Environmental Impact of Invertebrates for Biological Control of Arthropods

Methods and Risk Assessment This page intentionally left blank Environmental Impact of Invertebrates for Biological Control of Arthropods

Methods and Risk Assessment

Edited by

Franz Bigler and Dirk Babendreier

Agroscope, FAL Reckenholz Swiss Federal Research Station for Agroecology and Agriculture Zürich Switzerland

and

Ulrich Kuhlmann

CABI Bioscience Switzerland Centre Delémont Switzerland

CABI Publishing CABI Publishing is a division of CAB International

CABI Publishing CABI Publishing CAB International 875 Massachusetts Avenue Wallingford 7th Floor Oxon OX10 8DE Cambridge, MA 02139 UK USA Tel: +44 (0)1491 832111 Tel: +1 617 395 4056 Fax: +44 (0)1491 833508 Fax: +1 617 354 6875 E-mail: [email protected] E-mail: [email protected] Website: www.cabi-publishing.org

© CAB International 2006. All rights reserved. No part of this publication may be reproduced in any form or by any means, electronically, mechanically, by photocopying, recording or otherwise, without the prior permission of the copyright owners.

A catalogue record for this book is available from the British Library, London, UK.

Library of Congress Cataloging-in-Publication Data Environment impact of invertebrates for biological control of arthropods : methods and risk assessment / edited by Franz Bigler and Dirk Babendreier and Ulli Kuhlmann. p. cm. Includes bibliographical references and index. ISBN-13: 978-0-85199-058-3 (alk. paper) ISBN-10: 0-85199-058-4 (alk. paper) 1. Insect pests--Biological control. 2. Arthropod pests--Biological control. 3. Arthropoda as biological pest control agents. 4. Pesticides-- Environmental aspects. I. Bigler, Franz. II. Babendreier, Dirk. III. Kuhlmann, Ulli. IV. Title.

SB933.3.E58 2006 632Ј.96--dc22 2005020627

ISBN-10: 0-85199-058-4 ISBN-13: 978-0-85199-058-3

Typeset by Columns Design Ltd, Reading, UK. Printed and bound in the UK by Cromwell Press, Trowbridge. Contents

Contributors vii Foreword Joop C. van Lenteren xi

Preface xiii Acknowledgements xv 1 Current Status and Constraints in the Assessment of Non-target Effects 1 Dirk Babendreier, Franz Bigler and Ulrich Kuhlmann 2 Selection of Non-target Species for Host Speciﬁcity Testing 15 Ulrich Kuhlmann, Urs Schaffner and Peter G. Mason 3 Host Speciﬁcity in Arthropod Biological Control, Methods for Testing 38 and Interpretation of the Data Joop C. van Lenteren, Matthew J.W. Cock, Thomas S. Hoffmeister and Don P.A. Sands 4 Measuring and Predicting Indirect Impacts of Biological Control: 64 Competition, Displacement and Secondary Interactions Russell Messing, Bernard Roitberg and Jacques Brodeur 5 Risks of Interbreeding Between Species Used in Biological Control and 78 Native Species, and Methods for Evaluating Their Occurrence and Impact Keith R. Hopper, Seth C. Britch and Eric Wajnberg 6 Assessing the Establishment Potential of Inundative Biological 98 Control Agents Guy Boivin, Ursula M. Kölliker-Ott, Jeffrey Bale and Franz Bigler 7 Methods for Monitoring the Dispersal of Natural Enemies from Point 114 Source Releases Associated with Augmentative Biological Control Nick J. Mills, Dirk Babendreier and Antoon J.M. Loomans 8 Risks of Plant Damage Caused by Natural Enemies Introduced for 132 Arthropod Biological Control Ramon Albajes, Cristina Castañé, Rosa Gabarra and Òscar Alomar

v vi Contents

9 Methods for Assessment of Contaminants of Invertebrate Biological 145 Control Agents and Associated Risks Mark S. Goettel and G. Douglas Inglis 10 Post-release Evaluation of Non-target Effects of Biological Control Agents 166 Barbara I.P. Barratt, Bernd Blossey, Heikki M.T. Hokkanen 11 Molecular Methods for the Identiﬁcation of Biological Control Agents 187 at the Species and Strain Level Richard Stouthamer 12 The Usefulness of the Ecoregion Concept for Safer Import of Invertebrate 202 Biological Control Agents Matthew J.W. Cock, Ulrich Kuhlmann, Urs Schaffner, Franz Bigler and Dirk Babendreier 13 Statistical Tools to Improve the Quality of Experiments and Data Analysis 222 for Assessing Non-target Effects Thomas S. Hoffmeister, Dirk Babendreier and Eric Wajnberg 14 Principles of Environmental Risk Assessment with Emphasis on the 241 New Zealand Perspective Abdul Moeed, Robert Hickson and Barbara I.P. Barratt 15 Environmental Risk Assessment: Methods for Comprehensive Evaluation 254 and Quick Scan Joop C. van Lenteren and Antoon J.M. Loomans 16 Balancing Environmental Risks and Beneﬁts: a Basic Approach 273 Franz Bigler and Ursula M. Kölliker-Ott Glossary 287 Index 291 Contributors

Albajes, Ramon, Universitat de Lleida, Centre UdL-IRTA, Rovira Roure 191, 25198 Lleida, Spain. Email: [email protected]. Phone number: ϩ34-973-702571. Fax number: ϩ34-973-238301. Alomar, Òscar, IRTA, Centre de Cabrils, 08348 Cabrils (Barcelona), Spain. Email: [email protected]. Phone number: ϩ34-93-750-9961. Fax number: ϩ34-93-753- 3954. Babendreier, Dirk, Agroscope, FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstr. 191, 8046 Zürich, Switzerland. Email: [email protected]. Phone number: ϩ41-44-377-7217. Fax number: ϩ41- 44-377-7201. Bale, Jeffrey, School of Biosciences, University of Birmingham, Edgbaston, Birmingham B15 2TT, UK. Email: [email protected]. Phone number: ϩ44-121-414-5908. Fax number: ϩ44-121-414-5925. Barratt, Barbara, AgResearch, Invermay Agricultural Centre, Private Bag 50034, Mosgiel, New Zealand. Email: [email protected]. Phone number: ϩ64-3-489-9059. Fax number: ϩ64-3-489-3739. Bigler, Franz, Agroscope, FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstr. 191, 8046 Zürich, Switzerland. Email: [email protected]. Phone number: ϩ41-44-377-7235. Fax number: ϩ41-44- 377-7201. Blossey, Bernd, Department of Natural Resources, 122E Fernow Hall, Cornell University, Ithaca, New York 14853, USA. Email: [email protected]. Phone number: ϩ1-607-255- 5314. Fax number: ϩ1-607-255-0349. Boivin, Guy, Centre de Recherche et de Développement en Horticulture, Agriculture et Agroalimentaire Canada, 430 Boul. Gouin, Saint-Jean-sur-Richelieu, Québec J3B 3E6, Canada. Email: [email protected]. Phone number: ϩ1-450-346-4494. Fax number: ϩ1-450-346-7740. Britch, Seth, Beneﬁcial Insects Introduction Research Laboratory, Agricultural Research Service, USDA, 501 South Chapel Street, Newark, DE 19713, USA. Email: [email protected]. Phone number: ϩ1-302-731-7330 ext. 239. Fax number: ϩ1-302-737-6780. Brodeur, Jacques, Département des Sciences Biologiques, Institut de Recherche en Biologie Végétale, Université de Montréal, 4101, rue Sherbrooke Est, Montréal

vii viii Contributors

(Québec), Canada H1X 2B2. Email: [email protected]. Phone number: ϩ1-514-872-4563. Fax number: ϩ1-514-872-9406. Castañé, Cristina, IRTA, Centre de Cabrils, 08348 Cabrils, (Barcelona), Spain. Email: [email protected]. Phone number: ϩ34-93-750-9961. Fax number: ϩ34-93-753- 3954. Cock, Matthew, CABI Bioscience Switzerland Centre, Rue des Grillons 1, 2800 Delémont, Switzerland. Email: [email protected]. Phone number: ϩ41-32-421-4870. Fax number: ϩ41-32-421-4871. Gabarra, Rosa, IRTA, Centre de Cabrils, 08348 Cabrils (Barcelona), Spain. Email: [email protected]. Phone number: ϩ34-93-750-9976. Fax number: ϩ34-93-753- 3954. Goettel, Mark, Environmental Health, Agriculture and Agri-Food Canada, Lethbridge Research Centre, PO Box 3000, 5403 – 1st Avenue South, Lethbridge, AB T1J 4B1 Canada. Email: [email protected]. Phone number: ϩ44-403-317-2264. Fax number: ϩ44-403-382-3156. Hickson, Robert, Ministry of Research, Science and Technology, PO Box 5336, Wellington, New Zealand. Email: [email protected]. Phone number: ϩ64- 4-917-2917. Fax number: ϩ64-4-471-1284. Hoffmeister, Thomas, Institute of Ecology and Evolutionary Biology, University of Bremen, Leobener Str. NW2, D-28359 Bremen, Germany. Email: hoffmeister@uni- bremen.de. Phone number: ϩ49-421-218-4290. Fax number: ϩ49-421-218-4504. Hokkanen, Heikki, Department of Applied Zoology, University of Helsinki, PO Box 27, 00014 Helsinki, Finland. Email: heikki.hokkanen@helsinki.ﬁ. Phone number: ϩ358- 9191-58371. Fax number: ϩ358-9191-58463. Hopper, Keith, Beneﬁcial Insects Introduction Research Laboratory, Agricultural Research Service, USDA, 501 South Chapel Street, Newark, DE 19713, USA. Email: [email protected]. Phone number: ϩ1-302-731-7330 ext. 238. Fax number: ϩ1-302- 737-6780. Inglis, Douglas, Food Safety and Quality, Agriculture and Agri-Food Canada, 5403-1st Avenue South, Lethbridge, AB T1J 4B1, Canada. Email: [email protected]. Phone number: ϩ1-403-317-3355. Fax number: ϩ1-403-382-3156. Kölliker-Ott, Ursula, Agroscope, FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstr. 191, 8046 Zürich, Switzerland. Email: [email protected]. Phone number: ϩ41-44-377-7181. Fax number: ϩ41- 44-377-7201. Kuhlmann, Ulli, CABI Bioscience Switzerland Centre, Rue des Grillons 1, 2800 Delémont, Switzerland. Email: [email protected]. Phone number: ϩ41-32-421- 4882. Fax number: ϩ41-32-421-4871. Loomans, Antoon, Plant Protection Service, Section Entomology, PO Box 9102, 6700 HC Wageningen, The Netherlands. Email: [email protected]. Phone number: ϩ31-317-496825. Fax number: ϩ31-317-421701. Mason, Peter, Agriculture and Agri-food Canada, Research Centre, K.W. Neatby Building, Central Experimental Farm, 960, Carling Avenue, Ottawa, Ontario K1A OC6, Canada. Email: [email protected]. Phone number: ϩ1-613-759-1908. Fax number: ϩ1-613-759-170. Messing, Russell, University of Hawaii at Manoa, Kauai Agricultural Research Center, 7370 Kuamoo Road, Kapaa, Hawaii 96746, USA. Email: [email protected]. Phone number: ϩ1-808-822-4984 x223. Fax number: ϩ1-808-822-2190. Mills, Nick, Environmental Science, Policy and Management, 127 Mulford Hall, University of California, Berkeley, CA 94720-3114, USA. Email: [email protected]. Phone number: ϩ1-510-642-1711. Fax number: ϩ1-510-643-5438. Contributors ix

Moeed, Abdul, ERMA New Zealand, PO Box 131, Wellington, New Zealand. Email: [email protected]. Phone number: ϩ64-4-916-2426. Fax number: ϩ64-4- 914-0433. Roitberg, Bernie, Department of Biological Science, Simon Fraser University, Burnaby, BC, V5A IS6, Canada. Email: [email protected]. Phone number: ϩ1-604-291- 3585. Fax number: ϩ1-604-291-3496. Sands, Don, CSIRO Entomology, 120 Meiers Road, Indooroopilly, Queensland 4068, Australia. Email: [email protected]. Phone number: ϩ61-403-517224. Schaffner, Urs, CABI Bioscience Switzerland Centre, Rue des Grillons 1, 2800 Delémont, Switzerland. Email: [email protected]. Phone number: ϩ41-32-421- 4877. Fax number: ϩ41-32-421-4871. Stouthamer, Richard, Department of Entomology, University of California, Riverside, CA 92521, USA. Email: [email protected]. Phone number: ϩ1-951-827- 2422. Fax number: ϩ1-951-827-3086. van Lenteren, Joop, Laboratory of Entomology, Wageningen University, PO Box 8031, 6700 EH Wageningen, The Netherlands. Email: [email protected]. Phone number: ϩ31-317-482327. Fax number: ϩ31-317-484821. Wajnberg, Eric, INRA, 400, Route des Chappes, BP 167, 06903 Sophia Antipolis Cedex, France. Email: [email protected]. Phone number: ϩ33-4-92-38-6447. Fax number: ϩ33-4-92-38-6557. This page intentionally left blank Foreword

Classical biological control of insects, where exotic natural enemies are introduced to control exotic pests, has been applied for more than 120 years, and release of more than 2000 species of natural enemies has resulted in the permanent reduction of at least 165 pest species worldwide. Augmentative biological control, where exotic or native natural enemies are periodically released, has been used for 90 years, and more than 150 species of natural enemy are available on demand for the control of about 100 pest species. Contrary to the thorough environmental risk evaluations applied in the search for natural enemies of weeds, potential risks of biological control agents for arthropod control have not been routinely studied in pre-release evaluations. The reason might be that until now, very few problems have been reported concerning negative effects of releases of invertebrates for control of arthropods, despite there having been well over 5000 introductions that have been made worldwide. It is a well-known fact that intended or accidental invasions by many other exotic organisms have resulted in serious negative environmental and economic effects. However, discussion of the risks of releases of exotic natural enemies for non-target species now takes a prominent place in biological control programmes. On the other hand, one normally tends to forget or even not know the enormous economic and environmental benefits resulting from biological control with introduced exotic organisms. Recent retrospective analyses of biological control projects have provided quantitative data on nontarget effects and illustrated the need for risk assessments to increase the future safety of biological control. Twenty countries have already implemented regulation for release of biological control agents and many other countries are considering regulation. Soon, the International Standard for Phytosanitary Measures (ISPM3) will become the standard for all biological control introductions worldwide, but this standard does not provide methods by which to assess environmental risks. The same can be said about other risk assessments that have previously been used to evaluate exotic natural enemies. In order to fulfil the need of developing environmental risk assessment methods, as well as a framework for a general risk assessment of biological control agents, an international group of scientists first wrote a number of working papers. Next, these were discussed and modified during a week of hard work in the Swiss mountains. Finally, the papers were peer reviewed and rewritten for the current book. The goal of this book is not only to present risk assessment methods, but also to give ample background information relevant for developing and adapting these methods.

xi xii Foreword

It is my hope that this book will ﬁnd its way to scientists, biological control workers and regulators. Intensive collaboration between representatives of these groups will hopefully result in a light and harmonized regulation procedure that is not prohibitive to the biological control industry and will result in the selection of safe natural enemies. Joop C. van Lenteren President of the International Organization for Biological Control (IOBC Global) Professor of Entomology, Laboratory of Entomology, Wageningen University, The Netherlands. Preface

While safety of biological control was generally not questioned until the beginning of the 1990s, an ongoing debate started shortly after the Rio Convention on Biodiversity was agreed in 1992. Based on this agreement and on an increasing amount of published literature blaming biological control for contributing to biodiversity loss, international organizations and national governments started after the mid-nineties to publish documents in which general principles of guidance and good governance for import and release of invertebrate biological control agents were laid down. None of the international documents was meant to give detailed advice to national regulatory bodies on how to regulate import and release of such organisms, nor did they provide methodologies on how to assess potential effects and how to perform risk and benefit analysis. While the documents specify what information will be needed for risk assessment, they do not give any indication on how to obtain the relevant information, i.e., what methods could best be applied to obtain the needed data to perform risk assessments. This lack of background information and advice on methodology was the starting point of the present book. The idea was born to publish a document that summarizes the present status on risk assessment in biological control of arthropods with invertebrates, and gives guidance on methods to generate data which enable biological control scientists, natural enemy producers, retailers, practitioners and regulators to make informed risk assessments. The guiding principle of the book is to provide a science-based framework for identifying and evaluating relevant environmental effects that could result from import and release of exotic invertebrate biological control agents. It should assist those who are involved in risk and benefit assessment and in regulation of invertebrate biological control agents used against arthropod pests. A literature review has shown us that there is presently very little literature published providing reliable information on standard methods that could be applied to produce data for risk assessment. It is the intention of the present book to set a framework for risk assessment, to discuss strengths, weaknesses and lack of methods and to propose new approaches and practical guidance on how to measure and evaluate effects that contribute to environmental risks and benefits. We are aware that we do not cover all relevant aspects of risk–benefit assessment and regulation, and further efforts will be needed. Nevertheless, we are confident we can offer the reader a range of methods and guidance that will improve and facilitate regulation of invertebrate biological control agents, and contribute to the ongoing debate.

xiii xiv Preface

Based on previous projects and existing experience on risk assessment and regulation of invertebrate biological control agents, we identified the most critical issues to be considered and addressed in this book. With financial support from the Swiss Agency of Environment, Landscape and Forest and the Swiss Federal Research Station for Agroecology and Agriculture we were able to invite an international group of experts to prepare chapters and to present and discuss them at a workshop held in Engelberg, Switzerland, in 2004. The very open, critical and constructive atmosphere here was the ground for fruitful debates that contributed to improving the chapters and to make the book more comprehensive. The book consists of three parts, namely the major section in which methods for assessing environmental effects of invertebrate biological control agents are reviewed, discussed in the light of risk assessment and, when possible, recommendations on appropriate methods are made. The second section consists of three chapters presenting different technical tools which are extremely important in environmental risk assessment and regulatory procedures, and they belong to the basic prerequisites to evaluate risks. In the third section, the principles of environmental risk assessment are presented together with a case study; two methods on how to perform risk analysis with invertebrate biological control agents are shown with practical examples given, and finally, a risk–benefit assessment together with an example is discussed. As the book is a compilation of the current knowledge of methodology available for assessing non-target effects and risks of invertebrate biological control agents, it shows the arsenal of tools and methods. However, limitations of our understanding of ecological mechanisms and lack of methods to analyse such processes show the obvious gaps. We are far from having answers and solutions to all questions relevant to risks and regulation, and we still need to tackle a number of practical problems. Bearing in mind that improvements can still be made in the future, we should not forget that regulation of biological control agents must be cost effective. Overregulation of biological control would be disas- trous because it would prevent progress of biological control and its role in IPM. Regulation of invertebrate biological control agents will certainly undergo changes in the coming years. We expect that national authorities in many countries will be more demanding, with the consequent need for biological control manufacturers to prepare more elaborated dossiers, with more information and data. This will be an additional burden for biological control projects and lead to a longer time period for approval of new organisms. On the other hand, it will give more confidence in biological control and help to maintain and strengthen the good reputation of these pest control methods. We have reached our goals if this book contributes to the better assessment of environmental effects, risks and benefits of invertebrate biological control agents, and if it provides guidance to all those who are involved in biological control and its regulation. Franz Bigler, Dirk Babendreier and Ulli Kuhlmann, June 2005 Zürich and Delémont, Switzerland. Acknowledgements

This book has been written by authors who have long-standing expertise in biological control and/or regulation of agents introduced and released to this end. First, we would like to thank those authors who participated in the workshop held in 2004 in Engelberg, in the Swiss Alps, where ﬁrst drafts of the chapters were discussed and critically reviewed in an open and constructive spirit. Special thanks are addressed to the few co- authors who were not able to attend, but still made their invaluable contributions to different chapters. Many colleagues reviewed the chapters and gave their comments and views, provided ideas and insights and helped the authors to achieve a text which will be useful to all stakeholders of biological control. From within the group of workshop participants, we would like to thank Barbara Barratt, Guy Boivin, Jaques Brodeur, Keith Hopper, Doug Inglis, Antoon Loomans, Peter Mason, Russell Messing, Nick Mills, Bernie Roitberg, Richard Stouthamer and Joop van Lenteren. Furthermore, several external reviewers shared their expertise with us, and the following colleagues are particularly acknowledged: Moshe Coll, Eric Conti, Dave Gillespie, George Heimpel, Lia Hemerik, Mark Hoddle, Kim Hoelmer, Larry Lacey, Peter McEvoy, Bill Turnock, Franco Widmer and Robert Wiedenmann. This book is the fruit of a project funded by the Swiss Agency of Environment, Landscape and Forest, the Swiss Federal Research Station for Agroecology and Agriculture and CABI Bioscience Centre, Switzerland. We are thankful for the continuous support by these institutions.

xv This page intentionally left blank 1 Current Status and Constraints in the Assessment of Non-target Effects

Dirk Babendreier,1 Franz Bigler1 and Ulrich Kuhlmann2 1Agroscope, FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstr. 191, 8046 Zürich, Switzerland (email: [email protected]; [email protected]; fax number: +41-44-3777201); 2CABI Bioscience Centre, Rue des Grillons 1, 2800 Delémont, Switzerland (email: [email protected]; fax number: +41-32-4214871)

Abstract

In the last two decades increasing concerns have been expressed regarding potential non- target effects of invertebrate biological control agents of arthropods. This has led to an increasing number of studies investigating non-target effects in many systems. Several international initiatives aimed at providing guidance for risk assessment of biological control agents are brieﬂy reviewed here. Furthermore, we aim to provide an overview of the current status of non-target testing of arthropod biological control agents, and identify the most recent developments. Most importantly, we aim to identify constraints and unsolved questions which need further research or consideration in the future. Major obstacles encountered include the need for harmonization of regulation and methods, and the increasing costs that are associated with implementing regulation. In addition, statistical analysis, the interpretation of host range tests, and inherent uncertainties associated with non-target testing are major problems currently faced in risk assessment. Finally, this chapter will refer to other chapters of this book that address the identiﬁed issues and propose the urgently needed and relevant methodology.

