sign in sign up
<<
Home , Francis Collins, Introduction to genetics

9/25/2013

INTRODUCTION TO

Lizzie Dorfman [email protected] PHG 523/LAW H 520 October 2, 2013

Outline

Genetics: the study of , variation and in living

1. Genes

1.

2. Heredity

Genes

• What is DNA? • Where is DNA? • How is DNA organized? (genes show up here) • What does DNA do? • Human Project & ENCODE

1 9/25/2013

Biochemically: DNA • Large • Double helix structure (twisted ladder) • Ladder rungs: 4 bases: Adenine, Cytosine, Guanine, Thymine • Ladder sides: sugar and phosphate • Bonding rules: A‐T, C‐G

Functionally: “[DNA is] a narrative of the journey of our species through time. It's a shop manual, with an incredibly detailed blueprint for building every human . And it's a transformative textbook of medicine, with insights that will give health care providers immense new powers to treat, prevent and cure disease.” MD, PhD NIH NIH Director

www.lpch.org

Chromosomes

• Organized structures of DNA in cell nucleus

• Humans: 23 pairs, diploid

• Named 1‐22 from largest to smallest

• 1‐22 called “autosomes”

• X,Y sex

2 9/25/2013

Chromosomes

Penn State University

What does DNA do?

1. Make more of itself 2. Make (via RNA)

3. Regulate #1 and #2

DNA Replication

• Part of the cell cycle

• Single strand sufficient to reconstruct double strand (base‐pairing rules)

• Each new DNA molecule has one strand from parent molecule, one new strand

• Rate of depends on type of cell: • skin: days • liver/pancreas: ~1 year replicationdna.blogspot.com

3 9/25/2013

Genes : segment of DNA that tells the cell how to make a certain or otherwise has a in an

Exons: stretches of DNA within a gene that code for a part of the final protein • ~9 exons/gene • “exome” is all of the exons in a genome • 1.5‐2% of genome

Introns: stretches of DNA within a gene that are removed between and and do not code for a part of the final protein • ~8 introns/gene • some regulatory functions • make possible >1 protein/gene Wikipedia

Proteins TRANSCRIPTION DNA is transcribed into mRNA • Just the gene of interest • mRNA, single stranded • Thymine replaced by Uracil

TRANSLATION mRNA is translated into a protein • Multistep process involving tRNA and • mRNA “read” 3 letters at a time (codon) • Each codon specifies an

Penn State University

PROTEINS

FUNCTION DESCRIPTION EXAMPLE Antibody • Help protect the body by binding to Immunoglobulin G specific foreign particles (e.g. viruses and (IgG) ) • Carry out chemical reactions DNA helicase • Read genetic information Messenger • Transmit signals to coordinate biological Human growth processes between different cells, tissues, hormone and organs

Structural • Small scale: provide structure and support Actin Component for cells • Large scale: allow the body to move Transport/Storag • Carry small within cells and Ferritin e throughout the body Content from National Library of Medicine

4 9/25/2013

Human Genome Project

Human Genome Project

WHAT WHY

• DoE/NIH project, formally • Better understand genetics and launched 1990, completed 2003 disease

• $3 billion • Find disease‐causing variants

• Primary goals: • Identify new treatments • Sequence a human genome • Identify and map all human genes • (physical and functional) Enable comparative /evolutionary studies, functional genomics • ELSI issues (5%)

• Technique development

NHGRI

5 9/25/2013

“junk” DNA?

Just 2% of the genome codes proteins…so what about the rest?

Encyclopedia of DNA Elements (ENCODE) • NHGRI project launched 2003 • Goal: identify all functional elements of human genome • Initial results released 2012 o 20% non‐coding DNA functional o 60% non‐coding DNA transcribed but of unknown function o Function frequently regulation and expression of genes

• Key takeaways: 1. It is NOT junk 2. Gene regulation is very complex

Genetic Variation

• Key terminology

• Genetic comparisons: across species, among humans

• Types of genetic variation

• Sources of genetic variation

• HapMap and 1,000

• Race, ethnicity, identity, and genetics

• Genetics and human forensics

•

Some Terms

LOCUS A specific location of a gene or DNA sequence on a . ATCGTGCTAGTTAAAGGCGATCGTACGGACTAG One of two or more alternative forms of a gene that are found at the same locus. ATCGTGCTAGTTAAAGGCGATCGTACGGACTAG ATCGTGCTAGTTAAAGTCGATCGTACGGACTAG (n) The allelic composition of an individual for one or more genes. (v) The process of determining…

PHENOTYPE The observable traits or characteristics of an organism.

6 9/25/2013

Phenotype, cont.

Phenotypes are determined by a person’s genes, environment and interactions between the two.

• Morphological, molecular, disease, behavioral • Binary, categorical, continuous • Static or dynamic/temporary

Humans v. other organisms

Percent of genes shared between humans and…

Chimp: 98% Gorilla: 96% : 92% Fruit Fly: 44% Yeast: 26% Plants: ~18%

National Academy of

www.sciencemag.org

Humans v. humans

Humans are, on average, 99.9% identical to every other human…

…but 0.001 * 3 billion = 3 million points of variation. These differences are what make us unique.

