell-cell interactions as well as cell-extracellular matrix interactions. Galectin-3 is also expressed and secreted by macrophages and monocytes. Galectin-3 is specifically upregulated during monocyte differentiation, and downregulated during differentiation into dendritic cells. In some examples, expression of Galectin-1 is increased in a subject with muscular dystrophy, such as with DMD, MDC1A, FHMD, Beckers muscular dystrophy or LGMD. The term Galectin-1 includes any Galectin-1 gene, cDNA, mRNA, or protein from any organism and that is Galectin-1 and is expressed in a sample from a subject with muscular dystrophy such as DMD, LGMD, FHMD, Beckers muscular dystrophy or MDC1A. In some examples, expression of Galectin-3 is increased in a subject with muscular dystrophy, such as with DMD, MDC1A, FHMD, Beckers muscular dystrophy or LGMD. The term Galectin-3 includes any Galectin-3 gene, cDNA, mRNA, or protein from any organism and that is Galectin-3 and is expressed in a sample from a subject with muscular dystrophy such as DMD, LGMD, FHMD, Beckers muscular dystrophy or MDC1A. Nucleic acid and protein sequences for Galectin-1 and Galectin-3 are publicly available. For example, GENBANK® Accession Nos: NM_002306; NM_003225; NM_00177388 disclose Galectin-1 nucleic acid sequences, and GENBANK® Accession No.: NP_002296 discloses a Galectin-1 protein sequence, all of which are incorporated by reference as provided by GENBANK® on August 11, 2011; GENBANK® Accession

216

No. NP_032521.1 also provides a Galectin-1 protein sequence which is incorporated by reference in its entirety as provided by GENBANK® on August 10, 2012. GENBANK® Accession Nos: NM_001177388; NM_002306; NP_003225 disclose Galectin-3 nucleic acid sequences, and GENBANK® Accession Nos.:_BA22164 discloses a Galectin-3 protein sequence, all of which are incorporated by reference as provided by GENBANK® on August 11, 2011; GENBANK® Accession No. NP_034835.1 also provides a Galectin-3 protein sequence which is incorporated by reference in its entirety as provided by GENBANK® on August 10, 2012. In one example, Galectin-1 includes a full-length wild-type (or native) sequence, as well as Galectin-1 allelic variants, fragments, homologs or fusion sequences, such as Galectin-1 allelic variants, fragments, homologs or fusion sequences that retain the ability to increase α7 integrin expression or biological activity. In certain examples, Galectin-1 has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to Galectin-1. In one example, Galectin-3 includes a full-length wild-type (or native) sequence, as well as Galectin-3 allelic variants, fragments, homologs or fusion sequences, such as Galectin-3 allelic variants, fragments, homologs or fusion sequences that retain the ability to increase α7 integrin expression or biological activity. In certain examples, Galectin-3 has at least 80% sequence identity, for example at least 85%, 90%, 95%, or 98% sequence identity to Galectin-3. Improving muscular health: An improvement in muscular health compared with a preexisting state or compared with a state which would occur in the absence of treatment. For example, improving muscular health may include enhancing muscle regeneration, maintenance, or repair. Improving muscular health may also include prospectively treating a subject to prevent or reduce muscular damage or injury. Inhibiting a disease or condition: A phrase referring to inhibiting the development of a disease or condition, such as reducing, decreasing or delaying a sign or symptom associated with the disease or condition, for example, in a subject who is at risk of acquiring the disease/condition or has the particular disease/condition. Particular methods of the present disclosure provide methods for inhibiting muscular dystrophy.

217

Label: An agent capable of detection, for example by ELISA, spectrophotometry, flow cytometry, or microscopy. For example, a label can be attached to a nucleic acid molecule or protein (such as Galectin-1 or Galectin-3), thereby permitting detection of the nucleic acid molecule or protein. Examples of labels include, but are not limited to, radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent agents, fluorophores, haptens, enzymes, and combinations thereof. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed for example in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998). In a particular example, a label is conjugated to an agent that binds to one or more of the muscular dystrophy associated molecules, such as Galectin-1 or Galectin-3, to allow for the detection and prognosis of the disease in a subject. Maintenance of cells or tissue: A phrase refers to maintaining cells or tissue, such as muscle cells or muscle tissue, in at least substantially the same physiological condition, such as maintaining such condition even in the presence of stimulus which would normally cause damage, injury, or disease. Muscle: Any myoblast, myocyte, myofiber, myotube or other structure composed of muscle cells. Muscles or myocytes can be skeletal, smooth, or cardiac. Muscle may also refer to, in particular implementations of the present disclosure, cells or other materials capable of forming myocytes, such as stem cells and satellite cells. Muscular dystrophy: A term used to refer to a group of genetic disorders that lead to progressive muscle weakness. Muscular dystrophy can result in skeletal muscle weakness and defects in skeletal muscle proteins, leading to a variety of impaired physiological functions. No satisfactory treatment of muscular dystrophy exists. Existing treatments typically focus on ameliorating the effects of the disease and improving the patient’s quality of life, such as through physical therapy or through the provision of orthopedic devices. Mutated genes associated with muscular dystrophy are responsible for encoding a number of proteins associated with the costameric protein network. Such proteins

218 include laminin-2, collagen, dystroglycan, integrins, caveolin-3, ankyrin, dystrophin, α- dystrobrevin, vinculin, plectin, BPAG1b, muscle LIM protein, desmin, actinin-associated LIM protein, α-actin, titin, telethonin, cypher, myotilin, and the sarcoglycan/sarcospan complex. The most common form of muscular dystrophy is Duchenne muscular dystrophy (DMD), affecting 1 in 3,500 live male births. DMD is an X-linked recessive disorder characterized by a mutation in the gene that codes for dystrophin. Dystrophin is a cytoskeletal protein about 430 kDa in size. This protein works to connect the cell’s cytoskeleton and extracellular matrix. The loss of dystrophin in DMD patients leads to a loss of muscle fiber attachment at the extracellular matrix during contraction, which ultimately leads to progressive fiber damage, membrane leakage and a loss of muscle function. Most patients die before they reach the age of 30 due to respiratory or cardiac failure. Beckers muscular dystrophy (also known as Benign pseudohypertrophic muscular dystrophy) is related to Duchenne muscular dystrophy in that both result from a mutation in the dystrophin gene, but in Duchenne muscular dystrophy no functional dystrophin is produced making DMD much more severe than BMD. BMD is an X- linked recessive inherited disorder characterized by slowly progressive muscle weakness of the legs and pelvis. BMD is a type of dystrophinopathy, which includes a spectrum of muscle diseases in which there is insufficient dystrophin produced in the muscle cells, results in instability in the structure of muscle cell membrane. This is caused by mutations in the dystrophin gene, which encodes the protein dystrophin. The pattern of symptom development of BMD is similar to DMD, but with a later, and much slower rate of progression. Congenital muscular dystrophies are caused by gene mutations affecting the production of other costameric proteins. MDC1A is a congential muscular dystrophy due to a genetic mutation in the LAMA2 gene which results in lack of or complete loss of laminin-α2 protein. This loss of laminin-α2 leads to an absence of laminins-211/221. Laminins-211/221 are major components of the extracellular matrix and play a key role in muscle cell development. During muscle cell differentiation laminin binds to the α71

219 integrin. Without laminin-α2, muscle fibers are unable to adhere to the basement membrane and myotubes undergo apotosis. Muscle regeneration also fails, leading to a loss of muscle repair and an increase in muscle fibrosis and inflammation. This chronic tissue injury is a major cause of morbidity and mortality in MDC1A. Congenital Muscular Dystrophies (CMD) and Limb-Girdle muscular dystrophy (LGMD) are common forms of highly heterogeneous muscular dystrophies which can be distinguished by their age at onset. In CMD, onset of symptoms is at birth or within the first 6 months of life; in LGMD onset of symptoms is in late childhood, adolescence or even adult life. Inheritance in LGMD can be autosomal dominant (LGMD type 1) or autosomal recessive (LGMD type 2), CMD is recessively inherited. CMD and LGMD can overlap both clinically and genetically MDC1A is a progressive muscle wasting disease that results in children being confined to a wheelchair, requiring ventilator assistance to breathe and premature death. Symptoms are detected at birth with poor muscle tone and “floppy” baby syndrome. DMD, BMD and LGMD are progressive muscle degenerative diseases usually diagnosed at 3-5 years of age when children show developmental delay including ability to walk and climb stairs. The disease is progressive and children are usually confined to a wheelchair in their teens and require ventilator assistance. Facioscapulohumeral muscular dystrophy (FHMD) is a form of muscular dystrophy associated with progressive muscle weakness and loss of muscle tissue. Unlike DMD and BMD which mainly affect the lower body, FHMD affects the upper body mainly the face, shoulder and upper arm muscles. However, it can affect muscles around the pelvis, hips, and lower leg. Symptoms for FHMD often do not appear until age 10 - 26, but it is not uncommon for symptoms to appear much later. In some cases, symptoms never develop. Symptoms are usually mild and very slowly become worse. Facial muscle weakness is common, and may include eyelid drooping, inability to whistle, decreased facial expression, depressed or angry facial expression, difficulty pronouncing words, shoulder muscle weakness (leading to deformities such as pronounced shoulder blades (scapular winging) and sloping shoulders), weakness of the lower, hearing loss and possible heart conditions.

220

Muscular dystrophy-associated molecule: A molecule whose expression or biological activity is altered in subject with muscular dystrophy. Such molecules include, for instance, nucleic acid sequences (such as DNA, cDNA, or mRNAs) and proteins. Specific genes include those disclosed herein, including the Examples, as well as fragments of the full-length genes, cDNAs, or mRNAs (and proteins encoded thereby) whose expression is altered (such as upregulated or downregulated) in response to muscular dystrophy, including DMD, LGMD, FHMD, Beckers muscular dystrophy and/or MDC1A. Thus, the presence or absence of the respective muscular dystrophy- associated molecules can be used to diagnose and/or determine the prognosis of a muscular dystrophy, and in particular DMD, LGMD, FHMD, Beckers muscular dystrophy or MDC1A in a subject as well as to treat a subject with a muscular dystrophy, such as DMD, LGMD, FHMD, Beckers muscular dystrophy or MDC1A. In some examples, it is a molecule associated with one or more signs or symptoms of a muscular dystrophy-associated condition or disease. In some examples, a muscular dystrophy- associated molecule is one or more molecules associated with DMD, LGMD, FHMD, Beckers muscular dystrophy and/or MDC1A, such as Galectin-1 or Galectin-3. Pharmaceutically acceptable carriers: The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 19th Edition (1995), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic agents, such as one or more compositions that include a binding agent that specifically binds to at least one of the disclosed muscular dystrophy-associated molecules. In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations can include injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents

221 and the like, for example sodium acetate or sorbitan monolaurate, sodium lactate, potassium chloride, calcium chloride, and triethanolamine oleate. Polymerase Chain Reaction (PCR): An in vitro amplification technique that increases the number of copies of a nucleic acid molecule (for example, a nucleic acid molecule in a sample or specimen). In an example, a biological sample collected from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for the hybridization of the primers to nucleic acid template in the sample (such as those listed in Example 1 or 2). The primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid. The product of a PCR can be characterized by electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing, using standard techniques or other standard techniques known in the art. Prognosis: A prediction of the course of a disease, such as muscular dystrophy. The prediction can include determining the likelihood of a subject to develop aggressive, recurrent disease, to survive a particular amount of time (e.g. determine the likelihood that a subject will survive 1, 2, 3 or 5 years), to respond to a particular therapy or combinations thereof. Regeneration: The repair of cells or tissue, such as muscle cells or tissue (or organs) which includes muscle cells, following injury or damage to at least partially restore the muscle or tissue to a condition similar to which the cells or tissue existed before the injury or damage occurred. Regeneration also refers to facilitating repair of cells or tissue in a subject having a disease affecting such cells or tissue to eliminate or ameliorate the effects of the disease. In more specific examples, regeneration places the cells or tissue in the same condition or an improved physiological condition as before the injury or damage occurred or the condition which would exist in the absence of disease. Repair of cells or tissue: A phrase which refers to the physiological process of healing damage to the cells or tissue such as muscle cells or tissue (or organs) following damage or other trauma.

222

Sample (or biological sample): A biological specimen containing genomic DNA, RNA (including mRNA), protein, or combinations thereof, obtained from a subject. Examples include, but are not limited to, peripheral blood, urine, saliva, tissue biopsy, surgical specimen, and autopsy material. In one example, a sample includes muscle biopsy, such as from a subject with DMD, LGMD, FHMD, Beckers muscular dystrophy or MDC1A. Signs or symptoms: Any subjective evidence of disease or of a subject's condition, e.g., such evidence as perceived by the subject; a noticeable change in a subject's condition indicative of some bodily or mental state. A “sign” is any abnormality indicative of disease, discoverable on examination or assessment of a subject. A sign is generally an objective indication of disease. Signs include, but are not limited to any measurable parameters such as tests for detecting muscular dystrophy, including measuring creatine kinase levels, electromyography (to determine if weakness is caused by destruction of muscle tissue rather than by damage to nerves) or immunohistochemistry/immunoblotting/immunoassay (e.g., ELISA) to measure muscular dystrophy-associated molecules. In one example, reducing or inhibiting one or more symptoms or signs associated with muscular dystrophy, includes reducing or inhibiting the activity or expression of one or more disclosed muscular dystrophy-associated molecules by a desired amount, for example by at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100%, as compared to the activity and/or expression in the absence of the treatment. Symptoms of muscular dystrophy include, but are not limited to, muscle weakness and loss, difficulty running, difficulty hopping, difficulty jumping, difficulty walking, difficulty breathing, fatigue, skeletal deformities, muscle deformities (contractions of heels; pseudohypertrophy of calf muscles), heart disease (such as dilated cardiomyopathy), elevated creatine phosphokinase (CK) levels in blood or combinations thereof. Subject: Living multi-cellular vertebrate organisms, a category that includes human and non-human mammals. Therapeutically-effective amount: An amount effective for lessening, ameliorating, eliminating, preventing, or inhibiting at least one symptom of a disease,

223 disorder, or condition treated and may be empirically determined. In various embodiments of the present disclosure, a “therapeutically-effective amount” is a “muscle regeneration promoting-amount,” an amount sufficient to achieve a statistically significant promotion of tissue or cell regeneration, such as muscle cell regeneration, compared to a control. In particular, indicators of muscular health, such as muscle cell regeneration, maintenance, or repair, can be assessed through various means, including monitoring markers of muscle regeneration, such as transcription factors such as Pax7, Pax3, MyoD, MRF4, and myogenin. For example, increased expression of such markers can indicate that muscle regeneration is occurring or has recently occurred. Markers of muscle regeneration, such as expression of embryonic myosin heavy chain (eMyHC), can also be used to gauge the extent of muscle regeneration, maintenance, or repair. For example, the presence of eMyHC can indicate that muscle regeneration has recently occurred in a subject. Muscle cell regeneration, maintenance, or repair can also be monitored by determining the girth, or mean cross sectional area, of muscle cells or density of muscle fibers. Additional indicators of muscle condition include muscle weight and muscle protein content. Mitotic index (such as by measuring BrdU incorporation) and myogenesis can also be used to evaluate the extent of muscle regeneration. In particular examples, the improvement in muscle condition, such as regeneration, compared with a control is at least about 10%, such as at least about 30%, or at least about 50% or more. Tissue: An aggregate of cells, usually of a particular kind, together with their intercellular substance that form one of the structural materials of an animal and that in animals include connective tissue, epithelium, muscle tissue, and nerve tissue. Treating a disease: A therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition related to a muscular dystrophy, such as a sign or symptom of muscular dystrophy. Treatment can induce remission or cure of a condition or slow progression, for example, in some instances can include inhibiting the full development of a disease, for example preventing development of a muscular dystrophy. Prevention of a disease does not require a total absence of disease. For

224 example, a decrease of at least 20%, such as at least 30%, at least 40%, at least 50%, decrease in a sign or symptom associated with the condition or disease, such as MD, can be sufficient. As used herein, the term “ameliorating,” with reference to a disease or condition, refers to any observable beneficial effect of the treatment. The beneficial effect can be evidenced, for example, by a delayed onset of clinical symptoms of the disease or condition in a susceptible subject, a reduction in severity of some or all clinical symptoms of the disease or condition, a slower progression of the disease or condition, a reduction in the number of relapses of the disease or condition, an improvement in the overall health or well-being of the subject, by other parameters well known in the art that are specific to the particular disease or condition, and combinations of such factors.

III. Methods of Diagnosing and Prognosing Muscular Dystrophy Methods are disclosed for diagnosing and prognosing muscular dystrophy, such as DMD, LGMD, FHMD, Beckers muscular dystrophy (BMD) or MDC1A, in a subject. In one example, the methods include detecting expression of at least one (such as at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 30, at least 50, at least 80, at least 100, at least 190 or more) muscular dystrophy-associated molecules in a sample obtained from a subject either at risk of having or having one or more signs or symptoms associated with muscular dystrophy. In some examples, the muscular dystrophy-associated molecules can include, consist essentially of, or consist of disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin- α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) or any combination thereof. In some examples, muscular dystrophy-associated molecules include Galectin-1, Galectin-3, Col6A1, Itga3, Iga6, Itga7, Tnc and Timp 1. In some examples, muscular dystrophy- associated molecules include Galectin-1 and Galectin-3. In some examples, muscular dystrophy-associated molecules include Galectin-3 and Tnc. In some examples, the muscular dystrophy-associated molecules include at least Galectin-3 for detecting DMD,

225

LGMD, FHMD, BMD or MDC1A. In some examples, the muscular dystrophy- associated molecules include at least Galectin-3 for detecting DMD. “Consists essentially of” in this context indicates that the expression of additional molecules can be evaluated (such as a control), but that these molecules do not include more than the listed muscular dystrophy-associated molecules. Thus, in one example, the expression of a control, such as a housekeeping protein or rRNA can be assessed (such as 18S RNA, beta-microglobulin, GAPDH, and/or 18S rRNA). In some examples, “consist essentially of” indicates that no more than 5 other molecules are evaluated, such as no more than 4, 3, 2, or 1 other molecules. In this context “consist of” indicates that only the expression of the stated molecules are evaluated; the expression of additional molecules is not evaluated. The methods also can include comparing expression of the at least one muscular dystrophy-associated molecule in the sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy to a control, wherein an increase in the expression of the at least one muscular dystrophy- associated molecule relative to the control indicates that the subject has a decreased chance of survival. For example, an increase in the expression of Galectin-3 relative to a normal control sample or reference value (or range of values) indicates a poor prognosis, such as a decreased chance of survival. In an example, a decreased chance of survival includes a survival time of equal to or less than 50 months, such as 40 months, 30 months, 20 months, 12 months, 6 months or 3 months from time of diagnosis. Conversely, a decrease in expression of a muscular dystrophy-associated molecule or expression levels similar to those in control levels indicates a better prognosis, such as an increased chance of survival (e.g., survival time of at least 50 months from time of diagnosis, such as 60 months, 80 months, 100 months, 120 months or 150 months from time of diagnosis). For example, the level of the muscular dystrophy-associated molecule detected can be compared to a control or reference value, such as a value that represents a level of a muscular dystrophy-associated molecule expected if a subject does not have muscular dystrophy. In one example, the muscular dystrophy-associated molecule detected in the sample obtained from the subject being evaluated is compared to the level

226 of such molecules detected in a sample obtained from a subject that does not have muscular dystrophy. In certain examples, detection of at least a 2-fold, such as at least 3- fold, at least 4-fold, at least 6-fold or at least 10-fold increase in the relative amount of the muscular dystrophy-associated molecule in the test sample, as compared to the relative amount of such molecules in a control, indicates that the subject has muscular dystrophy, such as DMD, LGMD, or MDC1A, has a poor prognosis (e.g., survival time of less than 50 months from time of diagnosis, such as 40 months, 30 months, 20 months, 12 months, 6 months or 3 months from time of diagnosis or increased muscle deterioration), or combinations thereof. In some examples, detection of statistically similar relative amounts (or decreased amounts) of muscular dystrophy-associated molecules observed in a test sample, as compared to the relative amount of such molecules in a control sample, indicates that that subject does not have muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A, has a good prognosis (survival time of at least 50 months from time of diagnosis, such as 60 months, 80 months, 100 months, 120 months or 150 months from time of diagnosis), or combinations thereof. Alterations in the expression can be measured at the nucleic acid level (such as by real time quantitative polymerase chain reaction or microarray analysis) or at the protein level (such as by Western blot analysis or ELISA). In some examples, such methods can be used to identify those subjects that will benefit from the disclosed treatment methods. For example, such diagnostic or prognostic methods can be performed prior to the subject undergoing the treatment. In other examples, these methods are utilized to predict subject survival or the efficacy of a given treatment, or combinations thereof. Thus, the methods of the present disclosure are valuable tools for practicing physicians to make quick treatment decisions regarding how to treat muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A. These treatment decisions can include the administration of an agent for treating one or more signs or symptoms associated with muscular dystrophy and decisions to monitor a subject for onset and/or advancement of a muscular dystrophy associated condition. The method disclosed herein can also be used to monitor the effectiveness of a therapy.

