DOCSLIB.ORG

Advances in Analysis of Novel Protein Therapeutics and Clinical Samples with LC-MS/MS Methods

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Advances in Analysis of Novel Protein Therapeutics and Clinical Samples with LC-MS/MS Methods ADVANCES IN ANALYSIS OF NOVEL PROTEIN THERAPEUTICS AND CLINICAL SAMPLES WITH LC-MS/MS METHODS A Dissertation Presented by Fangfei Yan to The Department of Chemistry and Chemical Biology In partial fulfillment of the requirements for the degree of Doctor of Philosophy in the field of Chemistry Northeastern University Boston, Massachusetts April 9, 2013 ADVANCES IN ANALYSIS OF NOVEL PROTEIN THERAPEUTICS AND CLINICAL SAMPLES WITH LC-MS/MS METHODS by Fangfei Yan ABSTRACT OF DISSERTATION Submitted in partial fulfillment of the requirements for the Degree of Doctor of Philosophy in Chemistry in the College of Science of Northeastern University April 9, 2013 2 Abstract Analytical characterization is essential for drug efficacy, stability and safety. Significant concern in protein stability and potential immunogenicity requires detailed characterization of protein therapeutics. Therefore, the ability to detect product variants from non-clonal cell lines is very important. To fulfill this job, LC-MS/MS becomes the perfect choice. This Ph.D. research discusses advances in analysis of novel protein therapeutics and clinical samples with LC- MS/MS methods. Recombinant protein therapeutics is a major focus of my research work. In Chapter 1, an overview of production of recombinant protein therapeutics and the potential heterogeneity, in particular post-translational modifications, is reviewed. Common techniques for protein characterization are discussed, including electrophoresis, chromatography, and mass spectrometry. Because the major focus of my research is about mass spectrometry, further details about ionization method, mass analyzer, hybrid mass spectrometer, fragmentation method and LC-MS/MS analysis are reviewed. In addition, common strategies for protein characterization are discussed. Furthermore, biology part for proteomic analysis is reviewed. ERBB2, an important oncogene, is of particular interest and its association to cancer disease is included. Chapter 2, 3 and 4 detail my research projects. Chapter 2 is comprehensive mass spectrometric characterization of recombinant phenylalanine ammonia lyase (rAvPAL). Full characterization with the identification of the active site for this protein is discussed. Active sites of RtPAL and GFP with similar structure were analyzed. The characterization process and strategies developed here are applied in the work of Chapter 3. Chapter 3 discusses the characterization of disulfide bond linkage and improper disulfide bridging of a variant of acidic lysosomal glucosidase (GAA) by LC-MS/MS. Here, details about the disulfide bond linkage analysis with the technique that 3 ETD (electron transfer dissociation) is in combination with CID (collision induced dissociation) for fragmentation are included. The work flow including gel-based protein separation, enzymatic digestion and LC-MS/MS analysis were then applied in proteomic studies in Chapter 4. In Chapter 4, proteomic and genomic analysis of gastric cancer patient tissues is the topic. This includes proteomic studies with the help of LC-MS/MS. Also, the study of gastric cancer is part of the C-HPP Initiative, the exploration of proteomics and transcriptomics has provided in-depth analysis in oncology. 4 ACKNOWLEDGEMENTS First of all, I want to thank my advisor Professor William S. Hancock for giving me the great opportunity to be in his research group and for bringing me into the exciting research world. Thank you so much for your great instructions and kind help to me all these years. Your insight into research advancement is great value in my life. Thank you so much for all your support, patience and encouragement to me. I feel so lucky to have you as my advisor. Also, I want to thank Professor Shiaw-lin (Billy) Wu for his great instructions on my projects collaborated with industry company. I have learned a lot from your valuable experience in mass spectrometry. Thank you so much for your patient guidance and support. Lastly, I want to thank Professor Barry Karger for providing a great environment for research at Barnett Institute. In addition, many thanks to members in my Ph.D. committee: Professor Paul Vouros, Professor Zhaohui (Sunny) Zhou, Professor Michael Pollastri and Professor Erno Pungor. Professor Vouros has given me great instructions regarding mass spectrometry and related techniques. He has also given me very helpful advice in my Ph.D studies. Professor Zhou has given me a lot of advice on Ph.D. studies, seminar talk and thesis completion. Professor Pollastri also provided helpful suggestions and great support in my thesis defense. Last but not the least, Professor Pungor provided a lot of support towards my Ph.D. research