DOCSLIB.ORG

Pyridoxal Kinase Inhibition by Artemisinins Down-Regulates Inhibitory Neurotransmission

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pyridoxal Kinase Inhibition by Artemisinins Down-Regulates Inhibitory Neurotransmission Pyridoxal kinase inhibition by artemisinins down-regulates inhibitory neurotransmission Vikram Babu Kasaragoda,1,2,3, Anabel Pacios-Michelenaa,1, Natascha Schaeferb, Fang Zhengc, Nicole Badera, Christian Alzheimerc, Carmen Villmannb, and Hermann Schindelina,3 aInstitute of Structural Biology, Rudolf Virchow Center for Integrative and Translational Bioimaging, University of Würzburg, 97080 Würzburg, Germany; bInstitute for Clinical Neurobiology, University of Würzburg, 97078 Würzburg, Germany; and cInstitute of Physiology and Pathophysiology, Friedrich Alexander University Erlangen-Nürnberg, 91054 Erlangen, Germany Edited by Lily Yeh Jan, University of California, San Francisco, CA, and approved October 26, 2020 (received for review May 3, 2020) The antimalarial artemisinins have also been implicated in the combination with quinones such as mefloquine and lumefantrine, regulation of various cellular pathways including immunomodu- nowadays represent the standard drug combinations used to treat lation of cancers and regulation of pancreatic cell signaling in malaria caused by Plasmodium falciparum (9). In addition to their mammals. Despite their widespread application, the cellular speci- antiprotozoan activities, these drugs have also been pharmaco- ficities and molecular mechanisms of target recognition by artemi- logically observed to regulate the activities of a variety of mam- sinins remain poorly characterized. We recently demonstrated how malian cellular processes, some of which are deregulated in these drugs modulate inhibitory postsynaptic signaling by direct various types of cancer (10, 11). Recently, it was discovered that binding to the postsynaptic scaffolding protein gephyrin. Here, we artemisinins also modulate the differentiation of pancreatic Tα report the crystal structure of the central metabolic enzyme pyri- cells by inducing the transdifferentiation of glucagon-producing doxal kinase (PDXK), which catalyzes the production of the active Tα cells into insulin-secreting Tβ cells, thus suggesting an antidi- ′ form of vitamin B6 (also known as pyridoxal 5 -phosphate [PLP]), in abetic activity of artemisinins (7). However, two subsequent complex with artesunate at 2.4-Å resolution. Partially overlapping studies contradicted this observation, thus questioning the po- binding of artemisinins with the substrate pyridoxal inhibits PLP tential clinical application of these compounds in the treatment of biosynthesis as demonstrated by kinetic measurements. Electro- diabetes (12, 13). physiological recordings from hippocampal slices and activity mea- Until recently, in the absence of a single protein crystal BIOCHEMISTRY surements of glutamic acid decarboxylase (GAD), a PLP-dependent enzyme synthesizing the neurotransmitter γ-aminobutyric acid structure in complex with artemisinins (neither a plasmodial nor a (GABA), define how artemisinins also interfere presynaptically with mammalian protein), the detailed framework describing the target GABAergic signaling. Our data provide a comprehensive picture of recognition by these small molecules remained enigmatic. The first artemisinin-induced effects on inhibitory signaling in the brain. molecular insights into artemisinin recognition by a target protein were derived by us from crystal structures of the C-terminal domain artemisinins | pyridoxal kinase | pyridoxal phosphate (PLP) | of the moonlighting protein gephyrin (GephE) in complex with two GABA biosynthesis | inhibitory neurotransmission artemisinin derivatives, artesunate and artemether (14). Gephyrin is yridoxal 5′-phosphate (PLP) is the active form of vitamin B6. Significance PIn humans, PLP biosynthesis is catalyzed by pyridoxal kinase (PDXK), a member of the ribokinase superfamily. PDXK uti- Information processing in the central nervous system relies on lizes inactive forms of vitamin B6 (pyridoxal [PL], pyridoxine, chemical synapses where neurotransmitters such as the inhib- and pyridoxamine) and ATP as substrates, producing PLP along itory neurotransmitter γ-aminobutyric acid (GABA) are released with the byproduct ADP. The corresponding reaction proceeds at presynaptic nerve endings. GABA is synthesized by glutamic via a random substrate addition reaction mechanism (1) in which acid decarboxylase (GAD), an enzyme requiring pyridoxal 5’- PLP biosynthesis takes place by transferring the γ-phosphate of phosphate (PLP or vitamin B6) as cofactor, the latter being ATP to the 5′-OH group of the B6 vitamers, in a process assisted synthesized by pyridoxal kinase (PDXK). Here, we show that by divalent metal ions such as Zn2+ and Mg2+ (2) (Fig. 1A). PLP the antimalarial drug artemisinin inhibits PDXK and describe serves as the essential active site component for more than 160 the structural basis of this inhibition. The decrease in PLP pro- distinct human enzymatic activities (3) catalyzing crucial cellular duction reduces the amount of GABA being produced, which, processes such as detoxification reactions and multiple metabolic in turn, impacts the efficacy of GABAergic transmission. This processes including amino acid, carbohydrate, and lipid metab- study combined with our previous data sheds light on how olism. PLP-dependent enzymes also participate in neurotrans- artemisinins can influence inhibitory synaptic transmissions mitter biosynthesis including the inhibitory neurotransmitters both presynaptically, as described here, and postsynaptically. γ-aminobutyric acid (GABA) and glycine (4–6), which are syn- Author contributions: V.B.K., A.P.M., N.S., F.Z., C.A., C.V., and H.S. designed research; thesized by glutamic acid decarboxylase (GAD) and serine V.B.K., A.P.M., N.S., F.Z., N.B., and C.V. performed research; V.B.K., A.P.M., N.S., F.Z., hydroxymethyl transferase (SHMT), respectively. Vitamin B6 N.B., C.V., and H.S. analyzed data; and V.B.K., C.A., C.V., and H.S. wrote the paper. deficiency has been implicated in multiple neurological, psychi- The authors declare no competing interest. atric, and internal disorders possibly including even diabetes, This article is a PNAS Direct Submission. cancer, and autism (3), thus underpinning the importance of a Published under the PNAS license. finely tuned PLP biosynthesis. 1V.B.K. and A.P.M. contributed equally to this work. Recently, PDXK was identified as one of the mammalian 2Present address: Neurobiology Division, Medical Research Council Laboratory of Molec- targets of the antimalarial drug artemisinin (7). Artemisinin- ular Biology, Cambridge CB2 0QH, United Kingdom. containing plant extracts have been used in traditional Chinese 3To whom correspondence may be addressed. Email: [email protected] or medicine for the treatment of malaria (8). Chemically, these small [email protected]. molecules are sesquiterpene lactones with an unusual endoper- This article contains supporting information online at https://www.pnas.org/lookup/suppl/ oxide bridge. Artemisinin and its semisynthetic derivatives arte- doi:10.1073/pnas.2008695117/-/DCSupplemental. mether and artesunate (collectively referred to as artemisinins), in First published December 14, 2020. www.pnas.org/cgi/doi/10.1073/pnas.2008695117 PNAS | December 29, 2020 | vol. 117 | no. 52 | 33235–33245 Downloaded by guest on September 27, 2021 A + + PTA laxodiryP etahpsohp-'5laxodiryP PDA CH CH 3 B 0.20 C 3 D H H O O 0.15 O CH3 O CH3 ) -1 O O OH 0.10 H H H H Vel (s O O H3C O 0.05 H3C O O 0.00 0 100 200 300 400 500 O Pyridoxal ( M) Artemisinin Artesunate E 0.15 F 120 **** **** Artemisinin 100 0.10 Artesunate 80 Vel (s-1) 60 0.05 40 % Inhibition 20 0.00 WT 0 1234 Artesunate Artemisinin log Inhibitor M) Fig. 1. Biochemical basis of PDXK inhibition by artemisinins. (A) Schematic representation of the reaction catalyzed by PDXK. (B) Michaelis–Menten curve derived for the enzymatic activity of recombinantly purified PDXK. (C and D) Chemical structures of artemisinin (C) and artesunate (D). (E) Enzymatic activity of wild-type PDXK (WT-PDXK) in the absence and presence of artemisinin derivatives at a concentration of 1.5 mM (artesunate) and 156 μM (artemisinin), respectively. Data are presented as mean ± SEM (P values are *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001) (one-way ANOVA test). (F) Inhibition curves of PDXK by artemisinin and artesunate used to derive the corresponding IC50 values. the principal scaffolding protein at inhibitory postsynaptic speciali- PLP production in the presence of artemisinins with Ki values in zations and also catalyzes the final two steps of the evolutionarily the high micromolar range. Electrophysiological recordings and conserved molybdenum cofactor (Moco) biosynthesis (15–17). measurements of GABA biosynthesis suggest that artemisinins exert