History of Initiatives for Regulation of reviews have been published within the last ten years (e.g. Simberloff and Stiling, The potential for non-target effects result- 1996; Follett et al., 2000; Lockwood et al., ing from the release of biological control 2001; Lynch et al., 2001; Louda et al., agents has been recognized for over a hun- 2003). dred years. However, only much later has International laws and agreements this question stimulated intensive discus- coupled with an increasing interest in the sion among scientists and beyond import and release of exotic biological con- (Howarth, 1983, 1991). Since then, non- trol agents requires harmonized and appro- target effects in biological control are priate regulation. However, provisions increasingly being studied, and a number within such legislation vary considerably ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of Arthropods: Methods and Risk Assessment (eds F. Bigler et al.)1 2 D. Babendreier et al.

between countries. A starting point microorganism in EU countries. An expert towards international regulation was panel was established and the results of marked by the FAO Code of Conduct for their meetings were published in two guid- the Import and Release of Exotic Biological ance documents and in a ‘positive list’ of Control Agents; this was adopted in 1995 organisms for safe use in EPPO countries by the FAO Conference and published in (EPPO, 1999, 2001, 2002). The two guide- 1996 as the International Standard for lines stress the importance of a two-step Phytosanitary Measures No. 3 (IPPC, 1996). system for importation and release, i.e. EU One objective of the Code was to provide a countries should first establish a regulatory standard for those countries that lack ade- process for the import of exotic organisms quate legislation and procedures to regu- for research under containment. The late importation and to analyse risks results of these investigations will provide related to biological control agents. The the necessary data to make decisions on document lists in a generic way the respon- whether the organism can later be sibilities of the authorities and importers imported for release. and exporters of biological control agents. In parallel with the EPPO panel activi- The revised version of this Code of ties, the EU-funded research project ERBIC Conduct has extended its range from classi- (Evaluating Environmental Risks of cal biological control to inundative biologi- Biological Control Introductions into cal control, native natural enemies, Europe) was executed from 1998 to 2002. microorganisms and other beneficial One of the main outcomes of the project organisms, and it also includes evaluation was a proposal for the environmental risk of environmental impacts (IPPC, 2005). assessment of exotic natural enemies in This standard will certainly continue to inundative biological control (van Lenteren provide guidance for countries that are et al., 2003). This represents the first paper developing their own legislative systems with detailed criteria for risk assessment for biological control regulation, and the and a ranking system that is based on the Code may be seen as a first attempt to quantitative evaluation of more than 30 globally harmonize regulation of biological invertebrate biological control agents used control agents. in inundative control in Europe. Shortly after the Code’s first publication, In 2000, the North American Plant the European and Mediterranean Plant Protection Organization (NAPPO) pub- Protection Organization (EPPO) together lished its ‘Guidelines for Petition for with CABI Bioscience organized a work- Release of Exotic Entomophagous Agents shop on safety and efficacy of biological for the Biological Control of Pests’ (RSPM control in Europe (EPPO, 1997). This work- No 12, NAPPO, 2000). These guidelines are shop broadly endorsed the FAO Code but intended to assist researchers and compa- recommended that regulation should not nies in drafting a petition for release of slow the importation or import of biologi- exotic entomophagous agents for biological cal control agents, be it for preliminary control of pest insects and mites. It will research or for subsequent release. The also assist reviewers and regulators in workshop concluded that a certification assessing the risk of exotic introductions system should be put in place for Europe intended for biological control. The guide- instead of a registration procedure to line specifies the requirement for informa- ensure a ‘light’ regulatory system with effi- tion on biology of the agent and the target cient and rapid mechanisms. The reason- pest(s), the economic impact of the pest, ing behind this decision was based on regulatory status, and the quarantine proce- previous experience with the registration dures needed for importation of the biolog- system for microbial biological control ical control agent. To some extent there has agents in Europe: the EU Directive and its been some harmonization in data require- implementation is so stringent that it is ments for entomophagous biological con- basically impossible to register a new trol agents in that the three countries Current Status and Constraints in the Assessment of Non-target Effects 3

(Canada, USA and Mexico) have agreed to from each other’s reviews. The document conform to NAPPO guidelines. However, (OECD, 2003) proposes guidance for mem- currently the regulatory system within the ber countries on information requirements USA is cumbersome with a mixture of for: a) the characterization and identifica- inconsistent Federal and State jurisdiction. tion of the organism; b) the assessment of The system for biological control regula- safety and effects on human health; c) the tion in Hawaii, the State where the most assessment of environmental risks; and d) rigorous review procedure has been the assessment of efficacy of the organism. adopted, is worth reviewing. While the sys- With native or established organisms and tem appears to be exhaustive in ensuring with those in long-term use in a country, environmental safety of biological control, substantially reduced information require- and allows for a degree of public consulta- ments may be appropriate. tion, it is steeped in bureaucracy that In Europe, the biological control indus- results in frustration and lengthy delays for try expressed their concerns when the biological control practitioners. OECD guidance document was published Island nations, such as Australia and as the information requirements were con- New Zealand, have the unique situation sidered to be too stringent. As a conse- where shared borders are not an issue, and quence, the International Biocontrol complete control over imported biological Manufacturers’ Association (IBMA) pro- control agents can be achieved. The 1996 posed to the International Organization for Hazardous Substances and New Organ- Biological Control (IOBC/WPRS) facilita- isms (HSNO) Act in New Zealand tion of the harmonization among the (http://www.legislation.govt.nz) has attracted European regulatory authorities. A considerable attention internationally as Commission for the IOBC/WPRS was estab- very environmentally focused legislation, lished in 2003 and a meeting of scientists, and its implementation by ERMA NZ has together with the biological control indus- been observed with interest (see Moeed et try and regulators, resulted in the produc- al., Chapter 14 this volume). In Australia, tion of a document that gives detailed biological control agents are regulated by guidance on regulation procedures for two agencies under three separate Acts, and exotic and indigenous biological control have been similarly heralded as a thorough agents (Bigler et al., 2005). and biosafety-conscious approach. The two Most recently, the European systems have some key differences in Commission released a call for project approach, the most notable ones being the applications with the aim of developing a opportunity for public participation and the balanced system for regulation of biological degree of risk-aversion of the regulatory control agents (micro- and macro-organ- agencies. isms), semiochemicals and botanicals. This An initiative starting from a meeting specifies that the number of microbiologi- held in Canada in 1999 resulted in OECD cal products on the market in Europe is (Organization for Economic Co-operation currently still low compared to other coun- and Development) member countries devel- tries, e.g. the USA and Canada. The aim of oping a harmonized approach for regulation the task is to review current legislation, of invertebrate biological control agents. It guidelines and guidance documents and to was agreed that a harmonized regulatory compare this with similar legislation in system in the OECD member countries other countries where the introduction of would be beneficial for biological control new biopesticides has proved to be more and that a ‘light’ form of regulation would successful. New appropriate and balanced be appropriate. The development of harmo- regulatory systems should be designed. It nized guidance for regulation requirements can be expected that within a few years the would enable companies to submit the EU members and other European countries same applications to many countries, and may regulate invertebrate biological control would allow regulatory agencies to benefit agents under uniform principles. 4 D. Babendreier et al.

From this overview on regulation in dif- human health and safety, here we will dis- ferent countries it is becoming evident that cuss mainly the third part, i.e. the assess- challenges and opportunities have ment of environmental risks. emerged. The above-mentioned initiatives generally highlight what should be done or what knowledge is required, but they are Host specificity not designed to provide detailed methods on how one should test for non-target Host specificity is a key element if non- effects. Recently, a guide to best practice of target effects of biological control agents host range testing has been released by Van are to be assessed, and this is also Driesche and Reardon (2004). In addition, reflected in the OECD document. all aspects of non-target testing have Although only information available to recently been addressed in a comprehen- identify any potential hazards posed to sive review of the current methods used to the environment is currently required assess potential risks of biological control under 3.1, data may be required for host agents (Babendreier et al., 2005). This book specificity testing under 3.2 (Table 1.1). attempts to go a step further by providing Here, we like to stress that host range guidance on methods necessary to assess assessment does not necessarily mean that non-target effects of invertebrate biological tests have to be conducted. Often, pub- control agents of insect pests. The authors lished information is sufficient to draw feel that the lack of methodology and conclusions on the host specificity of the approaches is a major concern and a bottle- agent. A recent example was provided by neck in environmental risk assessment at De Nardo and Hopper (2004), who con- the moment, and that these issues need to ducted a comprehensive literature study be tackled. for the ichneumonid parasitoid Macrocentrus grandii (Goidanich). These authors stressed that a lot of information Status and Important Issues in can be obtained even from negative obser- Assessing Environmental Effects vations, i.e. from studies on potential non- target hosts that did not report the While all documents underline the need biological control candidate as a natural for regulation of invertebrate biological enemy. control agents, the level of guidance on Although host specificity testing has information needed for risk assessment been required in weed biological control varies to a great extent between these docu- projects for many decades, it was incorpo- ments. The OECD guidance document rated into arthropod biological control pro- (OECD, 2003) is one of the most compre- jects rather recently. For the latter, there are hensive initiatives to date, as it requires still not many experimental studies avail- relatively detailed information from the able in which host range testing was con- applicant in order to receive an import and ducted, though this number increased release permit, and because the OECD cov- recently (see Babendreier et al., 2005). ers a wide geographic area. Based on expe- There are also several reviews or discus- rience with many other regulatory sion papers available dealing with topics documents released by the OECD, we that need to be addressed in these tests assume that this document will be widely (Sands, 1997, 1998; Van Driesche and adopted internationally, or at least serve as Hoddle, 1997; Sands and Van Driesche, a basis for national regulatory documents. 2000; Van Driesche and Murray, 2004a,b; Therefore, this chapter basically follows Van Driesche and Reardon, 2004). the issues raised in that document (OECD, After the first step, i.e. the collection of 2003). While the first two parts of the docu- all available information (Sands and Van ment address issues of characterization and Driesche, 2004) an important subsequent identification of organisms as well as step may be to carry out field surveys in the Current Status and Constraints in the Assessment of Non-target Effects 5

Table 1.1. Information requirements of the OECD document on environmental risk assessment of biological control agents.

3. Information for assessment of environmental risks

3.1 Identify any potential hazards posed to the environment including: (a) available information on the role of organism in original ecosystem, the type of natural enemy (parasitoid, predator, pathogen), type of organisms it attacks, effects of attack on targets and non-targets, intra-guild effects, higher up trophic level effects, effects on ecosystem (b) available information on existing natural enemies of the target organism in the area of release (c) available information on non-target effects from previous use in biological control 3.2 Host specificity testing (a) available information and/or data on possible direct effects: ● on non-target host/prey related to target host (phylogenetically or ecologically related) ● on non-related non-target hosts, such as threatened and endangered species ● concerning competition or displacement of organisms ● concerning potential for interbreeding with indigenous natural enemy strains or biotypes ● on plants (target crop and non-target plants) (b) available information and/or data on potential of establishment and dispersal of biological control agent (c) available information on and/or data on possible indirect effects (d) available information (from rearing facility; in the field) on ability to vector viruses or microorganisms which can negatively affect non-target organisms 3.3 Available information, and/or data on potential host/prey range in areas of release and potential distribution 3.4 Available information on environmental benefits e.g. beneficial effects of release compared to current or alternative control methods 3.5 Summary of information for assessment of environmental risks

country of origin and also to analyse the Driesche and Reardon, 2004). Moreover, the fauna of the proposed area of introduction number of species in taxonomic groups is (Hoddle, 2004). For those surveys, classical often higher by an order of magnitude com- ecological methods or more recently devel- pared to plants. Molecular tools are increas- oped molecular methods may be used ingly being used and may help to solve this depending on the organisms (Symondson, problem in the future (see Stouthamer, 2002; Gariepy et al., 2005). Field surveys Chapter 11, this volume). Criteria that have are not only an important preliminary step been taken into account for creating such in identifying the species with the most lists in arthropod biological control have narrow host range out of a pool of species, included geographic distributions, oviposi- but they can also provide guidance regard- tion phenology, number of generations per ing which species should be included in year, overwintering stage, host-plant prefer- host specificity tests (see Kuhlmann et al., ences, and the type and feeding niche of the Chapter 2, this volume). A general problem host (for a review, see Babendreier et al., with field surveys is in defining the limits 2005). In addition to the ecological criteria of the system. Should one collect only mentioned above, the importance and avail- species from taxa that contain known hosts ability of potential non-target species were or include additional taxa? also considered; some species that would Creating a list of species that should be be desirable members of a host range test tested for acceptance by biological control list may be impossible to find or to rear. agents is obviously a difficult task. A gen- However, there appears to be some contra- eral problem, especially for insect biologi- diction as the OECD (2003, see Table 1.1) cal control, is that the taxonomy of requires information on rare non-target involved groups is often unclear (Van hosts which, generally, is very difficult or 6 D. Babendreier et al.

impossible to obtain (Barratt, 2004). aethiopoides Loan and Microctonus hypero- In this book, Kuhlmann et al. (Chapter 2, dae Loan (Hymenoptera: Braconidae) this volume) for the first time worked out a obtained in the laboratory with actual field general approach that could be applied in parasitism after the agents were established. creating a list of non-target species used in The authors basically concluded that tests host-range testing, both for inundative and conducted in the laboratory were in fact classical biological control agents targeting indicative of field parasitism. Coombs (2003) insects. The ultimate aim of host range tests reported that the tachinid fly Trichopoda is to determine the agent’s ecological host giacomelli (Blanchard) attacked two non- range, i.e. the number of hosts that will be target hosts after field release in Australia, attacked in the field where the biological exactly as was anticipated by host range tests control agent is to be introduced (Van carried out beforehand. However, there are Driesche and Reardon, 2004). Clearly, labora- also examples, such as the retrospective case tory tests have their limitations, as it is study on the braconid wasp Peristenus extremely difficult to accurately reproduce digoneutis Loan (Haye et al., 2005), suggest- the cues and stimuli that affect host accep- ing that physiological host range is often tance of biological control agents in a natural (much) greater than ecological host range. environment (Keller, 1999; Kuhlmann et al., Despite the fact that laboratory tests demon- 2000; Sands and Van Driesche, 2000). strated high parasitism levels in non-targets, The interpretation of host specificity tests ecological assessments in both North is a problem and there are ongoing debates America and Europe suggested a much regarding how indicative these tests are. A lower impact of P. digoneutis on non-target number of studies exist that conducted no- mirids. While some non-targets were not choice tests and choice tests with the same parasitized at all, others showed very low non-target species. The majority of these levels of parasitism (below 1% in Europe). studies have shown that results from both Therefore, ecological host range studies in kinds of tests are in general agreement the area of origin provide useful supplemen- (Duan and Messing, 2000; Zilahi-Balogh et tary data for interpretation of pre-release al., 2002; Mansfield and Mills, 2004). laboratory host range tests. Recently, Withers However, Haye (2004) has shown that sev- and Browne (2004) came up with a different eral non-target species were less preferred in approach, aiming the overall objective at choice tests while target and non-target maximizing the probability that non-target species were equally parasitized in no- test species would be accepted during labora- choice tests. Unfortunately, the reverse was tory tests, which resulted in an accurate also observed, i.e. non-targets and the target (although probably overestimated) risk were similarly attacked in choice tests while assessment of the invertebrate biological con- less non-target parasitism was observed in trol agent. When relying only on small cage the no-choice test. Whether choice tests are laboratory experiments to assess the maxi- useful or necessary at all is still debated. mum host range possible retrospectively, Guidance on what test should be used and P. digoneutis may have been classified as how this should be done is given by van potentially risky, when in fact laboratory tests Lenteren et al. (Chapter 3, this volume). may have had a poor predictive value in this Most importantly, however, one likes to case. In general, when and why there is a know whether results obtained under labora- good match between laboratory and field tory (or semi-field) conditions are indicative data remains an open and important question of what a biological control agent would in arthropod biological control. attack in the field. So far, there is no long track record on the reliability of host specificity testing in arthropod biological control. Competition and indirect effects A pioneering study was conducted by Barratt et al. (1997), who compared results It is suggested that negative interactions on host specificity of Microctonus amongst biological control agents and com- Current Status and Constraints in the Assessment of Non-target Effects 7

petitors may play a significant role both for cage studies including the biological con- the success of biological control projects trol agents and a competitor (Schellhorn et and for non-target effects (Denoth et al., al., 2002) or intra-guild experiments in 2002; Reitz and Trumble, 2002). In fact, small arenas (e.g. for predators (Burgio et some well-documented examples of dis- al., 2002); for parasitoids (Wang and placement have occurred among intro- Messing, 2002)). A tiered approach, com- duced biological control agents, and some bining laboratory, semi-field and field of these showed that ecological processes experiments, was recently applied in order responsible for displacement can be very to assess whether mass releases of complex (e.g. Murdoch et al., 1996). Trichogramma brassicae Bezdenko Regarding the natural enemy complex of (Hymenoptera: Trichogrammatidae) against the target, it is obvious that a successful the European corn borer might have detri- biological control agent by itself may have mental effects on populations of other nat- dramatic consequences on the composition ural enemies in maize and adjacent of this complex (e.g. Neuenschwander, habitats (Babendreier et al., 2003a). Again, 2001). It may be questioned whether dis- the most serious problem with indirect placement of an exotic natural enemy by effects is their complexity and the high another exotic, and population changes of degree of uncertainty inherently associated native natural enemies associated with the with them. Therefore, it is very difficult to control of the pest, can really be consid- incorporate them into risk assessment ered relevant non-target effects. schemes (see Messing et al., Chapter 4 this Information on indirect effects is now volume; van Lenteren and Loomans, required by the OECD (2003, see Table 1.1), Chapter 15, this volume). but how this can be achieved is unclear, and it is still debated how an indirect effect can be defined. We believe that a clarifying defin- Post-release studies ition has been provided by Messing et al. (Chapter 4, this volume), which basically dis- Retrospective post-release studies could be tinguishes between direct competitive effects especially useful in verifying predictions (those in which a natural enemy comes into made from host specificity testing before direct physical contact with a competitor) release of a biological control agent; how- and indirect competitive effects (in which the ever, to our knowledge, very few such stud- interaction among competing natural ene- ies are available (see Barratt et al., Chapter mies is mediated via a third organism). While 10, this volume). This is probably due to the the former part of the definition relates to fact that most host specificity tests of arthro- intra-guild predation (also listed in the OECD pod biological control agents have been con- document, see Table 1.1), the latter part of the ducted only recently. The paucity of definition relates to all other, sometimes com- baseline data is a major drawback for post- plex, processes. Messing et al. (Chapter 4, release studies. Typically for such studies, this volume) propose that an evaluation of one or several non-target species were indirect effects should preferentially concen- selected and sampled in areas where the trate on population- and community-level biological control agent was released or was impacts rather than on consequences on indi- known to occur, and the mortality due to viduals, and where possible, should be pur- the agent was determined. Another method sued under field conditions for extended involves the placement of non-target indi- periods of time. These studies typically viduals in the field where the biological include prolonged post-release monitoring control agent is known to occur or has been and are thus labour-intensive and costly. experimentally released. Life tables have Basic methods used to date include field also been shown to be a valuable tool in surveys to compare non-target populations post-release studies, making it possible to prior to and following release of the biolog- put the observed mortality of the non-targets ical control agents (Brown, 2003), field into context. To date, these studies suggest 8 D. Babendreier et al.

