PRRS) Virus Vaccine Candidates in Pigs

Home , Cardiovirus

Development and Evaluation of Efficacy of Novel Porcine Reproductive

and Respiratory Syndrome (PRRS) Virus Vaccine Candidates in Pigs

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy

in the Graduate School of The Ohio State University

Yashavanth Shaan Lakshmanappa

Graduate Program in Comparative and Veterinary Medicine

The Ohio State University

2018

Dissertation Committee

Dr. Renukaradhya J. Gourapura, Advisor

Dr. Daral Jackwood, Committee Member

Dr. Jianrong Li, Committee Member

Dr. Qiuhong Wang, Committee Member

Copyrighted by

Yashavanth Shaan Lakshmanappa

2018

ABSTRACT

Porcine reproductive and respiratory syndrome (PRRS) continues to be a huge threat to the swine industry globally. PRRS is caused by PRRS virus (PRRSV) it is a small single- stranded, positive sense RNA virus. This RNA virus is constantly evolving to adapt to the existing immunity and re-emerging as new pathogenic variants, which escape from the host immune response to cause new outbreaks periodically. In recent years, many PRRSV control and elimination strategies have been in practice in swine farms, but many a times these measures were not always successful especially on small village farms in developing countries. Hence development of effective vaccines is still a best measure for controlling

PRRS and reducing economic losses. The ideal vaccine should be safe in pigs, should trigger strong innate and adaptive immune responses, should differentiate the vaccinated from naturally infected pigs and cross-protect against variants of PRRSV. Due to constant advancements in trade across the globe, both PRRSV species which originated from different continents have been transmitted across the continents and can cause co-infections in the same herd. Presently available modified live PRRSV vaccines, killed virus vaccines and recombinant vaccines are not always effective in controlling PRRS outbreaks. In this study, we employed new vaccine development strategies to induce an increased breadth of immunity against both PRRSV species. In PRRSV-1 and PRRSV-2 co-infected MARC-

145 cells we observed a strong interference of PRRSV-2 on PRRSV-1 replication, iii especially in concurrent co-infected cells. We used PRRSV-1 and PRRSV-2 modified live virus vaccines (MLV) to analyze the efficacy of both consecutive and concurrent vaccination methods administered intramuscularly, either 3 days apart (PRRSV-1 MLV followed by PRRSV-2 MLV, consecutive) or together on the same day (concurrent) against homologous challenge in pigs. We showed that the consecutive vaccination method appears to provide better clearance of both PRRSV species through induction of increased frequency of PRRSV-1 and PRRSV-2 specific IFN-γ positive T-helper/memory and cytotoxic T cells responses with increased virus neutralization antibody titers against both

PRRSV-1 and PRRSV-2 species.

Further, PRRSV MLVs have a safety concern, because the vaccine virus may revert back to virulence, However, killed vaccines are safe but have an efficacy concern due to their less immunogenicity. We examined a killed vaccination strategy to boost the cell- mediated immune response and achieve better virus clearance in pigs. In that study, we employed killed vaccines against PRRSV-1 and PRRSV-2 species along with a potent mucosal adjuvant, like non-toxic heat labile (LT) enterotoxin for priming, followed by oral boosting with immunogenic conserved T-cell epitopes of PRRSV expressed by nonpathogenic E. coli against respective homologous challenge virus infections in pigs. We showed that our vaccination strategy induced a robust cell-mediated immune response, especially T cell responses against both PRRSV-1 and PRRSV-2, and importantly improved the overall adaptive immune response in pigs. Further studies are needed to improve the PRRSV specific B-cell response and in turn enhance the virus neutralizing antibody titers against both the PRRSV species.

Due to the emergence of pathogenic variants of PRRSV, use of next generation vaccine platforms are important. Replicating viral vectors are potential vaccine candidates for the development of recombinant vaccines. In our study, we attempted to exploit the advantages of the vesicular stomatitis virus (VSV) vector system to express two PRRSV proteins together with a linker. The internal ribosome entry site (IRES) in VSV was used to increase the expression of a second gene by the sequential transcription mechanism. The

VSV vector has been successfully used in the delivery of antigens for various emerging and re-emerging pathogens which cause respiratory infections in humans and animals. In this study, we adapted a novel approach for expression of PRRSV genes by the VSV vector system from the second open reading frame (ORF) through the IRES. Recombinant VSV

(rVSV) expressing PRRSV genes were successfully recovered using the reverse genetics system by employing bacteriophage T7 RNA polymerase expressed in vaccinia virus. The recovered recombinant VSV (rVSV-GP5-IRES-GP3) was more attenuated in cell culture which was evident in the size of the plaques formed and low level of replication in vitro.

Thus, these rVSV PRRSV and similarly generated other structural PRRSV genes in rVSV can be employed in in vivo vaccine trials in pigs to elucidate its efficacy.

In summary, diverse innovative PRRSV vaccine strategies were evaluated which have the potential to provide robust cross-protective immune response and likely help in the control of PRRS outbreaks across the globe. Future studies should focus on comparative analysis of the efficacy of our PRRSV vaccine formulations with the available commercial vaccines.

Dedication

Dedicated to

MY PARENTS, WIFE AND FAMILY

Acknowledgments

The work presented in this thesis would not have been possible without my close association with many people. I take this opportunity to extend my sincere gratitude and appreciation to all those who made this Ph.D. thesis possible.

First and foremost, I would like to extend my sincere gratitude to my advisor,

Professor Dr. Renukaradhya Gourapura (Aradhya) for giving this opportunity to work in his lab and introducing me to this exiting field of science in The Ohio State University

(OSU). He has been supportive since the days I began working in his lab. I thank him for his continuous guidance, mentorship, advice, inspiration, encouragement, motivation and support, both academically and emotionally throughout my Ph.D. I thank my committee members Dr. Daral Jackwood, Dr. Jianrong Li and Dr. Qiuhong Wang for their valuable comments, suggestions and constructive criticisms to improve quality of my research work presentation in this thesis, which also helped me to realize the power of critical reasoning.

I would like to thank Dr. Jianrong Li for providing all the VSV system and guidance for generating new rVSV PRRSV vaccine constructs.

I had a great opportunity to work with collaborators from different institutions: Dr.

Ying Fang and her group from Kansas State university, Dr. Weeping Zhang from Kansas state university, Dr. Joan Lunney from ARS-USDA and Dr. Jainrong Li from OSU, I owe vii my deep respect and gratitude to all of them. I would also like to thank USDA-NIFA for financial support for my PhD projects.

I extend my deepest gratitude to Indian council of agricultural sciences (ICAR),

New Delhi for granting my fellowship for three years to pursue my PhD in the USA through

ICAR-International Fellowship (ICAR-IF) program. I also extend my thanks to Dr. Suresh

S Honnappagol, Commissioner of Animal Husbandry, INDIA and Dr. Venkateshwvarulu,

ADG (Education), ICAR and Mr. Bhagwath Singh, CTO (EQR), ICAR for their help during my PhD period.

I sincerely thank Dr. Ying Fang and Pengcheng Shang (PhD student, Fang’s lab,

KSU) for their collaborative contribution towards my PhD thesis. I thank all the past and present members of Dr. Aradhya’s lab with whom I had an opportunity to work together, including, Kathy Bondra, Jagadish Hiremath, Basavaraj Binjawadagi, Santosh Dhakal,

Kang Ouyang, DL (Bruce) Shyu, Sankar Renu, Shristi Ghimire, Christina Misch, Brad

Hogshead, Jennifer Rank, Yi Han and Ninoshkaly Feliciano Ruiz. I sincerely thank

Shaoyan Zhang (Dr. Qu’s lab) and Dr. Feng Qu for their help and sharing their lab space during my in vitro experiments. I also thank Dr. Niraj Makadiya, Mizia, Yuanmei, Yu of

Dr. Li’s lab for their help during my experiments.

I appreciate Mrs. Hannah Gehman, Robin Weimer, Casey Hoffman and Kathy

Froilan for their help in administrative issues. My sincere acknowledgements to Dr. Juliette

Hanson, Megan Strother, Sara Tallmadge, Ronna Wood and other staff members of animal care unit without whom all these animal studies would have not been possible. My appreciation also goes to summer students and students from Agricultural Technical

viii

Institute (ATI) including, Bridgette, Ally, Cody, Akhila and Alikhya for their help during my experiments.

My special thanks to all the friends at Wooster campus who created homely environment during my stay including Anand, Anwar, Sridhar, Vishal, Andika, Mao,

Mahesh KC, Deepak and others.

I am always indebted to my parents, doddappa, doddamma, uncle and aunt, sisters, brother, in-laws and other family members who have always been my motivation and inspiration to achieve better even if we are far-away from each-other. Their sacrifices, constant encouragement and support motivated me to achieve this milestone. At last but most importantly, immense respect and love to my dear wife Jyothi (Lekhana) who is always there in my journey by encouraging and supporting to reach my goal. Overall, it has been a wonderful expedition both personally and professionally filled with great learnings. I am looking forward to making use of these learnings for betterment of human and animal health in future.

VITA

August 1998 to October 2003……………... B.V.Sc. & A.H, Bidar Veterinary College,

University of Agricultural sciences, Dharwad

Karnataka, India.

October 2003 to October 2004 ...... Veterinary medical surgeon at Animal Right

Fund, an animal welfare organization.

October 2004 to January 2007 ...... M.V.Sc (Veterinary Microbiology/Virology)

Bombay Veterinary College, MAFSU,

Mumbai, India.

January 2007 to March 2008 ...... Veterinary Surgeon, Department of Animal

Husbandry, Karnataka, India.

March 2008 to January 2015...... Scientist/Assistant Professor, Institute of

Animal Health and Veterinary Biologicals,

Bangalore, Karnataka, India.

January 2015 to present ...... PhD student, CVM, The Ohio State

University, USA.

PUBLICATIONS

First Author Publications

1) Yashavanth Shaan Lakshmanappa*, Pengcheng Shang*, Sankar Renu, Santosh Dhakal,

Bradley Hogshead, Pauline Bernardo, Xinyu Yan, Ying Fang and Gourapura J.

Renukaradhya. Concurrent but consecutive vaccination of live modified PRRSV-1 and

PRRSV-2 provides better protection in nursery pigs. Submitted to Journal of Veterinary

Microbiologty. 2018: I.F: 2.7. (*Equal contribution).

2) Pengcheng Shang*, Yashavanth Shaan Lakshmanappa*, Longchao Zhu, Xiaoshan

Ruan, Santosh Dhakal, Sankar Renu, Bradley Hogshead, Weiping Zhang, Gourapura J.

Renukaradhya and Ying Fang. Application of non-toxic enterotoxin and E. coli as the

delivery system for in vivo expression of immunogenic epitopes of PRRSV. In preparation

for submission to Journal of Clinical Vaccine and Immunology. 2018 IF: 2.598 (*Equal

contribution). (Patent Pending at Kansas State University)

3) Yashavanth Shaan Lakshmanappa, Shoayan Zhang, Niraj Makadia, Mijia, Sankar Renu,

Santosh Dhakal, Jianrong Li and Gourapura J. Renukaradhya. Construction and recovery

of recombinant vesicular stomatitis virus expressing PRRSV proteins through an internal

ribosomal entry site. (Manuscript in preparation).

Co-author publications:

4) Basavaraj Binjawadagi, Yashavanth Shaan Lakshmanappa, Zhu Longchao, Santosh

Dhakal, Jagadish Hiremath, Kang Ouyang, Duan-Liang Shyu, Jesus Arcos, Shang

Pengcheng, Aaron Gilbertie, Federico Zuckermann, Jordi B. Torrelles, Daral Jackwood,

Ying Fang and Gourapura J. Renukaradhya. Development of a porcine reproductive and

respiratory syndrome virus-like-particle-based vaccine and evaluation of its

immunogenicity in pigs. Archives of Virology, June 2016, Volume 161, Issue 6, pp 1579–

1589. I.F: 2.11

5) Rui Guo, Pengcheng Shang, Celena A Carrillo, Zhi Sun, Yashavanth S Lakshmanappa,

Xingyu Yan, Gourapura J Renukaradhya, Jodi McGill, Crystal J Jaing, Megan C

Niederwerder; Raymond R Rowland. Double-stranded viral RNA persists in vitro and in

vivo during prolonged infection of porcine reproductive and respiratory syndrome virus.

Submitted to Journal of Virology, 2018 I.F: 3.353.

6) Santosh Dhakal, Sankar Renu, Shristi Ghimire, Yashavanth Shaan Lakshmanappa,

Bradley Hogshead, Ninoshkaly Feliciano Ruiz, Steven Krakowka, Chang Won Lee and

Gourapura J Renukaradhya*. Mucosal immunity and protective efficacy of inactivated

influenza virus vaccine is improved by using the intranasal chitosan delivery system in

pigs. Frontiers of Immunology, 2018: I.F: 6.424

7) Sankar Renu, Santosh Dhakal, Jonathan Goodman, Yashavanth Shaan Lakshmanappa,

Eunsoo Kim, Michael Wannemuehler, Balaji Narasimhan, Prosper Boyaka and Gourapura

J Renukaradhya. Differential expression of B cell activation factor regulates breadth of

antibody responses to nanoparticle-based nasal vaccines. Cellular Immunology, 2018: I.F:

2.14

8) Santosh Dhakal, Jagadish Hiremath, Kathryn Bondra, Yashavanth S Lakshmanappa,

DuanLiang Shyu, Kang Ouyang, Kyung-il Kang, Basavaraj Binjawadagi, Jonathan

Goodman, Kairat Tabynov, Steven Krakowka, Balaji Narasimhan, Chang Won Lee and

Gourapura J. Renukaradhya. Biodegradable nanoparticle delivery of inactivated swine

influenza virus vaccine provides heterologous cell-mediated immune response in pigs.

Journal Control Release, Volume 247, 2017, Pages 194–205. I.F: 7.705

9) Santosh Dhakal, Jonathan Goodman, Kathryn Bondra, Yashavanth S Lakshmanappa,

xii

Jagadish Hiremath, Duan-Liang Shyu, Kang Ouyang, Kyung-il Kang, Steven Krakowka,

Michael J. Wannemuehler, Chang Won Lee, Balaji Narasimhan and Gourapura J.

Renukaradhya. Polyanhydride nanovaccine against swine influenza virus in pigs. Vaccine,

January 2017. I.F: 3.235

10) Santosh Dhakal; Fangjia Lu; Shristi Ghimire; Sankar Renu; Yashavanth Shaan

Lakshmanappa; Bradley Hogshead; Darryl Ragland; Harm Hogenesch and Gourapura J

Renukaradhya. Corn-derived alpha-D-glucan nanoparticles as adjuvant for intramuscular

and intranasal immunization in pigs. Submitted to Nanomedicine: Nanotechnology,

Biology, and Medicine, 2018. I.F: 6.692.

11) Santosh Dhakal, Xingguo Cheng, Renu Sankar, Yashavanth Shaan Lakshmanappa

Bradley Hogshead; Kathy Bondra, Nino Feliciano-Ruiz, Steve Krakowka, Chang Won Lee

and Gourapura J Renukaradhya. Liposome nanoparticle-based influenza conserved

peptides vaccine and monosodium urate crystal adjuvant elicits protective immune

response in pigs. Submitted to Journal Control Release,2017, I.F: 7.705.

12) Kang Ouyang, Duan-Liang Shyu, Santosh Dhakal, Jagadish Hiremath, Basavaraj

Binjawadagi, Yashavanth S Lakshmanapp. Rui Guo, Russell Ransburgh, Kathryn M

Bondra, Phillip Gauger, Jianqiang Zhang, Terry Spencht, Aaron Gilbertie, William

Minton, Ying Fang and Gourapura J Renukaradhya. Evaluation of humoral immune status

in porcine epidemic diarrhea virus (PEDV) infected sows under field conditions.

Veterinary Research, 2015, 46:140. I.F: 2.798

13) Santosh Dhakal, Lingling Wang, Linto Antony, Jennifer Rank, Pauline Bernardo, Shristi

Ghimire, Kathy Bondra, Christina Siems, Yashavanth Shaan Lakshmanappa, Renu

Sankar, Bradley Hogshead, Steven Krakowka, Mike Kauffman, Joy Scaria, Jeffrey

Lejeune, Zhongtang Yu and Gourapura J. Renukaradhya. Rural versus urban infant fecal

xiii microbiota are highly diverse and transplantation lead to differences in mucosal immune maturation in the humanized germfree piglet model, submitted to Microbiome, 2018; I.F

8.496.

Fields of Study

Major Field: Comparative and Veterinary Medicine

Veterinary Microbiology/Immunology/virology-vaccine construction and vaccine development

xiv

Table of Contents

Abstract ……………………………………………………………………………….. iii

Dedication………………………………………………………………………………vi

Acknowledgments……………………………………………………………………...vii

Vita……………………………………………………………………………………... x

List of Tables…………………………………………………………………………..xix

List of Figures…………………………………………………………………………. xx

Chapter 1. Literature Review ……………………………………………………………1

Porcine reproductive and respiratory syndrome in pigs; prevention, control and vaccinology……………………………………………………………………………...2

1.1 Introduction to porcine reproductive and respiratory syndrome (PRRS)……..2

1.1.1 Etiology and its evolution………………………………………………………..3

1.1.2 Molecular biology of PRRSV…………………………………………………....4

1.1.3 Structural protein of PRRSV……………………………………………………6

1.1.4 Genetic and antigenic diversity of PRRSV-1 and PRRSV-2………………….9

1.1.5 Antigenic variation …………………………………………………………….11

1.1.6 Genetic recombination and evolution of new strains of PRRSV …………....11 xv

1.1.7 PRRSV infectivity and replication……………………………………………..16

1.1.8 PRRSV transmission and clinical symptoms …………………………………18

1.2 Economic importance of PRRSV………………………………………………...20

1.3 Host immune response……………………………………………………………21

1.3.1 Adaptive immune response……………………………………………………. 21

1.3.2 Innate immune response………………………………………………………..26

1.3.3 Identification of immunogenic T-cell epitopes ………………………………..28

1.4 Control of PRRSV………………………………………………………………...30

1.4.1 Modified live virus vaccines of PRRSV………………………………………..31

1.4.2 Killed vaccines of PRRSV………………………………………………………33

1.4.2.1 Use of adjuvants in vaccine…………………………………………………...35

1.4.3 DNA or subunit vaccines……………………………………………………….38

1.4.4 Replicating virus vaccines………………………………………………………40

1.5 Introduction to VSV………………………………………………………………42

xvi

1.5.1 Structure of the VSV……………………………………………………………43

1.5.2 VSV transcription and replication……………………………………………..45

1.5.3 Reverse genetics of VSV………………………………………………………..46

1.5.4 Advantages of VSV……………………………………………………………...47

1.5.5 VSV as vaccine vector…………………………………………………………...48

1.6 IRES………………………………………………………………………………..50

1.7 Objectives of the study……………………………………………………………54

Chapter 2 Concurrent but consecutive vaccination of modified live PRRSV-1 and PRRSV-2 provides better protection in nursery pigs……………………………..55 2.1 Summary…………………………………………………………………………...56

2.2 Introduction………………………………………………………………………..57

2.2.1 Rationale of the study…………………………………………………………...59

2.2.2 Hypothesis of the study ………………………………………………………....59

2.3 Materials and Methods……………………………………………………………59

2.4 Results……………………………………………………………………………...70

2.5 Discussion………………………………………………………………………….75

2.6 Acknowledgement…………………………………………………………………79

2.7 Disclosures…………………………………………………………………………79

xvii

Chapter 3: Efficacy of PRRSV-1 & PRRSV-2 killed virus delivered with non-toxic enterotoxin (LT) adjuvant and E. coli expressing immunogenic conserved PRRSV epitopes to induce protective response against PRRSV challenge infection in pigs91

3.1 Summary…………………………………………………………………………...92

3.2 Introduction………………………………………………………………………..93

3.2.1 Rationale of the study…………………………………………………………...96

3.2.2 Hypothesis of the study………………………………………………………….97

3.3 Materials and methods……………………………………………………………97

3.4 Results…………………………………………………………………………….105

3.5 Discussion.………………………………………………………………………..108

Chapter 4: Construction and recovery of recombinant vesicular stomatitis virus expressing PRRSV proteins ………………………………………………………...127 4.1 Summary………………………………………………………………………….128

4.2 Introduction………………………………………………………………………129

4.2.1 Hypothesis of the study………………………………………………………...132

4.3 Materials and methods…………………………………………………………..133

4.4 Results………………………………………………………………………….....140

4.5 Discussion………………………………………………………………………...143

Chapter 5: General conclusion and future directions……………………………..153

Chapter 6: Bibliography…………………………………………………...... 158

xviii

List of Tables

Table 2.1 Strong interference of PRRSV-2 on PRRSV-1 replication in vitro showed by RT-PCR assay…………………………………………………………….……………88

Table 2.2 Details of the primer sequences used in the study……………….………….89

Table 2.3 Experimental design of PRRSV-1 and PRRSV-2 vaccination and challenge study in pigs……………………………………………………………………………90

Table 3.1 Experimental design of PRRSV-1 and PRRSV-2 killed vaccination and challenge study in pigs…………………………………………………………..……125

Table 3.2 Showing the Significant increase in the T-cell subsets by PRRSV specific T- cell epitopes against each of the 12 individual peptides………………………………126

xix

List of Figures

Figure 1.1 Schematic representation of PRRSV genome organization………………….6

Figure 1.2 Schematic representation of PRRS virion representing the orientation of structural proteins surrounding the viral genome………………………………………..6

Figure 1.3 Schematic diagram of Vesicular stomatitis virus showing the surface glycoproteins and the genome…………………………………………………………...43

Figure 1.4 VSV genome organization…………………………………………………...45

Figure 2.1 Schematic representation of experimental design and sampling ……………80

Figure 2.2 Strong interference of PRRSV-2 on PRRSV-1 replication in vitro showed by immunofluorescence assay………………………………………………………………81

Figure 2.3 Quantification of PRRSV genomic copy numbers and live virus in pigs……82

Figure 2.4 PRRSV-1 and PRRSV-2 induced expression of TLRs in pig BAL cells……83

Figure 2.5 Pre-challenge cellular immune response in PRRSV-1 and PRRSV-2 vaccinated pigs…………………………………………………………………………..84

Figure 2.6 Post-challenge cellular immune response in PRRSV-1 and PRRSV-2 vaccinated pigs…………………………………………………………………………..85

Figure 2.7 Post-challenge cellular immune response in PRRSV-1 and PRRSV-2 vaccinated pigs…………………………………………………………………………..86

Figure 2.8 PRRSV neutralization titers in vaccinated and homologous virus challenged pigs………………………………………………………………………………………87

Figure 3.1 Schematic representation of experimental design and sampling………… 113

Figure 3.2 PRRSV neutralization titers in killed vaccine and homologous virus challenged pigs…………………………………………………………………………114

Figure 3.3 Quantification of infectious PRRSV titer in pigs…………………………..115

Figure 3.4 Pre-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs…………………………………………………………………………116

Figure 3.5 Pre-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs…………………………………………………………………………117

Figure 3.6 Pre-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs…………………………………………………………………………118

Figure 3.7 Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs…………………………………………………………………………119

Figure 3.8 Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs…………………………………………………………………………120

Figure 3.9 Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs…………………………………………………………………………121

xxi

Figure 3.10 Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs………………………………………………………………………….122

Figure 3.11 Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs………………………………………………………………………….123

Figure 3.12 Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs………………………………………………………………………….124

Figure 4.1 Construction of plasmids for generation of recombinant VSV expressing PRRSV proteins………………………………………………………………………...147

Figure 4.2 Schematic representation of VSV reverse genetics and recovery of rVSV....148

Figure 4.3 The rVSV plaques morphology and diameter compared to vector VSV…...149

Figure 4.4 The average plaque size of rVSV…………………………………………...150

Figure 4.5 Amplification of PRRSV GP5 and GP3 from recovered viruses…………...151

Figure 4.6 PRRSV protein expression from rescued recombinant viruses……………..152

xxii

Chapter 1

Literature Review

Chapter 1

Literature Review

Porcine reproductive and respiratory syndrome in pigs; prevention, control and

vaccinology

1.1 Introduction to porcine reproductive and respiratory syndrome (PRRS)

PRRS is a viral disease of pigs which causes huge economic losses to the swine industry

worldwide. During 1990 the Dutch pig industry had noticed the sudden outbreak of a

disease among breeding sows and the piglets, commonly called in Dutch as “abortus

blauw”. The affected sows had reproductive failures and blue ears, whereas young

piglets died due to respiratory disease (Wensvoort et al., 1991a). This disease was

called by different names in different parts of the world, like blue ear disease, mystery

swine disease, mysterious reproductive syndrome, swine infertility and reproductive

syndrome, porcine epidemic abortion and respiratory syndrome (PEARS), porcine

reproductive and respiratory syndrome (PRRS), swine infertility and respiratory

syndrome (SIRS) etc., (Collins et al., 1992; Wensvoort et al., 1991a). Finally, the 1992

international symposium on disease in St Paul, Minnesota agreed to use the name

PRRS (Collins et al., 1992), and since then, the Office of International Epizootics (OIE)

has recognized the disease as PRRS.

The causative agent was isolated and characterized for the first time in Europe in

1991 at the Central Veterinary Institute in the Netherlands and the new virus was named

as the Lelystad virus (Wensvoort et al., 1991b). Soon after similar virus was discovered

2 in pigs in Germany (Ohlinger et al., 1991) and in the United States of America (Collins et al., 1992).

1.1.1 Etiology and its evolution

The causative agent, porcine reproductive and respiratory syndrome virus (PRRSV) is a small, enveloped and cytolytic virus with a size of 50-65 nm. The PRRSV has single- stranded, linear, positive sense RNA genome size 15 kilobases. It belongs to the order

Nidovirales, family Arteriviridae, which also includes equine arteritis virus (EAV), lactate dehydrogenase-elevating virus (LDV) and simian hemorrhagic fever virus

(SHFV) (Cavanagh, 1997; Conzelmann et al., 1993; Snijder and Meulenberg, 1998;

Wu et al., 2001). Recently, PRRSV has been regrouped into genus Porartivirus and reclassified into two separate species, PRRSV-1 (formerly named type 1 PRRSV or genotype 1 or European genotype virus) and PRRSV-2 (formerly named type 2 PRRSV or genotype 2 or North American genotype virus), along with two murine arterivirus species lactate dehydrogenase-elevating virus and Rat arterivirus-1 (Adams et al.,

2017b; Kuhn et al., 2016).The PRRSV species share about 63% nucleotide identity and can be distinguished by serology (Allende et al., 2000; Meng, 2000; Nelsen et al.,

1999). Lelystad virus (Wensvoort et al., 1991b) and VR-2332 (Benfield et al., 1992;

Collins et al., 1992) are the prototype strains of PRRSV-1 and PRRSV-2, respectively.

Due to the advancement in global trade, these PRRSV species have been transmitted across the continents and distributed globally. Both strains circulate in the same region and even in the same farm (Goldberg et al., 2003). PRRSV-1 is also found in other parts of the world such as Canada (Dewey et al., 2000) and has emerged in the US

3 herds (Fang et al., 2007; Ropp et al., 2004b). PRRSV-2 has been found in European continents via the introduction of the live vaccine (Nielsen et al., 2001; Nielsen et al.,

2002; Storgaard et al., 1999). RNA viruses undergo a constant mutation that leads to antigenic and genetic variation. PRRSV-1 and PRRSV-2 are constantly evolving at the highest evolutionary rate (on the order of 10-2 /site/year) which helps the virus in evading the vaccine-induced immunity and re-emerging as new variants to cause fresh outbreaks continuously in different countries (Hanada et al., 2005; Morgan et al., 2013).

Highly pathogenic (HP) PRRSV strain was isolated in China and South East Asia (Feng et al., 2008; Tian et al., 2007). New PRRSV isolates of East Europe were analyzed for

ORF5 and ORF7 sequences and grouped into European genotype PRRSV. Further, they were subdivided in to pan European subtype 1, East European subtype 2 and 3.

Another highly pathogenic strain Lena (East European subtype 3 PRRSV) was reported from a Belarusian farm in Eastern Europe (Karniychuk et al., 2010). The genetic differences are not only concentrated in a particular location of the genome but also observed throughout the genome. Substantial sequence variations exists within the

North American genotype which signifies the highly mutagenic nature of the PRRSV

(Nelsen et al., 1999).

1.1.2 Molecular biology of PRRSV

PRRSV belongs to the order Nidovirales. Expression of a nested set of subgenomic

(sg) mRNAs is the prominent feature of viruses in this group (Snijder et al., 2013). The

RNA genome of 15 kb in length contains 11 open reading frames (ORFs), with 3’ polyadenylated tail (AAA) and 5’ cap and untranslated regions (UTRs) at both the ends.

The replicase gene consists of large ORF1a and ORF1b, which accounts for 75% of the genome and encodes two large nonstructural polyproteins, pp1a and pp1b. These polyproteins are translated from viral genomic RNA and further processed by four viral proteases (PLP1α (nsp1α), PLP1β (nsp1β), PLP2 (nsp2) and SP(nsp4) encoded by

ORF1a into 14 nonstructural proteins (NSPs). Recently, two novel proteins nsp2TF and nsp2N were discovered in the central hypervariable region of ORF1a, which were formed due to -1/ -2 programmed ribosomal frameshift (PRF) in a transframe (TF) open reading frame (ORF). This protein consists of two-thirds of the NSP2 protein fused to the C-terminal region and has been shown to be required for efficient growth rate, but not essential for replication (Fang et al., 2012b). ORF1b encodes four highly conserved domains includes, RNA-dependent RNA polymerase (R), multinuclear zinc-binding domain (Z), RNA helicase (H), and NendoU endoribonuclease domain (Ne). Similarly, six subgenomic mRNAs express ORFs 2–7 encoding eight structural proteins, which includes four membrane-associated glycoproteins (GP2a, GP3, GP4, and GP5), three unglycosylated membrane proteins (E, ORF5a and M) and a nucleocapsid protein (N)

(Bautista et al., 1996; Fang et al., 2012b; Firth et al., 2011; Li et al., 2014; Lunney et al., 2016b; Mardassi et al., 1996; Meng et al., 1996; Meulenberg et al., 1995).

Fig1.1: Schematic representation of PRRSV genome organization. Adopted from Lunney et al 2016 with modifications.

1.1.3 Structural proteins of PRRSV

Fig 1.2: Schematic representation of PRRS virion representing the orientation of structural proteins surrounding the viral genome. Adopted from (Music and Gagnon, 2010) with a few modifications

The major structural proteins of PRRS includes GP5, matrix (M) and nucleocapsid (N) which are encoded by ORF 5, 6 and 7, respectively. The minor structural proteins include GP2, GP3, and GP4 derived from ORFs 2, 3 and 4, respectively (Snijder et al.,

2013); and E/2b, 5a encoded by ORF2b and ORF5a constitutes two small non- glycosylated proteins (Johnson et al., 2011; Wu et al., 2001).

GP5 is the most abundant glycoprotein of 24.5 – 26 kDa with putative N-glycosylation sites. It is one of the highly variable structural protein which induces virus neutralizing antibodies. It forms a disulfide-linked heterodimer with M protein and essential for virion formation and infectivity (Dea et al., 2000; Murtaugh et al., 1995a).

The M protein is a major unglycosylated structural protein encoded by ORF6 and having an estimated molecular weight of 18-19 kDa. This protein accumulates in the endoplasmic reticulum of infected cells and forms a disulfide-linked heterodimers complex with GP5 which is crucial for virus infectivity. M protein interacts with the heparin sulfate on the surface of permissive macrophages and GP5 glycosyl residues interact with macrophage sialoadhesin (CD169). M protein plays a key role in virus assembly and budding (Van Breedam et al., 2010).

The N protein is a small, highly basic unglycosylated and phosphorylated structural protein with the estimated molecular weight of 14-15 kDa. It is an abundant protein and constitutes 20 to 40% of the total mass of the virion and it interacts with the RNA genome to form the icosahedral virion core (Dea et al., 2000; Snijder and Meulenberg,

1998). This protein contributes about 40% of the total mass of the virion. Further, it is highly immunogenic, resulting in the induction of large amounts of non-neutralizing

7 antibodies as early as five days post-infection (Lunney et al., 2016b; Murtaugh et al.,

2002). The N protein modulates the host immune response by induction of IL-10 secretion, an immunosuppressive cytokine demonstrated in vitro in cultured porcine peripheral blood mononuclear cells (PBMCs) and porcine alveolar macrophages

(PAMs) which causes immune evasion (Yoo et al., 2010).

The minor envelope proteins include GP2, encoded by ORF2a having a molecular weight of 27-30 kDa. It is a glycosylated structural protein essential for virus infectivity. It appears to associate via covalent and non-covalent interactions to form a heterotrimeric complex with GP3 and GP4 in infected cells. This complex is essential for the transport of these proteins from the endoplasmic reticulum to Golgi apparatus prior to virion assembly (Mardassi et al., 1996; Wissink et al., 2005). The E protein is encoded by ORF2b and it is an unglycosylated and myristoylated structural protein essential for virus infectivity. It is also incorporated into the virion as a multimeric complex and with the help of its ion-channel-like properties it may function as a viroporin in the envelope and facilitates release of the viral genome (Lee and Yoo,

2006; Lunney et al., 2016b).

GP3 is a minor glycosylated structural protein encoded by ORF3 with a molecular weight of 42- 50 kDa (de Lima et al., 2006). It is essential for virus infectivity. It is also the second most heterogenous protein of PRRSV. It is highly antigenic and has virus neutralization activity. A subset of GP3 could be secreted as a non-virion- associated soluble protein (Das et al., 2010; Murtaugh et al., 1995a).

GP4 is a minor glycosylated structural protein encoded by ORF4, with a molecular weight of 31-35 kDa. It is also essential for virus infectivity, viral attachment and it is incorporated into the virion as a hetero-multimeric complex with other minor proteins.

It contains a variable neutralizing epitope but antibodies to this protein are not cross- protective between viral strains (Ropp et al., 2004b; Vanhee et al., 2010). The interaction of the envelope heterotrimer (formed by GP2a, GP3 and GP4) and a macrophage receptor protein CD163 are essential for internalization and uncoating of the virus in macrophages (Das et al., 2011). Another short novel structural protein is designated as ORF5a which is expressed by an ORF that overlaps the 5’ end of ORF.

This protein is a minor unglycosylated hydrophobic structural protein present in low levels in both infected cells and virions (Johnson et al., 2011). This protein is essential for virus viability (Sun et al., 2013a). It has been demonstrated that the three main structural proteins GP5, M, and N are essential for virus particle formation and infectivity. Apart from GP5, minor proteins like GP3 and GP4 also possess virus neutralizing epitopes (Dea et al., 2000).

1.1.4 Genetic and antigenic diversity of PRRSV-1 and PRRSV-2

PRRSV is genetically heterogeneous in nature. The two species of PRRSV share only

60% genetic identify based on their overall nucleotide homology but they have similar biological characteristics (Kim and Yoon, 2008). PRRSV-1 isolates have slowly emerged in US herds (Fang et al., 2007; Ropp et al., 2004b). There are reports available for quasispecies evolution and emergence of a virus subpopulation during inutero infection of pigs with a PRRSV isolate (Rowland et al., 1999). Analysis of the

9 sequences of various PRRSV strains is important to understand the strategies of

PRRSV infection and spread among the interspecies (Goldberg et al., 2003). Therefore, having a quasispecies population during virus infection will affect vaccine efficacy and may lead to vaccine failure (Domingo, 1998; Domingo and Holland, 1992). Hence future investigation of the quasispecies populations may prove beneficial to the field of

PRRSV vaccinology. The relative nucleotide sequence identity between the US isolates

(PRRSV-2) and European (EU) isolates (PRRSV-1) have been compared and found to be 45.7% in ORF1b, 65-67% in ORF2, 61-64% in ORF3, 63-66% in ORF4, and 61-

63% in ORF5. The ORFs 6 and 7 genes exhibited extensive genetic variations between

US and EU isolates, but are relatively conserved among the US isolates or among the

EU isolates (Meng et al., 1995a; Meng et al., 1995b). The ORF1 genomic sequence also differs by 55% nucleotide sequence identity, whereas ORF1b is more conserved and shares 63% nucleotide sequence identity between the US and the EU strains

(Allende et al., 1999; Meng, 2000; Nelsen et al., 1999). The pathogenic PRRSV-2 isolate has its greatest diversity in the NSP2 genome. PRRSV-1 isolates have only about 32% amino acid identity shared in the NSP2 region but they share a 66-75% amino acid identity in ORF1b and 47% amino acid identity in ORF1a compared to

PRRSV-2 (Allende et al., 1999; Meng, 2000).

The GP5 structural protein is the major envelope protein with high variability and is only 50-55% identical between the two genotypes (Mardassi et al., 1995; Meng et al., 1995a; Nelsen et al., 1999). The highly conserved peptide at epitope B of the hypervariable region-1 (HVR-1) of GP5 presumably functions as the major target for

10 neutralizing antibodies (Ostrowski et al., 2002). Some of the factors responsible for the genetic divergence in PRRSV include the lack of proof-reading activities of RdRp and

RNA recombination of PRRSV (Meng, 2000; Yuan et al., 1999).

1.1.5 Antigenic Variation

The differential activity of the monoclonal antibodies (mAb) against the two species of

PRRSV evidently indicates the antigenic variations among the species and strains. Two mAbs VO17 and EP147 to N protein recognize a conserved epitope in PRRSV-1 and

PRRSV-2 (Meng, 2000). However, the N-protein mAb SDOW17 recongizes both

PRRSV-1 and PRRSV-2, and it is commonly used in diagnosis of both PRRSV species, which indicates the presence of a common conserved epitope (Nelson et al., 1993). The reactivity of mAbs against GP3, GP4 and N proteins with PRRSV-1 and 2 strains revealed antigenic differences both within the strains as well as between the strains

(Katz et al., 1995; Wieczorek-Krohmer et al., 1996). Researchers reported that six mAbs raised against British isolates recognized only PRRSV-1 isolates but not

PRRSV-2 isolates (Drew et al., 1995). This antigenic variation is an important factor to be considered during the design of future multivalent vaccine comprising multiple antigenically distinct strains of PRRSV for a promising next-generation vaccine candidate (Meng, 2000).

1.1.6 Genetic recombination and evolution of new strains of PRRSV

Over the past several years, there has been a continual emergence of increasingly divergent and often virulent new strains of PRRSV because of genetic recombination among existing strains. The genetic recombination plays an important role in creating

PRRSV diversity although the relative contribution of recombination in creating

PRRSV diversity is still not clear (Holtkamp and Kliebenstein, 2011; Tian et al., 2007).

There are many instances of recombination occurring between PRRSV field strains of the same genotype, as well as defined coinfection studies in swine and the recombination hot spots are lies in nsp2, nsp9 and within 3’end structural genes (Li et al., 2009b; Liu et al., 2011). Multiple breakpoints of recombination were detected all along the genome of PRRSV-1 and PRRSV-2. Two different co-infecting PRRSV strains of the same genotypes cause inter genomic homologous recombination during negative strand synthesis. Recombinant frequencies up to 10% were noticed and recombination can also be found in animals (Kappes et al., 2015).

The process of recombination explains the noticeable differences in genetic sequence among various isolates of PRRSV, the sudden appearance of atypical or acute or severe form of PRRS and immediate phenotype change in PRRSV. The genetic recombination among the strains of PRRSV occurs frequently and it is a common means by which

PRRSV induces changes in the field conditions. Several experiments were performed in the past to explain the involvement of genetic recombination in the evolution of new pathogenic strains of PRRSV. The identification of recombinants following co- infection of cell cultures with two attenuated strains of PRRSV-2 or PRRSV-1 evolution and predominance of recombinants in pigs when simultaneously exposed to five attenuated strains of PRRSV (Mengeling et al., 2002), showing strong statistical evidence of intragenic recombination (Kapur et al., 1996). Though recombination is a successful event but the predominance (i.e., out-replicate its parents to be the primary

12 or only strain shed from the infected pig) of recombinants in the host for long period created by simultaneous infection of cell cultures with two strains of PRRSV, which apparently disappear from the mixture during additional cell culture passages (Yuan et al., 1999).

PRRSV recombination can be divided into three categories: a) recombination between or among virulent strains b) recombination between or among attenuated strains c) recombination between or among virulent and attenuated strains a) Recombination between or among virulent strains

When pigs infected with two or more virulent strains of PRRSV at or about the same time leads to strain recombination. If both the strains have similar rate of replication, they do co-exist for weeks or months and co-infect the cells to initiate the stage of recombination. However, the emergence of a recombinant as the predominant strain is less common as the parent PRRSV takes an upper hand. On the other hand, if the recombinants have replication advantages with an added level of virulence it might eventually become established in swine population with serious consequences, and thus results in occurrence of atypical PRRS. b) Recombination between or among attenuated strains:

Attenuated strains of PRRSV can recombine in cell cultures and in pigs. Recombinant viruses can predominate in pigs. A recombinant of attenuated parents was tested in pigs. It was found to be somewhat more virulent than its parents, but markedly less virulent than a virulent field strain tested under similar conditions. The recombinant

13 that predominates in its host is likely to be less attenuated than its parent strains which argues against the use of multi-strain PRRSV vaccines despite the potential for such vaccines to stimulate a broader spectrum of immunity (Meng, 2000; Mengeling et al.,

1996). c) Recombination between or among virulent and attenuated strains:

When pigs are vaccinated either at a time when they are already infected with virulent virus, or when they are exposed to virulent viruses, dual (strain) infection occurs. The virulent strains quickly predominate, therefore, dual infection is relatively short-lived.

Hence the chances of recombination between virulent and attenuated strains of PRRSV is less likely than recombination between strains of similar virulence. In case of an occurrence of recombination, the recombinant would out-replicate its virulent parent and would have greater virulence than its virulent parent. This could be due to the gain of competitive advantage by the recombinant through a) the genetically controlled replication and predominance, b) immune selection whereby humoral immunity or cellular immunity or both might be more effective against the parent strains, and c) receptor affinity, whereby the recombinant might be better able to attach or adhere (or both) to susceptible cell receptors - which in turn would likely promote a greater incidence of infection. In China recently a highly pathogenic PRRSV strain emerged during 2013-14 has a very different genetic background due to the recombination of mild virulent strains (NADC30-like PRRSV introduced from North America) and with the classic HP-PRRSV strains which have been circulating in China since 2006

PRRSV outbreaks. The recombined HP-PRRSV has high pathogenicity and mixed

14 genetic background, which merits special attention in control and vaccine strategies

(Ohlinger et al., 1991; Shi et al., 2010b).

There are chances of intra-strain recombination during replication of PRRSV which promote and accelerate the genetic change in much slower pace. Recombination may occur among these putative quasispecies forms due to point mutation during the replication of the PRRSV inside the cell (Rowland et al., 1999).

Previous studies have indicated that recombination could result in large-scale mutation, resulting in new strains of PRRSV evolution (Chang et al., 2002). Two different strains could recombine in MA-104 cells, and the presence of intragenic and intergenic recombination in pigs infected with two different virulent PRRSV (Liu et al., 2011).

PRRSV recombination has increased due to the excessive use of attenuated live virus vaccines and the presence of constant immune system induced selection pressure (Zhou et al., 2009). GDsg is an intragenic recombinant between wild strain QYYZ and attenuated live virus vaccine strain JXA1-P80. A recent report mentioned that the emergence of pathogenic recombinant PRRSV strain GM2 is due to recombination with the MLV strain RespPRRS with wild counterpart QYYZ (Wenhui et al., 2012).

Chinese field strain Em2007 could recombine with vaccine variant HB-1(sh) resulting in increase in virulence through intragenic recombination (Li et al., 2009a). Genetic recombination is an important aspect to be considered in the epidemiology and control of PRRS. PRRSV persists and replicates in an infected pig for 6 or more weeks, which makes it a better candidate for genetic diversity and evolution via recombination. The prevalence of genetic recombination in pig depends on infection with strains of similar

15 virulence or a similar sequence over at least some segments of the genome and ability of the recombinant to demonstrate predominance (Mengeling et al., 2002).