Structures of the GephE–artemisinin complexes demonstrated that their effect by down-regulating the activity of PLP-dependent en- artemisinins specifically target the universal receptor binding pocket zymes such as GAD. Taken together, our data define the molecular of this moonlighting protein, without altering its enzymatic activity, basis for the inhibition of PDXK by artemisinins and their conse- thus inhibiting critical interactions of gephyrin with GABA type A quences at the presynaptic terminals of inhibitory postsynapses and receptors (GABAARs) and glycine receptors (GlyRs). As an im- extend our current understanding of the artemisinin-induced mod- portant functional consequence, artemisinins modulate inhibitory ulation of inhibitory neurotransmission beyond gephyrin. neurotransmission in a gephyrin-dependent
Load more

Recommended publications
  • Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans
    Am J Hum Genet 28:9-17, 1976 Biochemical and Electrophoretic Studies of Erythrocyte Pyridoxine Kinase in White and Black Americans CHING J. CHERN1 AND ERNEST BEUTLER2 Pyridoxine kinase (PNK; EC 2.7.1.35) catalyzes the phosphorylation of pyridox- ine to its active coenzyme form, pyridoxine phosphate: pyridoxine + ATP - + pyridoxine phosphate + ADP. The same enzyme catalyzes the phosphorylation of pyridoxal to pyridoxal phos- phate. Previous communications [1, 21 have shown that the average PNK activity in red cells of American blacks is significantly lower than that of American whites; in contrast, the activities of the enzyme in lymphocytes, granulocytes, and cultured skin fibroblasts from black subjects are the same as those from whites. To gain a better understanding of the genetics of the red cell PNK of blacks, the size of our population survey has been expanded, and some limited family studies have been carried out. To determine whether the enzyme deficiency of black subjects is due to a structural gene mutation or regulatory mutation, we have investigated further the biochemical characteristics of PNK in red cells of white and black donors. The results of our investigations suggest that low red cell PNK activity may be coded by a single structural allele which results in the pro- duction of an enzyme with reduced in vivo stability. MATERIALS AND METHODS Pyridoxine kinase activity was estimated by measuring MH-pyridoxine-5'-phosphate as described previously [3]. Assay results were found to be highly reproducible in the same subject at different times. The red cells of one normal white subject were assayed four times over a 2 month period.
    [Show full text]
  • A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions
    A Screen for Suppressors of Gross Chromosomal Rearrangements Identifies a Conserved Role for PLP in Preventing DNA Lesions Pamela Kanellis1,2, Mark Gagliardi1, Judit P. Banath3, Rachel K. Szilard1, Shinichiro Nakada1, Sarah Galicia1, Frederic D. Sweeney1,2, Diane C. Cabelof4, Peggy L. Olive3, Daniel Durocher1,2* 1 Samuel Lunenfeld Research Institute, Mount Sinai Hospital, Toronto, Ontario, Canada, 2 Department of Medical Genetics and Microbiology, University of Toronto, Toronto, Ontario, Canada, 3 British Columbia Cancer Research Centre, Vancouver, British Columbia, Canada, 4 Karmanos Cancer Institute, Detroit, Michigan, United States of America Genome instability is a hallmark of cancer cells. One class of genome aberrations prevalent in tumor cells is termed gross chromosomal rearrangements (GCRs). GCRs comprise chromosome translocations, amplifications, inversions, deletion of whole chromosome arms, and interstitial deletions. Here, we report the results of a genome-wide screen in Saccharomyces cerevisiae aimed at identifying novel suppressors of GCR formation. The most potent novel GCR suppressor identified is BUD16, the gene coding for yeast pyridoxal kinase (Pdxk), a key enzyme in the metabolism of pyridoxal 59 phosphate (PLP), the biologically active form of vitamin B6. We show that Pdxk potently suppresses GCR events by curtailing the appearance of DNA lesions during the cell cycle. We also show that pharmacological inhibition of Pdxk in human cells leads to the production of DSBs and activation of the DNA damage checkpoint. Finally, our evidence suggests that PLP deficiency threatens genome integrity, most likely via its role in dTMP biosynthesis, as Pdxk-deficient cells accumulate uracil in their nuclear DNA and are sensitive to inhibition of ribonucleotide reductase.