that it is often not the suspected introduced from the point of release. Suitable methods agent, but rather other factors, that were to gather these data are provided by Mills responsible for most of the non-target mor- et al. (Chapter 7, this volume). tality observed (Barron et al., 2003; Johnson et al., 2005). Alternatively, populations of non-targets could be observed both in areas Modelling where the biological control agent is present and in areas where it is absent. Although In addition to experimental studies, model- this approach is being used in New Zealand ling approaches can also be used to predict to detect potential non-target effects in long- potential risks of biological control agent term studies (B.I.P. Barratt, Mosgiel, NZ, introductions. Using a Nicholson-Bailey 2004, personal communication), to date no model, Lynch et al. (2002) studied whether published reports are available where this transient non-target effects can occur at an method has been applied in arthropod bio- early stage of a biological control introduc- logical control. tion due to the very high target and, consequently, agent populations. Interestingly, this study demonstrated the potential for a Establishment and dispersal strong, transient decline of a non-target host population, even when the biological Two additional topics, namely the poten- control agent has a very low acceptance of tial for establishment and dispersal, need the non-target species. Recently, another to be addressed in risk assessment of bio- modelling study was conducted with the logical control agents, though they are aim of making predictions for populations mainly important in inundative release of non-targets when these suffered from, programmes. Unfortunately, until recently for example, 15% parasitism (Barlow et al., (Babendreier et al., 2005) there have been 2004). Building upon the vast amount of very few published studies dealing explic- knowledge on Microctonus spp. introduced itly with these issues in the context of non- in New Zealand, Barlow et al. (2004) used target effects. General methods used were discrete Ricker or continuous logistic mod- either to expose the agent under outdoor els that incorporated density dependence conditions or to assess the agent’s lethal and the intrinsic rate of increase as the key temperature. All methods available are factors. Using the same parasitism rate, the summarized in Boivin et al. (Chapter 6, model predicted reductions of two non- this volume). A quite different approach target host populations of 8% or 35%, that may be useful in predicting the likeli- respectively, and the major factor was found hood of establishment of a biological con- to be the intrinsic rate of increase of popula- trol agent is based on ecoregions (see Cock tions at different altitudes. We believe that et al., Chapter 12, this volume). such studies are potentially important in However, even when an exotic biologi- addressing the risks of biological control cal control agent is not able to establish agents to non-target populations, but on the permanently, seasonal persistence might be other hand we feel that the special value of possible. This means that potential non- modelling studies will become apparent target effects would be limited in time and only when these have been validated with dependent on the dispersal abilities of the field, or at least experimental, data. agent. Despite the large amount of literature on dispersal in general, few studies have been carried out on dispersal of bio- General Considerations Regarding logical control agents specifically to assess the Regulation of Invertebrate non-target effects. The most important Biological Control Agents details required include the numbers leaving release fields (or the greenhouse), and Above, we have provided a short overview the densities of agents at certain distances on the status of non-target testing of arthro- Current Status and Constraints in the Assessment of Non-target Effects 9

pod biological control with special empha- were observed if the baseline is the extirpa- sis on methodological aspects. We also tion of host populations on regional or identified several difficulties encountered even larger scales. However, biological con- and briefly discussed them where appro- trol agents will already be rejected at a priate. However, some more general con- lower level of impact; but at what level of straints may be important to note as well. effect to reject a natural enemy is an impor- First, the statistical analysis of studies test- tant and yet unsolved question. As host ing for non-target effects is sometimes specificity again (and establishment for inappropriate (see Hoffmeister et al., inundative releases) will be the central Chapter 13, this volume). For instance, issue(s), the question may finally be: how there is not enough discussion on the num- many non-target species should be in the ber of replicates that should be carried out host range of a biological control agent in in host range testing; often this number is order to consider it unsafe (see van too low. A still unsolved issue is the ques- Lenteren et al., Chapter 3, this volume)? tion of whether one or very few replicates What about an agent that has the potential showing negative results are sufficient to to attack some non-target species, but on conclude that the non-target host is outside the other hand also has the potential for of the agent’s host range. Clearly, statistical large benefits? We believe that such ques- power decreases if a small number of repli- tions will be of increasing importance in cates are carried out, and low power may the risk assessment of biological control be especially critical in the context of risk agents and these questions are being assessment (see Hoffmeister et al., Chapter addressed by Bigler and Kölliker-Ott 13, this volume). (Chapter 16, this volume). Another problem, especially valid for One disadvantage of regulating inverte- many field studies, is that they often have brate biological control agents would be the been limited in time (e.g. one field season increased costs and time lag to bring new only) and space. Longer-term studies may biological control agents on to the market. allow more precise conclusions to be drawn While producers of biological control agents on non-target impacts, but have rarely been must invest more initially to develop new conducted in the past. The importance of agents, these costs are likely to be passed to spatial dimension was demonstrated by growers who buy biological control agents, Follett et al. (2000), who found non-target and ultimately to consumers who want to parasitism to be dependent on the elevation purchase ‘pesticide-free’ products. There is level of Hawaiian Islands. Clearly, to also the risk that a few producers of biologi- increase the temporal or spatial scale of cal control agents will dominate the biologi- such studies would increase the costs, a cal control industry and small units will be problem that is discussed below. eliminated. On the other hand it is impor- In those cases where parasitism/preda- tant that augmentative biological control is tion of a non-target host was observed, it is not oversold; that is, recommended when important to know the consequences at the unnecessary or when not appropriate. A population level. However, impact of bio- spin-off benefit of regulating biological con- logical control agents on field populations trol agents will be the increased difficulty of of non-target species has rarely been inves- selling products that are ineffective or in- tigated experimentally. Even if effects on appropriate, and which may nevertheless the population level have been demon- pose risks to the environment. Another strated, there is still no consensus as to potential benefit would be greater protection what a relevant non-target effect is. First of intellectual property. Thus, regulations approaches have been outlined by Lynch et would enhance reputable biological control al. (2001), who suggested a severity index agent manufacturers and sellers, make bio- ranging from zero (no negative reports) to logical control more science-based and help nine (large-scale extinction). They con- to maintain a good image of biological concluded that few serious non-target effects trol by the public. 10 D. Babendreier et al.

Given the limited resources available for strains of the same or a related species could biological control projects, it was stated be encouraged. However, local populations that extensive assessment of non-target should be used only as source material for effects would be unrealistic and impractical laboratory cultures, not as a convenient sup- (Messing, 2001). If a large number of ply. In North America, the convergent lady- species are tested with detailed investiga- bird beetle, Hippodamia convergens tions of the host-finding behaviour, and Guérin-Meneville, is collected from over- tests are conducted under semi-field condi- wintering aggregations and shipped directly tions, then costs can be substantial. to buyers (Gillespie et al., 2002). This is Obviously, the most costly species are those questionable because this practice has the having a relatively wide host range, and it potential for reducing local biodiversity and is worth noting that for polyphagous biolog- for transmitting contaminants (e.g. para- ical control agents, such as most tricho- sitoids and diseases) to native species in the grammatids, a comprehensive list of area of release (see Goettel and Inglis, non-target species may not be manageable. Chapter 9, this volume). We believe that if polyphagous agents are to A problem somehow specific to the be considered at all (e.g. in inundative bio- OECD guidance document is the fact that it logical control), other approaches of risk often requests ‘available information’. assessment may have to be used. For There will immediately be the question of instance, studies on habitat specificity or what to do if there are no data available for dispersal might be more promising than a specific question. Moreover, the OECD pure host range testing to determine the document includes some issues that have risk of such agents. One example of what received little attention in the past, includ- can be done to assess non-target effects of ing the potential for interbreeding (see the polyphagous T. brassicae was recently Hopper et al., Chapter 5, this volume), the provided by Babendreier et al. (2003b). potential of damage to non-target plants Another example is nematodes, which are (see Albajes et al., Chapter 8, this volume) often not restricted in their host range, but or the potential risk that a biological con- hardly any non-target effects due to the trol agent carries unwanted contaminants release of nematodes have been observed in (see Goettel and Inglis, Chapter 9, this vol- the past (see Barratt et al., Chapter 10, this ume). These topics are addressed in the volume). If risks are not negligible, a book and information on how to tackle cost–benefit analysis will provide a more such questions is provided. accurate and balanced picture of the advantages and disadvantages of releasing an agent; in fact, information on potential ben- Conclusions efits is also required by the OECD guidance document (Table 1.1), but to date only lim- Despite the fact that few non-target effects ited information on cost–benefit analysis in associated with arthropod biological control invertebrate biological control is available. have been reported, the number of studies One of the few papers including such infor- that have tested for such effects increased mation in the context of biological control substantially during the last decade. A lot of was recently published by Heimpel et al. progress has been achieved and many recent (2004) on the risks and benefits of introduc- introductions have been accompanied by ing parasitoids for control of soybean appropriate host range assessments. aphids. In this book, we shall try to elabo- Nevertheless, we are still not at the stage rate further on this issue (see Bigler and where host-range assessment combined Kölliker-Ott, Chapter 16, this volume). with pre- and post-release studies are stan- Regulations will certainly have an impact dard procedures in each biological control on the business strategy of biological control project, a suggestion put forward by Barratt manufacturers, particularly when generalist et al. (Chapter 10, this volume). We would species are involved. Investigations of local also like to stress that often only a fraction Current Status and Constraints in the Assessment of Non-target Effects 11

of all potential risks have been assessed. Since regulation and non-target testing This becomes especially obvious when will increase associated costs, it is impor- looking at indirect effects where it is clearly tant to use the available resources as effi- not possible to test for all interactions. ciently as possible. Therefore, it is Although the above-mentioned efforts important to provide guidance on testing have already led to increased costs of biologi- non-target effects, and for this goal it is cal control projects, a recent evaluation of the extremely valuable to have appropriate IPPC Code of Conduct revealed no decrease methods available. This book aims to con- in the number of introductions of exotic bio- tribute to both objectives. We believe that logical control agents, but rather indicated a improving non-target testing procedures in delay of introductions (Kairo et al., 2003). arthropod biological control is not only This, however, may be due to the fact that the necessary for reducing the potential of IPPC Code was not legally binding to adverse effects on non-targets even further, involved parties. If guidance documents (e.g. but also for preventing the hurdles that the OECD document) could find their way accompany over-regulation. The vast into national laws, then this situation may majority of agents used in arthropod bio- change in the future (i.e. the number of biological control have been shown to be safe. logical control projects and introductions Finally, we suggest conducting careful and might decrease). However, the application of well-balanced analyses of potential risks appropriate regulatory procedures is impor- and benefits for biological control projects tant in order to maintain public confidence in the future, keeping in mind that all in biological control and to facilitate intro- plant protection methods bear risks and ductions and the commercial use of exotic benefits which need to be evaluated biological control agents in the future. against each other.

References

Babendreier, D., Rostas, M., Hofte, M.C.J., Kuske, S. and Bigler, F. (2003a) Effects of mass releases of Trichogramma brassicae on predatory insects in maize. Entomologia Experimentalis et Applicata 108, 115–124. Babendreier, D., Schoch, D., Kuske, S., Dorn, S. and Bigler, F. (2003b) Non-target habitat exploitation by Trichogramma brassicae (Hym.: Trichogrammatidae): what are the risks for endemic butterflies? Agricultural and Forest Entomology 5, 199–208. Babendreier, D., Bigler, F. and Kuhlmann, U. (2005) Methods used to assess non-target effects of invertebrate biological control agents of insect pests. BioControl 50, 821–870. Barlow, N.D., Barratt, B.I.P., Ferguson, C.M. and Barron, M.C. (2004) Using models to estimate parasitoid impacts on non-target host abundance. Environmental Entomology 33, 941–948. Barratt, B.I.P. (2004) Microctonus parasitoids and New Zealand weevils: comparing laboratory estimates of host ranges to realized host ranges. In: Van Driesche, R.G and Reardon, R. (eds) Assessing Host Ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. FHTET-2004-03, Forest Health Technology Enterprise Team, Morgantown,West Virginia, USA, pp. 103–120. Barratt, B.I.P., Evans, A.A., Ferguson, C.M., Barker, G.M., McNeill, M.R. and Phillips, C.B. (1997) Laboratory non-target host range of the introduced parasitoids Microctonus aethiopoides and M. hyperodae (Hymenoptera: Braconidae) compared with field parasitism in New Zealand. Environmental Entomology 26, 694–702. Barron, M.C., Barlow, N.D. and Wratten, S.D. (2003) Non-target parasitism of the endemic New Zealand Red Admiral Butterfly (Bassaris gonerilla) by the introduced biological control agent Pteromalus puparum. Biological Control 27, 329–335. Bigler, F., Bale, J., Cock, M., Dreyer, H., GreatRex, R., Kuhlmann, U., Loomans, A. and van Lenteren, J. (2005) Guideline on information requirements for import and release of invertebrate biological control agents in European countries. Biocontrol News and Information 26, 115N-123N. Brown, M.W. (2003) Intraguild responses of aphid predators on apple to the invasion of an exotic species, Harmonia axyridis. BioControl 48, 141–153. 12 D. Babendreier et al.

Burgio, G., Santi, F. and Maini, S. (2002) On intra-guild predation and cannibalism in Harmonia axyridis (Pallas) and Adalia bipunctata L. (Coleoptera: Coccinellidae). Biological Control 24, 110–116. Coombs, M. (2003) Post-release evaluation of Trichopoda giacomellii (Diptera: Tachinidae) for efficacy and non-target effects. In: Van Driesche, R.G. (ed.) Proceedings of the 1st International Symposium on Biological Control of Arthropods, Honolulu, Hawaii, 14–18 January 2002. FHTET-2003-05, United States Department of Agriculture, Forest Service, Morgantown, West Virginia, USA, pp. 399–406. De Nardo, E.A.B. and Hopper, K.R. (2004) Using the literature to evaluate parasitoid host ranges: a case study of Macrocentrus grandii (Hymenoptera: Braconidae) introduced into North America to control Ostrinia nubilalis (Lepidoptera: Crambidae). Biological Control 31, 280–295. Denoth, M., Frid, L. and Myers, J.H. (2002) Multiple agents in biological control: improving the odds? Biological Control 24, 20–30. Duan, J.J. and Messing, R.H. (2000) Evaluating non-target effects of classical biological control: fruit fly parasitoids in Hawaii as a case study. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Norwell, Massachusetts, USA, pp. 95–109. EPPO (1997) EPPO/CABI workshop on safety and efficacy of biological control agents in Europe. EPPO Bulletin 27, 1–3. EPPO (1999) First import of exotic biological control agents for research under contained conditions. EPPO Bulletin 29, 271–272. EPPO (2001) Import and release of exotic biological control agents. EPPO Bulletin 31, 33–35. EPPO (2002) List of biological control agents widely used in the EPPO region. EPPO Bulletin 32, 447–461. Follett, P.A., Duan, J.J., Messing, R.H. and Jones, V.P. (2000) Parasitoid drift after biological control introductions: Re-examining Pandora’s Box. American Entomologist 46, 82–94. Gariepy, T.D., Kuhlmann, U., Haye, T., Gillott, C. and Erlandson, M. (2005) A single-step multiplex PCR assay for the detection of European Peristenus spp. (Hymenoptera: Braconidae), parasitoids of Lygus spp. (Hemiptera: Miridae). Biocontrol Science and Technology, 15, 481–495. Gillespie, D.R., Shipp, J.L., Raworth, D.A. and Foottit, R.G. (2002) Aphis gossypii Glover, melon/ cotton aphid, Aulacorthum solani (Kaltenbach), foxglove aphid, Macrosiphum euphorbiae (Thomas), potato aphid, and Myzus persicae (Sulzer), green peach aphid (Homoptera: Aphididae). In: Mason, P.G. and Huber, J.T. (eds) Biological Control Programmes in Canada 1981–2000. CABI Publishing, Wallingford, UK, pp. 44–49. Haye, T. (2004) Studies on the ecology of European Peristenus spp. (Hymenoptera: Braconidae) and their potential for the biological control of Lygus spp. (Hemiptera: Miridae) in Canada. PhD thesis, University of Kiel, Germany. Haye, T., Goulet, H., Mason, P.G. and Kuhlmann, U. (2005) Does fundamental host range match ecological host range of Lygus plant bug parasitoids? A retrospective case study. Biological Control, 35, 55–67. Heimpel, G.E., Ragsdale, D.W., Venette, R., Hopper, K.R., O’Neil, R.J., Rutledge, C.E. and Wu, Z.S. (2004) Prospects for importation biological control of the Soybean aphid: anticipating potential costs and benefits. Annals of the Entomological Society of America 97, 249–258. Hoddle, M.S. (2004) Analysis of fauna in the receiving area for the purpose of identifying native species that exotic natural enemies may potentially attack. In: Van Driesche, R.G. and Reardon, R. (eds) Assessing Host Ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. Forest Health Technology Enterprise Team, Morgantown, West Virginia, USA, pp. 24–39. Howarth, F.G. (1983) Classical biological control: panacea or Pandora’s box. Proceedings of the Hawaiian Entomological Society 24, 239–244. Howarth, F.G. (1991) Environmental impacts of classical biological control. Annual Review of Entomology 36, 485–509. IPPC (1996) Code of conduct for the import and release of exotic biological control agents. Publication No. 3, FAO, Rome, Italy. IPPC (International Plant Protection Convention) (2005) Guidelines for the export, shipment, import and release of biological control agents and other beneficial organisms. International Standards for Phytosanitary Measures No. 3. https://www.ippc.int/servlet/CDSServlet?status=ND0xMz M5OS43NjA0NyY2PWVuJjMzPXB1YmxpY2F0aW9ucyZzaG93Q2hpbGRyZW49dHJ1ZSYzNz1p bmZv#koinfo (accessed 16 November 2005). Current Status and Constraints in the Assessment of Non-target Effects 13

Johnson, M.T., Follett, P.A., Taylor, A.D. and Jones, V.P. (2005) Impacts of biological control and invasive species on a non-target native Hawaiian insect. Oecologia 142, 529–540. Kairo, M.T.K., Cock, M.J.W. and Quinlan, M.M. (2003) An assessment of the use of the Code of Conduct for the Import and Release of Exotic Biological Control Agents (ISPM No. 3) since its endorsement as an international standard. Biocontrol News and Information 24, 15N–27N. Keller, M. (1999) Understanding host selection behaviour: the key to more effective host specificity testing. In: Withers, T.M. and Stanley, J.N. (eds) Host Specificity Testing in Australasia: Towards Improved Assays for Biological Control. CRC for Tropical Pest Management, Brisbane, Australia, pp. 84–92. Kuhlmann, U., Mason, P.G. and Foottit, R.G. (2000) Host specificity assessment of European Peristenus parasitoids for classical biological control of native Lygus species in North America: use of field host surveys to predict natural enemy habitat and host ranges. In: Van Driesche, R.G., Heard, T.A., McClay, A.S. and Reardon, R. (eds) Proceedings: Host Specificity Testing of Exotic Arthropod Biological Control Agents: the Biological Basis for Improvement in Safety. Xth International symposium on Biological Control of Weeds, July 4–14, 1999, Bozeman, Montana. Bulletin, FHTET-99–1, USDA Forest Service Morgantown, West Virginia, USA, pp. 84–95. Lockwood, J.A., Howarth, F.G. and Purcell, M.F. (2001) Balancing Nature: Assessing the Impact of Importing Non-Native Biological Control Agents (an International Perspective). Thomas Say Publications in Entomology, ESA. Lanham, Maryland, USA, 130 pp. Louda, S.M., Pemberton, R.W., Johnson, M.T. and Follett, P.A. (2003) Nontarget effects – the Achilles’ Heel of biological control? Retrospective analyses to reduce risk associated with biocontrol introductions. Annual Review of Entomology 48, 365–396. Lynch, L.D., Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Gao, Z.H., Kuske, S., Loomans, A., Menzler-Hokkanen, I., Thomas, M.B., Tommasini, G., Waage, J.K., van Lenteren, J.C. and Zeng, Q.-Q. (2001) Insect biological control and non-target effects: a European perspective. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, New York, USA, pp. 99–125. Lynch, L.D., Ives, A.R., Waage, J.K., Hochberg, M.E. and Thomas, M.B. (2002) The risks of biocontrol: transient impacts and minimum non-target densities. Ecological Applications 12, 1872–1882. Mansfield, S. and Mills, N.J. (2004) A comparison of methodologies for the assessment of host preference of the gregarious egg parasitoid Trichogramma platneri. Biological Control 29, 332–340. Messing, R.H. (2001) Centrifugal phylogeny as a basis for non-target host testing in biological control: Is it relevant for parasitoids? Phytoparasitica 29, 187–190. Murdoch, W.W., Briggs, C.J. and Nisbet, R.M. (1996) Competitive displacement and biological control in parasitoids: a model. American Naturalist 148, 807–826. NAPPO (2000) Guidelines for petition for release of exotic entomophagous agents for the biological control of pests. Secretariat of North American Plant Protection Organization, Ottawa, Canada. Neuenschwander, P. (2001) Biological control of the cassava mealybug in Africa: A review. Biological Control 21, 214–229. OECD (2003) Guidance for information requirements for regulations of invertebrates as biological control agents. OECD Environment, Health and Safety Publications. Series on Pesticides 21, 22 pp. Reitz, S.R. and Trumble, J.T. (2002) Competitive Displacement among insects and arachnids. Annual Review of Entomology 47, 435–465. Sands, D. (1997) The ‘safety’ of biological control agents: Assessing their impact on beneficial and other non-target hosts. Memoirs of the Museum of Victoria 56, 611–616. Sands, D. (1998) Guidelines for testing host specificity of agents for biological control of arthropod pests. In: Zalucki, M.P., Drew, R.A.I. and White, G.G. (eds). Proceedings of the Sixth Australasian Applied Entomological Research Conference, Volume 1. University of Queensland Press, Brisbane, Australia, pp. 556–560. Sands, D.P.A. and Van Driesche, R.G. (2000) Evaluating the host range of agents for biological control of arthropods: rationale, methodology and interpretation. In: Van Driesche, R.G., Heard, T.A., McClay, A.S. and Reardon, R. (eds) Proceedings: Host Specificity Testing of Exotic Arthropod Biological Control Agents: the Biological Basis for Improvement in Safety. Xth International symposium on Biological Control of Weeds, July 4–14, 1999, Bozeman, Montana. Bulletin, FHTET-99-1, USDA Forest Service Morgantown, West Virginia, USA, pp. 69–83. 14 D. Babendreier et al.