227

Following the measurement of the expression levels of one or more of the molecules identified herein, the assay results, findings, diagnoses, predictions and/or treatment recommendations are typically recorded and communicated to technicians, physicians and/or patients, for example. In certain embodiments, computers will be used to communicate such information to interested parties, such as, patients and/or the attending physicians. Based on the measurement, the therapy administered to a subject can be modified. In one embodiment, a diagnosis, prediction and/or treatment recommendation based on the expression level in a test subject of one or more of the muscular dystrophy- associated molecules disclosed herein is communicated to the subject as soon as possible after the assay is completed and the diagnosis and/or prediction is generated. The results and/or related information may be communicated to the subject by the subject's treating physician. Alternatively, the results may be communicated directly to a test subject by any means of communication, including writing, such as by providing a written report, electronic forms of communication, such as email, or telephone. Communication may be facilitated by use of a computer, such as in case of email communications. In certain embodiments, the communication containing results of a diagnostic test and/or conclusions drawn from and/or treatment recommendations based on the test, may be generated and delivered automatically to the subject using a combination of computer hardware and software which will be familiar to artisans skilled in telecommunications. One example of a healthcare-oriented communications system is described in U.S. Pat. No. 6,283,761; however, the present disclosure is not limited to methods which utilize this particular communications system. In certain embodiments of the methods of the disclosure, all or some of the method steps, including the assaying of samples, diagnosing of diseases, and communicating of assay results or diagnoses, may be carried out in diverse (e.g., foreign) jurisdictions. In several embodiments, identification of a subject as having muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A, results in the physician treating the subject, such as prescribing one or more agents for inhibiting or delaying one or more signs and symptoms associated with muscular dystrophy. In additional embodiments, the

228 dose or dosing regimen is modified based on the information obtained using the methods disclosed herein.

Detection of Muscular Dystrophy-Associated Nucleic Acids In one example, one or more muscular dystrophy-associated molecules can be detected by polymerase chain reaction (PCR). The biological sample can be incubated with primers that permit the amplification of one or more of the disclosed muscular dystrophy, such as DMD, LGMD, or MDC1A-associated mRNAs, under conditions sufficient to permit amplification of such products. In another example, the biological sample is incubated with probes that can bind to one or more of the disclosed muscular dystrophy-associated nucleic acid sequences (such as cDNA, genomic DNA, or RNA (such as mRNA)) under high stringency conditions. The resulting hybridization can then be detected using methods known in the art, such as by Northern blot analysis. In an example, the isolated nucleic acid molecules or amplification products are incubated with an array including oligonucleotides complementary to at least one muscular dystrophy-associated molecule, such as disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) or any combination thereof for a time sufficient to allow hybridization between the isolated nucleic acid molecules and oligonucleotide probes, thereby forming isolated nucleic acid molecule:oligonucleotide complexes. The isolated nucleic acid molecule:oligonucleotide complexes are then analyzed to determine if expression of the isolated nucleic acid molecules is altered. In some examples, oligonucleotides complementary to Galectin-1, Galectin-3, Col6A1, Itga3, Iga6, Itga7, Tnc and Timp 1 are included within the array. In some examples, an array includes oligonucleotides complementary to at least Galectin-1 and Galectin-3. In some examples, an array includes oligonucleotides complementary to at

229 least Galectin-3 and Tnc. In some examples, an array includes oligonucleotides complementary to at least Galectin-3 for detecting DMD, LGMD, FHMD, BMD or MDC1A. In some examples, an array includes oligonucleotides complementary to at least Galectin-3 for detecting DMD. Detecting Muscular Dystrophy-Associated Proteins As an alternative to analyzing the sample for the presence of nucleic acids, alterations in protein expression can be measured by methods known in the art, such as by Western blot analysis, immunoassay (e.g., ELISA), mass spectrometry or a protein microarray. For example, the presence of one or more muscular dystrophy-associated molecules can be determined by using a protein array that includes one or more capture agents, such as antibodies that are specific for the one or more disclosed muscular dystrophy-associated molecules. In one example, the antibody that specifically binds a muscular dystrophy- associated molecule (such as Galectin-1 or Galectin-3) is directly labeled with a detectable label. In another example, each antibody that specifically binds a muscular dystrophy-associated molecule (the first antibody) is unlabeled and a second antibody or other molecule that can bind the human antibody that specifically binds the respective muscular dystrophy-associated molecule is labeled. As is well known to one of skill in the art, a second antibody is chosen that is able to specifically bind the specific species and class of the first antibody. For example, if the first antibody is a human IgG, then the secondary antibody can be an anti-human-IgG. Other molecules that can bind to antibodies include, without limitation, Protein A and Protein G, both of which are available commercially. Suitable labels for the antibody or secondary antibody include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, magnetic agents and radioactive materials. Non-limiting examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase. Non- limiting examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin. Non-limiting examples of suitable fluorescent materials include umbelliferone, Cy3, Cy5, fluorescein, fluorescein isothiocyanate, rhodamine,

230 dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin. A non-limiting exemplary luminescent material is luminol; a non-limiting exemplary magnetic agent is gadolinium, and non-limiting exemplary radioactive labels include 125I, 131I, 35S or 3H. In some examples, the presence of one or more muscular dystrophy-associated molecules can be determined by using an ELISA. ELISA is a heterogeneous immunoassay, which has been widely used in laboratory practice since the early 1970s, and can be used in the methods disclosed herein. The assay can be used to detect protein antigens in various formats. In the “sandwich” format the antigen being assayed is held between two different antibodies. In this method, a solid surface is first coated with a solid phase antibody. The test sample, containing the antigen (e.g., a diagnostic protein), or a composition containing the antigen, such as a urine sample from a subject of interest, is then added and the antigen is allowed to react with the bound antibody. Any unbound antigen is washed away. A known amount of enzyme-labeled antibody is then allowed to react with the bound antigen. Any excess unbound enzyme-linked antibody is washed away after the reaction. The substrate for the enzyme used in the assay is then added and the reaction between the substrate and the enzyme produces a color change. The amount of visual color change is a direct measurement of specific enzyme-conjugated bound antibody, and consequently the antigen present in the sample tested. In an alternative example, muscular dystrophy-associated molecules can be assayed in a biological sample by a competition immunoassay utilizing muscular dystrophy-associated molecule standards labeled with a detectable substance and unlabeled antibody that specifically bind to the desired muscular dystrophy-associated molecule. In this assay, the biological sample (such as serum, tissue biopsy, or cells isolated from a tissue biopsy), the labeled muscular dystrophy-associated molecule standards and the antibody that specifically binds to the muscular dystrophy-associated molecule are combined and the amount of labeled muscular dystrophy-associated molecule standard bound to the unlabeled antibody is determined. The amount of muscular dystrophy-associated molecule in the biological sample is inversely proportional to the amount of labeled muscular dystrophy-associated molecule standard

231 bound to the antibody that specifically binds the muscular dystrophy-associated molecule. In some examples, ELISA can also be used as a competitive assay. In the competitive assay format, the test specimen containing the antigen to be determined is mixed with a precise amount of enzyme-labeled antigen and both compete for binding to an anti-antigen antibody attached to a solid surface. Excess free enzyme-labeled antigen is washed off before the substrate for the enzyme is added. The amount of color intensity resulting from the enzyme-substrate interaction is a measure of the amount of antigen in the sample tested. A heterogenous immunoassay, such as an ELISA, can be used to detect any molecules associated with muscular dystrophy. The methods as disclosed herein, such as with a method diagnosing a subject with MD or determining the effectiveness of a particular treatment, can be performed manually or automatically, for example on an automated sample processing instrument with capability of detecting nucleic acid and protein sequences and comparing expression levels of such sequences. Automated systems typically are at least partially, if not substantially entirely, under computer control. Because automated systems typically are at least partially computer controlled, certain embodiments of the present disclosure also concern one or more tangible computer-readable media that stores computer-executable instructions for causing a computer to perform disclosed embodiments of the method. Thus, disclosed are computers or tangible computer readable medium with instructions for the disclose methods. Tangible computer readable medium means any physical object or computer element that can store and/or execute computer instructions. Examples of tangible computer readable medium include, but not limited to, a compact disc (CD), digital versatile disc (DVD), blu-ray disc (BD), usb floppy drive, floppy disk, random access memory (RAM), read-only memory (ROM), erasable programmable read- only memory (EPROM), optical fiber, and the like. It should be noted that the tangible computer readable medium may even be paper or other suitable medium in which the instructions can be electronically captured, such as optical scanning. Where optical scanning occurs, the instructions may be compiled, interpreted, or otherwise processed in a suitable manner, if necessary, and then stored in computer memory.

232

Alternatively, it may be a plugin or part of a software code that can be included in, or downloaded and installed into a computer application. As a plugin, it may be embeddable in any kind of computer document, such as a webpage, word document, pdf file, mp3 file, etc. An exemplary computer system for implementing a disclosed method, such as with a method diagnosing a subject with MD or determining the effectiveness of a particular treatment, includes a computer (such as a personal computer, laptop, palmtop, set-top, server, mainframe, hand held device, and other varieties of computer), including a processing unit, a system memory, and a system bus that couples various system components including the system memory to the processing unit. The processing unit can be any of various commercially available processors, including INTEL® x86, PENTIUM® and compatible microprocessors from INTEL® and others, including Cyrix, AMD and Nexgen; Alpha from Digital; MIPS from MIPS Technology, NEC, IDT®, Siemens, and others; and the PowerPC from IBM® and Motorola. Dual microprocessors and other multi-processor architectures also can be used as the processing unit 121. The system bus can be any of several types of bus structure including a memory bus or memory controller, a peripheral bus, and a local bus using any of a variety of conventional bus architectures such as PCI, VESA, AGP, Microchannel, ISA and EISA, to name a few. A basic input/output system (BIOS), containing the basic routines that help to transfer information between elements within the computer, such as during start- up, is stored in ROM. The system memory includes read only memory and random access memory (RAM). The computer may further include a hard disk drive, a magnetic disk drive, for example to read from or write to a removable disk, and an optical disk drive, for example to read a CD-ROM disk or to read from or write to other optical media. The hard disk drive, magnetic disk drive, and optical disk drive are connected to the system bus by a hard disk drive interface, a magnetic disk drive interface, and an optical drive interface, respectively. The drives and their associated computer readable media provide nonvolatile storage of data, data structures (databases), computer executable instructions, etc. for the computer. Although the description of computer readable media above refers

233 to a hard disk, a removable magnetic disk and a CD, it should be appreciated by those skilled in the art that other types of media which are readable by a computer, such as magnetic cassettes, flash memory cards, digital video disks, Bernoulli cartridges, and the like, can also be used in the exemplary operating environment. A user can enter commands and information into the computer using various input devices, such as a keyboard and pointing device, such as a mouse. Other input devices can include a microphone, satellite dish, scanner, or the like. These and other input devices are often connected to the processing unit through a serial port interface that is coupled to the system bus, but can be connected by other interfaces, such as a parallel port, game port or a universal serial bus (USB). A monitor or other type of display device is also connected to the system bus via an interface, such as a video adapter. In addition to the monitor, computers typically include other peripheral output devices, such as printers. The computer can operate in a networked environment using logical connections to one or more other computer systems, such as computer. The other computer systems can be servers, routers, peer devices or other common network nodes, and typically include many or all of the elements described relative to the computer. Logical connections can include a local area network (LAN) and a wide area network (WAN). Such networking environments are common in offices, enterprise-wide computer networks, intranets and the Internet. When used in a LAN networking environment, the computer is connected to the local network through a network interface or adapter. When used in a WAN networking environment, the computer 120 typically includes a modem or other means for establishing communications (for example via the LAN and a gateway or proxy server) over the wide area network, such as the Internet. The modem, which can be internal or external, is connected to the system bus via the serial port interface. In a networked environment, program modules depicted relative to the computer, or portions thereof, can be stored in the remote memory storage device. It will be appreciated that the network connections shown are exemplary and other means of establishing a communications link between the computer systems (including an Ethernet card, ISDN terminal adapter,

234

ADSL modem, 10BaseT adapter, 100BaseT adapter, ATM adapter, or the like) can be used. The methods, including the acts and operations they comprise, described above can be performed by the computer. Such acts and operations are sometimes referred to as being computer executed. It will be appreciated that the acts and symbolically represented operations include the manipulation by the processing unit of electrical signals representing data bits which causes a resulting transformation or reduction of the electrical signal representation, and the maintenance of data bits at memory locations in the memory system (including the system memory, hard drive, floppy disks, and CD- ROM) to thereby reconfigure or otherwise alter the computer system's operation, as well as other processing of signals. The memory locations where data bits are maintained are physical locations that have particular electrical, magnetic, or optical properties corresponding to the data bits. It is contemplated that a distributed computing environment can be used to implement the methods and systems of the present disclosure may reside. The distributed computing environment includes two computer systems connected by a connection medium, although the disclosed method is equally applicable to an arbitrary, larger number of computer systems connected by the connection medium. The computer systems can be any of several types of computer system configurations, including personal computers, multiprocessor systems, handheld devices, and the like. In terms of logical relation with other computer systems, a computer system can be a client, a server, a router, a peer device, or other common network node. Additional computer systems may be connected by an arbitrary number of connection mediums. The connection medium can comprise any local area network (LAN), wide area network (WAN), or other computer network, including but not limited to Ethernets, enterprise-wide computer networks, intranets and the Internet. Portions of the software for automated gene detection and quantification as well as databases storing correlation data can be implemented in a single computer system, with the application later distributed to other computer systems in the distributed computing environment. Portions of the software for determining gene expression and

235 quantification may also be practiced in a distributed computing environment where tasks are performed by a single computer system acting as a remote processing device that is accessed through a communications network, with the distributed application later distributed to other computer systems in the distributed computing environment. In a networked environment, program modules comprising the software for determining gene expression and quantification as well as databases storing the correlation data can be located on more than one computer system. Communication between the computer systems in the distributed computing network may advantageously include encryption of the communicated data. In certain embodiments, the communication containing results of a diagnostic test and/or conclusions drawn from and/or treatment recommendations based on the test, may be generated and delivered automatically to the subject, facility, physician and the like using a combination of computer hardware and software which will be familiar to artisans skilled in telecommunications. One example of a healthcare-oriented communications system is described in U.S. Pat. No. 6,283,761; however, the present disclosure is not limited to methods which utilize this particular communications system. In certain embodiments of the methods of the disclosure, all or some of the method steps, including the assaying of samples, diagnosing of diseases, and communicating of assay results or diagnoses, may be carried out in diverse (e.g., foreign) jurisdictions.

IV. Methods of Treating Muscular Dystrophy It is shown herein that muscular dystrophy is associated with differential expression of muscular dystrophy-associated molecules, such as disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2). Based on these observations, methods of treatment to reduce or eliminate one or more signs or symptoms associated with muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A are disclosed by decreasing

236 the expression of at least one of the disclosed muscular dystrophy-associated molecules. In a particular example, the subject is a human. Methods are disclosed herein for treating muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A. In one example, the method includes administering an effective amount of an agent to a subject with muscular dystrophy in which the agent decreases the biological activity or expression of one or more of the disclosed muscular dystrophy-associated molecules, such as one or more of disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin- 1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2). Such agents can alter the expression of nucleic acid sequences (such as DNA, cDNA, or mRNAs) and proteins. A decrease in the expression does not need to be 100% for the composition to be effective. For example, an agent can decrease the expression or biological activity by a desired amount, for example by at least 20%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or even at least 100% as compared to activity or expression in a control. In particular examples, the agent is a specific binding agent that binds to and decreases the expression of one or more of the disclosed muscular dystrophy-associated molecules. Specific molecules include disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) as well as fragments of the full-length molecules, cDNAs, or mRNAs (and proteins encoded thereby) whose expression is increased in response to muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A. The agents can alter the activity or expression of the one or more disclosed muscular dystrophy- associated molecules well as other molecules involved in muscular dystrophy progression.

237

In particular examples, the agent is an inhibitor such as a siRNA or an antibody to one of the disclosed muscular dystrophy-associated molecules that is upregulated in muscular dystrophy patients. For example, the agent can be an siRNA that interferes with mRNA expression of one of the disclosed muscular dystrophy-associated molecules. For example, the agent is an siRNA that inhibitor reduces expression of Galectin-3 or Galectin-1. In additional examples, a composition includes at least two agents such as two specific siRNAs that each bind to their respective muscular dystrophy-associated nucleotide sequences and inhibit one or more signs or symptoms associated with muscular dystrophy in the subject. Therapeutic agents Therapeutic agents are agents that when administered in therapeutically effective amounts induce the desired response (e.g., treatment of muscular dystrophy). In one example, therapeutic agents are specific binding agents that bind with higher affinity to a molecule of interest, than to other molecules. For example, a specific binding agent can be one that binds with high affinity to one of the genes or gene products of a disclosed muscular dystrophy-associated molecules, but does not substantially bind to another gene or gene product. In some examples, a specific binding agent binds to one thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) that are upregulated in muscular dystrophy subjects, thereby reducing or inhibiting expression of the gene, but does not bind to the other genes (or gene product). For example, the agent can interfere with gene expression (transcription, processing, translation, post-translational modification), such as, by interfering with the gene's mRNA and blocking translation of the gene product or by post-translational modification of a gene product, or by causing changes in intracellular localization. In another example, a specific binding agent binds to a protein encoded by of one of the genes disclosed herein to be associated with muscular dystrophy with a binding affinity in the range of 0.1 to 20 nM and reduces or inhibits the activity of such protein.

238

Examples of specific binding agents include siRNAs, antibodies, ligands, recombinant proteins, peptide mimetics, and soluble receptor fragments. One example of a specific binding agent is a siRNA. Methods of making siRNAs that can be used clinically are known in the art. Particular siRNAs and methods that can be used to produce and administer them are described in detail below. In a specific example, a specific binding agent includes a Galectin-1 or Galectin-3 siRNA molecule). Another specific example of a specific binding agent is an antibody, such as a monoclonal or polyclonal antibody. Methods of making antibodies that can be used clinically are known in the art. Particular antibodies and methods that can be used to produce them are known to those of ordinary skill in the art. Further, antibodies to Galectin-1 and Galectin-3 are commercially available. In a further example, small molecular weight inhibitors or antagonists of the receptor protein can be used to regulate activity such as the expression or production of muscular dystrophy-associated molecules. In a particular example, small molecular weight inhibitors or antagonists of the proteins encoded by the genes of thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2). Specific binding agents can be therapeutic, for example by reducing or inhibiting the biological activity of a nucleic acid or protein that is associated muscular dystrophy progression. For example, a specific binding agent that binds with high affinity to one or more genes disclosed herein to be upregulated in subjects with muscular dystrophy, may substantially reduce the biological function of the gene or gene product. In other examples, a specific binding agent that binds with high affinity to one of the proteins disclosed herein to be upregulated in subjects with muscular dystrophy, may substantially reduce the biological function of the protein. Such agents can be administered in effective amounts to subjects in need thereof, such as a subject having muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A.

239

Galectin or a composition comprising galectin can be therapeutic, for example, For example, the present disclosure relates to a method of providing therapeutic benefit to a subject by administering to the subject a galectin or a composition that includes galectin, such as Galectin-1 or Galectin-3. In a particular embodiment, the present disclosure provides a method of enhancing muscle regeneration, such as to treat muscular dystrophy, in a subject by administering galectin or a galectin composition. In various embodiments, the present disclosure provides a method of treating a subject with galectin or a composition that includes galectin. For example, some embodiments provide methods of improving muscular health, such as enhancing muscle regeneration, maintenance, or repair in a subject by administering to the subject an effective amount of galectin or a composition comprising galectin, including fragments, derivatives, or analogs thereof. In a specific example, the galectin is a complete galectin protein. In further examples, the galectin is selected from Galectin-1, Galectin-3, and combinations thereof. In further examples, the galectin or galectin composition includes a substance at least substantially homologous to Galectin-1 or Galectin-3. In yet further implementations, the galectin or galectin composition comprises a polypeptide at least substantially homologous to the Galectin-1 or Galectin-3. In additional examples, the galectin or galectin composition consists of Galectin- 1, Galectin-3, and combinations thereof. In further examples, the galectin or galectin composition consists of a substance at least substantially homologous to Galectin-1 or Galectin-3. In a specific example, the galectin or galectin composition does not include a galectin fragment, such as including only a complete galectin protein. In yet another example, the galectin or galectin composition consists essentially of Galectin-1, Galectin-3, and combinations thereof. In further examples, the galectin or galectin composition consists essentially of a substance at least substantially homologous to Galectin-1 or Galectin-3. In yet further implementations, the galectin or galectin composition consists essentially of a polypeptide at least substantially homologous to the galectin α1 chain. In a specific example, the galectin or galectin composition does not include a galectin fragment, such as including essentially only a complete galectin protein.