    [Show full text]
  • Identifying and Characterizing Genes Involved in Telomere Length
    Tel Aviv University George S. Wise Faculty of Life Sciences Graduate School The Department of Molecular Microbiology and Biotechnology Identifying and Characterizing Genes Involved in Telomere Length Regulation in Saccharomyces cerevisiae Thesis submitted to the Senate of Tel Aviv University For the degree "Doctor of Philosophy (Ph.D.)" Submitted by Tal Yehuda Under the supervision of The deceased Dr. Anat Krauskopf and Prof. Martin Kupiec May 2008 עבודת המחקר שלי ארכה זמן רב, הן בגלל הנסיבות המיוחדות במעבדה והן בגלל סוג המחקר שבחרתי, לכן אני רוצה להודות לכל האנשים שליוו אותי בדרך ארוכה זו: החל מהמנחה הראשונה שלי- ענת קראוסקופף ז"ל, תודה על ההיכרות האישית והמדעית, למרטין קופייק- על הסבלנות הבלתי נלאית ללמד, לחנך ולהרביץ בי תורה, יישר כח! (תדע שהקשבתי לכל מילה), לחברי המעבדה- הישנים והחדשים, ובמיוחד לך יובל, תודה על העזרה ועל שיתוף הפעולה, למשפחתי העניפה- סבתותי, דודיי, חמיי, גיסותיי, הוריי ואחיי הנפלאים שהתעניינתם ושאלתם (גם אם ההסברים נשמעו לרוב עלומים), בעזרתכם הרבה סיימתי סוף סוף, ובמיוחד לבעלי האהוב- תודה על הכל ! וילדי היקרים לי מכל... ABSTRACT Telomeres are nucleoprotein structures present at the ends of eukaryotic chromosomes. Telomeres play a central role in guarding the integrity of the genome by protecting chromosome ends from degradation and fusion. Regulation of telomere length is central to their function. In order to broaden our knowledge about the mechanisms that control telomere length, we have carried out a systematic examination of ~4800 haploid deletion mutants of Saccharomyces cerevisiae for telomere-length alterations. Using this screen we have identified more than 150 new genes that affect telomere length. A novel array-based method for creating double mutants was used to sort the newly identified genes into epistasis groups.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Single-Cell Expression Profiling Of
    Edinburgh Research Explorer Single-cell expression profiling of dopaminergic neurons combined with association analysis identifies pyridoxal kinase as Parkinson's disease gene Citation for published version: Elstner, M, Morris, CM, Heim, K, Lichtner, P, Bender, A, Mehta, D, Schulte, C, Sharma, M, Hudson, G, Goldwurm, S, Giovanetti, A, Zeviani, M, Burn, DJ, McKeith, IG, Perry, RH, Jaros, E, Krueger, R, Wichmann, H-E, Schreiber, S, Campbell, H, Wilson, JF, Wright, AF, Dunlop, M, Pistis, G, Toniolo, D, Chinnery, PF, Gasser, T, Klopstock, T, Meitinger, T, Prokisch, H & Turnbull, DM 2009, 'Single-cell expression profiling of dopaminergic neurons combined with association analysis identifies pyridoxal kinase as Parkinson's disease gene', Annals of Neurology, vol. 66, no. 6, pp. 792-798. https://doi.org/10.1002/ana.21780 Digital Object Identifier (DOI): 10.1002/ana.21780 Link: Link to publication record in Edinburgh Research Explorer Document Version: Peer reviewed version Published In: Annals of Neurology Publisher Rights Statement: Published in final edited form as: Ann Neurol. 2009 December ; 66(6): 792–798. doi:10.1002/ana.21780. General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • 615.9Barref.Pdf