Sands, D.P.A. and Van Driesche, R.G. (2004) Using the scientific literature to estimate the host range of a biological control agent. In: Van Driesche, R.G. and Reardon, R. (eds) Assessing Host Ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. Forest Health Technology Enterprise Team, Morgantown, West Virginia, USA, pp. 15–23. Schellhorn, N.A., Kuhman, T.R., Olson, A.C. and Ives, A.R. (2002) Competition between native and introduced parasitoids of aphids: non-target effects and biological control. Ecology 83, 2745–2757. Simberloff, D. and Stiling, P. (1996) How risky is biological control? Ecology 77, 1965–1974. Symondson, W.O.C. (2002) Molecular identification of prey in predator diets. Molecular Ecology 11, 627–641. Van Driesche, R.G. and Hoddle, M. (1997) Should arthropod parasitoids and predators be subject to host range testing when used as biological control agents? Agriculture and Human Values 14, 211–226. Van Driesche, R.G. and Murray, T.J. (2004a) Overview of testing schemes and designs used to estimate host ranges. In: Van Driesche, R.G. and Reardon, R. (eds) Assessing Host Ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. Forest Health Technology Enterprise Team, Morgantown, West Virginia, USA, pp. 68–89. Van Driesche, R.G. and Murray, T. J. (2004b) Parameters used in laboratory host range tests. In: Van Driesche, R.G. and Reardon, R. (eds) Assessing Host Ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. Forest Health Technology Enterprise Team, Morgantown, West Virginia, USA, pp. 56–67. Van Driesche, R.G. and Reardon, R. (2004) Assessing Host ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. Forest Health Technology Enterprise Team, Morgantown, West Virginia, USA. van Lenteren, J.C., Babendreier, D., Bigler, F., Burgio, G., Hokkanen, H.M.T., Kuske, S., Loomans, A.J.M., Menzler-Hokkanen, I., van Rijn, P.C.J., Thomas, M.B., Tommasini, M.G. and Zeng, Q.-Q. (2003) Environmental risk assessment of exotic natural enemies used in inundative biological control. BioControl 48, 3–38. Wang, X.G. and Messing, R.H. (2002) Newly imported larval parasitoids pose minimal competitive risk to extant egg-larval parasitoid of tephritid fruit flies in Hawaii. Bulletin of Entomological Research 92, 423–429. Whithers, T.M. and Browne, L.B. (2004) Behavioral and physiological processes affecting outcomes of host range testing. In: Van Driesche, R.G. and Reardon, R. (eds) Assessing Host ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. Forest Health Technology Enterprise Team, Morgantown, West Virginia, USA, pp. 40–55. Zilahi-Balogh, G.M.G., Kok, L. and Salom, S. (2002) Host specificity of Laricobius nigrinus Fender (Coleoptera: Derodontidae), a potential biological control agent of the hemlock woolly adelgid, Adelges tsugae Annand (Homoptera: Adelgidae). Biological Control 24, 192–198. 2 Selection of Non-target Species for Host Specificity Testing

Ulrich Kuhlmann,1 Urs Schaffner1 and Peter G. Mason2 1CABI Bioscience Switzerland Centre, Rue des Grillons 1, 2800 Delémont, Switzerland (email: [email protected]; fax number: +41-32-4214871); 2Agriculture and Agri-Food Canada, Research Centre, Central Experimental Farm, Ottawa, Ontario, K1A 0C6 Canada (email: [email protected]; fax number: +1-613-7591701)

Abstract

We present comprehensive recommendations for setting up test species lists for arthropod biological control programmes that are scientifically based and ensure that all aspects of potential direct impacts are considered. It is proposed that a set of categories, including ecological similarities, phylogenetic/taxonomic affinities and safeguard considerations are applied to ecological host range information to develop an initial test list. This list is then filtered to reduce the number of species to be tested by eliminating those with different spatial, temporal and morphological attributes and those species that are not readily obtained, and thus unlikely to yield scientifically sound data. The revised test list is used for the actual testing but can (and should) be revised if new information obtained indicates that additional or more appropriate species should be included. Use of the recommendations is illustrated by a case study on the host specificity of a tachinid fly Celatoria compressa Wulp, a candidate for use as a biological control agent against the western corn rootworm, Diabrotica virgifera virgifera LeConte.

Introduction into new environments have minimal impact on non-target species. Host-speci- Biological control is an environmentally ﬁcity testing of entomophagous biological friendly and highly cost-effective strategy control agents has lagged behind that of for combating pests in agriculture and for- phytophagous biological control agents. In est ecosystems. Despite recent concerns fact, until the warnings by Howarth (1983, about unintended effects, the use of exotic 1991), Lockwood (1993a,b, 2000) and natural enemies against invasive alien Louda et al. (1997), concerns about impacts species in natural and agricultural habitats on non-target species were infrequently remains a key component of integrated pest considered in entomophagous biological management. What has changed during the control projects. Lynch et al. (2001) last decade is the importance of scientiﬁ- reviewed the published and unpublished cally sound decisions for ensuring that European information and determined that exotic biological control agents introduced a mere 1.5% of entomophagous biological ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of Arthropods: Methods and Risk Assessment (eds F. Bigler et al.)15 16 U. Kuhlmann et al.

control agents introduced before 1999 the available information is on parasitoids, appeared to have undergone host speci- the recommendations developed should ficity analyses, thus the extent of informa- apply to other invertebrate groups such as tion on non-target impacts, including arthropod predators and entomopathogenic selection of species to be tested, is limited. nematodes. Selection of appropriate species for testing potential impacts of candidate biological control agents is the first critical step in What can be Learned from Current the process once the need for pest suppres- Practice in Weed Biological Control? sion is justified and one or more potential agents have been identified. Several For more than 30 years, the screening of authors, e.g. Sands (1997, 1998); van the fundamental (= physiological) and the Lenteren et al. (2003), have suggested that ecological host range of candidate biologi- the centrifugal phylogenetic method of cal control agents has been the most crucial Wapshere (1974) should be the primary step in pre-release studies of any weed bio- method used for selecting non-target logical control programme (Harris and species for testing candidate ento- Zwoelfer, 1968; Zwoelfer and Harris, 1971; mophagous biological control agents. Wapshere, 1974). Because of the overriding However, the centrifugal phylogenetic importance of safety, greatest care is taken approach may not always be feasible in selecting appropriate test plants and in because of taxonomic uncertainties and the designing meaningful screening tests to greater number of taxa that could be accurately predict the host specificity of required in testing compared to weeds potential control agents. Host range studies (Kuhlmann et al., 2000). Moreover, other were originally developed to protect agri- parameters such as the feeding niche or the cultural crops from unwanted attack. common habitat of target and non-target While taxonomic relatedness provides a species may be more meaningful, at least starting point, in practice other considera- for certain biological control agents tions, such as inclusion of beneficial (i.e. (Messing, 2001). crop) species and those that are aestheti- In this chapter, we review the current cally important (i.e. species at risk), are practice of developing test plant lists in also considered. weed biological control programmes as a At present, the selection of test plants is basis for discussion, what determines para- based on proposals made by Harris and sitoid host ranges, and review the Zwoelfer (1968) Wapshere (1974) and approaches taken in recent arthropod bio- Wapshere (1989). The aim is to select those logical control programmes. We propose plant species most likely to be hosts of the comprehensive recommendations for set- organism in question, without undue ting up test species lists for arthropod bio- expansion of the test plant list. The basis of logical control programmes that are the standard selection protocol is the cen- scientifically based and ensure that all trifugal phylogenetic method developed by aspects of potential direct impacts are con- Wapshere (1974). This method was based sidered. At the same time, the recommen- on the observation that the host range of dations attempt to take into consideration specialist herbivores is usually restricted to possible practical constraints associated one or a few phylogenetically related plant with arthropod host specificity screening taxa. Recent studies have confirmed this (Sands and Van Driesche, 2000). Use of the pattern for many, but not all, insect herbi- recommendations is illustrated by a case vore groups (Bernays, 2000; Pemberton, study on the host specificity of a tachinid 2000; for groups including biological con- fly, Celatoria compressa, a candidate for trol agents see Dobler, 2001; Ronquist and use as a biological control agent against the Liljeblad, 2001). The centrifugal phyloge- chrysomelid Diabrotica virgifera virgifera netic method involves selecting and testing (Kuhlmann et al., 2005). Although most of plants of increasingly distant phylogenetic Selection of Non-target Species for Host Specificity Testing 17

relationship to the target weed (Wapshere, As noted by Briese et al. (2002), while 1974; Table 2.1). As a safeguard against the centrifugal phylogenetic method claims failure of the centrifugal phylogenetic to be phylogenetically based, it used to be method, Wapshere (1974) proposed adding – and largely still is to date – based on tax- a number of economically important plants onomic circumscription. For example, it is to the test plant list, as well as any plant only recently that comprehensive phyloge- species on which the candidate agent had nies of the species-rich genera Centaurea previously been recorded. In modern weed and Senecio, both of which include inva- biological control programmes, additional sive weeds, and species in the closely plants considered in test plant lists are related genera, have been hypothesized species with phytochemical or morphologi- using molecular data (Garcia-Jacas et al., cal features similar to those of the target 2001; Pelser et al., 2002). host; plants known to be attacked by organ- The number of plant species that should isms closely related to the candidate bio- be included in a non-target list depends logical agent; threatened and endangered mainly on: species in the same family as the target ● The taxonomic position of the target species; and those occurring in the same weed – whether it belongs to an isolated habitat (Table 2.2). family or to a family with close relations.

Table 2.1. Wapshere’s (1974) centrifugal phylogenetic testing method.

Testing Host range determined if plants at that sequence Plants to be tested phylogenetic level remain unattacked

1st Other forms (ecotypes/biotypes) of target species Specific to clone 2nd Other species of same genus Specific to species 3rd Other members of tribe Specific to genus 4th Other members of subfamily Specific to tribe 5th Other members of family Specific to subfamily 6th Other members of order Specific to family

Table 2.2. Plant categories listed in the Reviewer’s Manual for the Technical Advisory Group for Biological Control of Weeds (USDA/APHIS, Plant Protection and Quarantine) for compilation of a test plant list.

Category 1: Genetic types of the target pest species (genotypes, geographic populations, etc.) Category 2: Species in the same genus as the target weed, divided by subgenera (if applicable), including economically and environmentally important plants of North America. Category 3: Species in other genera in the same family as the target weed, divided by subfamily (if applicable), including economically and environmentally important plants of North America. Category 4: Threatened and endangered species in the same family as the target weed, divided by subgenus, genus and subfamily. Category 5: Species in other families in the same order that have some phylogenetic, morphological or biochemical similarities to the target weed, or that share the same habitat, including economically and environmentally important plants of North America. Category 6: Species in other orders that have some morphological or biochemical similarities to the target or that share the same habitat, including economically and environmentally important plants of North America. Category 7: Any plant species on which the biological control agent or its close relatives (within the same genus) have previously been found or recorded feeding and/or reproducing. 18 U. Kuhlmann et al.

● The number of closely related cultivated tion on the host affiliation. While these plants, and other-valued wild plants. practices have been developed over time for ● The geographic and/or ecological isola- weed biological control, in arthropod bio- tion of the release area. logical control other factors may determine ● Whether or not the candidate biological the parasitoid host range. These factors will control organism belongs to a systematic be outlined in the following section. group which is known to be restricted to a small group of closely related plants (genus, subtribe and tribe). What Determines Parasitoid Host Range? In recent examples of host range determination, the number of plant species screened Our knowledge of parasitoid host ranges is ranges from 40 to more than 100. In host based primarily on associations made plant lists of modern weed biological control through rearing a limited number of host projects, unrelated plant species sharing species. The number of studies exploring conspicuous secondary metabolites or mor- the evolutionary and ecological determi- phological characters are represented to a nants of host use in parasitoids is growing certain extent, but it is usually not known (e.g. Hawkins, 1994; Hawkins and whether the characters selected are indeed of Sheehan, 1994), yet for most groups we relevance in the host selection behaviour of have limited information on the relative the candidate weed biological control agent. importance of host habitat, processes of To increase the chances of detecting disjunct host location, physiological interactions oligophagy, one needs to elucidate the cues with hosts, host defences or host phyloge- used by the candidate species in selecting netic history in influencing parasitoid host and accepting host plants (Schaffner, 2001). ranges (Stireman and Singer, 2003). In a recent review of the relevance of the Documenting parasitoid host range is far criteria set up by Wapshere (1974), Briese et more difficult than collecting data on host al. (2002) argued that none of the safeguard parasitoid species load because it involves criteria has generated additional insight into rearing parasitoids to the adult stage for the results obtained by applying the cen- identification from many different species trifugal phylogenetic method. Briese et al. of hosts rather than rearing or dissecting (2002) therefore recommended dropping many individuals of a single host species. these safeguard criteria to reduce costs of Existing data are of two main types: large pre-release studies. However, host range catalogues of known host associations, fre- testing with the agromyzid fly Napomyza quently, although not always, concerned sp. near lateralis in a biological control pro- with selected taxonomic groups of para- ject against Russian knapweed, Acroptilon sitoids and very seldom including any repens (L.) de Candolle, revealed that the quantitative information; and food webs only plant species outside the knapweeds containing information on all parasitoids (genera Acroptilon and Centaurea) found to attacking a restricted range of hosts, often be both within the fundamental and ecologi- in a single geographical area (Memmott cal host ranges of this species is the dis- and Godfray, 1993). Information from host tantly related host plant of a sibling catalogues must be treated with extreme agromyzid species (U. Schaffner, Delémont, caution (Askew and Shaw, 1986; Noyes, 2004, unpublished results). Since the addi- 1994). The difficulties of parasitoid taxon- tion of a few safeguard species, e.g. in no- omy, plus the risk of erroneous parasitoid- choice feeding bioassays, usually does not host associations, render many large cause major additional costs in weed biolog- catalogues almost useless for ecological ical control programmes, further inclusion studies, but exceptions occur where of safeguard species may be scientifically experts have at least carefully scrutinized and politically justified, despite the fact that host records in the literature (e.g. Boucek they rarely contribute to additional informa- and Askew, 1968; Griffiths, 1964–1968). Selection of Non-target Species for Host Specificity Testing 19

No parasitoid successfully parasitizes idiobiont ectoparasitoids) and species that all hosts in the environment, and species attack non-growing host stages. The first that are attacked by the same parasitoid group should be relatively specialized and share certain characteristics. The two most their host range will be strongly influenced important determinants of host range are by host taxonomy. The last group should most probably host taxonomy and shared be less specialized and their host range ecology (Askew and Shaw, 1986; Shaw, will be influenced by both host taxonomy 1988). The correlation between host taxon- and host ecology. Thus: omy and parasitoid range has been demon- ● Koinobionts should have fewer hosts strated on numerous occasions (e.g. Askew, than idiobionts. 1961; Griffiths, 1964–1968) and these cor- ● Pupal and egg and adult parasitoids relations can arise for at least two reasons. should be less specialized than larval First, parasitoids may attack closely related parasitoids (Strand, 1986). hosts because they share similar physiolog- ● The koinobiont parasitoids of taxonomi- ical properties and defence mechanisms. cally isolated hosts should attack few Second, closely related parasitoids are other species. likely to be biologically similar, for exam- ● The idiobiont parasitoids of ecologically ple, they are more likely to feed on hosts isolated hosts should attack few other using the same host plant or to have simi- species. lar feeding niches. The importance of shared ecology is best illustrated by exam- Idiobiont larval parasitoids more often ples of unrelated hosts of parasitoids that attack hosts in concealed feeding niches share host plants or feeding niches and are where death or permanent paralysis is less attacked by the same parasitoid. Hosts that likely to increase the risk of predation feed on the same food plant frequently (Hawkins, 1990). There will be numerous share the same parasitoids (e.g. Vinson, exceptions to the broad generalizations set 1981, 1985; Fitton et al., 1988). Plant up by Godfray (1994). For example, many chemistry may influence parasitoid host tachinid flies are koinobiont endopara- range if hosts sequester toxins from their sitoids, yet can subvert the host immune food plants. Chemical similarity is known system of a wide variety of species and to influence polyphagy at the herbivore thus enjoy a remarkably broad host range trophic level, and chemical diversity has (Belshaw, 1994). The suggestion that koino- been linked with host range (e.g. Strong et bionts have broader host ranges than idio- al., 1984), including semiochemicals bionts has some empirical support. In released when the plant is damaged by her- surveys of parasitoids of lepidopteran and bivore hosts (e.g. Godfray, 1994). hymenopteran leafminers, Askew and Hoffmeister (1992) surveyed the para- Shaw (1986), Pschorn-Walcher and sitoids attacking seven races or species of Altenhofer (1989) and Sato (1990) all tephritid fly feeding in the fleshy seeds of a observed more restricted host ranges variety of trees, shrubs and climbers in among idiobionts than among koinobionts. Europe. He found that host ecology, The importance of shared ecology broadly defined as phenology, feeding should not be overemphasized. There are habitat and host plant taxonomy, was more many examples of parasitoids that attack important than host taxonomy in determin- one or a few closely related hosts in a wide ing the make-up of the parasitoid complex. variety of habitats (e.g. Price, 1981). Based on Godfray (1994), some predic- Futuyma and Moreno (1988) reviewed a tions can be made about the relative host variety of macroevolutionary aspects of par- ranges of parasitoid species with an inti- asitoid host range. In some taxa, particular mate biochemical and physiological con- specializations appear to be taxonomically nection with their hosts (larval koinobiont conserved: all Eucharitidae parasitize ants; endoparasitoids), species that do not have the complete Opiinae and Alysiinae clade to contend with active host defences (larval (Braconidae) are restricted to cyclorraphous 20 U. Kuhlmann et al.