240

Further implementations of the disclosed method include diagnosing the subject as having a condition treatable by administering galectin or a composition comprising galectin, such as by administering Galectin-1, Galectin-3 or a combination thereof or a composition containing Galectin-1, Galectin-3 or a combination. In one example, the subject is diagnosed as suffering from muscular dystrophy, such as LGMD, FHMD, Beckers muscular dystrophy and/or MDC1A. In further instances the condition is characterized by the failure of a subject, or the reduced ability of the subject, to express one or more proteins associated with the formation or maintenance of the extracellular matrix, such as impaired or non-production of a galectin, an integrin, dystrophin, utrophin, or dystroglycan. In a specific embodiment, the present disclosure also provides a method for increasing muscle regeneration in a subject. For example, geriatric subjects, subjects suffering from muscle disorders, and subjects suffering from muscle injury, including activity induced muscle injury, such as injury caused by exercise, may benefit from this embodiment. In yet further embodiments of the disclosed method, the galectin or galectin composition, such as Galectin-1, Galectin-3 or a combination thereof containing composition, is administered in a preventative manner, such as to prevent or reduce muscular damage or injury (such as activity or exercise induced injury). For example, geriatric subjects, subjects prone to muscle damage, or subjects at risk for muscular injury, such as athletes, may be treated in order to eliminate or ameliorate muscular damage, injury, or disease. Implementations of the present disclosure may also be used to promote wound healing. In some examples, a galectin or a composition comprising galectin is administered into or proximate to a wound. In further examples, the substance is administered systemically. Although the substance is typically applied after the wound occurs, the substance is applied prospectively in some examples. In further embodiments, the method of the present disclosure includes administering the galectin or galectin composition, such as Galectin-1, Galectin-3 or a combination thereof containing composition, with one or more additional

241 pharmacological substances, such as a therapeutic agent. In some aspects, the additional therapeutic agent enhances the therapeutic effect of the galectin or galectin composition. In further aspects, the therapeutic agent provides independent therapeutic benefit for the condition being treated. In various examples, the additional therapeutic agent is a component of the extracellular matrix, such as an integrin, dystrophin, dystroglycan, utrophin, or a growth factor. In further examples, the therapeutic agent reduces or enhances expression of a substance that enhances the formation or maintenance of the extracellular matrix. In some examples, the galectin or galectin composition is applied to a particular area of the subject to be treated. For example, the galectin or galectin composition may be injected into a particular area to be treated, such as a muscle. In further examples, the galectin or galectin composition is administered such that it is distributed to multiple areas of the subject, such as systemic administration or regional administration. Galectin, or a composition comprising galectin, such as Galectin-1, Galectin-3, or a combination thereof, can be administered by any suitable method, such as topically, parenterally (such as intravenously or intraperitoneally), or orally. In a specific example, the galectin or galectin composition is administered systemically, such as through parenteral administration, such as stomach injection or peritoneal injection. Although the disclosed methods generally have been described with respect to muscle regeneration, the disclosed methods also may be used to enhance repair or maintenance, or prevent damage to, other tissues and organs. For example, the methods of the present disclosure can be used to treat symptoms of muscular dystrophy stemming from effects to cells or tissue other than skeletal muscle, such as impaired or altered brain function, smooth muscles, or cardiac muscles. Pre-screening therapeutic agents In some examples, potential therapeutic agents are initially screened for treating muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A, by detecting one or more muscular dystrophy-associated molecules (as discussed in detail below in Section VI.). For example, the disclosed muscular dystrophy-associated molecules can be used to identify agents capable of reducing or inhibiting one or more signs or

242 symptoms of muscular dystrophy. In an example, subjects can be first pre-screened for the presence of muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A, which will respond to a particular therapeutic agent prior to receiving treatment. Administration Methods of administration of the disclosed compositions are routine, and can be determined by a skilled clinician. For example, the disclosed therapies (such as those that include a binding agent specific for one of the disclosed muscular dystrophy-associated molecules or a galectin, such as Galectin-1) can be administered via injection, orally, topically, transdermally, parenterally, or via inhalation or spray. In a particular example, a composition is administered intravenously to a mammalian subject, such as a human. In another example, the composition is administered orally. In some examples, the composition is applied to a particular are of the subject to be treated. For example, the composition is injected into a muscle. The therapeutically effective amount of the agents administered can vary depending upon the desired effects and the subject to be treated. In one example, the method includes daily administration of at least 1 µg of a therapeutic agent to the subject (such as a human subject). For example, a human can be administered at least 1 µg or at least 1 mg of the agent daily, such as 10 µg to 100 µg daily, 100 µg to 1000 µg daily, for example 10 µg daily, 100 µg daily, or 1000 µg daily. In one example, the subject is administered at least 1 µg (such as 1-100 µg) intravenously of the agent (such as a composition that includes a binding agent that specifically binds to one of the disclosed muscular dystrophy-associated molecules or a galectin, such as Galectin-1 or Galectin-3). In one example, the subject is administered at least 1 mg intramuscularly (for example in an extremity) of such composition. The dosage can be administered in divided doses (such as 2, 3, or 4 divided doses per day), or in a single dosage daily. In particular examples, the subject is administered the therapeutic composition that includes a binding agent specific for one of the disclosed muscular dystrophy- associated molecules or a galectin, such as Galectin-1, Galectin-3 or a combination thereof, on a multiple daily dosing schedule, such as at least two consecutive days, 10 consecutive days, and so forth, for example for a period of weeks, months, or years. In

243 one example, the subject is administered the therapeutic composition that includes a binding agent specific for one of the disclosed muscular dystrophy-associated molecules or a galectin, such as Galectin-1, Galectin-3 or a combination thereof daily for a period of at least 30 days, such as at least 2 months, at least 4 months, at least 6 months, at least 12 months, at least 24 months, or at least 36 months. The compositions, such as those that include a binding agent specific for one of the muscular dystrophy-associated molecules or a galectin (such as Galectin-1, Galectin- 3 or a combination thereof), can further include one or more biologically active or inactive compounds (or both), such as other agents known in the art for reducing or treating one or more signs or symptoms associated with muscular dystrophy and conventional non-toxic pharmaceutically acceptable carriers, respectively. For example, additional therapeutic agent which enhance the therapeutic effect of the disclosed compositions are included, such as a component of the extracellular matrix, such as an integrin, dystrophin, dystroglycan, utrophin, or a growth factor. In further examples, the additional therapeutic agent reduces or enhances expression of a substance that enhances the formation or maintenance of the extracellular matrix. In some examples, the additional substance can include aggrecan, angiostatin, cadherins, collagens (including collagen I, collagen III, or collagen IV), decorin, elastin, enactin, endostatin, fibrin, fibronectin, osteopontin, tenascin, thrombospondin, vitronectin, and combinations thereof. Biglycans, glycosaminoglycans (such as heparin), glycoproteins (such as dystroglycan), proteoglycans (such as heparan sulfate), and combinations thereof can also be administered. A particular laminin can be administered with other forms of laminin, laminin analogs, laminin derivatives, or a fragment of any of the foregoing. In some examples, growth stimulants such as cytokines, polypeptides, and growth factors such as brain-derived neurotrophic factor (BDNF), CNF (ciliary neurotrophic factor), EGF (epidermal growth factor), FGF (fibroblast growth factor), glial growth factor (GGF), glial maturation factor (GMF) glial-derived neurotrophic factor (GDNF), hepatocyte growth factor (HGF), insulin, insulin-like growth factors, kerotinocyte growth factor (KGF), nerve growth factor (NGF), neurotropin-3 and -4, PDGF (platelet-derived

244 growth factor), vascular endothelial growth factor (VEGF), and combinations thereof may be administered with one of the disclosed therapies. In a particular example, a therapeutic composition that includes a therapeutically effective amount of a therapeutic agent (such as a binding agent specific for one of the disclosed muscular dystrophy-associated molecules or a galectin, such as Galectin-1, Galectin-3 or a combination thereof) further includes one or more biologically inactive compounds. Examples of such biologically inactive compounds include, but are not limited to: carriers, thickeners, diluents, buffers, preservatives, and carriers. The pharmaceutically acceptable carriers useful for these formulations are conventional (see Remington’s Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 19th Edition (1995)). In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations can include injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can include minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate. Additional treatments In particular examples, prior to, during, or following administration of an effective amount of an agent that reduces or inhibits one or more signs or symptoms associated with muscular dystrophy, the subject can receive one or more other therapies. In one example, the subject receives one or more treatments prior to administration of a disclosed agent specific for one of the disclosed muscular dystrophy-associated molecules or a galectin, such as galectin protein therapy (e.g., Galectin-1/Galectin-3 protein therapy). Examples of such therapies include, but are not limited to, laminin-111 protein therapy, which works to stabilize the sarcolemma and reduce muscle

245 degeneration. In some examples, a source of muscle cells can be added to aid in muscle regeneration and repair. In some aspects of the present disclosure, satellite cells are administered to a subject in combination with laminin therapy. U.S. Patent Publication 2006/0014287, incorporated by reference herein to the extent not inconsistent with the present disclosure, provides methods of enriching a collection of cells in myogenic cells and administering those cells to a subject. In further aspects, stem cells, such as adipose- derived stem cells, are administered to the subject. Suitable methods of preparing and administering adipose-derived stem cells are disclosed in U.S. Patent Publication 2007/0025972, incorporated by reference herein to the extent not inconsistent with the present disclosure. Additional cellular materials, such as fibroblasts, can also be administered, in some examples.

V. Methods of Monitoring the Efficacy of a Treatment for Muscular Dystrophy Methods are also disclosed herein to monitor the efficacy of a treatment for muscular dystrophy. In some examples, the method of determining the effectiveness of an agent for the treatment of muscular dystrophy in a subject with muscular dystrophy includes detecting one or more disclosed muscular dystrophy-associated molecules in a sample from the subject following treatment with the agent; and comparing expression of such molecules following treatment to a reference value or control, wherein a decrease in the expression of the one or more muscular dystrophy-associated molecules following treatment indicates that the agent is effective for the treatment of muscular dystrophy in the subject. In some examples, these methods utilize a biological fluid, such as, but not limited to urine or serum, for the detection of a molecule associated with muscular dystrophy, including, but not limited to, disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) or any combination thereof. The methods include detecting,

246 or determining the abundance (amount) or activity of one or more molecules associated with muscular dystrophy, including those disclosed herein. The disclosed methods can include detecting at least one, such as two, three, four, five, six, seven, eight, nine, ten, eleven, or more molecules associated with muscular dystrophy. In one example, the method includes detecting at least one, such as two, three, four, five, six, seven, eight, nine, ten, eleven, twelve or thirteen of the following molecules associated with muscular dystrophy: disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2). In some examples, the methods include detecting at least Galectin-3. In some examples, the methods include detecting at least Galectin-1. In some embodiments, the method includes detecting a decrease, such as a statistically significant decrease, such as an at least a 1.5, 2, 3, 4, or 5 fold decrease in the amount of one or more molecules associated with muscular dystrophy, including at least a 1.5, 2, 3, 4, or 5 fold decrease in one or more of disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) as compared to a reference value. In some embodiments, the method includes detecting a decrease, such as a statistically significant decrease, such as an at least 10% increase, including an at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, including a 10% to 90% decrease, 20% to 80% decrease, 30% to 70% decrease or a 40% to 60% decrease (e.g., a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, 200% or more decrease) in the amount of one or more molecules associated with muscular dystrophy, including an at least a 10% decrease, including an at least 15%, at least 20%, at least 25%, at least 30%,

247 at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, including a 10% to 90% decrease, 20% to 80% decrease, 30% to 70% increase or a 40% to 60% increase (e.g., a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 100%, 200% or more increase) in one or more of disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) as compared to a reference value. In some embodiments, the methods can be performed over time, to monitor the progression or regression of one or more signs or symptoms of muscular dystrophy in a subject, such as one or more signs or symptoms associated with DMD, LGMD, FHMD, BMD or MDC1A. The method can be performed multiple times over a specified time period, such as days, weeks, months or years. In several examples, the therapy includes treatment with an agent for muscular dystrophy. If the reference sample is a normal sample, and the test sample reading (e.g., expression or activity level of an evaluated muscular dystrophy-associated molecule) is essentially the same as the normal sample the subject is determined to have an effective therapy, while if the test sample has a significantly greater value for an evaluated muscular dystrophy-associated molecule relative to the normal sample, the subject is determined to have an ineffective therapy. Changes in the profile can also represent the progression (or regression) of the disease process. The subject can be monitored while undergoing treatment using the methods described herein in order to assess the efficacy of the treatment protocol. Following the measurement of the expression levels of one or more of the molecules identified herein, the assay results, findings, diagnoses, predictions and/or treatment recommendations can be recorded and communicated to technicians, physicians and/or patients, for example. In certain embodiments, computers are used to communicate such information to interested parties, such as, patients and/or the attending physicians. Based on the measurement, the therapy administered to a subject is modified. For example, the dose or

248 dosing regimen is modified based on the information obtained using the methods disclosed herein. In one embodiment, a diagnosis, prediction and/or treatment recommendation based on the expression level in a test subject of one or more of the muscular dystrophy- associated molecules disclosed herein is communicated to the subject as soon as possible after the assay is completed and the diagnosis and/or prediction is generated. The results and/or related information may be communicated to the subject by the subject's treating physician. Alternatively, the results may be communicated directly to a test subject by any means of communication, including writing, such as by providing a written report, electronic forms of communication, such as email, or telephone. Communication may be facilitated by use of a computer, such as in case of email communications. In certain embodiments, the communication containing results of a diagnostic test and/or conclusions drawn from and/or treatment recommendations based on the test, may be generated and delivered automatically to the subject using a combination of computer hardware and software which will be familiar to artisans skilled in telecommunications. One example of a healthcare-oriented communications system is described in U.S. Pat. No. 6,283,761; however, the present disclosure is not limited to methods which utilize this particular communications system. In certain embodiments of the methods of the disclosure, all or some of the method steps, including the assaying of samples, diagnosing of diseases, and communicating of assay results or diagnoses, may be carried out in diverse (e.g., foreign) jurisdictions.

VI. Methods of Identifying Agents for Treating Muscular Dystrophy Methods are provided herein for identifying agents to treating muscular dystrophy, such as DMD, LGMD, FHMD, BMD and MDC1A. In some examples, the method of includes contacting a sample, such as a blood or urine sample, with one or more test agents under conditions sufficient for the one or more test agents to decrease the expression or biological activity of one or more of the disclosed muscular dystrophy- associated molecules. The method can also include detecting expression or biological activity of the one or more disclosed muscular dystrophy-associated molecules in the

249 presence of the one or more test agents. The expression or biological activity of the one or more disclosed muscular dystrophy-associated molecules in the presence of the one or more test agents is then compared to a control, such as a reference value to determine if there is an alteration in expression or activity of the one or more disclosed muscular dystrophy-associated molecules, wherein decreased activity or expression of the one or more disclosed muscular dystrophy-associated molecules indicates that the one or more test agents is of use to treat the muscular dystrophy. In one example, determining whether there is differential expression of one or more muscular dystrophy-associated molecules is by use of an in vitro assay. For example, an in vitro assay can be employed to compare expression of one or more muscular dystrophy-associated molecules in a sample, such as a blood or urine sample, in the presence and absence of the test agent. Expression levels can be determined by methods known to those of skill in the art including real time quantitative polymerase chain reaction, microarray analysis or Western blot analysis. In some examples, an at least 2-fold, at least 3-fold, or at least 5-fold, decrease in the activity of one or more disclosed muscular dystrophy-associated molecules, such as Galectin-1 or galection-3, in the presence of the one or more test agents as compared to the reference value indicates the one or more test agents is of use to treat muscular dystrophy.

Test Agents The one or more test agents can be any substance, including, but not limited to, a protein (such as an antibody), a nucleic acid molecule (such as a siRNA), an organic compound, an inorganic compound, a small molecule or any other molecule of interest. In a particular example, the test agent is a siRNA that reduces or inhibits the activity (such as the expression) of one of the disclosed muscular dystrophy-associated molecules, such as disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue

250 inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2). For example, the siRNA is directed to Galectin-1 or Galectin-3. In other examples, the test agent is an antibody. For example, the antibody is directed to specifically bind to one of the disclosed muscular dystrophy-associated molecules, such as disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2). In a particular example, the antibody is directed to Galectin-1 or Galectin-3. Disclosed test agents also include aptamers. In one example, an aptamer is a single stranded nucleic acid molecule (such as, DNA or RNA) that assumes a specific, sequence dependent shape and binds to a target protein (e.g., Galectin-1 or Galectin-3) with high affinity and specificity. Aptamers generally comprise fewer than 100 nucleotides, fewer than 75 nucleotides, or fewer than 50 nucleotides (such as 10 to 95 nucleotides, 25 to 80 nucleotides, 30 to 75 nucleotides, or 25 to 50 nucleotides). In a specific embodiment, a disclosed diagnostic specific binding reagent is a mirror image aptamer (also called a SPIEGELMER™). Mirror image aptamers are high affinity L enantiomeric nucleic acids (for example, L ribose or L 2’-deoxyribose units) that display high resistance to enzymatic degradation compared with D oligonucleotides (such as, aptamers). The target binding properties of aptamers and mirror image aptamers are designed by an in vitro selection process starting from a random pool of oligonucleotides, as described for example, in Wlotzka et al., Proc. Natl. Acad. Sci. 99(13):8898 8902, 2002. Methods of generating aptamers are known in the art (see e.g., Fitzwater and Polisky (Methods Enzymol., 267:275-301, 1996; Murphy et al., Nucl. Acids Res. 31:e110, 2003). In another example, an aptamer is a peptide aptamer that binds to a target protein (e.g., a Galectin-1 or Galectin-3) with high affinity and specificity. Peptide aptamers can include a peptide loop (e.g., which is specific for Galectin-1 or Galectin-3) attached at both ends to a protein scaffold. This double structural constraint greatly increases the

251 binding affinity of the peptide aptamer to levels comparable to an antibody's (nanomolar range). The variable loop length is typically 8 to 20 amino acids (e.g., 8 to 12 amino acids), and the scaffold may be any protein which is stable, soluble, small, and non-toxic (e.g., thioredoxin-A, stefin A triple mutant, green fluorescent protein, eglin C, and cellular transcription factor Sp1). Peptide aptamer selection can be made using different systems, such as the yeast two-hybrid system (e.g., Gal4 yeast-two-hybrid system) or the LexA interaction trap system.

VII. Kits Provided by this disclosure are kits that can be used to diagnose, prognose or treat muscular dystrophy. For example, a kit is disclosed herein for diagnosing or prognosing muscular dystrophy, such as DMD, LGMD, FHMD, BMD or MDC1A, by reducing or inhibiting one or more symptoms associated with the muscular dystrophy in which the kit includes at least one agent capable of inhibiting or reducing the expression or biological activity of one or more of the disclosed muscular dystrophy-associated molecules. The disclosed kits can include instructional materials disclosing means of use of the compositions in the kit. The instructional materials can be written, in an electronic form (such as a computer diskette or compact disk) or can be visual (such as video files). For example, instructions indicate to first perform a baseline measurement of a particular activity, such as measuring expression levels of one or more of the disclosed muscular dystrophy-associated molecules, such as Galectin-1 or Galectin-3. Then, administer a composition known to regulate such molecules according to the teachings herein. Administration is followed by re-measuring the particular activity. The activity level prior to treatment is compared to activity observed following treatment. An alteration in activity of at least 10%, for example, about 15% to about 98%, about 30% to about 95%, about 40% to about 80%, about 50% to about 70%, including about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90%, about 95%, about 98% or about 100%, as compared to such activity in the absence of the composition indicates an effective treatment. In particular embodiments, a greater than 50% reduction indicates an effective treatment. An effective treatment can include, but are not limited

252 to, an increase in patient survival, a slowing of the progression of the particular type of muscular dystrophy, a good prognosis, or a prevention of further muscle damage. Kits are provided that can be used in the therapy assays disclosed herein. For example, kits can include one or more compositions, agents (such as antibodies) capable of detecting one or more of the muscular dystrophy biomarkers (for example, measuring Galectin-1 or Galectin-3, or combinations thereof). One skilled in the art will appreciate that the kits can include other agents to facilitate the particular application for which the kit is designed. In one example, a kit is provided for treating DMD. For example, such kits can include one or more compositions capable of targeting inhibiting or reducing Galectin-3 activity or expression. In some examples, a kit is provided for detecting one or more of the disclosed muscular dystrophy biomarkers in a biological sample. Kits for detecting muscular dystrophy-associated molecules can include one or more probes that specifically bind to the molecules. In an example, a kit includes an array with one or more of disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agrn), collagen 6A1 (Col6a1), Galectin-1, Galectin-3, matrix metalloproteinase 2 (Mmp2), integrin α3 (Iga3), integrin α6 (Iga6), , integrin α7 (Iga7), laminin-α4 (Lama4), laminin-α5 (Lama5), nidogen 1 (Nid1), tenascin C (Tnc), tissue inhibitor of metalloproteinase 1 (Timp1), tissue inhibitor of metalloproteinase 2 (Timp2) or any combination thereof and controls, such as positive and negative controls. In other examples, kits include antibodies that specifically bind to one of the muscular dystrophy-associated biomarkers disclosed herein. In some examples, the antibody is labeled (for example, with a fluorescent, radioactive, or an enzymatic label). Such a diagnostic kit can additionally contain means of detecting a label (such as enzyme substrates for enzymatic labels, filter sets to detect fluorescent labels, appropriate secondary labels such as a secondary antibody, or the like), as well as buffers and other reagents routinely used for the practice of a particular diagnostic method. In some examples, a kit includes at least one probe or antibody that specifically binds to Galectin-3 and the kit is used to diagnose or prognose DMD, LGMD, FHMD, BMD or MDC1A. In some examples, a kit includes at least one probe or antibody that

253 specifically binds to Galectin-3 and the kit is used to prognose DMD and/or determine the efficacy of a treatment for DMD.

The disclosure is further illustrated by the following non-limiting Examples.