    INDEX Abortifacient, abortifacients bees, wasps, and ants ginkgo, 492 aconite, 737 epinephrine, 963 ginseng, 500 barbados nut, 829 blister beetles goldenseal blister beetles, 972 cantharidin, 974 berberine, 506 blue cohosh, 395 buckeye hawthorn, 512 camphor, 407, 408 ~-escin, 884 hypericum extract, 602-603 cantharides, 974 calamus inky cap and coprine toxicity cantharidin, 974 ~-asarone, 405 coprine, 295 colocynth, 443 camphor, 409-411 ethanol, 296 common oleander, 847, 850 cascara, 416-417 isoxazole-containing mushrooms dogbane, 849-850 catechols, 682 and pantherina syndrome, mistletoe, 794 castor bean 298-302 nutmeg, 67 ricin, 719, 721 jequirity bean and abrin, oduvan, 755 colchicine, 694-896, 698 730-731 pennyroyal, 563-565 clostridium perfringens, 115 jellyfish, 1088 pine thistle, 515 comfrey and other pyrrolizidine­ Jimsonweed and other belladonna rue, 579 containing plants alkaloids, 779, 781 slangkop, Burke's, red, Transvaal, pyrrolizidine alkaloids, 453 jin bu huan and 857 cyanogenic foods tetrahydropalmatine, 519 tansy, 614 amygdalin, 48 kaffir lily turpentine, 667 cyanogenic glycosides, 45 lycorine,711 yarrow, 624-625 prunasin, 48 kava, 528 yellow bird-of-paradise, 749 daffodils and other emetic bulbs Laetrile", 763 yellow oleander, 854 galanthamine, 704 lavender, 534 yew, 899 dogbane family and cardenolides licorice Abrin,729-731 common oleander, 849 glycyrrhetinic acid, 540 camphor yellow oleander, 855-856 limonene, 639 cinnamomin, 409 domoic acid, 214 rna huang ricin, 409, 723, 730 ephedra alkaloids, 547 ephedra alkaloids, 548 Absorption, xvii erythrosine, 29 ephedrine, 547, 549 aloe vera, 380 garlic mayapple amatoxin-containing mushrooms S-allyl cysteine, 473 podophyllotoxin, 789 amatoxin poisoning, 273-275, gastrointestinal viruses milk thistle 279 viral gastroenteritis, 205 silibinin, 555 aspartame, 24 ginger, 485 mistletoe, 793 Medical Toxicology ofNatural Substances, by Donald G.
    [Show full text]
  • A Dissection of SARS‑Cov2 with Clinical Implications (Review)
    INTERNATIONAL JOURNAL OF MOleCular meDICine 46: 489-508, 2020 A dissection of SARS‑CoV2 with clinical implications (Review) FELICIAN StanCIOIU1, GEORGIOS Z. PapaDAKIS2, STELIOS KTENIADAKIS3, BORIS NIKovaeviCH Izotov4, MICHAEL D. COLEMAN5, DEMETRIOS A. SpanDIDOS6 and ARISTIDIS TsatsaKIS4,7 1Bio‑Forum Foundation, 030121 Bucharest, Romania; 2Department of Radiology, Medical School, University of Crete, 71003 Heraklion; 3Emergency Department, Venizeleion General Hospital, 71409 Heraklion, Greece; 4Department of Analytical and Forensic Medical Toxicology, Sechenov University, 119991 Moscow, Russia; 5School of Life and Health Sciences, Aston University, B4 7ET Birmingham, UK; 6Laboratory of Clinical Virology, Medical School, 7Department of Forensic Sciences and Toxicology, Faculty of Medicine, University of Crete, 71003 Heraklion, Greece Received May 15, 2020; Accepted June 9, 2020 DOI: 10.3892/ijmm.2020.4636 Abstract. We are being confronted with the most consequen- 1. Clinical aspects of COVID‑19 infections; acute respi‑ tial pandemic since the Spanish flu of 1918‑1920 to the extent ratory distress syndrome (ARDS); known and potential that never before have 4 billion people quarantined simultane- treatments ously; to address this global challenge we bring to the forefront the options for medical treatment and summarize SARS‑CoV2 In China, the first comprehensive analysis published on the structure and functions, immune responses and known treat- COVID‑19 (1) included 44,672 cases and 1,023 deaths, with an ments. Based on literature and our own experience we propose overall case-fatality rate (CFR) of 2.3%. There were 0 deaths new interventions, including the use of amiodarone, simv- in patients 9 years old or younger, and the CFR increased with astatin, pioglitazone and curcumin.