Diptera; and the ichneumonid subfamily into five categories: ecological, phyloge- Ichneumoninae and the braconid subfamily netic, socio-economic, biological and avail- Microgasterinae parasitize only Lepidoptera ability of test species (Table 2.3). Many (Futuyma and Moreno, 1988). In other studies state the reasons behind selection groups, for example the Eulophidae and of the test species, and all but three studies Pteromalidae, nearly all species parasitize a used at least two of the categories in their restricted set of hosts, yet the clade is not selection. The numbers of non-target committed to any particular host group. species tested in the laboratory ranged Generalism also may be phylogenetically from one to 23 (average 10.5). Although conserved. The braconid genus Dacnusa is Rutledge and Wiedenmann (1999) and comprised of many species specialized on Bourchier (2003) did not actually do any particular agromyzid leaf miners, but the testing, both provided important ideas for few species with wide host ranges are selecting test species. Phylogenetic consid- closely related (Godfray, 1994). erations were based on taxonomic related- In summary, although determining para- ness (e.g. same genus, same family, etc.) of sitoid host ranges is plagued with difficul- test species to target host. Ecological fea- ties (Shaw, 1994), it appears that most tures included overlaps of geographic parasitoids attack a narrow range of hosts range, habitat preference and feeding niche (Memmott et al., 2000). The two principal of species representing different compo- factors that limit host ranges in parasitoids nents of the community. Biological charac- are thought to be taxonomic relatedness of teristics included known host range, hosts and host ecology. The effect of host phenological overlap of the target and non- taxonomic affinity is believed to be related target species, dispersal capability of the primarily to physiological (and morpholog- candidate biological control agent (and par- ical) defences of hosts that may require asitized host), morphological similarity, specific adaptations of their parasitoids behavioural factors (e.g. feeding, oviposi- (Vinson and Iwantsch, 1980; Godfray, tion, host location, etc.) and overlap of the 1994). The proposal that physiological physiological host range of biological con- defences limit parasitoid host ranges is trol agents. Socio-economic factors analogous to arguments concerning the included whether a potential test species importance of secondary chemicals in the was commercially important (e.g. a pollina- specialization of phytophagous insects on tor), beneficial (e.g. predator, weed biologi- food plants (Ehrlich and Raven, 1964). cal control agent) or of conservation Ecological characteristics that influence importance (e.g. rare or endangered). The host use by parasitoids include the plants availability of non-target material was con- on which a host feeds (Vinson, 1981; sidered, and sources included commercial Askew, 1994), the microhabitat in which it or laboratory cultures, field collections and feeds (Weseloh, 1993), the host’s phenology progeny of field-collected individuals. In (Askew, 1961) and the host and parasitoid most examples literature records provided mobility (Barratt, 2004). Thus, parasitoid important guidance on at least broad host range is determined by biological and groups, habitats or biological parameters. ecological factors, often, but not always, In one case, surveys by Fuester et al. (2001) associated with related host species. in the area of origin of the target species provided information on actual host range that was useful for selecting test lists. What Methods Have Been Used So Sands et al. (1993) studied the host Far for Selecting Non-target Species range of Cotesia erionotae (Wilkinson) in Arthropod Biological Control? (Hymenoptera: Braconidae), a parasitoid of the banana skipper Erionota thrax (L.) A review of some recent studies suggests (Lepidoptera: Hesperiidae). One non-target that in practice, criteria for selecting non- species in the same family as the banana target species for testing can be divided skipper and three species that were consid- Selection of Non-target Species for Host Specificity Testing 21 (2003a,b) (2003c) (2003d) (2000) (2001) et al. et al. et al. (1997, 1998, (1997) (2000) et al. et al. et al. et al. ological control agents for et al. Fuester Mansfield and Mills (2002) Munro and Henderson (2002) Babendreier st species. (2000) Boettner (1995) – (1997, 1998, Barratt (1997) Duan (2000) Orr et al. et al. et al. et al. et al. Kitt and Keller (1998) Kitt and Keller (1998) Orr (2003a,b) Babendreier (2000) Boettner (2003) (1995) Andow et al. (1997, 1998, Barratt (1993) (1995) (1997) Duan et al. et al. et al. et al. et al. et al. et al. Andow Benson (2003c) Babendreier et al. (1997, 1998, Barratt (1993) Sands (1995) Neale (1997) Duan et al. et al. et al. et al. Babendreier Sands (2003a,b) Babendreier (2003d) (2000) Boettner (2001) et al. et al. (1997, 1998, Barratt (1997) Duan Review of some recent studies suggests that, in practice, criteria for selecting non-target species testing invertebrate bi . (1995) Neale et al. et al. et al. et al et al. 2000) 2000) 2000) 2000) 2000) (1999) 1997) 1997) 1997) 1997) 1997) Fuester Munro and Henderson (2002) Bourchier (2003)Babendreier Bourchier (2003) Bourchier (2003) Kitt and Keller (1998) Rutledge and Wiedenmann Porter (2000)Boettner Porter (2000) Porter (2000) Babendreier Cameron and Walker (1997)Cameron and Walker Barratt (1997) Cameron and Walker (1997) Cameron and Walker Duan and Messing (1996, Duan and Messing (1996, Duan Duan and Messing (1996, Duan and Messing (1996, Duan and Messing (1996, Neale Ecological Phylogenetic Table 2.3. Table arthropod pests can be divided into five categories: ecological, phylogenetic, socio-economic, biological and availability of te similarity affinity Socio-economic Biological Availability 22 U. Kuhlmann et al.

ered of commercial value were selected. on a suite of criteria. These included: gall Although not stated, it appears that test size and shape or feeding niche (of the tar- individuals were obtained commercially or get and non-target species); relatedness of field-collected. The results indicated that parasitoid species attacking target and non- none of the non-target species would be target hosts in the field; and shape of the attacked. parasitoid ovipositor and specialized Andow et al. (1995) developed a hypo- searching behaviour. One of the non-target thetical analysis of risks to non-target species studied was a native species col- Lepidoptera after release of Trichogramma lected in the field, and the other was a nubilale Ertle and Davis (Hymenoptera: weed biological control agent that was Trichogrammatidae) for control of Ostrinia obtained from an established culture. nubilalis Hübner (Lepidoptera: Cram- These studies showed that fruit shape, size bidae). Selection of the non-target Karner and colour are essential stimuli to elicit Blue Butterfly, Lycaeides melissa samuelis oviposition by the candidate parasitoids Nabakov, as a test species was based on and that these species would only attack endangered status, spatial occurrence, fruit fly hosts that live in fruit or fruit-like known host range of the agent, phenologi- structures; non-target hosts in a different cal overlap of the target and non-target feeding niche were not impacted by the species, dispersal of the biological control biological control agents. agent and mortality of the agent during dis- Cameron and Walker (1997) studied the persal. Their analysis indicated that popu- host specificity of Cotesia rubecula lations of L. m. samuelis were unlikely to (Marshall) and Cotesia plutellae Kudjumov be reduced by inundative introductions of (Hymenoptera: Braconidae), parasitoids of T. nubilale. Pieris rapae L. (Lepidoptera: Pieridae) and Neale et al. (1995) developed a non- Plutella xylostella (L.) (Lepidoptera: target test list for assessing one encyrtid Plutellidae). Initial selection of non-target and two eulophid larval parasitoids of the species for host specificity testing was citrus leafminer, Phyllocnistris citrella based on literature records and field collec- Stainton (Lepidoptera: Gracillaridae) in tions of Lepidoptera from Brassica spp. Australia. Although not stated, the test and Urtica dioica DC in areas where C. species were probably chosen based on rubecula and C. plutellae were abundant in ecological, phylogenetic and socio- New Zealand and Fiji. The test list was economic criteria. Twelve non-target refined using behavioural data on host Lepidoptera species belonging to five fami- plant attractiveness to each parasitoid lies were selected; these were mainly species. These studies determined that C. leafminers and gallformers, and included rubecula was highly specific to P. rapae. In the single native Australian representative contrast, despite being more attracted to of Phyllocnistris and several weed biologi- species associated with cabbage volatiles, cal control agents. Three gall-forming and C. plutellae attacked all species tested, and one leaf-mining fly species and a single successfully developed in ten of the 14 leaf-mining beetle species were also non-target species. included. The outcome of host range test- Barratt et al. (1997, 1998, 2000) studied ing indicated that the parasitoids were spe- host specificity of two braconid parasitoids, cific to the target species. Microctonus aethiopoides Loan and Duan and Messing (1996, 1997) and Microctonus hyperodae Loan (Hymenoptera: Duan et al. (1997) studied the potential Braconidae), of the adult Sitona discoideus non-target impacts of Dichasmimorpha Gyllenhal and Listronotus bonariensis longicaudata (Ashmead), Dichasmimorpha (Kuschel) (Coleoptera: Curculionidae), tryoni (Cameron) and Psytallia fletcheri important forage pests in New Zealand. (Sivestri) (all Hymenoptera: Braconidae), They conducted field surveys (Barratt et al., introduced for fruit fly control in Hawaii. 1998) of native Curculioniodea to determine Two non-target species were selected based which phylogenetic, ecological and behav- Selection of Non-target Species for Host Specificity Testing 23

ioural affinities could be used to develop a Boettner et al. (2000) studied the non- test list. Of the 85 Curculionoidea species target effects of the tachinid Compsilura found, 11 were selected, and test material concinnata (Meigen) (Diptera: Tachinidae), was collected from the field. A combina- introduced for control of the gypsy moth tion of phylogenetic and known host range Lymantria dispar (L.) (Lepidoptera: information on M. aethiopoides and M. Lymantriidae), and 12 other pest species, hyperodae was used to determine which including the saturniid moth Hemileuca non-target species would potentially be at oliviae Cockerell. Based on the knowledge greatest risk. Additional pest and benefi- that C. concinnata has a very broad host cial (weed biological control agents) range (>180 native North American species related to the target species found Lepidoptera spp.), non-target hosts selected in the surveys were included. Further cri- for study were species of the same family teria included similarities in feeding, sea- (Saturniidae) as the target, species that feed sonal abundance and activity patterns. on plants found in the same habitat (oak Parasitoid behaviour patterns were also forest) as the main target species and those studied to determine if oviposition activi- were obtainable from culture. An addi- ties coincided with active cycles of poten- tional, threatened, non-target species was tial non-target hosts. Laboratory results collected by chance in the study habitat suggested that M. aethiopoides success- and was incorporated into the project. fully developed in nine of 12, and M. These authors found that C. concinnata hyperodae in four of 11 species tested. was responsible for significant parasitism Field studies confirmed that M. (36% to 81%) of the three non-target aethiopoides parasitized a broader range of species studied. species than did M. hyperodae. Orr et al. (2000) studied host specificity Kitt and Keller (1998) carried out tests of Trichogramma brassicae Bezdenko on host plant preferences of the aphid (Hymenoptera: Trichogrammatidae) and parasitoid Aphidius rosae Haliday used biological and ecological criteria to (Hymenoptera: Aphidiidae). Results determine which non-target species to showed that only non-target aphids on include in evaluations. Based on dispersal roses, the habitat utilized by the target behaviour, they determined that Macrosiphum rosae (L.) (Hemiptera: Lepidoptera species found in the target Aphididae), would be at risk, thereby habitat (maize) and adjacent habitats were reducing the list of non-target species to the most appropriate for host range test- test. Species tested included those col- ing. Furthermore, only those Lepidoptera lected in sufficient numbers from glass- species where eggs were present during houses and from the field. They concluded periods of T. brassicae release were con- that A. rosae would successfully attack sidered to be potentially vulnerable. Orr only the target, M. rosae. et al. (2000) collected and identified Rutledge and Wiedenmann (1999) tested Lepidoptera species and estimated their the response of Cotesia flavipes Cameron, flight period from museum collection Cotesia sesamiae (Cameron) and Cotesia data. Flight periods from 22 species over- chilonus (Matsumura), braconid para- lapped with T. brassicae release periods, sitoids of stem-boring pests of gramina- and progeny from field-collected material ceous plants. Although no non-target were used for further testing. The authors testing was conducted, biological charac- noted that species not attracted to light teristics of the parasitoids and responses to traps or not abundant may have been a range of host and non-host plant volatiles missed, particularly rare species. Of the were used as a theoretical basis for select- 22 species tested in the laboratory, 11 ing non-target species. It was concluded were found to be highly suitable hosts for that for certain parasitoids, testing plant T. brassicae, but in the field, parasitism of preferences could help determine their these same non-target species was very ecological host range. low, often zero. 24 U. Kuhlmann et al.

Porter (2000) examined the host speci- neri successfully emerged from six of 12 ficity of Pseudacteon curvatus Borgmeier Lepidoptera species and the neuropteran, (Diptera: Phoridae) as a biological control Chrysoperla carnea Stephens. These agent for the fire ants Solenopsis invicta authors also concluded that larger eggs are Buren and Solenopsis richteri Forel generally better hosts for T. platneri. (Hymenoptera: Formicidae) in the southern Munro and Henderson (2002) evaluated United States and used phylogenetic and the tachinid Trigonospila brevifacies biological information to develop a list of (Hardy) a parasitoid of the fruit crop non-target species for testing. Information tortricid Epiphyas postvittana Walker. on the candidate agent indicated that only Community-level interactions were consid- Formicidae were attacked by Pseudacteon ered when selecting non-target test species, spp., that the ovipositor of this group was and the list was narrowed down to species highly specialized and that host size was a in families (Tortricidae and Oecophoridae) factor, thus limiting the ability to parasitize known to be hosts of the tachinid para- other organisms. Material was collected sitoid. Test candidates were field-collected from the field for the 19 species tested. in the forest community. Results showed Results confirmed that P. curvatus will only that T. brevifacies was more abundant in develop in Solenopsis spp., and parasitism the field than all native parasitoids col- of two native species tested was consider- lected, and parasitized more species than ably less than for the target species. did native New Zealand tachinid species. Fuester et al. (2001) studied the host Benson et al. (2003) examined the range of Aphantorhaphopsis samarensis impact of Cotesia glomerata and C. rubec- (Villeneuve) (Diptera: Tachinidae), a candi- ula parasitoids of P. rapae on non-target date for biological control of gypsy moth in Pieris spp. Phylogenetic information and North America. Ecological and biological ecological information were used to deter- information, such as habitat and life his- mine the species to be tested. The results tory overlap, were considered in the selec- indicated that neither of the two non-target tion of non-target species. Field studies in species Pieris virginiensis Edwards and the area of origin provided information on Pieris napi (Scudder), nor the target species the realized host range of A. samarensis. Of P. rapae, were attacked in the habitat occu- the 54 species collected in 11 families of pied by P. virginiensis. Lepidoptera no A. samarensis emerged. Bourchier (2003) developed a list of Progeny of field-collected individuals (11 butterfly species that are potentially at risk species from ten lepidopteran families) if Trichogramma minutum Riley were to be were primarily used in laboratory tests, mass-released in maize against Ostrinia although it was not stated from which nubilalis Hübner in Canada. Using recent habitats these species were collected. Only taxonomic information and an existing one non-target species, one of two database of 153 species he considered eco- Lymantriidae tested, was successfully para- logical and biological attributes (geographic sitized by A. samarensis. distributions, oviposition, phenology, num- Mansfield and Mills (2002) evaluated ber of generations per year, overwintering the host range of Trichogramma platneri stage, host-plant preferences and egg-mass Nagarkatti for control of Cydia pomonella type and location) to establish known host L. (Lepidoptera: Tortricidae). They consid- ranges of Trichogramma spp. Most species ered ecological and biological criteria (e.g. were excluded from the list because of mis- known hosts, novel hosts and host egg match in the geographic distributions and characteristics) to develop a list of non- oviposition phenology, and some species target species for testing. From this list, were excluded because their biology was commercially available species and labora- less known. This served as a baseline for tory cultures that could be easily obtained selecting a manageable number of non- were chosen for testing. The results indi- target insects that should be subjected to cated that of the 17 species tested, T. plat- host range testing. Bourchier (2003) sug- Selection of Non-target Species for Host Specificity Testing 25

gested that these non-target host selection considerations and on availability of test criteria should be generally applied to material. Representative groups occurring in inundative and classical biological control the target habitat were chosen and species agents. Like Orr et al. (2000), Bourchier that were commercially available were (2003) noted the difficulty of obtaining rare tested. Two of the four non-target predators species, especially those on the ecological were successfully parasitized at high levels vulnerability list. in the laboratory, but under field conditions Babendreier et al. (2003a,b) conducted the levels of parasitism were very low and laboratory and field risk assessment studies significantly less than for control species. for T. brassicae using an approach similar In summary, a variety of strategies has to Bourchier (2003), considering ecological been used to select species for non-target information, habitat and temporal overlap host tests. Although phylogenetic consider- of non-target hosts and the biological con- ations were an underlying criterion (i.e. trol agent to select species for testing. For that a particular parasitoid group attacks field tests, availability was used to deter- certain host groups), ecological, biological mine the list of non-target species. These and socio-economic information was very authors focused on butterflies as non-tar- important for selecting non-target species gets because their biology was better for study. Availability of test material was known, and also because butterfly biodi- also critical for selection of non-target test versity is of great concern in conservation species in most studies. biology. The list of 23 non-target lepidopteran species included nine species on the endangered species list in Switzerland. All species were tested in the laboratory Recommendations for Selecting a (Babendreier et al. (2003a)) and successful Species List for Host Specificity parasitism was documented for 17 of the Testing using Invertebrates in 23 species. Of the six species tested under field-cage conditions (including two Biological Control of Arthropods species on the endangered list), all were parasitized by T. brassicae, though only at It is apparent that the criteria used in weed low levels. A field study with two non-tar- biological control are unlikely to provide get species revealed that both were para- all the necessary information that would sitized at up to 2 m from the release point enable development of a meaningful non- but parasitism at 20 m was zero. The work target test list for entomophagous biologi- of Babendreier et al. (2003a,b) marks the cal control agents. Arguments that have first instance that rare butterfly species been brought forward in support of this have been included in host specificity test- include: ing of biological control agents of arthro- ● Arthropods often outnumber plant pods. species in communities by an order of Babendreier et al. (2003c) studied the magnitude (e.g. Kuhlmann et al., 2000; potential of T. brassicae to overwinter in Messing, 2001). eggs of non-target Lepidoptera. ● There is a significant lack of knowledge Phylogenetic information, representatives of arthropod phylogeny (e.g. Sands and of several lepidopteran families and avail- Van Driesche, 2000; Messing, 2001). ability of test material were used to select ● Natural enemies of arthropod pests the non-target species studied. T. brassicae respond to two trophic levels, i.e. the successfully overwintered in all of the six host and its host plant(s) (e.g. Godfray, species tested. 1994). Babendreier et al. (2003d) studied the ● Disjunct host ranges appear to be the impacts of T. brassicae on predators associ- rule with parasitoids, rather than the ated with maize. In this work non-target exception as in herbivores (Messing, species were selected based on ecological 2001). 26 U. Kuhlmann et al.

● The fact that it is much more difficult control agent (Hopper, 2001). Within the first and time consuming to rear a large num- step, the ecological (or realized) host range of ber of test arthropod species than test the candidate species should be assessed plant species (Kuhlmann et al., 1998; through carefully planned field studies of Sands and Van Driesche, 2000). the parasitoid–host complexes in the area of origin of the candidate biological control A central question with regard to the selection of test species is whether the host agent. Knowledge of the host species range of parasitoids considered for use in attacked by the candidate agent and its close biological control programmes is restricted relatives in the native range will facilitate to one or a few closely related groups of the selection of appropriate test species for herbivorous insects, or whether phyloge- host range testing in the proposed area of netic disjunction in host range, i.e. a host introduction (Kuhlmann et al., 2000; range that includes phylogenetically unre- Kuhlmann and Mason, 2003). In addition, lated species, is the rule, rather than the comparable field studies in the area of intro- exception. There seems to be consensus duction would generate valuable insight into among arthropod biological control scien- which herbivore species would be exposed tists that phylogeny is a valuable starting to the candidate biological control agent, point for predicting and assessing the host both in space and time. If little is known range of parasitoids but that other criteria about the target pest (see Barratt, 2004), ini- (e.g. ecological similarities and safeguard tial studies need to be carried out to develop considerations) are also of high relevance, the information required for selection of even more so than in host range assessment appropriate non-target test species. of herbivores. Thus, the selection of non- Based on the knowledge of the ecologi- target test species has to be carried out on a cal host range of the candidate biological case-by-case basis. control agent in its native range, an initial Recent studies to determine the host test species list should be established. We range of candidate entomophagous biologi- propose that this list be compiled by select- cal control agents have used an array of cri- ing species from three different categories, teria to develop lists of species for testing which need not be followed in any particu- the agent’s host range, as shown above in lar sequence: the review of methods used to date. Category 1: However, there is currently no standard Ecological Similarities: Species which live protocol which has been developed for test in the same/adjacent habitat (e.g. on arable species selection. land and adjacent field margins) or feed in Here, we provide recommendations for the same microhabitat (e.g. on same plant developing a test list for host specificity of species, or in galls) as the target species; entomophagous arthropods (Fig. 2.1). As a first step, the information available on the Category 2: recorded field hosts of the candidate biologi- Phylogenetic/Taxonomic Affinities: Species cal control agent, as well as of closely related which are taxonomically/phylogenetically species, should be collected (see De Nardo related to the candidate biological control and Hopper, 2004). Although literature agent (according to modern weed biologi- reports or museum collections are important, cal control programmes); this information should be viewed with cau- Category 3: tion, and the quality of the data assessed Safeguard Considerations: ‘Safeguard with a taxonomic expert. Also, it should be species’, which are either beneficial insects noted that host records tend to be primarily (e.g. pollinators, other biological control from agricultural and forest habitats and agents) or rare and endangered species that from economically more important species. belong to the same family or order. There is general consensus that experiments Additionally, host species of congeneric are required to thoroughly determine the species of the candidate biological control ecological host range of a potential biological agent could be selected when appropriate. Selection of Non-target Species for Host Specificity Testing 27

Ecological Host Range Information

Category 1: Category 2: Category 3: Ecological Phylogenetic/ Safeguard Similarities Taxonomic Considerations Affinities

Initial Test List

Filter 1: Spatial, Temporal and Morphological Attributes

Filter 2: Accessibility and Availability

Revised New Test List Information

Host Specificity Testing

Fig. 2.1. Recommendations for the selection of non-target species for a test list to be applied in host speciﬁcity testing of invertebrates for biological control of arthropods.