1.1.7 PRRSV virus infectivity and replication

PRRSV displays a very restricted tropism for mononuclear phagocytic cells of myeloid lineage which includes macrophages and dendritic cells. Porcine alveolar macrophages

(PAM) are the primary cell target for PRRSV, and macrophages from spleen, tonsils, lymph nodes, liver, payer’s patches, thymus and progenitor cells in bone marrow are also susceptible (Duan et al., 1997; Morgan et al., 2014; Sur et al., 1996; Wang et al.,

2016). However, lung dendritic cells and peritoneal macrophages from blood are not susceptible (Loving et al., 2007). PRRSV infection is characterized by prolonged acute and persistent infection in pigs due to the development of weak and delayed protective immunity against PRRSV infection. The PRRSV infection is comprised of 3 phases, acute infection, persistent infection and extinction. The acute infection phase lasts for

3 to 4 weeks and is characterized by viremia from 6 to 12 h post-infection, followed by the presence of clinical symptoms and abundant replication of the virus in target cells such as alveolar macrophages and dendritic cells (Allende et al., 2000). The persistent phase is characterized by the replication of the virus in lymphoid tissues, including tonsils and lymph nodes without viremia (Beyer et al., 2000; Rowland et al., 2003).

The virus persists for an extended period of up to 180 days. During this period the virus persists in the lymphoid tissues and can easily spread to uninfected pigs. This phase gives evidence that the innate immune response was compromised, and that B-cell and

T-cell responses are weak. This prolonged PRRSV infection makes it difficult to

16 control PRRSV in field conditions (Wills et al., 2003). Finally, in the extinction phase, the virus is eventually eliminated from the pigs (Linhares et al., 2014; Torremorell et al., 2002) which indicates the development of a delayed immune response in pigs. The reasons for the delayed response could be due to multi-phase of infection, poor induction of innate immune response, delayed production of neutralizing antibodies, or delayed maturation and proliferation of cell-mediated immune response (Lunney et al., 2016b; Sun et al., 2012).

Different cell lines were tested for susceptibility to PRRSV infection in vitro, and only the African green monkey kidney cell line MA-104 and its subclones MARC-145,

CRL-11171 and CRL-2621a are susceptible to infection (Chang et al., 2008; Kim et al., 1993). Among the subclones, MARC-145 is the most widely used cell line. PRRSV enters the host cell by clathrin-mediated endocytosis and the viral genome is released into the cytosol following endosomal acidification and membrane fusion (Nauwynck et al., 1999). The PRRSV infection of cells is mediated by various cellular receptors, heparin sulphate (HS) on the cell surface which serves as an initial binding receptor and binds to GP5-M disulphide linked heterodimer (Delputte et al., 2002), followed by

CD163 mediated viral internalization and disassembly after interacting with the two minor structural proteins GP2a and GP4 (Burkard et al., 2017; Prather et al., 2013).

Vimentin interacts with the nucleocapsid protein helping in opsonizing and endocytosis of the PRRS virion (Kim et al., 2006). Earlier it was reported that CD169 (Sialoadhesin) was involved in the virus attachment and endocytosis (Calvert et al., 2007; Delputte et al., 2007) and MYH9 receptor interacts with the GP5 and helps in endocytosis of virus

(Gao et al., 2016). The E protein is viroporin in nature which helps in the virus uncoating by causing disruption of nucleocapsid interactions with envelope proteins, thus playing a role of an ion-exchange channel (Lee and Yoo, 2006). Viral replication occurs in the cytoplasm of the host cell (Benfield et al., 1992). Initially, genome translation yields replicase polyproteins pp1a-nsp2TF, pp1a-nsp2N, pp1a, and pp1ab.

These polyproteins are cleaved by viral internal proteinases to generate at least 14 nonstructural proteins (Lunney et al., 2016a; Snijder and Meulenberg, 1998), which are assembled into a replication and transcription complex (RTC) (Van Der Meer et al.,

1998). The RTC synthesizes a negative sense RNA (antigenome) which is used as the template for genomic copies for the progeny virions to produce both single-strand full- length and subgenomic (sg) length minus strand RNAs. Subsequently, the sg mRNAs serve as templates for the synthesis of plus strand sg mRNAs which are then translated into viral structural proteins (Meulenberg et al., 1993a). Assembly and packaging of the virion particles occur in the endoplasmic reticulum and/or Golgi complex. The membrane proteins localize to the endoplasmic reticulum while the genome is encapsulated by the nucleoproteins in the cytoplasm. The nucleocapsid then buds into the endoplasmic reticulum or the Golgi apparatus, where the virion acquires its lipid envelope, complete with glycoproteins correctly modified, and the progeny virion is then released from the cell via exocytic pathways/intracellular vesicles (Lunney et al.,

2016b; Wissink et al., 2005).

1.1.8 PRRSV transmission and clinical symptoms

Swine are the only natural host for PRRSV. Transmission of PRRSV occurs by the respiratory and oral route through mucosa or percutaneously. The virus transmits through direct contacts of infected pigs and through semen or indirectly through fomites or personnel between swine populations (Pitkin et al., 2009). The infected pigs excrete the virus at low level or intermittently in all body secretions like saliva, nasal secretions, urine, milk, colostrum, feces and semen (Albina, 1997; Christopher-

Hennings et al., 1998; Rossow et al., 1994; Voicu et al., 1994; Wagstrom et al., 2001;

Zimmerman, 2003). PRRSV is also reported to be airborne transmitted (short or long distance) (Otake et al., 2010) and vertically transmitted during the last trimester of gestation (Christianson et al., 1993; Pileri and Mateu, 2016a).

The clinical symptoms of PRRS appear mainly in two forms, respiratory and reproductive (Wensvoort et al., 1992). The respiratory signs are observed in pigs of all age groups and are clinically characterized by pneumonia, dyspnoea (thumping), fever, anorexia, listlessness, reduced feed and water intake with recurring chronic illness; followed by physical debilitation leading to high mortality due to secondary bacterial infection if the clinical signs do not subside quickly. On the other hand, reproductive symptoms include reduced conception rate, late-gestation abortions, early or delayed farrowing with dead and mummified fetuses, stillborn pigs and weak-born pigs. In severe cases, abortion storms with significant piglet mortality during the last term of pregnancy and may even end up in the death of infected sows. An increase in repeat breeders during the acute phase of the epizootic is commonly reported. Transient fever

19 and anorexia may be observed in boars, gilts, and sows (Mengeling et al., 1998;

Meulenberg, 2000; Rowland, 2007).

1.2 Economic importance of PRRSV

PRRSV continues to be a threat to the swine industry worldwide since the isolation of the etiological agent, which costs US swine industry at least $600 million annually

(Holtkamp and Kliebenstein, 2011; Miller, 2011). The estimates of the impact on the

UK pig industry was ₤52,180 (due to respiratory disease) and ₤93,590 (due to reproductive failure) per herd of 500 animals (Richardson, 2011). Since the simultaneous emergence of PRRSV in US and Europe during late 1980’s and early

1990’s, virus has spread throughout the continents and cause diseases in most of the swine producing countries of the world (Wensvoort et al., 1991c). According to the US

Animal and Plant Health Inspection Service (APHIS) report (January 2009), more than half of the unvaccinated swine farming sites from all the five regions in the US (North,

South, West Central, and East Central) are seropositive for PRRSV antibodies and nearly 49.8% of unvaccinated pigs are seropositive to PRRSV, suggesting the widespread prevalence of PRRSV in the US.

Major economic losses to the pork industry due to PRRS is mainly due to reproductive failures in pregnant sows/gilts, and the disease adversely affects the breeding stock causing abortions, still births, stunted fetal growth and decreased weight gain, and in grower and finisher herds it causes reduced growth performance. In sows, the virus causes infertility, abortions, and high mortality in pre-weaned piglets. On the other hand, in the nursery and finisher pigs, economic losses are mainly attributed to

20 increased morbidity and mortality rates, decreased appetite and diminished feed intake, delayed growth rate and increase in unmarketable pigs. Broadly the losses to swine industry due to PRRSV infection can be attributed to decline in average daily weight gain and feed efficiency in growing pigs costing the US $250 million (45%). Mortality in growing pigs costs the US $243 million (43%) and reproductive losses costs the US

$63 million (12%) (Neumann et al., 2005). The economic loss to the pork industry due to PRRSV is increasing over the years. The estimated loss only includes costs related to PRRS vaccination, treatment, diagnostics and biosecurity; collectively, responsible for close to $3 million loss daily, and approximately 1 billion USD per year to the US

Pork Industry. However, indirect costs would add up a couple more hundred million dollars (Holtkamp et al., 2013).

1.3 Host immune response

PRRSV infected pigs elicit weak, delayed immune response against PRRSV infection.

The reasons for the delayed response could be due to multi-phase of infection, poor induction of innate immune response, delayed production of neutralizing antibodies and delayed maturation and proliferation of cell-mediated immune response (Lunney et al., 2016b; Sun et al., 2012).

1.3.1. Adaptive immune response to PRRSV

1.3.1.1 Antibody-mediated immune response to PRRSV infection

PRRSV infection in pigs stimulates the antibody response by 7-9 days post-infection but not enough to insure enough virus neutralizing antibodies to protect against the infection. PRRSV-neutralizing antibodies (NAbs) appear only at later times post-

21 infection (≥ 4 weeks) (Labarque et al., 2004; Loemba et al., 1996), indicates the polygonal B-cell activation occurs especially in tonsils (Lamontagne et al., 2001).

PRRSV nucleocapsid protein carries the highest immunogenic properties among all the

PRRSV proteins. Anti-N antibodies detected in the early stage of infection (viremic phase) are non-neutralizing and do not correlate with protection (Lopez et al., 2007;

Lopez and Osorio, 2004). Induction of low levels of non-NAbs followed by the delayed

NAbs helps in internalization of the virus particles into macrophages (Diaz et al 2006).

PRRSV NAbs play an important role in protecting pigs against re-infection of PRRSV.

NAbs transferred through serum showed the passive protection. High titered

NAbs which are passively transferred from pregnant sows to the offspring provide protection against PRRSV infection and help to block transplacental PRRSV infection

(Lopez et al., 2007; Osorio et al., 2002). NAbs transfer from sows to their offspring through the colostrum and milk provide sterilizing immunity in the newborn piglets.

NAbs also appear in sera and bronchoalveolar (BAL) fluid and help in the clearance of

PRRSV infection in the lungs of infected pigs (Labarque et al., 2004). PAM and

MARC-145 cells are prone to secondary PRRSV infection even after treatment with antibodies generated from the first infection in pigs in in vitro studies (Nelson et al.,

1994; Yoon et al., 1994; Yoon et al., 1995). However, supplementation of NAbs helps in blocking viral attachment and internalization and suppresses the viral infectivity in pre-infected PAM and MARC-145 cells (Delputte et al., 2004).

Viral epitopes reside on the GP2a, GP3, GP4, GP5 and M proteins which are also capable of inducing NAbs (Ostrowski et al., 2002; Plagemann, 2006; Ropp et al.,

2004b; Yang et al., 2000). The major neutralization epitopes of PRRSV are located in the middle of GP5 ectodomain, hence NAbs against GP5 are relevant for protection against PRRSV-1 and PRRSV-2 (Plagemann, 2006). M protein also contains two neutralizing epitopes and the GP5-M interaction is used while construction of a DNA vaccine, but NAbs titers induced by such vaccines are low (Jiang et al., 2006a).

Interestingly, GP3-specific antibodies have the PRRSV neutralizing ability due to its characterization as an NSP in some PRRSV-2 isolates, as well as a structural protein in some PRRS-1 isolates (Meulenberg and Petersen-den Besten, 1996). GP4 protein of

PRRSV-1 also contains a neutralizing epitope (Vanhee et al., 2010).

Potential mechanisms for delayed NAbs in PRRSV infection is due to a) glycan- shielding effect of N-linked glycosylation in GPs (Ansari et al., 2006; Lunney et al., 2016b), b) antibody-dependent enhancement of viral entry into target cells is facilitated by PRRSV isolates (Cancel-Tirado et al., 2004; Yoon et al., 1997), c) prevention of normal B-cell repertoire development (Butler et al., 2001). d) suppression of innate immune responses, e) presence of immunodominant decoy epitope in GP5 upstream of the neutralizing epitope. The GP5-based neutralizing epitope of PRRSV-

2 denoted as epitope B is highly conserved (Ostrowski et al., 2002; Plagemann, 2006) but the presence of an immunodominant non-neutralizing decoy epitope, epitope A, interferes with the immune response to epitope B (Fang et al., 2006a). However, the proximity of epitopes A and B is a compulsory requirement in delayed NAb response

(Fang et al., 2006a).

The virulent strains of PRRSV have a higher level of viral replication and elicit more intense and rapid antibody response in vivo. Hence the level of antibody response is also linked to the level of viral replication and potential abundance of a viral antigen

(Johnson et al., 2007). Low levels of virus replication are found in lungs and lymphoid tissues even in the presence of the Nabs, suggesting the involvement of other immune responses like T-cell immune response for the complete clearance of PRRSV infection

(Labarque et al., 2000).

1.3.1.2 Cell-mediated immune response to PRRSV infection

In PRRSV infected pigs, virus-specific IFN-γ secreting T cells (SC) are considered important effector cells of anti-viral cell-mediated immunity (CMI). CMI is also delayed and takes up to four weeks post-PRRSV infection, along with a weak lymphoproliferative response (Bautista and Molitor, 1997; Lopez Fuertes et al., 1999;

Meier et al., 2003). This belated response was observed upon infection with both

PRRSV- 1 and PRRSV- 2 (Diaz et al., 2005; Meier et al., 2003). The PRRSV specific

T-cell response is characterized by secretion of IFN-γ to a large extent and IL-2 to a lesser extent (Lopez Fuertes et al., 1999), detected between 4 and 12 weeks post- infection, but the levels induced are not effective in preventing the infection leading to the establishment of viral persistence (Batista et al., 2004; Lowe et al., 2005). IFN-γ and IFN-α play a major role in the induction of the CMI response against PRRSV infection, and IFN-γ is known to inhibit PRRSV replication in vitro (Bautista and

Molitor, 1999; Rowland et al., 2001). Porcine IFN-α is a major type I IFNs encoded by up to fifteen functional genes and contributing to the induction of T cells to become

IFN-γ SC (Cousens et al., 1999; Kadowaki et al., 2000). PRRSV has the ability to impair IFN-α production hence this could affect the induction of T-cells and responsible for the initial weak IFN-γ response. The positive feedback mechanism by the induction of just a few IFN-γ-SC could subsequently induce naive T cells into IFN-

γ-SC and gradually increase the IFN-γ-SC population (Meier et al., 2003). A recent study showed that a highly pathogenic PRRSV-1 subgenotype 3 strain (Lena strain) induces a higher percentage of CD8+ T-cells and much stronger IFN-γ response than classical strains, and this response was associated with an early inflammatory response induced by IFN-γ leading to more severe disease, gross pathology and enhanced clearance of the virus (Amarilla et al., 2015; Morgan et al., 2013; Weesendorp et al.,

2013). In PRRSV infected pigs immune responses areevident in immune cells ex vivo upon restimulation using various virus isolates, measured by delineating the immune cell phenotypes secreting IFN-γ responsible for mounting CMI response. CD4 T cells drive the proliferative response (Molitor et al., 1997) whereas both CD4 and CD8 T cells produce IFN-γ over the course of infection (Morgan et al., 2013). Following

PRRS-MLV vaccination, secretion of IL-10 appears to be inversely proportional to

IFN-γ secretion. These results collectively indicate an involvement of poor T cell immunity with IFN-γ secretion at low levels and IL-10 at high levels helping the development of weak cell-mediated immunity against PRRSV (Diaz et al., 2006). The virus appears to utilize multiple strategies for its survival within its host, such as quasispecies variation, reduced secretion of IFN-α in infected cells, lack of expression of viral proteins ADE, decoy epitopes, glycan shielding of NE etc., (Darwich et al.,

2010). T cell response against PRRSV proteins were also evaluated and among the

PRRS proteins M protein is the strongest inducer of a lymphoproliferative response

(Bautista et al., 1999). GP5 and N are inducers of T cell proliferation, and GP3 was shown to induce T cell proliferation in mice (Jiang et al., 2007).

1.3.2 Innate immune response

The first line of innate immune response against any viral infection is the production of type I interferons (IFNs), IFN-α/β, an essential component of the antiviral innate immune system. The secreted IFN slows down or even blocks virus replication, further aiding in the establishment of an adaptive immune response (Thiel and Weber, 2008).

PRRSV infection causes a prolonged persistent infection in infected pigs, which could be due to the weak innate immune response elicited. Coordinated early expression of interleukin (IL)-1β, IL-8 and IFN-γ have been reported in pigs that are able to clear the virus (Lunney et al., 2009). Different virus strains or clones of the same isolates induce different cytokines, IFN-α (Lee et al., 2004; Wang et al., 2013c), IL-10 and the tumor necrosis factor alpha (TNF-α) (Gimeno et al., 2011). IFN-α secretion is crucial for downstream regulation of an immune response which induces NK cell activation, induction of monocyte to DC differentiation and maturation, activation of naive T cells and memory T cell proliferation. PRRSV downregulates the IFN-α response in infected pigs (Loving et al., 2007; Van Reeth et al., 1998). PRRSV impairs TNF-α production both in the lung of the infected pig (Van Reeth et al., 1999) and at the cellular level in

PAMs in vitro (Chiou et al., 2000; Thanawongnuwech et al., 2001). TNF-α has a negative effect on PRRSV (Chang et al., 2005), TNF-α and IFN-α do not work

26 synergistically to downregulate viral replication (Lopez-Fuertes et al., 2000).

Downregulation of this early innate cytokine production in macrophages and dendritic cells contributes to the weak innate immune response, delayed neutralizing antibodies, slow IFN-γ response and a depressed cytotoxic T cell response, resulting in incomplete clearance of the virus from the body (Costers et al., 2009). Natural killer cells are responsible for innate antiviral cytotoxic activity and IFN-γ production. They are suppressed in PRRSV infected pigs (Jung et al., 2009; Renukaradhya et al., 2010). This impairment of NK cell responses could contribute to the failure of the innate immune response to effectively control PRRSV infections. IL-10 is the most debated cytokine in PRRSV immunomodulation. It is secreted by activated Th2 cells, B cells, and macrophages, and it is known to regulate cell-mediated immune responses, promote the proliferation and antibody production by B cells and inhibit production of proinflammatory cytokines, which seems to rescue cells from apoptosis [reviewed in

(Cohen et al., 1997; Moore et al., 1993). Increased levels of induction of immune suppressive and Th2 cytokines such as IL-10, TGF-β and IL-4 by the virus have been implicated in possible mechanisms of immune evasion. Upregulation of IL-10 may contribute to downregulation in the production of inflammatory cytokines and the Th-

1 response during PRRSV infection (Diaz et al., 2006; Silva-Campa et al., 2009;

Thanawongnuwech et al., 2001). PRRSV also modulates host cell receptors.

Transfection of CD163 into non-PRRSV permissive cell lines allow them to become infected by both PRRSV species showing that CD163 expression is essential or sufficient to allow PRRSV infection. However, IL-10 can induce the expression of

CD163 (Patton et al., 2009) indicating that PRRSV may enhance the availability of susceptible host cells through induction of IL-10. Replication of PRRSV in pig monocyte-derived dendritic cells (DCs) induces apoptosis, downregulate the expression of CD11b/c, CD14, costimulatory molecule CD80/86 and major histocompatibility complex (MHC) class I and II molecules, resulting in reduced allogeneic stimulation of T cells. Further, during the early stages of the infection,

PRRSV induces an anti-apoptotic state in infected macrophages and DCs (Costers et al., 2008; Flores-Mendoza et al., 2008). Viral antigenic proteins are retained inside the infected macrophages and accumulate at the budding site. As a result, infected cells are not exposed to PRRSV-specific antibodies and thus turn the infected cell refractory to antibody- and complement-mediated cell lysis (Costers et al., 2006). This contributes to the PRRSV immune invasion and contributes to the persistence of infection.

1.3.3 Identification of immunogenic T cell epitopes

It is still not clear whether conserved T-cell epitopes might provide cross-protection against different PRRSV strains. Several studies have described the identification of potent T-cell epitope targets which can elicit strong CMI response, as most of the T- cell epitopes have not yet been identified at amino acid level. Determination of T-cell epitopes is an expensive and cumbersome task due to lack of a systematic approach based on the synthesis and testing of large sets of overlapping peptides. Recently, researchers synthesized entire GP5 proteins and tested their ability to induce IFN-γ production. Researchers identified two distinct regions (amino acid residues 117-131 and 149-163) on GP5 of PRRSV-2 that appear to contain immune dominant T-cell

28 epitopes (Vashisht et al., 2008). Using a bioinformatics approach along with the

ELISpot assay two distinct regions on the GP5 amino acid sequence from PRRSV-1 and PRRSV-2 were detected (Diaz et al., 2009). In addition, one study reported the identification of four T-cell epitopes located on the membrane (M) protein of PRRSV

(Wang et al., 2012). Four epitopes were identified on the N protein, two on GP4 and one large immune dominant region on GP5. It was also concluded that the N protein elicited the greatest T-cell response followed by GP5 and then GP4. Taken together these reports illustrate an invigorated interest in achieving a more detailed picture of the cell-mediated protective immunity against PRRSV (Vashisht et al., 2008). In the case of other highly diverse and variable RNA viruses such as hepatitis C virus (HCV)

(Martin et al., 2004) and HIV (Dewey et al., 2000) highly conserved T-cell epitopes are responsible for broad protection through CMI response. Such conserved regions are often present in the NSPs of these RNA viruses that are synthesized early during the life cycle of the virus. These NSPs typically constitute structurally constrained and conserved proteins involved in replication of the virus. Thus, it has become essential to determine T-cell epitopes in those proteins and vaccinate PRRSV infected pigs with those conserved epitopes to develop cross-protective immunity.

In our present study, we have utilized 12 PRRSV specific consensus T-cell epitope from PRRSV-1 and PRRSV-2 species as an oral boost to enhance the PRRSV strain- specific immune response in killed vaccine administered pigs.

1.4 Control of PRRSV

PRRSV is constantly evolving to adapt to the existing immunity and re-emerging as new variants which escape from the host immune response to cause new outbreaks continuously (Morgan et al., 2013). Control of PRRSV infection is a complex phenomenon comprising of at least 4 different line of action: diagnosis, monitoring and herd management, biosecurity and immunization. Presently, PRRSV control and elimination models are included in multiple herds namely, a) herd closure with total/normal herd replacement (involves prevention of inclusion of new animals) followed by vaccination of the herd keeping it in isolation until the virus clears out from all animals (typically about 200 days); b) depopulation/repopulation (involves complete removal of PRRSV-positive animals from a herd, cleaning and decontaminating the site, then replacing with PRRSV–negative animals bred elsewhere) (Corzo et al., 2010; Perez et al., 2015); and c) load, close, homogenise/expose (LCH) model, which allows the PRRSV status to stabilize in a breeding herd before introduction of new PRRSV-negative animals (Linhares et al.,

2015). Each model has both merits and demerits. Depopulation/repopulation programs are effective but expensive because of requirements for large external breeding projects and loss of productivity after depopulation (Holtkamp et al., 2013), whereas LCH model helps in complete elimination of PRRSV in less time, it is inexpensive and is a very effective model but demands stringent biosecurity measures to prevent virus transmission within the herd (Desrosiers, 2011; Rathkjen and Dall, 2017; Torremorell et al., 1997).

Further PRRSV outbreak check will be done by using the active and passive surveillance methods and the suspected cases will be confirmed by laboratory tests, immunohistochemistry and RT-PCR. As per the OIE Ad Hoc Group on PRRS, 2008, upon confirmation of positive PRRSV infection, quarantine measures will be imposed and pig movement will be restricted. Good biosecurity measures, like perimeter fences,

PRRSV negative pigs introduction into herds, minimal visitors, regular disinfection of equipment and vehicles, personal hygiene, use of air filtration methods, etc., will be adopted to prevent further spread of PRRSV infection in endemic areas (Alonso et al.,

2013). In reality, these measures are not always enforceable and protective in areas of small farming, especially in developing countries and in village farms rather than the larger commercial facilities. Despite these challenges, vaccination is a popular method of controlling PRRS and reducing losses caused by it. Multiple vaccines are commercially available (Rathkjen and Dall, 2017).

Control of PRRSV by vaccination

Multiple vaccines have been in use to control PRRS since the discovery of PRRSV in

1991. Vaccines which are available commercially include modified live vaccines, killed virus vaccines, DNA vaccines and recombinant DNA vector vaccines (Kimman et al., 2009), but these vaccines are not always efficacious in protection against infection from a wide array of heterologous PRRSV in the field conditions.

1.4.1 Modified live virus vaccines against PRRSV

The first commercial modified live-attenuated PRRSV vaccine (PRRSV-MLV) was licensed in the US in 1994 and later released in various other countries using the

31 circulating viral genotype and popular viral strain. PRRSV-MLVs confer late but effective protection against homologous strains and confer partial protection or no protection against heterologous strains (Charerntantanakul, 2012; Park et al., 2012;

Renukaradhya et al., 2015b). Earlier live virus immunization was in practice during the replacement of gilts into the PRRSV positive herds. Though this method was beneficial, but it posed a potential risk of reversion of live virus to virulence, lack of cross-protection and dissemination of virus to adjacent naïve farms (Mengeling, 2005;

Renukaradhya et al., 2015b). Previous studies have reported the moderate efficacy of

PRRS-MLVs in reducing the clinical disease and severity, conserving body weight, reducing lung lesions, as well as reducing the duration of viremia and virus shedding

(Cano et al., 2007; Ellingson et al., 2010; Labarque et al., 2003; Murtaugh et al., 2002).

However, they failed to completely prevent respiratory infection, transplacental transmission and horizontal transmission of the virus (Osorio et al., 2002), and are incapable of providing long-term protection against PRRSV infection (Diaz et al.,

2006; Labarque et al., 2004; Prieto et al., 2008; Zuckermann et al., 2007). PRRSV-

MLVs are of partial help in controlling the co-infection of PRRSV-1 and PRRSV-2 in the same herd. Concurrent vaccination of nursery pigs with both species PRRSV reduced the PRRSV-1 but not PRRSV-2 viremia in dually infected pigs (Park et al.,

2015a). In another study, concurrent vaccination of boars with PRRSV-1 and PRRSV-

2 reduced shedding of both species of virus in semen (Jeong et al., 2017a).

Besides efficacy, safety is a concern while using PRRSV-MLVs. MLV vaccinated pigs develop viremia up to 4 weeks after immunization. The virus replicates inside the

32 host and spread the vaccine virus to healthy pigs (Nielsen et al., 2002). It may result in reversion to virulence and leads to outbreaks in the vaccinated herds

(Charerntantanakul, 2012; Wang et al., 2013b; Wang et al., 2010). Use of PRRSV-

MLVs in endemic areas results in recombination between MLVs and wild-type viruses contributing to the viral evolution and emergence of recombined and quasispecies viruses. Evaluation of the novel variant in China has been shown to be the result of recombination between highly pathogenic PRRSV-2 strains and vaccine strains (Li et al., 2009b; Shi et al., 2013). Genetic and phenotypic characterization of isolated field strains suggests the reversion to virulence seen in both PRRSV-1 (Storgaard et al.,

1999) and PRRSV-2 (Allende et al., 2000). PRRSV-MLVs are also responsible for the antibody-dependent enhancement (ADE) of the infection. Studies have reported that non-neutralizing antibodies generated within first 4 weeks after MLV vaccination are responsible for enhanced internalization of the virus by macrophages which leads to

ADE phenomenon (Yoon et al., 1996; Yoon et al., 1997). In addition, there will be difficulty in distinguishing wild-type strains and MLV in vaccinated animals (DIVA) which raise concerns about safety of MLV vaccines and warranting the need for better vaccine candidates (Kim et al., 2008).

1.4.2 Inactivated/Killed vaccines

In contrast to PRRSV-MLVs, inactivated vaccines are very safe but there is a debate over their efficacy which is less than the ideal. The killed vaccines generally offer very little or no protection against heterologous pathogenic challenge virus (Zuckermann et al., 2007). They lack detectable production of PRRSV-specific antibodies (Kim et al.,

2011) and lack of induction of CMI (Bassaganya-Riera et al., 2004; Piras et al., 2005).

Killed virus vaccination against homologous PRRSV challenge induced weak PRRSV specific NA titers (<3 log2) and could not efficiently clear the virus in vivo (Nilubol et al., 2004; Zuckermann et al., 2007). However, commercial killed vaccines reduce pre- weaning mortality of piglets born to vaccinated sows, but fails to provide cross- protection against PRRSV infection as evident from clinical signs, reproductive failure, congenital infection in the offspring, magnitude of viremia and shedding of virus in semen against homologous challenge in pigs (Nielsen et al., 1997; Scortti et al., 2007).

Some preparations of inactivated vaccines without adjuvants induce virus neutralizing antibodies, but the vaccines offer only partial protection upon challenge (Kim et al.,

2011; Vanhee et al., 2009). Whereas, inactivated PRRSV administered along with an oil adjuvant induced CMI response against homologous virus challenge (Piras et al.,

2005). Hence several attempts were made to enhance CMI response and humoral immune response of killed vaccines against homologous or heterologous challenge with or without adjuvants. Killed PRRSV vaccine enhances specific antibody and T- cell responses when administered with adjuvants CpG ODN (TLR-9 ligand) and oligodeoxynucleotides containing synthetic immunostimulatory motifs (Zhang et al.,

2006, 2007). Killed vaccines induce PRRSV-specific NA response and protective immune response against homologous challenge after inactivation with UV light or binary ethylenimine (which preserve the virus-NA specific response) and co- administered with incomplete Freund’s adjuvant (Darwich et al., 2010; Vanhee et al.,

2009).

Further, to increase the potency of killed vaccines different delivery routes were proposed along with suitable delivery systems. Oral delivery of PRRSV nucleocapsid conjugated to cholera toxin enhances virus-specific local intestinal mucosal antibody response (Hyland et al., 2014; Renukaradhya et al., 2012). Intranasal delivery of poly(lactic-co-glycolic) acid nanoparticle entrapped inactivated PRRSV vaccine along with a potent adjuvant, whole cell lysate of Mycobacterium tuberculosis, elicits broadly protective PRRSV specific immune response against a challenge heterologous PRRSV

(Binjawadagi et al., 2014a; Binjawadagi et al., 2014b). Hence there is a scope for improving the efficacy of killed vaccines by using a novel formulation strategy, combined with novel adjuvant systems or by using novel vaccine delivery systems.

1.4.2.1 Use of adjuvants to potentiate PRRSV vaccines

Poor immunogenicity and weak protective efficacy are the major problems of existing

PRRSV vaccines. Many vaccine adjuvants are in use along with the existing vaccines to enhance immune response of PRRSV vaccines. Some of the vaccine adjuvants namely, cytokines, chemical adjuvants, bacterial toxins etc., having the T-helper cell

(Th1)/Th2 inducing properties through activation of APCs and secretion of proinflammatory cytokines were shown to enhance immune response with increased vaccine efficacy.

Use of cytokines in combination with killed PRRSV vaccine acts synergistically to enhance the T-cell response and increase cross-protective efficacy. IL-1 and IL-6 enhance proliferation of thymocytes and peripheral blood T-cells (Dinarello, 1994). IL-

2 acts as the genetic adjuvant to enhance Th1 response to PRRSV DNA vaccines by

35 promoting proliferation and NK cell activity (Knoblock and Canning, 1992). The IL-2

DNA cloned into a plasmid expressing PRRSV ORF5 (ORF5/IL-2), ORF7/IL-2 reduces viral load in a homologous challenge study in pigs (Xue et al., 2004). When pigs were vaccinated with IL-2 and ORF-7 expressed plasmids separately, increased

T-cell proliferation was detected in a recall response (Rompato et al., 2006). IL-4 enhances the Th2 response and acts as a genetic adjuvant. Plasmids expressing cytokines IL-4 and IFN-γ in combination with GP5 (ORF 5) and N (ORF 7) enhance

PRRSV specific T-cell response and reduce the PRRS viremia in pigs. Whereas plasmids expressing IL-4 along with GP5 and N protein suppress the T-cell response in pigs (Rompato et al., 2006; Xue et al., 2004).

1.4.2.1 Bacterial Toxins as adjuvants

Bacterial toxins and products help in activation of antigen presentation by APCs required for T-cell stimulation and for enhancing the immune responses. The bacterial toxins interact with the GM1 gangliosides on APC surface, enhances cAMP production resulting in activation of downstream transcription factors (Lavelle et al., 2004).

Cholera toxin (CT) in pigs induces an immune response (Foss et al., 2002). While recombinant CT-A1-deleted peptides along with PRRSV N peptides delivered orally stimulates robust PRRSV specific IgG response with slightly enhanced mucosal IgA response, but it does not elicit the CMI response (Charerntantanakul et al., 2006;

Hyland et al., 2004).

E. coli heat labile (LT) adjuvant

Enterotoxigenic bacteria generates two types of toxins, heat stable and heat-labile toxins. The heat-labile enterotoxin of E. coli (LT) is the potent mucosal immunogen and the immunoadjuvant which enhances mucosal IgA and systemic antibody responses when co-administered with antigen (Snider, 1995). LT toxin has two subunits, A subunit (LTA), includes ADP-ribosylation activity, and B subunit (LTB) a homopentamer, binds to the cell receptors on the surface of eukaryotic cells (Merritt et al., 1994; Sixma et al., 1992). Use of LT as an adjuvant remains limited due to toxicity of its LTA subunit (Williams et al., 1999), hence the production of LTB lacking LTA alone has potent mucosal immunogenicity mediated by pentameric association of B subunit with the cell receptors in general and GM1 in particular (Dickinson and

Clements, 1995; Spangler, 1992). Thus, several expression systems have already been applied for the production of recombinant LTB, including E. coli (de Geus et al., 1997);

Mycobacterium bovis (Hayward et al., 1999); Lactobacillus brevis (Goto et al., 2000);

Staphylococcus xylosus (Liljeqvist et al., 1997); Pichia pastoris (Fingerut et al., 2005);

Saccharomyces cerevisiae (Rezaee et al., 2005); and plants (Haq et al., 1995).

Alternatively, genetically detoxified derivatives of LTB fused to heterogenous epitope are all successful in some cases with the limitation of size and type of antigen that can be attached to the LTB by genetic fusion (Dertzbaugh and Elson, 1993;

Sandkvist et al., 1987). Internalization of exogenous antigen by LTB suggests the carrier function of LTB which directly delivers the antigen into mucus associated lymphoid tissues (MALT). LTB also enhances the amount of antigen delivery to the

MALT inductive sites and in turn stimulation of antigen-specific B- and T-

37 lymphocytes (Nashar et al., 1993), promotes Th1 and Th2 cytokines response (Nashar et al., 1996), modulates mucosal immune response through lymphocyte apoptosis

(Truitt et al., 1998) and expression of B-cell activation molecules (Nashar et al., 1997).

The vaccine adjuvant effect of LTB in the genetically fused chimeric antigens using the envelope glycoprotein E2 of Classical swine fever virus is found to induce mucosal and systemic immune responses in the gut.

The mutant subunit of LTB like LTA72R and LTR192G are the most promising mucosal adjuvants. LTR192G mutant has a single amino acid substitution at the trypsin-sensitive loop of the LTA subunit, which renders LT resistance to trypsin- mediated cleavage and provides strong mucosal adjuvanticity (Choi et al., 2007). A panel of LT toxin double mutants also has been evaluated for adjuvanticity in New castle disease vaccines (NDV) in inducing the local mucosal immune response.

Previously LT adjuvants have been successfully used to enhance the mucosal immune response to various pathogens causing respiratory diseases (Cheng et al., 1999;

Zhang and Francis, 2010b; Zhang et al., 2010b). In this study, we adopted E. coli LT as a mucosal adjuvant to enhance an immune response to killed PRRSV vaccine administered systemically and LT genetically linked to PRRSV multi epitopes to construct LT-Fusion antigen as an oral boost and evaluated the immunogenicity against

PRRSV challenge in nursery pigs.

1.4.3 DNA and subunit vaccines

In addition to the existing MLVs and inactivated vaccines against PRRSV other novel vaccine design strategies were attempted, including coadministration of various

38 adjuvants, DNA vaccines, subunit vaccines, recombinant DNA vector vaccines, replicating virus vector vaccines etc. These approaches have been in use to develop next-generation vaccines which can confer broad protection against PRRSV.

Various DNA vaccines studies have been conducted and in a few of the trials observed satisfactory protection. Immediately after identification of PRRSV, baculovirus expressed PRRSV structural proteins were used as subunit vaccines against

PRRSV infection, but these vaccines induced only partial protection (Plana-Duran et al., 1997). Among the plasmid DNA vaccines expressing the GP5 structural protein

(ORFs 5) and Nucleocapsid (N) protein (ORFs 7), GP5 expressing plasmid conferred partial protection from infection in pigs (Pirzadeh et al., 1998). Plasmids co-expressing

GP5 and M increases the magnitude of CMI and humoral immune responses more than plasmids expressing only GP5 or M alone (Jiang et al., 2006b). The plasmid expressing

GP5 in combination with IL-18 enhances T cell proliferation responses, increases

CD4(+) and CD8(+) IFN-g responses, but was not comparable to a live vaccine (Zhang et al., 2013). Plasmid co-expressing cytotoxic T lymphocyte-associated protein 4

(CTLA4) and GP5 enhances both antibody and T cell responses in mice (Wang et al.,

2013c), whereas a plasmid co-expressing swine ubiquitin and GP5 could improve only

T cell but not antibody response (Hou et al., 2008). In a recent study, immunization of pigs with GP5 mosaic T-cell DNA vaccine (codon optimized mosaic sequence based on 748 independent PRRSV GP5 sequences) evokes PRRSV specific antibody and

IFN-g mRNA expression but still not enough for complete protection. In a prime-boost immunization study, preimmunization of DNA vaccine containing truncated N protein

39 followed by MLV immunization enhances PRRSV specific IFN-g production and NA response with reduction of IL-10 and PRRSV specific T-regulatory cells in a challenge study (Sirisereewan et al., 2017b).

1.4.4 Replicating virus vaccines

Replicating virus vector-based vaccines elicit both cell-mediated and humoral immune responses and various virus vectors have been explored in PRRSV vaccine development (Cruz et al., 2010a; Renukaradhya et al., 2015a). Adenovirus vectored vaccines have been tested in pigs and mice, including granulocyte macrophage-colony stimulating factor (GM-CSF) coexpressed with GP5/3 (Wang et al., 2009), CD40

Ligand (CD40L) coexpressed with GP5/3 (Cao et al., 2010), heat-shock protein 70

(HSP70) coexpressed with GP5/3 (Li et al., 2009d), all of which induced PRRSV specific cell-mediated immune response and specific neutralization antibody response in pigs. Adenoviral vectored constructs of PRRSV proteins in single or in combination such as GP5/M and GP5/3 or GP3/4/5 constructs induce both T cell and antibody responses in mice (Jiang et al., 2006a). In addition, an adenoviral vectored GP5/M construct induces CMI and neutralizing antibodies in mice (Cai et al., 2010).

Similar to the adenovirus, an attenuated pseudorabies virus (PRV) was also used as a potential replicating vector for PRRSV. PRV recombinant expressing PRRSV proteins as rPRV-GP5, rPRV-GP5-M, rPRV-GP5-native M, rPRV-GP5m-M in which construct rPRV-GP5-m-M induces protection against virus challenge with the reduction in viremia. Similarly, construction of rPRV-GP5 also confers significant protection

40 against viral challenge (Jiang et al., 2007; Qiu et al., 2005). PRV can also be used as a bivalent vaccine against PRRSV and PRV.

Recombinant transmissible gastroenteritis virus (TGEV) expressing PRRSV GP5 and M proteins (rTGEV-GP5-M) acts as a bivalent vaccine against PRRSV and TGEV.

It produces the high level of antibody response against TGEV but not against PRRSV.

Similarly, recombinant EAV (Equine Arthritis virus) expressing GP5 and M proteins of PRRSV infects only EAV susceptible cell lines but not PRRSV susceptible cell lines

(Cruz et al., 2010b; Lu et al., 2012; Renukaradhya et al., 2015b). In the same way, a

Modified Vaccinia Ankara (MVA) vectored GP5/M construct induces T cell and antibody responses in mice (Zheng et al., 2007).

Recombinant canine adenovirus type 2 (CAV-2) expressing PRRSV GP5 or

GP5/M induces specific antibody, virus neutralization activity and T-cell secreting

IFN-g response, but fails to provide protection against challenge infection (Zhou et al.,

2010). Some of the subunit vaccines using bacterial vectors expressing PRRSV proteins were also tested against PRRSV, such as Mycobacterium bovis BCG expressing GP5/M develops specific NA and T-cell IFN- response, whereas a recombinant GP5 expressed in E. coli or in transgenic tobacco plants failed to provide protection and in fact exacerbated disease upon challenge (Prieto et al., 2011). The open reading frame of a Danish isolate of PRRSV was constructed in a DNA vaccine

(Barfoed et al., 2004), but such candidates failed to inhibit virus persistence and shedding (Pirzadeh and Dea, 1998). While the results from all recombinant subunit vector vaccines were encouraging but failed to translate successfully to the porcine

41 system. The important disadvantage in use of viral vectors for vaccine construction is their own risk of recombination with wild-type viruses and potential pre-existing host immunity rendering the vaccine inactive (Ura et al., 2014). The major limitation in the use of vector-based vaccine is the pre-existing or vector induced neutralizing antibodies which can limit replication of the vector vaccine e.g. adenoviral and poxvirus-based vector vaccines (Barouch et al., 2004; Casimiro et al., 2003). However, current replication-competent viral vector vaccines are very effective in a heterologous prime- boost regimen (Santra et al., 2007).

1.5. Introduction to Vesicular Stomatitis Virus

Vesicular stomatitis virus (VSV) is a prototype member of the Vesiculovirus genus, belongs to the Rhabdoviridae family. VSV is comprising of 11,161 nucleotides of a non-segmented negative-sense (NNS) RNA, having two major serotypes isolated in the

U.S. namely, Indiana and New Jersey strains (Whelan and Wertz, 2002). VSV is a natural pathogen in livestock and causes disease in cattle, swine and horses marked by febrile illness, anorexia, loss of body weight, vesicular lesions in the mucosa around the mouth, nostrils, teats and coronary bands of the hooves. Vesicles, ulcers, erosions, and crustings are the main manifestations associated with VSV infection, and most of the time the symptoms are indistinguishable from foot-and-mouth disease. The infection resolves in a few weeks without mortality (Letchworth et al., 1999). The incubation period of VSV infection varies from 2 to 9 days, and transmission occurs through direct contact with the infected animals through abrasions and scarifications of the mucosa. Insects are the reservoir and carrier for VSV with livestock as the end host

(Letchworth et al., 1999). VSV infection in humans is normally asymptomatic but can cause mild flu-like symptoms.

1.5.1 The structure of VSV virions

VSV is an enveloped virus with a bullet-shaped virion that measures 80 × 170 nm in size (Fig 1.3). The genome of VSV is 11.161 kilobases (kb) in length with single- stranded RNA genome organized into five VSV genes encoding nucleocapsid (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), and large (L) proteins, and leader and trailer regulatory sequences arranged in the order 3’-(leader), N, P, M, G, L,

(trailer)-5’(Abraham and Banerjee, 1976; Ball, 1977; Whelan and Wertz, 2002)

(Fig 1.3).

Fig 1.3; Schematic diagram of Vesicular stomatitis virus showing the surface glycoproteins and the genome. Adopted from Jianrong Li et al 2013 with modifications.

The genome of VSV forms a nuclease-resistant helical N-RNA complex after encapsidating with the N protein, which acts as the functional template for mRNA synthesis as well as genomic RNA replication. The first event during the VSV gene expression is the transcription of each viral gene by RNA dependent RNA polymerase

(RdRp), which consists of a complex of the 241-kDa L protein catalytic subunit and the 29-kDa essential P protein cofactor bound to the 3’ end of viral RNA, subsequently translated by host cell machinery to produce viral proteins which are necessary for replication and assembly of virus. Combination of nucleoprotein along with RdRp forms a viral ribonucleoprotein (RNP) complex (Emerson and Wagner, 1972; Emerson and Yu, 1975). M protein stabilizes the RNP and M-RNP complex is essential for packaging of viral RNA, assembly of virions and helps in budding of the viral particles

(Ge et al., 2010). The G gene encodes the glycoprotein (G), protrudes from the envelope which allows attachment to target cells and helps in the entry into cells by initiating fusion of the virus particle to the host cell membrane (Hammond and

Helenius, 1994; Ma and Li, 2011). The L gene encodes viral RNA polymerase which acts as both a viral transcriptase to produce viral mRNAs and a replicase responsible for producing successive copies of the genome. Due to the stop-start sequential transcription mechanism, decreasing gradient of mRNAs from the viral genome is noticed. Viral genes near the 3' end of the genome produce in much higher quantities as polymerase starts at 3’ end and the genes closer to 5’ end are produced much less abundantly.

