Thyroid Hormone Receptor B2 Is Strongly Up-Regulated at All Levels of the Hypothalamo–Pituitary–Thyroidal Axis During Late Embryogenesis in Chicken
Total Page：16
File Type：pdf, Size：1020Kb
519 Thyroid hormone receptor b2 is strongly up-regulated at all levels of the hypothalamo–pituitary–thyroidal axis during late embryogenesis in chicken Sylvia V H Grommen, Lutgarde Arckens1, Tim Theuwissen1, Veerle M Darras and Bert De Groef Research Group of Comparative Endocrinology, Animal Physiology and Neurobiology Section, Department of Biology, K U Leuven, Naamsestraat 61, B-3000 Leuven, Belgium 1Research Group of Neuroplasticity and Neuroproteomics, Animal Physiology and Neurobiology Section, Department of Biology, K U Leuven, Naamsestraat 59, B-3000 Leuven, Belgium (Correspondence should be addressed to B De Groef; Email: [email protected]) Abstract In this study, we tried to elucidate the changes in thyroid demonstrated the presence of TRb2 mRNA throughout the hormone (TH) receptor b2(TRb2) expression at the diencephalon and confirmed the elevation in TRb2 mRNA different levels of the hypothalamo–pituitary–thyroidal expression in the hypophyseal thyrotropes. In vitro incubation (HPT) axis during the last week of chicken embryonic with THs caused a down-regulation of TRb2 mRNA levels development and hatching, a period characterized by an in embryonic but not in post-hatch pituitaries. The observed augmented activity of the HPT axis. We quantified TRb2 expression patterns in pituitary and diencephalon may point mRNA in retina, pineal gland, and the major control levels of to substantial changes in TRb2-mediated TH feedback active the HPT axis – brain, pituitary, and thyroid gland – at day 18 during the perinatal period. The strong rise in thyroidal of incubation, and found the most abundant mRNA content TRb2 mRNA content could be indicative of an augmented in retina and pituitary. Thyroidal TRb2 mRNA content modulation of thyroid development and/or function by THs increased dramatically between embryonic day 14 and 1 day toward and after hatching. Finally, THs proved to exert an post-hatch. In pituitary and hypothalamus, TRb2 mRNA age-dependent effect on pituitary TRb2 mRNA expression. expression rose gradually, in parallel with increases in plasma Journal of Endocrinology (2008) 196, 519–528 thyroxine concentrations. Using in situ hybridization, we have Introduction embryos and 1-day-old (C1) chicks treated with methimazole, indicating that TH feedback is functional at this stage of Late embryogenesis and the perinatal period in the chicken development (Muchow et al. 2005). The THs are also able to embryo are associated with substantial physiological changes, inhibit in vitro corticotropin-releasing hormone (CRH)- such as yolk sac retraction, transition from chorioallantoic to induced TSH release in E19 and C8 animals (Geris et al. 1999). lung respiration, and the onset of endothermy (Decuypere THs exert their effects, including their feedback regulation, et al. 1990). During this important phase of development, by binding to TH receptors (TRs) in the target cells, plasma thyroid hormone (TH) concentrations change stimulating or inhibiting gene transcription. In chicken, three markedly – with a profound increase toward the end of functional TR variants have been cloned: TRa,TRb0, and embryogenesis – and contribute to the critical events taking TRb2(Sap et al. 1986, Forrest et al. 1990, Sjo¨berg et al. 1992). place around hatching (Decuypere et al. 1990). THs are known As TRb2 is strongly expressed in chicken pituitary to play an important role in controlling their own secretion (Grommen et al. 2005) – it is even the most abundant through feedback effects acting on the different levels of the isoform in rodent pituitary gland (Bradley et al. 1989, Hodin hypothalamo–pituitary–thyroidal (HPT) axis. In birds, infor- et al. 1989) – and given its role in mammalian TRH and TSH mation on TH feedback is scarce. Most studies dealing with gene expression (Langlois et al. 1997, Abel et al. 1999, 2001, TH feedback have been performed at the hypophyseal level in Nakano et al. 2004), our study focused on this receptor type. embryos as well as in post-hatch chicks. Gregory et al. (1998) Our primary goal was to increase our knowledge of the TH demonstrated a suppressive effect of THs on pituitary feedback active during late embryogenesis and hatching thyrotropin (TSH)-b mRNA levels in cultured anterior and to examine whether a role is reserved for TRb2 herein. pituitary cells of 19-day-old embryos (E19). An increase We first determined TRb2 mRNA levels in several brain in TSHb mRNA expression was observed in 19-day-old parts, pituitary, thyroid gland, pineal gland, and retina. Journal of Endocrinology (2008) 196, 519–528 DOI: 10.1677/JOE-07-0443 0022–0795/08/0196–519 q 2008 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org Downloaded from Bioscientifica.com at 09/25/2021 04:04:02PM via free access 520 S V H GROMMEN and others . TRb2 expression during late embryogenesis Subsequently, TRb2 mRNA expression was quantified by USA). For each tissue, three individual samples or pools were real-time PCR in