Depending on the information available, to grow plant species. Collection of suit- one may prioritize in the test list either able stages of test species may be possible, species related to the target host or species but requires evidence that the collected that feed in the same microhabitat. Priority stages are not already parasitized or dis- should be given to selecting species that eased. Holding field-collected individuals are associated with more than one category. for non-target testing in a laboratory The initial list may consist of 50 or colony is recommended to ensure that any more test species and may be comparable field parasitism or natural disease runs its to the final test plant list in a weed biolog- course. Sands (1997) stated that testing of ical control programme. However, it is more than ten species of non-target arthro- much more laborious and time-consuming pods may be impractical and often unnec- to rear 50 or more insect species than it is essary. Further, Sands (1998) suggested 28 U. Kuhlmann et al.

that carefully designed tests on a few ered during the pre-release studies may species related to the target will provide lead to scientifically based justification for adequate information relating to the host removal or addition of test species. Such a specificity of candidate agents. We there- scenario is also applied in weed biological fore propose reduction of the list of test control programmes. In North America, test species by filtering out those species with plant lists that have been submitted to and attributes which do not overlap with approved by the Technical Advisory Group those of the target species. Attributes that at the beginning of a programme may be may lead to a species being discarded subject to well-founded revision during from the test list are non-overlapping geo- later stages of the pre-release studies. graphical distribution, different climate However, we believe that this reiterative requirements, phenological asynchroniza- process is of greater relevance in arthropod tion or host size which is outside the biological control programmes because of range that is accepted by the candidate the need to keep the test list as short as biological control agent (Filter 1 in Fig. possible, while still providing a reliable 2.1). The latter attribute can be tested by host range profile for the candidate biologi- offering target species or other host cal control agent. species of different size classes to the candidate biological control agent. Other attributes may be investigated by studying Selection of Non-target Species for a the herbivore complex that inhabits the Test List: a Case Study area into which the candidate biological control agent is to be released. Some of Celatoria compressa, an adult parasitoid of the species remaining in the test list are species in the subtribe Diabroticina in not available or accessible in large enough North America, was selected as a candidate numbers and they should not be consid- for classical biological control of ered for host specificity testing as an ade- Diabrotica virgifera virgifera (Coleoptera: quate number of replicates cannot be Chrysomelidae: Galerucinae) in Europe. conducted (Filter 2 in Fig. 2.1). In the case Prior to its potential release, host speci- of rare and endangered species considera- ficity testing was conducted to evaluate the tion can be given to testing congenors as potential impacts of C. compressa on surrogates. European indigenous Coleoptera species. The revised test species list may then The non-target species selection recom- include some ten to 20 test species. mendations described above were applied Although this revised list would be appro- to select appropriate indigenous non-target priate for starting host specificity testing, it species for host specificity testing of C. should not necessarily be considered as the compressa under quarantine conditions. final test list. Results from ongoing host specificity testing and parallel studies that aim to assess the chemical, visual and tac- Ecological host range information tile cues emitted by the host or its host- plant(s), and involved in the agent’s Information was compiled about the host-selection behaviour, may shed new known field host ranges of Celatoria light on which non-target species may be at species, such as C. compressa, C. bosqi risk of being attacked by the candidate bio- Blanchard, C. diabroticae (Shimer) and C. logical control agent. We therefore propose setosa (Coquillet), based on published that the revised test species list should be host–parasitoid rearing records from North, periodically revisited during the pre- Central and South America. release studies of arthropod biological con- Based on literature records, the known trol programmes (indicated by the feedback ecological host range of the three better- loop in Figure 2.1). New information gath- known Celatoria species (C. bosqi, C. diabroticae and C. setosa) is restricted to the Selection of Non-target Species for Host Specificity Testing 29

subtribe Diabroticina within the tribe piercing ovipositor to successfully para- Luperini of the subfamily Galerucinae. sitize hosts. Therefore, it is likely that Celatoria bosqi, present in South America, Celatoria species have a high degree of is known to parasitize Diabrotica speciosa host specificity compared to many other (Germar) (Blanchard, 1937; Heineck-Leonel tachinids due to the elaborately modified and Salles, 1997), D. sp. nr. fulvofasciata piercing ovipositor (Belshaw, 1994; J. Jacoby and D. viridula (F.) (G. Cabrera O’Hara, Ottawa, 2000, personal communi- Walsh, Buenos Aires, 2003, personal com- cation). Based on these findings, the selec- munication) and the chrysomelid tion of non-target coleopteran species for Cerotoma arcuata Olivier (Magalhães and testing should be limited to the family Quintela, 1987). The ecological host range Chrysomelidae. from the North American C. diabroticae is restricted to D. undecimpunctata howardi Ecological similarities (Category 1) Barber, D. undecimpunctata undecimpunctata Mannerheim, D. longicornis (Say) and Literature records were used to compile a D. v. virgifera (Fisher, 1983). Although list of the Coleoptera species which occur recorded hosts of the North American C. in selected European agricultural habitats setosa include Diabrotica species (Arnaud, such as maize (Zea mays L.), lucerne 1978), field and experimental data indi- (Medicago sativa L.), pumpkin (Cucurbita cated that it was almost exclusively a para- maxima Duch.), wheat (Triticum aestivum sitoid of Acalymma species, such as the L.) and sunflower (Helianthus annuus L.), chrysomelids Acalymma blandula as well as in adjacent field margin habitats. LeConte, A. trivittata (Mannerheim) and A. These habitats were selected because they vittata (F.) (Fischer, 1981, 1983). are commonly present in the area invaded As ecological host range information by the target. about C. compressa was mostly not avail- A total of 185 coleopteran species able, field host range surveys were carried (belonging to 14 families) were found to be out in Mexico, the area of origin. Celatoria associated with these selected habitats in compressa was found to only parasitize D. Europe. From these 185 species, three v. virgifera, D. balteata LeConte, D. por- Galerucinae, 22 Alticinae, six racea Harold, D. scutellata Baly, D. tibialis Chrysomelinae, five Criocerina and two Baly, D. viridula, Acalymma blomorum Cassidinae species (all in the family Munroe and Smith, A. fairmairei (F.), A. Chrysomelidae) were included (in total, 38 innubum (F.), A. trivittata, Gynandrobrotica species for the initial test list). With regard to spp. and Cerotoma atrofasciata Jacoby species living in the same microhabitat (Eben and Barbercheck, 1996; A. Eben, (same host plant) no obvious candidates Xalapa, Mexico, 2003, personal communi- were found but the cereal leaf beetle, cation). Oulema melanopus (L.), which occasionally The information on the ecological host feeds in the same microhabitat (maize), and range provided evidence that C. bosqi, C. has been considered in the selection process. diabroticae and C. setosa, as well as C. compressa, are highly specialized. Thus, Phylogenetic/Taxonomic affinities most probably all species in the genus (Category 2) Celatoria parasitize only adults of single or related genera within the subfamily The phylogenetic relationship of the non- Galerucinae (most probably at the tribe target species to the target was checked to level of Luperini), or Alticinae in the fam- ensure that European species of related ily Chrysomelidae (see Cox, 1994 and pub- subfamily, genera or subtribes of the target lications mentioned above). Additionally, were added to the non-target list. In addi- it was reported by Fischer (1983) for C. dia- tion, a representative non-target species broticae and C. setosa, and by Zhang et al. from a genus in a different family within (2003) for C. compressa, that females use a the same order (outgroup) was selected. 30 U. Kuhlmann et al.

As reported before, D. v. virgifera belongs Initial test list to the tribe Luperini (subtribe Diabroticina) Taking the above results, a total of 42 within the subfamily Galerucinae (Wilcox, species were included in the initial test list 1972), therefore, representative species (38 (category 1) + 2 (category 2) + 2 (cate- closely related to D. v. virgifera were consid- gory 3) = 42 species). It should be noted ered. Further, phylogenetic studies by Hsiao that G. pusilla was selected under both cat- (1994) have shown that the subfamily egories 2 and 3, and O. melanopus was Galerucinae is closely related to the subfami- selected under categories 1 and 2, illustrat- lies Criocerinae, Chrysomelinae and ing that species can fulfil multiple informa- Alticinae, and relatively distant from tion requirements. Cassidinae. In this case study, representative non-target species selected belonged to the Spatial, temporal and morphological subfamilies Criocerinae (e.g. O. melanopus), attributes (Filter 1) Chrysomelinae (e.g. Gastrophysa viridula The initial test list was progressively fil- Deg. and Gonioctena fornicata Brüggemann) tered (reduced), due to the fact that non- and Cassidinae (e.g. Cassida rubiginosa target species potentially at risk need to Müller). Within the subfamily Galerucinae, have ecological and biological attributes other representative non-target species in the that may or may not overlap with those of tribe Galerucini, such as Galerucella pusilla the target species. In this case, geographical Duft and Pyrrhalta luteola (Müller), were distribution and climate requirements chosen. In addition, a species in the tribe (European continent excluding UK and Luperini, Aulacophora foveicollis Lucas Scandinavia), temporal pattern of adult (subtribe Aulacophorinia), which represents occurrence in the field (June till October) a species of the genus Diabrotica in the Old and similarity in size (3–10 mm required World (Maulik, 1936), was selected. Besides for parasitoid development within the host; this chrysomelid, the pea weevil, Sitona lin- Eben and Barbercheck, 1996) were used. eatus L., was selected as the outgroup repre- As a result of Filter 1, 21 chrysomelid sentative of a different and not closely related species were excluded due to body size Coleoptera family (Coleoptera: Curculi- (>10 mm and <3 mm) and one chrysomelid onidae); this is a common species present in species was excluded due to its different tem- Diabrotica-invaded areas (in total, two addi- poral pattern to D. v. virgifera. At this point tional species for the initial test list). 20 (42 minus 22) potential non-target Coleopteran species remained on the test list.

Accessibility and availability (Filter 2) Safeguard considerations (Category 3) With the regard to the accessibility and Representatives of beneficial insect fami- availability, the goal not only was to further lies such as Coccinellidae or Carabidae, as reduce the number of non-target species to well as weed biological control agents, be tested but also to maintain representative were included to avoid non-target impacts species from each of the subfamilies of the on these organisms. In addition, rare and Chrysomelidae that were included in the ini- endangered species were considered for tial test list. Field surveys were conducted in selection. southern Hungary over a two-year period to The two-spotted ladybird beetle, Adalia identify the availability of the 20 test species bipunctata L., was added to the non-target in maize, alfalfa, sunflower, wheat and adja- list as a representative of beneficial cent field margin habitats. Coccinellinae (Coleoptera: Coccinellidae), Based on this filter, two closely related and the golden loosestrife beetle, G. species of Galerucinae, P. luteola and G. pusilla, considered as an important species pusilla and two representatives of for the control of the weed, purple looses- Chrysomelinae, G. viridula and G. forni- trife (Lythrum salicariae L.) in Europe (two cata, were chosen. One representative additional species for the initial test list). species of the subfamily Cassidinae, C. Selection of Non-target Species for Host Specificity Testing 31

rubiginosa, was included, as well as a rep- list for host specificity testing of the resentative from the subfamily Criocerinae, tachinid fly C. compressa, a candidate bio- O. melanopus. logical control agent of the western corn Lack of information about the biology rootworm, D. v. virgifera, comprises nine and rearing methods for many of the non- Coleoptera species (Table 2.4). As men- target insects chosen made it impractical to tioned above, this revised list should not assemble sets of laboratory-reared non- necessarily be considered as the final test target species for testing. Therefore, 100 to list as new results from ongoing host speci- 120 adults of each non-target species were ficity testing and parallel biological studies dissected after each field collection to assess may shed new light on which non-target naturally occurring field parasitism. For the species may be at risk of being attacked by tests, only specimens from non-target popu- the candidate biological control agent. lations free of parasitism were used. As a result of Filter 2, nine species were selected for host specificity testing (seven Conclusions chrysomelids, S. lineatus and A. foveicollis). Selecting non-target species for inclusion in host range testing for exotic entomophagous biological control agents must be done care- Revised test list fully to ensure that appropriate species are As a result of applying the recommenda- chosen. While the centrifugal–phylogenetic tions outlined for the selection of non-tar- method used for selecting test species in get species for a test list, the revised test weed biological control is a useful starting

Table 2.4. Revised test list for host speciﬁcity testing of the tachinid Celatoria compressa, a candidate biological control agent of the western corn rootworm, Diabrotica virgifera virgifera LeConte.

Family Subfamily Tribe Species Host plants hosts

CHRYSOMELIDAE Galerucinae Aulacophora foveicollis Lucas Pumpkin, Luperini Cucurbita maxima Duch. Galerucinae Galerucella pusilla Duft Purple loosestrife, Galerucini Lythrum salicaria L. Galerucinae Pyrrhalta luteola (Mueller) Elm, Galerucini Ulmus spp. Chrysomelinae Gastrophysa viridula Deg. Sorrel, Rumex spp. Chrysomelinae Gonioctena fornicata Brueggemann Lucerne, Medicago sativa L. Criocerinae Oulema melanopus (L.) Wheat, Triticum aestivum L. Cassidinae Cassida rubiginosa Mueller Thistle, Cirsium arvense (L.) Sop. COCCINELIDAE Coccinellinae Adalia bipunctata L. Flour moth eggs, Ephestia spp. CURCULIONIDAE Brachyderinae Sitona lineatus Linnaeus White clover, Trifolium repens L. Lucerne, Medicago sativa L. 32 U. Kuhlmann et al.

point, other attributes such as ecological bearing in mind that host selection by para- similarities, biological properties, socio- sitoids is often triggered by an additional economic considerations and availability trophic level (host and host–plant) than of test species are of primary importance that by herbivores. and have been used in the limited number The recommendations proposed are of studies conducted to date. In fact, recent intended to further stimulate and help work in host range testing for weed biologi- improve the host specificity testing of ento- cal control agents has included phylogenet- mophagous biological control agents (see ically unrelated plant species that share van Lenteren et al., Chapter 3, this volume). conspicuous biological attributes relevant In fact, the process of compiling a test to host selection behaviour of phy- species list is already a valuable step by tophagous species. The number of plant itself in the pre-release assessment because species screened in weed biological control it provides a mechanism for assembling ranges from 40 to 100, including ‘safe- and synthesizing relevant information and guard’ species, but testing these numbers of knowledge. Hopefully, new evidence from species would be prohibitive for ento- thorough host specificity tests will accu- mophagous biological control agents. Thus, mulate relatively quickly so that the pro- one of the key aspects in host specificity posed recommendations for the non-target testing in arthropod biological control pro- selection procedure, which are based on a grammes lies in setting up a test species relatively small data set of experimental list that is both scientifically sound and parasitoid host range assessments, can be manageable. This is a challenging task, soon revisited and refined if necessary.

References

Andow, D.A., Lane, C.P. and Olson, D.M. (1995) Use of Trichogramma in maize-estimating environmental risks. In: Lynch, J.M. and Hokkanen, H.H. (eds) Benefits and Risks of Introducing Biocontrol Agents. Cambridge University Press, New York, pp. 101–118. Arnauld, P.H. (1978) A Host–Parasite Catalogue of North American Tachinidae (Diptera). Miscellaneous Publication No. 1319, United States Department of Agriculture, Washington DC. Askew, R.R. (1961) On the biology of the inhabitants of oak galls of Cynipidae (Hymenoptera) in Britain. Transactions of the Society for British Entomology 14, 237–268. Askew, R.R. (1994) Parasitoids of leaf-mining Lepidoptera: what determines their host ranges? In: Hawkins, B.A. and Sheehan, W. (eds) Parasitoid Community Ecology. Oxford University Press, Oxford, UK, pp. 177–202. Askew, R.R. and Shaw, M.R. (1986) Parasitoid communities: their structure and development. In: Waage, J.K. and Greathead, D. (eds) Insect Parasitoids. Academic Press, London, pp. 225–264. Babendreier, D., Kuske, S. and Bigler, F. (2003a) Non-target host acceptance and parasitism by Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae) in the laboratory. Biological Control 26, 128–138. Babendreier, D., Kuske, S. and Bigler, F. (2003b) Parasitism of non-target butterflies by Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae) under field cage and field conditions. Biological Control 26, 139–145. Babendreier, D., Kuske, S. and Bigler, F. (2003c) Overwintering of the egg parasitoid Trichogramma brassicae in northern Switzerland. BioControl 48, 261–273. Babendreier, D., Rostas, M., Höfte, M.C.J., Kuske, S. and Bigler, F. (2003d) Effects of mass releases of Trichogramma brassicae on predatory insects in maize. Entomologia Experimentalis et Applicata 108, 115–124. Barratt, B.I.P. (2004) Microctonus parasitoids and New Zealand weevils: comparing laboratory estimates of host ranges to realised host ranges. In: Van Driesche, R.G. and Reardon, R. (eds) Assessing Host Ranges of Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practise. Forest Health Technology Enterprise Team 2004–03, USDA Forest Service, Morgantown, West Virginia, pp. 103–120. Selection of Non-target Species for Host Specificity Testing 33

Barratt, B.I.P., Evans, A.A., Ferguson, C.M., Barker, G.M., McNeill, M.R. and Phillips, C.B. (1997) Laboratory non-target host range of the introduced parasitoids Microctonus aethiopoides and M. hyperodae (Hymenoptera: Braconidae) compared with field parasitism in New Zealand. Environmental Entomology 26, 694–702. Barratt, B.I.P., Evans, A.A., Ferguson, C.M., McNeill, M.R., Proffitt, J.R. and Barker, G.M. (1998) Curculionoidea (Insects: Coleoptera) of New Zealand agricultural grassland and lucerne as potential non-target hosts of the parasitoids Microctonus aethiopoides Loan and Microctonus hyperodae Loan (Hymenoptera: Braconidae). New Zealand Journal of Zoology 25, 47–63. Barratt, B.I.P., Ferguson, C.M., Goldson, S.L., Phillips, C.B. and Hannah, D.J. (2000) Predicting the risk from biological control agent introductions: a New Zealand approach. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 59–75. Belshaw, R. (1994) Life history characteristics of Tachinidae (Diptera) and their effect on polyphagy. In: Hawkins, B.A. and Sheehan, W. (eds) Parasitoid Community Ecology. Oxford University Press, Oxford, UK, pp. 45–162. Benson, J., Pasquale, A., Van Driesche, R. and Elkinton, J. (2003) Assessment of risk posed by introduced braconid wasps to Pieris virginiensis, a native woodland butterfly in New England. Biological Control 26, 83–93. Bernays, E.A. (2000) Neural limitations in phytophagous insects: Implications for diet breadth and evolution of host affiliation. Annual Review of Entomology 46, 703–727. Blanchard, E.E. (1937) Dípteros Argentinos nuevos o poco conocidos. Revista Sociedade Entomologica Argentina 9, 35–38. Boettner, G.H., Elkinton, J.S. and Boettner, C.J. (2000) Effects of a biological control introduction on three non-target native species of saturniid moths. Conservation Biology 14, 1798–1806. Boucek, Z. and Askew, R.R. (1968) Index of Paleartic Eulophidae (excluding Tetrastichinae). Index of Entomophagous Insects 3. Le François, Paris. Bourchier, R.S. (2003) Receptor characterization of non-target butterflies for risk assessment of biological control with the egg parasitoid Trichogramma minutum (Hymenoptera: Trichogrammatidae). The Canadian Entomologist 135, 449–466. Briese, D.T., Walker, A., Pettit, W. and Sagliocco, J.-L. (2002) Host-specificity of candidate agents for Onopordum spp. thistles in Australia: an assessment of testing procedures. Biocontrol Science and Technology 12, 149–163. Cameron, P.J. and Walker, G.P. (1997) Host specificity of Cotesia rubecula and Cotesia plutellae, parasitoids of white butterfly and diamondback moth. Proceedings of the 50th New Zealand Plant Protection Conference, New Zealand Plant Protection Society, Lincoln, NZ, pp. 236–241. Cox, M.L. (1994) The Hymenoptera and Diptera parasitoids of Chrysomelidae. In: Jolivet, P.H., Cox, M.L. and Petitpierre, E. (eds) Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 419–468. De Nardo, E.A.B. and Hopper, K.R. (2004) Using the literature to evaluate parasitoid host ranges: a case study of Macrocentrus grandii (Hymenoptera: Braconidae) introduced into North America to control Ostrinia nubilialis (Lepidoptera: Crambidae). Biological Control 31, 280–295. Dobler, S. (2001) Evolutionary aspects of defence by recycled plant compounds in herbivorous insects. Basic and Applied Ecology 2, 15–26. Duan, J.J. and Messing, R.H. (1996) Response of two Opiine fruit fly parasitoids (Hymenoptera: Braconidae) to the lantana gall fly (Diptera: Tephritidae). Environmental Entomology 25, 1428–1437. Duan, J.J. and Messing, R.H. (1997) Effect of two Opiine parasitoids (Hymenoptera: Braconidae) introduced for fruit fly control on a native Hawaiian tephritid, Trupanea dubautiae (Diptera: Tephritidae). Biological Control 8, 177–184. Duan, J.J., Ahmad, M., Joshi, K. and Messing, R.H. (1997) Evaluation of the impact of the fruit fly parasitoid Diachasmimorpha longicaudata (Hymenoptera: Braconidae) on a non-target tephritid, Eutreta xanthochaeta (Diptera: Tephritidae). Biological Control 8, 58–64. Eben, A. and Barbercheck, M.E. (1996) Field observations on host plant associations and natural enemies of Diabroticite beetles (Chrysomelidae: Luperini) in Veracruz, Mexico. Acta Zoologica Mexicana 67, 47–65. Ehrlich, P.R. and Raven, P.H. (1964) Butterflies and plants: a study in coevolution. Evolution 18, 586–608. 34 U. Kuhlmann et al.