Fig 1.4: VSV genome organization (Adapted from Li et al., 2013, with modifications).

VSV encodes five structural proteins: nucleocapsid (N) protein, phosphoprotein (P), matrix (M), glycoprotein (G) and large (L) proteins. The VSV genome is arranged in the order 3’-(leader), N, P, M, G, L, (trailer)-5’.

1.5.2 VSV transcription and replication

VSV transcription involves the stop-start model of sequential transcription to produce five capped, methylated and polyadenylated mRNAs, N, P, M, G, and L (Abraham and

Banerjee, 1976; Ball and White, 1976). The leader, trailer and intergenic sequences are essential for viral replication and transcriptional control. The RdRp enters the genome at a single site and initiates transcription at position 1 synthesizing Le+. Termination of Le+ allows the transcription of N mRNA by the polymerase and so on (Whelan and

Wertz, 2002). L protein is also involved in the mRNA cap addition, cap methylation and polyadenylation. In response to a cis-acting element, the cap is added to 5’ end of the mRNA through an unconventional mechanism in which GDP: poly ribonucleotidyl transferase (PRNTase) of L transfers a monophosphate RNA onto a GDP acceptor through a covalent protein-RNA intermediate (Li et al., 2008; Ogino and Banerjee,

2007). The cap is further methylated at the ribose 2’-O and guanine-N-7 by L protein

(Li et al., 2005; Li et al., 2009c). When encountering a gene-end sequence, L poly adenylates and terminates mRNA synthesis. During the start/stop process, the RdRp occasionally detaches from nucleocapsid template at the gene junction which results in a 30% decline in transcription of downstream genes leading to a gradient of mRNA expression from 3’ to 5’ end (Abraham et al., 1975; Barr et al., 1997; Hwang et al.,

1998). Transcription and replication of VSV are controlled by a single RdRp. N-RNA template recruits the RdRp at the gene start sequence located between Le and N gene junction and initiates transcription, whereas the recruitment of RdRp at the beginning of the Le sequence initiates viral replication which proceeds from 3' to 5' end to synthesis of positive sense antigenomic RNA. The synthesized mRNA serves as a template for the production of full length viral genomic RNA (Whelan and Wertz,

2002).

1.5.3 Reverse genetics of VSV

The rVSV reverse Genetics System has proven to provide important biomedical tools as VSV can be easily be genetically engineered using reverse genetic systems to become useful research tools such as vectors, vaccines, viral tracers in neurotropism studies and basic viral lifecycle studies. The VSV reverse genetics system was established in 1995 by recovering the VSV entirely from cloned cDNA by transfecting mammalian cells with plasmids encoding full-length genomic or antigenomic RNA and the major proteins involved in replication and transcription, namely N, P, and L

(Lawson et al., 1995; Whelan et al., 1995). Although there are several systems

46 established for rescuing rVSV, in the present study we used a helper plasmid containing genes for N, P, L, and a plasmid-encoded T7 RNA polymerase system.

A plasmid encoding the full-length VSV genome [pVSV(+)] was transfected into

BSRT-7 cells, concurrently with three support plasmids carrying VSV L (pL), P (pP), and N (pN) protein genes. The T7 RNA polymerase produced by vaccinia virus was utilized to transcribe the VSV antigenomic RNA and mRNA of the L, P and N gene.

The newly synthesized L, P and N proteins bound to antigenomic RNA and generated full-length genomic RNA, resulting in the formation of a functional RNP and production of other viral proteins. After assembly, a complete infectious recombinant

VSV was recovered. This is a powerful system that allows genetic manipulation of the viral genome such as mutation, deletion and insertion of foreign genes (Li et al., 2005;

Whelan et al., 1995; Whitt et al., 2016).

1.5.4 Advantages of using VSV as a viral vaccine vector

VSV is a versatile vaccine vector offers a number of advantages, such as it replicates solely in cytoplasm, does not undergo recombination which generates no DNA intermediates that might integrate in to host genome (Rose and Whitt, 2001), genetic stability and expression of multiple antigens which can accommodate at least 4.5 kilobases of foreign genes. Also provides high level of expression of foreign genes in infected cells, simplicity of production, multiple routes of administration, ease of large- scale production in pre-approved cell lines, no need of use of adjuvant along with VSV vectored vaccine, ability to increase the packaging capacity of the VSV by semi replication competent vector system for ease of manipulation and generates potent

47 immune response (Ma and Li, 2011; Ramsburg et al., 2004; Roberts et al., 1999;

Schwartz et al., 2007). The transcription level of foreign genes can be controlled by inserting them at different positions in the genome because of the 3’ to 5’ gradient of expression as mentioned previously. Unlike the adenovirus, human infection with VSV is very rare and the general population is free of pre-existing immunity against VSV.

The above characteristics of VSV suggest that recombinant VSVs expressing foreign viral proteins would be an ideal vaccine candidate.

1.5.5 VSV as a vaccine vector

Recently VSV has been used as a viral vector successfully in various infectious diseases of humans and animals. A decade ago, a procedure was established to generate replication competent, negative-stranded recombinant rVSV entirely from complementary DNA Several strategies were employed to generate a candidate replication competent rVSV based vaccines with enhanced safety. Previous studies have shown that VSV G is directly associated with pathogenesis and virulence of VSV in mice (Clarke et al., 2007; Robain et al., 1986; van den Pol et al., 2002) and determinant of pathogenesis in swine (Martinez et al., 2003). Researchers have used several approaches to attenuate rVSV vectors, including mutations truncating the VSV

G cytoplasmic domain from 29 to 9 or 1 amino acid (Fang et al., 2012b; Publicover et al., 2004), complete deletion of VSV G and replace with foreign glycoproteins to develop GP exchange vectors (Schnell et al., 1996), gene rearrangements (Wertz et al.,

1998) and M gene mutation (Ahmed et al., 2008). rVSV based vaccines elicit strong

48 humoral and cell-mediated immune responses in vivo (Haglund et al., 2002; Roberts et al., 1999).

The generation of rVSVs and utilities as vaccine vectors in inducing protective immunity in animal models against a large number of different pathogens was shown in several studies. Live attenuated rVSV expressing the human immunodeficiency virus (HIV) envelope (env) and core (Gag) proteins protect rhesus monkeys from AIDS following challenge with a pathogenic AIDS virus (Rose et al., 2001). rVSV vectors expressing influenza hemagglutinin (HA) protein in the mouse model provides complete protection from virulent influenza virus challenge (Roberts et al., 1999). A vaccine candidate with the VSV G deletion and expressing influenza HA (rVSV-∆G-

HA) proved to be protective and nonpathogenic and induces no neutralizing antibody to the vector (Roberts et al., 1999). rVSV GP exchange vectors after effective boosting generate neutralizing antibodies to HIV type I (Rose et al., 2001). rVSV vaccines are successful in protection against Severe Acute Respiratory Syndrome (SARS) (Faber et al., 2005), Hepatitis C virus (Buonocore et al., 2002), Papillomavirus (Reuter et al.,

2002), human respiratory syncytial virus (Kahn et al., 2001) and Poxvirus (Braxton et al., 2010). Recently, by using the strategy of developing nonpathogenic rVSV-∆G vectors expressing foreign genes, rVSV-∆G vaccines were developed for Ebola

(EBOV) viruses and Marburg viruses (MARV) (Garbutt et al., 2004; Geisbert et al.,

2009; Jones et al., 2005). The rVSV-∆G vectors modified to carry the GP gene from

(ZEBOV) Zaire ebolavirus, Sudan ebolavirus (SEBOV) or the Musoke strain of

MARV in place of the VSV G protein showed slight attenuation in growth. This rVSV

49 has provided complete protection to non-human primates when administered as a single injection (Garbutt et al., 2004).

The rVSV-∆G vaccine platform has also been used as a post-exposure treatment for filovirus infection in addition to its utility as a preventive vaccine. Administration of rVSV-∆G MARV-Musoke GP vaccine constructed as post-exposure after 24 hr of a homologous high-dose MARV challenge in rhesus monkeys showed protection in animals from clinical illness and mortality (Daddario-DiCaprio et al., 2006).

Administration of rVSV-∆G GP vaccines for ZEBOV and SEBOV as post-exposure prophylaxis after high-dose homologous virus challenge protects rhesus macaques

(Feldmann et al., 2007; Geisbert et al., 2008). These studies have shown that VSV- based vaccines trigger strong immunity in animal models even after a single immunizing dose (Geisbert et al., 2009). Two phase I clinical trials testing VSV-based

HIV vaccines (VSV-Indiana HIV gag vaccine and HIV DNA vaccine followed by

VSV-gag vaccine boost) have shown acceptable data of significantly enhanced immune response in prime-boost vaccination regimes (Clarke et al., 2016; Fuchs et al., 2015).

However, VSV based-vectored vaccines are contraindicated in people with an immunodeficiency (e.g. HIV+) and children since the vaccine strain could be pathogenic (Pavot, 2016).

1.6 IRES: Internal ribosome entry site

IRES is an RNA element found in viral RNAs and cellular mRNAs with long 5'UTR

(untranslated terminal region) regions (Jang et al., 1988; Pelletier and Sonenberg, 1988) and can promote internal initiation of translation of RNA to facilitate the expression of

50 two or more proteins from a polycistronic transcription unit in eukaryotic cells

(Mountford and Smith, 1995). They allow an alternative 5' cap-independent, internal translation initiation and bypass its subset of Eukaryotic translation initiation factor

(eIFs) but the IRES-dependent translation initiation is a slow process (Andreev et al.,

2009; Belsham and Sonenberg, 2000; Ochs et al., 1999). The progress in capture of the ribosome and its exact positioning on the viral RNA is stimulated by additional cellular proteins called IRES transacting factors (ITAFs) (Jang, 2006).

Viral IRES was first discovered in the RNA genome of picornaviruses. The 5' UTR region of Poliovirus direct the protein synthesis within a synthetic bicistronic mRNA

(Pelletier and Sonenberg, 1988). Similar structures in other picornaviruses like EMCV

(Jang et al., 1988), FMDV (Belsham et al., 1990) and HRV (Borman and Jackson,

1992) were discovered. Viruses containing the IRES can initiate translation independent 5’ cap structure and interfere with the host translation machinery without affecting their own gene expression. Using the same strategy, Picornaviruses contribute to the fast replication phenotypes by selectively interfering with cellular protein synthesis and utilize host translational machinery for viral protein (Lamphear et al.,

1995). Encephalomyocarditis virus interferes with the host translation machinery after binding to the cap structure without affecting the virus protein synthesis (Gingras et al.,

1996; Groppo and Palmenberg, 2007).

Cellular IRES are present in the cellular mRNAs which help in synthesis of essential proteins required for the translation process whenever the cap-dependent translation is impaired due to the stress conditions like apoptosis, hypoxia, and ER-

51 stress (Spriggs et al., 2008). The major difference in the IRES elements of the viruses and cells is their site of synthesis. Picornaviruses RNAs are synthesized in the cytoplasm and encounter the factors required for translation initiation in the cytoplasm and form RNP complexes. In contrast, the site of production of cellular RNAs is in the nucleus, and they interact with the several protein presents in the nucleus and are exported to the nucleus for RNP complexes. DNA viruses have IRES that resembles those of cellular IRES.

IRES has been used against rabies virus, a non-segmented negative strand RNA virus, to investigate the role of phosphoprotein isoforms in virus replication and virulence (Marschalek et al., 2012; Marschalek et al., 2009). IRES promotes expression of foreign genes from the second ORF of NDV genes which provides direct proof of sequential transcription mechanism for NDV (Zhang et al., 2015). Here, we utilized

IRES to promote expression of foreign genes from the second ORF of PRRSV genes and to enhance equal expression of the second gene of PRRSV to stimulate immune responses equally to both the genes

Our aim of this study is to develop an alternative strategy to control the expression of essential gene products of PRRSV in the rVSV vector on the translational level by use of IRES elements. We have exploited the IRES of CMV which preferentially initiates the translation at a second downstream initiation codon, and we aimed to change the relative expression of N-terminally expressed proteins by CMV–IRES controlled rVSV expression system.

During 2007, in a colloquium at the University of Illinois, college of veterinary medicine in the USA, all the experts working in PRRSV including the clinicians, academicians, vaccinology researchers and industry experts have set up the standards for the next generation of PRRSV vaccines, which were presented by Rock D L. The meeting proceedings concluded that the ideal PRRS vaccine should possess rapid induction of both innate and adaptive immune responses, protection against most currently prevalent PRRSV strains, should not cause adverse effect to swine health and should be able to differentiate vaccinated from infected animals.

It is clear from the previous works that PRRSV infection is very complex and there is a need for improved vaccines to protect PRRS outbreaks in swine herds. Novel vaccination strategies need to be employed to generate broadly protective vaccines to prevent further spread of PRRSV across the world. The problem of induction of heterologous immunity within the PRRSV 1 and PRRSV-2 species still exist. In this study, we focused on testing the novel vaccination strategies to effectively mitigate co- infections of PRRSV-1 and PRRSV-2 in the same swine herd using modified live virus vaccines. Further attempted to improve the breadth of immunity to killed PRRSV vaccines using the combination of killed PRRSV-1 and -2 prime and E. coli expressed

T-cell epitopes as a booster vaccine; and also in design of recombinant VSV expressing

PRRSV subunit vaccine candidates. The three specific objectives below are addressed in the following experimental project.

1.7 Objectives of the study

1. To evaluate the efficacy of concurrent and consecutive vaccination of modified live

virus vaccines of PRRSV-1 and PRRSV-2 for induction of enhanced protection

against coinfections in nursery pigs.

2. To elucidate the outcome of PRRSV-1 and PRRSV-2 killed virus vaccines

delivered with non-toxic enterotoxin (LT) adjuvant and E. coli expressing

immunogenic conserved PRRSV epitopes against PRRSV challenge infection in

pigs.

3. Construction and recovery of infectious recombinant vesicular stomatitis virus

(rVSV) expressing PRRSV proteins to develop a novel vector-based vaccine

candidate for pigs.

Chapter 2

Consecutive but not concurrent vaccination of modified live PRRSV-1

and PRRSV-2 provides better protection in nursery pigs

2.1 Summary

Pigs are vaccinated with modified live (MLV) PRRSV-1 and PRRSV-2 vaccines globally.

In PRRSV-1 and PRRSV-2 co-infected MARC-145 cells a strong interference of PRRSV-

2 on PRRSV-1 replication was observed, especially in concurrent co-infected cells.

Therefore, we analyzed the efficacy PRRSV-MLV in both consecutive and concurrent vaccination of pigs administered by intramuscular route, either 3 days apart (PRRSV-1

MLV followed by PRRSV-2 MLV, consecutive) or together on the same day (concurrent).

At day post-vaccination (DPV) 42 when viral RNA was absent in serum, half of the pigs in each group were challenged with homologous PRRSV-1 or PRRSV-2. The study was terminated at days post-challenge (DPC) 10. Quantitative RT-PCR results showed that

PRRSV-1 was detectable from DPV 7 to 35 in consecutive and only at DPV 35 in concurrent vaccinated pigs; and PRRSV-2 was detected from DPV 7 to 35 and DPV 3 to

35 in consecutive and concurrent vaccinated pigs, respectively. In PRRSV challenged pigs, replicating PRRSV-1 was undetectable in the consecutively vaccinated group, while in concurrent group, 2 of 3 pigs had 2 logs PRRSV-1 at DPC 10; and challenge PRRSV-2 was undetectable. Immunologically, the frequency of PRRSV-1 and PRRSV-2 specific

IFN-γ positive T-helper/memory and cytotoxic T cells were increased (P<0.05) in tracheobronchial lymph nodes of both consecutive and concurrent vaccinated pigs at DPC

10. But virus neutralizing antibody titers against both PRRSV-1 and PRRSV-2 were higher in consecutive compared to concurrent vaccinated pig groups. In conclusion, consecutive vaccination method appears to provide better clearance of both the viral species through improved adaptive immune response.

Keywords: PRRSV-1 and PRRSV-2 MLV, concurrent/consecutive vaccination, virus clearance, adaptive immunity

2.2 Introduction

Porcine reproductive and respiratory syndrome virus (PRRSV) is a devastating chronic immunosuppressive disease of pigs. PRRS causes significant economic losses to the swine industry worldwide. PRRSV is a single stranded, positive sense enveloped RNA virus belonging to the order Nidovirales, family Arteriviridae (Meulenberg et al., 1993b), and recently was included under the genus Porartevirus. Viruses under Porartevirus group include: PRRSV-1 (formerly named type 1 PRRSV or genotype 1), PRRSV-2 (formerly named type 2 PRRSV or genotype 2), two murine arterivirus species such as lactate dehydrogenase-elevating virus and Rat arterivirus-1 (Adams et al., 2017a). PRRSV causes respiratory distress in pigs of all ages and reproductive failure in sows (Albina et al., 1994;

Benfield et al., 1992). PRRSV was discovered first in The Netherlands and is represented by the European prototypic strain, Lelystad virus (PRRSV-1) (Wensvoort et al., 1991b).

Subsequently, in the North America PRRSV was isolated in 1992 and it is represented by the North American prototype strain VR-2332 (PRRSV-2) (Benfield et al., 1992; Collins et al., 1992). At the genome level both PRRSV-1 and PRRSV-2 shares only 55% to 70% sequence identity and have significant difference in their pathogenicity in pigs (Allende et al., 2000; Benfield et al., 1992; Lunney et al., 2015; Nelsen et al., 1999).

Currently, both the genotypes of PRRSV are rapidly spreading in their respective continents and also across the globe, and have been identified in most of the swine

57 producing countries globally (Shi et al., 2010a). Rapid transmission of PRRSV between continents and swine herds has been thought to be attributed to extensive vaccination program (Pileri and Mateu, 2016b), contaminated semen, mixing with PRRSV positive weaned/feeder pigs and contaminated vehicles (Dee et al., 2004). Overall, both species of

PRRSV are circulating in the US with constant increase in incidences of co-infection in swine herds (Amadori and Razzuoli, 2014; Chen et al., 2011; Nam et al., 2009; Park et al.,

2015a; Ropp et al., 2004a).

PRRS modified live virus (MLV) vaccines have been in use extensively to protect against PRRS infections across the globe for over two decades (Renukaradhya et al.,

2015b). Both the MLV vaccines of two species confer protective response against homologous and partial protection against heterologous strains within species; but they provide very weak protective response across the species (Charerntantanakul, 2012;

Renukaradhya et al., 2015b). Therefore, there is an urgent need to develop an innovative strategy with existing MLV vaccination approaches to effectively mitigate swine herds from growing problems of co-infections of both PRRSV species. In an earlier study, concurrent vaccination of nursery pigs with both species PRRSV reduced the PRRSV-1 but not PRRSV-2 viremia in dually infected pigs (Park et al., 2015b). In another study, concurrent vaccination of boars with PRRSV-1 and PRRSV-2 reduced shedding of both species of virus in semen (Jeong et al., 2017b). However, studies have demonstrated that

PRRSV-2 induces more severe respiratory disease, pulmonary pathology and virus detected in multiple organs than PRRSV-1 in pigs (Gomez-Laguna et al., 2013; Halbur et al., 1996; Han et al., 2013). Studies have shown that PRRSV-2, but not PRRRSV-1,

58 induces T-regulatory cell proliferation and that likely impairs the host immune response

(Gomez-Laguna et al., 2013). Considering the nature of PRRSV-1 and PRRSV-2, it is essential to invent an ideal vaccination strategy using PRRS MLV to effectively control co-infections of these two species in swine herds. Therefore, in this study, our objective was to compare the efficacy of both concurrent and consecutive method of administration of PRRSV-1 and PRRSV-2 MLV against homologous challenge virus infections in nursery pigs by conducting detailed viral and immunological analyses.

2.2.1 Rationale of the study

PRRSV-2 has higher cellular tropism and replicates more efficiently in cells of monocyte- macrophage lineage than PRRSV-1 leading to higher level of PRRSV-2 in blood and lungs of the infected pigs. Therefore, during co-infection better adapted PRRSV-2 readily infects pulmonary alveolar macrophages and competes out PRRSV-1.

2.2.2 Hypothesis of the study

Vaccination of pigs with MLVs of both the PRRSV species at 3 days apart (PRRSV 1

MLV followed by PRRSV 2 MLV) provides better protection and clearance of challenge viral infection of both PRRSV species.

2.3 Materials and Methods

2.3.1 PRRS viruses and cells

The PRRSV-1 modified live virus (MLV, strain SD01-08) was passaged on MARC-145 cells for 43 passages, while PRRSV-2 MLV (strain SD95-21) was passaged on MARC-

145 cells for 100 passages. The wild type (WT) PRRSV-1 (SD01-08) (Fang et al., 2006c)

(GenBank accession no. DQ489311.1) and PRRSV-2 (SD95-21) (GenBank accession no.

KC469618) were used for homologous challenges.

MARC-145 cells were maintained in Dulbeco’s Modified Eagle Medium (Gibco) supplemented with 10% heat inactivated fetal bovine serum and antibiotics (100 units/mL of penicillin, 100µg/mL of streptomycin and 0.25 µg/mL of fungizone) at 37oC with 5%

CO2.

2.3.2 Co-infection of PRRSV-1 & PRRSV-2 in vitro

MARC-145 cells were seeded in 96-well plates at 2X104 cells/well and after the 48h culture approximately 85% confluent monolayer was co-infected with PRRSV-1 [multiplicity of infection (MOI) 0.1 or 1.0] and PRRSV-2 (MOI 0.1) either consecutively by infecting the cells first with PRRSV-1 or PRRSV-2 and then co-infected with PRRSV-2 or PRRSV-1, respectively, after 3, 6, 12, 24 and 30h of initial infection, or infected concurrently with both PRRSV-1 and PRRSV-2 (Table 1). Cells infected with only PRRSV-1 or PRRSV-2 for 6, 12, 24, 30 and 36h were included as controls. Every infection at each time points was carried out in duplicate wells and at 36h post-infection all the cells in wells were fixed to detect the level of PRRSV-1 or PRRSV-2 infection using specific mAb by indirect immunofluorescence assay. Similarly, infected cells and their supernatants were collected for total RNA extraction to identify the viral RNA qualitatively by RT-PCR.

2.3.3 RNA extraction and cDNA synthesis

Total RNA was extracted in both PRRSV infected cells and supernatants at above indicated time points by using Master Pure™ RNA purification kit (Lucigen Biotechnologies, USA) by following the manufacturer’s instructions. Briefly, in a microcentrifuge tube the cells

60 were pelleted and dispersed with 300µl T and C lysis solutions with Proteinase K mixture

(300:1) or 150µl cell culture supernatants were mixed with 150µl of 2XT and C lysis solution and Proteinase K mixture (150:1), incubated at 65oC for 15 min with vortexing at every 5 min interval. The tubes were cooled to 37°C and added 5 µl of RNase free-DNase

I (1U/µl), mixed thoroughly and incubated for 30 min at 37 °C. For RNA precipitation,

200µl of MPC protein precipitation reagent (provided with the kit) was added and mixed vigorously for 10 secs and centrifuged at ≥10000 xg for 10 min at 4 °C. The supernatant containing RNA was transferred to a new tube and 500µl of Isopropanol was added and mixed the contents by inverting the tube 30-40 times. Finally, purified RNA was pelleted by centrifugation with 500µl of isopropanol, rinsed twice with 70% ethanol and the pellet was re-suspended in 35µl of TE buffer. Reverse Transcription was performed using M-

MLV Reverse Transcriptase (Promega, Madison, USA) in a 20µl reaction mixture containing 2ug of RNA according to the manufacturer’s instructions. Briefly, in the RT reaction, a mixture of 2µg of total RNA was made up to the volume 11.3µl and heated at

70oC for 12 min and then a mixture of 1µl of Oligo(dT)15 primer (0.5µg/µl), 1µl RNase inhibitor (40U/ µl), 1µl dNTP(10mM), 4µl 5X PCR buffer, 1µl M-MLV reverse transcriptase (200U/ µl) and 0.2µl of RNAsin were added together to the volume of 20µl.

The reaction was carried out in 40oC for 1hr and followed by 10 min reaction at 95oC using a thermocycler.

2.3.4 RT-PCR for detection of viral RNA

The 2µl of RT-reaction mixture was subjected to RT-PCR amplification using Phusion

Flash High-Fidelity PCR Master Mix (Thermo Scientific) and PRRSV-1 (amplicon size is

800 bp) and PRRSV-2 (amplicon size 600 bp) specific forward and reverse primers. PCR conditions were carried out at 35 cycles of initial denaturation at 98°C for 30 sec, denaturation at 98°C for 10 sec, annealing at 60°C for 20 sec, extension at 72 °C for 15 sec and final extension at 72 °C for 1 min. The PCR product of PRRSV-1 and PRRSV-2 were visualized using 1% agarose gel electrophoresis in the presence of ethidium-bromide.

2.3.5 Indirect Immunofluorescence assay (IFA)

The presence of PRRSV-1 and PRRSV-2 in the cells was analyzed by indirect immunofluorescence assay (IFA) as previously described (Christopher-Hennings et al.,

2001). Briefly, at 36 h post initial infection cells were fixed using 80% acetone in water for

10 min and plates were allowed to dry in a fume hood for 30 min. Cells were rehydrated with 100μl/well of PBS for 5 min and incubated with 50μl/well of mouse anti-PPRSV-1 nsp2 protein specific mAb (140-68) (1:1000) or PRRSV-2 nsp2 mAb (36-19) (1:1000) followed by Alexa-488 conjugated anti-mouse IgG (H+L) secondary antibody (1:3000).

After each treatment, plates were incubated at 37°C for 2h and washed 4 times in between the treatments. Finally, the immunofluorescence was observed under an inverted fluorescent microscope (Olympus, Tokyo, Japan) after mounting the cell monolayer with glycerol-PBS in 6:4 ratio (50μl/well). The immunofluorescence images were recorded using ImageJ software.

2.3.6 Preparation of macrophages from BAL cells and in vitro stimulation

Porcine alveolar macrophages (PAMs) were obtained by bronchoalveolar lavage (BAL) fluid collected from 3 pigs. BAL fluid was collected from pigs as described previously

(Binjawadagi et al., 2014). Briefly, lungs were lavaged with PBS and recovered lavage

62 fluid was centrifuged at 400 xg for 15 min. Pelleted cells were washed with PBS and resuspended in cell culture medium (RPMI 1640, 10% fetal bovine serum, 5 mM HEPES,

1 mM glutamine, antibiotic-antimycotic, and 50 mg/mL gentamicin; Invitrogen Life

Technologies, San Diego, CA). Further, cells were cultured in 24 well plates (7x104 cells/well) supplemented with RPMI-1640 medium for 2 h in a humidified 5% CO2 at

37°C. After 2 h of incubation non-adherent cells were removed and replenished with fresh medium and the adherent cells were used as PAMs. Porcine BAL fluid cells contains approximately 80% macrophages (Gehrke and Pabst, 1990).

The PAMs from 3 pigs were individually infected with PRRSV-1 (0.1 MOI),

PRRSV-2 (0.1 MOI) or combination of PRRSV-1 and PRRSV-2 (0.1 MOI each virus) concurrently. Control PAM cells were treated with TLR-3 ligand 10ug/ml [Polyionosinic

:polycytidilic acid (Poly I:C) Invivogen, CA], TLR-9 ligand 10ug/ml (CpG-ODN, M362-

Invivogen) or mock treated with DMSO. Cells were incubated for 24 h and the cell pellet was treated with Trizol reagent (Life technologies) for RNA extraction by using Master pure RNA purification kit (Lucigen /epigenetics Biotechnologies, USA) as per the manufacturer’s instructions.

2.3.7 Quantitative real time RT-PCR (qRT-PCR) for TLR-3 and TLR-9

Total RNA isolated from PAM cells was subjected to Reverse Transcription using M-MLV

Reverse Transcriptase (Promega, Madison, USA) in a 20µl reaction mixture containing 2 ug of RNA according to the manufacturer’s instructions. Real-time PCR was used to quantify mRNA expression levels of TLR 3 and 9 using 7500 fast real-time PCR system

(Applied Biosystems) and SYBR Green Kit without ROX. Beta-actin was used as the

63 internal control gene. Ampliﬁcation was carried out in sealed PCR tubes in 20 µL ﬁnal reaction volume containing 10 µL of SYBR green master mix, 2 µL primers (each 10

µM/reaction) (Table 2), 5 µL of diethyl pyrocarbonate (DEPC)-water and 1 µL template cDNA, or nuclease free water (as a negative control). The PCR reaction was carried out at

50oC for 10 min, 95 oC for 5 min, 94 oC for 20 sec and annealing at 55oC for 32 sec. Melting curve analysis of the PCR products was performed after ampliﬁcation using the conditions suggested in the SYBR green kit manual. Level of mRNA was calculated using the cycle threshold (2-∆∆Ct) method (Miguel et al., 2010). Relative gene expression data were normalized against Ct values of the housekeeping gene β-Actin and the relative index was determined in comparison to the average expression levels of control samples with the index defined at 1.000.

2.3.8 Experimental design

Conventional crossbred nursery pigs weaned at 3-4 weeks of age were obtained from The

Ohio State University (OSU) swine herd and housed in OSU BSL2 isolation rooms at

OARDC. Pigs were randomly (male and female) divided into 4 experimental groups (group

1: n=3; and groups 2 to 4: n=6) (Table 3). Pigs were vaccinated at 4-5 weeks of age, group

2 were vaccinated consecutively with PRRSV-1 MLV followed by PRRSV-2 MLV after

3 days, and group 3 animals were vaccinated concurrently on the same day with both the species of MLVs. Viruses were administered by intramuscular (IM) route with 1 ml dose

5 on either side of the neck, and each virus dose was adjusted to 10 TCID50 in 2 ml medium.

Control groups 1 and 4 were mock vaccinated using DMEM. On 42 days post-vaccination

(DPV), half of the pigs (3 pigs in each group) of groups 2 to 4 were placed in separate

64 isolation rooms and challenged with respective homologous PRRSV-1 or PRRSV-2 105

TCID50 /mL per pig through IM route (Table 1). The mock control group 1 was similarly challenged with DMEM. Pigs were housed in isolation rooms equipped with adequate biosecurity measures to prevent transmission of vaccine and challenge viruses between and among the groups. Animals were monitored daily for any PRRS signs (anorexia, cough and labored breathing), and rectal temperature was recorded every third day until necropsy.

All the pigs of the experimental groups were fed with water and feed ad libitum, and all the experimental procedures were compiled in accordance with the guidelines of the

Institutional Animal Care and Use Committee of The Ohio State University.

2.3.9 Collection of samples for analysis

The blood samples (3 to 8 ml) were collected at DPV 0, 3, 7, 14, 21, 28, 35, 42, 45, 49 and

52. Serum was separated using clot activator (BD vaccutainer) tubes and aliquots were stored at -80oC until used in the study. Pigs were euthanized at 10 days post-challenge

(DPC) and lungs were examined for gross lesions during the necropsy. Bronchoalveolar lavage (BAL) fluid was collected by infusing 20 ml PBS containing 2% EDTA through the trachea into lung lobes, the BAL fluid was harvested after gentle massaging all the lung lobes. The lung lysate samples were prepared after homogenizing 1g of lung tissue collected in 3 mL of DMEM, centrifuged and the supernatant was collected. The aliquots of BAL fluid and lung lysate samples were stored at -80oC until used in the study.

2.3.10 Isolation of blood and Tracheobronchial lymph nodes mononuclear cells

Blood was collected in EDTA for isolating peripheral blood mononuclear cells (PBMCs) at DPC 0 (DPV 42) and DPC 10 as described previously (Dhakal et al., 2017). Briefly,

PBMCs were isolated by using density gradient medium Lymphoprep in SepMate-50 tubes

(Stemcell, BC, Canada) as per the manufacturer’s instructions. Tracheobronchial lymph nodes (TBLN) derived mononuclear cells (MNCs) from individual pigs were isolated at

DPC 10 as described previously (Dwivedi et al., 2011a). Briefly, TBLN was collected in

DMEM, chopped into small pieces, passed through stainless steel selectors. Homogenates were washed and the pellet was resuspended in RPMI containing 43% Percoll and layered with 70% Percoll. The MNCs at the 43%-70% Percoll interphase were collected, washed, resuspended in enriched RPMI. Live and dead PBMCs and TBLN MNCs were counted using Trypan blue dye exclusion method and used in the assays.

2.3.11 Analysis of PRRSV load, viral titer and virus neutralizing antibody titer

All the assays were performed by using standard indirect immunofluorescence assay (IFA) as described previously (Benfield et al., 1992; Reed and Muench, 1938). Briefly, for virus titration, MARC-145 confluent monolayer cells in 96-well plates were incubated with 10- fold dilutions of serum for 24 h. For determination of virus neutralization (VN) titers, serum was heat treated for complement inactivation, two-fold diluted in DMEM and incubated with an equal volume of the SD01-08 or SD95-21 virus isolates containing 100

o TCID50 per well for 2 h at 37 C. One hundred microliter of the mixture was transferred to

96-well microtiter plate containing a confluent monolayer of MARC-145 cells and incubated for 24 h at 37oC. Cells were fixed with acetone water and anti-PPRSV nucleoprotein specific mAb (clone SDOW17; Rural Technologies, Inc., Brookings, SD) followed by Alexa-488 conjugated anti-mouse IgG(H+L) secondary antibody were added.

The immunofluorescence was observed under a fluorescent microscope after mounting with PBS and glycerol at 6:4 ratio.

Limit of detection for Virus titration

PRRSV titration by end point dilution was performed in MARC145 cells grown in 96-well plates. The 50% end point titer was expressed as tissue culture infectious dose 50%

(TCID50)/ mL, with a limit of detection of 101.67 TCID50/ml (Li et al., 2016).

2.3.12 Quantification of PRRSV RNA by quantitative real-time PCR

For detection of PRRSV RNA genomic copies and quantification of viral load, serum was subjected to PCR as described previously (Li et al., 2016). Briefly, viral genomic RNA was extracted by using MagMAX-96 viral RNA isolation kit (Life Technologies, Carlsbad, CA) with automated KingFisher Flex instrument (Thermofisher, Carlsbad, CA). Quantitative

RT-PCR (qRT-PCR) was performed to measure the viral genomic RNA in serum by using

Path-ID Multiplex One-Step RT-PCR Kit (Life Technologies, Carlsbad, CA). Viral RNA copy numbers were calculated by interpolating from a standard curve made by in vitro transcribed standard RNA. Two specific primers/probe pairs were designed for SD01-08 and SD95-21 genomic RNA detection.

SD01-08,ORF1b-F(GTCCGACTAATGGTCTGGAAAG),

SD01-08,ORF1b-R(CGTCCTTGGGAAGCTGAATAA),and

SD01-08,ORF1b-probe (TGGAAGGACTTACATGGTCAGCGC) were located at SD01-

08 viral genomic region (nucleotides [nt] 11228 to 11333);

SD95-21-5’UTR-F(AGGTGTTGGCTCTATGCCTT),

SD95-21-5’UTR-R(AGGAGGCTATCACAGAAGGG), and

SD95-21probe (TGACCATTGGCACAGCCCAA) were located at SD95-21 viral genomic region (nt 11 to 112).

The RNA standard was prepared by in vitro transcription. Briefly, amplicon regions within viral genome of SD01-08 and SD95-21 were separately amplified by RT-PCR using primersSD01-08,ORF1b-T7-F

(ATAATTAATACGACTCACTATAGGGGTCCGACTAATGGTCTGGAAAG

[underlining indicates the T7 promoter])/SD01-08 ORF1b-R and SD95-21 5UTR-T7-F

(ATAATTAATACGACTCACTATAGGGAGGTGTTGGCTCTATGCCTT [underlining indicates the T7 promoter])/SD95-21 5UTR-R. Purified PCR products were in vitro transcribed by using a MEGAscript T7 transcription kit (Invitrogen, Carlsbad, CA) according to manufacturer's instruction. Transcribed RNA products were quantified and diluted to be used as viral genomic RNA standard in qRT-PCR as described previously (Li et al., 2016). Briefly limit of detection is the lowest concentration of genomic RNA copy, that can be detected with 95% confidence that it is a true detection. To prepare the dilution end-point standard curve Serial 10-fold dilutions of the transcribed RNA (known viral

RNA concentration of 9.0 × 105 copy numbers per reaction mixture) were performed in

DEPC-treated water to 10-7. The lowest viral titer at which PRRSV was detectable was assigned as the detection limit. The means of the threshold cycle (Ct) for these 10-fold dilutions were used to determine minimum RNA copy numbers. Ct represents the number of cycles in which fluorescence intensity is significantly greater than background fluorescence and is directly proportional to log10 of its corresponding copy numbers value.

The PRRSV absolute copy numbers were extrapolated from the standard curve. Those samples with a Ct value below the negative control Ct value were considered as positive.

2.3.13 Flow cytometric analysis for phenotyping the lymphocytes subsets

The frequency of different total and activated IFN-γ secreting specifically activated three important T lymphocytes subsets were determined using multicolor immunostaining and subjected to flow cytometry as described previously (Dwivedi et al., 2013; Renukaradhya et al., 2010). Briefly, PBMCs and TBLN MNCs isolated at DPC 0 and DPC 10 were restimulated with PRRSV-1 or PRRSV-2 at 0.1 MOI for 72 h and the culture supernatant was analyzed for IFN-γ by ELISA. The cells were washed once in fluorescence-activated cell-sorting (FACS) buffer, counted and treated with 2% pig serum in FACS buffer to block

Fc receptors and surface labeled with pig lymphocyte specific purified, fluorochrome or biotin conjugated mAbs followed by treatment with fluorochrome labeled anti-mouse isotype specific or streptavidin conjugated secondary antibodies. Antibodies used include: anti-porcine CD3 (Southernbiotech, AL), CD4α (Southernbiotech, AL), CD8α

(Southernbiotech, AL), CD8β (BD Biosciences, CA). For intracellular IFN-γ staining,

GolgiPlug™ (BD Biosciences, CA) and Brefeldin A (Sigma, MO) were added during the last 6 h of incubation of cells treated with or without indicated restimulants. Finally, surface stained cells were fixed with 1% paraformaldehyde and permeabilized with cell

+ + permeabilization buffer (85.9% deionized water, 11% PBS without Ca2 or Mg2 , 3% formaldehyde solution, and 0.1% saponin) overnight at 4 °C. Cells were washed and immunostained using fluorochrome conjugated anti-pig IFN-γ or its isotype control mAb

(BD Biosciences, CA) in 0.1% saponin containing FACS buffer. Immunostained cells were

69 acquired using the flow cytometer (BD Aria II, BD Biosciences, CA) and analyzed using the FlowJo software (V.10 Tree Star, OR). All specific cell population frequencies were presented as the percent of total CD3+ T lymphocytes. Further analysis was performed to determine three important lymphocyte sub populations based on the expression of cell surface markers: T-helper cells (CD3+CD4+CD8-), cytotoxic T-lymphocytes (CTLs)

(CD3+CD4-CD8+CD8β+), T-helper/ memory cells (CD3+CD4+CD8+).

2.3.14 Statistical analysis

Data were presented as mean ± SEM of 3 pigs in each treatment group. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by post- hoc Tukey's test using GraphPad Prism 5.0 InStat. A P value < 0.05 was considered statistically significant.

2.4 Results

2.4.1 Interference of PRRSV-2 on PRRSV-1 replication in vitro by qualitative analysis

To demonstrate any interference in the replication of two species of PRRSV when co- infected, MARC-145 cells were infected with PRRSV-1 and PRRSV-2 either consecutively by infecting cells first with PRRSV-1 or PRRSV-2 and then co-infected with PRRSV-2 or

PRRSV-1, respectively, after 3, 6, 12, 24 and 30h of initial infection. Separate cell monolayers were also infected concurrently with both PRRSV-1 and PRRSV-2. The viral

RNA was extracted from the infected cells after 6, 12, 24, 30h and 36h after the initial first infection and subjected to RT-PCR using PRRSV-1 and PRRSV-2 specific primers sets which yields amplicon sizes 800 bp and 600 bp, respectively. Our results indicated that concurrent infection strongly inhibited replication of PRRSV-1 by PRRSV-2 and this was

70 observed even when PRRSV-1 was used at 10 times more MOI than PRRSV-2 (Table 1).

In consecutively infected cells with PRRSV-1 followed by PRRSV-2 (both at 0.1 MOI) noticeable delay in detection of PRRSV-1 RNA by 6 h compared to single PRRSV-1 infection was observed, but it was rescued when 10 times more PRRSV-1 was used (1

MOI) (Table 2.1). When PPRSV-2 followed by PRRSV-1 (both at 0.1 and 1 MOI) was tested in a consecutive co-infection, we observed delay in detection of PRRSV-1 RNA by up to 24 h (Table 2.1). This in vitro study data suggest that there is a strong interference of

PRRSV-2 on PRRSV-1 replication. To demonstrate this interference effect we stained the

PRRSV-1 and PRRSV-2 infected cells by using the virus species specific mAb followed by immunofluorescence assay (Fig 2.2). Our data revealed poor replication of PRRSV-1 when co-infected concurrently and also when PRRSV-2 was infected first in consecutive infected cells (Fig 2.1). Similar results were observed even when PRRSV-1 was used with

10 times more at 1 MOI versus 0.1 MOI (data not shown). In contrast, replication of

PRRSV-2 was unaffected when co-infected with PRRSV-1 (Fig. 2.2).

2.4.2 Quantification of viral load in pig serum samples

To investigate whether concurrent and consecutive co-infection of PRRSV-1 and PRRSV-

2 MLVs impairs replication of either viral species especially PRRSV-1 in vaccinated pigs, we followed different immunization methods. PRRSV-1 and PRRSV-2 MLVs were administered either 3 days apart (consecutive vaccination, PRRSV-1 followed by PRRSV-

2; group 2) or in combination on the same day (concurrent vaccination; group 3) (Table

2.2). The viral load in serum samples was quantified by species specific qRT-PCR. The inter-assay calibration curve indicated the linear detection range between 9 to 9 X105 copy

71 numbers per reaction mixture. In concurrently vaccinated pigs (open circles), PRRSV-1 genomic RNA copies in serum were detected only on DPV 35 with 1 log titer (Fig. 2.3 A), and PRRSV-2 genomic RNAs were detected from DPV 3 through 28 with 4-5 log titers

(Fig. 2.3 B). While in consecutive MLV-vaccinated pigs (closed circles), both species of viral RNAs were detected from DPV 7. The PRRSV-2 titer of 4-5 logs was detected until

DPV 28 and the PRRSV-1 titer of 3 logs was detected until DPV 35 in consecutive MLV- vaccinated pigs (Fig. 2.3 A&B). By DPV 42 both vaccine viral RNA copies were undetectable in serum. To determine the efficacy of our vaccination methods, one- half of the pigs in each group were challenged with homologous PRRSV-1 or PRRSV-2 at DPV

42 of initial vaccination. This experiment was terminated at DPC 10 (DPV 52) and the viral load in serum samples was quantified. After challenge, PRRSV-1 RNA copy numbers in serum of consecutive MLV vaccinated pigs were approximately 1 log less than concurrent vaccination group (Fig. 2.3A). Importantly, the replicating PRRSV-1 was undetectable in the consecutive vaccinated group (Fig. 2.3 C), while in concurrent vaccination group 2 of

3 pigs had 2 logs virus at DPV 52 (DPC 10) against the detection limit of 101.67 TCID50/ml

(Fig. 2.3 C). In contrast, viral genomic RNA copies of PRRSV-2 were undetectable at DPV

49 and DPV 52 (Fig. 2.3 B), and the live virus was undetectable until DPV 52 (Fig. 2.3 D).

