Anti-SEMA6A Monoclonal Antibody, Clone 105C4 (DMAB5999MH) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

Total Page：16

File Type：pdf, Size：1020Kb

Anti-SEMA6A monoclonal antibody, clone 105C4 (DMAB5999MH) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Monoclonal Anti-human SEMA6A Antigen Description Semaphorins represent a large family composed of 19 secreted, GPI-linked or transmembrane members divided into 5 classes (3 to 7) and characterized by the presence of a 500 amino acid Sema domain in the N-terminus. Initially described for their role in axon guidance and apoptosis during neuronal development, some semaphorins like the class 4 regulate immune functions and are involved in organogenesis and angiogenesis. The transmembrane class 6 semaphorins include 4 members (SEMA-6A to 6D). SEMA-6A features an intracellular binding site for regulatory Evl protein. In the immune system, SEMA6A protein is restricted in vitro and in vivo to an activation status of Langerhans cells. Specificity human SEMA-6A (epitope in extracellular domain) Immunogen human recombinant SEMA-6A Isotype IgG1 Source/Host Mouse Species Reactivity Human Clone 105C4 Purification QMA Hyper D ion exchange chromatography Conjugate Unconjugated Applications IHC Format Purified: 100 μg in 200 μl / 50 μg in 100 μl Tris-NaCl pH 8; Coupled: 100 μg in 200 μl / 50 μg in 100 μl PBS 50% glycerol Preservative None Storage -20℃. KEEP CONTENTS STERILE: no preservative; Purified antibodies: avoid repeated freeze/thaw cycles; Coupled antibodies: glycerol protects from freezing. 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved GENE INFORMATION Gene Name SEMA6A sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A [ Homo sapiens ] Official Symbol SEMA6A Synonyms VIA; SEMA; HT018; SEMAQ; SEMA6A1; semaphorin-6A; SEMA6A; KIAA1368; SEMA6A-1; sema Via; semaphorin VIA; semaphorin 6A-1; semaphorin-6A-1; OTTHUMP00000223008; OTTHUMP00000223009; OTTHUMP00000223010 Entrez Gene ID 57556 Protein Refseq NP_065847 UniProt ID Q9H2E6 Chromosome Location 5q23.1 Pathway Axon guidance; Developmental Biology; Other semaphorin interactions; Semaphorin interactions Function protein binding; receptor activity; semaphorin receptor binding 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved.

Copy Link

Recommended publications

Pdf%5Cn T/32/Suppl 1/D267.Short%5Cn
University of Kentucky UKnowledge Theses and Dissertations--Molecular and Cellular Biochemistry Molecular and Cellular Biochemistry 2019 COMPUTATIONAL TOOLS FOR THE DYNAMIC CATEGORIZATION AND AUGMENTED UTILIZATION OF THE GENE ONTOLOGY Eugene Waverly Hinderer III University of Kentucky, [email protected] Author ORCID Identifier: https://orcid.org/0000-0001-8045-7083 Digital Object Identifier: https://doi.org/10.13023/etd.2019.362 Right click to open a feedback form in a new tab to let us know how this document benefits ou.y Recommended Citation Hinderer, Eugene Waverly III, "COMPUTATIONAL TOOLS FOR THE DYNAMIC CATEGORIZATION AND AUGMENTED UTILIZATION OF THE GENE ONTOLOGY" (2019). Theses and Dissertations--Molecular and Cellular Biochemistry. 43. https://uknowledge.uky.edu/biochem_etds/43 This Doctoral Dissertation is brought to you for free and open access by the Molecular and Cellular Biochemistry at UKnowledge. It has been accepted for inclusion in Theses and Dissertations--Molecular and Cellular Biochemistry by an authorized administrator of UKnowledge. For more information, please contact [email protected]. STUDENT AGREEMENT: I represent that my thesis or dissertation and abstract are my original work. Proper attribution has been given to all outside sources. I understand that I am solely responsible for obtaining any needed copyright permissions. I have obtained needed written permission statement(s) from the owner(s) of each third-party copyrighted matter to be included in my work, allowing electronic distribution (if such use is not permitted by the fair use doctrine) which will be submitted to UKnowledge as Additional File. I hereby grant to The University of Kentucky and its agents the irrevocable, non-exclusive, and royalty-free license to archive and make accessible my work in whole or in part in all forms of media, now or hereafter known.