Fischer, D.C. (1981) Tachinid parasitoids of Acalymma vittata, Diadrotica undecimpunctata, and Diabrotica virgifera. MSc thesis, University of Illinois at Urbana-Champaign, USA, pp. 1–61. Fischer, D.C. (1983) Celatoria diabroticae Shimer and Celatoria setosa Coquillett: tachinid parasitoids of the Diabroticite Coleoptera. PhD thesis, University of Illinois at Urbana-Champaign, USA, pp. 1–120. Fitton, M.G., Shaw, M.R. and Gauld, I.D. (1988) Pimpline ichneumon-flies. Hymenoptera, Ichneumonidae (Pimplinae). Handbooks for the Identification of British Insects 7(1), 1–110. Fuester, R.W., Kenis, M., Swan, K.S., Kingsley, P.C., López-Vaamonde, C. and Hérard, F. (2001) Host range of Aphantorhaphopsis samarensis (Diptera: Tachinidae), a larval parasite of the gypsy moth (Lepidoptera: Lymantriidae). Environmental Entomology 30, 605–611. Futuyma, D.J. and Moreno, G. (1988) The evolution of ecological specialisation. Annual Review of Ecology and Systematics 19, 207–233. Garcia-Jacas, N., Susanna, A., Garnatje, T. and Vilatersana, R. (2001) Generic delimitation and phylogeny of the subtribe Centaureinae (Asteraceae): a combined nuclear and chloroplast DNA analysis. Annals of Botany 87, 503–515. Godfray, H.C.J. (1994) Parasitoids: Behavioral and Evolutionary Ecology. Princeton University Press, Princeton, New Jersey, pp. 447. Griffiths, G.C.D. (1964–1968) The Alysiinae (Hymenoptera, Braconidae) parasites of the Agromyzidae (Diptera). I–VI. Beiträge zur Entomologie 14, 823–914 (1964); 16, 551–605 (1966); 16, 775–951 (1966); 17, 653–696 (1967); 18, 5–62 (1968); 18, 63–152 (1968). Harris, P. and Zwoelfer, H. (1968) Screening of phytophagous insects for biological control of weeds. The Canadian Entomologist 100, 295–303. Hawkins, B.A. (1990) Global patterns of parasitoid assemblage size. Journal of Animal Ecology 59, 57–72. Hawkins, B.A. (1994) Pattern and Process in Host–Parasitoid Interactions. Cambridge University Press, Cambridge, UK. Hawkins, B.A. and Sheehan, W. (1994) Parasitoid Community Ecology. Oxford University Press, Oxford, UK. Heineck-Leonel, M.A. and Salles, L.A.B. (1997) Incidence of parasitoids and pathogens of Diabrotica speciosa (Germ.) (Coleoptera: Chrysomelidae) in Pelotas RS. Anais da Sociedade Entomologica do Brasil 26, 81–85. Hoffmeister, T.S. (1992) Factors determining the structure and diversity of parasitoid complexes in tephritid fruit flies. Oecologia 89, 288–297. Hopper, K.R. (2001) Research needs concerning non-target impacts of biological control introductions. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 39–56. Howarth, F.G. (1983) Biological control: panacea or Pandora’s box? Proceedings of the Hawaiian Entomological Society 24, 239–244. Howarth, F.G. (1991) Environmental impacts of classical biological control. Annual Review of Entomology 36, 485–509. Hsiao, T.H. (1994) Molecular techniques for studying systematics and phylogeny of Chrysomelidae. In: Jolivet, P.H., Cox, M.L. and Petitpierre, E. (eds) Novel Aspects of the Biology of Chrysomelidae. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 237–248. Kitt, J.T. and Keller, M.A. (1998) Host selection by Aphidius rosae Haliday (Hym., Braconidae) with respect to assessment of host specificity in biological control. Journal of Applied Entomology 122, 57–63. Kuhlmann, U. and Mason, P.G. (2003) Use of field host range surveys for selecting candidate non- target species for physiological host specificity testing of entomophagous biological control agents. In: Van Driesche, R.G. (ed.) Proceedings of the International Symposium on Biological Control of Arthropods. Honolulu, Hawaii, 14–18 January 2003. FHTET-2003-05, USDA Forest Service, United States Department of Agriculture, Morgantown, West Virginia, pp. 370–377. Kuhlmann, U., Mason, P.G. and Greathead, D. (1998) Assessment of potential risks for introducing European Peristenus species as biological control agents of Lygus species in North America: a co-operative approach. Biocontrol News and Information 19, 83N–90N. Kuhlmann, U., Mason, P.G. and Foottit, R.G. (2000) Host specificity assessment of European Peristenus parasitoids for classical biological control of native Lygus species in North America: Use of field host surveys to predict natural enemy habitat and host ranges. In: Van Driesche, R., Selection of Non-target Species for Host Specificity Testing 35

Heard, T., McClay, A. and Reardon, R. (eds) Host Specificity Testing of Exotic Arthropod Biological Control Agents: The Biological Basis for Improvement in Safety. FHTET-99-1, August 2000, USDA Forest Service, Forest Health Technology Enterprise Team, Morgantown, West Virginia, pp. 84–95. Kuhlmann, U., Toepfer, S. and Zhang, F. (2005) Is classical biological control against western corn rootworm in Europe a potential sustainable management strategy. In: Vidal, S., Kuhlmann, U. and Edwards, C.R. (eds) Western Corn Rootworm: Ecology and Management. CABI Publishing, Wallingford, UK, pp. 263–284. Lockwood, J.A. (1993a) Environmental issues involved in biological control of rangeland grasshoppers (Orthoptera: Acrididae) with exotic agents. Environmental Entomology 22, 503–518. Lockwood, J.A. (1993b) Benefits and costs of controlling rangeland grasshoppers (Orthoptera: Acrididae) with exotic organisms: search for a null hypothesis and regulatory compromise. Environmental Entomology 22, 904–914. Lockwood, J.A. (2000) Nontarget effects of biological control: what are we trying to miss? In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 15–30. Louda, S.M., Kendall, D., Conner, J. and Simberloff, D. (1997) Ecological effects of an insect introduced for the biological control of weeds. Science 277, 1088–1090. Lynch, L.D., Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Gao, Z.-H., Kuske, S., Loomans, A., Menzler-Hokkanen, I., Thomas, M.B., Tommasini, G., Waage, J.K., van Lenteren, J.C. and Zeng, Q.-Q. (2001) Insect biological control and non-target effects: a European perspective. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 99–125. Magalhães, B.P. and Quintela, E.D. (1987) Níveis de parasitismo de Urosigalphus chalcodermi Wilkinson sobre Chalcodermus bimaculatus Fiedler e de Celatoria bosqi Blanchard sobre Cerotoma arcuata Olivier em caupi (Vigna unguiculata (L.) Walp.) em Goiás. Anais da Sociedade Entomologica do Brasil 16, 235–238. Mansfield, S. and Mills, N.J. (2002) Host egg characteristics, physiological host range, and parasitism following inundative releases of Trichogramma platneri (Hymenoptera: Trichogrammatidae) in walnut orchards. Environmental Entomology 31, 723–731. Maulik, S. (1936) Coleoptera Chrysomelidae (Galerucinae). Fauna of British India. Taylor and Francis, London, UK. Memmott, J., and Godfray, H.C.J. (1993) Parasitoid webs. In: LaSalle, J. and Gauld, I.D. (eds) Hymenoptera and Biodiversity. CABI Publishing, Wallingford, UK. pp. 217–234. Memmott, J. Martinez, N.D. and Cohen, J.E. (2000) Predators, parasitoids and pathogens: species richness, trophic generality and body sizes in a natural food web. Journal of Animal Ecology 69, 1–15. Messing, R.H. (2001) Centrifugal phylogeny as a basis for non-target host testing in biological control: is it relevant for parasitoids? Phytoparasitica 29, 187–189. Munro, V.M.W. and Henderson, I.M. (2002) Nontarget effect of entomophagous biocontrol: shared parasitism between native lepidopteran parasitoids and the biocontrol agent Trigonospila brevifacies (Diptera: Tachinidae) in forest habitats. Environmental Entomology 31, 388–396. Neale, C., Smith, D., Beattie, G.A.C. and Miles, M. (1995) Importation, host specificity testing, rearing and release of three parasitoids of Phyllocnistis citrella Stainton (Lepidoptera: Gracillariidae) in eastern Australia. Journal of the Australian Entomological Society 34, 343–348. Noyes, J.S. (1994) The reliability of published host–parasitoid records: a taxonomist’s view. Norwegian Journal of Agricultural Sciences, Supplement No. 16, 59–69. Orr, D.B., Garcia-Salazar, C. and Landis, D.A. (2000) Trichogramma non-target impacts: a method for biological control risk assessment. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Boston, Massachusetts, pp. 111–125. Pelser, P.B., Gravendeel, B. and van der Meijden, R. (2002) Tackling speciose genera: species composition and phylogenetic position of Senecio sect. jacobaea (Asteraceae) based on plastid and nrDNA sequences. American Journal of Botany 89, 929–939. Pemberton, R.W. (2000) Predictable risk to native plants in weed biological control. Oecologia 125, 489–494. Porter, S.D. (2000) Host specificity and risk assessment of releasing the decapitating fly Pseudacteon curvatus as a classical biocontrol agent for imported fire ants. Biological Control 19, 35–47. 36 U. Kuhlmann et al.

Price, P. (1981) Semiochemicals in evolutionary time. In: Nordlund, D.A., Jones, R.L. and Lewis, W.J. (eds) Semiochemicals, their Role in Pest Control. John Wiley and Sons, New York, pp. 251–279. Pschorn-Walcher, H. and Altenhofer, E. (1989) The parasitoid community of leaf-mining sawflies (Fenusini and Heterarthrini): a comparative analysis. Zoologischer Anzeiger 222, 37–57. Ronquist, F. and Liljeblad, J. (2001) Evolution of the gall wasp–host plant association. Evolution 55, 2503–2522. Rutledge, C.E. and Wiedenmann, R.N. (1999) Habitat preferences of three congeneric braconid parasitoids: Implications for host-range testing in biological control. Biological Control 16, 144–154. Sands, D.P.A. (1997) The ‘safety’ of biological control agents: assessing their impact on beneficial and other non-target hosts. Memoirs of the Museum of Victoria 56, 611–615. Sands, D.P.A. (1998) Guidelines for testing host specificity of agents for biological control of arthropod pests. Sixth Australian Applied Entomological Research Conference, The University of Queensland, Brisbane, Australia, Volume I. The University of Queensland, Australia, pp. 556–560. Sands, D.P.A. and Van Driesche, R.G. (2000) Evaluating the host range of agents for biological control of arthropods: rationale, methodology and interpretation. In: Van Driesche, R.G., Heard, T.A., McClay, A.S. and Reardon, R. (eds) Proceedings: Host Specificity Testing of Exotic Arthropod Biological Control Agents: The Biological Basis for Improvement in Safety. Xth International Symposium on Biological Control of Weeds, Bozeman, Montana, July 4–14, 1999. FHTET-99-1, USDA Forest Service, Forest Health Technology Enterprise Team, Morgantown, West Virginia, pp. 69–83. Sands, D.P.A., Bakker, P. and Dori, F.M. (1993) Cotesia erionotae (Wilkinson) (Hymenoptera: Braconidae) for biological control of banana skipper, Erionota thrax (L.) (Lepidoptera: Hesperiidae) in Papua New Guinea. Micronesia, Supplement 4, 99–105. Sato, H. (1990) Parasitoid complexes of lepidopteran leafminers on oaks (Quercus dentata and Quercus mongolica) in Hokkaido, Japan. Ecological Research 5, 1–8. Schaffner, U. (2001) Host range testing of insects for biological weed control: how can it be better interpreted? BioScience 51, 1–9. Shaw, S.R. (1988) Euphorine phylogeny: The evolution of diversity in host-utilization by parasitoid wasps (Hymenoptera: Braconidae). Ecological Entomology 13, 323–335. Shaw, M.R. (1994) Parasitoid host ranges. In: Hawkins, B.A. and Sheehan, W. (eds) Parasitoid Community Ecology. Oxford University Press, Oxford, UK, pp. 111–144. Stireman, J.O. and Singer, M.S. (2003) Determinants of parasitoid–host associations: insights from a natural tachinid–lepidopteran community. Ecology 84, 296–310. Strand, M.R. (1986) The physiological interactions of parasitoids with their hosts and their influence on reproductive strategies. In: Waage, J.K. and Greathead, D. (eds) Insect Parasitoids. Academic Press, London, pp. 97–136. Strong, D.R., Lawton, J.H. and Southwood, T.R.E. (1984) Insects on Plants. Blackwell Scientific, Oxford, UK. van Lenteren, J.C., Babendreier, D., Bigler, F., Burgio, G., Hokkanen, H.M.T., Kuske, S., Loomans, A.J.M., Menzler-Hokkanen, I., van Rijn, P.C.J., Thomas, M.B., Tommasini, M.G. and Zeng, Q.-Q. (2003) Environmental risk assessment of exotic natural enemies used in inundative biological control. BioControl 48, 3–38. Vinson, S.B. (1981) Habitat location. In: Nordlund, D.A., Jones, R.L. and Lewis, W.J. (eds) Semiochemicals, their Role in Pest Control. John Wiley and Sons, New York, pp. 51–78. Vinson, S.B. (1985) The behaviour of parasitoids. In: Kerkut, G.A. and Gilbert, L.I. (eds) Comprehensive Insect Physiology, Biochemistry and Pharmacology. Pergamon Press, New York, pp. 417–469. Vinson, S.B. and Iwantsch, G.F. (1980) Host suitability for insect parasitoids. Annual Review of Entomology 25, 397–419. Wapshere, A.J. (1974) A strategy for evaluating the safety of organisms for biological weed control. Annals of Applied Biology 77, 201–211. Wapshere, A. (1989) A testing sequence for reducing rejection of potential biological control agents for weeds. Annals of Applied Biology 114, 515–526. Weseloh, R.M. (1993) Potential effects of parasitoids on the evolution of caterpillar foraging behavior. In: Stamp, N.E. and Casey, T.M. (eds) Caterpillars: Ecological and Evolutionary Constraints on Foraging. Chapman and Hall, New York, pp. 203–223. Wilcox, J.A. (1972) Chrysomelidae, Galerucinae, Luperini. Coleopterum Catalogus Supplementa. Pars 78, Fasc, 3. Junk’s, Gravenhagen, The Netherlands. Selection of Non-target Species for Host Specificity Testing 37

Zhang, F., Toepfer, S., Riley, K. and Kuhlmann, U. (2003) Basic biology and small-scale production of Celatoria compressa (Diptera: Tachinidae), a parasitoid of Diabrotica virgifera virgifera (Coleoptera: Chrysomelidae). Bulletin of Entomological Research 93, 569–575. Zwoelfer, H. and Harris, P. (1971) Host speciﬁcity determination of insects for biological control of weeds. Annual Review of Entomology 16, 159–178. 3 Host Speciﬁcity in Arthropod Biological Control, Methods for Testing and Interpretation of the Data

Joop C. van Lenteren,1 Matthew J.W. Cock,2 Thomas S. Hoffmeister3 and Don P.A. Sands4 1Laboratory of Entomology, Wageningen University, P.O. Box 8031, 6700 EH Wageningen, The Netherlands (email: [email protected]; fax number: +31-317-484821); 2CABI Bioscience Centre, Rue des Grillons 1, 2800 Delémont, Switzerland (email: [email protected]; fax number: +41-32-421-4871); 3Institute of Ecology and Evolutionary Biology, University of Bremen, Leobener Strasse NW2, 28359 Bremen, Germany (email: [email protected]; fax number: +49-421-218-4504); 4CSIRO Entomology, 120 Meiers Road, Indooroopilly, Queensland 4068, Australia (email: [email protected])

Abstract

Potentially, the introduction of exotic natural enemies or mass release of biological control agents may lead to unwanted non-target effects. Whether or not such effects occur will depend mainly upon the host range of the biological control agent and the presence of non-target species in the areas of release and dispersal. To predict non-target effects, risk assessments for release of exotic natural enemies have been developed and applied during the modern era of biological control. Although methods to determine host ranges of natural enemies have been proposed during the past decades, decisions about release of exotic natural enemies are often still based on short-term decisions strongly influenced by financial benefit and tend to ignore environmental ethics, especially where risks are difficult to quantify. Here, we propose a framework for host-range testing of arthropod biological control agents, and suggest methods for evaluating possible effects on those non-target species considered to be at risk. Several factors should be incorporated into a host-range assessment, including literature and museum records, field observations in the area of origin, as well as physiological, behavioural and ecological observations and experiments. Usually, laboratory-based manipulative experiments will form the core of host-range assessments. In this chapter we concentrate on the question of how to determine host ranges. Several important considerations involved in designing host-range testing are presented. Next, a framework for step-wise host-range testing is given with levels of increasing complexity that should allow over- and underestimation of the host range of a biological control agent to be avoided. Finally, the interpretation of data obtained with host-range testing is discussed and conclusions are drawn about the importance of host- range testing within the framework of future biological control projects. ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 38 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Host Specificity in Arthropod Biological Control 39

Introduction before designs of host-range testing can be discussed. Despite the thorough host-range evalua- Several publications have appeared in tions applied in the evaluation of potential which ideas or methods for host-range test- natural enemies of weeds (Wapshere, 1974, ing are presented (Table 3.1; Barratt et al., 1975), it was unusual for host ranges of 1997, 2003; Sands, 1998; Hopper, 2001; biological control agents for insect or mite Kuhlmann and Mason, 2003; van Lenteren control to be extensively studied until et al., 2003). Aspects of risk assessments recently (Kuhlmann and Mason, 2003). The have been developed and applied during earlier lack of concern for non-target the past two decades, though often in a effects, combined with the fact that very preliminary way and not always satisfacto- few non-target effects were ever found in rily. Decisions about release of exotic nat- insect biological control, resulted in hardly ural enemies are often still strongly any host-range assessment or screening influenced by financial and social benefits studies before the 1990s, except in reflecting national priorities (see e.g. Australia, where they were started in the Neuenschwander and Markham, 2001; 1980s (see glossary in this book for defini- Cock, 2003) and tend to ignore environ- tion of host range and host specificity; in mental ethics, especially where risks are this chapter the word host is often treated difficult to quantify (van Lenteren, 1997). as synonymous with prey). However, it was However, there are several positive devel- not the relative lack of host-range assess- opments taking place currently. A recent ment, so much as the almost complete lack review, in which the implementation and of integration of modern natural enemy use of the IPPC Code of Conduct (CoC) biology into such tests, that alarmed us (IPPC, 1996) is evaluated (Kairo et al., when preparing this chapter. We will thus 2003), contains a number of very important have to summarize some of this knowledge conclusions. These include:

Table 3.1. Approaches for host-range testing presented in the literature.

No-choice, ‘black box’ host-range test, small scale: does biological control agent prey on or parasitize non-target host? (Sands, 1998; Babendreier et al., 2003a; van Lenteren et al., 2003.) No-choice, behavioural observation host-range test, small scale: does biological control agent attack or parasitize non-target host consistently? (Sands, 1998; van Lenteren et al., 2003.) No-choice sequential host-range test with behavioural observation, small scale: does biological control agent attack or parasitize non-target host consistently? (Sands, 1998; van Lenteren et al., 2003.) Choice, behavioural observation host-range test, small scale: does the biological control agent attack the non-target when the target species is present? (Sands, 1998; van Lenteren et al., 2003.) Choice, behavioural observation host-range test, large scale semi-field testing: does the biological control agent attack the non-target when the target species is present in a semi-natural situation? (Sands, 1998; van Lenteren et al., 2003.) Choice, black box host-range test, large scale semi-field testing: does the biological control agent attack the non-target when the target species is present in a semi-natural situation? (Sands, 1998; Babendreier et al., 2003b; van Lenteren et al., 2003.) Choice, black box host-range test, field testing: does the biological control agent attack the non-target when the target species is present in a natural situation? (Sands, 1998; van Lenteren et al., 2003.) Pre-introduction field determination of host range in area of origin of natural enemy. (Barratt et al., 2003; Kenis et al., 2003; Kuhlmann and Mason, 2003.) Post-introduction field determination of host range in area of release of natural enemy. (Barratt et al., 1997; Coombs, 2003.) Other approaches mentioned in literature: Fecundity, sex ratio, emergence of biological control agent, selective exploitation of hosts. (Mansfield and Mills, 2004.) 40 J.C. van Lenteren et al.