    [Show full text]
  • Vitamin B6 Metabolism and Regulation of Pyridoxal Kinase
    Virginia Commonwealth University VCU Scholars Compass Theses and Dissertations Graduate School 2009 VITAMIN B6 METABOLISM AND REGULATION OF PYRIDOXAL KINASE Amit Gandhi Virginia Commonwealth University Follow this and additional works at: https://scholarscompass.vcu.edu/etd Part of the Chemicals and Drugs Commons © The Author Downloaded from https://scholarscompass.vcu.edu/etd/2008 This Dissertation is brought to you for free and open access by the Graduate School at VCU Scholars Compass. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of VCU Scholars Compass. For more information, please contact [email protected]. © Amit K. Gandhi 2009 All Rights Reserved VITAMIN B 6 METABOLISM AND REGULATION OF PYRIDOXAL KINASE A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy at Virginia Commonwealth University. By AMIT K. GANDHI M.S (Pharmaceutical Science), Rajiv Gandhi University, Indore, India, 2003 B.Pharm, Rajiv Gandhi University, Indore, India, 2001 Director: Martin K. Safo, Ph.D Assistant Professor, Department of Medicinal Chemistry Virginia Commonwealth University Richmond, Virginia December, 2009 Acknowledgement I would like to take this opportunity to express my deep gratitude and profound respect to my advisor, Dr. Martin K. Safo, for his supervision, advice, and guidance in this research work. His support and insight have been invaluable in the progression of my research. I also appreciate his words of encouragement, which kept me always in an innovative mood and guided me at all the times to bring about the best in me. He is my mentor and teacher whom I shall remember forever.
    [Show full text]
  • Brain-Specific Knock-Out of Hypoxia-Inducible Factor-1Α
    The Journal of Neuroscience, April 20, 2005 • 25(16):4099–4107 • 4099 Neurobiology of Disease Brain-Specific Knock-Out of Hypoxia-Inducible Factor-1␣ Reduces Rather Than Increases Hypoxic–Ischemic Damage Rob Helton,1* Jiankun Cui,2* John R. Scheel,1* Julie A. Ellison,1 Chris Ames,1 Claire Gibson,2 Barbara Blouw,3 Ling Ouyang,1 Ioannis Dragatsis,4 Scott Zeitlin,5 Randall S. Johnson,3 Stuart A. Lipton,2 and Carrolee Barlow1 1Laboratory of Genetics, The Salk Institute for Biological Studies, and 2Center for Neuroscience and Aging, The Burnham Institute, La Jolla, California 92037, 3Molecular Biology Section, Division of Biology, University of California, San Diego, La Jolla, California 92093, 4Department of Physiology, The University of Tennessee, Health Science Center, Memphis, Tennessee 38163, and 5Department of Neuroscience, University of Virginia School of Medicine, Charlottesville, Virginia 22908 ␣ ␣ Hypoxia-inducible factor-1 (HIF-1 ) plays an essential role in cellular and systemic O2 homeostasis by regulating the expression of genes important in glycolysis, erythropoiesis, angiogenesis, and catecholamine metabolism. It is also believed to be a key component of the cellular response to hypoxia and ischemia under pathophysiological conditions, such as stroke. To clarify the function of HIF-1␣ in the brain, we exposed adult mice with late-stage brain deletion of HIF-1␣ to hypoxic injuries. Contrary to expectations, the brains from the HIF-1␣-deficient mice were protected from hypoxia-induced cell death. These surprising findings suggest that decreas- ing the level of HIF-1␣ can be neuroprotective. Gene chip expression analysis revealed that, contrary to expectations, the majority of hypoxia-dependent gene-expression changes were unaltered, whereas a specific downregulation of apoptotic genes was observed in the HIF-1␣-deficient mice.