7 9/25/2013

Types of Genetic Variation

SINGLE BASE CHANGES ‐ My pet fish is named Sylvester ~15M total ‐ My wet fish is named Sylvester ‐ My pet[]

STRUCTURAL VARIATION Insertion ‐ My pet afis hi sname dSylveste r Deletion ‐ My pet fish is [] Sylvester Inversion ‐ My pet fish is Sylvester named Translocation ‐ My Sylpet fish is named []vester Copy # variation ‐ My pet fish fish fish fish fish is named Sylvester ‐ My pet fish is named Sylvester My pet fish is named Sylvester My pet fish is named Sylvester My pet fish is named Sylvester

Types of Genetic Variation

INHERITED ACQUIRED

• From parents • Errors in DNA replication

• DNA damage from • De novo during environment

• Intentional modification aaaaaaaaaaaaaaaaaaaaaaaaa () a CAN be passed on to offspring CANNOT be passed on to offspring

Sources of Genetic Variation

1. • “Survival of the fittest” • Organisms better adapted to their environment tend to survive and produce more offspring

2. • Changes in due to chance • Bottlenecks and founder effects

3. Mutations • Formation of new • Can be harmful, neutral, or beneficial

4. • Exchange of genes between • Affected by geography, migration, breeding patterns

8 9/25/2013

Human Genetic Variation

• Multi‐national project, initiated 2008 • Multi‐national, multi‐sector project 2002‐ • Sequence the genomes of ~1,000 individuals 2009 from different ethnic groups

• Goal of identifying “tag” SNPs that are • Goal of identifying >95% of genetic variation informative about genotype for other • Structural variation polymorphic loci • Rare variation in genes • allele frequencies • Associations among SNPs and frequencies • Haplotypes and linkage disequilibrium patterns vary across populations • Samples from HapMap populations, plus Kenya, Italy, Peru, Native American, Asian‐ • Included Nigerian (Yoruban), Han Chinese, American, Mexican‐American, African‐ Japanese, and European participants American.

www.hapmap.ncbi.nlm.nih.gov www.1000genomes.org

Race, ethnicity & identity physical characteristics categorization racism sociology

discrimination skin color

social construction

www.radiolab.org

anthropology culture colonialism inferiority/superiority

Race, ethnicity, identity & genetics

• Human genetic variation is geographically structured • Gene flow and genetic drift • Implications for genetic epidemiologic research

• Analysis of multiple genetic loci can be informative of ancestry/geographic origin

• Genetic variation tends to be distributed in a continuous, overlapping fashion among populations • Individuals from different populations can be genetically more similar than individuals from the same population.

• Some medically relevant genetic variants are found exclusively or at much higher frequencies in specific populations • Tay‐Sachs in Ashkenazi Jews • HLA‐B*1502 and carbamazepine‐associated Stevens‐Johnson Syndrome in Asian populations

9 9/25/2013

Genetics & human forensics

• Comparative DNA Profiling • Evaluation of the extent of genetic similarity between a known individual and an unidentified sample • Match probability based on population allele frequencies • Forensic DNA Phenotyping • Inferring biogeographical ancestry and externally visible characteristics (eye, hair, and skin color, freckling, hair ) • Reduce pool of potential suspects • Missing person identification/unidentified remains • Relatedness • Determine kinship, including paternity

CONSIDERATIONS: sample: type, amount, mixed samples, contamination, degradation variation: single base changes (SNPs), structural variation (STRs) genomic location: non/coding; autosomal, Y‐chromosome, mtDNA

Short • Repeating sequences of 2‐6 base pairs of DNA Tandem • Multi‐allelic Repeats (STRs)

• Specimen DNA typically amplified via Polymerase Chain Reaction (PCR) ‐ 4‐5 sequences optimal • Analyzed via Restriction Fragment Length Polymorphism (RFLP) and gel electrophoresis

• Combined DNA Index System (CODIS) ‐ 13 core loci (STRs) ‐ Non‐coding regions

Microbiome

: “[T]he ecological of commensal, symbiotic, and pathogenic microorganisms that literally share our body space.” ( PhD, 2001) commensal: beneficial to bacteria, neutral to human symbiotic: beneficial to both bacteria and human pathogenic: beneficial to bacteria, harmful to human HUMAN

Human cells per person: ~1012 NOT Microbial cells per person: ~1013 >90% cells Human genes: 2*104 >98% genes # Human microbiome genes: >3*106

10 9/25/2013 Me,

Myself,

and

Us

www.scientificamerican.com

Human Microbiome Project

• NIH funded, launched 2008

• Feasibility focused, $115M budget

• Goals: • Characterize “reference” human microbiome (genomic sequences) • Explore relationship between microbiome and disease • Develop new technologies for computational analysis • Establish repository • Study ELSI implications of microbiome research

www.hmpdacc.org

Heredity

Defined: Genetic transmission of traits from parent to offspring.