Thus, our data suggest that consecutive but not concurrent vaccination of PRRSV-1 and

PRRSV-2 MLVs results in better replication of both the viral species in pigs.

2.4.3 PRRSV induced Toll-like Receptors expression in pig macrophages

Porcine alveolar macrophages derived from BAL cells were treated with PRRSV-1,

PRRSV-2 or both the viruses concurrently for 24 h and the levels of TLR-3 and TLR-9

72 mRNA expression were measured by qRT-PCR. Our results indicated that expression of

TLR-3 was relatively higher in PRRSV-2 treated cells either alone or concurrently with

PRRSV-1 (Fig. 2.4A). The expression of TLR-9 was significantly greater in both PRRSV-

2 infected cells either in the presence or absence of PRRSV-1 (Fig. 2.4B). This data suggest that the expression of TLR-3 and TLR-9 were weaker in PRRSV-1 compared to PRRSV-

2 treated PAM cells.

2.4.4 PRRSV specific lymphocytes response in pigs after vaccination (pre-challenge) in blood.

From both consecutive (group 2) and concurrent (group 3) vaccinated pigs, PBMCs were isolated at DPV 42/ DPC 0 (pre-challenge) and restimulated with PRRSV-1 or PRRSV-2 for analyzing the frequency of total and specific IFN- positive (activated) lymphocyte subsets by flow cytometry. Our results indicated that frequency of T-helper cells in group

2 and activated PRRSV-1 specific T-helper cells in group 3 were increased compared to mock pigs (P<0.05) (Fig. 2.5 A to D). But the frequency of PRRSV-2 specific total and activated T-helper/memory cells were increased (P<0.05) in group 3 pigs compared to mock (Fig. 4 H&K). The other T cell subsets were not significantly modulated in experimental vaccinated groups pre-challenge (Fig. 2.5 B, C, E, F, G, I, J, and L).

2.4.5 PRRSV specific lymphocyte response in pigs post-challenge in blood

PBMCs isolated from both consecutive (group 2) and concurrent (group 3) vaccinated pigs challenged with corresponding homologous PRRSV-1 and PRRSV-2 at DPC 10 were restimulated with the challenge virus. Our data detected increase (P<0.05) in the frequency of T-helper/memory and CTLs in both group 2 and group 3 animals compared to both mock

73 and mock-challenge groups (Fig. 2.6 A&B). But none of the other total and activated (IFN-

γ+) T cell subsets were altered significantly (Fig.2.6 CtoJ).

2.4.6 PRRSV specific lymphocytes response in pigs post-challenge in lung draining lymph nodes

Isolated TBLN MNCs of experimental pigs at DPC 10 were also restimulated with respective homologous viruses. Our data identified increase (P<0.05) in the frequency of

PRRSV-1 specific activated T-helper/memory and CTLs in group 2 pigs compared to both mock and mock-challenge groups (Fig.2.7 E&F). Exactly similar increase in PRRSV-2 specific activated T cell subsets were detected (Fig. 2.7 J&K). In addition, total CTLs were also increased in group 3 pigs (Fig. 6H). None of the other total and activated T cell subsets were altered significantly in group 2 and group 3 animals (Fig. 2.7 A to D and G).

2.4.7 PRRSV specific neutralizing antibody response in pigs post-challenge

PRRSV specific virus-neutralizing (VN) antibody response was analyzed at both pre- challenge (DPC 0) and post-challenge (DPC 10). Our results indicated that mock pigs complement inactivated sera did not have any background inhibition of virus infection at

1:2 dilution. In group 2 (consecutive vaccinated) pigs, VN titers against PRRSV-1 were higher (P<0.05) compared to group 3 (concurrent) and mock-challenge pigs at DPC 10 and not at DPC 0 (Fig. 2.8 A&B). PRRSV-2 specific VN titers were increased (P<0.05) in group 2 at pre-challenge and both at pre- and post-challenge in group 2 and group 3 pigs

(Fig. 2.8 C&D).

2.5 DISCUSSION

We observed strong interference of PRRSV-2 on PRRSV-1 replication in co-infected

MARC-145 cells. PRRSV-2 inference was very high when concurrently infected with

PRRSV-1, and when PRRSV-2 was infected first in a consecutive infection with PRRSV-

1, including when 10 times more MOI of PRRSV-1 was used. Thus, concurrent vaccination with PRRSV-1 and PRRSV-2 MLVs in pigs at risk of co-infection is not beneficial to induce herd immunity against both the viral species; especially immunity to PRRSV-1 will be greatly impaired. PRRSV-1 or PRRSV-2 MLV are routinely used in pigs which reduces clinical respiratory signs, lung lesions, viremia and morbidity to exposed homologous virus infection (Labarque et al., 2004; Leng et al., 2012; Renukaradhya et al., 2015b; Tian et al.,

2009; Wei et al., 2013). In the US, both species of PRRSV are circulating with constant increases in incidences of co-infection (Amadori and Razzuoli, 2014; Chen et al., 2011;

Nam et al., 2009; Park et al., 2015a; Ropp et al., 2004a).

To mitigate the outcomes of PRRSV co-infection an earlier study performed in

Korea vaccinated nursery pigs concurrently with PRRSV-1 and PRRSV-2 MLV, and found this method was relatively effective in protecting pigs from respiratory disease caused by heterologous PRRSV-1 but not PRRSV-2 in dually challenged pigs (Park et al., 2015b). In that study, due to a lack of a consecutive method of PRRS MLV vaccination, and like our study not including single (PRRSV-1 or PRRSV-2) virus challenge infection pig groups, it is difficult to compare with our results. However, consistent with that previous study, in pigs that received concurrent MLV vaccine, we too detected low VN titers (~3 log2) against PRRSV-2. Interestingly, the consecutive method of vaccination significantly

75 increased the VN titers (~6 log2) against both the viral species. PRRS VN antibodies have been reported to play an important role in reducing viremia and viral replication in lungs by inhibiting attachment and internalization of virus to alveolar macrophages (Batista et al., 2004; Labarque et al., 2000; Osorio et al., 2002). The protection efficacy of PRRS MLV is generally being assessed by viral clearance and development of VN antibodies in challenged animals (Labarque et al., 2000; Park et al., 2014).

Studies have shown that pathogenesis of PRRSV-1 and PRRSV-2 is different and the PRRSV-2, but not PRRSV-1, induces T-regulatory cell proliferation and impairs the host immune response (Gomez-Laguna et al., 2013; Halbur et al., 1996; Han et al., 2013).

In our study, lower levels of challenged PRRSV-1 in consecutive compared to concurrent vaccinated animals coincides with the induction of better adaptive immunity mediated by early presence of MLV PRRSV-1 from DPV 7. But in the concurrent group induction of poor immunity against PRRSV-1 was correlated with delayed detection of MLV at DPV

35. This could be due to increased tropism of PRRSV-2 to pulmonary targets than PRRSV-

1 vaccinated concurrently (Choi et al., 2015). Earlier studies showed better cellular tropism of PRRSV-2 to monocyte–macrophage lineage cells of the respiratory tract causing higher pulmonary pathology and virus distribution than PRRSV-1 in pigs (Gomez-Laguna et al.,

2013; Halbur et al., 1996; Han et al., 2013). Thus there is less interference on replication of PRRSV-1 by PRRSV-2 when injected consecutively with PRRSV-1 followed by

PRRSV-2, but not vice versa.

In a previous study in adult 8 months old boars, no such PRRSV interference was observed in induction of cellular and humoral immune responses (Jeong et al., 2017b). This

76 could be attributed to immune status and age of pigs, grownup pigs (> 20 weeks of age) elicits more abundant PRRSV specific IFN- secreting cells than nursery pigs (Klinge et al., 2009). However, in our study in both consecutive and concurrent vaccinates, PRRSV-

2 was efficiently replicated and induced a robust cell-mediated immune response helping the viral clearance. Thus, our study demonstrated a new strategy to overcome the initial interference caused by PRRSV-2 on PRRSV-1 MLV replication in naïve nursery pigs, and induced better protective response against both viral species to mitigate incidences of co- infection and single virus infection in a real field scenario.

The quantitative analysis of TLR transcripts by qRT-PCR revealed a similar pattern of expression of TLR-3, 7 and 9 by infected PAM cells in vitro (Kuzemtseva et al., 2014).

PRRSV infection in pigs is known to upregulate the mRNA expression of TLR-2, 3, 4, 7 and 8 in lymphoid tissues and cells (Liu et al., 2009). We showed that the levels of TLR-3 and 9 are differentially expressed in PAM cells infected with PRRSV-1 and PRRSV-2, indicating the likely difference in the initiation of early immune response. Both cell- mediated and humoral immune responses are necessary for efficient clearance of PRRSV from pigs. Th1 cytokine IFN-γ is produced by activated T-helper, CTLs and Th/memory cells in addition to innate NK cells, which is the key cytokine in cell-mediated immune response (Costers et al., 2009; Dwivedi et al., 2011b). In our study, in consecutively vaccinated pig group infectious PRRSV-1 was undetectable until DPC 10, but 2 of 3 pigs vaccinated concurrently had virus at DPC 10. However, live PRRSV-2 was undetectable by both the methods of vaccination. Despite the comparable cell-mediated immune response in terms of IFN-γ secreting activated CTLs and Th/memory cells in the TBLN

(but not in PBMCs) of pigs by both the methods of vaccination, we observed reduced VN titers in concurrent vaccinated pigs against both the virus species which needs further investigation. Suggesting that for better interpretation of cell-mediated immune response against PRRSV we need to consider evaluating the responses in the local lung draining lymph nodes (TBLN) of pigs.

This is the first study reporting the benefits of consecutive vaccination with

PRRSV-1 followed by PRRSV-2 MLV in nursery pigs, and compared the efficacy with concurrent vaccination and single virus challenge homologous infections. Efficacy of

PRRSV MLV depends on the genetic and antigenic relatedness between vaccine and challenge viral strains (Labarque et al., 2004), and hence it is necessary to evaluate the efficacy of consecutive vaccination against single and dual heterologous challenge viral infections.

In summary, the consecutive method of vaccination with PRRSV-1 and PRRSV-2

MLV elicited enhanced cellular and humoral immune responses against PRRSV-1, without interfering with responses elicited against PRRSV-2 in nursery pigs. Hence the consecutive but not the concurrent PRRS MLV vaccination strategy is more beneficial in finisher swine herds at risk for PRRSV-1 and PRRSV-2 co-infections. Further investigations are required to establish this result with more numbers of pigs and to identify an ideal time interval between PRRSV-1 and PRRSV-2 MLV vaccination to elicit the maximum protective efficacy against a single and dual infection in swine herds. Also we would like to assess the efficacy of these two vaccination methods using other PRRSV isolates derived MLVs, in pigs of different age groups, breeds and against duel challenge PRRSV infections.

2.6 Acknowledgement

This project was supported by Agriculture and Food Research Initiative Competitive Grant no. 2011-02925 from the USDA-NIFA to YF and GJR. Salaries and research support were also provided by state and federal funds appropriated to OARDC. We are thankful to Dr.

Juliette Hanson and Megan Strother who provided help in animal studies.

2.7 Disclosures

The authors have no financial conflict of interest.

Fig 2.1 Schematic representation of experimental design and sampling

Vaccination of pigs at day 0 and day 3. Serum collection from the vaccinated pigs at

0,3,7,15,21,28,35,42,45,49 & 52 days post vaccination (DPV). Challenging of pigs on 42

DPV. Euthanasia and sampling on 52 DPV.

Fig. 2.2: Strong interference of PRRSV-2 on PRRSV-1 replication in vitro showed by immunofluorescence assay. MARC-145 cells were infected with PRRSV-1 and PRRSV-2 at 0.1 MOI, and the infection was carried our either consecutively by infecting the cells first with PRRSV-1 or PRRSV-2 and then co-infected with PRRSV-2 or PRRSV-1, respectively, after 3, 6, 12, 24 and 30h of initial infection; or infected concurrently with both PRRSV-1 and PRRSV-2. Cells were fixed after 36 hours of initial infection and immunostained using mAb specific to PRRSV-1 and PRRSV-2 followed by treatment with Alexa-488 conjugated secondary antibody and the virus specific fluorescence was read using a fluorescent microscope. Similar results were obtained in another independent experiment.

Fig.2.3: Quantification of PRRSV genomic copy numbers and live virus in pigs. Pigs (n=6 per group) were vaccinated once with MLV PRRSV-1 and PRRSV-2 either consecutively (PRRSV-1 followed by PRRSV-2, 3 days apart) (closed circles) or concurrently (same day) (open circles) and 50% pigs (n=3) were challenged with homologous PRRSV-1 (A&C) and other 50% with homologous PRRSV-2 (B&D) at day post-vaccination (DPV) 42 and euthanized at DPV 52. Blood samples collected at various DPV were analyzed for genomic viral copy numbers by qRT-PCR (A&B); and for live virus titer after challenge at DPV 45, 49 and 52. Each data point is mean ± SEM values of 3 pigs (A&B) and one pig each (C&D).

Fig 2.4: PRRSV-1 and PRRSV-2 induced expression of TLRs in pig BAL cells. Cells collected from 3 pigs were separately stimulated with PRRSV-1 (0.1 MOI), PRRSV-2 (0.1 MOI), poly I:C (10µg/ml), CpG-ODN (10µg/ml) for 24 hrs and analyzed for the expression of mRNAs of A) TLR-3 and B) TLR-9 by RT-qPCR. The relative expression of mRNAs of TLRs were normalized to β-actin. Each bar is the mean ± SEM values of 3 pigs cells in each group. Asterisk denotes statistically significant difference (P < 0.05) between the indicated two groups. Groups 1: Mock; 2: PRRSV-1; 3: PRRSV-2; 4: PRRS- 1 + PRRSV 2 concurrent infection; 5: Poly I:C (TLR-3) or CpG-ODN (TLR-9). P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: B *P=0.0690.

Fig 2.5: Pre-challenge cellular immune response in PRRSV-1 and PRRSV-2 vaccinated pigs. PBMCs isolated from pigs at DPV42 (DPC0) were restimulated with PRRSV-1 (A to F) or (G to L) PRRSV-2 for 3 days and immunostained using pig specific markers for phenotyping and to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 3 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (** P< 0.01). Group 1. Mock; Group 2: Day0 PRRSV-1+Day3 PRRSV-2+Ch.; Group 3: Day 0 PRRSV-1+PRRSV-2+Ch. P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: A *P=0.0157; H **P=0.0288; D *P=0.0269; K *P=0.0232.

Fig 2.6: Post-challenge cellular immune response in PRRSV-1 and PRRSV-2 vaccinated pigs. PBMCs isolated from pigs at DPC10 were restimulated with PRRSV-1 (A-D) or (E-J) PRRSV-2 for 3 days and immunostained using pig specific markers for phenotyping and to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 3 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Day0 Type1+Day3 Type2+Ch.; Group 3. Day0 Type1+Type2+Ch.; Group 4. Mock+Ch. P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: A **P=0.0060; B *P=0.077.

Fig 2.7: Post-challenge cellular immune response in PRRSV-1 and PRRSV-2 vaccinated pigs. TBLN MNCs isolated from pigs at DPC10 were restimulated with PRRSV-1 (A-F) or (G-K) PRRSV-2 for 3 days and immunostained using pig specific markers for phenotyping and to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 3 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Day0 Type1+Day3 Type2+Ch.; Group 3. Day0 Type1+Type2+Ch.; Group 4. Mock+Ch. P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: G *P=0.0447; H **P=0.0019; E ***P=0.0004 F **P=0.0053 J **P=0.0085 K **P=0.0024.

Fig 2.8: PRRSV neutralization titers in vaccinated and homologous virus challenged pigs. Serum samples collected at pre- and post-challenge were subjected to virus neutralization against the respective challenge virus: (A&B) type 1 PRRSV and (C&D) type2 PRRSV. Each bar is the mean ± SEM values of 3 pigs. Data were analyzed by one- way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Day0 Type1+Day3 Type2+Ch.; Group 3. Day0 Type1+Type2+Ch.; Group 4. Mock+Ch. P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: B **P=0.0070; C *P =0.0100; D **P=0.008

Tables

Table 2.1: Strong interference of PRRSV-2 on PRRSV-1 replication in vitro showed by RT-PCR assay. MARC-145 cells were infected with PRRSV-1 (0.1 or 1.0 MOI) and PRRSV-2 (0.1 MOI), and the infection was carried our either consecutively by infecting the cells first with PRRSV-1 or PRRSV-2 and then co-infected with PRRSV-2 or PRRSV- 1, respectively, after 3, 6, 12, 24 and 30h of initial infection. Separate cell monolayers were also infected concurrently with both PRRSV-1 and PRRSV-2. The RNA was extracted from the infected MARC-145 cells after 6, 12, 24, 30 and 36 h after initial infection and subjected to RT-PCR using PRRSV-1 and PRRSV-2 specific primers sets which resulted in amplicon sizes 800 bp and 600 bp, respectively. Similar results were obtained in another independent experiment.

Description Primer Sequence (5’ to 3’) TLR-3 Forward GAGCAGGAGTTTGCCTTGTC Reverse GGAGGTCATCGGGTATTAGA TLR-9 Forward AGGGAGACCTCTATCTCCGC Reverse AAGTCCAGGGTTTCCAGCTT β-Actin Forward TTGGGCATGGAGTCCTGC Reverse CGCGATGATCTTGATCTTCATG

TLR- Toll-like receptor Table 2.2: Details of the primer sequences used in the study

PRRSV challenge Groups Type of PRRSV vaccine Blood collection days at DPV42 1 Mock/A N/A 0, 3, 7, 14, 21, 28, 35, 42, 45, 49, 52 2 MLV PRRSV-1 Day 0 & PRRSV-1 0, 3, 7, 14, 21, 28, 35, 42, 45, 49, 52 MLV PRRSV-2 Day 3 PRRSV-2

3 MLV PRRSV-1 Day 0 & PRRSV-1 0, 3, 7, 14, 21, 28, 35, 42, 45, 49, 52 MLV PRRSV-2 Day 0 PRRSV-2

4 Mock PRRSV-1 0, 3, 42, 45, 49, 52 PRRSV-2 DPV- Day post-vaccination; DPC - Day post-challenge; MLV-Modified live virus accine

Table 2.3: Experimental design of PRRSV-1 and PRRSV-2 vaccination and challenge study in pigs

CHAPTER 3

Efficacy of PRRSV-1 & PRRSV-2 killed virus delivered with non-toxic enterotoxin

(LT) adjuvant and E. coli expressing immunogenic conserved PRRSV epitopes to

induce protective response against PRRSV challenge infection in pigs

Acknowledgement

Note: The technologies of “Antigen-Adjuvant Chimera Constructs for Swine Vaccination and a Non-Toxic Enterotoxin and E. coli as an Adjuvant-Delivery System” are invented by investigators (PI: Weiping Zhang) at Kansas State University and are protected under

Kansas State University’s pending patent application. Some of the in vitro and in vivo study data are included as support for examples of these patent pending technologies

3.1 Summary

Porcine reproductive and respiratory syndrome virus (PRRSV) causes significant economic losses to the swine industry. Both PRRS killed vaccines and modified live vaccines (MLVs) have been in use over the past three decades. However, commonly used

MLVs have failed to protect against reinfections and field outbreaks of PRRSV-1 and

PRRSV-2. Safety of the live virus vaccines is also a concern. Studies have claimed that the killed vaccines are safe but poorly immunogenic. In the present study, we evaluated the protective efficacy of killed vaccine of PRRVS-1 and PRRSV-2 delivered with non-toxic heat labile (LT) enterotoxin as an adjuvant and immunogenic conserved epitopes of

PRRSV expressed by E.coli as a booster vaccine against homologous viruses challenge infection in pigs. The PRRSV-1 and PRRSV-2 vaccine viruses were inactivated using binary ethylene imine (BEI) and administered intramuscularly along with LT protein as adjuvant. At day post-vaccination (DPV) 14 and 28, three E.coli cultures expressing 4 peptides each, a total of 12 different PRRSV T-cell epitopes, were administered orally as a booster vaccination. At day 42, half of the pigs in each group were challenged with homologous PRRSV-1 or PRRSV-2. This study was terminated at day post-challenge

(DPC) 10. Immunologically, at DPV 42 isolated PBMCs restimulated with challenge

PRRSV-1 observed enhanced frequency of IFN-g secreting T-helper/memory cells against

PRRSV-1, and enhanced frequency of IFN-g secreting cytotoxic T-cells against PRRSV-

2. At DPV 52, PBMCs restimulated with challenge viruses (PRRSV-1 & PRRSV-2) and the individual peptides had enhanced frequency of IFN-g secreting T-helper/memory, T-

92 helper, cytotoxic T lymphocytes in comparison to mock-challenge group. Pigs that received killed vaccine with adjuvant showed 1 log10 reduction in detectable infectious

PRRSV-2 at DPC 3 and DPC 6, and 1.5 log10 reduction in PRRSV-1 titer at DPC 6 in serum. Pigs that received killed vaccine showed higher VN titer (~4 log2) against PRRSV-

2 and < 2 log2 titer against PRRSV-1 in pigs. In conclusion, killed PRRSV vaccination with LT adjuvant along with E. coli expressing immunogenic PRRSV epitopes induced a robust cell-mediated immune response, especially a T cell response and improved the adaptive immune response in pigs.

3.2 Introduction

PRRSV causes severe economic losses to the swine industry and remains one of the major disease challenges to the swine industry throughout the world. The disease was first identified in the US during 1987 and appeared in the Europe in 1990 (Collins et al., 1992;

Wensvoort et al., 1991b). Since then it has become an endemic disease throughout the globe, and also the virus has been continuously evolving and causing new outbreaks

(Chand et al., 2012; Tian et al., 2009). The causative agent of PRRS was first identified by researchers at the Central Veterinary Institute (Lelystad, The Netherlands) during 1991

(Terpstra et al., 1991; Wensvoort et al., 1991a), and at the same time it was isolated in the

United States (Benfield et al., 1992; Collins et al., 1992). PRRS is caused by an enveloped, single stranded, linear, positive sense, RNA virus, called PRRSV, belonging to the family

Arteriviridae, in the order Nidovirales (Cavanagh, 1997). Recently, PRRSV was regrouped in to genus Porartivirus and classified into two species, PRRSV-1 (formerly named type 1

PRRSV or genotype 1) and PRRSV-2 (formerly named type 2 PRRSV or genotype 2); along with two murine arterivirus species lactate dehydrogenase-elevating virus and Rat arterivirus-1 (Adams et al., 2017b). PRRSV causes respiratory distress in pigs of all ages associated with severe morbidity and mortality, decreased growth performance in growing/finishing pigs and reproductive failure in sows which includes increased premature farrowing, abortion in late term, poor farrowing rate, decreased farrowing rate, mummified fetuses and stillborn piglets with respiratory disease (Albina et al., 1994;

Benfield et al., 1992; Cho et al., 2006; Chung et al., 1997). The PRRSV-1 and PRRSV-2 are constantly evolving at the highest evolutionary rate (on the order of 10-2 /site/year) and thus evade the vaccine induced immunity and re-emerging as new variant causing fresh new outbreaks continuously (Hanada et al., 2005; Morgan et al., 2013).

As per the report mentioned by Rock DL in the American association of Swine veterinarians 2007, the ideal PRRS vaccine should possess the ability to rapidly induce both innate and adaptive immune responses, protection against most currently prevalent

PRRSV strains, should not cause adverse effects to swine health and should be differentiated from infected animals. Both PRRSV modified-live vaccines (PRRSV-MLV) and PRRS killed virus (KV) vaccines have been in use since the appearance of PRRSV, but are not efficient in protection against wide array of heterologous field isolates (Butler et al., 2014). PRRSV-MLVs do confer protection against genetically homologous wild type

PRRSV strains but provide only partial protection or no protection against heterologous strains (Charerntantanakul, 2012; Roca et al., 2012). Apart from efficacy issues of MLV another concern is safety issue, because of the presence of PRRSV outbreaks in vaccinated

94 swine herds, virus shedding and persistence of genetically changed MLVs derived infections in herds and recombination of MLVs with wild type viruses (Botner et al., 1997;

Charerntantanakul, 2012; Madsen et al., 1998; Mengeling et al., 1998; Wang et al., 2013a;

Wang et al., 2010; Wenhui et al., 2012).

In contrast, killed/inactivated PRRSV vaccines are safe but provide limited protection against both homologous and heterologous virus infections. The efficacy of killed virus vaccines is associated with lack of sufficient levels of production of PRRSV specific neutralizing antibodies and weak cell-mediated immune response (CMI) and thus inability to clear the virus (Kim et al., 2011; Nilubol et al., 2004; Piras et al., 2005; Zuckermann et al., 2007). However, PRRSV seropositive sows boost the CMI and neutralizing antibody

(NA) responses after continuous exposure to virus or long-term administration of killed virus vaccines (Papatsiros et al., 2006). In our previous studies, adapting new vaccination strategies using potent mucosal adjuvant like whole cell lysate of Mycobacterium tuberculosis and nanoparticle-entrapped inactivated PRRSV vaccine delivery system made of poly (lactic-co-glycolic) acid demonstrated the induction of broadly reactive cross- protective anti-PRRSV immune responses against heterogeneous virus strains

(Binjawadagi et al., 2014b). Hence there is an urgent need of developing more efficient vaccination strategies like novel alternate techniques to produce next generation killed virus or subunit vaccines including potent adjuvants and vaccine delivery systems to develop better and safe PRRSV vaccines.

The E. coli heat labile (LT) adjuvant has been used successfully as one of the mucosal adjuvants to enhance host immunity to various pathogens that cause respiratory diseases

(Cheng et al., 1999; Clements, 1990). The LT adjuvant has two subunits, toxic A subunit

(LTA) and toxic B subunit (LTB). LTB is pentameric in structure, function as carrier protein and a potent mucosal immunogen, induces enhanced systemic and mucosal immune responses when co-administered with a unrelated antigen/s to the mucosal surfaces

(Dickinson and Clements, 1995; Liljeqvist et al., 1997). In the present study, we adapted a novel approach for vaccine development by utilizing the conserved immunogenic epitopes that elicit both humoral and cellular immune responses simultaneously against heterologous PRRSV strains. In our study, pigs were vaccinated using both PRRSV-1 and

PRRSV-2 killed viruses with a potent mucosal adjuvant, LT (thermo labile) enterotoxin produced by E.coli, co-administered intramuscularly as a prime dose; and boosted orally with three E. coli cultures expressing four each of conserved PRRSV T-cell epitopes (total

12) conjugated to nontoxic E. coli enterotoxin to induce robust cross-reactive immune responses.

3.2.1 Rationale of the study

Killed and subunit PRRSV vaccines are safe but poorly immunogenic and they failed to elicit protective T-cell response. Soluble killed viruses failed to present T-cell epitopes to immune cells and subunit vaccines are expensive. Goal of our study is to induce robust cross-reactive humoral and cell-mediated immune responses against both PRRSV species

(PRRSV-1 and PRRSV-2) using an innovative strategy comprising of killed viruses and

PRRSV T cell epitopes delivered in E. coli adjuvant system. To achieve our goal, we vaccinated pigs with A) both killed PRRSV species co-administered with heat labile (LT)

96 enterotoxin adjuvant; and boosted with B) cocktail of PRRSV conserved immunogenic T cell epitopes constructed in non-pathogenic E. coli vector for oral delivery.

3.2.2 Hypothesis of the study

PRRSV-1 and PRRSV-2 killed vaccine priming and E. coli expressed PRRSV epitopes conjugated nontoxic enterotoxin boost by oral route induces robust cross-reactive immune response in pigs.

3.3 Materials and methods

3.3.1 Cells, PRRSV, Adjuvants and T-cell epitopes

PRRSV-1 (strain SD01-08) (Fang et al., 2006b) (GenBank accession no. DQ489311.1) and

PRRSV-2 (SD95-21) (GenBank accession no. KC469618) were grown in Mycoplasma- free MARC-145 cells (African green monkey kidney cell line) to prepare the virus stocks.

MARC-145 cells were maintained in Dulbeco’s Modified Eagle Medium (Gibco) supplemented with 10% heat inactivated fetal bovine serum and antibiotics (100 units/mL

o penicillin, 100µg/mL streptomycin and 0.25 µg/mL of fungizone) at 37 C with 5% CO2.

For virus infection, DMEM supplemented with 2% heat inactivated fetal bovine serum was used. PRRSV-1 (SD01-08) and PRRSV-2 (SD95-21) were used for homologous challenge infections. The non-toxic heat labile (LT) enterotoxin of E.coli was used as an adjuvant

(Zhang and Francis, 2010a) which was provided by Dr. Ying Fang (Kansas State

University). Conserved 12 potential T-cell epitopes of PRRSV-1 and PRRSV-2 expressed in non-pathogenic E. coli were provided by Dr. Ying Fang (Kansas State University).

3.3.2 Preparation of killed vaccines

Both PRRSV-1 and PRRSV-2 propagated in MARC-145 cells were concentrated by using ultracentrifugation at 112,000 xg for 2 h using a Type 35 rotor (Beckman Coulter, Analis,

Ghent), and subsequently viruses were semi-purified by ultracentrifugation at 100,000 xg for 3 hr by using the 30% sucrose cushion in a SW41Ti rotor (Beckman Coulter). The virus pellet was resuspended in PBS and stored at -80 oC.

3.3.3 Virus inactivation using binary ethylene imine (BEI) method

7.33 8.33 Semipurified PRRSV-1 and PRRSV-2 having the titer of 10 TCID50/ml and 10

TCID50/ml, respectively, were inactivated by using BEI as described previously

(Bahnemann, 1990). Briefly, 0.1 M stock of BEI was prepared by cyclization of 2- bromoethylamine in 0.175 M NaOH for 1 h at 37 oC and stored at 4 oC. Virus was inactivated by incubation with 1 mM BEI for 24 hr at 37 oC. Subsequently, BEI was neutralized by incubation with 0.1 mM Sodium thiosulphate for 2 hr at 37 oC. Inactivated virus was stored at -80o C.

3.3.4 Analysis of complete inactivation of PRRSV

To confirm the complete inactivation of the PRRSV, 1 mL each of inactivated virus suspension was inoculated on MARC-145 cells in a 150 cm2 tissue culture flask with 25 mL of virus infection medium. The cells were cultured for 1 week at 37o C, subsequently the supernatant was transferred to a fresh 150 cm2 tissue culture flask and incubated for another week. Inoculation of MARC-145 cells with 1 mL of non-inactivated virus and medium for 72 h were included as positive and negative controls, respectively. At the end of the incubation period, cells were analyzed for cytopathic effect (CPE) and fixed with

80% acetone and subjected to indirect immunofluorescence assay using mouse anti-

PPRSV nucleocapsid protein specific mAb (SDOW-17) to detect infected cells (Vanhee et al., 2009; Wieczorek-Krohmer et al., 1996).

3.3.4 Construction and expression of potent T-cell multi epitopes antigens

Bacterial strains and plasmids: The data is not included here as the technologies of

“Antigen-Adjuvant Chimera Constructs for Swine Vaccination and a Non-Toxic

Enterotoxin and E. coli as an Adjuvant-Delivery System” are invented by investigators (PI:

Weiping Zhang) at Kansas State University and are protected under Kansas State

University’s pending patent application.

Based on immunogenic properties and percentage of conservation within and between

PRRSV-1 and PRRSV-2 species, conserved 12 PRRSV T-cell epitopes were selected. Four multi-epitope constructs were prepared in each individual E. coli construct named A, B, C and D; and each bacterial culture contain three T-cell epitopes as described previously

(Fang et al., 2008; Sun et al., 2004) with modifications. PRRSV T-cell epitopes included in the multi epitope construct are shown in table 1. Each of the plasmid containing PRRSV epitope was transformed into E. coli to generate a modified live E. coli carrying the PRRSV epitopes, and each constructed bacteria were designated as E. coli PRRSV epitopes A to

D. The expression and confirmation of the biological activity of the constructs was performed at Kansas State University by in vitro methods as previously described by (Fang et al., 2012b; Zhang and Francis, 2010a; Zhang et al., 2012).

3.3.5 Evaluation of the efficacy of combined killed PRRSV-1 and PRRSV-2 along with PRRSV-epitope-LT E. coli adjuvant against homologous PRRSV-1 and

PRRSV-2 virus infection in pigs

Experimental design

Conventional crossbred nursery pigs weaned at 3-4 weeks of age were obtained from The

Ohio State University (OSU) swine herd and housed in BSL2 isolation rooms at OARDC.

Pigs were randomly (male and female) divided into 3 experimental groups (group 1: n=6; and groups 2 & 3: n=12 each). One mg of LT enterotoxin adjuvant mixed with inactivated

8 PRRSV-1 and PRRSV-2 (10 TCID50 per pig dose) was administered intramuscularly 1 ml per dose on either side of the neck as a prime immunization to group 3 pigs. Groups 1 and

2 were mock vaccinated using DMEM. For boosting of animals, E coli expressing T-cell multi-epitopes construct in four different E. coli expressing total of 12 PRRSV T cell epitopes were used. Briefly, E coli cultures were propagated in LB medium supplemented with ampicillin. LB Medium was prepared by dissolving 25 g of LB powder in 1 liter of distilled water with constant stirring on the magnetic stirrer and autoclaved. Four different

E .coli each expressing three multi epitope constructs named A, B, C and D were provided by Dr. Ying Fang (Kansas State University). Each bacterium from individual plates were inoculated separately into 5 ml LB broth supplemented with ampicillin in a shaker incubator for 8 hr at 37 oC for further scale-up. One ml of the bacterial culture was transferred in to 100 ml fresh LB broth supplemented with ampicillin in a shaker incubator for overnight at 37 oC. On day 14 and 28 after prime vaccination, booster vaccination was performed orally containing approximately 3 X109 CFU of each bacterium per dose. On

100

42 days post-vaccination (DPV), half of the pigs (6 pigs in group) of groups 2 and 3 were placed in separate isolation rooms and challenged with respective homologous PRRSV-1

5 or PRRSV-2 10 TCID50 /mL per pig through IM route (Table 2). The mock control group

1 was similarly challenged with DMEM. Animals were monitored daily for any PRRS signs (anorexia, cough and labored breathing), and rectal temperature was recorded every third day until necropsy. All the pigs of experimental groups were fed with water and feed ad libitum, and all the experimental procedures were compiled in accordance with the guidelines of the Institutional Animal Care and Use Committee of The Ohio State

University.

3.3.6 Collection of samples for analysis

The blood samples (3 to 8 ml) were collected at DPV 0, 3, 7, 14, 21, 28, 35, 42, 45, 49 and

52, and serum was separated using clot activator (BD vaccutainer) tubes and aliquots were stored at -80oC until used in analysis. Pigs were euthanized at 10 days post-challenge

(DPC) and lungs were examined for gross lesions during the necropsy. The samples of lung, tonsils, tracheobronchial lymph nodes were collected by three methods by snap freezing (immediately on dry ice), in RNA later and in formalin. Bronchoalveolar lavage

(BAL) fluid was collected by infusing 20 ml PBS containing 2% EDTA through the trachea into lung lobes and the BAL fluid was harvested after gentle massaging all the lung lobes.

The lung lysate samples were prepared after homogenizing 1 g of lung tissue collected in

3 mL of DMEM, centrifuged and the supernatant was collected. The aliquots of BAL fluid and lung lysate samples were stored at -80oC until used in the study.

101

3.3.7 Isolation of peripheral blood and tracheobronchial lymph nodes mononuclear cells

Blood was collected in EDTA for isolating peripheral blood mononuclear cells (PBMCs) at DPC 0 (DPV 42) and DPC 10 as described previously (Dhakal et al., 2017). Briefly,

PBMCs were isolated by using density gradient medium Lymphoprep in SepMate-50 tubes

(Stemcell, BC, Canada) as per the manufacturer’s instructions. Tracheobronchial lymph nodes (TBLN) derived mononuclear cells (MNCs) from individual pigs were isolated at

DPC 10 as described previously (Dwivedi et al., 2011b). Briefly, TBLN was collected in

3.3.8 Analysis of PRRSV load, viral titer and virus neutralizing antibody titer

All those assays were performed by using standard indirect immunofluorescence assay

(IFA) as described previously (Benfield et al., 1992; Reed and Muench, 1938). Briefly, for virus titration MARC-145 confluent monolayer cells in 96-well plates were incubated with

10-fold dilutions of serum for 24 h. For determination of virus neutralization (VN) titers, serum was heat treated for complement inactivation, two-fold diluted samples in DMEM were incubated with an equal volume of SD01-08 or SD95-21 virus isolates containing 100

o TCID50 per well for 2 hr at 37 C. One hundred microliter of the mixture was transferred to 96-well microtiter plate containing a confluent monolayer of MARC-145 cells and

102 incubated for 48 hr or 24 hr at 37oC with SD01-08 or SD95-21, respectively. The time and the 100 TCID50 of PRRSV-1 and PRRSV-2 used in the assay were optimized before this analysis. Subsequently, cells were fixed with acetone water and treated with anti-PPRSV nucleoprotein specific mAb (clone SDOW17; Rural Technologies, Inc., Brookings, SD) followed by Alexa-488 conjugated anti-mouse IgG(H+L) secondary antibody. The immunofluorescence was observed under a fluorescent microscope after mounting with

PBS and glycerol at 6:4 ratio.

Limit of detection for Virus titration

PRRSV titration by end point dilution was performed in MARC145 cells grown in 96-well plates. The 50% end point titer was expressed as tissue culture infectious dose 50%

(TCID50)/ mL, with a limit of detection of 101.67 TCID50/ml (Li et al., 2016).

3.3.9 Analysis of cellular immune response through phenotyping the lymphocyte subsets by using flow cytometry

Briefly, PBMCs isolated at DPV 14, 28, 42 and DPV 52, and TBLN MNCs isolated at

DPC 10 were restimulated with pooled or individual peptide (2 µg/ml), PRRSV-1 (0.1

MOI), PRRSV-2 (0.1 MOI) or complete media (cell control, CC) for 72 hr at 37°C in a 5%

CO2 incubator. The culture supernatant was analyzed for IFN-γ by ELISA. The cells were washed once in fluorescence-activated cell-sorting (FACS) buffer, counted and treated with 2% pig serum in FACS buffer to block Fc receptors and surface labeled with pig

103 lymphocyte specific purified, fluorochrome or biotin conjugated mAbs followed by treatment with fluorochrome labeled anti-mouse isotype specific or streptavidin conjugated secondary antibody. Antibodies used include: anti-porcine CD3 (Southernbiotech, AL),

CD4α (Southernbiotech, AL), CD8α (Southernbiotech, AL), CD8β (BD Biosciences, CA).

For intracellular IFN-γ staining, GolgiPlug™ (BD Biosciences, CA) and Brefeldin A

(Sigma, MO) were added during the last 6 h of incubation of cells treated with or without indicated restimulants. Finally, surface stained cells were fixed with 1% paraformaldehyde and permeabilized with cell permeabilization buffer (85.9% deionized water, 11% PBS without Ca2+ or Mg2+, 3% formaldehyde solution, and 0.1% saponin) overnight at 4 °C.

Cells were washed and immunostained using fluorochrome conjugated anti-pig IFN-γ or its isotype control mAb (BD Biosciences, CA) in 0.1% saponin containing FACS buffer.

Immunostained cells were acquired using the flow cytometer (BD Aria II, BD Biosciences,

CA) and analyzed using the FlowJo software (V.10 Tree Star, OR). All specific cell population frequencies were presented as the percent of total CD3+ T lymphocytes. Further analysis was performed to determine three important lymphocyte subpopulations based on the expression of cell surface markers: T-helper cells (CD3+CD4+CD8-), cytotoxic T- lymphocytes (CTLs) (CD3+CD4-CD8+CD8β+) and T-helper/ memory cells

(CD3+CD4+CD8+)

3.3.10 Statistical analysis

Data were presented as mean ± SEM of 6 pigs in each treatment group. Statistical significance was determined by one-way analysis of variance (ANOVA) followed by post-

104 hoc Tukey's test using GraphPad Prism 5.0 InStat. A P value < 0.05 was considered statistically significant.

3.4 Results

3.4.1 Detection of PRRSV specific VN titer in serum

The immunogenicity of PRRSV killed vaccine with adjuvant and E. coli expressed T cell epitopes conjugated to nontoxic LT adjuvants as oral boost was assessed in PRRSV antibody negative 4-5 weeks old nursery pigs. PRRSV specific virus neutralizing (VN) antibody response was determined at both pre-challenge (DPC 0) and post-challenge (DPC

10). Our results indicated that mock pigs’ sera did not had any background inhibition of virus infection at 1:2 dilution. In group 3 pigs, VN titers against PRRSV-2 were significantly higher (4 log2, P<0.05) compared to group 2 (mock-challenge) pigs at DPC

10, and at DPC 0 the respective titers was>2log2 (Fig. 3.2 A&B). But the VN titer was < 2 log2 in pigs vaccinated and challenged with PRRSV-1 at DPC 10 (Fig. 3.2 C).

3.4.2. Detection of virus load in the sera samples

Sera samples collected at DPC 0 (DPV 42), DPC 3 (DPV 45), DPC 6 (DPV 48) and DPC

10 (DPV 52) were subjected to virus titration in MARC-145 cells. Vaccine received pigs

(group 3) had 1 log reduction in infectious PRRSV-2 at DPC 3 and 6; and PRRSV-1 titer was 1.5 log reduced at DPC 6 and 1 log reduced at DPC 9 compared to mock-challenge pigs (Fig 3.3 A&B).

3.4.3. PRRSV specific cellular immune response in vaccinated pigs pre-challenge

105

PBMCs isolated from candidate vaccine-immunized pigs at DPV 14, DPV 28 and DPV 42 were measured for the frequency of total and specific IFN- positive (activated) lymphocyte subsets by flow cytometry. In that assay isolated PBMCs were restimulated with PRRSV-1 (0.1 MOI), PRRSV-2 (0.1 MOI), pooled 12 peptides (2 g/ml each peptide) or media (cell control) for 72 hr. Cells were immune-stained and analyzed for the frequency of specific IFN- positive (activated) lymphocyte subsets. Our results indicated that

PBMCs collected and restimulated with homologous vaccine virus PRRSV-1 or PRRSV-

2 or pooled peptides at DPV 14 and 28 were not significantly modulated in vaccinated pigs compared to unvaccinated controls. Whereas at DPV 42 the frequency of activated T- helper/memory cells (CD3+CD4+CD8α+IFN-γ+) specific to PRRSV-1 and pooled peptides, activated cytotoxic T-cells (CD3+CD4-CD8α+CD8β+IFN-γ+) specific to PRRSV-2 were significantly increased (p<0.05) in vaccinated compared to unvaccinated control pigs (Fig

3.4, 3.5 &3.6).

3.4.4. PRRSV-1 and PRRSV-2 specific cellular immune responses in the blood of pigs’ post-challenge

PBMCs isolated at DPC 10 from candidate vaccine immunized and unvaccinated mock pigs challenged with homologous PRRSV-1 or PRRSV-2 were restimulated with the respective challenge virus and immunostained to determine the frequency of specific IFN-

 positive (activated) lymphocyte subsets. Our results detected significantly increased

(P<0.05) frequency of PRRSV-1 specific total and activated T-helper/memory (IFN-γ+), total and activated CTLs (IFN-γ+), total and activated T-helper cells (IFN-γ+) in vaccine immunized group compared to non-immunized groups (Fig 3.7). Similarly, detected

106 significant increase (P<0.05) in the frequency of PRRSV-2 specific activated (IFN-γ+) T- helper/memory cells, activated (IFN-γ+) CTLs, and activated (IFN-γ+) T-helper cells in vaccinated compared to unvaccinated (mock and mock-challenge) pig groups (Fig 3.7).

3.4.5 Pooled peptide and individual peptide specific cellular immune response in the blood of pigs post-challenge

PBMCs isolated at DPC 10 from the candidate vaccine immunized pigs and non- immunized control pigs challenged with PRRSV-1 or PRRSV-2 were restimulated with pooled peptides (2g/ml each peptide). Our results detected significant increase (P<0.05) in the frequency of PRRSV-1 specific T-helper/memory, activated (IFN-γ+) T- helper/memory cells, CTLs, activated (IFN-γ+) CTLs, activated (IFN-γ+) T-helper cells in vaccine immunized group compared to non-immunized groups (Fig 3.8). Similarly, detected significant increase (P<0.05) in the frequency of PRRSV-2 specific activated

(IFN-γ+) T-helper/memory cells, activated (IFN-γ+) CTLs and activated (IFN-γ+) T-helper cells in vaccinated pig group compared to unvaccinated (mock and mock-challenge) groups

(Fig 3.8).