EXAMPLES Example 1 Biomarkers for MDC1A This example investigates the use of Galectin-1 and Galectin-3 a biomarkers for MDC1A. i. Materials and methods Western blotting. Gastrocnemius muscles from 4- and 8-week old male wild-type and dyW -/- animals were pulverized with a mortar and pestle cooled in liquid nitrogen. Protein was extracted from both serum and muscle tissue in RIPA buffer (50mM Hepes pH 7.4, 150mM NaCl, 1mM Na3VO4, 10mM NaF, 0.5% Triton X-100, 0.5% NP50, 10% glycerol, 2mM PMSF and a 1:200 dilution of Protease Inhibitor Cocktail Set III) and quantified using a Bradford assay (Bio-Rad Laboratories Inc, Herculues, CA). Proteins were separated by SDS-PAGE. Galectin-1 was detected using a 1:1000 dilution of anti- Galectin-1 antibody (H00003956-D01P Abnova, Walnut, CA). Galectin-3 was detected using a 1:1000 dilution of anti-galecin-3 antibody (ab53082, Abcam). Blots were incubated with primary antibody overnight at 4C. Blots were then incubated with a 1:5000 dilution of goat-anti-rabbit-IgG secondary antibody (Li-Cor Biosciences, Lincoln, NE) for 1 hour. Blots were imaged using an Odyssey Imaging System and bands were quantified using the same system. Tissue blots were normalized to α-tubulin using a 1:5000 dilution of anti-α-tubulin (AbCam, Cambridge, MA) followed by a goat-anti- mouse-IgG (Li-Cor Biosciences, Lincoln, NE). Immunofluorescence. Cryosections (8mm) of 4- and 8-week old male tibialis anterior (TA) muscles were cut using a LeicaCM 1850 cryostat and mounted onto pre-cleaned Surgipath slides. Sections were fixed using 4% paraformaldehyde (PFA) for 5 minutes then rehydrated using PBS. Slides were blocked in 5% BSA in PBS then incubated with

254 a 1:500 dilution of ab53082 (AbCam) for 1 hour. Slides were then incubated with a 1:1000 dilution of FITC-conjugated anti-rabbit-IgG antibody for 1 hour. Slides were mounted using Vectashield with DAPI and imaged using a Zeiss Axioskop 2 plus fluorescence microscope. Images were captured using a Zeiss AxioCam HRc digital camera with Axiovision 4.1 software. Quantitative real-time PCR analysis. Total RNA was purified from five 4- and 8-week old male wild-type and dyW -/- grastrocnemius muscles using Trizol (Invitrogen, Carlsbad, CA) reagent. After the concentration was determined, mRNA was pooled equally by genotype for cDNA production. The cDNA was prepared from 3g of pooled total RNA with random hexamers and Superscript III (Invitrogen, Carlsbad, CA) using standard procedures. Quantitative real-time PCR was conducted with 50pg total cDNA using SYBR Green Jumpstart (Sigma-Aldrich, St Louis, MO) with Lgals1 primer sequences and Lgals3 primer sequences and levels were normalized to that of Gapdh. Statistics. The fold change over wild-type was calculated using the Ct method after normalization and the average fold change in transcript and (s.e.m.) were calculated. One and two way ANOVA with a Bonferroni post test correction were used to determine statistical significance using GraphPad Prism ii. Results Quantitative Real-Time PCR was used to determine changes in the transcription of Lgals1 and Lgals3 (FIGS. 1A-1B). Both 4- and 8-week old dystrophic mice had significantly increased transcripts of Lgals3 compared to age-matched wild-type mice. The 4-week old mice had 70.02 fold increase in Galectin-3 transcript compared to wild- type animals. Lgals3 transcription was reduced in the 8-week old mice; however, it was still significantly elevated 9.37 fold compared to wild-type animals (FIG. 1B.). These results indicate the loss of laminin-α2 resulted in increased transcription of Galectin-3 and that transcription levels drop as the dystrophic mice age. Both 4- and 8-week old dystrophic mice had significantly increased transcripts of Lgals1 compared to age-matched wild-type animals as well. The 4-week old mice had a 9.19 fold increase in Galectin-1 transcript compared to wild-type animals. Lgals1 transcription was reduced in the 8-week old mice; however, it was still significantly

255 elevated 1.7 fold compared to wild-type animals (FIG. 1A.). These results indicate the loss of laminin-α2 results in increased transcription of Galectin-1 and that transcription levels drop as the dystrophic mice age. Western blotting analysis revealed no significant difference in Galectin-1 protein levels in 4- or 8-week old dyW -/- animals when compared to age-matched wild-type animals (FIG. 2A and 2B, respectively). There was also no significant difference between the Galectin-1 protein when comparing 4- and 8-week old dyW -/- animals (FIG. 2C.). Western blotting analysis for Galectin-3 protein revealed significantly more Galectin-3 protein in 4-week old dyW -/- animals compared to age-matched wild-type animals (FIGS. 3A and 3B) and 8-week old dyW -/- animals compared to age-matched wild-type animals. Western blotting on serum revealed no significant difference in Galectin-3 protein between 4-week old dyW -/- mice and age-matched wild-type mice (FIG. 4.A.). In addition, serum western blots showed significantly more Galectin-3 protein in 4-week old dyW -/- mice than 8-week old dyW -/- mice (FIG. 4B.). These results revealed that the amount of Galectin-3 released into the blood stream is different than that held in the muscle. Immunofluorescence for Galectin-3 was also completed on the tibialis anterior muscle of 4- and 8-week old dyW -/- mice and wild-type mice. Immunofluorescence revealed a similar pattern as to that shown in the tissue western blots. 4-week old dyW -/- mice had elevated levels of Galectin-3 compared to age-matched wild-type animals. Galectin-3 levels appeared to be similar in 4- and 8-week old dyW -/- mice as well as between 8-week old dyW -/- and age-matched wild-type mice. Galectin-3 levels also appeared to increase as the wild-type animals age (FIG. 5.). Although Galectin-1 transcript was significantly elevated in the dyW -/- animals, this did not translate to an elevation in detectable Galectin-1 protein. These studies indicate that Galectin-1 is not a good candidate as a biomarker for the dyW -/- mouse model of MDC1A. In contrast, Galectin-3 was significantly elevated at the transcript

256 level of dyW-/- mice, and at the protein level in the muscle, indicating its use as a biomarker of MDC1A.

Example 2 Biomarkers for DMD This example investigates the use of Galectin-1 and Galectin-3 a biomarkers for DMD. i. Materials and Methods Western blotting. Gastrocnemius muscles from 2-, 5- and 10-week old male wild-type and mdx animals were pulverized with a mortar and pestle cooled in liquid nitrogen. Protein was extracted from both serum and muscle tissue in RIPA buffer (50mM Hepes pH 7.4, 150mM NaCl, 1mM Na3VO4, 10mM NaF, 0.5% Triton X-100, 0.5% NP50, 10% glycerol, 2mM PMSF and a 1:200 dilution of Protease Inhibitor Cocktail Set III) and quantified using a Bradford assay (Bio-Rad Laboratories Inc, Herculues, CA). Proteins were separated by SDS-PAGE. Galectin-1 was detected using a 1:1000 dilution of anti- Galectin-1 antibody (H00003956-D01P Abnova, Walnut, CA). Galectin-3 was detected using a 1:1000 dilution of anti-galecin-3 antibody (ab53082, Abcam). Blots were incubated with primary antibody overnight at 4C. Blots were then incubated with a 1:5000 dilution of goat-anti-rabbit-IgG secondary antibody (Li-Cor Biosciences, Lincoln, NE) for 1 hour. Blots were imaged using an Odyssey Imaging System and bands were quantified using the same system. Blots were normalized to α-tubulin using a 1:5000 dilution of anti-α-tubulin (AbCam, Cambridge, MA) followed by a goat-anti-mouse-IgG (Li-Cor Biosciences, Lincol, NE). Immunofluorescence. Cryosections (8 mm) of 5- and 10-week old male tibialis anterior (TA) muscles were cut using a LeicaCM 1850 cryostat and mounted onto pre-cleaned Surgipath slides. Sections were fixed using 4% paraformaldehyde (PFA) for 5 minutes then rehydrated suing PBS. Slides were blocked in 5% BSA in PBS then incubated with a 1:500 dilution of ab53082 (AbCam) for 1 hour. Slides were then incubated with a 1:1000 dilution of FITC-conjugated anti-rabbit-IgG antibody for 1 hour. Slides were mounted using Vectashield with DAPI and imaged using a Zeiss Axioskop 2 plus

257 fluorescence microscope. Images were captured using a Zeiss AxioCam HRc digital camera with Axiovision 4.1 software. Quantitative real-time PCR analysis. Total RNA was purified from five 5- and 10-week old male wild-type and mdx grastrocnemius muscles using Trizol (Invitrogen, Carlsbad, CA) reagent. After the concentration was determined, mRNA was pooled equally by genotype for cDNA production. The cDNA was prepared from 3g of pooled total RNA with random hexamers and Superscript III (Invitrogen, Carlsbad, CA) using standard procedures. Quantitative real-time PCR was conducted with 50pg total cDNA using SYBR Green Jumpstart (Sigma-Aldrich, St Louis, MO) with Lgals1 primer sequences and Lgals3 primer sequences (and levels were normalized to that of Gapdh. Statistics. The fold change over wild-type was calculated using the Ct method after normalization and the average fold change in transcript and (s.e.m.) were calculated. One and two way ANOVA with a Bonferroni post test correction were used to determine statistical significance using GraphPad Prism. ii. Results Quantitative Real-Time-PCR was used to determine changes in the transcription of Lgals1 and Lgals3. Both 5- and 10-week old dystrophic mice had significantly increased transcripts of Lgals3 compared to age-matched wild-type mice. The 5-week old mice had an 11.42 fold increase in Galectin-3 transcript compared to wild-type animals, while the 10-week old mice had a 67.20 fold increase in Galectin-3 transcript compared to wild-type animals. Transcript levels of Lgals3 also increased from the 5- week old mdx mice (11.42 fold increase) to the 10-week old mdx mice (67.20 fold increase). These results indicate the loss of dystrophin resulted in increased transcription of Galectin-3 and that transcription levels increased as the dystrophic mice age. Only the 10-week old mdx mice had significantly increased levels of Lgals1 transcript compared to wild-type animals. The 5-week old mice had a 1.49 fold increase in Galectin-1 transcript, while the 10-week old dystrophic mice had a 2.51 fold increase in Galectin-1 transcript compared to wild-type animals. In addition, transcript levels of Lgals1 increased from the 5-week old mdx mice (1.49 fold increase) to the 10-week old mdx mice (2.51 fold increase) (FIG. 6). These results indicate the loss of dytstrophin

258 resulted in increased transcription of Galectin-1 and that transcription levels increased as the dystrophic mice age. Western blotting analysis revealed no significant difference in Galectin-1 protein levels in the gastrocnemius muscle of 5- or 10-week old mdx animals when compared to age-matched wild-type animals (FIG. 7A. and 7B, respectively). There was, however, a significant difference between the Galectin-1 protein when comparing 2-, 5- and 10-week old mdx animals (FIG. 7C.). At 5-weeks of age, the mdx animals had significantly more Galectin-3 protein in the gastrocnemius muscle than the wild-type animals (FIG. 8A.). In addition, there was a significant difference in the Galectin-3 protein levels between 5- and 10-week old mdx animals (FIG. 8B.). Western blotting on 5- and 10-week old mdx and wild-type serum revealed similar results to the tissue blots, although there was no significant difference in Galectin-3 protein levels (FIG. 9A. and FIG. 9B, respectively). However, at both age points the mdx mice were trending towards more Galectin-3 protein. Immunofluorescence for Galectin-3 was also completed on the tibialis anterior (TA) muscle of 5- and 10-week old mdx and wild-type mice. Immunofluorescence revealed a similar pattern as to that shown through western blotting. Both 5- and 10- week old mdx mice had elevated levels of Galectin-3 compared to age-matched wild-type animals. Galectin-3 levels also appeared to be elevated in 10-week old mdx mice compared to 5-week old mdx mice (FIG. 10). These results revealed that although Galectin-1 transcript was significantly elevated in the mdx animals, is did not translate to an elevation in detectable Galectin-1 protein. Western blotting revealed no significant difference between Galectin-1 levels in mdx and wild-type mice, but a significant difference was seen between 5- and 10-week old mdx mice. A biomarker needs to not only follow the progression of the disease, but must also be differentiable from levels found in disease-free patients. As the results do αnot reveal these differences in Galectin-1 levels, it is not a good candidate as a biomarker for the mdx mouse model of DMD.

259

In this study, however, Galectin-3 was significantly elevated at the transcript level of mdx mice, as well as at the protein level in the muscle. Galectin-3 was secreted by macrophages and monocytes, two cells seen in fibrosis, a hallmark of DMD. Therefore, these studies support the use of Galectin-3 as a biomarker for DMD. Additional studies have been performed evaluating the levels of Galectin-3 in the muscle of the GRMD dog model of DMD. The GRMD model develops progressive and fatal muscle disease and has been shown to exhibit pathophysiological disease features identical to DMD including progressive loss of muscle function, muscle membrane fragility, cardiomyopathy and premature death (Kornegay et al., Muscle Nerve 11:1056-1064, 1988;Cooper et al., Nature 334:154-156, 1988). The GRMD dog model is generally accepted as the gold standard preclinical model to test therapeutics for DMD. Western analysis revealed GRMD dogs had increased Galectin-3 levels in the Vastus lateralus muscle of GRMD as compared to control dogs (FIG. 11). Immunofluorescence studies revealed that Galectin-3 is found surrounding myofibers and associated with blood vessels of unaffected dogs. In sharp contrast, the amount of Galectin-3 increases in muscle and localization changes to discrete sites that are associated with smooth muscle actin positive regions which correspond to small blood vessels. In unaffected dogs, Galectin-3 was localized around myofibers and associated with large blood vessels within the endothelial/smooth muscle of such vessels. Loss of dystrophin in GRMD dogs resulted in higher levels of Galectin-3 with punctate staining in skeletal muscle tissue. There was also a loss of Galectin-3 localization from large muscle blood vessels to smaller blood vessels in GRMD dogs and the colocalization of Galectin-3 and smooth muscle actin was lost. Galectin3 serum levels in wild-type and mdx mice were determined by ELISA (Table 3). There was very little variation in the wild-type (WT) control animals at all ages observed. Mdx animals exhibited a steady increase in average serum levels from 5 weeks to 10 weeks, when dystrophic pathology were most consistently observed. After 10 weeks there was variance in these animals. Exercise had no effect on the serum levels of 5-week old mdx mice.

260

Table 3. Galectin3 serum levels in wild-type and mdx mice. Age Average Serum Level SEM N (months) (ng/mL) WT C57BL/10 3.5 47.76 5.71 3 9.5 40.92 4.67 8 10 52.09 5.62 7 11 54.90 23.56 4 12 50.97 5.70 10 mdx 1.25 45.40 11.05 8 2 108.45 29.96 5 3 120.11 21.04 15 4.5 47.86 18.00 2 5 86.55 45.58 2 5.5 71.16 17.47 7 6 301.90 153.33 5 7.5 557.53 198.73 4 8.5 141.38 76.98 3 9 204.76 85.47 10 9.5 207.63 176.75 2 exercised mdx 1.25 60.14 10.48 4

261

In addition, Galectin-3 serum levels were measured in MDC1A patients and compared to age matched controls (Table 4). Patients and controls were broken into age- matched categories by age or gender starting with up to three years in which patients had significantly higher serum levels then controls. After age 3, for both males and females, patients appear to have slightly lower serum levels. A final category for patients was based on a lack of muscular ability and these patients had the lowest serum levels. Table 5 provides a summary of the MDC1A patient data shown in Table 4. Table 4. Galectin-3 serum analysis of MDC1A patients compared to age matched controls. Galectin- Age Gender Muscular Abilities 3 pg/mL Controls 1845 0.9 M 3091 1.3 M 4867 1.5 F 4193 2.5 F 3441 2.7 M 2357 4.0 F 5825 5.9 M 6288 6.4 M 2185 7.3 F 5412 7.9 M Patients 5687 0.9 M good head control, unable to sit without assistance 1172 1.4 M briefly able to sit without assistance 7367 1.5 F sat without assistance 12263 1.7 F sat without assistance 5002 2.8 M sat without assistance 1549 3.9 F sat without assistance 4372 5.6 M sat without assistance

262

4417 6.5 M sat without assistance 3135 7.8 M sat without assistance 633 11.6 F good head control, unable to sit without assistance

Table 5. Average Serum Levels of Galectin-3 in various patient populations. Average Serum Levels (ng/mL) N Controls Under 3 3.49 5 (3M, 2F) Patients Under 3 (mobile) 7.58 4 (2M, 2F) Patient Under 3 (non-mobile) 1.17 1 M

Male Controls Over 3 5.84 3 Male Patients Over 3 (mobile) 3.97 3

Female Controls Over 3 2.27 2 Female Patient Over 3 (mobile) 1.55 1 Female Patient Over 3 (non- 0.63 1 mobile)

The dyw-/- mouse has a bell shaped curve for Galectin-3 protein in muscle which peaks around 4 weeks and then falls by 8 weeks as the mice became less and less active due to muscle weakness. A similar pattern was observed in MDC1A patient serum compared to controls. Before the age of 3, the average serum level of Galectin-3 was over 2-fold higher than that in controls (~7.5 ng/mL compared to 3.5 ng/mL, respectively). However, after the age of 3 the levels were lower than gender matched controls. The observed decrease indicates a significant loss of muscle as supported by the fact that the two patients who were non-mobile and unable to sit without assistance had extremely low serum levels of Galectin-3. These studies further indicate a role of Galectin-3 in MD and a use of such to indicate the presence of MD. Additionally, for MDC1A, Galectin-3 serum levels are diagnostic before the age of 3 (high Gal-3 serum

263 levels) and potentially prognostic for severe pathology (extremely low Gal-3 serum levels). Example 3 Additional Biomarkers for MDC1A This example describes possible biomarkers for MDC1A. i. Material and Methods Transgenic α7 integrin dyW-/- mice. Transgenic α7 integrin dyW-/- mice were generated by breeding mice that overexpressed the α7BX2 integrin in skeletal muscle with dyW+/- animals. Resultant pups which were heterozygous for the laminin α2 mutant allele and positive for the α7BX2 transgene were bred to dyW+/- mice. The male pups from these matings included dyW+/+;itga7- (wild-type), dyW-/-;itga7- (dyW-/-) (laminin-α2 deficient) and dyW-/-;itga7+ (laminin-α2 deficient that overexpress the α7BX2 integrin) mice. Male littermates were used as controls for all studies. Genomic DNA was isolated from tail biopsies taken at 10 days of age using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI). Polymerase chain reaction (PCR) was used as previously described to detect the laminin-α2 allele and the α7BX2 transgene. Isolation of Skeletal Muscle. Four-week-old wild-type, dyW-/- and dyW-/-;itga7+ male mice were sacrificed. Skeletal muscles were dissected and flash frozen in liquid nitrogen cooled isopentane. Tissues were stored at -80°C. Western blot analysis. Gastrocnemius muscles from 4 week old male mice were pulverized with a mortar and pestle cooled in liquid nitrogen. Protein was extracted in

RIPA buffer (50mM Hepes pH 7.4, 150mM NaCl, 1mM Na3VO4, 10mM NaF, 0.5% Triton X-100, 0.5% NP50, 10% glycerol, 2mM PMSF and a 1:200 dilution of Protease Inhibitor Cocktail Set III) and quantified by a Bradford assay (Bio-Rad Laboratories Inc, Hercules, CA). Proteins were separated by SDS-PAGE. The α7 integrin was detected with a 1:1000 dilution of anti-α7B antibody overnight. Integrin α7A was detected using 1:1000 dilution of CDB 345 antibody overnight. Integrin α3 was quantified using AB1920 antibody (Chemicon). The α1D integrin was visualized using α1D-antibody overnight. All primary antibodies were followed by a 1:5000 goat-anti-rabbit secondary antibody (Li-Cor Biosciences, Lincoln, NE) for 1 hour. Galectin-1 was detected with a

264

1:1000 dilution of H00003956-D01P (Abnova, Walnut, CA). Galectin-3 was detected with a 1:1000 dilution of ab53082 (Abcam, Cambridge, MA). Immunoblots were normalized by using a 1:5000 dilution of an anti-α tubulin (AbCam, Cambridge, MA) antibody followed by a 1:5000 dilution of goat-anti-mouse secondary antibody. Band intensities were determined with an Odyssey Imaging System. Immunofluorescence. Cryosections (8 µm) of 4 week old male Tibialis Anterior (TA) muscle were cut using a LeicaCM 1850 cryostat and mounted on precleaned Surgipath slides. Sections were fixed using 4% paraformaldehyde (PFA) for 2 or 5 minutes then rehydrated using Phosphate Buffered Saline (PBS). Slides were blocked in 5% Bovine Serum Albumin (BSA) in PBS then incubated with laminin-α2G or α1D integrin antibody. For detection of Galectin-1 H00003959-D01P (Abnova) antibody was used. Galectin-3 was visualized using ab53082 (abcam). Antibody T3413 (Sigma) was used to detect Tenascin C. MMP2 and TIMP1 were detected using antibodies ab37150 and ab86482 respectively (Abcam). Slides were then incubated using an appropriate secondary which was a FITC-anti rabbit in all cases except for Tenascin C which was a FITC-anti rat secondary antibody. For detection of spectrin, slides were fixed for 1 minute in ice cold acetone then treated with the M.O.M ™ kit according to package instructions (FMK-2201 Vector Laboratories, inc. Burlingame, CA). A mouse monoclonal spectrin antibody (Novo Castra NCL-spec2) was then used at 1:100 for 30 minutes followed by a FITC-anti mouse secondary at 1:1000 for 1 hour. Slides were mounted using Vectashield with DAPI and imaged using a Zeiss Axioskop 2 Plus fluorescent microscope. Images were captured using a Zeiss AxioCam HRc digital camera with Axiovision 4.1 software. Inflammatory Cell Infiltrate. Four week old TA muscle cryosections were fixed in 4% PFA for 5 minutes followed by rehydration with PBS. Slides were incubated with FITC Rat Anti-Mouse CD11b antibody (BD Biosciences, San Jose, CA) at 1:1000 for 1 hour to detect macrophages in the muscle tissue. Slides were washed with PBS and mounted using Vectashield with DAPI. Muscle sections from five mice of each genotype were analyzed and CD11b positive cells per twenty fields at 400X magnification were counted. A Zeiss Axioskop 2 Plus fluorescent microscope was used to view the slides and images