projects and he has given me many solid instructions on detailed experiments. Thank you all for being in my committee and thank you for your great advice and instructions on my thesis. Additionally, grateful thanks are given to members, both former and present, in Professor Hancock’s group: Professor Marina Hincapie, Dr. Xiaoyang Zheng, Dr. Haitao Jiang, Dr. Qiaozhen Lu, Dr. Yi Wang, Dr. Zhi Zeng, Dr. Agnes Ralfako, Dr. Majlinda Kullolli, Xiaomei 5 He, Suli Liu, Fan Zhang, Yue Zhang, Francisca Sekyere, and KyOnese Taylor. Thank you very much for your kind help and support to me in my Ph.D. research. Also, grateful thanks are given to members from Professor Karger’s group: Professor Shujia Dai, Dr. Sangwon Cha, Dr. Quanzhou Luo, Dr. Dongdong Wang, Chen Li, Wenqin Ni, Zhenke Liu and Siyang Li. Thank you very much for your help and friendship. Besides, I want to give my sincere thanks to Dr. Melinda Hull, Dr. Khrystal DeHate, and Ms. Sheila Magee Beare from College of Science, Jean Harris and Andrew Bean at Department of Chemistry and Chemical Biology, Nancy Carbone, Jeffrey Kasilman, Jana Volf, and Felicia Hopkins at Barnett Institute. Thank you for giving me your sincere help during my study and research at Northeastern University. Last but not least, I want to thank to my family members, my mom, my dad, and my grandparents. Thank you so much for your encouragement and support to me all these years. Although we are in different countries, your love gives me continuous power at all times. Finally, special thank is given to my husband Xiaowei Wang. I am very lucky and happy to be with you. Thank you so much for your love and support. Being with you, I am able to confront any barrier. 6 Table of Contents ABSTRACT………………………………………………………………………………………2 ACKNOWLEDGEMENT……………………………………………………………………......5 TABLE OF CONTENTS………………………………………………………………………....7 LIST OF FIGURES……………………………………………………………………………...13 LIST OF TABLES……………………………………………………………………………….17 LIST OF ABBREVIATIONS…………………………………………………………………...18 Chapter 1 Overview of Industrial Protein Therapeutics and Proteomic Studies ….……………24 1.1 Introduction…………………………………………………………………………….….....25 1.2 Overview of Industrial Protein Therapeutics ………………….………………………….....26 1.2.1 Production of recombinant proteins …………………….……………………………..27 1.2.2 Heterogeneity associated with recombinant protein therapeutics ….………………….28 1.2.3 PTMs of protein therapeutics…………………..............................................................32 1.2.3.1 Deamidation………………….............................................................................33 1.2.3.2 Oxidation…………………..................................................................................35 1.2.3.3 Glycosylation…………………...........................................................................37 1.2.3.4 Other common types of PTMs ………………....................................................39 1.3 Techniques for Protein Characterization …………………………………............................40 1.3.1 Electrophoresis ………………………………………………………………………..40 7 1.3.2 Chromatography……….………………………………………………………………42 1.3.3 Mass spectrometry.....................................................................………………………44 1.3.3.1 Ionization methods......................................................................................…..45 1.3.3.1.1 Chemical ionization............................................................................45 1.3.3.1.2 Fast atom bombardment ionization................................................... 45 1.3.3.1.3 Field ionization/field desorption........................................................ 46 1.3.3.1.4 Matrix-assisted laser desorption ionization....................................... 46 1.3.3.1.5 Thermospray ionization......................................................................47 1.3.3.1.6 Electrospray ionization.......................................................................47 1.3.3.2 Mass analyzer....................................................................................................48 1.3.3.2.1 Magnetic sector..................................................................................49 1.3.3.2.2 Time of flight.................................................................................... 49 1.3.3.2.3 Quadrupole........................................................................................ 50 1.3.3.2.4 Ion trap............................................................................................... 51 1.3.3.2.5 FT-ICR............................................................................................... 51 1.3.3.2.6 Orbitrap.............................................................................................. 52 1.3.3.3 Tandem mass spectrometry................................................................................ 52 1.3.3.3.1 Fragmentation method.......................................................................