[Show full text]
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
[Show full text]
Developmental Enhancers Revealed by Extensive DNA Methylome Maps of Zebrafish Early Embryos
ARTICLE Received 24 Oct 2014 | Accepted 19 Jan 2015 | Published 20 Feb 2015 DOI: 10.1038/ncomms7315 Developmental enhancers revealed by extensive DNA methylome maps of zebrafish early embryos Hyung Joo Lee1,2, Rebecca F. Lowdon1,2, Brett Maricque1,2, Bo Zhang1,2, Michael Stevens1,2, Daofeng Li1,2, Stephen L. Johnson1 & Ting Wang1,2 DNA methylation undergoes dynamic changes during development and cell differentiation. Recent genome-wide studies discovered that tissue-specific differentially methylated regions (DMRs) often overlap tissue-specific distal cis-regulatory elements. However, developmental DNA methylation dynamics of the majority of the genomic CpGs outside gene promoters and CpG islands has not been extensively characterized. Here, we generate and compare comprehensive DNA methylome maps of zebrafish developing embryos. From these maps, we identify thousands of developmental stage-specific DMRs (dsDMRs) across zebrafish developmental stages. The dsDMRs contain evolutionarily conserved sequences, are associated with developmental genes and are marked with active enhancer histone posttranslational modifications. Their methylation pattern correlates much stronger than promoter methylation with expression of putative target genes. When tested in vivo using a transgenic zebrafish assay, 20 out of 20 selected candidate dsDMRs exhibit functional enhancer activities. Our data suggest that developmental enhancers are a major target of DNA methylation changes during embryogenesis. 1 Department of Genetics, Washington University School of Medicine, St Louis, Missouri 63108, USA. 2 Center for Genome Sciences and Systems Biology, Washington University School of Medicine, St Louis, Missouri 63108, USA. Correspondence and requests for materials should be addressed to T.W. (email: [email protected]). NATURE COMMUNICATIONS | 6:6315 | DOI: 10.1038/ncomms7315 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited.
[Show full text]
1 in Vivo Epigenetic Editing of Sema6a Promoter Reverses Impaired
bioRxiv preprint doi: https://doi.org/10.1101/491779; this version posted December 10, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. In vivo epigenetic editing of sema6a promoter reverses impaired transcallosal connectivity caused by C11orf46/ARL14EP neurodevelopmental risk gene Cyril J. Peter1,*, Atsushi Saito2,*, Yuto Hasegawa2, Yuya Tanaka2, Gabriel Perez2, Emily Alway2, Sergio Espeso-gil1, Tariq Fayyad1, Chana Ratner1, Aslihan Dincer1, Achla Gupta1,8, Lakshmi Devi1,8, John G. Pappas3, François M. Lalonde4, John A. Butman5, Joan C. Han6,7, Schahram Akbarian1,#, and Atsushi Kamiya2,# 1Friedman Brain Institute and Department of Psychiatry, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA 2Department of Psychiatry and Behavioral Sciences, Johns Hopkins University School of Medicine, Baltimore, MD 21287, USA 3Department of Pediatrics, New York University School of Medicine, New York, NY 4Human Genetics Branch, National Institute of Mental Health, Bethesda, MD 20892, USA. 5Diagnostic Radiology Department, The Clinical Center of the National Institutes of Health, Bethesda, MD 20892, USA 6Unit on Metabolism and Neuroendocrinology, Eunice Kennedy Shriver National Institute of Child Health and Human Development, National Institute of Health, Bethesda, MD 20892, USA 7Departments of Pediatrics and Physiology, University of Tennessee Health Science Center, and Children's Foundation Research Institute, Le Bonheur Children's Hospital, Memphis, TN, 38103, USA 8Department of Pharmacology and System Therapeutics, Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA *These authors contributed equally to this work. #Correspondence: [email protected] (A.K.), [email protected] (S.A.).