• in humans: key concepts

• Heritability

• Patterns of inheritance

11 9/25/2013

Reproduction in Humans KEY CONCEPTS

SOMATIC CELL ‐ Any cell in a living organism other than a reproductive cell (sperm and eggs). ‐ Cell nucleus contains TWO of each chromosome (one from each parent) ‐ Undergo/produced by

GAMETE ‐ Sex cell (sperm and eggs) ‐ Cell nucleus contains ONE of each chromosome ‐ Can unite with another gamete of opposite sex to produce a fertilized egg with TWO of each chromosome, one each from the sperm and the egg ‐ Produced by MEIOSIS

Reproduction in Humans KEY CONCEPTS During meiosis, chromosomes undergo recombination, in which segments of each chromosome are broken off and exchanged within a pair, resulting in gametes with new chromosomes that are derived from, but not identical to, those of the parents.

www.genome.wellcome.ac.uk

Reproduction in Humans KEY CONCEPTS

In cases of bi‐allelic or multi‐allelic loci, the more common allele is known as the major or wildtype allele, and the less common allele(s) is known as the minor or variant allele.

Because humans have two copies of each chromosome*, one from each parent, an individual’s genotype for a specific gene/locus can be either matching (homozygous) or non‐matching (heterozygous). * exceptions: X/Y chromosome in males, mitochondria Location 1

Location 2

12 9/25/2013

Heritability

Inherited: received by genetic transmission from one's parents/ancestors.

Heritable: having a large proportion of phenotypic variation in a population attributable to genetic variation among individuals.

Important Note: Changing only the environment can change the heritability of a trait.

[genetically determined variation] [genetic + environmental variation]

Inheritance Patterns

Inheritance patterns trace the transmission of genetically encoded traits/diseases to offspring. They are used to:

1. Aid in the process of identifying the gene(s) associated with the trait/disease of interest

2. Allow counseling of the risk of disease and risk of transmitting disease alleles to offspring

Inheritance Patterns: Single Gene

There are four types of inheritance patterns in which a trait/disease is caused by variation in a single gene (aka “Mendelian”):

1. AUTOSOMAL DOMINANT: The responsible gene is on one of the 22 pairs of autosomes, and the condition is present in individuals with only ONE copy of the variant allele.

2. AUTOSOMAL RECESSIVE: The responsible gene is on one of the 22 pairs of autosomes, and the condition is ONLY present in individuals with TWO copies of the variant allele.

3. X‐LINKED DOMINANT: The responsible gene is on the X chromosome, and the condition is present in individuals with only ONE copy of the variant allele.

4. X‐LINKED RECESSIVE: The responsible gene is on the X chromosome, and the condition is ONLY present in females with TWO copies of the variant allele, or males with ONE copy.

13 9/25/2013

Inheritance Patterns: Single Gene

Autosomal Dominant Autosomal Recessive

X‐linked Recessive

Pedigrees from www.uvw.edu

Genetic carrier status in my family: Carrier

For single gene disorders that follow a recessive pattern of inheritance, individuals with ONE copy of the disease variant are known as genetic “carriers”.

A carrier is not affected by the disease; however two carriers of the same disease have a 25% chance with each pregnancy of having an affected child. Not tested Tested, non‐carrier (cc) Cc Tested, carrier (Cc) C CC (25%) Cc (25%) c Cc (25%) cc (25%)

Inheritance Patterns: Multifactorial

Diseases with multifactorial inheritance are not genetically determined. Genetic variants may predispose an individual to a disease. Other genetic and environmental factors contribute to whether or not the disease develops.

MOST CONDITIONS/DISEASES ARE MULTIFACTORIAL

heart disease, type‐2 diabetes, Parkinson’s disease, (e.g. lung, colon, prostate, and breast), stroke, Crohn’s disease, age‐related macular degeneration, Alzheimer's disease, bipolar disorder, brain aneurism, cleft lip and palate, dyslexia, Hodgkin lymphoma, kidney disease, lupus, melanoma, narcolepsy, multiple sclerosis, psoriasis, rheumatoid arthritis, scoliosis, Tourette's syndrome, venous thromboembolism, ulcerative colitis…

14 9/25/2013

Epigenetics

Differences/changes in the expression of individual genes (location, timing, or amount of protein or other gene product generated, i.e. a phenotype change) caused by mechanisms other than differences in the underlying DNA sequence, that may be transmitted to offspring.

• Etymology: epi‐ (Greek: επί‐ over, above, outer) • Mechanisms: DNA (de)methylation, histone modification, others • Sources: developmental environment, diet, chemical exposure, stress, age

Epigenetic inheritance

Nature or/and/?? Nurture Transmission or Direct Exposure?

Exposure: maternal depression, maternal PTSD/stress (during pregnancy) Mechanism: methylation of NR3C1 Transmitted phenotype: heightened stress response in G2

Exposure: maternal famine (during pregnancy) Mechanism: altered methylation of IGF2 Transmitted phenotype: low birth weight, metabolic disease, and CVD in G2; low birth weight in G3

Exposure: paternal obesity Mechanism: altered methylation of IGF2 Transmitted phenotype: … May need 4th generation…

www.genetics.utah.edu

QUESTIONS?

15