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Bayesian Hierarchical Modeling of High-Throughput Genomic Data with Applications to Cancer Bioinformatics and Stem Cell Differentiation
    BAYESIAN HIERARCHICAL MODELING OF HIGH-THROUGHPUT GENOMIC DATA WITH APPLICATIONS TO CANCER BIOINFORMATICS AND STEM CELL DIFFERENTIATION by Keegan D. Korthauer A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Statistics) at the UNIVERSITY OF WISCONSIN–MADISON 2015 Date of final oral examination: 05/04/15 The dissertation is approved by the following members of the Final Oral Committee: Christina Kendziorski, Professor, Biostatistics and Medical Informatics Michael A. Newton, Professor, Statistics Sunduz Kele¸s,Professor, Biostatistics and Medical Informatics Sijian Wang, Associate Professor, Biostatistics and Medical Informatics Michael N. Gould, Professor, Oncology © Copyright by Keegan D. Korthauer 2015 All Rights Reserved i in memory of my grandparents Ma and Pa FL Grandma and John ii ACKNOWLEDGMENTS First and foremost, I am deeply grateful to my thesis advisor Christina Kendziorski for her invaluable advice, enthusiastic support, and unending patience throughout my time at UW-Madison. She has provided sound wisdom on everything from methodological principles to the intricacies of academic research. I especially appreciate that she has always encouraged me to eke out my own path and I attribute a great deal of credit to her for the successes I have achieved thus far. I also owe special thanks to my committee member Professor Michael Newton, who guided me through one of my first collaborative research experiences and has continued to provide key advice on my thesis research. I am also indebted to the other members of my thesis committee, Professor Sunduz Kele¸s,Professor Sijian Wang, and Professor Michael Gould, whose valuable comments, questions, and suggestions have greatly improved this dissertation.
    [Show full text]
  • Universidade Estadual De Campinas Instituto De Biologia
    UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases
    G C A T T A C G G C A T genes Review RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases Amber Willbanks, Shaun Wood and Jason X. Cheng * Department of Pathology, Hematopathology Section, University of Chicago, Chicago, IL 60637, USA; [email protected] (A.W.); [email protected] (S.W.) * Correspondence: [email protected] Abstract: Chromatin structure plays an essential role in eukaryotic gene expression and cell identity. Traditionally, DNA and histone modifications have been the focus of chromatin regulation; however, recent molecular and imaging studies have revealed an intimate connection between RNA epigenetics and chromatin structure. Accumulating evidence suggests that RNA serves as the interplay between chromatin and the transcription and splicing machineries within the cell. Additionally, epigenetic modifications of nascent RNAs fine-tune these interactions to regulate gene expression at the co- and post-transcriptional levels in normal cell development and human diseases. This review will provide an overview of recent advances in the emerging field of RNA epigenetics, specifically the role of RNA modifications and RNA modifying proteins in chromatin remodeling, transcription activation and RNA processing, as well as translational implications in human diseases. Keywords: 5’ cap (5’ cap); 7-methylguanosine (m7G); R-loops; N6-methyladenosine (m6A); RNA editing; A-to-I; C-to-U; 2’-O-methylation (Nm); 5-methylcytosine (m5C); NOL1/NOP2/sun domain Citation: Willbanks, A.; Wood, S.; (NSUN); MYC Cheng, J.X. RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases. Genes 2021, 12, 627.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Chromatin Dysregulation and DNA Methylation at Transcription Start Sites Associated with Transcriptional Repression in Cancers