We further analyzed the specific cellular immune responses against each of the 12 individual peptides. The multi-epitope constructs were delivered orally as boost which contained three T-cell epitopes in each E. coli construct: construct A (A1, A2 and A3 peptides), construct B (B1, B2 and B3 peptides), construct C (C1, C2 and C3 peptides) and construct D (D1, D2 and D3 peptides), were used individually to restimulate PBMCs. Our results indicated that PBMCs from pigs challenged with PRRSV-1 (Fig 3.9&3.10) or

107

PRRSV-2 (Fig 3.11&3.12) showed significant increase (P<0.05) in the frequency of lymphocyte subsets specific to individual peptides as shown in the table 3.2.

3.5 Discussion

PRRSV-1 and PRRSV-2 are constantly evolving at the highest evolutionary rate (on the order of 4.7 to 9.8x10-2 /site/year) which helps in evading the vaccine induced immunity and re-emergence of new variants causing constant PRRS outbreaks in pigs (Hanada et al.,

2005; Morgan et al., 2013). This constant genetic variation is the major obstacle for development of broadly protective vaccines for PRRSV-1 and PRRSV-2. A safe and effective vaccine is critical to control and eradicate PRRS around the globe. To achieve better control and eradication strategies we need a vaccine candidate which is safe and cross-protective in vaccinated animals (Renukaradhya et al., 2015a). The current inactivated PRRSV vaccines are safe but they failed to protect pigs against even homologous challenge infection due to lack of induction of a cell-mediated immune response associated with low VN antibodies (Bassaganya-Riera et al., 2004; Piras et al.,

2005). Hence in this study, we used a new strategy to elicit both humoral and cellular immune responses by adapting innovative inactivated and subunit PRRSV vaccines with a potent adjuvant formulation and delivery methods, which includes inactivated PRRSV-1 and PRRSV-2, mucosal adjuvant (E. coli LT) as prime vaccine and oral boosting with

PRRSV T-cell epitopes-LTB toxin conjugate.

Recently, researchers have reported the use of mixture of conserved immunogenic epitopes of both T and B cells to induce robust immune responses simultaneously against

108 heterologous viruses (Parida et al., 2012). Our collaborator at Kansas state university has successfully constructed and expressed multi-epitope and toxin conjugate using a set of consensus T-cell epitopes from structural proteins and non-structural proteins of PRRSV.

This was aimed to simultaneously induce potent cell-mediated immune response against both the PRRSV species. Previous studies confirmed the augmented effect of using more than two epitopes together against influenza virus (Adair, 2009; Sun et al., 2013b). The use of multiple epitopes to form heterovalent vaccines is beneficial as it covers wide antigen diversity of a pathogen, and reduces the risk of pathogen escape due to immune pressure like mutational adoption of pathogen (Skwarczynski and Toth, 2016). In our study, the beneficial effects of multi-epitope constructs were observed through enhanced cell- mediated immune response against both the PRRSV species.

Peptides alone when injected are poorly immunogenic, thus peptides were conjugated to a strong mucosal adjuvant like the E. coli LT, a protein with potent mucosal adjuvant property (Clements et al., 1980). LTB subunit by itself is an immunogen and enhances the immune response by acting as a carrier protein for the co-administered vaccine antigen when genetically fused with LTB. It delivers the antigen across the mucosal epithelium to the underlying mucosa-associated lymphoid tissues and induces robust immune responses (Liljeqvist et al., 1997; Rosales‐Mendoza et al., 2009; Tacket et al., 1998; Zhang et al., 2010a). In our study, LTB subunit fused with PRRSV T-cell multi- epitopes were used. We administered the LT antigen intramuscularly along with PRRSV killed vaccine to enhance the immune response. In previous studies, LT or LT subunit

109

(LTB) has been used as an adjuvant to enhance the immunogenicity of viral/unrelated antigens (de Haan et al., 1998; Tamura et al., 1997).

Peptide epitope mixture does not assure the delivery of antigen to targeted APCs which will impair the immune response, hence many delivery systems have been in use

(Skwarczynski and Toth, 2016). In the present study, the epitope-toxin conjugate was subsequently transformed into a swine non-pathogenic E. coli strain to use as a vaccine boost by oral delivery. This proved to be the most economical method to deliver specific immunogenic T-cell epitopes (Zhang and Francis, 2010a).

The multi-epitope vaccines have been proposed against some of the RNA viruses which have extensive antigenic and genetic variations like HCV (Martin et al., 2004) or

HIV (Gruters et al., 2002); and also against chronic hepatitis B virus infection (Depla et al., 2008) and Foot and mouth disease virus (Sun et al., 2004). PRRSV also has high genetic variations and many T-cell epitopes have been identified on the PRRSV protein GP5, which is the abundant glycoprotein and a major inducer of neutralizing antibodies in both

PRRSV species (Diaz et al., 2009; Vashisht et al., 2008). The potential T-cell epitopes were also reported in PRRSV GP4 protein (Costers et al., 2010; Diaz et al., 2009; Meulenberg et al., 1997). Four potential T-cell epitopes were detected in the nucelocapsid protein (Diaz et al., 2009) and matrix protein of PRRSV which are considered as the most conserved proteins in PRRSV (Wang et al., 2011). Conserved immunogenic epitopes were also identified on the non-structural proteins (Fang and Snijder, 2010). Seven potential T-cell epitopes were identified on nsp9, nsp10 and nsp11 regions of PRRSV-2 (Parida et al.,

2012).

110

Our data demonstrated induction of specific T-cell responses in pigs against both

PRRSV-1 and PRRSV-2, suggesting that E. coli acted successfully as a delivery vehicle for T-cell multi epitopes to the host immune system. The oral boost was administered at

DPV 14 and 28, and after the second boost observed relatively increased frequency of lymphocytes subsets compared to the unvaccinated group. At DPV 42 observed significantly increased frequency of activated T-helper memory cells and CTLs against

PRRSV-1 and PRRSV-2, respectively. Further, after homologous challenge with PRRSV-

1 and PRRSV-2 we observed significantly increased frequency of lymphocyte subsets against PRRSV-1, PRRSV-2, pooled peptides and individual peptides. Thus, enhanced cell-mediated immune response was observed in the vaccinated pigs.

Reduction in viral load and detection of VN antibody in PRRSV-challenged pigs is an important criteria in evaluation of anti-PRRSV immunity. In our study, in pigs that received our candidate vaccine formulation detected marginal protection with 1 log reduction in infectious PRRSV-2 at DPC 3 and 6; and 1.5 log reduction in PRRSV-1 at

DPC 6 and 1 log reduction at DPC 9 compared to unvaccinated challenge pigs were detected. The PRRSV specific VN antibody titers in vaccinated pig sera against PRRSV-2 were significantly higher at DPC 10 and DPC 0. However, the VN titer was < 2 log against

PRRSV-1 in virus challenged pigs at DPC 10. These results were expected as booster dose was using multi T-cell epitopes constructs with B cell epitopes. However, the contribution of antigen toxin construct induced robust cell-mediated immune response and reduced the viral load.

111

The previous reports demonstrated that the efficiency of killed vaccines are less than ideal and induce poor cell-mediated and humoral immune responses (Bassaganya-

Riera et al., 2004; Piras et al., 2005; Zuckermann et al., 2007). Our animal challenge experiment demonstrated the potential of a killed and subunit PRRSV vaccine combination with the LT adjuvant in the modified E. coli platform to be considered in future vaccine studies against infection of both the PRRSV species. Our vaccine candidate induced efficient cell-mediated immune response against both the species PRRSV challenge. In the future, our candidate vaccine construct can be modified by including epitopes/antigens to stimulate neutralizing antibody response also.

The present vaccination method demonstrated that the efficient delivery of killed

PRRSV vaccines with LT adjuvant as prime and oral boost of conserved T-cell epitope toxin conjugate through oral delivery enhanced the cellular immune response. Recently,

DNA-MLV prime-boost immunization was shown to enhance PRRSV MLV-induced specific immunity against highly pathogenic PRRSV infection (Sirisereewan et al., 2017a).

Further studies are needed to determine the protective efficacy of our candidate vaccine formulation against heterologous virus challenge. Confirmation of our results with more numbers of animals is needed to fully evaluate the protective efficacy of our candidate vaccine. In summary, this study represents our initial effort towards enhancing the breadth of immune response of killed PRRSV vaccine by using a potent LT adjuvant and oral delivery of multi-epitope-toxin conjugate through a nonpathogenic E. coli carrier platform.

112

Fig 3.1: Schematic representation of experimental design and sampling

Vaccination of pigs with killed vaccines along with LT adjuvant on day 0 and oral boosting with PRRSV-epitopes-toxin-cocktail mix on 14 & 28 days post- vaccination (DPV). Serum collection from the vaccinated pigs at DPV 0,3,7,15,21,28,35,42,45,49 & 52 and pigs were challenged at DPV 42. Euthanasia and sampling was performed at DPV 52.

113

Fig. 3.2: PRRSV neutralization titers in killed vaccine and homologous virus challenged pigs. Serum samples collected post-vaccination at indicated pre- and post- challenge days were subjected to virus neutralization titers against the respective challenge viruses: (A&B) PRRSV-2 and (C) PRRSV-1. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05). Group 1. Mock; Group 2. Mock + Challenge; Group 3. Killed vaccine (PRRSV-1 & PRRSV-2) + Challenge. P-value for panel B, was analyzed by one-way ANOVA followed by Tukey’s post-hoc test: B *P=0.0131.

114

Fig 3.3: Quantification of infectious PRRSV titer in pigs. Pigs were vaccinated with killed (PRRSV-1 and PRRSV-2) vaccine along with LT adjuvant and boosted twice with E. coli expressing PRRSV T-cell multi-epitopes-LT toxin conjugate and challenged with the respective homologous virus. Blood samples collected at DPC 0 (DPV 42), DPC 3 (DPV 45), DPC 7 (DPV 49) and DPC 10 (DPV 52) were analyzed for live (A) PRRSV-1 and (B) PRRSV-2 titer using MARC-145 cells. Each data point is an average value of 6 pigs.

115

Fig.3.4: Pre-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated from pigs at DPV 14 were restimulated with PRRSV-1 and pooled peptides (A to F) or PRRSV-2 and pooled peptides (G to L) for 3 days and immunostained using pig specific lymphocyte markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by unpaired t-test with two tailed p-value at 95% confidence interval. Asterisk refers to statistical significant difference between the indicated two groups (* P< 0.05; ** P< 0.01). Group 1. Mock; Group 2: killed vaccine (PRRSV-1 and PRRSV-2) restimulated with PRRSV-1 or PRRSV-2 ; Group 3: killed vaccine ( PRRSV- 1+PRRSV-2) restimulated with pooled peptides. P-value for each panel analyzed by Student’s t- test: G *P=0.0404, H * P=0.0179, ** P=0.0070.

116

Fig.3.5: Pre-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated from pigs at DPV 28 were restimulated with PRRSV-1 and pooled peptides (A to F) or PRRSV-2 and pooled peptides (G to L) for 3 days and immunostained using pig specific lymphocyte markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by unpaired t-test with two tailed p-value at 95% confidence interval. Group 1. Mock; Group 2: killed vaccine (PRRSV-1and PRRSV-2) restimulated with PRRSV-1 or PRRSV-2; Group 3: killed vaccine ( PRRSV-1+PRRSV-2) restimulated with pooled peptides.

117

Fig. 3.6: Pre-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated from pigs at DPV 42 (DPC 0) were restimulated with PRRSV-1 and pooled peptides (A to F) or PRRSV-2 and pooled peptides (G to L) for 3 days and immunostained using pig specific lymphocyte markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by unpaired t-test with two tailed p-value at 95% confidence interval. Asterisk refers to statistical significant difference between the indicated two groups (* P< 0.05; ** P< 0.01). Group 1. Mock; Group 2: killed vaccine (PRRSV-1and PRRSV-2) restimulated with PRRSV-1 or PRRSV-2; Group 3: killed vaccine (PRRSV- 1+PRRSV-2) restimulated with pooled peptides. P-value for each panel analyzed by Student’s t- test: G *P=0.0492, D ** P=0.0022; L,** P=0.0095.

118

Fig. 3.7: Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated from pigs at DPC 10 were restimulated with PRRSV-1 (A-F) or (G-L) PRRSV-2 for 3 days and immunostained using pig specific markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Mock+Challenge; Group 3. Killed vaccine + Challenge. P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: A ***P=0.0009, B ** P=0.0047; C ** P=0.0020; D ** P=0.0016; E ** P=0.0012; F*** P=0.0004; J ** P=0.0015; K *** P=0.0004; L,** P=0.0011.

119

Fig. 3.8: Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated at DPC 10 from pigs challenged with PRRSV-1 or PRRSV-2 were restimulated with pooled peptides (A to F) for 3 days and immunostained using pig specific markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p<0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Mock + PRRSV-1 Challenge; Group 3. Killed vaccine + PRRSV-1 Challenge; Group 4. Mock; Group 5. Mock + PRRSV-2 Challenge; Group 6. Killed vaccine + PRRSV-2 Challenge. P-value for each panel analyzed by one way ANOVA followed by Tukey’s post-hoc test: A * P=0.0206; C *** P=0.0008; D ** P=0.0028, * P=0.0218; E *** P=0.0002, ** P=0.0029; F *** P=0.0002, ** P=0.0034.

120

Fig 3.9: Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated at DPC 10 from pigs challenged with PRRSV-1 were restimulated with individual peptides A1, A2, A3 (A-F) or peptides B1, B2, B3 (G-L) for 3 days and immunostained using pig specific markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*P< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Mock + Challenge; Group 3. Killed vaccine + Challenge. P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: A * P= 0.0136; B * P=0.0476; C * P=0.052, ** P=0.0067, ** P=0.0091; H* P=0.0324, D *** P=0.0001,*** P=0.0001, *** P=0.0002; E *** P=0.0002, *** P=0.0004, *** P=0.0007; F *** P=0.0002, *** P=0.0003, *** P=0.0002; J *** P=0.0007, *** P=0.0006, * P=0.194; K ** P=0.0067, ** P=0.0076; L,** P=0.0055, ** P=0.0055; 121

Fig 3.10: Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated at DPC 10 from pigs challenged with PRRSV-1 were restimulated with individual peptides C1, C2, C3 (A-F) or peptides D1, D2, D3 (G-L) for 3 days and immunostained using pig specific markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Mock + Challenge; Group 3. Killed vaccine + Challenge. P-value for each panel analyzed by one way ANOVA followed by Tukey’s post-hoc test: H* P=0.0153, D * P=0.0155, * P=0.0490, ** P=0.0059; E * P=0.0140; F * P=0.495; J *** P=0.0007, *** P<0.0001, *** P<0.0001; K ** P=0.0057, *** P=0.0003, *** P=0.0003; L,* P=0.0248, *** P=0.0004, *** P=0.0003. 122

Fig 3.11: Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated at DPC 10 from pigs challenged with PRRSV-2 were restimulated with individual peptides A1, A2, A3 (A-F) or peptides B1, B2, B3 (G-L) for 3 days and immunostained using pig specific markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Mock + Challenge; Group 3. Killed vaccine + Challenge. P-value for each panel analyzed by one way ANOVA followed by Tukey’s post-hoc test: B* P=0.066; C* P=0.0235; D ** P=0.0039, ** P=0.0047, * P=0.0119; E ** P=0.0031, ** P=0.0066, ** P = 0.0048; F ** P=0.0024, ** P=0.0037, *P=0.312; J ** P=0.0051, *** P=0.0002, *** P=0.0003; K ** P=0.0017, * P=0.0160; L, * P=0.0720, ** P=0.0252.

123

Fig. 3.12: Post-challenge cellular immune response in killed (PRRSV-1 and PRRSV-2) vaccinated pigs. PBMCs isolated at DPC 10 from pigs challenged with PRRSV-2 were restimulated with individual peptides C1, C2, C3 (A-F) or peptides D1, D2, D3 (G-L) for 3 days and immunostained using pig specific markers to determine the frequency of total and activated (IFN-+) T-cell subsets by flow cytometry. Cells were gated for CD3 expression and subsequently grouped based on the expression of CD4, CD8 and IFN-. Each bar is the mean ± SEM values of 6 pigs. Data were analyzed by one-way ANOVA followed by Tukey's post-hoc test. Asterisk refers to statistical significant difference between the indicated two groups (*p< 0.05; ** P< 0.01; and *** P< 0.001). Group 1. Mock; Group 2. Mock + Challenge; Group 3. Killed vaccine + Challenge. P-value for each panel analyzed by one-way ANOVA followed by Tukey’s post-hoc test: D *** P=<0.0001, ** P=0.0017; *** P=<0.0001; E ** P=0.0049, ** P=0.0012; F *P=0.096, *P=0.084; J ** P=0.005, *** P=<0.0001; *** P=<0.0001; K ** P=0.0068, ** P=0.0010, ** P=0.0039; L, * P=0.0368, ** P=0.0096. ** P=0.0098.

124

TABLES

PRRSV challenge Groups Type of PRRSV vaccine Blood collection days at DPV42 1 Mock/A N/A 0, 3, 7, 14, 21, 28, 35, 42, 45, 49, 52 2 Mock PRRSV-1 0, 3, 7, 14, 21, 28, 35, 42, 45, 49, 52 PRRSV-2 3 KV PRRSV-1 & PRRSV-1 0, 3, 7, 14, 21, 28, 35, 42, 45, 49, 52 KV PRRSV-2 PRRSV-2

DPV- Day post-vaccination; DPC - Day post-challenge; KV-Killed virus vaccine

Table 3.1: Experimental design of PRRSV-1 and PRRSV-2 killed vaccination and challenge study in pigs

125

Table 2:

Challenge Significant increase in T- Specific peptides

Virus cell subset (p<0.05)

PRRSV-1 Naïve T-helper cells A1, B1, D3,

Cytotoxic T-cells A1,A2,A3,

Activated T- A1,A2,A3,B1,B2,B3,C1,C2,C3,D1,D2,D3

helper/memory cells

Activated T-helper cells A1,A2,A3,B1,B2,C3,D1,D2,D3

Activated cytotoxic T-cells A1,A2,A3,B1,B2,C3,D1,D2,D3

PRRSV-2 Naïve T-helper cells A3,

Activated T- A1,A2,A3,B1,B2,B3,C1,C2,C3,D1,D2,D3

helper/memory cells

Activated T-helper cells A1,A2,A3,B2,B3,C1,C3,D1,D2,D3

Activated cytotoxic T-cells A1,A2,A3,B2,B3,C1,C3,D1,D2,D3

Table 3.2: Summary of significant increase in PRRSV epitope specific T-cell subsets against 12 peptides. Construct A (A1, A2 and A3 peptides), construct B (B1, B2 and B3 peptides), construct C (C1, C2 and C3 peptides), construct D (D1, D2 and D3 peptides), were used individually to restimulate PBMCs of pigs challenged with PRRSV-1 and PRRSV-2 separately. The table showing the significant increase (P<0.05) in the frequency of lymphocyte subsets specific to individual peptides.

126

Chapter-4

Construction and recovery of recombinant vesicular stomatitis virus

expressing PRRSV proteins

127

4.1 Summary

The economic loss in the pork industry due to porcine reproductive and respiratory syndrome (PRRS) has been increasing over the years. The major losses are due to reproductive failure in pregnant sows/gilts and respiratory infection in pigs of all ages.

PRRSV is constantly evolving to overcome the preexisting immunity and re-emerging as new variants which escape from the host immune response and constantly cause new outbreaks. Hence development of novel vaccine candidates is warranted to control economic losses caused by PRRS to the swine industry globally. Several approaches based on viral vector vaccines are under development. Vesicular stomatitis virus (VSV) as a vector has been successfully examined for a number of pathogens which cause respiratory infections. In this study, we adapted a novel approach for expression of PRRSV genes by using VSV vector system. We employed an internal ribosomal entry site (IRES) to initiate the translation process from the second open reading frame (ORF). Recombinant VSV

(rVSV) expressing both major and minor PRRSV proteins were constructed individually by using in-fusion PCR cloning, and recovered rVSV from full length cDNA clones of the viral genome by using reverse genetics technology. Bacteriophage T7 RNA polymerase expressed from a recombinant vaccinia virus was used to drive the synthesis of the genome- length positive-sense transcript of VSV from a cDNA clone in BSRT-7 cells. Further, we engineered IRES controlled VSVs by constructing a double insertion construct using

PRRSV proteins in combination with IRES (GP5-IRES-GP3). The recovered rVSV

(rVSV-GP5-IRES-GP3) was more attenuated in cell culture especially the two PRRSV 128 gene sequence along with IRES sequence, which regulated the level of foreign gene expression and further attenuated the rVSV based gene expression in vitro. Future studies are aimed at performing in vivo vaccine trials in pigs to prove efficacy of the rVSV based

PRRSV constructs as a vaccine candidate.

4.2 Introduction

Due to the high mutation rate in the PRRSV genome, highly pathogenic PRRSV variants are emerging constantly and posing an increasing challenge for prevention and control of the disease across the globe (Li et al., 2007). For effective control of PRRS, various types of vaccines were developed since the isolation of PRRSV. In addition to existing PRRSV modified live virus vaccines (MLVs) and inactivated virus vaccines other novel vaccine candidates were designed, including vaccines with co-administration of various adjuvants,

DNA vaccines, subunit vaccines, recombinant DNA vector vaccines and replicating virus vector vaccines. All these vaccines are aimed at conferring broad protection against

PRRSV. Among the several new vaccines designed, replicating virus vector based vaccines were found to elicit both cell-mediated and humoral immune responses. Hence, various virus vectors have been explored in PRRSV vaccine development (Cruz et al., 2010a;

Renukaradhya et al., 2015a). Adenoviruses vectored vaccines with expression of PRRSV proteins have been tested in pigs and mice, including granulocyte macrophage-colony stimulating factor (GM-CSF) co-expressed GP5/3 (Wang et al., 2009), CD40 Ligand

(CD40L) co-expressed GP5/3 (Cao et al., 2010), heat-shock protein 70 (HSP70) coexpressed GP5/3 (Li et al., 2009d) and RRSV proteins in single or in combination such as

GP5/M and GP5/3 or GP3/4/5 (Jiang et al., 2006a) constructs. All of which induced 129

PRRSV specific cell-mediated immune response and higher level of specific antibody and neutralization antibody responses in pigs, but failed to provide protection against challenge

PRRSV infection.

VSV is a prototype member of the Vesiculovirus genus, a non-segmented negative- sense (NNS) RNA, belongs to the Rhabdoviridae family (Whelan and Wertz, 2002). VSV is a versatile vaccine vector that offers number of advantages. Some of them are a) it replicates solely in cytoplasm, and does not undergo recombination. During replication

VSV does not produce DNA intermediates that might integrate in to host genome (Rose and Whitt, 2001), b) high genetic stability, c) ease of expression of multiple antigens which can accommodate at least 4.5 kilobases of foreign genes, d) high level of expression of foreign genes in infected cells, e) ease of large scale production of VSV-vectored vaccines in pre-approved cell lines, f) no requirement of adjuvant along with VSV-vectored vaccine etc., (Ma and Li, 2011; Ramsburg et al., 2004; Roberts et al., 1999; Schwartz et al., 2007).

Due to the 3’ to 5’ gradient expression in VSV, the transcription level of foreign genes can be controlled by inserting them at different positions in the viral genome. The above characteristics of VSV suggests that recombinant VSVs expressing foreign viral proteins may be a very good vaccine candidate (Rose et al., 2001).

Recently, rVSV vaccines were shown to be successful in protection against Severe

Acute Respiratory Syndrome (Faber et al., 2005), Hepatitis C virus (Buonocore et al.,

2002), Papilloma virus (Reuter et al., 2002), human respiratory syncytial virus (Kahn et al., 2001) and Pox virus (Braxton et al., 2010). Importantly, rVSV-∆G vaccines were

130 developed for Ebola (EBOV) virus and Marbarg virus (MARV) (Garbutt et al., 2004;

Geisbert et al., 2009; Jones et al., 2005).

In the present study, we utilized genetically engineered (recombinant) methytransferase (MTase) defective VSV as a vaccine candidate. Due to the lack of MTase enzyme activity in MTase-defective VSV, these vectors have lost their virulence in animals. We expressed PRRSV protective antigens in the vector to use as a vaccine candidate. Two PRRSV proteins were expressed in VSV in single and in combination; GP5 is the most abundant glycoprotein, ORF 5 of PRRSV encodes a 24-26 kDa protein with putative N-glycosylation sites. It is one of the highly variable structural proteins which induces neutralizing antibodies and is essential for virion formation and infectivity (Dea et al., 2000; Murtaugh et al., 1995a). Another minor protein GP3, with molecular weight 42-

50 kDa (de Lima et al., 2006) is the second most heterogeneous protein of PRRSV, highly antigenic induces virus neutralization activity and is essential for virus infectivity (Das et al., 2010; Murtaugh et al., 1995a, b). GP5 and N proteins are inducers of lymphocyte proliferation and GP3 is able to induce T cell proliferation in mice (Jiang et al., 2007).

Previously rAd-HS35 and rAd-HSA35 were developed to express HSP70-GP3-GP5 fusion proteins by using two different linkers between HSP70 and GP3/GP5 (Li et al., 2009c).

But this construct failed to protect against virus challenge in pigs.

To further improve the VSV-based PRRSV vaccine, we adopted a double genome insertion into a single VSV vector along with a linker which can promote internal initiation of translation of RNA. Similar studies were done in the past wherein double genome insertion coupled with the HSP-70 as a vaccine adjuvant in the VSV enhanced the mucosal

131 immune response in mice (Ma et al., 2014). In the present study, we selected the internal ribosomal entry site (IRES) as a linker to enhance the expression of a second genome in the construct.

IRES is a RNA element found in viral RNAs and cellular mRNAs with long 5’UTR

(untranslated terminal region) (Jang et al., 1988; Pelletier and Sonenberg, 1988). They were first discovered in the RNA genome of Picorna viruses, in which IRES allows an alternative

5’ cap independent, internal translation initiation and bypass its subset of Eukaryotic translation initiation factor (eIFs), but the IRES dependent translation initiation is a slow process (Andreev et al., 2009; Belsham and Sonenberg, 2000; Ochs et al., 1999). IRES was effectively used to investigate the role of phosphoprotein isoforms in virus replication and virulence of rabies virus (Marschalek et al., 2012; Marschalek et al., 2009).

Our aim in this study was to develop an alternative strategy to control expression of essential gene products of PRRSV in the rVSV vector at the translational level by use of IRES elements. We exploited the IRES from a lentivirus isolated plasmid which preferentially initiates translation at the second downstream initiation codon to change relative expression of N-terminally expressed proteins by the IRES controlled rVSV expression system.

4.2.1 Hypothesis of the study: We hypothesized that double insertion of the PRRSV genome into VSV along with IRES will enhance gene expression from the second ORF, and the combination of all three components will further attenuate rVSV-GP3, rVSV-GP5 and rVSV-GP3-IRES-GP5 viruses in vitro and helps in generation of potent vaccine candidates.

132

4.3 Materials and methods

4.3.1 Cells and viruses

BSRT-7 cells were grown in Dulbeco’s Modified Eagle Medium (Gibco) supplemented with 10% heat inactivated fetal bovine serum and antibiotics (100 units/mL penicillin,

o 100µg/mL streptomycin and 0.25 µg/mL fungizone) at 37 C with 5% CO2. The cells were maintained in media supplemented with G418 (1 mg/ml final concentration) on alternate passages. Vero cells were propagated in Dulbeco’s Modified Eagle Medium (Gibco) supplemented with 10% heat inactivated fetal bovine serum and antibiotics (100 units/mL

o penicillin, 100µg/mL streptomycin and 0.25 µg/mL fungizone) at 37 C with 5% CO2.

4.3.2 Bacterial strains and growth conditions

Plasmids were introduced into E. coli DH5α competent cells by transformation. Cells were propagated in LB (Luria-Bertani) or TB (Terrific Broth) medium containing the appropriate antibiotics (100 µg/ml ampicillin).

4.3.3 Enzymes and reagents

Restriction enzymes were purchased from New England Biolabs (Beverly, MA). Hot Start

DNA polymerase was purchased from Invitrogen. Phusion Hot Start PCR master mix and molecular weight ladders of 1 kb and 10 kb DNA were purchased from Thermo scientific

(Waltham, MA). DNA and PCR product purification kits were purchased from Qiagen

(Germany) and Zymo Research Corp (Orange, CA). Chemicals and antibiotics were purchased from Sigma-Aldrich (St. Louis, MO). pVSV-β-Gal vector containing lacZ was purchased from Promega (Madison, WI).

4.3.4 Primer design and sequence analysis 133

DNA analysis and primers used for RT-PCR for fragments separation and sequencing were done by DNA Star software (DNASTAR Inc., Madison, WI) or in some cases manually.

Primer pairs used for Gibson assembly were designed with gene specific sequences along with portion of the vector sequences or portion of the junction regions for multiple fragment assembly, each with 20–30 bp overlap. Gp2-E gene fragments were synthesized through the gBlocks of Integrated DNA Technologies (IDT Inc).

Amplification of IRES from plasmid: Plasmid pCDH-EF was procured from Addgene which contains IRES from lentivirus. The IRES gene specific primers were designed and amplified from the plasmid as per the manufacturer’s instruction. Briefly, bacterial slant received from the Addgene was grown in the LB plate with ampicillin resistance for 18 hr at 37oC. Single colony isolated plasmid was extracted from the bacteria using IRES gene specific primers.

4.3.5 Plasmid construction

Plasmids encoding VSV N (pN), P (pP), and L (pL) genes and an infectious cDNA clone of the viral genome, pVSV1(+), Plasmid pVSV1(+) GxxL were generous gifts from Dr.

Jianrong Li. Plasmid pVSV1(+) GxxL which contains Sma I/xma I and Xho I at the G and

L gene junction. The plasmid construction was performed using the Gibson assembly cloning kit (NEBuilder assembly cloning kit, New England Biolabs Inc), structural proteins of PRRSV Gp2, Gp3, GP4, GP5, M and Gp2-E were amplified by high fidelity PCR with the upstream and downstream primers containing VSV gene start and gene end sequences along with portion of vector sequences. Briefly, PCR reaction was performed in 20 µl of total volume reaction containing 2X Phusion Flash PCR master mix (Thermo scientific) 10

134

µl, 1.0 µl each of forward primer oligo (10 µM) and reverse primer oligo (10 µM), 1 µl of

DNA template [cDNA or gDNA (∼50 ng/µl)] and sterile water to 20 µl. The PCR cycling program was followed as per manufacturer’s instructions. Initial denaturation conditions:

98°C for 30 s; denaturation: 98°C for 10 s; annealing: 58°C for 20 sec; extension: 72°C for

5 s; final extension 72°C for 1 min: with 35 cycles. The PCR products were run on 1 % agarose gel and purified by zymoclean purification kits.

4.3.6 Vector preparation

Vector pVSV(+) GxxL was digested by restriction enzyme Sma I (Isoschizomer Xma I) and Xho I by using restriction enzyme(s), heat-inactivated at 65°C for 10 minutes, enzyme- digested vector was run on 1.0% agarose gel and purified by using Zymoclean purification kit as per the manufacturer’s instructions.

4.3.7 Fusion PCR reaction using Gibson Assembly for single construct or multiple constructs

Cloning of two or four fragments were done by fusion PCR using NEBuilder HIFI DNA assembly master mix, in which the vector and the insert were viewed as two PCR fragments and were assembled into a circular DNA molecule. For assembly of 1 or 2 fragments in to a vector, total of 0.03–0.2 pmols of DNA fragments at 1:2 vector: insert ratio; and for assembly of 4–6 fragments a total of 0.2–0.5 pmols of DNA fragments in 1:1 vector: insert ratio were used. Assembly of fragments and vectors were performed as per the manufacturer’s instructions. Briefly, total amount of DNA fragments was mixed with 10 ul of NEBuilder HiFi DNA assembly master mix and volume adjusted to 20 ul using deionized water. Tubes were incubated in a thermocycler for 1 hour at 50°C and further

135 fusion reaction was used for transformation in to chemically competent cells. Two ul of the fusion product was mixed with 50 ul of competent cells in a 1.5 ml EP tubes, incubated at 4 oC for 30 min and 700 ul of SOC medium added to the mixture followed by incubation of the tube at 37 oC for 60 min with vigorous shaking (250 rpm). About 150 to 200 µl of cells were plated onto LB plates containing ampicillin and incubated overnight at 37°C.

Only competent cells were plated as negative control.

Selecting the colonies: 20 colonies were picked from each plate (for each construct) were screened by colony PCR with primers located on the backbone of the vector. The positive colonies were picked and inoculated on to 6 ml LB broth with ampicillin (100 µg/ml) in a

14-ml Falcon tube (Becton Dickinson, NJ) and incubated in a 32°C shaker (250 RPM) overnight.

4.3.8 Plasmid DNA isolation and RE digestion

Plasmid DNA was isolated using promega plasmid mini prep kit as per the manufacturer’s instruction. Purified DNA was digested with restriction digestion analysis using the restriction enzymes, Sma I and Xho I to confirm the presence of specific gene insert. This was further confirmed by sequencing for presence of the specific target gene insert using specific sequence primers. The resulted plasmids were designated as: pVSV1(+)-specific

PRRSV genes as shown in Table 4.1, and specific PRRSV gene was inserted in to G and

L gene junction.

4.3.9 Transfection and recovery of recombinant VSV

Three different recombinant VSVs were recovered using the above plasmids as described previously (Ma and Li, 2011). Briefly, BSRT-7 cells were infected with T7 polymerase

136 expressing vaccinia virus vTF7-3 (Fuerst et al., 1986) at MOI 1 in PBS with magnesium and calcium. Vaccinia virus expressing vTF7-3 was sonicated briefly and adsorbed on to cells for 1 h with intermittent shaking at every 15 min. We prepared lipid DNA complexes by mixing plasmids carrying the VSV genome (VSV-Gp3 or VSV-Gp5 or VSV-Gp3-IRES-

Gp5 plasmids) plus the support plasmids, pN, pP and pL in 0.5 ml of DMEM and transfecting reagent Lipofectamin-2000 in 1 ml of DMEM at room temperature for 15 min. The transfection reaction was set in duplicates for each recombinant VSV recovered along with a positive control for transfection using a mini genome plasmid expressing GFP [VSV-CB

(-) GFP] to check the efficacy of the transfection reaction. At 1 h post-infection (pi), the cells

o were washed and transfected with lipid DNA complex and incubated at 32 C, 5% CO2 for

96 h. At 96 h post-transfection, cell culture fluid was collected, centrifuged at 7000 rpm for

3 min at room temperature and filtered through a 0.2 μm filter. The supernatant from the mini genome infected well was aspirated and rinsed with PBS. Added 2 ml of fix solution (80 % acetone) and incubated for 20 min to inactivate the vaccinia virus. Discarded the fixative to killing pan and rinsed with PBS-glycerol before examining the cells for GFP expression using a fluorescence microscope. The schematic representation of the transfection is shown in (Fig 4.2).

4.3.10 Virus amplification

We plated BSRT-7 cells for 24 h before harvesting the supernatant from well for passaging the recovered virus. Further infected the cells with 300 ul of filtered cell culture supernatant

o and incubated for 48 h at 32 C with 5% CO2. Cell culture dishes were observed daily for development of VSV induced cytopathic effect (CPE), harvested the culture supernatant

137 when CPE was greater than 80% and the culture media was transferred to sterile centrifuge tubes. Cells were clarified after centrifugation for 3 min at 7000 rpm, filtered through 0.1

μm filter, stored frozen at −80 °C and labeled as P1.

4.3.11 Plaque Purification of VSV

To avoid sub genomic replicating virus particles, the recovered virus was plaque purified in vero cells (E6 strain). Cells were plated on 6-well plates when cells were at 85%-90% confluence and the recovered virus (P1 supernatant) was serially diluted by 10-fold and

o adsorbed on cells for 1 h at 37 C with 5% CO2 and shaking every 15 min. Prepared the molten agarose overlay (containing sea plaque agarose, 2X MEM, fetal bovine serum,

HEPES pH 7.7, sodium bicarbonate, glutamine and antibiotic) and kept at 42o C. After adsorption, cells were washed with MEM and overlay with a molten agar, allowed to solidify for 5 min at 4 oC and incubated for 24 to 48 h at 37 oC until plaques were visible.

Plaques that were well separated were picked using a sterile Pasteur pipette by inserting into bottom of the plate through agar and removed both plaque and agar plug by gentle aspiration. Eluted the virus from agar plug by placing in 0.5 ml medium for 1–2 h at 4 °C and finally stored at −80 °C until used for amplifying the virus to make a plaque-purified

P1 stock.

4.3.12 Reverse transcription polymerase chain reaction (RT-PCR)

Viral RNA was extracted from rVSV, rVSV-Gp5, rVSV-Gp3 and rVSV-Gp5-IRES-Gp3 using an RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer’s instructions. Two primers (5’-CGAGTTGGTATTTATCTTTGC-3’ and 5’-

GTACGTCATGCGCTCATCG-3’) were designed to target VSV G gene at position 4524

138 and L gene at position 4831 (numbering refers to the complete VSV Indiana genome sequence), respectively. These primers were used to detect insertion of Gp5, Gp3 or Gp5-

IRES-Gp3 genes at the G and L gene junction. RT-PCR was performed using a One Step

RT-PCR kit (Qiagen). The amplified products were analyzed on 1% agarose gel electrophoresis.

4.3.13 SDS PAGE and Western blot

BSRT7 cells were infected either with rVSV, rVSV-Gp5, rVSV-Gp3 or rVSV-Gp5-IRES-

Gp3 at MOI 3 as described above. At the indicated time points post-infection,

a) Cell culture medium was harvested and clarified at 3,000 rpm for 15 min and further

concentrated at 30,000 rpm for 1.5h.

b) Cell lysate: virus infected cells were lysed in lysis buffer containing 5% ß-

mercaptoethanol, 0.01% NP-40 and 2% sodium dodecyl sulfate (SDS).

The infected cells were combined with SDS-loading buffer (250 mM Tris HCl, pH 6.8,

10% SDS, 30% (v/v) Glycerol, 10 mM DTT,0.05% (w/v) Bromophenol Blue, 10% 2- mercaptoethanol v/v) and subjected to SDS-PAGE on a 12% acrylamide gel. The proteins were transferred to a Hybond ECL nitrocellulose membrane (Amersham) in a Mini Trans-

Blot electrophoretic transfer cell (Bio-Rad Laboratories, Inc., Hercules, CA). The blot was blocked overnight in PBS containing 0.5% Tween 20 (PBST) and 5% nonfat milk (PBST- milk) and incubated in PBST-milk containing pig hyper immune sera raised against

PRRSV-2 (gifted by Dr. Nelson, South Dakota university) at a 1:1,000 dilution or probed with polyclonal antibody against Gp3, Gp5 at a dilution of 1:1000 for 1 h at room temperature. After washing three times for 5 min each in PBST, the blot was incubated for 139

1 h at room temperature in a 1:5,000 dilution of goat anti-pig IgG (H+L) secondary antibody conjugated to alkaline phosphatase (Novus biological, Littleton, CO) in PBST- milk. The blot was washed three more times with PBST and developed with liquid BCIP and NBT substrate (5-bromo-4-chloro-3-indolyl phosphate (BCIP)/nitro blue tetrazolium

(NBT), which is an ideal insoluble substrate for use with alkaline phosphatase) as per the manufacturer’s instructions for 10-30 min until the color development. The reaction was stopped after washing the membrane with several changes of distilled water and air dry the membrane before imaging using Bio rad imaging system.

rVSV expressing PRRSV proteins alone or in combination with IRES element will be analyzed in future as combined vaccine candidates.

4.4 Results

4.4.1 Construction of VSV and VSV-IRES vector

Full-length cDNA of the RNA genome of VSV was assembled from clones of each of the five VSV genes and their intergenic regions. To generate recombinant VSV based vaccine vectors for PRRSV, we incorporated the PRRSV structural genes in single or in combination at the G-L gene junction into different rVSV vectors (Fig 4.1). In single gene insertion constructs of rVSV vector, we included both major and minor proteins individually between the G-L gene junction with the enzyme sites Sma I and XhoI.

Additionally, we generated multiple gene constructs of the rVSV vector by cloning IRES between two PRRSV genes. The advantage of cloning the IRES between two genes is to

140 promote the level of foreign gene expression which is regulated by the 3’ to 5’ sequential transcription mechanism (Zhang et al., 2015).

4.4.2 Recovery of recombinants - rVSV-GP5, rVSV-GP3, rVSV-GP5-IRES-GP3

Three rVSV-PRRSV protein constructs were successfully recovered using the approach described previously (Li et al., 2005; Ma et al., 2014). The schematic representation of the recovery process is shown in (Fig 4.2). The mini genome [CB(-) VSV] transfected cells were fixed and showed up to 40 to 70% of the GFP positive cells under the florescence microscope and hence indicates a successful transfection.

Recombinant rVSV-GP3 and rVSV-GP5 harbors the PRRSV-GP3 gene and

PRRSV-GP5 genes at the G-L gene junction, respectively, whereas rVSV-GP5-IRES-GP3 harbors both PRRSV GP5 and GP3 genes separated by the IRES gene at the G-L gene junction. The plaque morphology of these recombinants viruses in vero cells differed depending on the number of genome insertions (Fig4.1). After addition of filtered recovered virus supernatants on the fresh BSRT-7 cells, cells were observed daily for the development of VSV-induced CPE which were seen as areas (or foci) of rounded and refractile cells. Cell rounding initiated in rVSV-WT was observed as early as 18 h pi and in cells harvested at 40 h pi. However, in case of rVSV-GP3, rVSV-GP5 or rVSV-GP5-

IRES-GP3 infected cells observed VSV-specific CPE after 40 h pi and the cell culture supernatant harvested at 48 h pi. Recombinants rVSV-GP5 and rVSV-GP3 plaques are of similar size and smaller than those of wild type rVSV. Further rVSV-GP5-IRES-GP3 formed much smaller plaques than rVSV-GP3 or rVSV-GP5 (Fig.4.3). The rVSV wild type virus formed plaques after 40 h pi with virus titer of 4X109 PFU/ml and had an average

141 plaque size of 4.088 ± 0.9072 mm (mean ± standard deviation) in diameter. The average plaque size for rVSV-GP5 and rVSV-GP3 was 1.1194 ± 0.2129 and 0.9009 ± 0.2279 mm, and the virus titer was 6.4X107 PFU/ml and 5.6X107 PFU/ml respectively, after 48 h of incubation. However, the plaque size for multiple gene inserted virus rVSV-GP5-IRES-

GP3 was very small that could not be able to analyze using Image J software, and the virus titer was found to be 1.6X106 PFU/ml, suggesting that rVSV-GP5-IRES-GP3 viral growth is further impaired compared to rVSV-GP5 or rVSV-GP3. Thus, based on the average plaque size the rVSV-GP3 and rVSV-GP5 have shown significant differences in the plaque size (p<0.0001) compared to rVSV-wt, hence they are more attenuated and have a longer replicating cycle (Fig.4.4).

4.4.3 Confirmation of the viral gene in the recovered virus

To further confirm presence of the genes of interest in the recovered virus, viral genomic

RNA was extracted from each recombinant virus followed by RT-PCR using primers annealing to the VSV G and L genes. The 900bp cDNA band containing GP5 gene and 1.0 kb band containing GP3 gene (Fig.4.5) or a 2.2-kb band containing GP5-IRES-GP3 genes was amplified from genomic RNA extracted from rVSV-GP5, rVSV-GP3 and rVSV-GP5-

IRES-GP3, while a 300-bp cDNA was amplified from parental rVSV lacking either insert, demonstrating that the GP5 or GP3 or GP5-IRES-GP3 was inserted at G and L gene junction. Subsequently, the amplified cDNA was purified and sequenced, confirming that

GP3, GP5 or GP5-IRES-GP3 was indeed inserted into the targeted position in VSV genome.