    [Show full text]
  • PDXK Is Differentially Expressed in the Brains of Patients With
    1 Pyridoxal kinase, encoded by the PDXK gene, is differentially expressed in the brains of patients 2 with schizophrenia. 3 Shahan Mamoor, MS1 4 [email protected] East Islip, NY USA 5 6 Visual and auditory hallucinations are a cardinal feature of psychotic disorders1. We mined published and public microarray datasets2,3 to discover differentially expressed genes in 7 schizophrenia and schizoaffective disorder. We found significant differential expression of the 8 gene encoding pyridoxal kinase, PDXK in neurons of the dorsolateral pre-frontal cortex from 9 patients with schizophrenia and schizoaffective disorder. 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 Keywords: schizophrenia, schizoaffective disorder, psychotic disorders, psychosis, systems biology of schizophrenia, PDXK. 28 PAGE 1 OF 12 1 Psychiatric diseases schizophrenia and schizoaffective disorder have in common the 2 existence of psychotic symptoms1,4,5, like visual and auditory hallucinations, that can plague 3 4 affected patients. Understanding the transcriptional profiles of cells and tissues from the brain of 5 patients diagnosed with schizophrenia or schizoaffective disorder has the potential to provide 6 insights into molecular mechanisms underlying disease initiation, progression and associated 7 8 symptoms like psychosis. We mined published and public microarray data from layer 3 and 9 layer 5 pyramidal neurons of the dorsolateral pre-frontal cortex from patients with schizophrenia 10 and schizoaffective disorder and from the layer 3 parvalbumin-positive neurons of the 11 12 dorsolateral prefrontal cortex of patients with schizoaffective disorder to discover genes whose 13 expression was most significantly different in the brains of patients with psychosis at the 14 15 systems-level.
    [Show full text]
  • (PDXK) Human Variants in Drosophila Impacts on Genome Integrity
    www.nature.com/scientificreports OPEN The expression of four pyridoxal kinase (PDXK) human variants in Drosophila impacts on genome Received: 11 July 2019 Accepted: 15 September 2019 integrity Published: xx xx xxxx Elisa Mascolo1, Anna Barile2, Lorenzo Stufera Mecarelli 1, Noemi Amoroso1, Chiara Merigliano3, Arianna Massimi4, Isabella Saggio1,5, Torben Hansen 6, Angela Tramonti7,2, Martino Luigi Di Salvo2, Fabrizio Barbetti4, Roberto Contestabile2 & Fiammetta Vernì 1 In eukaryotes, pyridoxal kinase (PDXK) acts in vitamin B6 salvage pathway to produce pyridoxal 5′-phosphate (PLP), the active form of the vitamin, which is implicated in numerous crucial metabolic reactions. In Drosophila, mutations in the dPdxk gene cause chromosome aberrations (CABs) and increase glucose content in larval hemolymph. Both phenotypes are rescued by the expression of the wild type human PDXK counterpart. Here we expressed, in dPdxk1 mutant fies, four PDXK human variants: three (D87H, V128I and H246Q) listed in databases, and one (A243G) found in a genetic screening in patients with diabetes. Diferently from human wild type PDXK, none of the variants was able to completely rescue CABs and glucose content elicited by dPdxk1 mutation. Biochemical analysis of D87H, V128I, H246Q and A243G proteins revealed reduced catalytic activity and/or reduced afnity for PLP precursors which justify this behavior. Although these variants are rare in population and carried in heterozygous condition, our fndings suggest that in certain metabolic contexts and diseases in which PLP levels are reduced, the presence of these PDXK variants could threaten genome integrity and increase cancer risk. Diferently from bacteria and plants which synthesize ex novo the active form of vitamin B6, pyridoxal 5′ phos- phate (PLP), in other organisms PLP production relies on the salvaging activity of two enzymes: pyridoxal 5′-phosphate kinase (PDXK) and pyridoxine 5′-phosphate oxidase (PNPO).
    [Show full text]
  • "The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
    The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshfield, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data unification includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
    [Show full text]