265 were captured using a Zeiss AxioCam HRc digital camera with Axiovision 4.1 software Confocal microscopy. The TA muscles from 4 week old male mice from each genotype were sectioned and subjected to immunfluorescence. For detection of α7B integrin sections were fixed in ice cold acetone (-20°C) for 1 minute then rehydrated using phosphate-buffered saline (PBS). Cryosections were blocked in a 5% bovine serum albumin in PBS solution for 20 minutes followed by incubation with CDB347 (which recognizes the cytoplasmic domain of both mouse and rat α7B integrin) or α1D A2 antibodies for 1 hour. Slides were then washed with 1%BSA and incubated with FITC- conjugated anti-rabbit antibody for 1 hour. Slides were again washed with 1%BSA. To outline the myofibers sections were incubated with rhodamine labeled wheat germ agglutinin for 30 minutes. Slides were mounted using Vectashield with DAPI. Images were captured using an Olympus FluoviewTM Confocal Scanning System. Survival and weight gain analysis. Male mice were allowed to age and monitored daily for weight loss and any signs of pain, distress or illness. A weight loss of >10% over a one week period was also considered a terminal sign and the animals were humanely euthanized. Weights from animals of each genotype were compared at 3, 8, and 12 weeks of age. Grip strength and activity assays. The forelimb grip strength of four and eight week-old male wild-type, dyW-/- and dyW-/-;itga7+ mice were measured using a SDI Grip Strength System and a Chatillon DFE Digital Force Gauge (San Diego Instruments, Inc., San Diego, CA) as per standard protocol. Five consecutive tests were performed for each mouse and the data averaged for each mouse genotype. In order to assess mobility four and eight week old male wild-type, dyW-/- and dyW-/-;itga7+ mice were placed in a clean cage by themselves and monitored for five minutes. Periods of moving about the cage, standing up, and digging were considered times of activity. Additionally during this time period the number of times the mouse stood up was recorded. Stand up testing was only performed on animals which were physically able to stand up. Some mice were excluded from these samples due to the extent of their peripheral neuropathy. Hematoxylin and Eosin Staining. Cryosections from 4 week-old TA and diaphragm muscle were stained using Hematoxylin and Eosin and used to determine the percentage

266 of myofibers that contained centrally located nuclei using a Zeiss Axioskop 2 plus fluorescent microscope. A minimum of 1000 fibers per animal (5 animals per group) were counted and the percentage of myofibers with centrally located nuclei calculated. Images were captured using a Zeiss AxioCam HRc digital camera and Axiovision 4.1 software. Myofiber Area Determination. Cryosections from 4 week old TA and diaphragm muscles were fixed for 5 minutes in 4% paraformaldehyde (PFA) and rehydrated in PBS. Myofibers were outlined with 2µg/ml Oregon Green-488 conjugated WGA (Molecular Bioprobes, Eugene, OR) for 30 minutes. Sections were then washed with PBS for 15 minutes and mounted in Vectashield. A minimum of 1000 fibers per animal with five animals per group were assessed for the TA muscle. For diaphragm muscle a minimum of 500 fibers per animal with five animals per genotyped were used. Myofiber cross- sectional area was determined with a Zeiss Axioskop 2 Plus fluorescent microscope and images were captured with a Zeiss AxioCam HRc digital camera with Axiovision 4.1 software. Quantitative real-time PCR analysis. Total RNA was purified from five 4 week old male mice wild-type, dyW-/-, and dyW-/-;itga7+ gastrocnemius muscles using Trizol (Invitrogen, Carlsbad, CA) reagent. After the concentration was determined, mRNA was pooled equally by genotype for cDNA production. The cDNA was prepared from 4µg of pooled total RNA with random hexamers and Superscript III (Invitrogen, Carlsbad, CA) using standard procedures. Quantitative real-time PCR was conducted with 50pg total cDNA using SYBR Green Jumpstart (Sigma-Aldrich, St Louis, MO) with primer sequences to mouse extracellular matrix genes are listed in Table 2 and normalized to Gapdh. The fold change over wild-type was calculated using the ΔΔCt method after normalization and the average fold change in transcript and standard error of the mean were calculated. Statistics. Data is reported as the mean +/- standard deviation. One way analysis of variance (ANOVA) was used to compare animals across groups. Kaplan-Meier Log- Rank test was used to determine significance of life span changes. Myofiber cross- sectional area was analyzed using the GLIMMIX statistical analysis package in SAS. A

267 p-value of <0.05 was considered significant. ii. Results Transgenic α7 integrin expression alters the composition of the extracellular matrix in laminin-α2 deficient muscle. The loss of laminin-211/221 in the muscle extracellular matrix is an underlying cause of muscle disease in MDC1A. Since the α7 integrin is a major laminin receptor in muscle we next determined the mechanism by which increased α7β1 integrin rescued dyW-/- mice in the absence of its laminin-211/221 ligand. QRT-PCR was used to examine the expression profile of genes encoding an array of extracellular matrix proteins in the gastrocnemius muscle of 4 week old wild-type, dyW-/- and dyW-/-;itga7+ mice. QRT- PCR revealed that dyW-/- mice exhibited increased levels of a disintegrin and metalloproteinase with thrombospondin motifs 5 (Adamts5), agrin (Agn), collagen 6A1 (Col6A1), Galectin-1(Lgals1), Galectin-3 (Lgals3), matrix metalloprotease 2 (Mmp2), integrin α3 (Itga3), Integrin α6 (Itga6), Integrin α7 (Itga7), laminin-α4 (Lama4), laminin- α5 (Lama5), nidogen (Nid1), tenascin C (TnC), tissue inhibitor of metalloproteinase 1 (Timp1) and tissue inhibitor of metalloproteinase 2 (Timp2) transcripts compared to wild- type (Table 6).

Table 6. Changes in gene expression in dyW-/- mice. Gene Name dyW-/- dyW-/-;itga7+ Significant Change (fold increase over (fold increase over (dyW-/- vs dyW-/- Wild-type) Wild-type) ;itga7+) (p-value <0.05) Adamts5 1.97 ± 0.14 2.33 ± 0.08 No Agrn 9.23 ± 0.53 6.55 ± 0.15 Yes Col6a1 5.56 ± 0.27 7.45 ± 0.51 Yes Lgals1 9.19 ± 0.28 12.13 ± 0.31 Yes Lgala3 70.02 ± 0.83 80.43 ± 1.96 Yes Mmp2 19.21 ± 0.86 12.40 ± 0.43 Yes Itga3 4.99 ± 0.41 4.53 ± 0.23 No

268

Itga6 2.68 ± 0.09 3.71 ± 0.09 Yes Itga7 4.08 ± 0.11 17.15 ± 0.42 Yes Lama4 11.96 ± 0.40 12.60 ± 0.90 No Lama5 5.63 ± 0.34 6.16 ± 0.34 No Nid1 4.32 ± 1.56 6.07 ± 1.33 No Tnc 28.05 ±1.30 49.60 ±3.64 Yes Timp1 276.20 ± 22.35 328.56 ± 20.40 Yes Timp2 6.30 ± 0.18 6.34 ± 0.21 No Results are the fold increase in expression compared with that in wild-type mice. Significance is taken as P<0.5.

Transgenic expression of the α7 integrin in dyW-/-;itga7+ mice resulted in reduced levels of agrin and Mmp2 transcripts compared to dyW-/- mice (Table 1). Transgenic expression of the α7 integrin in dyW-/-;itga7+ mice resulted in increased transcripts for Col6A1, Lgals1, Lgals3, Itga3, Itga6, Itga7, Tnc and Timp1 compared to dyW-/- mice (Table 1). Next determined was if transgenic expression of the α7 integrin altered expression of Galectin-1 and -3 in the muscle of laminin-α2 null mice. Compared to wild-type mice, Galectin-1 transcript was increased 9.2-fold in dyW-/- muscle and 12.1-fold in dyW-/- ;itga7+ animals (Table 1). This increase in Galectin-1 transcript correlated with a 1.8- fold increase in Galectin-1 protein in dyW-/-;itga7+ animals compared to wild-type. These results indicate an increase in Galectin-1 protein in the gastrocnemius muscle of dyW-/-;itga7+ animals. Galectin-3 transcript was increased 70-fold and 80-fold in 4 week old dyW-/- and dyW-/-;itga7+ muscle respectively compared to wild-type (Table 1). This increase in Galectin-3 transcript resulted in a 2-fold increase in Galectin-3 protein in dyW-/- mice and a 7-fold increase in Galectin-3 protein in dyW-/-;itga7+ animals compared to wild-type. These results indicate loss of laminin-α2 resulted in increased Galectin-3 in the muscle extracellular matrix of dyW-/- mice and that transgenic expression of α7 integrin further enhanced the levels of Galectin-3 in laminin-α2 deficient muscle.

269

Tenascin C is normally localized at the myotendinous junctions and has been shown to be enriched at extrajunctional sites of laminin-α2 deficient muscle which correlate with regions of muscle regeneration. QRT-PCR was used to examine if transgenic overexpression of the α7 integrin altered the expression of tenascin C in the muscle of dyW-/- mice. QRT-PCR confirmed a 28-fold increase in tenascin C transcript in the gastrocnemius muscle of dyW-/- mice and a 49-fold increase in tenascin C transcript in dyW-/-;itga7+ gastrocnemius muscle compared to wild-type. These results indicate transgenic expression of the α7 integrin augmented tenascin C transcription in laminin-α2 null muscle. Immunofluorescence was used to confirm qRT-PCR and immunoblotting for several proteins. Immunofluorescence also demonstrated increased extracellular galectin 1, Galectin-3, and Tenascin C in the extracellular matrix with Galectin-3 and tenascin C being more prevalent in the dyW-/-;itga7+ mice. Immunostaining demonstrated reduced MMP2 and increased TIMP1 in the extracellular matrix of the dyW-/-;itga7+ mice compared with the dyW-/- mice. These results indicate that overexpression of the α7 integrin results in both augmentation and stabilization of the existing extracellular matrix in dyW-/-;itga7+ animals.

Transgenic expression of α7 integrin prevents muscle disease progression in the diaphragm of dyW mice. MDC1A patients exhibit severe restrictive respiratory syndrome and require ventilator assistance to breathe as a result of severe diaphragm muscle pathology. Histological analysis and measurements of myofiber area were used to examine if transgenic expression of the α7 integrin prevented the onset of severe diaphragm muscle pathology. H&E studies revealed transgenic expression of the α7 integrin in 4 week old dyW-/- diaphragm muscle resulted in reduced mononuclear cell infiltrate, hypotrophic muscle fibers, centrally located nuclei and fibrosis. Analysis of myofiber cross-sectional areas confirmed the improvement in the muscle pathology observed in the histological studies. Compared to wild-type with a peak myofiber cross-sectional area of between 3.5-4.5 µm2, dyW-/- muscle exhibited a large

270 number of hypotrophic muscle fibers with a peak myofiber area of only 2 µm2. In contrast dyW-/-;itga7+ diaphragm myofibers exhibited a peak myofiber area of between 3.5-5 µm2 and a curve more similar to wild-type. At the maximum frequency myofiber area, all three groups were significantly different from one another. These results indicate transgenic expression of the α7 integrin prevents muscle disease progression in the diaphragm of laminin-α2 null mice. The studies described in this Example were described in detail by Doe et al. in J. Cell Science: 124: 2287-2297, 2011 which is hereby incorporated by reference in its entirety.

271

Example 4 Galectin-1 treatment decreases muscle damage in mdx mice This example illustrates Galectin-1 increases muscle repair in mdx mice. To produce recombinant Galectin-1, PCR amplified LGALS1 cDNA isolated from total mouse muscle mRNA was cloned into a pET23b vector. Rosetta E. coli cells were transformed with pET23b-LGALS1 vector utilizing standard techniques. Recombinant Galectin-1 was isolated and determined to have a sequence corresponding to GENBANK® Accession No. NP_032521.1 as provided by GENBANK® on August 10, 2012 except with a single amino acid substitution at amino acid position 10, in which glutamine (Q) was substituted for leucine (L). Recombinant Galectin-1 was purified by loading induced cell lysate onto Talon affinity column. The purity of Galectin-1 fractions was then determined by using BCA protein analysis, Western blot analysis and Coomassie blue staining (see FIG. 12). To determine the effect of Galectin-1 treatment on muscle damage in mdx mice, mdx mice were injected with 100 µl of 13µM recombinant Galectin-1 through intramuscular injections into their TA muscle. Sections of TA muscle were stained using Hematoxylin and Eosin (H&E). The mdx TA injected with Galectin-1 showed decreased muscle damage over those injected with PBS, as indicated by decreased percentage of myofibers with CLN (FIG. 13). FIG. 14 illustrates Galectin-1 treatment increases α7 integrin. These studies indicate that Galectin-1/3 protein therapy may be beneficial for MD- Galectin-1 increases alpha7 integrin and provides additional extracellular matrix (ECM) for attachment of muscle cells.

In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.

272

We claim:

1. A method of diagnosing or prognosing a subject with muscular dystrophy, comprising: contacting a sample obtained from a subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy with a Galectin-1 and/or Galectin-3 detection molecule; detecting expression of Galectin-1 or Galectin-3 in the sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy; and comparing expression of Galectin-1 or Galectin-3 in the sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy to a control, wherein increased expression of Galectin-1 or Galectin- 3 molecules relative to a control indicates that the subject has muscular dystrophy

2. The method of claim 1, wherein comparing expression Galectin-1 or Galectin-3 comprises automation and implementation by using a computer.

3. The method of claim 1, wherein the muscular dystrophy is merosin deficient congenital muscular dystrophy Type 1A (MDC1A), limb-girdle muscular dystrophy (LGMD), facioscapulohumeral (FHMD), Beckers muscular dystrophy (BMD) or Duchenne muscular dystrophy (DMD).

4. The method of claim 1, wherein detecting expression comprises detecting Galectin-3.

5. The method of claim 4, wherein increased expression of Galectin-3 molecules relative to a control indicates that the subject has a poor prognosis and a decreased chance of survival.

6. The method of claim 5, wherein the muscular dystrophy is DMD.

7. The method of claim 5, wherein the muscular dystrophy is MDC1A.

8. The method of claim 1, wherein the sample is a blood or urine sample.

9. A method of determining the effectiveness of an agent for the treatment of muscular dystrophy in a subject with muscular dystrophy, comprising: detecting expression of Galectin-3 in a sample from the subject following treatment with the agent; and comparing expression of Galectin-3 following treatment to a reference value, wherein a decrease in the expression of Galectin-3 following treatment indicates that the agent is effective for the treatment of muscular dystrophy in the subject.

273

10. The method of claim 9, wherein the reference value represents an expression value of the Galectin-3 in a sample from the subject prior to treatment with the agent.

11. The method of claim 9, wherein the muscular dystrophy is merosin deficient congenital muscular dystrophy Type 1A (MDC1A), limb-girdle muscular dystrophy (LGMD), facioscapulohumeral (FHMD), Beckers muscular dystrophy (BMD) or Duchenne muscular dystrophy (DMD).

12. The method of claim 11, wherein the muscular dystrophy is DMD.

13. The method of claim 9, wherein an increase or no significant decrease in Galectin-3 following treatment indicates the subject has a poor prognosis and the agent is not effective at treating muscular dystrophy.

14. A method of enhancing muscle regeneration, repair, or maintenance in a subject comprising administering a therapeutically effective amount of Galectin-1, Galectin-3 or a combination thereof to the subject in need thereof.

15. The method of claim 14, wherein the method includes administering a therapeutically effective amount of Galectin-1.

16. The method of claim 15, wherein the subject has or is at risk of acquiring a muscular dystrophy.

17. A method of identifying an agent for use in treating muscular dystrophy, comprising: contacting a sample with one or more test agents under conditions sufficient for the one or more test agents to decrease the activity of at Galectin-1 or galection-3; detecting activity of Galectin-1 or galection-3 in the presence of the one or more test agents; and comparing activity of Galectin-1 or galection-3 in the presence of the one or more test agents to a reference value to determine if there is an alteration in expression of Galectin-1 or galection-3, wherein decreased expression of Galectin-1 or galection-3 indicates that the one or more test agents is of use to treat the muscular dystrophy.

18. The method of claim 17, wherein an at least 2-fold, at least 3-fold, or at least 5-fold, decrease in the activity of Galectin-1 or galection-3 in the presence of the one or more test agents as compared to the reference value indicates the one or more test agents is of use to treat muscular dystrophy.

19. The method of claim 17, wherein the muscular dystrophy is merosin deficient congenital muscular dystrophy Type 1A (MDC1A), limb-girdle muscular

274 dystrophy (LGMD), facioscapulohumeral (FHMD), Beckers muscular dystrophy (BMD) or Duchenne muscular dystrophy (DMD).

20. The method of claim 19, wherein the muscular dystrophy is DMD.

275

METHODS FOR DIAGNOSING, PROGNOSING AND TREATING MUSCULAR DYSTROPHY

ABSTRACT OF THE DISCLOSURE

Disclosed herein are methods for diagnosing, prognosing and treating muscular dystrophy. The disclosed methods can be used to diagnosis, prognosis or treat a subject with merosin-deficient congenital muscular dystrophy Type 1A (MDC1A), limb-girdle muscular dystrophy (LGMD), facioscapulohumeral (FHMD), Beckers muscular dystrophy (BMD) or Duchenne muscular dystrophy (DMD). Also disclosed are methods of determining the effectiveness of an agent for the treatment of muscular dystrophy. In an example, a method of diagnosing or prognosing a subject with muscular dystrophy includes detecting expression of Galectin-1 or Galectin-3 in a sample obtained from the subject at risk of having or having one or more signs or symptoms associated with muscular dystrophy, thereby diagnosing or prognosing the subject with muscular dystrophy. Also provided are methods of enhancing muscle regeneration, repair, or maintenance in a subject by administering galectin, such as Galectin-1 and/or Galectin-3 to a subject in need thereof.

276

KKB:mjc 08/07/14 UNR12-006 FILED VIA EFS Attorney Ref. No. 7276-87682-02 DATE OF DEPOSIT: AUGUST 10, 2012

277

278

279

280

281

282

283

284

285

286

287

288

289

290

291

Table 1 & 2

References to Table 1 and Table 1S in Doe et al. in patent application. (253)

292

Bibliography

1. Chargé SB & Rudnicki MA (2004) Cellular and molecular regulation of

muscle regeneration. Physiol Rev 84(1):209-238.

2. Zammit PS, Partridge TA, & Yablonka-Reuveni Z (2006) The skeletal

muscle satellite cell: the stem cell that came in from the cold. J Histochem

Cytochem 54(11):1177-1191.

3. Hawke TJ & Garry DJ (2001) Myogenic satellite cells: physiology to

molecular biology. J Appl Physiol 91(2):534-551.

4. Borg K (1992) The man behind the syndrome: Guillaume Duchenne. J

Hist Neurosci 1(2):145-154.

5. Hoffman EP & Kunkel LM (1989) Dystrophin abnormalities in

Duchenne/Becker muscular dystrophy. Neuron 2(1):1019-1029.

6. Monaco AP, et al. (1986) Isolation of candidate cDNAs for portions of the

Duchenne muscular dystrophy gene. Nature 323(6089):646-650.

7. Koenig M, et al. (1987) Complete cloning of the Duchenne muscular

dystrophy (DMD) cDNA and preliminary genomic organization of the DMD

gene in normal and affected individuals. Cell 50(3):509-517.

8. Monaco AP, Bertelson CJ, Liechti-Gallati S, Moser H, & Kunkel LM (1988)

An explanation for the phenotypic differences between patients bearing

partial deletions of the DMD locus. Genomics 2(1):90-95.

9. Anderson JL, Head SI, Rae C, & Morley JW (2002) Brain function in

Duchenne muscular dystrophy. Brain 125(Pt 1):4-13.

293

10. Moizard MP, et al. (1998) Are Dp71 and Dp140 brain dystrophin isoforms

related to cognitive impairment in Duchenne muscular dystrophy? Am J

Med Genet 80(1):32-41.

11. Tracey I, et al. (1995) Brain abnormalities in Duchenne muscular

dystrophy: phosphorus-31 magnetic resonance spectroscopy and

neuropsychological study. Lancet 345(8960):1260-1264.

12. Vaillend C, Rendon A, Misslin R, & Ungerer A (1995) Influence of

dystrophin-gene mutation on mdx mouse behavior. I. Retention deficits at

long delays in spontaneous alternation and bar-pressing tasks. Behav

Genet 25(6):569-579.

13. Barbujani G, et al. (1990) Segregation analysis of 1885 DMD families:

significant departure from the expected proportion of sporadic cases. Hum

Genet 84(6):522-526.

14. Shiao T, et al. (2004) Defects in neuromuscular junction structure in

dystrophic muscle are corrected by expression of a NOS transgene in

dystrophin-deficient muscles, but not in muscles lacking alpha- and beta1-

syntrophins. Hum Mol Genet 13(17):1873-1884.

15. Hack AA, et al. (2000) Differential requirement for individual sarcoglycans

and dystrophin in the assembly and function of the dystrophin-glycoprotein

complex. J Cell Sci 113 ( Pt 14):2535-2544.

16. Matsumura K, et al. (1994) Expression of dystrophin-associated proteins

in dystrophin-positive muscle fibers (revertants) in Duchenne muscular

dystrophy. Neuromuscul Disord 4(2):115-120.

294

17. Ervasti JM & Campbell KP (1993) Dystrophin-associated glycoproteins:

their possible roles in the pathogenesis of Duchenne muscular dystrophy.

Mol Cell Biol Hum Dis Ser 3:139-166.

18. Ibraghimov-Beskrovnaya O, et al. (1992) Primary structure of dystrophin-

associated glycoproteins linking dystrophin to the extracellular matrix.

Nature 355(6362):696-702.

19. Ohlendieck K, Ervasti JM, Snook JB, & Campbell KP (1991) Dystrophin-

glycoprotein complex is highly enriched in isolated skeletal muscle

sarcolemma. J Cell Biol 112(1):135-148.

20. Crosbie RH, et al. (2000) Molecular and genetic characterization of

sarcospan: insights into sarcoglycan-sarcospan interactions. Hum Mol

Genet 9(13):2019-2027.

21. Crosbie RH, et al. (1999) Membrane targeting and stabilization of

sarcospan is mediated by the sarcoglycan subcomplex. J Cell Biol

145(1):153-165.