[Show full text]
Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands That Promote Axonal Growth
Research Article: New Research Development Peripheral Nerve Single-Cell Analysis Identifies Mesenchymal Ligands that Promote Axonal Growth Jeremy S. Toma,1 Konstantina Karamboulas,1,ª Matthew J. Carr,1,2,ª Adelaida Kolaj,1,3 Scott A. Yuzwa,1 Neemat Mahmud,1,3 Mekayla A. Storer,1 David R. Kaplan,1,2,4 and Freda D. Miller1,2,3,4 https://doi.org/10.1523/ENEURO.0066-20.2020 1Program in Neurosciences and Mental Health, Hospital for Sick Children, 555 University Avenue, Toronto, Ontario M5G 1X8, Canada, 2Institute of Medical Sciences University of Toronto, Toronto, Ontario M5G 1A8, Canada, 3Department of Physiology, University of Toronto, Toronto, Ontario M5G 1A8, Canada, and 4Department of Molecular Genetics, University of Toronto, Toronto, Ontario M5G 1A8, Canada Abstract Peripheral nerves provide a supportive growth environment for developing and regenerating axons and are es- sential for maintenance and repair of many non-neural tissues. This capacity has largely been ascribed to paracrine factors secreted by nerve-resident Schwann cells. Here, we used single-cell transcriptional profiling to identify ligands made by different injured rodent nerve cell types and have combined this with cell-surface mass spectrometry to computationally model potential paracrine interactions with peripheral neurons. These analyses show that peripheral nerves make many ligands predicted to act on peripheral and CNS neurons, in- cluding known and previously uncharacterized ligands. While Schwann cells are an important ligand source within injured nerves, more than half of the predicted ligands are made by nerve-resident mesenchymal cells, including the endoneurial cells most closely associated with peripheral axons. At least three of these mesen- chymal ligands, ANGPT1, CCL11, and VEGFC, promote growth when locally applied on sympathetic axons.
[Show full text]
Downloaded from the European Nucleotide Archive (ENA; 126
Preprints (www.preprints.org) | NOT PEER-REVIEWED | Posted: 5 September 2018 doi:10.20944/preprints201809.0082.v1 1 Article 2 Transcriptomics as precision medicine to classify in 3 vivo models of dietary-induced atherosclerosis at 4 cellular and molecular levels 5 Alexei Evsikov 1,2, Caralina Marín de Evsikova 1,2* 6 1 Epigenetics & Functional Genomics Laboratory, Department of Molecular Medicine, Morsani College of 7 Medicine, University of South Florida, Tampa, Florida, 33612, USA; 8 2 Department of Research and Development, Bay Pines Veteran Administration Healthcare System, Bay 9 Pines, FL 33744, USA 10 11 * Correspondence: [email protected]; Tel.: +1-813-974-2248 12 13 Abstract: The central promise of personalized medicine is individualized treatments that target 14 molecular mechanisms underlying the physiological changes and symptoms arising from disease. 15 We demonstrate a bioinformatics analysis pipeline as a proof-of-principle to test the feasibility and 16 practicality of comparative transcriptomics to classify two of the most popular in vivo diet-induced 17 models of coronary atherosclerosis, apolipoprotein E null mice and New Zealand White rabbits. 18 Transcriptomics analyses indicate the two models extensively share dysregulated genes albeit with 19 some unique pathways. For instance, while both models have alterations in the mitochondrion, the 20 biochemical pathway analysis revealed, Complex IV in the electron transfer chain is higher in mice, 21 whereas the rest of the electron transfer chain components are higher in the rabbits. Several fatty 22 acids anabolic pathways are expressed higher in mice, whereas fatty acids and lipids degradation 23 pathways are higher in rabbits.
[Show full text]
Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
[Show full text]
Identifying Factors That Conctribute to Phenotypic Heterogeneity in Melanoma Progression
Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2012 Identifying factors that conctribute to Phenotypic heterogeneity in melanoma progression Widmer, Daniel Simon Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-73667 Dissertation Originally published at: Widmer, Daniel Simon. Identifying factors that conctribute to Phenotypic heterogeneity in melanoma progression. 2012, University of Zurich, Faculty of Medicine. Eidgenössische Technische Hochschule Zürich Swiss Federal Institute of Technology Zurich Identifying factors that conctribute to Phenotypic heterogeneity in melanoma progression Daniel Simon Widmer 2012 Diss ETH No. 20537 DISS. ETH NO. 20537 IDENTIFYING FACTORS THAT CONTRIBUTE TO PHENOTYPIC HETEROGENEITY IN MELANOMA PROGRESSION A dissertation submitted to ETH ZURICH for the degree of Doctor of Sciences presented by Daniel Simon Widmer Master of Science UZH University of Zurich born on February 26th 1982 citizen of Gränichen AG accepted on the recommendation of Professor Sabine Werner, examinor Professor Reinhard Dummer, co-examinor Professor Michael Detmar, co-examinor 2012 Contents 1. ZUSAMMENFASSUNG...................................................................................................... 7 2. SUMMARY ................................................................................................................... 11 3. INTRODUCTION ...........................................................................................................