diencephalon, pituitary, and thyroid gland – used for analysis. One microgram of total RNA was reverse the major control levels of the HPTaxis – during the last week transcribed using 0.375 U/ml AMV reverse transcriptase of embryonic development. Using in situ hybridization (ISH), (Invitrogen). Five microliter of cDNA, corresponding to we verified whether the density of the hypophyseal TRb2 w50 ng total RNA, were used for real-time PCR. Primers mRNA signal changes in the thyrotropic cells at E16 for TRb2 – located in the unique amino-terminal region of compared with E20 and investigated its distribution in the receptor (Sjo¨berg et al. 1992) – and the active reference diencephalon. As TH concentrations increase substantially b-actin were chosen using the Primer Express software v.2.0 during the perinatal period, we determined whether THs are (Applied Biosystems, Warrington, UK) and are listed in able to alter TRb2 mRNA expression levels in the embryonic Table 1. The real-time PCR was performed using an ABI and post-hatch pituitary in vitro. PRISM 7000 Sequence Detection System thermal cycler (Applied Biosystems) in a total volume of 25 ml with the following components: 1!Platinum SYBR Green (Invi- Materials and Methods trogen), 300 nM forward primer, and 300 nM reverse primer. The thermal cycle parameters used were 2 min at 50 8C, All experiments were approved by the ethical committee for 2 min at 95 8C, followed by 40 cycles of 15 s at 95 8C and 30 s animal experiments of the K U Leuven. at 60 8C. The amplification program was followed by a dissociation protocol to detect any non-specific amplification. Distribution of TRb2 mRNA in embryonic tissues For each gene, a non-template control and a sample that was Tissue sampling Fertilized eggs from Cobb broiler not reverse transcribed were added as negative controls. A 1:5 chickens were purchased from Poel-Houben (Lummen, dilution series of pituitary cDNA was added as a standard. Belgium) and incubated in a laboratory incubator as described Each experimental sample was analyzed in triplo, and standard previously (Darras et al. 1992). The start of incubation was samples were measured in duplo. called day 1 (E1). At E18 animals were decapitated and the different brain parts, pituitary glands (pooled per 4), pineal TRb2 mRNA expression at the different levels of the HPTaxis glands (pooled per 4), thyroid glands (pooled per 3 pairs), and during the last week of embryonic development retinal tissue (pooled per 3 pairs) were collected, immediately frozen in liquid nitrogen, and stored at K80 8C. Tissue sampling Fertilized eggs from Ross (pituitary) or Cobb (diencephalon, thyroid gland) broiler chickens were RNA isolation and real-time PCR Total RNA was purchased from Avibel (Halle-Zoersel, Belgium) and Poel- isolated using Trizol reagent (Invitrogen) following the Houben respectively and incubated in a laboratory incubator manufacturer’s instructions. To rule out any genomic DNA for 21 days as described earlier. At day 20 (E20) of embryonic contamination of the RNA, the samples were treated with development, we made a distinction between animals that had DNase I using the DNA-free kit (Ambion, Austin, TX, already switched from allantois to lung respiration, which we Table 1 Primers and probes used to amplify chicken TRb2, b-actin, and GAPDH with real-time PCR Sequence (50–30) Amplicon TRb2 (X62642) Forward primer CCCAGCTGCTGGTAGCAATT bp 55–74 Reverse primer CCTGAGCATCACAACTGCTGTA bp 125–146 b-actin (NM_205518) Forward primer ATGGCTCCGGTATGTGCAA bp 103–122 Reverse primer TGTCTTTCTGGCCCATACCAA bp 202–222 GAPDH (NM_204305) Forward primer GAAGCTTACTGGAATGGCTTTCC bp 729–751 Reverse primer GATATCATCATACTTGGCTGGTTTCTC bp 825–799 Sequence (50–30) Bp numbering Taqman probes TRb2 FAM-AGTCCACTGATTATTGC-NFQ-MGB bp 85–100 b-actin FAM-CCCCAGACATCAGGGT-NFQ-MGB bp 179–194 The EMBL accession number is indicated in parentheses beside each gene. TRb2, thyroid hormone receptor b2; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FAM, 6-carboxy fluorescein; NFQ, non-fluorescent quencher; MGB, minor groove binder; bp, base pair. Journal of Endocrinology (2008) 196, 519–528 www.endocrinology-journals.org Downloaded from Bioscientifica.com at 09/25/2021 04:04:02PM via free access TRb2 expression during late embryogenesis . S V H GROMMEN and others 521 0 0 called the internal pipping stage (E20IP), and animals that had RIA Plasma 3,5,3 ,5 -tetraiodothyronine (T4) concentrations not perforated the membrane of the air chamber, which was were measured as described previously (Van der Geyten termed the non-pipping stage (E20NP). Blood and tissue et al. 2001). samples were taken every day starting from E14 until 1-day- old chicks (C1). After collecting blood samples by heart Combined ISH–immunohistochemistry (IHC) puncture (embryos) or by decapitation (post-hatch chicks), Riboprobes were transcribed from 1 mg linearized plasmid pituitary glands (pooled per 5), thyroid glands (pooled per 3 containing a cDNA insert of chicken TRb2 in the presence pairs), and hypothalami were collected, frozen in liquid of 50 mCi [35S]UTP (Perkin–Elmer, Wellesly, MA, USA) and nitrogen, and stored at K80 8C.