22. Levine BA, Moir AJ, Patchell VB, & Perry SV (1990) The interaction of

actin with dystrophin. FEBS Lett 263(1):159-162.

23. Campbell KP & Kahl SD (1989) Association of dystrophin and an integral

membrane glycoprotein. Nature 338(6212):259-262.

24. Petrof BJ, Shrager JB, Stedman HH, Kelly AM, & Sweeney HL (1993)

Dystrophin protects the sarcolemma from stresses developed during

muscle contraction. Proc Natl Acad Sci U S A 90(8):3710-3714.

295

25. Weller B, Karpati G, & Carpenter S (1990) Dystrophin-deficient mdx

muscle fibers are preferentially vulnerable to necrosis induced by

experimental lengthening contractions. J Neurol Sci 100(1-2):9-13.

26. Matsumura K, Ervasti JM, Ohlendieck K, Kahl SD, & Campbell KP (1992)

Association of dystrophin-related protein with dystrophin-associated

proteins in mdx mouse muscle. Nature 360(6404):588-591.

27. Pearce M, et al. (1993) The utrophin and dystrophin genes share

similarities in genomic structure. Hum Mol Genet 2(11):1765-1772.

28. Tinsley JM, et al. (1992) Primary structure of dystrophin-related protein.

Nature 360(6404):591-593.

29. Ohlendieck K, et al. (1991) Dystrophin-related protein is localized to

neuromuscular junctions of adult skeletal muscle. Neuron 7(3):499-508.

30. Khurana TS, et al. (1991) Immunolocalization and developmental

expression of dystrophin related protein in skeletal muscle. Neuromuscul

Disord 1(3):185-194.

31. Pons F, Nicholson LV, Robert A, Voit T, & Leger JJ (1993) Dystrophin and

dystrophin-related protein (utrophin) distribution in normal and dystrophin-

deficient skeletal muscles. Neuromuscul Disord 3(5-6):507-514.

32. Kleopa KA, Drousiotou A, Mavrikiou E, Ormiston A, & Kyriakides T (2006)

Naturally occurring utrophin correlates with disease severity in Duchenne

muscular dystrophy. Hum Mol Genet 15(10):1623-1628.

33. Deconinck AE, et al. (1997) Utrophin-dystrophin-deficient mice as a model

for Duchenne muscular dystrophy. Cell 90(4):717-727.

296

34. Grady RM, et al. (1997) Skeletal and cardiac myopathies in mice lacking

utrophin and dystrophin: a model for Duchenne muscular dystrophy. Cell

90(4):729-738.

35. Burkin DJ & Kaufman SJ (1999) The alpha7beta1 integrin in muscle

development and disease. Cell Tissue Res 296(1):183-190.

36. Song WK, Wang W, Foster RF, Bielser DA, & Kaufman SJ (1992) H36-

alpha 7 is a novel integrin alpha chain that is developmentally regulated

during skeletal myogenesis. J Cell Biol 117(3):643-657.

37. Hynes RO (1992) Integrins: versatility, modulation, and signaling in cell

adhesion. Cell 69(1):11-25.

38. Martin PT, Kaufman SJ, Kramer RH, & Sanes JR (1996) Synaptic

integrins in developing, adult, and mutant muscle: selective association of

alpha1, alpha7A, and alpha7B integrins with the neuromuscular junction.

Dev Biol 174(1):125-139.

39. Burkin DJ, Wallace GQ, Nicol KJ, Kaufman DJ, & Kaufman SJ (2001)

Enhanced expression of the alpha 7 beta 1 integrin reduces muscular

dystrophy and restores viability in dystrophic mice. J Cell Biol

152(6):1207-1218.

40. Burkin DJ, et al. (2005) Transgenic expression of {alpha}7{beta}1 integrin

maintains muscle integrity, increases regenerative capacity, promotes

hypertrophy, and reduces cardiomyopathy in dystrophic mice. Am J

Pathol, United States), Vol 166, pp 253-263.

297

41. Guo C, et al. (2006) Absence of alpha 7 integrin in dystrophin-deficient

mice causes a myopathy similar to Duchenne muscular dystrophy. Hum

Mol Genet 15(6):989-998.

42. Rooney JE, et al. (2006) Severe muscular dystrophy in mice that lack

dystrophin and alpha7 integrin. J Cell Sci, England), Vol 119, pp 2185-

2195.

43. Bushby K, et al. (2010) Diagnosis and management of Duchenne

muscular dystrophy, part 1: diagnosis, and pharmacological and

psychosocial management. Lancet Neurol 9(1):77-93.

44. Flanigan KM, et al. (2001) Genetic characterization of a large, historically

significant Utah kindred with facioscapulohumeral dystrophy. Neuromuscul

Disord 11(6-7):525-529.

45. Mostacciuolo ML, et al. (2009) Facioscapulohumeral muscular dystrophy:

epidemiological and molecular study in a north-east Italian population

sample. Clin Genet 75(6):550-555.

46. Padberg GW, et al. (1995) Facioscapulohumeral muscular dystrophy in

the Dutch population. Muscle Nerve Suppl (2):S81-84.

47. Tawil R (2008) Facioscapulohumeral muscular dystrophy.

Neurotherapeutics 5(4):601-606.

48. Lemmers RJ, et al. (2010) A unifying genetic model for

facioscapulohumeral muscular dystrophy. Science 329(5999):1650-1653.

298

49. Lemmers RJ, et al. (2012) Digenic inheritance of an SMCHD1 mutation

and an FSHD-permissive D4Z4 allele causes facioscapulohumeral

muscular dystrophy type 2. Nat Genet 44(12):1370-1374.

50. Sahenk Z & Mendell JR (2011) The muscular dystrophies: distinct

pathogenic mechanisms invite novel therapeutic approaches. Curr

Rheumatol Rep 13(3):199-207.

51. Klinge L, et al. (2006) Severe phenotype in infantile facioscapulohumeral

muscular dystrophy. Neuromuscul Disord 16(9-10):553-558.

52. Geng LN, et al. (2012) DUX4 activates germline genes, retroelements,

and immune mediators: implications for facioscapulohumeral dystrophy.

Dev Cell 22(1):38-51.

53. van der Maarel SM, Tawil R, & Tapscott SJ (2011) Facioscapulohumeral

muscular dystrophy and DUX4: breaking the silence. Trends Mol Med

17(5):252-258.

54. Wijmenga C, et al. (1992) Chromosome 4q DNA rearrangements

associated with facioscapulohumeral muscular dystrophy. Nat Genet

2(1):26-30.

55. Lunt PW, et al. (1995) Phenotypic-genotypic correlation will assist genetic

counseling in 4q35-facioscapulohumeral muscular dystrophy. Muscle

Nerve Suppl (2):S103-109.

56. van der Maarel SM & Frants RR (2005) The D4Z4 repeat-mediated

pathogenesis of facioscapulohumeral muscular dystrophy. Am J Hum

Genet 76(3):375-386.

299

57. van Deutekom JC, et al. (1996) Evidence for subtelomeric exchange of

3.3 kb tandemly repeated units between chromosomes 4q35 and 10q26:

implications for genetic counselling and etiology of FSHD1. Hum Mol

Genet 5(12):1997-2003.

58. van der Maarel SM, Miller DG, Tawil R, Filippova GN, & Tapscott SJ

(2012) Facioscapulohumeral muscular dystrophy: consequences of

chromatin relaxation. Curr Opin Neurol 25(5):614-620.

59. Gabellini D, Green MR, & Tupler R (2002) Inappropriate gene activation in

FSHD: a repressor complex binds a chromosomal repeat deleted in

dystrophic muscle. Cell 110(3):339-348.

60. Jiang G, et al. (2003) Testing the position-effect variegation hypothesis for

facioscapulohumeral muscular dystrophy by analysis of histone

modification and gene expression in subtelomeric 4q. Hum Mol Genet

12(22):2909-2921.

61. Bodega B, et al. (2009) Remodeling of the chromatin structure of the

facioscapulohumeral muscular dystrophy (FSHD) locus and upregulation

of FSHD-related gene 1 (FRG1) expression during human myogenic

differentiation. BMC Biol 7:41.

62. van Deutekom JC, et al. (1996) Identification of the first gene (FRG1) from

the FSHD region on human chromosome 4q35. Hum Mol Genet 5(5):581-

590.

300

63. Grewal PK, Van Deutekom JC, Frants RR, & Hewitt JE (1996) A search

for genes in the facioscapulohumeral muscular dystrophy region. Biochem

Soc Trans 24(2):282S.

64. Grewal PK, Todd LC, van der Maarel S, Frants RR, & Hewitt JE (1998)

FRG1, a gene in the FSH muscular dystrophy region on human

chromosome 4q35, is highly conserved in vertebrates and invertebrates.

Gene 216(1):13-19.

65. Winokur ST, et al. (2003) Expression profiling of FSHD muscle supports a

defect in specific stages of myogenic differentiation. Hum Mol Genet

12(22):2895-2907.

66. Osborne RJ, Welle S, Venance SL, Thornton CA, & Tawil R (2007)

Expression profile of FSHD supports a link between retinal vasculopathy

and muscular dystrophy. Neurology 68(8):569-577.

67. van Overveld PG, et al. (2003) Hypomethylation of D4Z4 in 4q-linked and

non-4q-linked facioscapulohumeral muscular dystrophy. Nat Genet

35(4):315-317.

68. de Greef JC, et al. (2010) Clinical features of facioscapulohumeral

muscular dystrophy 2. Neurology 75(17):1548-1554.

69. Wood-Allum C, et al. (2004) Clinical and histopathological heterogeneity in

patients with 4q35 facioscapulohumeral muscular dystrophy (FSHD).

Neuropathol Appl Neurobiol 30(2):188-191.

301

70. Lin MY & Nonaka I (1991) Facioscapulohumeral muscular dystrophy:

muscle fiber type analysis with particular reference to small angular fibers.

Brain Dev 13(5):331-338.

71. Arahata K, et al. (1995) Inflammatory response in facioscapulohumeral

muscular dystrophy (FSHD): immunocytochemical and genetic analyses.

Muscle Nerve Suppl (2):S56-66.

72. Celegato B, et al. (2006) Parallel protein and transcript profiles of FSHD

patient muscles correlate to the D4Z4 arrangement and reveal a common

impairment of slow to fast fibre differentiation and a general deregulation

of MyoD-dependent genes. Proteomics 6(19):5303-5321.

73. Reed P, et al. (2006) Sarcolemmal reorganization in facioscapulohumeral

muscular dystrophy. Ann Neurol 59(2):289-297.

74. Neudecker S, Krasnianski M, Bahn E, & Zierz S (2004) Rimmed vacuoles

in facioscapulohumeral muscular dystrophy: a unique ultrastructural

feature. Acta Neuropathol 108(3):257-259.

75. Sandri M, et al. (2001) Caspase 3 expression correlates with skeletal

muscle apoptosis in Duchenne and facioscapulo human muscular

dystrophy. A potential target for pharmacological treatment? J

Neuropathol Exp Neurol 60(3):302-312.

76. Saito A, et al. (2000) An overexpression of fibroblast growth factor (FGF)

and FGF receptor 4 in a severe clinical phenotype of facioscapulohumeral

muscular dystrophy. Muscle Nerve 23(4):490-497.

302

77. Lunt PW, Compston DA, & Harper PS (1989) Estimation of age dependent

penetrance in facioscapulohumeral muscular dystrophy by minimising

ascertainment bias. J Med Genet 26(12):755-760.

78. Awerbuch GI, Nigro MA, & Wishnow R (1990) Beevor's sign and

facioscapulohumeral dystrophy. Arch Neurol 47(11):1208-1209.

79. Padberg GW, et al. (1995) On the significance of retinal vascular disease

and hearing loss in facioscapulohumeral muscular dystrophy. Muscle

Nerve Suppl (2):S73-80.

80. Fitzsimons RB, Gurwin EB, & Bird AC (1987) Retinal vascular

abnormalities in facioscapulohumeral muscular dystrophy. A general

association with genetic and therapeutic implications. Brain 110 ( Pt

3):631-648.

81. Funakoshi M, Goto K, & Arahata K (1998) Epilepsy and mental retardation

in a subset of early onset 4q35-facioscapulohumeral muscular dystrophy.

Neurology 50(6):1791-1794.

82. Lunt PW, et al. (1995) Correlation between fragment size at D4F104S1

and age at onset or at wheelchair use, with a possible generational effect,

accounts for much phenotypic variation in 4q35-facioscapulohumeral

muscular dystrophy (FSHD). Hum Mol Genet 4(5):951-958.

83. Anonymous (2000) New nomenclature and DNA testing guidelines for

myotonic dystrophy type 1 (DM1). The International Myotonic Dystrophy

Consortium (IDMC). Neurology 54(6):1218-1221.

303

84. Day JW, et al. (1999) Clinical and genetic characteristics of a five-

generation family with a novel form of myotonic dystrophy (DM2).

Neuromuscul Disord 9(1):19-27.

85. Udd B & Krahe R (2012) The myotonic dystrophies: molecular, clinical,

and therapeutic challenges. Lancet Neurol 11(10):891-905.

86. Mahadevan M, et al. (1992) Myotonic dystrophy mutation: an unstable

CTG repeat in the 3' untranslated region of the gene. Science

255(5049):1253-1255.

87. Fu YH, et al. (1992) An unstable triplet repeat in a gene related to

myotonic muscular dystrophy. Science 255(5049):1256-1258.

88. Brook JD, et al. (1992) Molecular basis of myotonic dystrophy: expansion

of a trinucleotide (CTG) repeat at the 3' end of a transcript encoding a

protein kinase family member. Cell 69(2):385.

89. Wheeler TM & Thornton CA (2007) Myotonic dystrophy: RNA-mediated

muscle disease. Curr Opin Neurol 20(5):572-576.

90. Llamusí B & Artero R (2008) Molecular Effects of the CTG Repeats in

Mutant Dystrophia Myotonica Protein Kinase Gene. Curr Genomics

9(8):509-516.

91. Bhagavati S, Bhagwati S, Ghatpande A, & Leung B (1996) Identification of

two nuclear proteins which bind to RNA CUG repeats: significance for

myotonic dystrophy. Biochem Biophys Res Commun 228(1):55-62.

92. Schoser BG, et al. (2004) Muscle pathology in 57 patients with myotonic

dystrophy type 2. Muscle Nerve 29(2):275-281.

304

93. Schoser B & Timchenko L (2010) Myotonic dystrophies 1 and 2: complex

diseases with complex mechanisms. Curr Genomics 11(2):77-90.

94. Liquori CL, et al. (2001) Myotonic dystrophy type 2 caused by a CCTG

expansion in intron 1 of ZNF9. Science 293(5531):864-867.

95. Ranum LP, Rasmussen PF, Benzow KA, Koob MD, & Day JW (1998)

Genetic mapping of a second myotonic dystrophy locus. Nat Genet

19(2):196-198.

96. Meola G (2013) Clinical aspects, molecular pathomechanisms and

management of myotonic dystrophies. Acta Myol 32(3):154-165.

97. Udd B, et al. (2003) Report of the 115th ENMC workshop: DM2/PROMM

and other myotonic dystrophies. 3rd Workshop, 14-16 February 2003,

Naarden, The Netherlands. Neuromuscul Disord 13(7-8):589-596.

98. Vihola A, et al. (2010) Differences in aberrant expression and splicing of

sarcomeric proteins in the myotonic dystrophies DM1 and DM2. Acta

Neuropathol 119(4):465-479.

99. Vihola A, et al. (2003) Histopathological differences of myotonic dystrophy

type 1 (DM1) and PROMM/DM2. Neurology 60(11):1854-1857.

100. Bassez G, et al. (2008) Type 2 myotonic dystrophy can be predicted by

the combination of type 2 muscle fiber central nucleation and scattered

atrophy. J Neuropathol Exp Neurol 67(4):319-325.

101. Pisani V, et al. (2008) Preferential central nucleation of type 2 myofibers is

an invariable feature of myotonic dystrophy type 2. Muscle Nerve

38(5):1405-1411.

305

102. Ashizawa T (1998) Myotonic dystrophy as a brain disorder. Arch Neurol

55(3):291-293.

103. Spranger M, Spranger S, Tischendorf M, Meinck HM, & Cremer M (1997)

Myotonic dystrophy. The role of large triplet repeat length in the

development of mental retardation. Arch Neurol 54(3):251-254.

104. Chebel S, Ben Hamda K, Boughammoura A, Frih Ayed M, & Ben Farhat

MH (2005) [Cardiac involvement in Steinert's myotonic dystrophy]. Rev

Neurol (Paris) 161(10):932-939.

105. Auvinen S, et al. (2008) Myotonic dystrophy type 2 found in two of sixty-

three persons diagnosed as having fibromyalgia. Arthritis Rheum

58(11):3627-3631.

106. Savkur RS, Philips AV, & Cooper TA (2001) Aberrant regulation of insulin

receptor alternative splicing is associated with insulin resistance in

myotonic dystrophy. Nat Genet 29(1):40-47.

107. Rocha CT & Hoffman EP (2010) Limb-girdle and congenital muscular

dystrophies: current diagnostics, management, and emerging

technologies. Curr Neurol Neurosci Rep 10(4):267-276.

108. Bushby K (2009) Diagnosis and management of the limb girdle muscular

dystrophies. Pract Neurol 9(6):314-323.

109. Nigro V & Savarese M (2014) Genetic basis of limb-girdle muscular

dystrophies: the 2014 update. Acta Myol 33(1):1-12.

306

110. Nigro V, Aurino S, & Piluso G (2011) Limb girdle muscular dystrophies:

update on genetic diagnosis and therapeutic approaches. Curr Opin

Neurol 24(5):429-436.

111. Chou FL, et al. (1999) Calpain III mutation analysis of a heterogeneous

limb-girdle muscular dystrophy population. Neurology 52(5):1015-1020.

112. Siala O, et al. (2008) Molecular prenatal diagnosis of muscular

dystrophies in Tunisia and postnatal follow-up role. Genet Test 12(4):581-

586.

113. Liang WC, et al. (2013) Limb-girdle muscular dystrophy type 2I is not rare

in Taiwan. Neuromuscul Disord 23(8):675-681.

114. Rasmussen M, Scheie D, Breivik N, Mork M, & Lindal S (2014) Clinical

and muscle biopsy findings in Norwegian paediatric patients with limb

girdle muscular dystrophy 2I. Acta Paediatr 103(5):553-558.

115. Marshall JL, Kwok Y, McMorran B, Baum LG, & Crosbie-Watson RH

(2013) The potential of sarcospan in adhesion complex replacement

therapeutics for the treatment of muscular dystrophy. FEBS J.

116. Marshall JL, et al. (2012) Dystrophin and utrophin expression require

sarcospan: loss of α7 integrin exacerbates a newly discovered muscle

phenotype in sarcospan-null mice. Hum Mol Genet 21(20):4378-4393.

117. Peat RA, et al. (2008) Diagnosis and etiology of congenital muscular

dystrophy. Neurology 71(5):312-321.

118. Mercuri E & Muntoni F (2012) The ever-expanding spectrum of congenital

muscular dystrophies. Ann Neurol 72(1):9-17.

307

119. van Reeuwijk J, et al. (2005) POMT2 mutations cause alpha-dystroglycan

hypoglycosylation and Walker-Warburg syndrome. J Med Genet

42(12):907-912.

120. Beltrán-Valero de Bernabé D, et al. (2002) Mutations in the O-

mannosyltransferase gene POMT1 give rise to the severe neuronal

migration disorder Walker-Warburg syndrome. Am J Hum Genet

71(5):1033-1043.

121. Yoshida A, et al. (2001) Muscular dystrophy and neuronal migration

disorder caused by mutations in a glycosyltransferase, POMGnT1. Dev

Cell 1(5):717-724.

122. Longman C, et al. (2003) Mutations in the human LARGE gene cause

MDC1D, a novel form of congenital muscular dystrophy with severe

mental retardation and abnormal glycosylation of alpha-dystroglycan. Hum

Mol Genet 12(21):2853-2861.

123. Beltran-Valero de Bernabé D, et al. (2004) Mutations in the FKRP gene

can cause muscle-eye-brain disease and Walker-Warburg syndrome. J

Med Genet 41(5):e61.

124. Brockington M, et al. (2001) Mutations in the fukutin-related protein gene

(FKRP) cause a form of congenital muscular dystrophy with secondary

laminin alpha2 deficiency and abnormal glycosylation of alpha-

dystroglycan. Am J Hum Genet 69(6):1198-1209.

125. Brockington M, et al. (2001) Mutations in the fukutin-related protein gene

(FKRP) identify limb girdle muscular dystrophy 2I as a milder allelic variant

308

of congenital muscular dystrophy MDC1C. Hum Mol Genet 10(25):2851-

2859.

126. Willer T, et al. (2012) ISPD loss-of-function mutations disrupt dystroglycan

O-mannosylation and cause Walker-Warburg syndrome. Nat Genet

44(5):575-580.

127. Barone R, et al. (2012) DPM2-CDG: a muscular dystrophy-

dystroglycanopathy syndrome with severe epilepsy. Ann Neurol

72(4):550-558.

128. Lefeber DJ, et al. (2009) Deficiency of Dol-P-Man synthase subunit DPM3

bridges the congenital disorders of glycosylation with the

dystroglycanopathies. Am J Hum Genet 85(1):76-86.

129. Manzini MC, et al. (2012) Exome sequencing and functional validation in

zebrafish identify GTDC2 mutations as a cause of Walker-Warburg

syndrome. Am J Hum Genet 91(3):541-547.

130. Vuillaumier-Barrot S, et al. (2012) Identification of mutations in TMEM5

and ISPD as a cause of severe cobblestone lissencephaly. Am J Hum

Genet 91(6):1135-1143.