[Show full text]
Supplemental Material
SUPPLEMENTAL MATERIAL Online OnlY Supplemental material miRNA expression profiling of cerebrospinal fluid in patients with cerebral aneurysmal subarachnoid hemorrhage S. S. Stylli et al. http://thejns.org/doi/abs/10.3171/2016.1.JNS151454 DisClaimer The Journal of Neurosurgery acknowledges that the following section is published verbatim as submitted by the authors and did not go through either the Journal’s peer-review or editing process. ©AANS, 2016 J Neurosurg Supplementary Table 1 nSolver Differential Expression Analysis Comparison Groups Comparison 1 No SAH SAH / No vasospasm (combined) CSF0012, CSF0018, CSF0030, CSF0034 CSF0020, CSF0023, CSF0024, CSF0025, CSF0038, CSF0039, CSF0040, CSF0041, CSF0042 Comparison 2 No SAH SAH / No vasospasm (Sample Day 1) CSF0012, CSF0018, CSF0030, CSF0034 CSF0020, CSF0023, CSF0024, CSF0027, CSF0041, CSF0038 Comparison 3 No SAH SAH / Vasospasm (combined) CSF0012, CSF0018, CSF0030, CSF0034 CSF0 022, CSF0027, CSF0032, CSF0033, CSF0036, CSF0044, CSF0045, CSF0048, CSF0052, CSF0053 Comparison 4 No SAH SAH / Vasospasm (Sample Day 1) CSF0012, CSF0018, CSF0030, CSF0034 CSF0027, CSF0032, CSF0036, CSF0044, CSF0052 Comparison 5 No SAH SAH / Vasospasm (post Sample Day 1) CSF0012, CSF0018, CSF0030, CSF0034 CSF0022, CSF0033, CSF0045, CSF0048, CSF0053 Comparison 6 SAH / No vasospasm (combined) SAH / Vasospasm (combined) CSF0020, CSF0023, CSF0024, CSF0025, CSF0022, CSF0027, CSF0032, CSF0033, CSF0036, CSF0038, CSF0039, CSF0040, CSF0041, CSF0044, CSF0045, CSF0048, CSF0052, CSF0053 CSF0042 Comparison 7 SAH / No vasospasm
[Show full text]
(IJDSIR) Page 62
ISSN: 2581-5989 PubMed - National Library of Medicine - ID: 101738774 International Journal of Dental Science and Innovative Research (IJDSIR) IJDSIR : Dental Publication Service Available Online at: www.ijdsir.com Volume – 2, Issue – 5, September – October - 2019, Page No. : 62 - 69 Transmembrane Semaphorin 6A controls timing of entrance of the Sensory Innervation into mice mandibular first molar tooth germ Salma Ali, PhD, Department of Diagnostic Dental Sciences and Oral Biology, College of Dentistry, King Khalid University, Abha, Kingdom of Saudi Arabia. Corresponding Author: Salma Ali, PhD, Department of Diagnostic Dental Sciences and Oral Biology, College of Dentistry, King Khalid University, Abha, Kingdom of Saudi Arabia. Type of Publication: Original Research Paper Conflicts of Interest: Nil Abstract ethylcarbazole (AEC) chromogen, were the main Background: Semaphorins are 9membrane-spanning and materials used in the study. Microscopical methods soluble proteins that have many important neuronal enabled revealing the results. and non neuronal functions during development as well Results: Serial sections of PostNatal day 0, 1, 3, 5 and 7 as in adult physiology. They regulate axon growth and were examined under bright field microscope and revealed guidance, angiogenesis, cell movement, and have that sensory nerve fibers were prematurely present inside functions in several organ systems. Semaphorin6A the dental pulp of sema6a knockout mice between PN0 (sema6a) is a membrane-spanning protein, which acts as a and PN1. In wild type kind of mice sensory nerve fibers repellant for sympathetic as well as sensory dorsal root were absent at PN3 and numerous at PN5 and that was in axons. It has been reported that embryonic and postnatal accordance to previous studies which showed that they murine dental mesenchyme expresses Sema6a mRNAs.