    Corrected: Publisher correction ARTICLE https://doi.org/10.1038/s41467-019-09937-w OPEN Chromatin dysregulation and DNA methylation at transcription start sites associated with transcriptional repression in cancers Mizuo Ando 1,2, Yuki Saito1,2, Guorong Xu3, Nam Q. Bui 4,5, Kate Medetgul-Ernar1, Minya Pu1, Kathleen Fisch 3, Shuling Ren1, Akihiro Sakai1, Takahito Fukusumi1, Chao Liu1, Sunny Haft1, John Pang1, Adam Mark3, Daria A. Gaykalova6, Theresa Guo6, Alexander V. Favorov 7,8, Srinivasan Yegnasubramanian7, Elana J. Fertig7, Patrick Ha 9, Pablo Tamayo 1, Tatsuya Yamasoba 2, Trey Ideker4, Karen Messer1 & Joseph A. Califano1,10 1234567890():,; Although promoter-associated CpG islands have been established as targets of DNA methylation changes in cancer, previous studies suggest that epigenetic dysregulation out- side the promoter region may be more closely associated with transcriptional changes. Here we examine DNA methylation, chromatin marks, and transcriptional alterations to define the relationship between transcriptional modulation and spatial changes in chromatin structure. Using human papillomavirus-related oropharyngeal carcinoma as a model, we show aberrant enrichment of repressive H3K9me3 at the transcriptional start site (TSS) with methylation- associated, tumor-specific gene silencing. Further analysis identifies a hypermethylated subtype which shows a functional convergence on MYC targets and association with CREBBP/EP300 mutation. The tumor-specific shift to transcriptional repression associated with DNA methylation at TSSs was confirmed in multiple tumor types. Our data may show a common underlying epigenetic dysregulation in cancer associated with broad enrichment of repressive chromatin marks and aberrant DNA hypermethylation at TSSs in combination with MYC network activation. 1 Moores Cancer Center, University of California San Diego, 3855 Health Sciences Dr, La Jolla, CA 92093, USA.
    [Show full text]
  • Noninvasive Sleep Monitoring in Large-Scale Screening of Knock-Out Mice
    bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Noninvasive sleep monitoring in large-scale screening of knock-out mice reveals novel sleep-related genes Shreyas S. Joshi1*, Mansi Sethi1*, Martin Striz1, Neil Cole2, James M. Denegre2, Jennifer Ryan2, Michael E. Lhamon3, Anuj Agarwal3, Steve Murray2, Robert E. Braun2, David W. Fardo4, Vivek Kumar2, Kevin D. Donohue3,5, Sridhar Sunderam6, Elissa J. Chesler2, Karen L. Svenson2, Bruce F. O'Hara1,3 1Dept. of Biology, University of Kentucky, Lexington, KY 40506, USA, 2The Jackson Laboratory, Bar Harbor, ME 04609, USA, 3Signal solutions, LLC, Lexington, KY 40503, USA, 4Dept. of Biostatistics, University of Kentucky, Lexington, KY 40536, USA, 5Dept. of Electrical and Computer Engineering, University of Kentucky, Lexington, KY 40506, USA. 6Dept. of Biomedical Engineering, University of Kentucky, Lexington, KY 40506, USA. *These authors contributed equally Address for correspondence and proofs: Shreyas S. Joshi, Ph.D. Dept. of Biology University of Kentucky 675 Rose Street 101 Morgan Building Lexington, KY 40506 U.S.A. Phone: (859) 257-2805 FAX: (859) 257-1717 Email: [email protected] Running title: Sleep changes in knockout mice bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • Original Communication Genomic and Expression Array Profiling of Chromosome 20Q Amplicon in Human Colon Cancer Cells
    128 Original Communication Genomic and expression array profiling of chromosome 20q amplicon in human colon cancer cells Jennifer l Carter, Li Jin,1 Subrata Sen University of Texas - M. D. Anderson Cancer Center, 1PD, University of Cincinnati sion and metastasis.[1,2] Characterization of genomic BACKGROUND: Gain of the q arm of chromosome 20 in human colorectal cancer has been associated with poorer rearrangements is, therefore, a major area of investiga- survival time and has been reported to increase in frequency tion being pursued by the cancer research community. from adenomas to metastasis. The increasing frequency of chromosome 20q amplification during colorectal cancer Amplification of genomic DNA is one such form of rear- progression and the presence of this amplification in carci- rangement that leads to an increase in the copy num- nomas of other tissue origin has lead us to hypothesize ber of specific genes frequently detected in a variety of that 20q11-13 harbors one or more genes which, when over expressed promote tumor invasion and metastasis. human cancer cell types. Our laboratory has been in- AIMS: Generate genomic and expression profiles of the terested in characterizing amplified genomic regions in 20q amplicon in human cancer cell lines in order to identify genes with increased copy number and expression. cancer cells based on the hypothesis that these seg- MATERIALS AND METHODS: Utilizing genomic sequenc- ments harbor critical genes associated with initiation and/ ing clones and amplification mapping data from our lab or progression of cancer. Gain of chromosome 20q in and other previous studies, BAC/ PAC tiling paths span- ning the 20q amplicon and genomic microarrays were gen- human colorectal cancer has been associated with erated.