4.4.4 Characterization of expression of GP3 and GP5 genes from rVSV vectors

142

To determine whether the GP3 and GP5 genes were expressed from recombinant VSV vectors, western blot analysis was performed using infected whole cell lysate extract.

Briefly, BSRT-7 cells were infected with rVSV-GP3, rVSV-GP5 and rVSV-GP5-IRES-

GP3 at MOI 3, cell lysates were harvested at 48 h pi and analyzed by SDS-PAGE followed by Western blot using PRRSV specific hyper immune serum and polyclonal anti-GP3 and anti-GP5 antibody in two separate blots (Fig.4.6). In rVSV-GP3 infected cells a protein specific band with a molecular mass of 50 kDA was detected, which correlates to the size of the GP3 protein of PRRSV. In rVSV-GP5 infected cells a protein band with molecular mass of 25 kDA was detected which correlates to the size of the GP5 protein of PRRSV.

Similarly, in rVSV-GP5-IRES-GP3 infected cells two protein bands with a molecular mass of 50 KDA and 25 kDA were detected in two separate blots against anti PRRSV hyper immune sera and GP3 specific polyclonal antibody which correlates to the size of GP3 and

GP5 proteins.

4.5 Discussion

PRRSV is a challenging swine pathogen which causes huge economic losses to the swine industry globally. Commercially available vaccines only provide partial protection and limited effect against heterologous challenge infection (Meng, 2000; Mengeling et al.,

2003). Previously, DNA vaccines with fusion expression of GP3/GP5 of PRRSV delivered in a human adenoviral vector induced enhanced humoral and cellular immune responses in mice (Jiang W 2008). Other viral vectors were also used to deliver the PRRSV proteins as

DNA vaccines such as, PRV recombinant expressing PRRSV proteins as rPRV-GP5, 143 rPRV-GP5-M, rPRV-GP5-native M, rPRV-GP5m-M in which construct rPRV-GP5-m-M induces protection against virus challenge with reduction in viremia. Recombinant transmissible gastroenteritis virus (TGEV) expressing PRRSV GP5 and M proteins

(rTGEV-GP5-M) acts as a bivalent vaccine against PRRSV and TGEV. It produces high level of antibody response against TGEV but not against PRRSV. Recombinant canine adenovirus type 2 (CAV-2) expressing PRRSV GP5 or GP5/M induces specific antibody, virus neutralization activity and T-cell secreting IFN- response but failed to provide protection against challenge infection (Renukaradhya et al., 2015b).

VSV has a wider host range as it can infect both vertebrate and insect cells

(Albertini et al., 2012). But the safety of VSV-based vaccine is still a concern, since VSV is neurotropic in nature and also it infects a wide range of domestic and wild animals, producing vesicular lesions in the mouth, teats and feet of animals (Ma et al., 2014). Many methods have been previously developed to attenuate VSV, including M gene mutation

(Ahmed et al., 2008), G gene deletion (Duntsch et al., 2004), G protein cytoplasmic truncation (Fang et al., 2012a), microRNA targeting (Kelly et al., 2010), Pseudotyping

(Ayala-Breton et al., 2012) and the combinations. Recently, VSV has been extensively used as a vector for delivery of foreign antigens as live vaccines, gene delivery and as oncolytic virus therapy for many malignant tumors (Ammayappan et al., 2013; Roberts et al., 1999; Rose et al., 2001). In the present study, we employed single or double insertion of PRRSV (GP3/GP5) genes with IRES linker into the VSV vector to effectively recover rVSV. These recovered viruses need further testing in pigs as vaccine candidates.

144

The construction of clones harboring PRRSV proteins (both major and minor proteins) between G and L genes of the VSV in single or in combination were made successfully by using in-fusion PCR cloning (Zhang et al., 2015). The recombinant rVSV-

GP3 or rVSV-Gp5 were rescued successfully in vitro and the recombinant viruses were plaque purified. rVSV formed smaller plaques than rVSV-WT which was confirmed by significant differences in the average size of the plaques between the rescued recombinant viruses and WT-VSV, and the rescued recombinant viruses were replicated less effectively.

In previous studies (Li et al., 2009c), multiple PRRSV genes (GP3/Gp5) were expressed in the adenovirus delivery vector to use as a vaccine candidate against PRRSV challenge in pigs, but these vaccines failed to provide the expected protection. This could be due to the lack of equal expression of the two genes simultaneously. Production of a decreasing gradient mRNAs in VSV viral genome is evident, as the polymerase always starts at the 3’ end of the genome and has a chance to dissociate at the end of each gene after transcription, those genes near the 3' end of the genome are produced in much higher quantities, and genes that are closer to the 5' end of the genome are produced much less abundantly. Hence, we designed to include the IRES element as a linker between the two

PRRSV genes, which can promote internal initiation of translation of RNA to facilitate the expression of two or more proteins from a polycistronic transcription unit in eukaryotic cells (Mountford and Smith, 1995).

In the present study, we utilized the IRES to promote the expression of a foreign gene from a second ORF and evaluated the double insertion of foreign genes with the help of a linker (Insertion of PRRSV Gp5-IRES- GP3) between G and L gene which have

145 further reduced the replicating ability of the VSV in cell culture. The rVSV-GP5-IRES-

GP3 formed smaller plaques compared to rVSV-GP5, rVSV-GP3 or rVSV-WT and replicated less effectively. Previous studies have elaborated the advantages of IRES- controlled gene expression. The effective use of IRES in multiple gene expression system increases the level of foreign gene expression by taking advantage of sequential transcription mechanism, as higher amounts of foreign gene could be expressed for vaccine purpose (Zhang et al., 2015). IRES-controlled gene expression further attenuates VSV without causing any negative effect on the virus replication, maintains the genomic structure of VSV and exhibiting typical CPE like VSV-WT (Ammayappan et al., 2013).

Further studies are needed to evaluate the rVSV expressing multiple genes using the IRES system as a vaccine candidate for pigs. It should be evaluated for its vaccine potential for any foreign gene expression through the sequential transcription mechanism and attenuation of VSV and gene expression regulation of the IRES controlled viruses.

146

Fig 4.1: Construction of plasmids for generation of recombinant VSV expressing PRRSV proteins. Nine plasmid constructs of rVSV inserted with PRRSV proteins either single or in combinations at the G-L gene junctions in the VSV genome. We generated rVSV-GP2, rVSV-GP2-E, rVSV-GP3, rVSV-GP4, rVSV-GP5 and rVSV- M. Also multi genome insertion along with IRES in VSV genome - rVSV-GP5-IRES- GP3 and a cassette of GP5-IRES-GP3; rVSV-GP2-IRES-GP3 and a cassette of GP2- IRES-GP3; rVSV-GP5-IRES-M and a cassette of GP5-IRES-M, all were inserted between G-L gene junction in VSV genome using an in-fusion PCR cloning system. The genomic organization of VSV: Le, VSV leader sequence; N, nucleocapsid gene; P, phosphoprotein gene; M, matrix protein gene; G, glycoprotein gene; L, large polymerase gene; Tr, VSV trailer sequence.

147

Fig 4.2: Schematic representation of VSV genome recovery

148

rVSV titers: 4X109 PFU/ml, 5.6x 107 PFU/ml, 6.4x 107 PFU/ml 1.6x 106 PFU/ml

Fig 4.3: The rVSV plaques morphology and diameter compared to vector VSV. Plaques of rVSV-GP3, rVSV-GP5 and rVSV-GP5-IRES-GP3 were developed after 48 h of incubation compared to control VSV. Average size of ten plaques of each recombinant viruses is shown. The plaques size of rVSV-GP5-IRES-GP3 was too small to be analyzed. The diameter of the plaques was calculated by using image J software.

149

Fig 4.4: The average diameter of plaques formed from each rVSV were analyzed for the size, and found significant differences (p<0.0001) between rescued viruses and control VSV-WT (wildtype). P-value by student’s t-test is ***P = 0.0002.

150

Fig 4.5: Amplification of PRRSV proteins GP5 and GP3 from single and double genome insertion cassettes - GP5-IRES-GP3, rVSV-GP5, rVSV-GP3 and rVSV-GP5- IRES-GP3 by RT-PCR. Genomic RNA was extracted from each virus and respective genes were amplified by RT-PCR using two primers annealing to G and L genes

151

Fig 4.6: PRRSV protein expression from rescued recombinant viruses. BSRT-7 cells were infected with rVSV-GP5, rVSV-GP3 and rVSV-GP5-IRES-GP3 at MOI 3. Cytoplasmic extracts were harvested at indicated time points. Cells were lysed in 500 μl of lysis buffer and 30 μl of the lysate were analyzed by western blot analysis. PRRSV specific hyperimmune serum from a pig and anti-GP3 and anti-GP5 polyclonal rabbit sera were used in immunoblotting. Blots were probed with: A) anti-GP3 and anti-GP5 polyclonal antibody raised in rabbits and B) PRRSV specific hyperimmune pig serum.

152

Chapter 5

Conclusions and future directions

Porcine reproductive and respiratory syndrome (PRRS) continues to be a threat to the swine industry. The PRRS virus (PRRSV) infection is very complex and currently available vaccines are not always efficacious in protection against the infections from the wide array of heterologous PRRSV isolates in the field. There is a need for development of improved vaccines by application of novel strategies to generate broadly protective vaccines to prevent spread of PRRSV across the world. In the present study, we have employed three different vaccination strategies to induce broadly protective immune response against

PRRSV.

5.1 Determine whether consecutive or concurrent vaccination methods of PRRSV-1 and

PRRSV-2 MLV provides better protection against homologous PRRSV challenge infections in nursery pigs:

Currently, both the PRRSV species are rapidly spreading in their respective continents, across the globe, and have been identified in most of the swine producing countries globally (Shi et al., 2010b). Both species of PRRSV are circulating in the US with a constant increase in incidences of co-infection in swine herds (Park et al., 2015a;

Ropp et al., 2004b). Considering the nature of PRRSV-1 and PRRSV-2, it is the need of the hour to identify an ideal vaccination strategy using PRRS modified live virus vaccines (MLVs) to effectively control co-infections of these two species of PRRSV in

153 swine herds. Therefore, in this study, we compared both concurrent and consecutive method of administration of PRRSV-1 and PRRSV-2 MLVs and determined the efficacy against homologous challenge virus infections separately in nursery pigs by using viral and immunological analyses. Our results demonstrated that the consecutive method of vaccination with PRRSV-1 and PRRSV-2 MLV elicited enhanced cellular and humoral immune responses against PRRSV-1 without interfering with responses elicited against

PRRSV-2 in nursery pigs. Hence the consecutive but not the concurrent PRRSV-MLV vaccination strategy is more beneficial in swine herds at risk for PRRSV-1 and PRRSV-2 co-infections.

Since our study was performed using a limited number of pigs/treatment groups and less number of control groups. Future studies should employ larger number of animals and additional pig groups to analyze the effect of PRRSV-1 and PRRSV-2 MLVs individually and also the outcome of challenge co-infection in vaccinated animals. In the present study, we evaluated PRRSV MLV vaccination strategy against homologous challenge viruses, and future studies should include analysis of cross-protective efficacy against the heterologous PRRSV challenge infections. This vaccination strategy was found effective in nursery pigs and likely beneficial in finisher swine herds at risk for co-infection, and it may not be effective in herds already exposure to PRRSV infection.

5.2 To determine the protective efficacy of killed PRRSV-1 and PRRSV-2 delivered with non-toxic heat labile (LT) enterotoxin adjuvant and boosted with immunogenic conserved epitopes of PRRSV expressed in E. coli against homologous challenge infections in pigs.

154

Due to safety issues of the MLVs, developing a safe and effective vaccine is critical to control PRRS. In this study, we employed combined killed PRRSV-1 and PRRSV-2 vaccines delivered intramuscular with a potent adjuvant and T-cell epitopes-toxin chimeric antigen expressed in E. coli as a oral boost and evaluated the efficacy against homologous challenge infections. Our data demonstrated success in enhancing the breadth of immune response by such a vaccine delivery strategy. This vaccination approach is very helpful in swine herds at risk of exposure to PRRSV, and the killed vaccines are safe to vaccinate in the young piglets.

Future vaccine trials should include additional pig groups to elucidate the effect of E. coli LT adjuvant to killed PRRSV-1 and PRRSV-2 vaccines alone. Further, in our study, titers of PRRSV neutralizing antibodies were low and hence to better control PRRS it is better to induce strong B cell response. Therefore, there is a need to include additional

B-cell epitopes of both PRRSV-1 and PRRSV-2 to stimulate virus neutralizing antibody response in pigs. Also analysis of breadth of anti-PRRSV immune response are needed by using genetically divergent PRRSV strains.

5.3 Novel virus replicating vaccines to confer broad protection against PRRSV.

Among the several new vaccines designed, replicating virus vector-based vaccines were found to elicit both cell-mediated and humoral immune responses against PRRSV. Various virus vectors have been explored in PRRSV vaccine development (Renukaradhya et al.,

2015a). Vesicular stomatitis virus (VSV) is a versatile vaccine vector, which has been successfully examined for number of pathogens cause respiratory infections. In the present

155 study, we adopted an approach for expression of PRRSV genes in the VSV vector using reverse genetics methods. Another advantage of using VSV as a vector is that it can harbor multiple foreign genes (up to 4.5 kb)..

It will be of great interest to generate recombinant VSV expressing multiple PRRSV genes with the help of internal ribosome entry site (IRES). Such multivalent live vaccine candidates will likely generate specific immunity and provide sufficient protection against different species of PRRSV. In this study, rVSV (recombinant VSV) expressing PRRSV proteins in single and in combinations of two genes were recovered and propagated in vitro. We engineered IRES controlled VSVs by constructing double insertion constructs of

PRRSV proteins in combination with IRES (GP5-IRES-GP3). These recombinant viruses were shown to have a longer replication cycle compared to VSV-wt in vitro. The goal of the replicating VSV vaccines is to develop broadly protective vaccine against PRRS in pigs. Hence, future research should focus on testing whether rVSV-expressing PRRSV can provide cross-protection against genetically different PRRSV strains.

We also have to recover VSV harboring PRRSV constructs (rVSV-GP5, rVSV-M, rVSV-GP5-IRES-M, rVSV-GP2-E, rVSV-GP2-IRES-GP3 and rVSV-GP4) and characterize them by in vitro methods. Further, we need to evaluate the recovered rVSV expressing multiple genes using the IRES system for its potential as foreign gene expression system through sequential transcription mechanism in vitro. Once the recovered viruses satisfy our hypothesis, we need to evaluate the attenuation ability of VSV and gene expression regulation ability of IRES controlled viruses as vaccine candidates in pigs.

156

In conclusion, we evaluated the potential of modified live virus vaccines

(MLVs) and killed virus vaccines with adjuvant and T-cell epitopes-toxin-chimeric antigen as prime-boost vaccination against homologous PRRSV challenges in pigs. Further, the

VSV-based virus replicating vaccines expressing PRRSV genes were recovered in vitro for further evaluation in pigs. Among the evaluated vaccines in in vivo studies, MLVs administered in consecutive but not concurrent methods have provided both cell-mediated and humoral immune responses against both the PRRSV species.

157

6. Bibliography

Abraham, G., Banerjee, A.K., 1976, Sequential transcription of the genes of vesicular

stomatitis virus. Proceedings of the National Academy of Sciences 73, 1504-1508.

Abraham, G., Rhodes, D.P., Banerjee, A.K., 1975, Novel initiation of RNA synthesis in

vitro by vesicular stomatitis virus. Nature 255, 37.

Adair, B.M., 2009, Nanoparticle vaccines against respiratory viruses. Wiley Interdiscip

Rev Nanomed Nanobiotechnol 1, 405-414.

Adams, M.J., Lefkowitz, E.J., King, A.M.Q., Harrach, B., Harrison, R.L., Knowles, N.J.,

Kropinski, A.M., Krupovic, M., Kuhn, J.H., Mushegian, A.R., Nibert, M.,

Sabanadzovic, S., Sanfacon, H., Siddell, S.G., Simmonds, P., Varsani, A., Zerbini,

F.M., Gorbalenya, A.E., Davison, A.J., 2017a, Changes to taxonomy and the

International Code of Virus Classification and Nomenclature ratified by the

International Committee on Taxonomy of Viruses (2017). Arch Virol 162, 2505-

2538.

Adams, M.J., Lefkowitz, E.J., King, A.M.Q., Harrach, B.z., Harrison, R.L., Knowles, N.J.,

Kropinski, A.M., Krupovic, M., Kuhn, J.H., Mushegian, A.R., Nibert, M.,

Sabanadzovic, S., SanfaÃ§on, H.l.n., Siddell, S.G., Simmonds, P., Varsani, A.,

Zerbini, F.M., Gorbalenya, A.E., Davison, A.J., 2017b, Changes to taxonomy and

the International Code of Virus Classification and Nomenclature ratified by the

158

International Committee on Taxonomy of Viruses (2017). Archives of Virology

162, 2505-2538.

Ahmed, M., Marino, T.R., Puckett, S., Kock, N.D., Lyles, D.S., 2008, Immune response in

the absence of neurovirulence in mice infected with M protein mutant vesicular

stomatitis virus. Journal of virology 82, 9273-9277.

Albertini, A.l.A., MÃ©rigoux, C.c., Libersou, S., Madiona, K., Bressanelli, S.p., Roche,

S.p., Lepault, J., Melki, R., Vachette, P., Gaudin, Y., 2012, Characterization of

monomeric intermediates during VSV glycoprotein structural transition. PLoS

pathogens 8, e1002556.

Albina, E., 1997, Epidemiology of porcine reproductive and respiratory syndrome (PRRS):

an overview. Vet Microbiol 55, 309-316.

Albina, E., Madec, F., Cariolet, R., Torrison, J., 1994, Immune response and persistence

of the porcine reproductive and respiratory syndrome virus in infected pigs and

farm units. Vet Rec 134, 567-573.

Allende, R., Laegreid, W.W., Kutish, G.F., Galeota, J.A., Wills, R.W., Osorio, F.A., 2000,

Porcine reproductive and respiratory syndrome virus: description of persistence in

individual pigs upon experimental infection. J Virol 74, 10834-10837.

Allende, R., Lewis, T.L., Lu, Z., Rock, D.L., Kutish, G.F., Ali, A., Doster, A.R., Osorio,

F.A., 1999, North American and European porcine reproductive and respiratory

syndrome viruses differ in non-structural protein coding regions. Journal of general

virology 80, 307-315.

159

Alonso, C., Murtaugh, M.P., Dee, S.A., Davies, P.R., 2013, Epidemiological study of air

filtration systems for preventing PRRSV infection in large sow herds. Preventive

veterinary medicine 112, 109-117.

Amadori, M., Razzuoli, E., 2014, Immune Control of PRRS: Lessons to be Learned and

Possible Ways Forward. Front Vet Sci 1, 2.

Amarilla, S.P., GÃ³mez-Laguna, J., Carrasco, L., RodrÃguez-GÃ³mez, I.M., y OcerÃn,

J.M.C., Morgan, S.B., Graham, S.P., Frossard, J.-P., Drew, T.W., Salguero, F.J.,

2015, A comparative study of the local cytokine response in the lungs of pigs

experimentally infected with different PRRSV-1 strains: upregulation of IL-1Î± in

highly pathogenic strain induced lesions. Veterinary Immunology and

Immunopathology 164, 137-147.

Ammayappan, A., Nace, R., Peng, K.-W., Russell, S.J., 2013, Neuroattenuation of

vesicular stomatitis virus through picornaviral internal ribosome entry sites. Journal

of virology 87, 3217-3228.

Andreev, D.E., Dmitriev, S.E., Terenin, I.M., Prassolov, V.S., Merrick, W.C., Shatsky,

I.N., 2009, Differential contribution of the m7G-cap to the 5â€² end-dependent

translation initiation of mammalian mRNAs. Nucleic acids research 37, 6135-6147.

Ansari, I.H., Kwon, B., Osorio, F.A., Pattnaik, A.K., 2006, Influence of N-linked

glycosylation of porcine reproductive and respiratory syndrome virus GP5 on virus

infectivity, antigenicity, and ability to induce neutralizing antibodies. J Virol 80,

3994-4004.

160

Ayala-Breton, C., Russell, S.J., Peng, K.-W., 2012. Oncolytic Properties of a Vesicular

Stomatitis/Measles Virus Hybrid. In: MOLECULAR THERAPY, pp. S208-S209.

Bahnemann, H.G., 1990, Inactivation of viral antigens for vaccine preparation with

particular reference to the application of binary ethylenimine. Vaccine 8, 299-303.

Ball, L.A., 1977, Transcriptional mapping of vesicular stomatitis virus in vivo. Journal of

virology 21, 411-414.

Ball, L.A., White, C.N., 1976, Order of transcription of genes of vesicular stomatitis virus.

Proceedings of the National Academy of Sciences 73, 442-446.

Barfoed, A.M., Blixenkrone-MÃ¸ller, M., Jensen, M.H., BÃ¸tner, A., Kamstrup, S.r.,

2004, DNA vaccination of pigs with open reading frame 1â€“7 of PRRS virus.

Vaccine 22, 3628-3641.

Barouch, D.H., Pau, M.G., Custers, J.H.H.V., Koudstaal, W., Kostense, S., Havenga,

M.J.E., Truitt, D.M., Sumida, S.M., Kishko, M.G., Arthur, J.C., 2004,

Immunogenicity of recombinant adenovirus serotype 35 vaccine in the presence of

pre-existing anti-Ad5 immunity. The Journal of Immunology 172, 6290-6297.

Barr, J.N., Whelan, S.P., Wertz, G.W., 1997, cis-Acting signals involved in termination of

vesicular stomatitis virus mRNA synthesis include the conserved AUAC and the

U7 signal for polyadenylation. Journal of virology 71, 8718-8725.

Bassaganya-Riera, J., Thacker, B.J., Yu, S., Strait, E., Wannemuehler, M.J., Thacker, E.L.,

2004, Impact of immunizations with porcine reproductive and respiratory

syndrome virus on lymphoproliferative recall responses of CD8+ T cells. Viral

Immunol 17, 25-37.

161

Batista, L., Pijoan, C., Dee, S., Olin, M., Molitor, T., Joo, H.S., Xiao, Z., Murtaugh, M.,

2004, Virological and immunological responses to porcine reproductive and

respiratory syndrome virus in a large population of gilts. Can J Vet Res 68, 267-

273.

Bautista, E.M., Meulenberg, J.J., Choi, C.S., Molitor, T.W., 1996, Structural polypeptides

of the American (VR-2332) strain of porcine reproductive and respiratory

syndrome virus. Arch Virol 141, 1357-1365.

Bautista, E.M., Molitor, T.W., 1997, Cell-mediated immunity to porcine reproductive and

respiratory syndrome virus in swine. Viral Immunol 10, 83-94.

Bautista, E.M., Molitor, T.W., 1999, IFN gamma inhibits porcine reproductive and

respiratory syndrome virus replication in macrophages. Arch Virol 144, 1191-1200.

Bautista, E.M., Suarez, P., Molitor, T.W., 1999, T cell responses to the structural

polypeptides of porcine reproductive and respiratory syndrome virus. Archives of

virology 144, 117-134.

Belsham, G.J., Brangwyn, J.K., Ryan, M.D., Abrams, C.C., King, A.M.Q., 1990,

Intracellular expression and processing of foot-and-mouth disease virus capsid

precursors using vaccinia virus vectors: influence of the L protease. Virology 176,

524-530.

Belsham, G.J., Sonenberg, N., 2000, Picornavirus RNA translation: roles for cellular

proteins. Trends in microbiology 8, 330-335.

Benfield, D.A., Nelson, E., Collins, J.E., Harris, L., Goyal, S.M., Robison, D.,

Christianson, W.T., Morrison, R.B., Gorcyca, D., Chladek, D., 1992,

162

Characterization of swine infertility and respiratory syndrome (SIRS) virus (isolate

ATCC VR-2332). J Vet Diagn Invest 4, 127-133.

Beyer, J., Fichtner, D., Schirrmeier, H., Polster, U., Weiland, E., Wege, H., 2000, Porcine

reproductive and respiratory syndrome virus (PRRSV): kinetics of infection in

lymphatic organs and lung. J Vet Med B Infect Dis Vet Public Health 47, 9-25.

Binjawadagi, B., Dwivedi, V., Manickam, C., Ouyang, K., Torrelles, J.B., Renukaradhya,

G.J., 2014a, An innovative approach to induce cross-protective immunity against

porcine reproductive and respiratory syndrome virus in the lungs of pigs through

adjuvanted nanotechnology-based vaccination. Int J Nanomedicine 9, 1519-1535.

Binjawadagi, B., Dwivedi, V., Manickam, C., Ouyang, K., Wu, Y., Lee, L.J., Torrelles,

J.B., Renukaradhya, G.J., 2014b, Adjuvanted poly(lactic-co-glycolic) acid

nanoparticle-entrapped inactivated porcine reproductive and respiratory syndrome

virus vaccine elicits cross-protective immune response in pigs. Int J Nanomedicine

9, 679-694.

Borman, A., Jackson, R.J., 1992, Initiation of translation of human rhinovirus RNA:

mapping the internal ribosome entry site. Virology 188, 685-696.

Botner, A., Strandbygaard, B., Sorensen, K.J., Have, P., Madsen, K.G., Madsen, E.S.,

Alexandersen, S., 1997, Appearance of acute PRRS-like symptoms in sow herds

after vaccination with a modified live PRRS vaccine. Vet Rec 141, 497-499.

Braxton, C.L., Puckett, S.H., Mizel, S.B., Lyles, D.S., 2010, Protection against lethal

vaccinia virus challenge by using an attenuated matrix protein mutant vesicular

163

stomatitis virus vaccine vector expressing poxvirus antigens. Journal of virology

84, 3552-3561.

Buonocore, L., Blight, K.J., Rice, C.M., Rose, J.K., 2002, Characterization of vesicular

stomatitis virus recombinants that express and incorporate high levels of hepatitis

C virus glycoproteins. Journal of virology 76, 6865-6872.

Burkard, C., Lillico, S.G., Reid, E., Jackson, B., Mileham, A.J., Ait-Ali, T., Whitelaw,

C.B.A., Archibald, A.L., 2017, Precision engineering for PRRSV resistance in pigs:

Macrophages from genome edited pigs lacking CD163 SRCR5 domain are fully

resistant to both PRRSV genotypes while maintaining biological function. PLoS

pathogens 13, e1006206.

Butler, J.E., Lager, K.M., Golde, W., Faaberg, K.S., Sinkora, M., Loving, C., Zhang, Y.I.,

2014, Porcine reproductive and respiratory syndrome (PRRS): an immune

dysregulatory pandemic. Immunologic Research 59, 81-108.

Butler, J.E., Sun, J., Weber, P., Ford, S.P., Rehakova, Z., Sinkora, J., Lager, K., 2001,

Antibody repertoire development in fetal and neonatal piglets. IV. Switch

recombination, primarily in fetal thymus, occurs independent of environmental

antigen and is only weakly associated with repertoire diversification. J Immunol

167, 3239-3249.

Cai, J., Li, J., Yan, C., Hu, R., Zhang, J., 2010, Construction and characterization of a

recombinant canine adenovirus expressing GP5 and M proteins of porcine

reproductive and respiratory syndrome virus. Journal of Veterinary Medical

Science 72, 1035-1040.

164

Calvert, J.G., Slade, D.E., Shields, S.L., Jolie, R., Mannan, R.M., Ankenbauer, R.G.,

Welch, S.K., 2007, CD163 expression confers susceptibility to porcine

reproductive and respiratory syndrome viruses. J Virol 81, 7371-7379.

Cancel-Tirado, S.M., Evans, R.B., Yoon, K.-J., 2004, Monoclonal antibody analysis of

porcine reproductive and respiratory syndrome virus epitopes associated with

antibody-dependent enhancement and neutralization of virus infection. Veterinary

Immunology and Immunopathology 102, 249-262.

Cano, J.P., Dee, S.A., Murtaugh, M.P., Pijoan, C., 2007, Impact of a modified-live porcine

reproductive and respiratory syndrome virus vaccine intervention on a population

of pigs infected with a heterologous isolate. Vaccine 25, 4382-4391.

Cao, J., Wang, X., Du, Y., Li, Y., Wang, X., Jiang, P., 2010, CD40 ligand expressed in

adenovirus can improve the immunogenicity of the GP3 and GP5 of porcine

reproductive and respiratory syndrome virus in swine. Vaccine 28, 7514-7522.

Casimiro, D.R., Chen, L., Fu, T.-M., Evans, R.K., Caulfield, M.J., Davies, M.-E., Tang,

A., Chen, M., Huang, L., Harris, V., 2003, Comparative immunogenicity in rhesus

monkeys of DNA plasmid, recombinant vaccinia virus, and replication-defective

adenovirus vectors expressing a human immunodeficiency virus type 1 gag gene.

Journal of virology 77, 6305-6313.

Cavanagh, D., 1997, Nidovirales: a new order comprising Coronaviridae and Arteriviridae.

Arch Virol 142, 629-633.

Chand, R.J., Trible, B.R., Rowland, R.R., 2012, Pathogenesis of porcine reproductive and

respiratory syndrome virus. Current opinion in virology 2, 256-263.

165

Chang, C.C., Yoon, K.J., Zimmerman, J.J., Harmon, K.M., Dixon, P.M., Dvorak, C.M.,

Murtaugh, M.P., 2002, Evolution of porcine reproductive and respiratory syndrome

virus during sequential passages in pigs. J Virol 76, 4750-4763.

Chang, H.-W., Jeng, C.-R., Liu, J.J., Lin, T.-L., Chang, C.-C., Chia, M.-Y., Tsai, Y.-C.,

Pang, V.F., 2005, Reduction of porcine reproductive and respiratory syndrome

virus (PRRSV) infection in swine alveolar macrophages by porcine circovirus 2

(PCV2)-induced interferon-alpha. Veterinary microbiology 108, 167-177.

Chang, H.C., Peng, Y.T., Chang, H.L., Chaung, H.C., Chung, W.B., 2008, Phenotypic and

functional modulation of bone marrow-derived dendritic cells by porcine

reproductive and respiratory syndrome virus. Vet Microbiol 129, 281-293.

Charerntantanakul, W., 2012, Porcine reproductive and respiratory syndrome virus

vaccines: Immunogenicity, efficacy and safety aspects. World Journal of Virology

1, 23-30.

Charerntantanakul, W., Platt, R., Johnson, W., Roof, M., Vaughn, E., Roth, J.A., 2006,

Immune responses and protection by vaccine and various vaccine adjuvant

candidates to virulent porcine reproductive and respiratory syndrome virus. Vet

Immunol Immunopathol 109, 99-115.

Chen, N., Cao, Z., Yu, X., Deng, X., Zhao, T., Wang, L., Liu, Q., Li, X., Tian, K., 2011,

Emergence of novel European genotype porcine reproductive and respiratory

syndrome virus in mainland China. J Gen Virol 92, 880-892.

Cheng, E., CÃ¡rdenas-Freytag, L., Clements, J.D., 1999, The role of cAMP in mucosal

adjuvanticity of Escherichia coli heat-labile enterotoxin (LT). Vaccine 18, 38-49.

166

Chiou, M.T., Jeng, C.R., Chueh, L.L., Cheng, C.H., Pang, V.F., 2000, Effects of porcine

reproductive and respiratory syndrome virus (isolate tw91) on porcine alveolar

macrophages in vitro. Vet Microbiol 71, 9-25.

Cho, J.G., Dee, S.A., Deen, J., Trincado, C., Fano, E., Jiang, Y., Faaberg, K., Murtaugh,

M.P., Guedes, A., Collins, J.E., Joo, H.S., 2006, The impact of animal age, bacterial

coinfection, and isolate pathogenicity on the shedding of Porcine reproductive and

respiratory syndrome virus in aerosols from experimentally infected pigs. Canadian

Journal of Veterinary Research 70, 297-301.

Choi, A.H.C., Smiley, K., Basu, M., McNeal, M.M., Shao, M., Bean, J.A., Clements, J.D.,

Stout, R.R., Ward, R.L., 2007, Protection of mice against rotavirus challenge

following intradermal DNA immunization by Biojector needle-free injection.

Vaccine 25, 3215-3218.

Choi, K., Lee, J., Park, C., Jeong, J., Chae, C., 2015, Comparison of the pathogenesis of

single or dual infections with type 1 and type 2 porcine reproductive and respiratory

syndrome virus. J Comp Pathol 152, 317-324.

Christianson, W.T., Choi, C.S., Collins, J.E., Molitor, T.W., Morrison, R.B., Joo, H.S.,

1993, Pathogenesis of porcine reproductive and respiratory syndrome virus

infection in mid-gestation sows and fetuses. Can J Vet Res 57, 262-268.

Christopher-Hennings, J., Holler, L.D., Benfield, D.A., Nelson, E.A., 2001, Detection and

duration of porcine reproductive and respiratory syndrome virus in semen, serum,

peripheral blood mononuclear cells, and tissues from Yorkshire, Hampshire, and

Landrace boars. J Vet Diagn Invest 13, 133-142.

167

Christopher-Hennings, J., Nelson, E.A., Nelson, J.K., Rossow, K.D., Shivers, J.L., Yaeger,

M.J., Chase, C.C., Garduno, R.A., Collins, J.E., Benfield, D.A., 1998, Identification

of porcine reproductive and respiratory syndrome virus in semen and tissues from

vasectomized and nonvasectomized boars. Vet Pathol 35, 260-267.

Chung, W.B., Lin, M.W., Chang, W.F., Hsu, M., Yang, P.C., 1997, Persistence of porcine

reproductive and respiratory syndrome virus in intensive farrow-to-finish pig herds.

Canadian Journal of Veterinary Research 61, 292-298.

Clarke, D.K., Hendry, R.M., Singh, V., Rose, J.K., Seligman, S.J., Klug, B., Kochhar, S.,

Mac, L.M., Carbery, B., Chen, R.T., 2016, Live virus vaccines based on a vesicular

stomatitis virus (VSV) backbone: standardized template with key considerations

for a risk/benefit assessment. Vaccine 34, 6597-6609.

Clarke, D.K., Nasar, F., Lee, M., Johnson, J.E., Wright, K., Calderon, P., Guo, M., Natuk,

R., Cooper, D., Hendry, R.M., 2007, Synergistic attenuation of vesicular stomatitis

virus by combination of specific G gene truncations and N gene translocations.

Journal of virology 81, 2056-2064.

Clements, J.D., 1990, Construction of a nontoxic fusion peptide for immunization against

Escherichia coli strains that produce heat-labile and heat-stable enterotoxins.

Infection and Immunity 58, 1159-1166.

Clements, J.D., Yancey, R.J., Finkelstein, R.A., 1980, Properties of homogeneous heat-

labile enterotoxin from Escherichia coli. Infection and Immunity 29, 91-97.

168

Cohen, S.B.A., Crawley, J.B., Kahan, M.C., Feldmann, M., Foxwell, B.M.J., 1997,

Interleukinâ€•10 rescues T cells from apoptotic cell death: association with an

upregulation of Bclâ€•2. Immunology 92, 1-5.

Collins, J.E., Benfield, D.A., Christianson, W.T., Harris, L., Hennings, J.C., Shaw, D.P.,

Goyal, S.M., McCullough, S., Morrison, R.B., Joo, H.S., et al., 1992, Isolation of

swine infertility and respiratory syndrome virus (isolate ATCC VR-2332) in North

America and experimental reproduction of the disease in gnotobiotic pigs. J Vet

Diagn Invest 4, 117-126.

Conzelmann, K.K., Visser, N., Van Woensel, P., Thiel, H.J., 1993, Molecular

characterization of porcine reproductive and respiratory syndrome virus, a member

of the arterivirus group. Virology 193, 329-339.

Corzo, C.A., Mondaca, E., Wayne, S., Torremorell, M., Dee, S., Davies, P., Morrison,

R.B., 2010, Control and elimination of porcine reproductive and respiratory

syndrome virus. Virus research 154, 185-192.

Costers, S., Delputte, P.L., Nauwynck, H.J., 2006, Porcine reproductive and respiratory

syndrome virus-infected alveolar macrophages contain no detectable levels of viral

proteins in their plasma membrane and are protected against antibody-dependent,

complement-mediated cell lysis. J Gen Virol 87, 2341-2351.

Costers, S., Lefebvre, D.J., Delputte, P.L., Nauwynck, H.J., 2008, Porcine reproductive

and respiratory syndrome virus modulates apoptosis during replication in alveolar

macrophages. Arch Virol 153, 1453-1465.

169

Costers, S., Lefebvre, D.J., Goddeeris, B., Delputte, P.L., Nauwynck, H.J., 2009,

Functional impairment of PRRSV-specific peripheral CD3+CD8high cells. Vet

Res 40, 46.

Costers, S., Vanhee, M., Van Breedam, W., Van Doorsselaere, J., Geldhof, M., Nauwynck,

H.J., 2010, GP4-specific neutralizing antibodies might be a driving force in PRRSV

evolution. Virus Res 154, 104-113.

Cousens, L.P., Peterson, R., Hsu, S., Dorner, A., Altman, J.D., Ahmed, R., Biron, C.A.,

1999, Two roads diverged: interferon Î±/Î²â€“and interleukin 12â€“mediated

pathways in promoting T cell interferon Î³ responses during viral infection. Journal

of Experimental Medicine 189, 1315-1328.

Cruz, J.L., Zuniga, S., Becares, M., Sola, I., Ceriani, J.E., Juanola, S., Plana, J., Enjuanes,

L., 2010a, Vectored vaccines to protect against PRRSV. Virus Res 154, 150-160.

Cruz, J.L.G., ZÃºÃ±iga, S., BÃ©cares, M., Sola, I., Ceriani, J.E., Juanola, S., Plana, J.,

Enjuanes, L., 2010b, Vectored vaccines to protect against PRRSV. Virus research

154, 150-160.

Daddario-DiCaprio, K.M., Geisbert, T.W., Geisbert, J.B., StrÃ¶her, U., Hensley, L.E.,

Grolla, A., Fritz, E.A., Feldmann, F., Feldmann, H., Jones, S.M., 2006, Cross-

protection against Marburg virus strains by using a live, attenuated recombinant

vaccine. Journal of virology 80, 9659-9666.

Darwich, L., Diaz, I., Mateu, E., 2010, Certainties, doubts and hypotheses in porcine

reproductive and respiratory syndrome virus immunobiology. Virus Res 154, 123-

132.

170

Das, P.B., Dinh, P.X., Ansari, I.H., de Lima, M., Osorio, F.A., Pattnaik, A.K., 2010, The

minor envelope glycoproteins GP2a and GP4 of porcine reproductive and

respiratory syndrome virus interact with the receptor CD163. J Virol 84, 1731-

1740.

Das, P.B., Vu, H.L.X., Dinh, P.X., Cooney, J.L., Kwon, B., Osorio, F.A., Pattnaik, A.K.,

2011, Glycosylation of minor envelope glycoproteins of porcine reproductive and

respiratory syndrome virus in infectious virus recovery, receptor interaction, and

immune response. Virology 410, 385-394. de Geus, B., Dol-Bosman, M., Scholten, J.W., Stok, W., Bianchi, A., 1997, A comparison

of natural and recombinant cholera toxin B subunit as stimulatory factors in

intranasal immunization. Vaccine 15, 1110-1113. de Haan, L., Verweij, W.R., Feil, I.K., Holtrop, M., Hol, W.G., Agsteribbe, E., Wilschut,

J., 1998, Role of GM1 binding in the mucosal immunogenicity and adjuvant

activity of the Escherichia coli heat-labile enterotoxin and its B subunit.

Immunology 94, 424-430. de Lima, M., Pattnaik, A.K., Flores, E.F., Osorio, F.A., 2006, Serologic marker candidates

identified among B-cell linear epitopes of Nsp2 and structural proteins of a North

American strain of porcine reproductive and respiratory syndrome virus. Virology

353, 410-421.

Dea, S., Gagnon, C.A., Mardassi, H., Pirzadeh, B., Rogan, D., 2000, Current knowledge

on the structural proteins of porcine reproductive and respiratory syndrome (PRRS)

171

virus: comparison of the North American and European isolates. Arch Virol 145,

659-688.

Dee, S., Deen, J., Pijoan, C., 2004, Evaluation of 4 intervention strategies to prevent the

mechanical transmission of porcine reproductive and respiratory syndrome virus.

Can J Vet Res 68, 19-26.

Delputte, P.L., Meerts, P., Costers, S., Nauwynck, H.J., 2004, Effect of virus-specific

antibodies on attachment, internalization and infection of porcine reproductive and

respiratory syndrome virus in primary macrophages. Vet Immunol Immunopathol

102, 179-188.

Delputte, P.L., Van Breedam, W., Barbe, F., Van Reeth, K., Nauwynck, H.J., 2007, IFN-

alpha treatment enhances porcine Arterivirus infection of monocytes via

upregulation of the porcine Arterivirus receptor sialoadhesin. J Interferon Cytokine

Res 27, 757-766.

Delputte, P.L., Vanderheijden, N., Nauwynck, H.J., Pensaert, M.B., 2002, Involvement of

the matrix protein in attachment of porcine reproductive and respiratory syndrome

virus to a heparinlike receptor on porcine alveolar macrophages. Journal of

Virology 76, 4312-4320.

Depla, E., Van der Aa, A., Livingston, B.D., Crimi, C., Allosery, K., De Brabandere, V.,

Krakover, J., Murthy, S., Huang, M., Power, S., BabÃ©, L., Dahlberg, C.,

McKinney, D., Sette, A., Southwood, S., Philip, R., Newman, M.J., Meheus, L.,

2008, Rational Design of a Multiepitope Vaccine Encoding T-Lymphocyte

172

Epitopes for Treatment of Chronic Hepatitis B Virus Infections. Journal of

Virology 82, 435-450.

Dertzbaugh, M.T., Elson, C.O., 1993, Reduction in oral immunogenicity of cholera toxin

B subunit by N-terminal peptide addition. Infection and immunity 61, 384-390.

Desrosiers, R., 2011, Transmission of swine pathogens: different means, different needs.

Animal health research reviews 12, 1-13.

Dewey, C., Charbonneau, G., Carman, S., Hamel, A., Nayar, G., Friendship, R., Eernisse,

K., Swenson, S., 2000, Lelystad-like strain of porcine reproductive and respiratory

syndrome virus (PRRSV) identified in Canadian swine. The Canadian Veterinary

Journal 41, 493.

Dhakal, S., Hiremath, J., Bondra, K., Lakshmanappa, Y.S., Shyu, D.L., Ouyang, K., Kang,

K.I., Binjawadagi, B., Goodman, J., Tabynov, K., Krakowka, S., Narasimhan, B.,

Lee, C.W., Renukaradhya, G.J., 2017, Biodegradable nanoparticle delivery of

inactivated swine influenza virus vaccine provides heterologous cell-mediated

immune response in pigs. J Control Release 247, 194-205.

Diaz, I., Darwich, L., Pappaterra, G., Pujols, J., Mateu, E., 2005, Immune responses of pigs

after experimental infection with a European strain of Porcine reproductive and

respiratory syndrome virus. J Gen Virol 86, 1943-1951.

Diaz, I., Darwich, L., Pappaterra, G., Pujols, J., Mateu, E., 2006, Different European-type

vaccines against porcine reproductive and respiratory syndrome virus have

different immunological properties and confer different protection to pigs. Virology

351, 249-259.

173

Diaz, I., Pujols, J., Ganges, L., Gimeno, M., Darwich, L., Domingo, M., Mateu, E., 2009,

In silico prediction and ex vivo evaluation of potential T-cell epitopes in

glycoproteins 4 and 5 and nucleocapsid protein of genotype-I (European) of porcine

reproductive and respiratory syndrome virus. Vaccine 27, 5603-5611.

Dickinson, B.L., Clements, J.D., 1995, Dissociation of Escherichia coli heat-labile

enterotoxin adjuvanticity from ADP-ribosyltransferase activity. Infection and

Immunity 63, 1617-1623.

Dinarello, C.A., 1994, The interleukin-1 family: 10 years of discovery. The FASEB Journal

8, 1314-1325.

Domingo, E., 1998, Quasispecies and the implications for virus persistence and escape.

Clinical and diagnostic virology 10, 97-101.