[Show full text]
Novel MITF Targets Identified Using a Two-Step DNA Microarray Strategy
Pigment Cell Melanoma Res. 21; 665–676 ORIGINAL ARTICLE Novel MITF targets identiﬁed using a two-step DNA microarray strategy Keith S. Hoek1, Natalie C. Schlegel1, Ossia M. Eichhoff1, Daniel S. Widmer1, Christian Praetorius2, Steingrimur O. Einarsson2,3, Sigridur Valgeirsdottir3, Kristin Bergsteinsdottir2, Alexander Schepsky2,4, Reinhard Dummer1 and Eirikur Steingrimsson2 1 Department of Dermatology, University Hospital of Zrich, Zrich, Switzerland 2 Department of Biochemistry KEYWORDS microphthalmia-associated transcrip- and Molecular Biology, Faculty of Medicine, University of Iceland, Reykjavik, Iceland 3 NimbleGen Systems of tion factor ⁄ microarray ⁄ melanoma ⁄ melanocyte ⁄ Iceland LLc, Reykjavik, Iceland 4 Signalling and Development Lab, Marie Curie Research Institute, Oxted, Surrey, transcription ⁄ correlation UK PUBLICATION DATA Received 20 June 2008, CORRESPONDENCE Keith S. Hoek, e-mail: [email protected] revised and accepted for publication 18 August 2008 doi: 10.1111/j.1755-148X.2008.00505.x Summary Malignant melanoma is a chemotherapy-resistant cancer with high mortality. Recent advances in our under- standing of the disease at the molecular level have indicated that it shares many characteristics with develop- mental precursors to melanocytes, the mature pigment-producing cells of the skin and hair follicles. The development of melanocytes absolutely depends on the action of the microphthalmia-associated transcription factor (MITF). MITF has been shown to regulate a broad variety of genes, whose functions range from pigment production to cell-cycle regulation, migration and survival. However, the existing list of targets is not sufﬁcient to explain the role of MITF in melanocyte development and melanoma progression. DNA microarray analysis of gene expression offers a straightforward approach to identify new target genes, but standard analytical procedures are susceptible to the generation of false positives and require additional experimental steps for validation.
[Show full text]
Genome-Wide Analysis of Epigenetics and Alternative Promoters in Cancer Cells
GENOME-WIDE ANALYSIS OF EPIGENETICS AND ALTERNATIVE PROMOTERS IN CANCER CELLS DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Jiejun Wu, M.D. & M.S. ***** The Ohio State University 2007 Dissertation Committee: Approved by: Dr. Christoph Plass, Adviser Dr. Tim H.-M. Huang, Adviser ____________________________________ Dr. Donald Harry Dean Adviser Graduate Program in Molecular Genetics Dr. Amanda Simcox Dr. Huey-Jen Lin ABSTRACT Genome-wide approaches, such as ChIP-chip, have been widely applied to explore the patterns of epigenetic markers and the interactions between DNA and proteins. Compared to candidate gene studies, the application of epigenomic and genomic tools in these fields provides more comprehensive understanding of normal and abnormal events in cells, such as those biological changes promoting cancer development. In the first part, I studied the relations between two well-known epigenetic markers, DNA methylation and histone modifications. Previous studies of individual genes have shown that in a self-enforcing way, dimethylation at histone 3 lysine 9 (dimethyl-H3K9) and DNA methylation cooperate to maintain a repressive mode of inactive genes. Less clear is whether this cooperation is generalized in mammalian genomes, such as the mouse genome. Here I use epigenomic tools to simultaneously interrogate chromatin modifications and DNA methylation in a mouse leukemia cell line, L1210. Histone modifications on H3K9 and DNA methylation in L1210 were profiled by both global CpG island array and custom mouse promoter array analysis. I used chromatin immunoprecipitation microarray (ChIP-chip) to examine acetyl-H3K9 and dimethyl-H3K9.
[Show full text]