    [Show full text]
  • High Levels of Genetic Diversity Within Nilo-Saharan Populations: Implications for Human Adaptation
    ARTICLE High Levels of Genetic Diversity within Nilo-Saharan Populations: Implications for Human Adaptation Julius Mulindwa,1,2 Harry Noyes,3 Hamidou Ilboudo,4 Luca Pagani,5,6 Oscar Nyangiri,1 Magambo Phillip Kimuda,1 Bernardin Ahouty,7 Olivier Fataki Asina,8 Elvis Ofon,9 Kelita Kamoto,10 Justin Windingoudi Kabore,11,15 Mathurin Koffi,7 Dieudonne Mumba Ngoyi,8 Gustave Simo,9 John Chisi,10 Issa Sidibe,11 John Enyaru,2 Martin Simuunza,12 Pius Alibu,2 Vincent Jamonneau,14 Mamadou Camara,15 Andy Tait,16 Neil Hall,17 Bruno Bucheton,14,15 Annette MacLeod,16 Christiane Hertz-Fowler,3 Enock Matovu,1,* and the TrypanoGEN Research Group of the H3Africa Consortium Summary Africa contains more human genetic variation than any other continent, but the majority of the population-scale analyses of the African peoples have focused on just two of the four major linguistic groups, the Niger-Congo and Afro-Asiatic, leaving the Nilo-Saharan and Khoisan populations under-represented. In order to assess genetic variation and signatures of selection within a Nilo-Saharan population and between the Nilo-Saharan and Niger-Congo and Afro-Asiatic, we sequenced 50 genomes from the Nilo-Saharan Lugbara population of North-West Uganda and 250 genomes from 6 previously unsequenced Niger-Congo populations. We compared these data to data from a further 16 Eurasian and African populations including the Gumuz, another putative Nilo-Saharan population from Ethiopia. Of the 21 million variants identified in the Nilo-Saharan population, 3.57 million (17%) were not represented in dbSNP and included predicted non-synonymous mutations with possible phenotypic effects.
    [Show full text]
  • 75 2. INTRODUCTION Triple-Negative Breast Cancer (TNBC)
    [Frontiers in Bioscience, Scholar, 11, 75-88, March 1, 2019] The persisting puzzle of racial disparity in triple negative breast cancer: looking through a new lens Chakravarthy Garlapati1, Shriya Joshi1, Bikram Sahoo1, Shobhna Kapoor2, Ritu Aneja1 1Department of Biology, Georgia State University, Atlanta, GA, USA, 2Department of Chemistry, Indian Institute of Technology Bombay, Powai, India TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Dissecting the TNBC racially disparate burden 3.1. Does race influence TNBC onset and progression? 3.2. Tumor microenvironment in TNBC and racial disparity 3.3. Differential gene signatures and pathways in racially distinct TNBC 3.4. Our Perspective: Looking racial disparity through a new lens 4. Conclusion 5. Acknowledgement 6. References 1. ABSTRACT 2. INTRODUCTION Triple-negative breast cancer (TNBC) Triple-negative breast cancer (TNBC), is characterized by the absence of estrogen a subtype of breast cancer (BC), accounts for and progesterone receptors and absence 15-20% of all BC diagnoses in the US. It has of amplification of human epidermal growth been recognized that women of African descent factor receptor (HER2). This disease has no are twice as likely to develop TNBC than approved treatment with a poor prognosis women of European descent (1). As the name particularly in African-American (AA) as foretells, TNBCs lack estrogen, progesterone, compared to European-American (EA) and human epidermal growth factor receptors. patients. Gene ontology analysis showed Unfortunately, TNBCs are defined by what they specific gene pathways that are differentially “lack” rather than what they “have” and thus this regulated and gene signatures that are negative nomenclature provides no actionable differentially expressed in AA as compared to information on “druggable” targets.
    [Show full text]