Domingo, E., Holland, J.J., 1992, Complications of RNA heterogeneity for the engineering

of virus vaccines and antiviral agents, In: Genetic engineering. Springer, pp. 13-

31.

Drew, T.W., Meulenberg, J.J.M., Sands, J.J., Paton, D.J., 1995, Production,

characterization and reactivity of monoclonal antibodies to porcine reproductive

and respiratory syndrome virus. Journal of General Virology 76, 1361-1369.

Duan, X., Nauwynck, H.J., Pensaert, M.B., 1997, Effects of origin and state of

differentiation and activation of monocytes/macrophages on their susceptibility to

porcine reproductive and respiratory syndrome virus (PRRSV). Archives of

Virology 142, 2483-2497.

174

Duntsch, C.D., Zhou, Q., Jayakar, H.R., Weimar, J.D., Robertson, J.H., Pfeffer, L.M.,

Wang, L., Xiang, Z., Whitt, M.A., 2004, Recombinant vesicular stomatitis virus

vectors as oncolytic agents in the treatment of high-grade gliomas in an organotypic

brain tissue sliceâ€”glioma coculture model. Journal of neurosurgery 100, 1049-

1059.

Dwivedi, V., Manickam, C., Binjawadagi, B., Renukaradhya, G.J., 2013, PLGA

nanoparticle entrapped killed porcine reproductive and respiratory syndrome virus

vaccine helps in viral clearance in pigs. Vet Microbiol 166, 47-58.

Dwivedi, V., Manickam, C., Patterson, R., Dodson, K., Murtaugh, M., Torrelles, J.B.,

Schlesinger, L.S., Renukaradhya, G.J., 2011a, Cross-protective immunity to

porcine reproductive and respiratory syndrome virus by intranasal delivery of a live

virus vaccine with a potent adjuvant. Vaccine 29, 4058-4066.

Dwivedi, V., Manickam, C., Patterson, R., Dodson, K., Weeman, M., Renukaradhya, G.J.,

2011b, Intranasal delivery of whole cell lysate of Mycobacterium tuberculosis

induces protective immune responses to a modified live porcine reproductive and

respiratory syndrome virus vaccine in pigs. Vaccine 29, 4067-4076.

Ellingson, J.S., Wang, Y., Layton, S., Ciacci-Zanella, J., Roof, M.B., Faaberg, K.S., 2010,

Vaccine efficacy of porcine reproductive and respiratory syndrome virus chimeras.

Vaccine 28, 2679-2686.

Emerson, S.U., Wagner, R.R., 1972, Dissociation and reconstitution of the transcriptase

and template activities of vesicular stomatitis B and T virions. Journal of virology

10, 297-309.

175

Emerson, S.U., Yu, Y., 1975, Both NS and L proteins are required for in vitro RNA

synthesis by vesicular stomatitis virus. Journal of virology 15, 1348-1356.

Faber, M., Lamirande, E.W., Roberts, A., Rice, A.B., Koprowski, H., Dietzschold, B.,

Schnell, M.J., 2005, A single immunization with a rhabdovirus-based vector

expressing severe acute respiratory syndrome coronavirus (SARS-CoV) S protein

results in the production of high levels of SARS-CoV-neutralizing antibodies.

Journal of general virology 86, 1435-1440.

Fang, L., Jiang, Y., Xiao, S., Niu, C., Zhang, H., Chen, H., 2006a, Enhanced

immunogenicity of the modified GP5 of porcine reproductive and respiratory

syndrome virus. Virus Genes 32, 5-11.

Fang, X., Zhang, S., Sun, X., Li, J., Sun, T., 2012a, Evaluation of attenuated VSVs with

mutated M or/and G proteins as vaccine vectors. Vaccine 30, 1313-1321.

Fang, Y., Christopher-Hennings, J., Brown, E., Liu, H., Chen, Z., Lawson, S.R., Breen, R.,

Clement, T., Gao, X., Bao, J., Knudsen, D., Daly, R., Nelson, E., 2008,

Development of genetic markers in the non-structural protein 2 region of a US type

1 porcine reproductive and respiratory syndrome virus: implications for future

recombinant marker vaccine development. J Gen Virol 89, 3086-3096.

Fang, Y., Faaberg, K.S., Rowland, R.R., Christopher-Hennings, J., Pattnaik, A.K., Osorio,

F., Nelson, E.A., 2006b, Construction of a full-length cDNA infectious clone of a

European-like Type 1 PRRSV isolated in the U.S. Adv Exp Med Biol 581, 605-

608.

176

Fang, Y., Rowland, R.R., Roof, M., Lunney, J.K., Christopher-Hennings, J., Nelson, E.A.,

2006c, A full-length cDNA infectious clone of North American type 1 porcine

reproductive and respiratory syndrome virus: expression of green fluorescent

protein in the Nsp2 region. J Virol 80, 11447-11455.

Fang, Y., Schneider, P., Zhang, W.P., Faaberg, K.S., Nelson, E.A., Rowland, R.R., 2007,

Diversity and evolution of a newly emerged North American Type 1 porcine

arterivirus: analysis of isolates collected between 1999 and 2004. Arch Virol 152,

1009-1017.

Fang, Y., Snijder, E.J., 2010, The PRRSV replicase: exploring the multifunctionality of an

intriguing set of nonstructural proteins. Virus Res 154, 61-76.

Fang, Y., Treffers, E.E., Li, Y., Tas, A., Sun, Z., van der Meer, Y., de Ru, A.H., van Veelen,

P.A., Atkins, J.F., Snijder, E.J., Firth, A.E., 2012b, Efficient -2 frameshifting by

mammalian ribosomes to synthesize an additional arterivirus protein. Proc Natl

Acad Sci U S A 109, E2920-2928.

Feldmann, H., Jones, S.M., Daddario-DiCaprio, K.M., Geisbert, J.B., StrÃ¶her, U., Grolla,

A., Bray, M., Fritz, E.A., Fernando, L., Feldmann, F., 2007, Effective post-

exposure treatment of Ebola infection. PLoS pathogens 3, e2.

Feng, Y., Zhao, T., Nguyen, T., Inui, K., Ma, Y., Nguyen, T.H., Nguyen, V.C., Liu, D.,

Bui, Q.A., To, L.T., 2008, Porcine respiratory and reproductive syndrome virus

variants, Vietnam and China, 2007. Emerging infectious diseases 14, 1774.

177

Fingerut, E., Gutter, B., Meir, R., Eliahoo, D., Pitcovski, J., 2005, Vaccine and adjuvant

activity of recombinant subunit B of E. coli enterotoxin produced in yeast. Vaccine

23, 4685-4696.

Firth, A.E., Zevenhoven-Dobbe, J.C., Wills, N.M., Go, Y.Y., Balasuriya, U.B., Atkins,

J.F., Snijder, E.J., Posthuma, C.C., 2011, Discovery of a small arterivirus gene that

overlaps the GP5 coding sequence and is important for virus production. J Gen

Virol 92, 1097-1106.

Flores-Mendoza, L., Silva-Campa, E., Resendiz, M., Osorio, F.A., Hernandez, J., 2008,

Porcine reproductive and respiratory syndrome virus infects mature porcine

dendritic cells and up-regulates interleukin-10 production. Clin Vaccine Immunol

15, 720-725.

Foss, D.L., Zilliox, M.J., Meier, W., Zuckermann, F., Murtaugh, M.P., 2002, Adjuvant

danger signals increase the immune response to porcine reproductive and

respiratory syndrome virus. Viral Immunol 15, 557-566.

Fuchs, J.D., Frank, I., Elizaga, M.L., Allen, M., Frahm, N., Kochar, N., Li, S., Edupuganti,

S., Kalams, S.A., Tomaras, G.D., 2015. First-in-human evaluation of the safety and

immunogenicity of a recombinant vesicular stomatitis virus human

immunodeficiency virus-1 gag vaccine (HVTN 090). In: Open forum infectious

diseases.

Fuerst, T.R., Niles, E.G., Studier, F.W., Moss, B., 1986, Eukaryotic transient-expression

system based on recombinant vaccinia virus that synthesizes bacteriophage T7

178

RNA polymerase. Proceedings of the National Academy of Sciences 83, 8122-

8126.

Gao, P., Xia, G., Bao, Z., Feng, C., Cheng, X., Kong, M., Liu, Y., Chen, X., 2016, Chitosan

based nanoparticles as protein carriers for efficient oral antigen delivery. Int J Biol

Macromol 91, 716-723.

Garbutt, M., Liebscher, R., Wahl-Jensen, V., Jones, S., MÃ¶ller, P., Wagner, R., Volchkov,

V., Klenk, H.-D., Feldmann, H., StrÃ¶her, U., 2004, Properties of replication-

competent vesicular stomatitis virus vectors expressing glycoproteins of filoviruses

and arenaviruses. Journal of virology 78, 5458-5465.

Ge, P., Tsao, J., Schein, S., Green, T.J., Luo, M., Zhou, Z.H., 2010, Cryo-EM model of the

bullet-shaped vesicular stomatitis virus. Science 327, 689-693.

Gehrke, I., Pabst, R., 1990, Cell composition and lymphocyte subsets in the

bronchoalveolar lavage of normal pigs of different ages in comparison with

germfree and pneumonic pigs. Lung 168, 79-92.

Geisbert, T.W., Daddario-DiCaprio, K.M., Geisbert, J.B., Reed, D.S., Feldmann, F.,

Grolla, A., StrÃ¶her, U., Fritz, E.A., Hensley, L.E., Jones, S.M., 2008, Vesicular

stomatitis virus-based vaccines protect nonhuman primates against aerosol

challenge with Ebola and Marburg viruses. Vaccine 26, 6894-6900.

Geisbert, T.W., Geisbert, J.B., Leung, A., Daddario-DiCaprio, K.M., Hensley, L.E., Grolla,

A., Feldmann, H., 2009, Single-injection vaccine protects nonhuman primates

against infection with marburg virus and three species of ebola virus. Journal of

virology 83, 7296-7304.

179

Gimeno, M., Darwich, L., Diaz, I., de la Torre, E., Pujols, J., MartÃn, M., Inumaru, S.,

Cano, E., Domingo, M., Montoya, M., 2011, Cytokine profiles and phenotype

regulation of antigen presenting cells by genotype-I porcine reproductive and

respiratory syndrome virus isolates. Veterinary research 42, 9.

Gingras, A.-C., Svitkin, Y., Belsham, G.J., Pause, A., Sonenberg, N., 1996, Activation of

the translational suppressor 4E-BP1 following infection with encephalomyocarditis

virus and poliovirus. Proceedings of the National Academy of Sciences 93, 5578-

5583.

Goldberg, T.L., Lowe, J.F., Milburn, S.M., Firkins, L.D., 2003, Quasispecies variation of

porcine reproductive and respiratory syndrome virus during natural infectionâ˜†.

Virology 317, 197-207.

Gomez-Laguna, J., Salguero, F.J., Pallares, F.J., Carrasco, L., 2013, Immunopathogenesis

of porcine reproductive and respiratory syndrome in the respiratory tract of pigs.

Vet J 195, 148-155.

Goto, N., Maeyama, J.-i., Yasuda, Y., Isaka, M., Matano, K., Kozuka, S., Taniguchi, T.,

Miura, Y., Ohkuma, K., Tochikubo, K., 2000, Safety evaluation of recombinant

cholera toxin B subunit produced by Bacillus brevis as a mucosal adjuvant. Vaccine

18, 2164-2171.

Groppo, R., Palmenberg, A.C., 2007, Cardiovirus 2A protein associates with 40S but not

80S ribosome subunits during infection. Journal of virology 81, 13067-13074.

180

Gruters, R.A., van Baalen, C.A., Osterhaus, A.D.M.E., 2002, The advantage of early

recognition of HIV-infected cells by cytotoxic T-lymphocytes. Vaccine 20, 2011-

2015.

Haglund, K., Leiner, I., Kerksiek, K., Buonocore, L., Pamer, E., Rose, J.K., 2002, High-

level primary CD8+ T-cell response to human immunodeficiency virus type 1 Gag

and Env generated by vaccination with recombinant vesicular stomatitis viruses.

Journal of virology 76, 2730-2738.

Halbur, P.G., Paul, P.S., Frey, M.L., Landgraf, J., Eernisse, K., Meng, X.J., Andrews, J.J.,

Lum, M.A., Rathje, J.A., 1996, Comparison of the antigen distribution of two US

porcine reproductive and respiratory syndrome virus isolates with that of the

Lelystad virus. Vet Pathol 33, 159-170.

Hammond, C., Helenius, A., 1994, Folding of VSV G protein: sequential interaction with

BiP and calnexin. Science 266, 456-458.

Han, K., Seo, H.W., Oh, Y., Kang, I., Park, C., Chae, C., 2013, Comparison of the virulence

of European and North American genotypes of porcine reproductive and respiratory

syndrome virus in experimentally infected pigs. Vet J 195, 313-318.

Hanada, K., Suzuki, Y., Nakane, T., Hirose, O., Gojobori, T., 2005, The origin and

evolution of porcine reproductive and respiratory syndrome viruses. Mol Biol Evol

22, 1024-1031.

Haq, T.A., Mason, H.S., Clements, J.D., Arntzen, C.J., 1995, Oral immunization with a

recombinant bacterial antigen produced in transgenic plants. Science 268, 714-716.

181

Hayward, C.M.M., O'Gaora, P., Young, D.B., Griffin, G.E., Thole, J., Hirst, T.R., Castello-

Branco, L.R.R., Lewis, D.J.M., 1999, Construction and murine immunogenicity of

recombinant Bacille Calmette Guerin vaccines expressing the B subunit of

Escherichia coli heat labile enterotoxin. Vaccine 17, 1272-1281.

Holtkamp, D., Kliebenstein, J., 2011, PRRS Costs Industry $664 Million Annually. Pork

Checkoff Study,

http://www.pork.org/News/1265/PRRSCostsIndustry664Million.aspx.

Holtkamp, D.J., Kliebenstein, J.B., Neumann, E.J., Zimmerman, J.J., Rotto, H.F., Yoder,

T.K., Wang, C., Yeske, P.E., Mowrer, C.L., Haley, C.A., 2013, Assessment of the

economic impact of porcine reproductive and respiratory syndrome virus on United

States pork producers. Journal of Swine Health and Production 21, 72-84.

Hou, Y.-H., Chen, J., Tong, G.-Z., Tian, Z.-J., Zhou, Y.-J., Li, G.-X., Li, X., Peng, J.-M.,

An, T.-Q., Yang, H.-C., 2008, A recombinant plasmid co-expressing swine

ubiquitin and the GP5 encoding-gene of porcine reproductive and respiratory

syndrome virus induces protective immunity in piglets. Vaccine 26, 1438-1449.

Hwang, L.N., Englund, N., Pattnaik, A.K., 1998, Polyadenylation of vesicular stomatitis

virus mRNA dictates efficient transcription termination at the intercistronic gene

junctions. Journal of virology 72, 1805-1813.

Hyland, K., Foss, D.L., Johnson, C.R., Murtaugh, M.P., 2004, Oral immunization induces

local and distant mucosal immunity in swine. Vet Immunol Immunopathol 102,

329-338.

182

Hyland, N.P., Quigley, E.M.M., Brint, E., 2014, Microbiota-host interactions in irritable

bowel syndrome: epithelial barrier, immune regulation and brain-gut interactions.

World journal of gastroenterology: WJG 20, 8859.

Jang, S.K., 2006, Internal initiation: IRES elements of picornaviruses and hepatitis c virus.

Virus research 119, 2-15.

Jang, S.K., KrÃ¤usslich, H.G., Nicklin, M.J., Duke, G.M., Palmenberg, A.C., Wimmer,

E., 1988, A segment of the 5'nontranslated region of encephalomyocarditis virus

RNA directs internal entry of ribosomes during in vitro translation. Journal of

virology 62, 2636-2643.

Jeong, J., Park, C., Kang, I., Park, S.-J., Chae, C., 2017a, Concurrent vaccination of boars

with type 1 and type 2 porcine reproductive and respiratory syndrome virus

(PRRSV) reduces seminal shedding of type 1 and type 2 PRRSV. Canadian Journal

of Veterinary Research 81, 108-117.

Jeong, J., Park, C., Kang, I., Park, S.J., Chae, C., 2017b, Concurrent vaccination of boars

with type 1 and type 2 porcine reproductive and respiratory syndrome virus

(PRRSV) reduces seminal shedding of type 1 and type 2 PRRSV. Can J Vet Res

81, 108-117.

Jiang, W., Jiang, P., Li, Y., Tang, J., Wang, X., Ma, S., 2006a, Recombinant adenovirus

expressing GP5 and M fusion proteins of porcine reproductive and respiratory

syndrome virus induce both humoral and cell-mediated immune responses in mice.

Vet Immunol Immunopathol 113, 169-180.

183

Jiang, Y., Fang, L., Xiao, S., Zhang, H., Pan, Y., Luo, R., Li, B., Chen, H., 2007,

Immunogenicity and protective efficacy of recombinant pseudorabies virus

expressing the two major membrane-associated proteins of porcine reproductive

and respiratory syndrome virus. Vaccine 25, 547-560.

Jiang, Y., Xiao, S., Fang, L., Yu, X., Song, Y., Niu, C., Chen, H., 2006b, DNA vaccines

co-expressing GP5 and M proteins of porcine reproductive and respiratory

syndrome virus (PRRSV) display enhanced immunogenicity. Vaccine 24, 2869-

2879.

Johnson, C.R., Griggs, T.F., Gnanandarajah, J., Murtaugh, M.P., 2011, Novel structural

protein in porcine reproductive and respiratory syndrome virus encoded by an

alternative ORF5 present in all arteriviruses. J Gen Virol 92, 1107-1116.

Johnson, C.R., Yu, W., Murtaugh, M.P., 2007, Cross-reactive antibody responses to nsp1

and nsp2 of Porcine reproductive and respiratory syndrome virus. J Gen Virol 88,

1184-1195.

Jones, S.M., Feldmann, H., StrÃ¶her, U., Geisbert, J.B., Fernando, L., Grolla, A., Klenk,

H.-D., Sullivan, N.J., Volchkov, V.E., Fritz, E.A., 2005, Live attenuated

recombinant vaccine protects nonhuman primates against Ebola and Marburg

viruses. Nature medicine 11, 786.

Jung, K., Renukaradhya, G.J., Alekseev, K.P., Fang, Y., Tang, Y., Saif, L.J., 2009, Porcine

reproductive and respiratory syndrome virus modifies innate immunity and alters

disease outcome in pigs subsequently infected with porcine respiratory

184

coronavirus: implications for respiratory viral co-infections. J Gen Virol 90, 2713-

2723.

Kadowaki, N., Antonenko, S., Lau, J.Y.-N., Liu, Y.-J., 2000, Natural interferon

Î±/Î²â€“producing cells link innate and adaptive immunity. Journal of Experimental

Medicine 192, 219-226.

Kahn, J.S., Roberts, A., Weibel, C., Buonocore, L., Rose, J.K., 2001, Replication-

competent or attenuated, nonpropagating vesicular stomatitis viruses expressing

respiratory syncytial virus (RSV) antigens protect mice against RSV challenge.

Journal of virology 75, 11079-11087.

Kappes, M.A., Miller, C.L., Faaberg, K.S., 2015, Porcine reproductive and respiratory

syndrome virus nonstructural protein 2 (nsp2) topology and selective isoform

integration in artificial membranes. Virology 481, 51-62.

Kapur, V., Elam, M.R., Pawlovich, T.M., Murtaugh, M.P., 1996, Genetic variation in

porcine reproductive and respiratory syndrome virus isolates in the midwestern

United States. J Gen Virol 77 ( Pt 6), 1271-1276.

Karniychuk, U.U., Geldhof, M., Vanhee, M., Van Doorsselaere, J., Saveleva, T.A.,

Nauwynck, H.J., 2010, Pathogenesis and antigenic characterization of a new East

European subtype 3 porcine reproductive and respiratory syndrome virus isolate.

BMC Veterinary Research 6, 30.

Katz, J.B., Shafer, A.L., Eernisse, K.A., Landgraf, J.G., Nelson, E.A., 1995, Antigenic

differences between European and American isolates of porcine reproductive and

185

respiratory syndrome virus (PRRSV) are encoded by the carboxyterminal portion

of viral open reading frame 3. Veterinary Microbiology 44, 65-76.

Kelly, E.J., Nace, R., Barber, G.N., Russell, S.J., 2010, Attenuation of vesicular stomatitis

virus encephalitis through microRNA targeting. Journal of virology 84, 1550-1562.

Kim, H., Kim, H.K., Jung, J.H., Choi, Y.J., Kim, J., Um, C.G., Hyun, S.B., Shin, S., Lee,

B., Jang, G., Kang, B.K., Moon, H.J., Song, D.S., 2011, The assessment of efficacy

of porcine reproductive respiratory syndrome virus inactivated vaccine based on

the viral quantity and inactivation methods. Virol J 8, 323.

Kim, H.S., Kwang, J., Yoon, I.J., Joo, H.S., Frey, M.L., 1993, Enhanced replication of

porcine reproductive and respiratory syndrome (PRRS) virus in a homogeneous

subpopulation of MA-104 cell line. Arch Virol 133, 477-483.

Kim, H.S., Park, H., Cho, I.Y., Paik, H.D., Park, E., 2006, Dietary supplementation of

probiotic Bacillus polyfermenticus, Bispan strain, modulates natural killer cell and

T cell subset populations and immunoglobulin G levels in human subjects. J Med

Food 9, 321-327.

Kim, W.I., Kim, J.J., Cha, S.H., Yoon, K.J., 2008, Different biological characteristics of

wild-type porcine reproductive and respiratory syndrome viruses and vaccine

viruses and identification of the corresponding genetic determinants. J Clin

Microbiol 46, 1758-1768.

Kim, W.I., Yoon, K.J., 2008, Molecular assessment of the role of envelope-associated

structural proteins in cross neutralization among different PRRS viruses. Virus

Genes 37, 380-391.

186

Kimman, T.G., Cornelissen, L.A., Moormann, R.J., Rebel, J.M., Stockhofe-Zurwieden, N.,

2009, Challenges for porcine reproductive and respiratory syndrome virus

(PRRSV) vaccinology. Vaccine 27, 3704-3718.

Klinge, K.L., Vaughn, E.M., Roof, M.B., Bautista, E.M., Murtaugh, M.P., 2009, Age-

dependent resistance to Porcine reproductive and respiratory syndrome virus

replication in swine. Virol J 6, 177.

Knoblock, K.F., Canning, P.C., 1992, Modulation of in vitro porcine natural killer cell

activity by recombinant interleukin-1 alpha, interleukin-2 and interleukin-4.

Immunology 76, 299-304.

Kuhn, J.H., Lauck, M., Bailey, A.L., Shchetinin, A.M., Vishnevskaya, T.V., BÃ o, Y.m.,

Ng, T.F.F., LeBreton, M., Schneider, B.S., Gillis, A., Tamoufe, U., Diffo, J.L.D.,

Takuo, J.M., Kondov, N.O., Coffey, L.L., Wolfe, N.D., Delwart, E., Clawson,

A.N., Postnikova, E., Bollinger, L., Lackemeyer, M.G., Radoshitzky, S.R.,

Palacios, G., Wada, J., Shevtsova, Z.V., Jahrling, P.B., Lapin, B.A., Deriabin, P.G.,

Dunowska, M., Alkhovsky, S.V., Rogers, J., Friedrich, T.C., Oâ€™Connor, D.H.,

Goldberg, T.L., 2016, Reorganization and expansion of the nidoviral family

Arteriviridae. Archives of Virology 161, 755-768.

Kuzemtseva, L., de la Torre, E., Martin, G., Soldevila, F., Ait-Ali, T., Mateu, E., Darwich,

L., 2014, Regulation of toll-like receptors 3, 7 and 9 in porcine alveolar

macrophages by different genotype 1 strains of porcine reproductive and

respiratory syndrome virus. Vet Immunol Immunopathol 158, 189-198.

187

Labarque, G., Reeth, K.V., Nauwynck, H., Drexler, C., Van Gucht, S., Pensaert, M., 2004,

Impact of genetic diversity of European-type porcine reproductive and respiratory

syndrome virus strains on vaccine efficacy. Vaccine 22, 4183-4190.

Labarque, G., Van Gucht, S., Van Reeth, K., Nauwynck, H., Pensaert, M., 2003,

Respiratory tract protection upon challenge of pigs vaccinated with attenuated

porcine reproductive and respiratory syndrome virus vaccines. Vet Microbiol 95,

187-197.

Labarque, G.G., Nauwynck, H.J., Van Reeth, K., Pensaert, M.B., 2000, Effect of cellular

changes and onset of humoral immunity on the replication of porcine reproductive

and respiratory syndrome virus in the lungs of pigs. J Gen Virol 81, 1327-1334.

Lamontagne, L., Page, C., Larochelle, R., Longtin, D., Magar, R., 2001, Polyclonal

activation of B cells occurs in lymphoid organs from porcine reproductive and

respiratory syndrome virus (PRRSV)-infected pigs. Vet Immunol Immunopathol

82, 165-182.

Lamphear, B.J., Kirchweger, R., Skern, T., Rhoads, R.E., 1995, Mapping of functional

domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with

picornaviral proteases Implications for cap-dependent and cap-independent

translational initiation. Journal of Biological Chemistry 270, 21975-21983.

Lavelle, E.C., Grant, G., Pfuller, U., O'Hagan, D.T., 2004, Immunological implications of

the use of plant lectins for drug and vaccine targeting to the gastrointestinal tract. J

Drug Target 12, 89-95.

188

Lawson, N.D., Stillman, E.A., Whitt, M.A., Rose, J.K., 1995, Recombinant vesicular

stomatitis viruses from DNA. Proceedings of the National Academy of Sciences

92, 4477-4481.

Lee, C., Yoo, D., 2006, The small envelope protein of porcine reproductive and respiratory

syndrome virus possesses ion channel protein-like properties. Virology 355, 30-43.

Lee, S.M., Schommer, S.K., Kleiboeker, S.B., 2004, Porcine reproductive and respiratory

syndrome virus field isolates differ in in vitro interferon phenotypes. Vet Immunol

Immunopathol 102, 217-231.

Leng, X., Li, Z., Xia, M., He, Y., Wu, H., 2012, Evaluation of the efficacy of an attenuated

live vaccine against highly pathogenic porcine reproductive and respiratory

syndrome virus in young pigs. Clin Vaccine Immunol 19, 1199-1206.

Letchworth, G.J., Rodriguez, L.L., Del Cbarrera, J., 1999, Vesicular stomatitis. The

Veterinary Journal 157, 239-260.

Li, B., Fang, L., Xu, Z., Liu, S., Gao, J., Jiang, Y., Chen, H., Xiao, S., 2009a,

Recombination in vaccine and circulating strains of porcine reproductive and

respiratory syndrome viruses. Emerg Infect Dis 15, 2032-2035.

Li, B., Xiao, S., Wang, Y., Xu, S., Jiang, Y., Chen, H., Fang, L., 2009b, Immunogenicity

of the highly pathogenic porcine reproductive and respiratory syndrome virus GP5

protein encoded by a synthetic ORF5 gene. Vaccine 27, 1957-1963.

Li, J., Fontaine-Rodriguez, E.C., Whelan, S.P.J., 2005, Amino acid residues within

conserved domain VI of the vesicular stomatitis virus large polymerase protein

189

essential for mRNA cap methyltransferase activity. Journal of virology 79, 13373-

13384.

Li, J., Jiang, P., Li, Y., Wang, X., Cao, J., Wang, X., Zeshan, B., 2009c, HSP70 fused with

GP3 and GP5 of porcine reproductive and respiratory syndrome virus enhanced the

immune responses and protective efficacy against virulent PRRSV challenge in

pigs. Vaccine 27, 825-832.

Li, J., Rahmeh, A., Brusic, V., Whelan, S.P.J., 2009d, Opposing effects of inhibiting cap

addition and cap methylation on polyadenylation during vesicular stomatitis virus

mRNA synthesis. Journal of virology 83, 1930-1940.

Li, J., Rahmeh, A., Morelli, M., Whelan, S.P.J., 2008, A conserved motif in region v of the

large polymerase proteins of nonsegmented negative-sense RNA viruses that is

essential for mRNA capping. Journal of virology 82, 775-784.

Li, Y., Shyu, D.L., Shang, P., Bai, J., Ouyang, K., Dhakal, S., Hiremath, J., Binjawadagi,

B., Renukaradhya, G.J., Fang, Y., 2016, Mutations in a Highly Conserved Motif of

nsp1beta Protein Attenuate the Innate Immune Suppression Function of Porcine

Reproductive and Respiratory Syndrome Virus. J Virol 90, 3584-3599.

Li, Y., Treffers, E.E., Napthine, S., Tas, A., Zhu, L., Sun, Z., Bell, S., Mark, B.L., van

Veelen, P.A., van Hemert, M.J., Firth, A.E., Brierley, I., Snijder, E.J., Fang, Y.,

2014, Transactivation of programmed ribosomal frameshifting by a viral protein.

Proc Natl Acad Sci U S A 111, E2172-2181.

190

Li, Y., Wang, X., Bo, K., Wang, X., Tang, B., Yang, B., Jiang, W., Jiang, P., 2007,

Emergence of a highly pathogenic porcine reproductive and respiratory syndrome

virus in the Mid-Eastern region of China. The Veterinary Journal 174, 577-584.

Liljeqvist, S., Samuelson, P., Hansson, M., Nguyen, T.N., Binz, H., StÃ¥hl, S., 1997,

Surface display of the cholera toxin B subunit on Staphylococcus xylosus and

Staphylococcus carnosus. Applied and environmental microbiology 63, 2481-

2488.

Linhares, D.C.L., Cano, J.P., Torremorell, M., Morrison, R.B., 2014, Comparison of time

to PRRSv-stability and production losses between two exposure programs to

control PRRSv in sow herds. Preventive veterinary medicine 116, 111-119.

Linhares, D.C.L., Johnson, C., Morrison, R.B., 2015, Economic Analysis of Vaccination

Strategies for PRRS Control. PloS one 10, e0144265.

Liu, C.H., Chaung, H.C., Chang, H.L., Peng, Y.T., Chung, W.B., 2009, Expression of Toll-

like receptor mRNA and cytokines in pigs infected with porcine reproductive and

respiratory syndrome virus. Vet Microbiol 136, 266-276.

Liu, D., Zhou, R., Zhang, J., Zhou, L., Jiang, Q., Guo, X., Ge, X., Yang, H., 2011,

Recombination analyses between two strains of porcine reproductive and

respiratory syndrome virus in vivo. Virus Res 155, 473-486.

Loemba, H.D., Mounir, S., Mardassi, H., Archambault, D., Dea, S., 1996, Kinetics of

humoral immune response to the major structural proteins of the porcine

reproductive and respiratory syndrome virus. Arch Virol 141, 751-761.

191

Lopez-Fuertes, L., Campos, E., Domenech, N., Ezquerra, A., Castro, J.M.,

DomÄ±Ì•nguez, J., Alonso, F., 2000, Porcine reproductive and respiratory

syndrome (PRRS) virus down-modulates TNF-Î± production in infected

macrophages. Virus research 69, 41-46.

Lopez Fuertes, L., Domenech, N., Alvarez, B., Ezquerra, A., Dominguez, J., Castro, J.M.,

Alonso, F., 1999, Analysis of cellular immune response in pigs recovered from

porcine respiratory and reproductive syndrome infection. Virus Res 64, 33-42.

Lopez, O.J., Oliveira, M.F., Garcia, E.A., Kwon, B.J., Doster, A., Osorio, F.A., 2007,

Protection against porcine reproductive and respiratory syndrome virus (PRRSV)

infection through passive transfer of PRRSV-neutralizing antibodies is dose

dependent. Clin Vaccine Immunol 14, 269-275.

Lopez, O.J., Osorio, F.A., 2004, Role of neutralizing antibodies in PRRSV protective

immunity. Vet Immunol Immunopathol 102, 155-163.

Loving, C.L., Brockmeier, S.L., Sacco, R.E., 2007, Differential type I interferon activation

and susceptibility of dendritic cell populations to porcine arterivirus. Immunology

120, 217-229.

Lowe, J.E., Husmann, R., Firkins, L.D., Zuckermann, F.A., Goldberg, T.L., 2005,

Correlation of cell-mediated immunity against porcine reproductive and respiratory

syndrome virus with protection against reproductive failure in sows during

outbreaks of porcine reproductive and respiratory syndrome in commercial herds.

J Am Vet Med Assoc 226, 1707-1711.

192

Lu, Z., Zhang, J., Huang, C.M., Go, Y.Y., Faaberg, K.S., Rowland, R.R.R., Timoney, P.J.,

Balasuriya, U.B.R., 2012, Chimeric viruses containing the N-terminal ectodomains

of GP5 and M proteins of porcine reproductive and respiratory syndrome virus do

not change the cellular tropism of equine arteritis virus. Virology 432, 99-109.

Lunney, J.K., Fang, Y., Ladinig, A., Chen, N., Li, Y., Rowland, B., Renukaradhya, G.J.,

2015, Porcine Reproductive and Respiratory Syndrome Virus (PRRSV):

Pathogenesis and Interaction with the Immune System. Annual review of animal

biosciences.

Lunney, J.K., Fang, Y., Ladinig, A., Chen, N., Li, Y., Rowland, B., Renukaradhya, G.J.,

2016a, Porcine reproductive and respiratory syndrome virus (PRRSV):

pathogenesis and interaction with the immune system. Annual review of animal

biosciences 4, 129-154.

Lunney, J.K., Fang, Y., Ladinig, A., Chen, N., Li, Y., Rowland, B., Renukaradhya, G.J.,

2016b, Porcine Reproductive and Respiratory Syndrome Virus (PRRSV):

Pathogenesis and Interaction with the Immune System. Annual review of animal

biosciences.

Lunney, J.K., Ho, C.-S., Wysocki, M., Smith, D.M., 2009, Molecular genetics of the swine

major histocompatibility complex, the SLA complex. Developmental &

Comparative Immunology 33, 362-374.

Ma, Y., Duan, Y., Wei, Y., Liang, X., Niewiesk, S., Oglesbee, M., Li, J., 2014, Heat shock

protein 70 enhances mucosal immunity against human norovirus when coexpressed

from a vesicular stomatitis virus vector. Journal of virology 88, 5122-5137.

193

Ma, Y., Li, J., 2011, Vesicular stomatitis virus as a vector to deliver virus-like particles of

human norovirus: a new vaccine candidate against an important noncultivable

virus. Journal of virology 85, 2942-2952.

Madsen, K.G., Hansen, C.M., Madsen, E.S., Strandbygaard, B., Botner, A., Sorensen, K.J.,

1998, Sequence analysis of porcine reproductive and respiratory syndrome virus of

the American type collected from Danish swine herds. Arch Virol 143, 1683-1700.

Mardassi, H., Massie, B., Dea, S., 1996, Intracellular synthesis, processing, and transport

of proteins encoded by ORFs 5 to 7 of porcine reproductive and respiratory

syndrome virus. Virology 221, 98-112.

Mardassi, H., Mounir, S., Dea, S., 1995, Molecular analysis of the ORFs 3 to 7 of porcine

reproductive and respiratory syndrome virus, Quebec reference strain. Archives of

Virology 140, 1405-1418.

Marschalek, A., Drechsel, L., Conzelmann, K.-K., 2012, The importance of being short:

the role of rabies virus phosphoprotein isoforms assessed by differential IRES

translation initiation. European journal of cell biology 91, 17-23.

Marschalek, A., Finke, S., Schwemmle, M., Mayer, D., Heimrich, B., Stitz, L.,

Conzelmann, K.-K., 2009, Attenuation of rabies virus replication and virulence by

picornavirus internal ribosome entry site elements. Journal of virology 83, 1911-

1919.

Martin, E.M., Novak, R.M., Fendrich, M., Vassileva, J., Gonzalez, R., Grbesic, S.,

Nunnally, G., Sworowski, L., 2004, Stroop performance in drug users classified by

194

HIV and hepatitis C virus serostatus. Journal of the International

Neuropsychological Society 10, 298-300.

Martinez, I., Rodriguez, L.L., Jimenez, C., Pauszek, S.J., Wertz, G.W., 2003, Vesicular

stomatitis virus glycoprotein is a determinant of pathogenesis in swine, a natural

host. Journal of virology 77, 8039-8047.

Meier, W.A., Galeota, J., Osorio, F.A., Husmann, R.J., Schnitzlein, W.M., Zuckermann,

F.A., 2003, Gradual development of the interferon-gamma response of swine to

porcine reproductive and respiratory syndrome virus infection or vaccination.

Virology 309, 18-31.

Meng, X.-J., Paul, P.S., Halbur, P.G., Morozov, I., 1995a, Sequence comparison of open

reading frames 2 to 5 of low and high virulence United States isolates of porcine

reproductive and respiratory syndrome virus. Journal of general virology 76, 3181-

3188.

Meng, X.J., 2000, Heterogeneity of porcine reproductive and respiratory syndrome virus:

implications for current vaccine efficacy and future vaccine development. Vet

Microbiol 74, 309-329.

Meng, X.J., Paul, P.S., Halbur, P.G., Lum, M.A., 1995b, Phylogenetic analyses of the

putative M (ORF 6) and N (ORF 7) genes of porcine reproductive and respiratory

syndrome virus (PRRSV): implication for the existence of two genotypes of

PRRSV in the USA and Europe. Archives of virology 140, 745-755.

195

Meng, X.J., Paul, P.S., Morozov, I., Halbur, P.G., 1996, A nested set of six or seven

subgenomic mRNAs is formed in cells infected with different isolates of porcine

reproductive and respiratory syndrome virus. J Gen Virol 77 ( Pt 6), 1265-1270.

Mengeling, W.L., 2005, The porcine reproductive and respiratory syndrome quandary Part

II:Vaccines and vaccination strategy. J Swine Health Prod., 152-156.

Mengeling, W.L., Clouser, D.F., Vorwald, A.C., Lager, K.M., 2002, The potential role of

genetic recombination in the evolution of new strains of porcine reproductive and

respiratory syndrome virus (PRRSV). J Swine Health Prod. 10, 273-275.

Mengeling, W.L., Lager, K.M., Vorwald, A.C., 1998, Clinical consequences of exposing

pregnant gilts to strains of porcine reproductive and respiratory syndrome (PRRS)

virus isolated from field cases of "atypical" PRRS. Am J Vet Res 59, 1540-1544.

Mengeling, W.L., Lager, K.M., Vorwald, A.C., Koehler, K.J., 2003, Strain specificity of

the immune response of pigs following vaccination with various strains of porcine

reproductive and respiratory syndrome virus. Vet Microbiol 93, 13-24.

Mengeling, W.L., Vorwald, A.C., Lager, K.M., Brockmeier, S.L., 1996, Comparison

among strains of porcine reproductive and respiratory syndrome virus for their

ability to cause reproductive failure. Am J Vet Res 57, 834-839.

Merritt, E.A., Pronk, S.E., Sixma, T.K., Kalk, K.H., van Zanten, B.A.M., Hol, W.G.J.,

1994, Structure of partiallyâ€activated E. coli heatâ€labile enterotoxin (LT) at

2.6 Ã… resolution. FEBS letters 337, 88-92.

Meulenberg, J.J., 2000, PRRSV, the virus. Vet Res 31, 11-21.

196

Meulenberg, J.J., de Meijer, E.J., Moormann, R.J., 1993a, Subgenomic RNAs of Lelystad

virus contain a conserved leader-body junction sequence. J Gen Virol 74 ( Pt 8),

1697-1701.

Meulenberg, J.J., Hulst, M.M., de Meijer, E.J., Moonen, P.L., den Besten, A., de Kluyver,

E.P., Wensvoort, G., Moormann, R.J., 1993b, Lelystad virus, the causative agent

of porcine epidemic abortion and respiratory syndrome (PEARS), is related to LDV

and EAV. Virology 192, 62-72.

Meulenberg, J.J., Petersen-den Besten, A., 1996, Identification and characterization of a

sixth structural protein of Lelystad virus: the glycoprotein GP2 encoded by ORF2

is incorporated in virus particles. Virology 225, 44-51.

Meulenberg, J.J., Petersen-den Besten, A., De Kluyver, E.P., Moormann, R.J., Schaaper,

W.M., Wensvoort, G., 1995, Characterization of proteins encoded by ORFs 2 to 7

of Lelystad virus. Virology 206, 155-163.

Meulenberg, J.J., van Nieuwstadt, A.P., van Essen-Zandbergen, A., Langeveld, J.P., 1997,

Posttranslational processing and identification of a neutralization domain of the

GP4 protein encoded by ORF4 of Lelystad virus. Journal of Virology 71, 6061-

6067.

Miguel, J.C., Chen, J., Van Alstine, W.G., Johnson, R.W., 2010, Expression of

inflammatory cytokines and Toll-like receptors in the brain and respiratory tract of

pigs infected with porcine reproductive and respiratory syndrome virus. Vet

Immunol Immunopathol 135, 314-319.

197

Miller, M., 2011, PRRS price tag, $664 million In M. Miller (ed.), Porknetwork 558

http://www.porknetwork.com/pork-news/PRRS-price-tag-641-million--

127963843.html.

Molitor, T.W., Bautista, E.M., Choi, C.S., 1997, Immunity to PRRSV: double-edged

sword. Vet Microbiol 55, 265-276.

Moore, K.W., O'Garra, A., Malefyt, R.d.W., Vieira, P., Mosmann, T.R., 1993, Interleukin-

10. Annual review of immunology 11, 165-190.

Morgan, S.B., Frossard, J.P., Pallares, F.J., Gough, J., Stadejek, T., Graham, S.P.,

Steinbach, F., Drew, T.W., Salguero, F.J., 2014, Pathology and virus distribution

in the lung and lymphoid tissues of pigs experimentally inoculated with three

distinct type 1 PRRS virus isolates of varying pathogenicity. Transboundary and

emerging diseases 63, 285-295.

Morgan, S.B., Graham, S.P., Salguero, F.J., SÃ¡nchez CordÃ³n, P.J., Mokhtar, H., Rebel,

J.M.J., Weesendorp, E., Bodman-Smith, K.B., Steinbach, F., Frossard, J.P., 2013,

Increased pathogenicity of European porcine reproductive and respiratory

syndrome virus is associated with enhanced adaptive responses and viral clearance.

Veterinary Microbiology 163, 13-22.

Mountford, P.S., Smith, A.G., 1995, Internal ribosome entry sites and dicistronic RNAs in

mammalian transgenesis. Trends in Genetics 11, 179-184.

Murtaugh, M.P., Elam, M.R., Kakach, L.T., 1995a, Comparison of the structural protein

coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus.

Arch Virol 140, 1451-1460.

198

Murtaugh, M.P., Elam, M.R., Kakach, L.T., 1995b, Comparison of the structural protein

coding sequences of the VR-2332 and Lelystad virus strains of the PRRS virus.

Archives of Virology 140, 1451-1460.

Murtaugh, M.P., Xiao, Z., Zuckermann, F., 2002, Immunological responses of swine to

porcine reproductive and respiratory syndrome virus infection. Viral Immunol 15,

533-547.

Music, N., Gagnon, C.A., 2010, The role of porcine reproductive and respiratory syndrome

(PRRS) virus structural and non-structural proteins in virus pathogenesis. Animal

health research reviews 11, 135-163.

Nam, E., Park, C.K., Kim, S.H., Joo, Y.S., Yeo, S.G., Lee, C., 2009, Complete genomic

characterization of a European type 1 porcine reproductive and respiratory

syndrome virus isolate in Korea. Arch Virol 154, 629-638.

Nashar, T.O., Amin, T., Marcello, A., Hirst, T.R., 1993, Current progress in the

development of the B subunits of cholera toxin and Escherichia coli heat-labile

enterotoxin as carriers for the oral delivery of heterologous antigens and epitopes.

Vaccine 11, 235-240.

Nashar, T.O., Hirst, T.R., Williams, N.A., 1997, Modulation of Bâ€•cell activation by the

B subunit of Escherichia coli enterotoxin: receptor interaction upâ€•regulates

MHC class II, B7, CD40, CD25 and ICAMâ€•1. Immunology 91, 572-578.