131. Reed UC (2009) Congenital muscular dystrophy. Part I: a review of

phenotypical and diagnostic aspects. Arq Neuropsiquiatr, Brazil), Vol 67,

pp 144-168.

132. Jones KJ, et al. (2001) The expanding phenotype of laminin alpha2 chain

(merosin) abnormalities: case series and review. J Med Genet 38(10):649-

657.

309

133. Hayashi YK, et al. (1998) Mutations in the integrin alpha7 gene cause

congenital myopathy. Nat Genet 19(1):94-97.

134. Shieh PB (2013) Muscular dystrophies and other genetic myopathies.

Neurol Clin 31(4):1009-1029.

135. Ellis JA (2006) Emery-Dreifuss muscular dystrophy at the nuclear

envelope: 10 years on. Cell Mol Life Sci 63(23):2702-2709.

136. Abdel-Hamid H & Clemens PR (2012) Pharmacological therapies for

muscular dystrophies. Curr Opin Neurol 25(5):604-608.

137. Bushby K, et al. (2010) Diagnosis and management of Duchenne

muscular dystrophy, part 2: implementation of multidisciplinary care.

Lancet Neurol 9(2):177-189.

138. Berardi E, Annibali D, Cassano M, Crippa S, & Sampaolesi M (2014)

Molecular and cell-based therapies for muscle degenerations: a road

under construction. Front Physiol 5:119.

139. D'Angelo MG, et al. (2012) Nitric oxide donor and non steroidal anti

inflammatory drugs as a therapy for muscular dystrophies: evidence from

a safety study with pilot efficacy measures in adult dystrophic patients.

Pharmacol Res 65(4):472-479.

140. Moxley RT, Pandya S, Ciafaloni E, Fox DJ, & Campbell K (2010) Change

in natural history of Duchenne muscular dystrophy with long-term

corticosteroid treatment: implications for management. J Child Neurol

25(9):1116-1129.

310

141. Bonifati MD, et al. (2000) A multicenter, double-blind, randomized trial of

deflazacort versus prednisone in Duchenne muscular dystrophy. Muscle

Nerve 23(9):1344-1347.

142. Fenichel GM, et al. (1991) A comparison of daily and alternate-day

prednisone therapy in the treatment of Duchenne muscular dystrophy.

Arch Neurol 48(6):575-579.

143. Griggs RC, et al. (2013) Corticosteroids in Duchenne muscular dystrophy:

major variations in practice. Muscle Nerve 48(1):27-31.

144. Angelini C, et al. (1994) Deflazacort in Duchenne dystrophy: study of long-

term effect. Muscle Nerve 17(4):386-391.

145. Reitter B (1995) Deflazacort vs. prednisone in Duchenne muscular

dystrophy: trends of an ongoing study. Brain Dev 17 Suppl:39-43.

146. Ruegg UT, et al. (2002) Pharmacological control of cellular calcium

handling in dystrophic skeletal muscle. Neuromuscul Disord 12 Suppl

1:S155-161.

147. Cozzoli A, et al. (2011) Evaluation of potential synergistic action of a

combined treatment with alpha-methyl-prednisolone and taurine on the

mdx mouse model of Duchenne muscular dystrophy. Neuropathol Appl

Neurobiol 37(3):243-256.

148. Moorwood C, et al. (2011) Drug discovery for Duchenne muscular

dystrophy via utrophin promoter activation screening. PLoS One

6(10):e26169.

311

149. Kayali R, et al. (2012) Read-through compound 13 restores dystrophin

expression and improves muscle function in the mdx mouse model for

Duchenne muscular dystrophy. Hum Mol Genet 21(18):4007-4020.

150. Finkel RS (2010) Read-through strategies for suppression of nonsense

mutations in Duchenne/ Becker muscular dystrophy: aminoglycosides and

ataluren (PTC124). J Child Neurol 25(9):1158-1164.

151. Malafarina V, Uriz-Otano F, Iniesta R, & Gil-Guerrero L (2012) Sarcopenia

in the elderly: diagnosis, physiopathology and treatment. Maturitas

71(2):109-114.

152. Todorov PT, Wyke SM, & Tisdale MJ (2007) Identification and

characterization of a membrane receptor for proteolysis-inducing factor on

skeletal muscle. Cancer Res 67(23):11419-11427.

153. Beenakker EA, et al. (2005) Intermittent prednisone therapy in Duchenne

muscular dystrophy: a randomized controlled trial. Arch Neurol 62(1):128-

132.

154. Mendell JR, et al. (2012) Gene therapy for muscular dystrophy: lessons

learned and path forward. Neurosci Lett 527(2):90-99.

155. Decrouy A, et al. (1997) Mini-dystrophin gene transfer in mdx4cv

diaphragm muscle fibers increases sarcolemmal stability. Gene Ther

4(5):401-408.

156. Phelps SF, et al. (1995) Expression of full-length and truncated dystrophin

mini-genes in transgenic mdx mice. Hum Mol Genet 4(8):1251-1258.

312

157. Cerletti M, et al. (2003) Dystrophic phenotype of canine X-linked muscular

dystrophy is mitigated by adenovirus-mediated utrophin gene transfer.

Gene Ther 10(9):750-757.

158. Bentzinger CF, Barzaghi P, Lin S, & Ruegg MA (2005) Overexpression of

mini-agrin in skeletal muscle increases muscle integrity and regenerative

capacity in laminin-alpha2-deficient mice. FASEB J 19(8):934-942.

159. Meinen S, et al. (2011) Apoptosis inhibitors and mini-agrin have additive

benefits in congenital muscular dystrophy mice. EMBO Mol Med 3(8):465-

479.

160. Morine KJ, et al. (2010) Systemic myostatin inhibition via liver-targeted

gene transfer in normal and dystrophic mice. PLoS One 5(2):e9176.

161. Mendell JR, et al. (2010) Sustained alpha-sarcoglycan gene expression

after gene transfer in limb-girdle muscular dystrophy, type 2D. Ann Neurol

68(5):629-638.

162. Kota J, et al. (2009) Follistatin gene delivery enhances muscle growth and

strength in nonhuman primates. Sci Transl Med 1(6):6ra15.

163. Lostal W, Kodippili K, Yue Y, & Duan D (2014) Full-Length Dystrophin

Reconstitution with Adeno-Associated Viral Vectors. Hum Gene Ther.

164. Rodino-Klapac LR, et al. (2013) Micro-dystrophin and follistatin co-delivery

restores muscle function in aged DMD model. Hum Mol Genet

22(24):4929-4937.

165. Douglas AG & Wood MJ (2013) Splicing therapy for neuromuscular

disease. Mol Cell Neurosci 56:169-185.

313

166. Goyenvalle A, et al. (2010) Prevention of dystrophic pathology in severely

affected dystrophin/utrophin-deficient mice by morpholino-oligomer-

mediated exon-skipping. Mol Ther 18(1):198-205.

167. Saito T, et al. (2010) Antisense PMO found in dystrophic dog model was

effective in cells from exon 7-deleted DMD patient. PLoS One

5(8):e12239.

168. Yokota T, et al. (2009) Efficacy of systemic morpholino exon-skipping in

Duchenne dystrophy dogs. Ann Neurol 65(6):667-676.

169. Kinali M, et al. (2009) Local restoration of dystrophin expression with the

morpholino oligomer AVI-4658 in Duchenne muscular dystrophy: a single-

blind, placebo-controlled, dose-escalation, proof-of-concept study. Lancet

Neurol 8(10):918-928.

170. van Deutekom JC, et al. (2007) Local dystrophin restoration with

antisense oligonucleotide PRO051. N Engl J Med 357(26):2677-2686.

171. Cirak S, et al. (2011) Exon skipping and dystrophin restoration in patients

with Duchenne muscular dystrophy after systemic phosphorodiamidate

morpholino oligomer treatment: an open-label, phase 2, dose-escalation

study. Lancet 378(9791):595-605.

172. Cirak S, et al. (2012) Restoration of the dystrophin-associated

glycoprotein complex after exon skipping therapy in Duchenne muscular

dystrophy. Mol Ther 20(2):462-467.

314

173. Kuang S, Chargé SB, Seale P, Huh M, & Rudnicki MA (2006) Distinct

roles for Pax7 and Pax3 in adult regenerative myogenesis. J Cell Biol

172(1):103-113.

174. Murphy MM, Lawson JA, Mathew SJ, Hutcheson DA, & Kardon G (2011)

Satellite cells, connective tissue fibroblasts and their interactions are

crucial for muscle regeneration. Development 138(17):3625-3637.

175. Schultz E, Chamberlain C, McCormick KM, & Mozdziak PE (2006)

Satellite cells express distinct patterns of myogenic proteins in immature

skeletal muscle. Dev Dyn 235(12):3230-3239.

176. Bentzinger CF, Wang YX, von Maltzahn J, & Rudnicki MA (2013) The

emerging biology of muscle stem cells: implications for cell-based

therapies. Bioessays 35(3):231-241.

177. Magli A, Schnettler E, Rinaldi F, Bremer P, & Perlingeiro RC (2013)

Functional dissection of Pax3 in paraxial mesoderm development and

myogenesis. Stem Cells 31(1):59-70.

178. Rinaldi F & Perlingeiro RC (2014) Stem cells for skeletal muscle

regeneration: therapeutic potential and roadblocks. Transl Res

163(4):409-417.

179. Bentzinger CF, Wang YX, & Rudnicki MA (2012) Building muscle:

molecular regulation of myogenesis. Cold Spring Harb Perspect Biol 4(2).

180. Partridge TA, Morgan JE, Coulton GR, Hoffman EP, & Kunkel LM (1989)

Conversion of mdx myofibres from dystrophin-negative to -positive by

injection of normal myoblasts. Nature 337(6203):176-179.

315

181. Sherwood RI, et al. (2004) Isolation of adult mouse myogenic progenitors:

functional heterogeneity of cells within and engrafting skeletal muscle. Cell

119(4):543-554.

182. Cerletti M, et al. (2008) Highly efficient, functional engraftment of skeletal

muscle stem cells in dystrophic muscles. Cell 134(1):37-47.

183. Tanaka KK, et al. (2009) Syndecan-4-expressing muscle progenitor cells

in the SP engraft as satellite cells during muscle regeneration. Cell Stem

Cell 4(3):217-225.

184. Sampaolesi M, et al. (2003) Cell therapy of alpha-sarcoglycan null

dystrophic mice through intra-arterial delivery of mesoangioblasts. Science

301(5632):487-492.

185. Sampaolesi M, et al. (2006) Mesoangioblast stem cells ameliorate muscle

function in dystrophic dogs. Nature 444(7119):574-579.

186. Mouly V, et al. (2005) Myoblast transfer therapy: is there any light at the

end of the tunnel? Acta Myol 24(2):128-133.

187. Quattrocelli M, et al. (2011) Intrinsic cell memory reinforces myogenic

commitment of pericyte-derived iPSCs. J Pathol 223(5):593-603.

188. Skuk D, et al. (2010) Intramuscular transplantation of human postnatal

myoblasts generates functional donor-derived satellite cells. Mol Ther

18(9):1689-1697.

189. van Rooij E, Liu N, & Olson EN (2008) MicroRNAs flex their muscles.

Trends Genet 24(4):159-166.

316

190. Crippa S, et al. (2011) miR669a and miR669q prevent skeletal muscle

differentiation in postnatal cardiac progenitors. J Cell Biol 193(7):1197-

1212.

191. Quattrocelli M, et al. (2013) Long-term miR-669a therapy alleviates

chronic dilated cardiomyopathy in dystrophic mice. J Am Heart Assoc

2(4):e000284.

192. Brown A, Hughes M, Tenner S, & Banks PA (1997) Does pancreatic

enzyme supplementation reduce pain in patients with chronic pancreatitis:

a meta-analysis. Am J Gastroenterol 92(11):2032-2035.

193. Leader B, Baca QJ, & Golan DE (2008) Protein therapeutics: a summary

and pharmacological classification. Nat Rev Drug Discov 7(1):21-39.

194. Reichert JM (2003) Trends in development and approval times for new

therapeutics in the United States. Nat Rev Drug Discov 2(9):695-702.

195. Chien YH, Hwu WL, & Lee NC (2013) Pompe disease: early diagnosis

and early treatment make a difference. Pediatr Neonatol 54(4):219-227.

196. Pauly DF, et al. (2001) Intercellular transfer of the virally derived precursor

form of acid alpha-glucosidase corrects the enzyme deficiency in inherited

cardioskeletal myopathy Pompe disease. Hum Gene Ther 12(5):527-538.

197. Ausems MG, et al. (1999) Frequency of glycogen storage disease type II

in The Netherlands: implications for diagnosis and genetic counselling.

Eur J Hum Genet 7(6):713-716.

317

198. Lin CY, Hwang B, Hsiao KJ, & Jin YR (1987) Pompe's disease in Chinese

and prenatal diagnosis by determination of alpha-glucosidase activity. J

Inherit Metab Dis 10(1):11-17.

199. Kishnani PS, et al. (2006) A retrospective, multinational, multicenter study

on the natural history of infantile-onset Pompe disease. J Pediatr

148(5):671-676.

200. Raben N, Plotz P, & Byrne BJ (2002) Acid alpha-glucosidase deficiency

(glycogenosis type II, Pompe disease). Curr Mol Med 2(2):145-166.

201. Hagemans ML, et al. (2005) Clinical manifestation and natural course of

late-onset Pompe's disease in 54 Dutch patients. Brain 128(Pt 3):671-677.

202. Tager JM, et al. (1980) An appraisal of human trials in enzyme

replacement therapy of genetic diseases. Birth Defects Orig Artic Ser

16(1):343-359.

203. Barton NW, Furbish FS, Murray GJ, Garfield M, & Brady RO (1990)

Therapeutic response to intravenous infusions of glucocerebrosidase in a

patient with Gaucher disease. Proc Natl Acad Sci U S A 87(5):1913-1916.

204. Van den Hout JM, et al. (2004) Long-term intravenous treatment of Pompe

disease with recombinant human alpha-glucosidase from milk. Pediatrics

113(5):e448-457.

205. Reuser AJ, et al. (2002) Enzyme therapy for Pompe disease: from science

to industrial enterprise. Eur J Pediatr 161 Suppl 1:S106-111.

206. Glentis A, Gurchenkov V, & Vignjevic DM (2014) Assembly, heterogeneity,

and breaching of the basement membranes. Cell Adh Migr 8(3).

318

207. Durbeej M (2010) Laminins. Cell Tissue Res 339(1):259-268.

208. Aumailley M & Smyth N (1998) The role of laminins in basement

membrane function. J Anat 193 ( Pt 1):1-21.

209. Carmignac V, et al. (2011) Autophagy is increased in laminin α2 chain-

deficient muscle and its inhibition improves muscle morphology in a

mouse model of MDC1A. Hum Mol Genet 20(24):4891-4902.

210. Patton BL, Miner JH, Chiu AY, & Sanes JR (1997) Distribution and

function of laminins in the neuromuscular system of developing, adult, and

mutant mice. J Cell Biol 139(6):1507-1521.

211. Aumailley M, et al. (2005) A simplified laminin nomenclature. Matrix Biol

24(5):326-332.

212. Van Ry PM, Minogue P, Hodges BL, & Burkin DJ (2014) Laminin-111

improves muscle repair in a mouse model of merosin-deficient congenital

muscular dystrophy. Hum Mol Genet 23(2):383-396.

213. Timpl R, et al. (1979) Laminin--a glycoprotein from basement membranes.

J Biol Chem 254(19):9933-9937.

214. Rooney JE, Gurpur PB, & Burkin DJ (2009) Laminin-111 protein therapy

prevents muscle disease in the mdx mouse model for Duchenne muscular

dystrophy. Proc Natl Acad Sci U S A, United States), Vol 106, pp 7991-

7996.

215. Rooney JE, Knapp JR, Hodges BL, Wuebbles RD, & Burkin DJ (2012)

Laminin-111 protein therapy reduces muscle pathology and improves

319

viability of a mouse model of merosin-deficient congenital muscular

dystrophy. Am J Pathol 180(4):1593-1602.

216. Rooney JE, Gurpur PB, Yablonka-Reuveni Z, & Burkin DJ (2009) Laminin-

111 restores regenerative capacity in a mouse model for alpha7 integrin

congenital myopathy. Am J Pathol, United States), Vol 174, pp 256-264.

217. Anonymous (February 14, 2014) Alexion Takes Option on Protein

Replacement Therapy. (Genetic Engineering & Biotechnology New).

218. McBride OW, Fisher LW, & Young MF (1990) Localization of PGI

(biglycan, BGN) and PGII (decorin, DCN, PG-40) genes on human

chromosomes Xq13-qter and 12q, respectively. Genomics 6(2):219-225.

219. Nastase MV, Young MF, & Schaefer L (2012) Biglycan: a multivalent

proteoglycan providing structure and signals. J Histochem Cytochem

60(12):963-975.

220. Choi HU, et al. (1989) Characterization of the dermatan sulfate

proteoglycans, DS-PGI and DS-PGII, from bovine articular cartilage and

skin isolated by octyl-sepharose chromatography. J Biol Chem

264(5):2876-2884.

221. Roughley PJ & White RJ (1989) Dermatan sulphate proteoglycans of

human articular cartilage. The properties of dermatan sulphate

proteoglycans I and II. Biochem J 262(3):823-827.

222. Bowe MA, Mendis DB, & Fallon JR (2000) The small leucine-rich repeat

proteoglycan biglycan binds to alpha-dystroglycan and is upregulated in

dystrophic muscle. J Cell Biol 148(4):801-810.

320

223. Lechner BE, Lim JH, Mercado ML, & Fallon JR (2006) Developmental

regulation of biglycan expression in muscle and tendon. Muscle Nerve

34(3):347-355.

224. Roughley PJ, et al. (1993) Non-proteoglycan forms of biglycan increase

with age in human articular cartilage. Biochem J 295 ( Pt 2):421-426.

225. Rafii MS, et al. (2006) Biglycan binds to alpha- and gamma-sarcoglycan

and regulates their expression during development. J Cell Physiol

209(2):439-447.

226. Mercado ML, et al. (2006) Biglycan regulates the expression and

sarcolemmal localization of dystrobrevin, syntrophin, and nNOS. FASEB J

20(10):1724-1726.

227. Amenta AR, et al. (2011) Biglycan recruits utrophin to the sarcolemma and

counters dystrophic pathology in mdx mice. Proc Natl Acad Sci U S A

108(2):762-767.

228. Amenta AR, et al. (2012) Biglycan is an extracellular MuSK binding protein

important for synapse stability. J Neurosci 32(7):2324-2334.

229. Braunstein JB (2013) Recombinant Biglycan for the Treatment of

Duchenne Muscular Dystrophy Parent Project Muscular Dystrophy Annual

Conference, (Parent Project Muscular Dystrophy).

230. Sonnemann KJ, et al. (2009) Functional substitution by TAT-utrophin in

dystrophin-deficient mice. PLoS Med 6(5):e1000083.

231. Connolly AM, Keeling RM, Mehta S, Pestronk A, & Sanes JR (2001) The

mouse models of muscular dystrophy: the natural history of strength and

321

fatigue in dystrophin-, dystrophin/utrophin-, and laminin alpha2-deficient

mice. Neuromuscular Disorders 11(December):703-712.

232. Delfín DA, et al. (2012) Cardiomyopathy in the dystrophin/utrophin-

deficient mouse model of severe muscular dystrophy is characterized by

dysregulation of matrix metalloproteinases. Neuromuscul Disord

22(11):1006-1014.

233. Fisher R, et al. (2001) Non-toxic ubiquitous over-expression of utrophin in

the mdx mouse. Neuromuscul Disord 11(8):713-721.

234. Takemitsu M, et al. (1991) Dystrophin-related protein in the fetal and

denervated skeletal muscles of normal and mdx mice. Biochem Biophys

Res Commun 180(3):1179-1186.

235. Rafael JA, Tinsley JM, Potter AC, Deconinck AE, & Davies KE (1998)

Skeletal muscle-specific expression of a utrophin transgene rescues

utrophin-dystrophin deficient mice. Nat Genet 19(1):79-82.

236. Tinsley J, et al. (1998) Expression of full-length utrophin prevents

muscular dystrophy in mdx mice. Nat Med 4(12):1441-1444.

237. Tinsley JM, et al. (2011) Daily treatment with SMTC1100, a novel small

molecule utrophin upregulator, dramatically reduces the dystrophic

symptoms in the mdx mouse. PLoS One 6(5):e19189.

238. Ebihara S, et al. (2000) Differential effects of dystrophin and utrophin gene

transfer in immunocompetent muscular dystrophy (mdx) mice. Physiol

Genomics 3(3):133-144.

322

239. Haase H, et al. (2006) Minigenes encoding N-terminal domains of human

cardiac myosin light chain-1 improve heart function of transgenic rats.

FASEB J 20(7):865-873.

240. Schwarze SR, Ho A, Vocero-Akbani A, & Dowdy SF (1999) In vivo protein

transduction: delivery of a biologically active protein into the mouse.

Science 285(5433):1569-1572.

241. Call JA, Ervasti JM, & Lowe DA (2011) TAT-μUtrophin mitigates the

pathophysiology of dystrophin and utrophin double-knockout mice. J Appl

Physiol (1985) 111(1):200-205.

242. Weisleder N, et al. (2012) Recombinant MG53 protein modulates

therapeutic cell membrane repair in treatment of muscular dystrophy. Sci

Transl Med 4(139):139ra185.

243. Weisleder N, Takeshima H, & Ma J (2008) Immuno-proteomic approach to

excitation--contraction coupling in skeletal and cardiac muscle: molecular

insights revealed by the mitsugumins. Cell Calcium 43(1):1-8.

244. Cai C, et al. (2009) MG53 nucleates assembly of cell membrane repair

machinery. Nat Cell Biol 11(1):56-64.