Nashar, T.O., Williams, N.A., Hirst, T.R., 1996, Cross-linking of cell surface ganglioside

GM1 induces the selective apoptosis of mature CD+ T lymphocytes. International

immunology 8, 731-736.

199

Nauwynck, H.J., Duan, X., Favoreel, H.W., Van Oostveldt, P., Pensaert, M.B., 1999, Entry

of porcine reproductive and respiratory syndrome virus into porcine alveolar

macrophages via receptor-mediated endocytosis. Journal of General Virology 80,

297-305.

Nelsen, C.J., Murtaugh, M.P., Faaberg, K.S., 1999, Porcine reproductive and respiratory

syndrome virus comparison: divergent evolution on two continents. J Virol 73, 270-

280.

Nelson, E.A., Christopher-Hennings, J., Benfield, D.A., 1994, Serum immune responses

to the proteins of porcine reproductive and respiratory syndrome (PRRS) virus. J

Vet Diagn Invest 6, 410-415.

Nelson, E.A., Christopher-Hennings, J., Drew, T., Wensvoort, G., Collins, J.E., Benfield,

D.A., 1993, Differentiation of U.S. and European isolates of porcine reproductive

and respiratory syndrome virus by monoclonal antibodies. J Clin Microbiol 31,

3184-3189.

Neumann, E.J., Kliebenstein, J.B., Johnson, C.D., Mabry, J.W., Bush, E.J., Seitzinger,

A.H., Green, A.L., Zimmerman, J.J., 2005, Assessment of the economic impact of

porcine reproductive and respiratory syndrome on swine production in the United

States. J Am Vet Med Assoc 227, 385-392.

Nielsen, H.S., Oleksiewicz, M.B., Forsberg, R., Stadejek, T., Botner, A., Storgaard, T.,

2001, Reversion of a live porcine reproductive and respiratory syndrome virus

vaccine investigated by parallel mutations. J Gen Virol 82, 1263-1272.

200

Nielsen, J., Botner, A., Bille-Hansen, V., Oleksiewicz, M.B., Storgaard, T., 2002,

Experimental inoculation of late term pregnant sows with a field isolate of porcine

reproductive and respiratory syndrome vaccine-derived virus. Vet Microbiol 84, 1-

13.

Nielsen, T.L., Nielsen, J., Have, P., Baekbo, P., Hoff-Jorgensen, R., Botner, A., 1997,

Examination of virus shedding in semen from vaccinated and from previously

infected boars after experimental challenge with porcine reproductive and

respiratory syndrome virus. Vet Microbiol 54, 101-112.

Nilubol, D., Platt, K.B., Halbur, P.G., Torremorell, M., Harris, D.L., 2004, The effect of a

killed porcine reproductive and respiratory syndrome virus (PRRSV) vaccine

treatment on virus shedding in previously PRRSV infected pigs. Vet Microbiol 102,

11-18.

Ochs, K., Rust, R.C., Niepmann, M., 1999, Translation initiation factor eIF4B interacts

with a picornavirus internal ribosome entry site in both 48S and 80S initiation

complexes independently of initiator AUG location. Journal of virology 73, 7505-

7514.

Ogino, T., Banerjee, A.K., 2007, Unconventional mechanism of mRNA capping by the

RNA-dependent RNA polymerase of vesicular stomatitis virus. Molecular cell 25,

85-97.

Ohlinger, V.F., Weiland, F., Haas, B., Visser, N., Ahl, R., Mettenleiter, T.C., Weiland, E.,

Rziha, H.J., Saalmuller, A., Straub, O.C., 1991, ETIOLOGIC STUDIES OF THE

201

PORCINE REPRODUCTIVE AND RESPIRATORY SYNDROME (PRRS).

Tierarztliche Umschau 46, 703-&.

Osorio, F.A., Galeota, J.A., Nelson, E., Brodersen, B., Doster, A., Wills, R., Zuckermann,

F., Laegreid, W.W., 2002, Passive transfer of virus-specific antibodies confers

protection against reproductive failure induced by a virulent strain of porcine

reproductive and respiratory syndrome virus and establishes sterilizing immunity.

Virology 302, 9-20.

Ostrowski, M., Galeota, J.A., Jar, A.M., Platt, K.B., Osorio, F.A., Lopez, O.J., 2002,

Identification of neutralizing and nonneutralizing epitopes in the porcine

reproductive and respiratory syndrome virus GP5 ectodomain. J Virol 76, 4241-

4250.

Otake, S., Dee, S., Corzo, C., Oliveira, S., Deen, J., 2010, Long-distance airborne transport

of infectious PRRSV and Mycoplasma hyopneumoniae from a swine population

infected with multiple viral variants. Vet Microbiol 145, 198-208.

Papatsiros, V.G., Alexopoulos, C., Kritas, S.K., Koptopoulos, G., Nauwynck, H.J.,

Pensaert, M.B., Kyriakis, S.C., 2006, Long-term administration of a commercial

porcine reproductive and respiratory syndrome virus (PRRSV)-inactivated vaccine

in PRRSV-endemically infected sows. J Vet Med B Infect Dis Vet Public Health

53, 266-272.

Parida, R., Choi, I.S., Peterson, D.A., Pattnaik, A.K., Laegreid, W., Zuckermann, F.A.,

Osorio, F.A., 2012, Location of T-cell epitopes in nonstructural proteins 9 and 10

202

of type-II porcine reproductive and respiratory syndrome virus. Virus Res 169, 13-

21.

Park, C., Choi, K., Jeong, J., Chae, C., 2015a, Cross-protection of a new type 2 porcine

reproductive and respiratory syndrome virus (PRRSV) modified live vaccine

(Fostera PRRS) against heterologous type 1 PRRSV challenge in growing pigs. Vet

Microbiol 177, 87-94.

Park, C., Choi, K., Jeong, J., Kang, I., Park, S.J., Chae, C., 2015b, Concurrent vaccination

of pigs with type 1 and type 2 porcine reproductive and respiratory syndrome virus

(PRRSV) protects against type 1 PRRSV but not against type 2 PRRSV on dually

challenged pigs. Res Vet Sci 103, 193-200.

Park, C., Seo, H.W., Han, K., Kang, I., Chae, C., 2012, Evaluation of the efficacy of a new

modified live porcine reproductive and respiratory syndrome virus (PRRSV)

vaccine (Fostera PRRS) against heterologous PRRSV challenge. Veterinary

microbiology 172, 432-442.

Park, C., Seo, H.W., Han, K., Kang, I., Chae, C., 2014, Evaluation of the efficacy of a new

modified live porcine reproductive and respiratory syndrome virus (PRRSV)

vaccine (Fostera PRRS) against heterologous PRRSV challenge. Veterinary

Microbiology.

Patton, J.B., Rowland, R.R., Yoo, D., Chang, K.-O., 2009, Modulation of CD163 receptor

expression and replication of porcine reproductive and respiratory syndrome virus

in porcine macrophages. Virus research 140, 161-171.

Pavot, V., 2016, Leading Ebola vaccine candidates. Vaccin Res Open J 1, 60-71.

203

Pelletier, J., Sonenberg, N., 1988, Internal initiation of translation of eukaryotic mRNA

directed by a sequence derived from poliovirus RNA. Nature 334, 320.

Perez, A.M., Davies, P.R., Goodell, C.K., Holtkamp, D.J., Mondaca-FernÃ¡ndez, E.,

Poljak, Z., Tousignant, S.J., Valdes-Donoso, P., Zimmerman, J.J., Morrison, R.B.,

2015, Lessons learned and knowledge gaps about the epidemiology and control of

porcine reproductive and respiratory syndrome virus in North America. Journal of

the American Veterinary Medical Association 246, 1304-1317.

Pileri, E., Mateu, E., 2016a, Review on the transmission porcine reproductive and

respiratory syndrome virus between pigs and farms and impact on vaccination.

Veterinary research 47, 108.

Pileri, E., Mateu, E., 2016b, Review on the transmission porcine reproductive and

respiratory syndrome virus between pigs and farms and impact on vaccination. Vet

Res 47, 108.

Piras, F., Bollard, S., Laval, F., Joisel, F., Reynaud, G., Charreyre, C., Andreoni, C.,

Juillard, V., 2005, Porcine reproductive and respiratory syndrome (PRRS) virus-

specific interferon-gamma(+) T-cell responses after PRRS virus infection or

vaccination with an inactivated PRRS vaccine. Viral Immunol 18, 381-389.

Pirzadeh, B., Dea, S., 1998, Immune response in pigs vaccinated with plasmid DNA

encoding ORF5 of porcine reproductive and respiratory syndrome virus. Journal of

general virology 79, 989-999.

204

Pirzadeh, B., Gagnon, C.A., Dea, S., 1998, Genomic and antigenic variations of porcine

reproductive and respiratory syndrome virus major envelope GP5 glycoprotein.

Canadian Journal of Veterinary Research 62, 170.

Pitkin, A., Deen, J., Dee, S., 2009, Further assessment of fomites and personnel as vehicles

for the mechanical transport and transmission of porcine reproductive and

respiratory syndrome virus. Can J Vet Res 73, 298-302.

Plagemann, P.G., 2006, Neutralizing antibody formation in swine infected with seven

strains of porcine reproductive and respiratory syndrome virus as measured by

indirect ELISA with peptides containing the GP5 neutralization epitope. Viral

Immunol 19, 285-293.

Plana-Duran, J., Bastons, M., Urniza, A., Vayreda, M., Vila, X., Mane, H., 1997, Efficacy

of an inactivated vaccine for prevention of reproductive failure induced by porcine

reproductive and respiratory syndrome virus. Veterinary microbiology 55, 361-

370.

Prather, R.S., Lorson, M., Ross, J.W., Whyte, J.J., Walters, E., 2013, Genetically

engineered pig models for human diseases. Annual review of animal biosciences 1,

203-219.

Prieto, C., Alvarez, E., Martinez-Lobo, F.J., Simarro, I., Castro, J.M., 2008, Similarity of

European porcine reproductive and respiratory syndrome virus strains to vaccine

strain is not necessarily predictive of the degree of protective immunity conferred.

Vet J 175, 356-363.

205

Prieto, C., MartÃnez-Lobo, F.J., DÃez-Fuertes, F., Aguilar-Calvo, P., Simarro, I., Castro,

J.M., 2011, Immunisation of pigs with a major envelope protein sub-unit vaccine

against porcine reproductive and respiratory syndrome virus (PRRSV) results in

enhanced clinical disease following experimental challenge. The Veterinary

Journal 189, 323-329.

Publicover, J., Ramsburg, E., Rose, J.K., 2004, Characterization of nonpathogenic, live,

viral vaccine vectors inducing potent cellular immune responses. Journal of

virology 78, 9317-9324.

Qiu, H.-J., Tian, Z.-J., Tong, G.-Z., Zhou, Y.-J., Ni, J.-Q., Luo, Y.-Z., Cai, X.-H., 2005,

Protective immunity induced by a recombinant pseudorabies virus expressing the

GP5 of porcine reproductive and respiratory syndrome virus in piglets. Veterinary

immunology and immunopathology 106, 309-319.

Ramsburg, E., Rose, N.F., Marx, P.A., Mefford, M., Nixon, D.F., Moretto, W.J.,

Montefiori, D., Earl, P., Moss, B., Rose, J.K., 2004, Highly effective control of an

AIDS virus challenge in macaques by using vesicular stomatitis virus and modified

vaccinia virus Ankara vaccine vectors in a single-boost protocol. Journal of

virology 78, 3930-3940.

Rathkjen, P.H., Dall, J., 2017, Control and eradication of porcine reproductive and

respiratory syndrome virus type 2 using a modified-live type 2 vaccine in

combination with a load, close, homogenise model: an area elimination study. Acta

Veterinaria Scandinavica 59, 4.

206

Reed, L.J., Muench, L., 1938, A Simple Method of Estimating Fifty Per Cent Endpoints.

The American Journal of Hygiene 27(3), 493-497.

Renukaradhya, G.J., Alekseev, K., Jung, K., Fang, Y., Saif, L.J., 2010, Porcine

reproductive and respiratory syndrome virus-induced immunosuppression

exacerbates the inflammatory response to porcine respiratory coronavirus in pigs.

Viral Immunol 23, 457-466.

Renukaradhya, G.J., Dwivedi, V., Manickam, C., Binjawadagi, B., Benfield, D., 2012,

Mucosal vaccines to prevent porcine reproductive and respiratory syndrome: a new

perspective. Anim Health Res Rev 13, 21-37.

Renukaradhya, G.J., Meng, X.J., Calvert, J.G., Roof, M., Lager, K.M., 2015a, Inactivated

and subunit vaccines against porcine reproductive and respiratory syndrome:

Current status and future direction. Vaccine 33, 3065-3072.

Renukaradhya, G.J., Meng, X.J., Calvert, J.G., Roof, M., Lager, K.M., 2015b, Live porcine

reproductive and respiratory syndrome virus vaccines: Current status and future

direction. Vaccine 33, 4069-4080.

Reuter, J.D., Vivas-Gonzalez, B.E., Gomez, D., Wilson, J.H., Brandsma, J.L., Greenstone,

H.L., Rose, J.K., Roberts, A., 2002, Intranasal vaccination with a recombinant

vesicular stomatitis virus expressing cottontail rabbit papillomavirus L1 protein

provides complete protection against papillomavirus-induced disease. Journal of

virology 76, 8900-8909.

Rezaee, M.A., Rezaee, A., Moazzeni, S.M., Salmanian, A.H., Yasuda, Y., Tochikubo, K.,

Pirayeh, S.N., Arzanlou, M., 2005, Expression of Escherichia coli heat-labile

207

enterotoxin B subunit (LTB) in Saccharomyces cerevisiae. The Journal of

Microbiology 43, 354-360.

Richardson, J.S., 2011, The cost of endemic disease in pig production. The Pig Journal 65,

10-17.

Robain, O., Chany-Fournier, F., Cerutti, I., Mazlo, M., Chany, C., 1986, Role of VSV G

antigen in the development of experimental spongiform encephalopathy in mice.

Acta neuropathologica 70, 220-226.

Roberts, A., Buonocore, L., Price, R., Forman, J., Rose, J.K., 1999, Attenuated vesicular

stomatitis viruses as vaccine vectors. Journal of virology 73, 3723-3732.

MartÃnez, E., Darwich, L., Fang, Y., Maldonado, J., March, R., Mateu, E., 2012,

Effects of challenge with a virulent genotype II strain of porcine reproductive and

respiratory syndrome virus on piglets vaccinated with an attenuated genotype I

strain vaccine. The Veterinary Journal 193, 92-96.

Rompato, G., Ling, E., Chen, Z., Van Kruiningen, H., Garmendia, A.E., 2006, Positive

inductive effect of IL-2 on virus-specific cellular responses elicited by a PRRSV-

ORF7 DNA vaccine in swine. Veterinary immunology and immunopathology 109,

151-160.

Ropp, S.L., Wees, C.E., Fang, Y., Nelson, E.A., Rossow, K.D., Bien, M., Arndt, B.,

Preszler, S., Steen, P., Christopher-Hennings, J., Collins, J.E., Benfield, D.A.,

Faaberg, K.S., 2004a, Characterization of emerging European-like porcine

208

reproductive and respiratory syndrome virus isolates in the United States. J Virol

78, 3684-3703.

Ropp, S.L., Wees, C.E.M., Fang, Y., Nelson, E.A., Rossow, K.D., Bien, M., Arndt, B.,

Preszler, S., Steen, P., Christopher-Hennings, J., 2004b, Characterization of

emerging European-like porcine reproductive and respiratory syndrome virus

isolates in the United States. Journal of Virology 78, 3684-3703.

Rosales‐Mendoza, S., Alpuche‐Solís, Á.G., Soria‐Guerra, R.E., Moreno‐Fierros, L.,

Martínez‐González, L., Herrera‐Díaz, A., Korban, S.S., 2009, Expression of an

Escherichia coli antigenic fusion protein comprising the heat labile toxin B

subunit and the heat stable toxin, and its assembly as a functional oligomer in

transplastomic tobacco plants. The Plant Journal 57, 45-54.

Rose, J.K., Whitt, M.A. 2001. Rhabdoviridae: the viruses and their replication, vol. 1

(Lippincott-Raven, New York, NY).

Rose, N.F., Marx, P.A., Luckay, A., Nixon, D.F., Moretto, W.J., Donahoe, S.M.,

Montefiori, D., Roberts, A., Buonocore, L., Rose, J.K., 2001, An effective AIDS

vaccine based on live attenuated vesicular stomatitis virus recombinants. Cell 106,

539-549.

Rossow, K.D., Bautista, E.M., Goyal, S.M., Molitor, T.W., Murtaugh, M.P., Morrison,

R.B., Benfield, D.A., Collins, J.E., 1994, Experimental porcine reproductive and

respiratory syndrome virus infection in one-, four-, and 10-week-old pigs. J Vet

Diagn Invest 6, 3-12.

209

Rowland, R.R., 2007, The stealthy nature of PRRSV infection: the dangers posed by that

ever-changing mystery swine disease. Vet J 174, 451.

Rowland, R.R., Lawson, S., Rossow, K., Benfield, D.A., 2003, Lymphoid tissue tropism

of porcine reproductive and respiratory syndrome virus replication during

persistent infection of pigs originally exposed to virus in utero. Vet Microbiol 96,

219-235.

Rowland, R.R., Steffen, M., Ackerman, T., Benfield, D.A., 1999, The evolution of porcine

reproductive and respiratory syndrome virus: quasispecies and emergence of a virus

subpopulation during infection of pigs with VR-2332. Virology 259, 262-266.

Rowland, R.R.R., Robinson, B., Stefanick, J., Kim, T.S., Guanghua, L., Lawson, S.R.,

Benfield, D.A., 2001, Inhibition of porcine reproductive and respiratory syndrome

virus by interferon-gamma and recovery of virus replication with 2-aminopurine.

Archives of Virology 146, 539-555.

Sandkvist, M., Hirst, T.R., Bagdasarian, M., 1987, Alterations at the carboxyl terminus

change assembly and secretion properties of the B subunit of Escherichia coli heat-

labile enterotoxin. Journal of bacteriology 169, 4570-4576.

Santra, S., Sun, Y., Parvani, J.G., Philippon, V., Wyand, M.S., Manson, K., Gomez-Yafal,

A., Mazzara, G., Panicali, D., Markham, P.D., 2007, Heterologous prime/boost

immunization of rhesus monkeys by using diverse poxvirus vectors. Journal of

virology 81, 8563-8570.

Schnell, M.J., Buonocore, L., Kretzschmar, E., Johnson, E., Rose, J.K., 1996, Foreign

glycoproteins expressed from recombinant vesicular stomatitis viruses are

210

incorporated efficiently into virus particles. Proceedings of the National Academy

of Sciences 93, 11359-11365.

Schwartz, J.A., Buonocore, L., Roberts, A., Suguitan Jr, A., Kobasa, D., Kobinger, G.,

Feldmann, H., Subbarao, K., Rose, J.K., 2007, Vesicular stomatitis virus vectors

expressing avian influenza H5 HA induce cross-neutralizing antibodies and long-

term protection. Virology 366, 166-173.

Scortti, M., Prieto, C., Alvarez, E., Simarro, I., Castro, J.M., 2007, Failure of an inactivated

vaccine against porcine reproductive and respiratory syndrome to protect gilts

against a heterologous challenge with PRRSV. Vet Rec 161, 809-813.

Shi, M., Holmes, E.C., Brar, M.S., Leung, F.C.-C., 2013, Recombination is associated with

an outbreak of novel highly pathogenic porcine reproductive and respiratory

syndrome viruses in China. Journal of virology 87, 10904-10907.

Shi, M., Lam, T.T., Hon, C.C., Hui, R.K., Faaberg, K.S., Wennblom, T., Murtaugh, M.P.,

Stadejek, T., Leung, F.C., 2010a, Molecular epidemiology of PRRSV: a

phylogenetic perspective. Virus Res 154, 7-17.

Shi, M., Lam, T.T., Hon, C.C., Murtaugh, M.P., Davies, P.R., Hui, R.K., Li, J., Wong,

L.T., Yip, C.W., Jiang, J.W., Leung, F.C., 2010b, Phylogeny-based evolutionary,

demographical, and geographical dissection of North American type 2 porcine

reproductive and respiratory syndrome viruses. J Virol 84, 8700-8711.

Silva-Campa, E., Flores-Mendoza, L., Resendiz, M., Pinelli-Saavedra, A., Mata-Haro, V.,

Mwangi, W., Hernandez, J., 2009, Induction of T helper 3 regulatory cells by

211

dendritic cells infected with porcine reproductive and respiratory syndrome virus.

Virology 387, 373-379.

Sirisereewan, C., Nedumpun, T., Kesdangsakonwut, S., Woonwong, Y., Kedkovid, R.,

Arunorat, J., Thanawongnuwech, R., Suradhat, S., 2017a, Positive

immunomodulatory effects of heterologous DNA vaccine- modified live vaccine,

prime-boost immunization, against the highly-pathogenic PRRSV infection.

Veterinary Immunology and Immunopathology 183, 7-15.

Sirisereewan, C., Nedumpun, T., Kesdangsakonwut, S., Woonwong, Y., Kedkovid, R.,

Arunorat, J., Thanawongnuwech, R., Suradhat, S., 2017b, Positive

immunomodulatory effects of heterologous DNA vaccine-modified live vaccine,

prime-boost immunization, against the highly-pathogenic PRRSV infection.

Veterinary immunology and immunopathology 183, 7-15.

Sixma, T.K., Aguirre, A., van Scheltinga, A.C.T., Wartna, E.S., Kalk, K.H., Hol, W.G.J.,

1992, Heat-labile enterotoxin crystal forms with variable A/B5 orientation Analysis

of conformational flexibility. FEBS letters 305, 81-85.

Skwarczynski, M., Toth, I., 2016, Peptide-based synthetic vaccines. Chemical Science 7,

842-854.

Snider, D.P., 1995, The mucosal adjuvant activities of ADP-ribosylating bacterial

enterotoxins. Critical Reviewsâ„¢ in Immunology 15.

Snijder, E.J., Kikkert, M., Fang, Y., 2013, Arterivirus molecular biology and pathogenesis.

J Gen Virol 94, 2141-2163.

212

Snijder, E.J., Meulenberg, J.J., 1998, The molecular biology of arteriviruses. J Gen Virol

79 ( Pt 5), 961-979.

Spangler, B.D., 1992, Structure and function of cholera toxin and the related Escherichia

coli heat-labile enterotoxin. Microbiological reviews 56, 622-647.

Spriggs, K.A., Stoneley, M., Bushell, M., Willis, A.E., 2008, Reâ€•programming of

translation following cell stress allows IRESâ€•mediated translation to

predominate. Biology of the Cell 100, 27-38.

Storgaard, T., Oleksiewicz, M., Botner, A., 1999, Examination of the selective pressures

on a live PRRS vaccine virus. Arch Virol 144, 2389-2401.

Sun, L., Li, Y., Liu, R., Wang, X., Gao, F., Lin, T., Huang, T., Yao, H., Tong, G., Fan, H.,

2013a, Porcine reproductive and respiratory syndrome virus ORF5a protein is

essential for virus viability. Virus research 171, 178-185.

Sun, T., Lu, P., Wang, X., 2004, Localization of infection-related epitopes on the non-

structural protein 3ABC of foot-and-mouth disease virus and the application of

tandem epitopes. Journal of Virological Methods 119, 79-86.

Sun, X.-Z., Wertz1, N., Lager, K.L., Tobin, G., Butler, J.E., 2012, Antibody Repertoire

Development in Fetal and Neonatal Piglets XXIII: Fetal piglets infected with a

vaccine strain of PRRS Virus display the same immune dysregulation seen in

isolator piglets. Vaccine, In press.

Sun, Z., Lawson, S., Langenhorst, R., McCormick, K.L., Brunick, C., Opriessnig, T.,

Baker, R., Yoon, K.J., Zhang, W., Huber, V.C., Fang, Y., 2013b, Construction and

immunogenicity evaluation of an epitope-based antigen against swine influenza A

213

virus using Escherichia coli heat-labile toxin B subunit as a carrier-adjuvant. Vet

Microbiol 164, 229-238.

Sur, J.-H., Cooper, V.L., Galeota, J.A., Hesse, R.A., Doster, A.R., Osorio, F.A., 1996, In

vivo detection of porcine reproductive and respiratory syndrome virus RNA by in

situ hybridization at different times postinfection. Journal of Clinical Microbiology

34, 2280-2286.

Tacket, C.O., Mason, H.S., Losonsky, G., Clements, J.D., Levine, M.M., Arntzen, C.J.,

1998, Immunogenicity in humans of a recombinant bacterial antigen delivered in a

transgenic potato. Nat Med 4, 607-609.

Tamura, S.-i., Yajima, A., Hatori, E., Tamura, S., Asanuma, H., Suzuki, Y., Aizawa, C.,

Kurata, T., 1997, Effects of frequent intranasal administration of adjuvant-

combined influenza vaccine on the protection against virus infection. Vaccine 15,

1784-1790.

Terpstra, C., Wensvoort, G., Pol, J.M., 1991, Experimental reproduction of porcine

epidemic abortion and respiratory syndrome (mystery swine disease) by infection

with Lelystad virus: Koch's postulates fulfilled. Vet Q 13, 131-136.

Thanawongnuwech, R., Young, T.F., Thacker, B.J., Thacker, E.L., 2001, Differential

production of proinflammatory cytokines: in vitro PRRSV and Mycoplasma

hyopneumoniae co-infection model. Vet Immunol Immunopathol 79, 115-127.

Thiel, V., Weber, F., 2008, Interferon and cytokine responses to SARS-coronavirus

infection. Cytokine Growth Factor Rev 19, 121-132.

214

Tian, K., Yu, X., Zhao, T., Feng, Y., Cao, Z., Wang, C., Hu, Y., Chen, X., Hu, D., Tian,

X., 2007, Emergence of fatal PRRSV variants: unparalleled outbreaks of atypical

PRRS in China and molecular dissection of the unique hallmark. PLoS One 2, e526.

Tian, Z.J., An, T.Q., Zhou, Y.J., Peng, J.M., Hu, S.P., Wei, T.C., Jiang, Y.F., Xiao, Y.,

Tong, G.Z., 2009, An attenuated live vaccine based on highly pathogenic porcine

reproductive and respiratory syndrome virus (HP-PRRSV) protects piglets against

HP-PRRS. Vet Microbiol 138, 34-40.

Torremorell, M., Moore, C., Christianson, W.T., 2002, Establishment of a herd negative

for porcine reproductive and respiratory syndrome virus (PRRSV) from PRRSV-

positive sources. Journal of Swine Health and Production 10, 153-160.

Torremorell, M., Pijoan, C., Janni, K., Walker, R., Joo, H.S., 1997, Airborne transmission

of Actinobacillus pleuropneumoniae and porcine reproductive and respiratory

syndrome virus in nursery pigs. American journal of veterinary research 58, 828-

832.

Truitt, R.L., Hanke, C., Radke, J., Mueller, R., Barbieri, J.T., 1998, Glycosphingolipids as

novel targets for T-cell suppression by the B subunit of recombinant heat-labile

enterotoxin. Infection and immunity 66, 1299-1308.

Ura, T., Okuda, K., Shimada, M., 2014, Developments in viral vector-based vaccines.

Vaccines 2, 624-641.

Van Breedam, W., Van Gorp, H., Zhang, J.Q., Crocker, P.R., Delputte, P.L., Nauwynck,

H.J., 2010, The M/GP(5) glycoprotein complex of porcine reproductive and

215

respiratory syndrome virus binds the sialoadhesin receptor in a sialic acid-

dependent manner. PLoS Pathog 6, e1000730. van den Pol, A.N., Dalton, K.P., Rose, J.K., 2002, Relative neurotropism of a recombinant

rhabdovirus expressing a green fluorescent envelope glycoprotein. Journal of

virology 76, 1309-1327.

Van Der Meer, Y., van Tol, H., Locker, J.K., Snijder, E.J., 1998, ORF1a-encoded replicase

subunits are involved in the membrane association of the arterivirus replication

complex. Journal of Virology 72, 6689-6698.

Van Reeth, K., Labarque, G., Nauwynck, H., Pensaert, M., 1999, Differential production

of proinflammatory cytokines in the pig lung during different respiratory virus

infections: correlations with pathogenicity. Res Vet Sci 67, 47-52.

Van Reeth, K., Nauwynck, H., Pensaert, M., 1998, Bronchoalveolar interferon-alpha,

tumor necrosis factor-alpha, interleukin-1, and inflammation during acute influenza

in pigs: a possible model for humans? J Infect Dis 177, 1076-1079.

Vanhee, M., Costers, S., Van Breedam, W., Geldhof, M.F., Van Doorsselaere, J.,

Nauwynck, H.J., 2010, A variable region in GP4 of European-type porcine

reproductive and respiratory syndrome virus induces neutralizing antibodies

against homologous but not heterologous virus strains. Viral Immunol 23, 403-413.

Vanhee, M., Delputte, P.L., Delrue, I., Geldhof, M.F., Nauwynck, H.J., 2009, Development

of an experimental inactivated PRRSV vaccine that induces virus-neutralizing

antibodies. Vet Res 40, 63.

216

Vashisht, K., Goldberg, T.L., Husmann, R.J., Schnitzlein, W., Zuckermann, F.A., 2008,

Identification of immunodominant T-cell epitopes present in glycoprotein 5 of the

North American genotype of porcine reproductive and respiratory syndrome virus.

Vaccine 26, 4747-4753.

Voicu, I.L., Silim, A., Morin, M., Elazhary, M.A., 1994, Interaction of porcine

reproductive and respiratory syndrome virus with swine monocytes. Vet Rec 134,

422-423.

Wagstrom, E.A., Chang, C.C., Yoon, K.J., Zimmerman, J.J., 2001, Shedding of porcine

reproductive and respiratory syndrome virus in mammary gland secretions of sows.

Am J Vet Res 62, 1876-1880.

Wang, C., Huang, B., Kong, N., Li, Q., Ma, Y., Li, Z., Gao, J., Zhang, C., Wang, X., Liang,

C., Dang, L., Xiao, S., Mu, Y., Zhao, Q., Sun, Y., Almazan, F., Enjuanes, L., Zhou,

E.M., 2013a, A novel porcine reproductive and respiratory syndrome virus vector

system that stably expresses enhanced green fluorescent protein as a separate

transcription unit. Vet Res 44, 104.

Wang, G., Li, L., Yu, Y., Tu, Y., Tong, J., Zhang, C., Liu, Y., Li, Y., Han, Z., Jiang, C.,

2016, Highly pathogenic porcine reproductive and respiratory syndrome virus

infection and induction of apoptosis in bone marrow cells of infected piglets.

Journal of General Virology 97, 1356-1361.

Wang, G., Song, T., Yu, Y., Liu, Y., Shi, W., Wang, S., Rong, F., Dong, J., Liu, H., Cai,

X., Zhou, E.M., 2013b, Immune responses in piglets infected with highly

217

pathogenic porcine reproductive and respiratory syndrome virus. Vet Immunol

Immunopathol 142, 170-178.

Wang, T.T., Tan, G.S., Hai, R., Pica, N., Ngai, L., Ekiert, D.C., Wilson, I.A., Garcia-Sastre,

A., Moran, T.M., Palese, P., 2010, Vaccination with a synthetic peptide from the

influenza virus hemagglutinin provides protection against distinct viral subtypes.

Proc Natl Acad Sci U S A 107, 18979-18984.

Wang, W., Chen, X., Xue, C., Du, Y., Lv, L., Liu, Q., Li, X., Ma, Y., Shen, H., Cao, Y.,

2012, Production and immunogenicity of chimeric virus-like particles containing

porcine reproductive and respiratory syndrome virus GP5 protein. Vaccine 30,

7072-7077.

Wang, X., Li, J., Jiang, P., Li, Y., Zeshan, B., Cao, J., Wang, X., 2009, GM-CSF fused

with GP3 and GP5 of porcine reproductive and respiratory syndrome virus

increased the immune responses and protective efficacy against virulent PRRSV

challenge. Virus research 143, 24-32.

Wang, Y., Zhao, H., Ma, Z., Wang, Y., Feng, W.H., 2013c, CTLA4 mediated targeting

enhances immunogenicity against PRRSV in a DNA prime/killed virus boost

strategy. Vet Immunol Immunopathol 154, 121-128.

Wang, Z.S., Xu, X.G., Liu, H.J., Li, Z.C., Ding, L., Yu, G.S., Tong, D.W., 2011,

Immunogenicity of the envelope GP3 protein of porcine reproductive and

respiratory syndrome virus displayed on baculovirus. Acta Virol 55, 139-146.

Weesendorp, E., Morgan, S., Stockhofe-Zurwieden, N., Popma-De Graaf, D.J., Graham,

S.P., Rebel, J.M.J., 2013, Comparative analysis of immune responses following

218

experimental infection of pigs with European porcine reproductive and respiratory

syndrome virus strains of differing virulence. Veterinary Microbiology 163, 1-12.

Wei, Z., Zhang, J., Zhuang, J., Sun, Z., Gao, F., Yuan, S., 2013, Immunization of pigs with

a type 2 modified live PRRSV vaccine prevents the development of a deadly long

lasting hyperpyrexia in a challenge study with highly pathogenic PRRSV JX143.

Vaccine 31, 2062-2066.

Wenhui, L., Zhongyan, W., Guanqun, Z., Zhili, L., JingYun, M., Qingmei, X., Baoli, S.,

Yingzuo, B., 2012, Complete Genome Sequence of a Novel Variant Porcine

Reproductive and Respiratory Syndrome Virus (PRRSV) Strain: Evidence for

Recombination between Vaccine and Wild-Type PRRSV Strains. Journal of

Virology 86, 9543-9543.

Wensvoort, G., de Kluyver, E.P., Pol, J.M.A., Wagenaar, F., Moormann, R.J.M., Hulst,

M.M., Bloemraad, R., den Besten, A., Zetstra, T., Terpstra, C., 1992, Lelystad

virus, the cause of porcine epidemic abortion and respiratory syndrome: a review

of mystery swine disease research at Lelystad. Veterinary Microbiology 33, 185-

193.

Wensvoort, G., Terpstra, C., Pol, J.M., 1991a, ['Lelystad agent'--the cause of abortus blauw

(mystery swine disease)]. Tijdschr Diergeneeskd 116, 675-676.

Wensvoort, G., Terpstra, C., Pol, J.M., ter Laak, E.A., Bloemraad, M., de Kluyver, E.P.,

Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F., Broekhuijsen, J.M.,

Moonen, P.L.J.M., Zetstra, T., de Boer, E.A., Tibben, H.J., de Jong, M.F., Van't

Veld, P., Groenland, G.J.R., Van Gennep, J.A., Voets, M.T., Verheijden, J.H.M.,

219

Braamskamp, J., 1991b, Mystery swine disease in The Netherlands: the isolation

of Lelystad virus. Vet Q 13, 121-130.

Wensvoort, G., Terpstra, C., Pol, J.M., ter Laak, E.A., Bloemraad, M., de Kluyver, E.P.,

Kragten, C., van Buiten, L., den Besten, A., Wagenaar, F., et al., 1991c, Mystery

swine disease in The Netherlands: the isolation of Lelystad virus. Vet Q 13, 121-

130.

Wertz, G.W., Perepelitsa, V.P., Ball, L.A., 1998, Gene rearrangement attenuates

expression and lethality of a nonsegmented negative strand RNA virus.

Proceedings of the National Academy of Sciences 95, 3501-3506.

Whelan, S.P., Ball, L.A., Barr, J.N., Wertz, G.T., 1995, Efficient recovery of infectious

vesicular stomatitis virus entirely from cDNA clones. Proceedings of the National

Academy of Sciences 92, 8388-8392.

Whelan, S.P.J., Wertz, G.W., 2002, Transcription and replication initiate at separate sites

on the vesicular stomatitis virus genome. Proceedings of the National Academy of

Sciences 99, 9178-9183.

Whitt, M.A., Geisbert, T.W., Mire, C.E., 2016, Single-vector, single-injection recombinant

vesicular stomatitis virus vaccines against high-containment viruses. Vaccine

Design: Methods and Protocols: Volume 1: Vaccines for Human Diseases, 295-

311.

Wieczorek-Krohmer, M., Weiland, F., Conzelmann, K., Kohl, D., Visser, N., van Woensel,

P., Thiel, H.J., Weiland, E., 1996, Porcine reproductive and respiratory syndrome

220

virus (PRRSV): Monoclonal antibodies detect common epitopes on two viral

proteins of European and U.S. isolates. Veterinary Microbiology 51, 257-266.

Williams, N.A., Hirst, T.R., Nashar, T.O., 1999, Immune modulation by the cholera-like

enterotoxins: from adjuvant to therapeutic. Immunology today 20, 95-101.

Wills, R.W., Doster, A.R., Galeota, J.A., Sur, J.H., Osorio, F.A., 2003, Duration of

infection and proportion of pigs persistently infected with porcine reproductive and

respiratory syndrome virus. J Clin Microbiol 41, 58-62.

Wissink, E.H., Kroese, M.V., van Wijk, H.A., Rijsewijk, F.A., Meulenberg, J.J., Rottier,

P.J., 2005, Envelope protein requirements for the assembly of infectious virions of

porcine reproductive and respiratory syndrome virus. J Virol 79, 12495-12506.

Wu, W.H., Fang, Y., Farwell, R., Steffen-Bien, M., Rowland, R.R., Christopher-Hennings,

J., Nelson, E.A., 2001, A 10-kDa structural protein of porcine reproductive and

respiratory syndrome virus encoded by ORF2b. Virology 287, 183-191.

Xue, Q., Zhao, Y.G., Zhou, Y.J., Qiu, H.J., Wang, Y.F., Wu, D.L., Tian, Z.J., Tong, G.Z.,

2004, Immune responses of swine following DNA immunization with plasmids

encoding porcine reproductive and respiratory syndrome virus ORFs 5 and 7, and

porcine IL-2 and IFNgamma. Vet Immunol Immunopathol 102, 291-298.

Yang, L., Frey, M.L., Yoon, K.J., Zimmerman, J.J., Platt, K.B., 2000, Categorization of

North American porcine reproductive and respiratory syndrome viruses: epitopic

profiles of the N, M, GP5 and GP3 proteins and susceptibility to neutralization.

Arch Virol 145, 1599-1619.

221

Yoo, D., Song, C., Sun, Y., Du, Y., Kim, O., Liu, H.C., 2010, Modulation of host cell

responses and evasion strategies for porcine reproductive and respiratory syndrome

virus. Virus Res 154, 48-60.

Yoon, I.J., Joo, H.S., Goyal, S.M., Molitor, T.W., 1994, A modified serum neutralization

test for the detection of antibody to porcine reproductive and respiratory syndrome

virus in swine sera. J Vet Diagn Invest 6, 289-292.

Yoon, K.J., Wu, L.L., Zimmerman, J.J., Hill, H.T., Platt, K.B., 1996, Antibody-dependent

enhancement (ADE) of porcine reproductive and respiratory syndrome virus

(PRRSV) infection in pigs. Viral Immunol 9, 51-63.

Yoon, K.J., Wu, L.L., Zimmerman, J.J., Platt, K.B., 1997, Field isolates of porcine

reproductive and respiratory syndrome virus (PRRSV) vary in their susceptibility

to antibody dependent enhancement (ADE) of infection. Vet Microbiol 55, 277-

287.

Yoon, K.J., Zimmerman, J.J., Swenson, S.L., McGinley, M.J., Eernisse, K.A., Brevik, A.,

Rhinehart, L.L., Frey, M.L., Hill, H.T., Platt, K.B., 1995, Characterization of the

humoral immune response to porcine reproductive and respiratory syndrome

(PRRS) virus infection. J Vet Diagn Invest 7, 305-312.

Yuan, S., Nelsen, C.J., Murtaugh, M.P., Schmitt, B.J., Faaberg, K.S., 1999, Recombination

between North American strains of porcine reproductive and respiratory syndrome

virus. Virus research 61, 87-98.

222

Zhang, L., Tian, X., Zhou, F., 2006, In vivo effects of oligodeoxynucleotides containing

synthetic immunostimulatory motifs in weaned piglets. Int Immunopharmacol 6,

1623-1631.

Zhang, L., Tian, X., Zhou, F., 2007, Intranasal administration of CpG oligonucleotides

induces mucosal and systemic Type 1 immune responses and adjuvant activity to

porcine reproductive and respiratory syndrome killed virus vaccine in piglets in

vivo. Int Immunopharmacol 7, 1732-1740.

Zhang, W., Francis, D.H., 2010a, Genetic fusions of heat-labile toxoid (LT) and heat-stable

toxin b (STb) of porcine enterotoxigenic Escherichia coli elicit protective anti-LT

and anti-STb antibodies. Clin Vaccine Immunol 17, 1223-1231.

Zhang, W., Francis, D.H., 2010b, Genetic fusions of heat-labile toxoid (LT) and heat-stable

toxin b (STb) of porcine enterotoxigenic Escherichia coli elicit protective anti-LT

and anti-STb antibodies. Clinical and Vaccine Immunology 17, 1223-1231.

Zhang, W., Zhang, C., Francis, D.H., Fang, Y., Knudsen, D., Nataro, J.P., Robertson, D.C.,

2010a, Genetic fusions of heat-labile (LT) and heat-stable (ST) toxoids of porcine

enterotoxigenic Escherichia coli elicit neutralizing anti-LT and anti-STa antibodies.

Infect Immun 78, 316-325.

Zhang, W., Zhang, C., Francis, D.H., Fang, Y., Knudsen, D., Nataro, J.P., Robertson, D.C.,

2010b, Genetic fusions of heat-labile (LT) and heat-stable (ST) toxoids of porcine

enterotoxigenic Escherichia coli elicit neutralizing anti-LT and anti-STa antibodies.

Infection and immunity 78, 316-325.

223

Zhang, X., Li, G., Gao, L., Mu, L., Zhang, L., Cong, Y., Ding, Z., 2013, Positive inductive

effect of IL-18 on virus-specific immune responses induced by PRRSV-GP5 DNA

vaccine in swine. Research in veterinary science 94, 346-353.

Zhang, X., Wang, X., Mu, L., Ding, Z., 2012, Immune responses in pigs induced by

recombinant DNA vaccine co-expressing Swine IL-18 and membrane protein of

porcine reproductive and respiratory syndrome virus. Int J Mol Sci 13, 5715-5728.

Zhang, Z., Zhao, W., Li, D., Yang, J., Zsak, L., Yu, Q., 2015, Development of a Newcastle

disease virus vector expressing a foreign gene through an internal ribosomal entry

site provides direct proof for a sequential transcription mechanism. Journal of

general virology 96, 2028-2035.

Zheng, Q., Chen, D., Li, P., Bi, Z., Cao, R., Zhou, B., Chen, P., 2007, Co-expressing GP5

and M proteins under different promoters in recombinant modified vaccinia virus

ankara (rMVA)-based vaccine vector enhanced the humoral and cellular immune

responses of porcine reproductive and respiratory syndrome virus (PRRSV). Virus

genes 35, 585-595.

Zhou, J.X., Xue, J.D., Yu, T., Zhang, J.B., Liu, Y., Jiang, N., Li, Y.L., Hu, R.L., 2010,

Immune responses in pigs induced by recombinant canine adenovirus 2 expressing

the glycoprotein 5 of porcine reproductive and respiratory syndrome virus.

Veterinary research communications 34, 371-380.

Zhou, L., Zhang, J., Zeng, J., Yin, S., Li, Y., Zheng, L., Guo, X., Ge, X., Yang, H., 2009,

The 30-amino-acid deletion in the Nsp2 of highly pathogenic porcine reproductive

224

and respiratory syndrome virus emerging in China is not related to its virulence. J

Virol 83, 5156-5167.

Zimmerman, J., 2003, PRRS Virus – What Happens After a Pig Becomes Infected with

PRRS Virus? 2003 PRRS Compendium Producer Edition Chapter V, 36-43.

Zuckermann, F.A., Garcia, E.A., Luque, I.D., Christopher-Hennings, J., Doster, A., Brito,

M., Osorio, F., 2007, Assessment of the efficacy of commercial porcine

reproductive and respiratory syndrome virus (PRRSV) vaccines based on

measurement of serologic response, frequency of gamma-IFN-producing cells and

virological parameters of protection upon challenge. Vet Microbiol 123, 69-85.

225