245. Cai C, et al. (2009) Membrane repair defects in muscular dystrophy are

linked to altered interaction between MG53, caveolin-3, and dysferlin. J

Biol Chem 284(23):15894-15902.

246. Hwang M, Ko JK, Weisleder N, Takeshima H, & Ma J (2011) Redox-

dependent oligomerization through a leucine zipper motif is essential for

323

MG53-mediated cell membrane repair. Am J Physiol Cell Physiol

301(1):C106-114.

247. Zhu H, et al. (2011) Polymerase transcriptase release factor (PTRF)

anchors MG53 protein to cell injury site for initiation of membrane repair. J

Biol Chem 286(15):12820-12824.

248. Weisleder N, et al. (2011) Visualization of MG53-mediated cell membrane

repair using in vivo and in vitro systems. J Vis Exp (52).

249. Lin P, et al. (2012) Nonmuscle myosin IIA facilitates vesicle trafficking for

MG53-mediated cell membrane repair. FASEB J 26(5):1875-1883.

250. He B, et al. (2012) Enhancing muscle membrane repair by gene delivery

of MG53 ameliorates muscular dystrophy and heart failure in δ-

Sarcoglycan-deficient hamsters. Mol Ther 20(4):727-735.

251. Yi JS, et al. (2013) MG53-induced IRS-1 ubiquitination negatively

regulates skeletal myogenesis and insulin signalling. Nat Commun 4:2354.

252. Nguyen N, Yi JS, Park H, Lee JS, & Ko YG (2014) Mitsugumin 53 (MG53)

ligase ubiquitinates focal adhesion kinase during skeletal myogenesis. J

Biol Chem 289(6):3209-3216.

253. Doe JA, et al. (2011) Transgenic overexpression of the α7 integrin

reduces muscle pathology and improves viability in the dy(W) mouse

model of merosin-deficient congenital muscular dystrophy type 1A. J Cell

Sci 124(Pt 13):2287-2297.

324

254. Welser JV, et al. (2009) Myotendinous junction defects and reduced force

transmission in mice that lack alpha7 integrin and utrophin. Am J Pathol,

United States), Vol 175, pp 1545-1554.

255. Grewal PK, McLaughlan JM, Moore CJ, Browning CA, & Hewitt JE (2005)

Characterization of the LARGE family of putative glycosyltransferases

associated with dystroglycanopathies. Glycobiology, England), Vol 15, pp

912-923.

256. Patnaik SK & Stanley P (2005) Mouse large can modify complex N- and

mucin O-glycans on alpha-dystroglycan to induce laminin binding. J Biol

Chem 280(21):20851-20859.

257. Kanagawa M, et al. (2009) Residual laminin-binding activity and enhanced

dystroglycan glycosylation by LARGE in novel model mice to

dystroglycanopathy. Hum Mol Genet 18(4):621-631.

258. Brockington M, et al. (2010) Transgenic overexpression of LARGE

induces alpha-dystroglycan hyperglycosylation in skeletal and cardiac

muscle. PLoS One 5(12):e14434.

259. Hu Y, Li ZF, Wu X, & Lu Q (2011) Large induces functional glycans in an

O-mannosylation dependent manner and targets GlcNAc terminals on

alpha-dystroglycan. PLoS One 6(2):e16866.

260. Zhang Z, Zhang P, & Hu H (2011) LARGE expression augments the

glycosylation of glycoproteins in addition to α-dystroglycan conferring

laminin binding. PLoS One 6(4):e19080.

325

261. Helbling-Leclerc A, et al. (1995) Mutations in the laminin alpha 2-chain

gene (LAMA2) cause merosin-deficient congenital muscular dystrophy.

Nat Genet 11(2):216-218.

262. Gawlik KI & Durbeej M (2011) Skeletal muscle laminin and MDC1A:

pathogenesis and treatment strategies. Skelet Muscle 1(1):9.

263. Muntoni F & Voit T (2004) The congenital muscular dystrophies in 2004: a

century of exciting progress. Neuromuscul Disord 14(10):635-649.

264. Philpot J, Bagnall A, King C, Dubowitz V, & Muntoni F (1999) Feeding

problems in merosin deficient congenital muscular dystrophy. Arch Dis

Child 80(6):542-547.

265. Philpot J, et al. (1999) Merosin-deficient congenital muscular dystrophy:

the spectrum of brain involvement on magnetic resonance imaging.

Neuromuscul Disord 9(2):81-85.

266. Mendell JR, Boué DR, & Martin PT (2006) The congenital muscular

dystrophies: recent advances and molecular insights. Pediatr Dev Pathol

9(6):427-443.

267. Gawlik K, Miyagoe-Suzuki Y, Ekblom P, Takeda S, & Durbeej M (2004)

Laminin alpha1 chain reduces muscular dystrophy in laminin alpha2 chain

deficient mice. Hum Mol Genet 13(16):1775-1784.

268. Gawlik KI, Akerlund M, Carmignac V, Elamaa H, & Durbeej M (2010)

Distinct roles for laminin globular domains in laminin alpha1 chain

mediated rescue of murine laminin alpha2 chain deficiency. PLoS One

5(7):e11549.

326

269. Gawlik KI & Durbeej M (2010) Transgenic overexpression of laminin

alpha1 chain in laminin alpha2 chain-deficient mice rescues the disease

throughout the lifespan. Muscle Nerve 42(1):30-37.

270. Kuang W, et al. (1998) Merosin-deficient congenital muscular dystrophy.

Partial genetic correction in two mouse models. J Clin Invest 102(4):844-

852.

271. Meinen S, Barzaghi P, Lin S, Lochmüller H, & Ruegg MA (2007) Linker

molecules between laminins and dystroglycan ameliorate laminin-alpha2-

deficient muscular dystrophy at all disease stages. J Cell Biol 176(7):979-

993.

272. Xu R, Chandrasekharan K, Yoon JH, Camboni M, & Martin PT (2007)

Overexpression of the cytotoxic T cell (CT) carbohydrate inhibits muscular

dystrophy in the dyW mouse model of congenital muscular dystrophy 1A.

Am J Pathol 171(1):181-199.

273. Kumar A, Yamauchi J, Girgenrath T, & Girgenrath M (2011) Muscle-

specific expression of insulin-like growth factor 1 improves outcome in

Lama2Dy-w mice, a model for congenital muscular dystrophy type 1A.

Hum Mol Genet 20(12):2333-2343.

274. Girgenrath M, Dominov JA, Kostek CA, & Miller JB (2004) Inhibition of

apoptosis improves outcome in a model of congenital muscular dystrophy.

J Clin Invest 114(11):1635-1639.

327

275. Erb M, et al. (2009) Omigapil ameliorates the pathology of muscle

dystrophy caused by laminin-alpha2 deficiency. J Pharmacol Exp Ther

331(3):787-795.

276. Girgenrath M, Beermann ML, Vishnudas VK, Homma S, & Miller JB

(2009) Pathology is alleviated by doxycycline in a laminin-alpha2-null

model of congenital muscular dystrophy. Ann Neurol 65(1):47-56.

277. Vachon PH, et al. (1997) Integrins (alpha7beta1) in muscle function and

survival. Disrupted expression in merosin-deficient congenital muscular

dystrophy. J Clin Invest 100(7):1870-1881.

278. Landis SC, et al. (2012) A call for transparent reporting to optimize the

predictive value of preclinical research. Nature 490(7419):187-191.

279. Junqueira LC, Bignolas G, & Brentani RR (1979) Picrosirius staining plus

polarization microscopy, a specific method for collagen detection in tissue

sections. Histochem J 11(4):447-455.

280. Hodges BL, et al. (1997) Altered expression of the alpha7beta1 integrin in

human and murine muscular dystrophies. J Cell Sci 110 ( Pt 22):2873-

2881.

281. Marshall JL & Crosbie-Watson RH (2013) Sarcospan: a small protein with

large potential for Duchenne muscular dystrophy. Skelet Muscle 3(1):1.

282. Gawlik KI, et al. (2006) Laminin alpha1 chain mediated reduction of

laminin alpha2 chain deficient muscular dystrophy involves integrin

alpha7beta1 and dystroglycan. FEBS Lett 580(7):1759-1765.

328

283. Lorts A, Schwanekamp JA, Baudino TA, McNally EM, & Molkentin JD

(2012) Deletion of periostin reduces muscular dystrophy and fibrosis in

mice by modulating the transforming growth factor-β pathway. Proc Natl

Acad Sci U S A 109(27):10978-10983.

284. Veidal SS, et al. (2011) Assessment of proteolytic degradation of the

basement membrane: a fragment of type IV collagen as a biochemical

marker for liver fibrosis. Fibrogenesis Tissue Repair 4:22.

285. Kuang W, Xu H, Vilquin JT, & Engvall E (1999) Activation of the lama2

gene in muscle regeneration: abortive regeneration in laminin alpha2-

deficiency. Lab Invest 79(12):1601-1613.

286. Taniguchi Y, et al. (2009) The C-terminal region of laminin beta chains

modulates the integrin binding affinities of laminins. J Biol Chem

284(12):7820-7831.

287. Nishiuchi R, et al. (2006) Ligand-binding specificities of laminin-binding

integrins: a comprehensive survey of laminin-integrin interactions using

recombinant alpha3beta1, alpha6beta1, alpha7beta1 and alpha6beta4

integrins. Matrix Biol 25(3):189-197.

288. Talts JF, Andac Z, Göhring W, Brancaccio A, & Timpl R (1999) Binding of

the G domains of laminin alpha1 and alpha2 chains and perlecan to

heparin, sulfatides, alpha-dystroglycan and several extracellular matrix

proteins. EMBO J 18(4):863-870.

329

289. Yamada H, Shimizu T, Tanaka T, Campbell KP, & Matsumura K (1994)

Dystroglycan is a binding protein of laminin and merosin in peripheral

nerve. FEBS Lett 352(1):49-53.

290. Yajima H, et al. (2010) Six family genes control the proliferation and

differentiation of muscle satellite cells. Exp Cell Res 316(17):2932-2944.

291. Campbell KP (1995) Three muscular dystrophies: loss of cytoskeleton-

extracellular matrix linkage. Cell 80(5):675-679.

292. Senter L, et al. (1993) Interaction of dystrophin with cytoskeletal proteins:

binding to talin and actin. Biochem Biophys Res Commun 192(2):899-904.

293. Suzuki A, et al. (1994) Molecular organization at the glycoprotein-

complex-binding site of dystrophin. Three dystrophin-associated proteins

bind directly to the carboxy-terminal portion of dystrophin. Eur J Biochem

220(2):283-292.

294. Leppänen A, Stowell S, Blixt O, & Cummings RD (2005) Dimeric galectin-

1 binds with high affinity to alpha2,3-sialylated and non-sialylated terminal

N-acetyllactosamine units on surface-bound extended glycans. J Biol

Chem 280(7):5549-5562.

295. Camby I, Le Mercier M, Lefranc F, & Kiss R (2006) Galectin-1: a small

protein with major functions. Glycobiology 16(11):137R-157R.

296. Cerri DG, et al. (2008) Degeneration of dystrophic or injured skeletal

muscles induces high expression of Galectin-1. Glycobiology 18(11):842-

850.

330

297. Gu M, Wang W, Song WK, Cooper DN, & Kaufman SJ (1994) Selective

modulation of the interaction of alpha 7 beta 1 integrin with fibronectin and

laminin by L-14 lectin during skeletal muscle differentiation. J.Cell Sci. 107

( Pt 1):175-181.

298. Camby I, Le MM, Lefranc F, & Kiss R (2006) Galectin-1: a small protein

with major functions. Glycobiology 16(11):137R-157R.

299. Wuebbles RD, Sarathy A, Kornegay JN, & Burkin DJ (2013) Levels of α7

integrin and laminin-α2 are increased following prednisone treatment in

the mdx mouse and GRMD dog models of Duchenne muscular dystrophy.

Dis Model Mech 6(5):1175-1184.

300. Laws N & Hoey A (2004) Progression of kyphosis in mdx mice. J Appl

Physiol (1985) 97(5):1970-1977.

301. Cerri DG, et al. (2008) Degeneration of dystrophic or injured skeletal

muscles induces high expression of Galectin-1. Glycobiology 18(11):842-

850.

302. McDonald CM, et al. (2013) The 6-minute walk test and other endpoints in

Duchenne muscular dystrophy: longitudinal natural history observations

over 48 weeks from a multicenter study. Muscle Nerve 48(3):343-356.

303. Karol LA (2007) Scoliosis in patients with Duchenne muscular dystrophy. J

Bone Joint Surg Am 89 Suppl 1:155-162.

304. Pichavant C, et al. (2011) Current status of pharmaceutical and genetic

therapeutic approaches to treat DMD. Mol Ther 19(5):830-840.

331

305. Tinsley JM, et al. (1996) Amelioration of the dystrophic phenotype of mdx

mice using a truncated utrophin transgene. Nature 384(6607):349-353.

306. Gu M, Wang W, Song WK, Cooper DN, & Kaufman SJ (1994) Selective

modulation of the interaction of alpha 7 beta 1 integrin with fibronectin and

laminin by L-14 lectin during skeletal muscle differentiation. J Cell Sci 107

( Pt 1):175-181.

307. McDonald CM, et al. (2013) The 6-minute walk test and other clinical

endpoints in duchenne muscular dystrophy: reliability, concurrent validity,

and minimal clinically important differences from a multicenter study.

Muscle Nerve 48(3):357-368.

308. Henricson E, et al. (2013) The 6-minute walk test and person-reported

outcomes in boys with duchenne muscular dystrophy and typically

developing controls: longitudinal comparisons and clinically-meaningful

changes over one year. PLoS Curr 5.

309. Brooke MH, et al. (1989) Duchenne muscular dystrophy: patterns of

clinical progression and effects of supportive therapy. Neurology

39(4):475-481.

310. Sussman M (2002) Duchenne muscular dystrophy. J Am Acad Orthop

Surg 10(2):138-151.

311. Tamma R, et al. (2013) Effects of prednisolone on the dystrophin-

associated proteins in the blood-brain barrier and skeletal muscle of

dystrophic mdx mice. Lab Invest 93(5):592-610.

332

312. Amalfitano A & Chamberlain JS (1996) The mdx-amplification-resistant

mutation system assay, a simple and rapid polymerase chain reaction-

based detection of the mdx allele. Muscle Nerve 19(12):1549-1553.

313. Song WK, Wang W, Sato H, Bielser DA, & Kaufman SJ (1993) Expression

of alpha 7 integrin cytoplasmic domains during skeletal muscle

development: alternate forms, conformational change, and homologies

with serine/threonine kinases and tyrosine phosphatases. J Cell Sci 106 (

Pt 4):1139-1152.

314. Furlong P (2010) Education Matters: A Teachers guide to Duchenne

Muscular Dystrophy (Parent Project Muscular Dystrophy: Leading the fight

to end Duchenne) 2 Ed p 68.

315. Moser H (1984) Duchenne muscular dystrophy: pathogenetic aspects and

genetic prevention. Hum Genet 66(1):17-40.

316. Bulfield G, Siller WG, Wight PA, & Moore KJ (1984) X chromosome-linked

muscular dystrophy (mdx) in the mouse. Proc Natl Acad Sci U S A

81(4):1189-1192.

317. Koenig M, et al. (1989) The molecular basis for Duchenne versus Becker

muscular dystrophy: correlation of severity with type of deletion. Am J

Hum Genet 45(4):498-506.

318. Way M, Pope B, Cross RA, Kendrick-Jones J, & Weeds AG (1992)

Expression of the N-terminal domain of dystrophin in E. coli and

demonstration of binding to F-actin. FEBS Lett 301(3):243-245.

333

319. Hohenester E, Tisi D, Talts JF, & Timpl R (1999) The crystal structure of a

laminin G-like module reveals the molecular basis of alpha-dystroglycan

binding to laminins, perlecan, and agrin. Mol Cell 4(5):783-792.

320. Ervasti JM & Campbell KP (1993) A role for the dystrophin-glycoprotein

complex as a transmembrane linker between laminin and actin. J Cell Biol

122(4):809-823.

321. Ohlendieck K & Campbell KP (1991) Dystrophin-associated proteins are

greatly reduced in skeletal muscle from mdx mice. J Cell Biol 115(6):1685-

1694.

322. Ervasti JM, Ohlendieck K, Kahl SD, Gaver MG, & Campbell KP (1990)

Deficiency of a glycoprotein component of the dystrophin complex in

dystrophic muscle. Nature 345(6273):315-319.

323. Mayer U, et al. (1997) Absence of integrin alpha 7 causes a novel form of

muscular dystrophy. Nat Genet 17(3):318-323.

324. Welser JV, et al. (2007) Loss of the alpha7 integrin promotes extracellular

signal-regulated kinase activation and altered vascular remodeling. Circ

Res, United States), Vol 101, pp 672-681.

325. Flintoff-Dye NL, et al. (2005) Role for the alpha7beta1 integrin in vascular

development and integrity. Dev Dyn 234(1):11-21.

326. Kanagawa M, et al. (2004) Molecular recognition by LARGE is essential

for expression of functional dystroglycan. Cell 117(7):953-964.

334

327. Grewal PK, Holzfeind PJ, Bittner RE, & Hewitt JE (2001) Mutant

glycosyltransferase and altered glycosylation of alpha-dystroglycan in the

myodystrophy mouse. Nat Genet, United States), Vol 28, pp 151-154.

328. Yoshida-Moriguchi T, et al. (2010) O-mannosyl phosphorylation of alpha-

dystroglycan is required for laminin binding. Science, United States), Vol

327, pp 88-92.

329. Percival JM & Froehner SC (2007) Golgi complex organization in skeletal

muscle: a role for Golgi-mediated glycosylation in muscular dystrophies?

Traffic, Denmark), Vol 8, pp 184-194.

330. Peyrard M, et al. (1999) The human LARGE gene from 22q12.3-q13.1 is a

new, distinct member of the glycosyltransferase gene family. Proc Natl

Acad Sci U S A 96(2):598-603.

331. Hewitt JE (2009) Abnormal glycosylation of dystroglycan in human genetic

disease. Biochim Biophys Acta 1792(9):853-861.

332. Hewitt JE & Grewal PK (2003) Glycosylation defects in inherited muscle

disease. Cell Mol Life Sci 60(2):251-258.

333. Levedakou EN & Popko B (2006) Rewiring enervated: thinking LARGEr

than myodystrophy. J Neurosci Res 84(2):237-243.

334. de Bernabe DB, et al. (2009) Loss of alpha-dystroglycan laminin binding in

epithelium-derived cancers is caused by silencing of LARGE. J Biol Chem,

United States), Vol 284, pp 11279-11284.

335. Inamori K, et al. (2012) Dystroglycan function requires xylosyl- and

glucuronyltransferase activities of LARGE. Science 335(6064):93-96.

335

336. Hara Y, et al. (2011) Like-acetylglucosaminyltransferase (LARGE)-

dependent modification of dystroglycan at Thr-317/319 is required for

laminin binding and arenavirus infection. Proc Natl Acad Sci U S A

108(42):17426-17431.

337. Burkin DJ, Kim JE, Gu M, & Kaufman SJ (2000) Laminin and alpha7beta1

integrin regulate agrin-induced clustering of acetylcholine receptors. J Cell

Sci 113 ( Pt 16):2877-2886.

338. Song WK, Wang W, Foster RF, Bielser DA, & Kaufman SJ (1992) H36-

alpha 7 is a novel integrin alpha chain that is developmentally regulated

during skeletal myogenesis. J Cell Biol 117(3):643-657.

339. Gundry RL, et al. (2009) The mouse C2C12 myoblast cell surface N-linked

glycoproteome: identification, glycosite occupancy, and membrane

orientation. Mol Cell Proteomics 8(11):2555-2569.

340. Ungar D (2009) Golgi linked protein glycosylation and associated

diseases. Semin Cell Dev Biol, England), Vol 20, pp 762-769.

341. Stalnaker SH, et al. (2011) Glycomic analyses of mouse models of

congenital muscular dystrophy. J Biol Chem 286(24):21180-21190.

342. Barresi R, et al. (2004) LARGE can functionally bypass alpha-

dystroglycan glycosylation defects in distinct congenital muscular

dystrophies. Nat Med 10(7):696-703.

343. Hara Y, et al. (2011) A dystroglycan mutation associated with limb-girdle

muscular dystrophy. N Engl J Med 364(10):939-946.

336

344. Jimenez-Mallebrera C, et al. (2009) A comparative study of alpha-

dystroglycan glycosylation in dystroglycanopathies suggests that the

hypoglycosylation of alpha-dystroglycan does not consistently correlate

with clinical severity. Brain Pathol 19(4):596-611.

345. Bozzi M, et al. (2013) Probing the stability of the "naked" mucin-like

domain of human alpha-dystroglycan. BMC Biochem 14(1):15.

346. Peter AK, Marshall JL, & Crosbie RH (2008) Sarcospan reduces

dystrophic pathology: stabilization of the utrophin-glycoprotein complex. J

Cell Biol 183(3):419-427.

347. Miller G, et al. (2012) Preventing phosphorylation of dystroglycan

ameliorates the dystrophic phenotype in mdx mouse. Hum Mol Genet

21(20):4508-4520.

348. Haliloğlu G & Topaloğlu H (2004) Glycosylation defects in muscular

dystrophies. Curr Opin Neurol 17(5):521-527.

349. Holt KH & Campbell KP (1998) Assembly of the sarcoglycan complex.

Insights for muscular dystrophy. J Biol Chem 273(52):34667-34670.

350. Barresi R & Campbell KP (2006) Dystroglycan: from biosynthesis to

pathogenesis of human disease. J Cell Sci 119(Pt 2):199-207.

351. Merlini L, et al. (2003) Early prednisone treatment in Duchenne muscular

dystrophy. Muscle Nerve 27(2):222-227.