● The current wide use of the CoC. agents. First we illustrate that next to host- ● With the CoC, several requests for range testing, other factors can and should importation could be rejected based on be incorporated into a host-range assess- good reasons. ment. Then we discuss a number of impor- ● The CoC made evaluation procedures tant considerations involved in designing generally more rigorous and lengthy, but host-specificity testing, and a framework did not necessarily lead to fewer intro- for host-range testing is presented. Next we ductions. discuss the interpretation of data obtained ● Most respondents were positive about with host-range testing and finally some the implementation of the CoC, but also conclusions are drawn. expressed concerns that the CoC lacks procedures for, amongst others, host- range assessment schemes and host- Host-range Assessment range testing methods that need to be developed with high priority (Kairo et Host-specificity testing is an important al., 2003; Quinlan et al., 2003). aspect of host-range assessment – perhaps the most important, and the easiest concep- Although there is still much debate on how tually for regulators. However, the purpose to test host specificity, several protocols for of host-specificity testing is to determine host-range determination have been experimentally the potential (= physiologi- designed and used during the past decade cal) host range of a biological control agent, (Barratt et al., 1997; Sands, 1998; van in order to assess the risks that it presents Lenteren et al., 2003). to the environment and to human interests. An important conclusion from recent There are other approaches that also pro- papers on risks of releasing exotic biologi- vide evidence regarding the potential host cal control agents is that host-range assess- range of a biological control agent, and ment should form the focus of every which can be used to make predictions natural enemy risk assessment. This needs about the risks that it presents. Sometimes to be combined with the potential spread this evidence may be rather conclusive, but of an introduced classical biological con- at other times it will provide supporting, trol agent, or in the case of augmentative corroborative evidence. biological control, considered together It should be remembered that many with the numbers of natural enemies that early studies of classical biological control are released and the dispersal capacity of have included detailed studies on the pest the natural enemy (see Mills et al., Chapter and its natural enemies in the pest’s area 7, this volume), to determine the probabil- of origin – in many cases in much more ity that non-target effects will occur. detail than is normally undertaken today. Several sources of information may be This detailed information inevitably gen- incorporated into a host-range assessment, erates insight into the potential host range including literature records, field observa- of the biological control agents being stud- tions in the area of origin, and physiologi- ied, so that many introductions were cal, behavioural and ecological made knowing the likely host range of the observations and experiments. Usually introduced biological control agent. Some though, laboratory-based manipulative of the best documented examples relate to experiments to test host range will be per- the work carried out by the pioneering formed. Developing a list of appropriate group of entomologists working in Fiji in non-target species is a difficult task and is the 1920s and 1930s (Paine, 1994), e.g. discussed in detail by Kuhlmann et al. against the coconut moth, Levuana iri- (Chapter 2, this volume). descens Bethune-Baker (Tothill et al., In this chapter we will concentrate on 1930) (the tachinid parasitoid of this the question of how to test the host speci- zygaenid moth was known to attack ficity of arthropod biological control species of Zygaenidae, Noctuidae and Host Specificity in Arthropod Biological Control 41

Pyralidae in its native range, and not sur- Taxonomic extrapolation prisingly subsequently attacked several non-target species when introduced into The biology of some groups is sufficiently Fiji), the coconut spike moth, Tirathaba well known that particular parasitoid rufivena (Walker) (Paine, 1935), and the species can be predicted as being restricted coconut scale, Aspidiotus destructor to certain host groups based on their taxo- Signoret (Taylor, 1935). Though several nomic affinities, e.g. a particular genus may researchers proposed to release only host- be known only as parasitoids of mealybugs. specific natural enemies, others supported This argument was used recently in the case the idea of releasing polyphagous natural of Anagyrus kamali Moursi, widely intro- enemies in classical biological control duced in the Caribbean area for control of programmes to increase the probability of pink hibiscus mealybug, Maconellicoccus establishment (for a discussion see hirsutus (Green) (Kairo et al., 2000), and can Turnbull and Chant, 1961). be applied to several groups of parasitoids. The number of recent studies (i.e. post- IPPC (1996)), including quantitative data on the pest and its natural enemies in Field surveys their area of origin, which have been published is still quite limited, so it is diffi- If the ecology and host or prey associations cult to suggest standard methods for are not rigorously known then it is possible assessing host ranges. The examples men- to make targeted surveys to assess the uti- tioned below may be considered as case lization of species related to the target studies, and as more accumulate, stan- species (e.g. Kuhlmann and Mason, 2003; dard methods should be easier to derive. Lopez and Kairo, 2003). Even in isolation, host-range information can go a long way towards providing an assessment of host specificity. Field stud- Behavioural studies ies have the advantage that laboratory constraints are not involved in changing One of the prerequisites for effective and behaviour and apparent specificity. On realistic host-specificity testing is a good the other hand, only non-target species understanding of the biology of the host– indigenous to the source area can be parasitoid or predator–prey interaction, assessed, and specific information relat- including host/prey location, searching ing to non-target species restricted to the behaviour, oviposition behaviour etc. These target area can only be generated in con- aspects in themselves may give very strong tainment (e.g. NAPPO, 2004), and there- indications of host specificity, and can be fore will almost certainly require particularly helpful in assessing the potential experimental testing methods at much prey range of predators. For example, the smaller scales. coccinellid predator Hyperaspis pantherina Fürsch was shown to lay almost all of its eggs on the fluted egg sac of its normal prey, Literature records Orthezia insignis Browne (Booth et al., 1995), indicating a close co-evolved relationship. If the source area of the potential biological Nephaspis spp. (Coccinellidae) seem to be control agents is one where the local ecol- stimulated to oviposit in the presence of ogy has been intensively studied, then whitefly flocculence (Lopez and Kairo, there will be accumulated host records, 2003). A clear example of a behaviour-based often catalogued, giving a strong indication specificity is provided by Teretrius that a particular parasitoid or predator is nigrescens (Lewis), the histerid predator of exclusively associated with particular larger grain borer, Prostephanus truncates hosts/prey. See section ‘choice of non- (Horn), which was shown to locate its prey’s target species’ for more information. breeding sites by attraction to the aggregation 42 J.C. van Lenteren et al.

pheromone of the target beetle (Rees et al., ing phases: host-habitat searching, host 1990; Boeye et al., 1992; Borgemeister et al., searching and host evaluation, with even- 2003) – again convincing evidence of a close tually host acceptance (Doutt, 1959). A co-evolved relationship. predator will eat the accepted prey, a parasitoid may parasitize a host and/or feed from it (host feeding). Only those hosts that Morphological constraints provide the natural enemy with possibilities for development and reproduction are Limits to the size of biological control considered suitable. To be able to show agents may also have clear implications the full range of host-finding behaviour, the regarding potential host range. Potential natural enemy needs to be exposed to biological control agents may be demon- the complete plant–host complex, but in strably too big, too small or morphologi- laboratory tests often only subsets are cally ill-equipped to attack particular offered, or hosts are offered on unnatural non-targets, or their ovipositor may be too host plants and in abnormal distribution short to reach them, too flimsy to penetrate patterns, which may result in altered host- them, etc. There will doubtless be other range profiles (van Dijken et al., 1986; mechanisms not considered here, which Conti et al., 2004). The main aspects affect- demonstrates the need for assessing each ing foraging behaviour are as follows: case on the available evidence. ● Plants affect host suitability through food and secondary plant substances Considerations when Developing (Schoonhoven et al., 1998), and thereby Host-range Testing influence foraging efficiency and fitness of natural enemies (Vet, 2001; Harvey et al., 2003). Plant nutrition and diseases, Hypotheses about host ranges of natural and plant contamination with non-host enemies generated from the literature and or prey species, or with higher-order field surveys can be tested in formal labora- predators or their signals, should be tory host-range tests (Sands, 1998). Host- considered as well. range tests aim to demonstrate whether a ● Plant anatomical, morphological and natural enemy can feed, develop or repro- architectural characteristics also influ- duce on a non-target species. Laboratory ence foraging behaviour of natural ene- testing can become quite complicated as a mies; e.g. plant hairs often reduce result of multitrophic chemical communi- search efficiency (Kareiva and Sahakian, cation, learning and wide host ranges 1990; van Lenteren and de Ponti, 1990; involving many host plant species. Host Dicke, 1999). preferences are determined not only by the ● Plant odour, taste, colour, shape and choice of species offered, but also by the touch may each influence attraction or physiological condition and experience of repellence of natural enemies (e.g. the natural enemy included. Host-range Dicke, 1999; Vet, 2001). testing is relevant only if proper experimen- ● It has been extensively demonstrated tal controls are included. Hence, before a that many plants, after being attacked by specific testing scheme is designed, several herbivores, start producing volatiles that points need to be considered in order to attract natural enemies, the so-called make the tests meaningful (Table 3.2). herbivore-induced synomones or HIS (Dicke and Vet, 1999). Based on these HIS volatiles, some natural enemies can Knowledge of natural enemy foraging assess host presence from a distance behaviour (Dicke and Vet, 1999). ● Host cues and other host characteristics The host-finding behaviour of natural ene- affect natural enemy behaviour and mies is usually separated into the follow- should thus be offered in a natural set- Host Specificity in Arthropod Biological Control 43

Table 3.2. Points to consider and specify in host-range testing.

Arenas/cages Should be clean and free of deterrent chemicals. Should have control of light, temperature and humidity. The right colour, pattern and size should be considered as it should allow for mating and normal search behaviour. Should allow for provision of full set of (infected) host plant, host and natural enemy stimuli. Host plant, host and natural enemy Strains of biological materials used should be characterized, preferably field-collected; healthy material should be used to prevent genetic deterioration; if laboratory rearing is needed, genetic changes that influence host preference should be monitored. If rearing of plant, host and/or natural enemy is based on artificial media and diets, the effects on host preference should be evaluated. How host-plant and host stimuli are included in the test situation should be descibed. Host plant Should not contain any residues of pesticides or other negatively interfering chemical materials. Should be in optimal condition. Should be herbivore infested sufficiently long enough before host-range testing to allow for production of host-induced synomones. Effect of, e.g. host plant colour, shape, odour, taste and structure may all influence host acceptance. Choice of host-plant species should be extensively described. Host/prey Laboratory rearing effects should be considered that might influence acceptance by natural enemy. Should be healthy, in appropriate stage for predation or parasitism and in sufficient numbers. Should be offered to natural enemy on its natural host plant and in normal host distribution pattern. Host colour, shape, odour, taste and structure should be controlled for, since all may influence host acceptance. Choice of non-target species should be extensively described. Natural enemy Possibility of diapausing by natural enemy should be considered. Laboratory rearing effects that might influence preference should be considered. Intra-specific variation in host preference should be considered. Should be healthy, in right physiological condition. Conditioning and learning effects that might negatively interfere with host preference should be prevented. Artificial selection that results in changed host-preference patterns should be prevented. Opportunity for host to feed should be ensured. The natural enemy strain that is used in host-range testing should be characterized and voucher material of the tested natural enemy strain(s) should be retained. Multitrophic aspects Should allow for normal set of stimuli to be provided by all organisms relevant for host-range testing (including host plants). Test should always include positive and negative controls. After testing, stocks of the natural enemy should be replaced instead of releasing laboratory-adapted, genetically bottlenecked stock.

ting. A recent study clearly shows how hosts were presented, a partial new asso- important the role of volatile and contact ciation was obtained. But this associa- host infochemicals are in host location tion is unlikely to occur in the ﬁeld as and host recognition (Conti et al., 2004). the parasitoid did not respond to the For example, in the laboratory, when volatile cues of the new host. This obser- contact infochemicals of non-co-evolved vation strongly indicates how carefully 44 J.C. van Lenteren et al.

laboratory and semi-field experiments the latitude and ecoregion of release. should be designed in order to avoid the Temperatures should be adjusted, either to overestimation or underestimation of the the mean or to appropriate diurnal temper- risk of non-target effects. ature cycles of the receiving country. ● Many generalist natural enemy species However, if diapause in non-target test change their location and host-selection organisms or agents is known or suspected, behaviour after finding a certain host in a it may be necessary to regulate laboratory certain habitat, because they quickly environmental conditions to avoid sus- learn to associate host availability with pended development. host plant and host cues (Vet et al., 1995). Learning can play a strong role during all Unnatural hosts, artificial diets and phases of host finding (host community effects of particular phenomena like location, microhabitat location, habitat diapause acceptance, host detection and host acceptance; for examples see Vet et al. (1995). One of the important effects of learning is that Rearing on unnatural hosts/prey or under habitat and host preferences can be altered unnatural conditions may cause behav- and temporary specializations to preferred ioural changes in immature stages and stimuli may arise. Field experiments by adults (Morrison and King, 1977; Grenier Papaj and Vet (1990) revealed that female and DeClerq, 2003; Vet et al., 2003). Leptopilina heterotoma (Thomson), experi- Reduced vigour can occur when natural enced with host-infested food substrates enemies are reared on unnatural hosts or such as mushrooms or fermenting apples, when natural enemies are reared on hosts were more likely to find a host-food sub- that are reared on an unnatural host diet. strate and found it faster than naive females, Rearing on artificial diets involves the risk i.e. learning reduced travel times. In addi- of changing natural enemy host prefer- tion, learning greatly influenced the choice ences, because they are no longer exposed of substrate. As a result of learning, the host to their natural set of infochemicals and range may change, and this is another prob- other stimuli (Grenier and DeClerq, 2003; lem which often cannot be accounted for in van Lenteren, 2003; Vet et al., 2003). small-scale laboratory tests. An aspect that is often difficult to con- Thus, it is essential to study and sider, if one is unfamiliar with the biology describe the general host-finding behaviour of the natural enemy, is the potential effect of a natural enemy before designing host- of diapausing natural enemies on host- range testing protocols. This is particularly specificity evaluation. Parasitoid eggs or important in small-scale laboratory tests. early instar larvae may remain in diapause until the host reaches the developmental stage that stimulates development of the Quality and rearing conditions of the host natural enemy. This could result in an plant, host and natural enemy underestimation of host range if the diapause leads to unrecognized parasitization The rearing of the host plant, host and nat- in non-target hosts. The effect can be sus- ural enemy species prior to testing should pected only if diapause occurs in the be described in a detailed way, as well as known target host. For example, after egg the host-range testing procedures, in order hatch, the first-instar larvae of a pteromalid, to be able to trace the effects of condition- Scutellista caerulea (Fonscolombe), remain ing, learning and multitrophic chemical in diapause beneath coccid hosts until they communication. During rearing and test- begin to oviposit, sometimes following a ing, use of pesticides and other chemicals period of parasitoid dormancy extending that might interfere with host preference for several months. As soon as oviposition should be avoided. Day length, humidity commences the parasitoid larvae begin and temperature should be appropriate to feeding on the eggs and complete develop- Host Specificity in Arthropod Biological Control 45

ment without feeding on the body of the Behavioural variation in natural enemies host (Sands et al., 1986). Likewise, first- instar larvae of an encyrtid, Anicetus com- The variation and changes in behaviour of munis Annecke, hatch in autumn and natural enemies that can be caused by rear- overwinter without feeding in the body tis- ing conditions are manifold, and may lead sues of third-instar hosts, but they develop to rather unexpected changes in host pref- rapidly as soon as the host changes to the erence (Vet et al., 2003). This issue, fourth instar (Waterhouse and Sands, 2001). together with a thorough theoretical background, is discussed by Lewis et al. (2003) and Vet et al. (2003). Most ecologists are Host or natural enemy infection aware that variability in natural enemy by pathogens behaviour occurs frequently and that it is important to know the sources of variabil- Laboratory-reared insects can be infected ity in order to prevent mistakes, e.g. during by pathogens (Bjørnson and Schütte, 2003). host-range testing. These could lead to high mortality, The sources of intrinsic variation in for- reduced fecundity, prolonged develop- aging behaviour (genetic, phenotypic and ment, small adults or wide fluctuations in those related to the physiological state) are the quality of insects. Goodwin (1984), not mutually exclusive but overlap exten- Shapiro (1984), Sikorowski (1984), Singh sively, even within a single individual. The and Moore (1985), Bjørnson and Schütte eventual foraging effectiveness and host (2003) and Stouthamer (2003) give infor- acceptance of a natural enemy is deter- mation on the effects of microorganisms on mined by how well the natural enemy’s net insect cultures and the measures available intrinsic condition is matched with the for- to minimize or eliminate the pathogens or aging environment in which it operates. contaminations. Further, they discuss the recognition of diseases and microorganisms in insect rearing and the common Managing genetic qualities sources of such microbial contaminants Host-range studies should be done with (see also Goettel and Inglis, Chapter 9, this well-characterized strains of a natural volume). enemy species, preferably based on genetic The most common microbial contami- identification methods (see Hopper et al., nants encountered in insect rearing are Chapter 5, this volume; Stouthamer, fungi, followed by bacteria, viruses, protozoa Chapter 11, this volume). When selecting (particularly microsporidia) and nematodes. between strains of natural enemies, ensure The field-collected insects that are used to that the traits of the natural enemies are start a laboratory colony are a major source appropriately matched with the targeted of microbial contaminants. The second main use situations in the field. Reliable genetic source is the various dietary ingredients. characterization is of particular importance Disinfection of insects and dietary ingredi- when using strains of polyphagous species. ents are recommended to prevent such contamination. The causes of microbial contamination can usually be quickly found, Managing phenotypic qualities but elimination of pathogens from insect colonies is difficult (Bartlett, 1984a; Without care, insectary environments lead Bjørnson and Schütte, 2003). Diseased hosts to agents developing weak or distorted and/or diseased natural enemies may result responses. Understanding the sources and in changed host preferences. Fungus- mechanism of natural enemy learning infected whiteflies, for example, at a certain allows the provision of an appropriate level stage are no longer accepted as hosts for par- of experience before testing the natural ene- asitism by Encarsia formosa Gahan (Fransen mies. Pre-release exposure to important and van Lenteren, 1993). stimuli can help improve the responses of 46 J.C. van Lenteren et al.

natural enemies through associative learn- type of C. bifasciata parasitizes up to 80% ing, leading to reduction in escape response, of adult females of A. aurantii (Smith et al., increased arrestment in target areas and, 1997). Similarly, larvae of different biotypes thus, a lower risk of non-target effects. of a pteromalid egg predator, Scutellista caerulea (Fonscolombe), are known to attack different species of coccid prey Managing physical and physiological (Waterhouse and Sands, 2001). Host-range qualities tests must therefore be conducted with Natural enemies should be tested in the individual natural enemies representing the physiological state in which they are most same geographical origin as those intended responsive to herbivore or plant stimuli and for making releases. will not be hindered in their responses by deprivations that interfere with host searching and acceptance. Natural enemies face Genetic changes, inbreeding and varying situations in meeting their food, replenishment of breeding stock mating, reproductive and safety requirements. Presence of strong chemical, visual Inbreeding problems may follow continued or auditory cues, cues related to presence of laboratory culture after several or many enemies of the natural enemy, and (tempo- generations while testing, or simply when rary) egg depletion can all reduce or disrupt building up numbers. There is no accepted the response to cues used to find hosts guide to how many generations are likely (Heimpel and Rosenheim, 1998; Lewis et to result in decline in genetic quality, as al., 2003). For example, hunger may result many factors contribute, including the in increased foraging for food and decreased number of individuals used for breeding. A attention to hosts in insect parasitoids useful ‘rule of thumb’ is to add newly (Waeckers, 2003). In that case, the reaction imported individuals (not before rearing to food and host cues will be different from through at least one generation) to the cul- when the natural enemy is well fed. ture kept in containment, or to replace the In view of the above discussion, it is culture entirely after about four generations best to rear natural enemies in as natural a of rearing in the laboratory. Caution must situation as possible to obtain reliable host- be exercised not to overlook hyperpara- range data. sitoids or diseases such as pathogenic microsporidia introduced with the freshly imported material. Intraspecific variation: biotypes and their When rearing host and natural enemy in different host ranges the laboratory for several generations, genetic changes may influence host prefer- Intraspecific, allopatric biotypes of para- ence. Those host ranges determined with sitoids with differing host ranges are well laboratory-reared material may, therefore, known and may be important when select- not be representative. ing the most effective agents. Biotypes can Bartlett (1984a,b, 1985) discusses what exhibit dissimilar host ranges and host happens to genetic variability in the specificity, comparable to separate species. process of domestication, what factors For example, different biotypes of might change variability and which ones Comperiella bifasciata Howard parasitize might be expected to have little or no yellow scale, Aonidiella citrina (Coquillet) effect. In laboratory domestication the and red scale, Aonidiella aurantii insects that survive and reproduce have (Maskell). The yellow scale biotype will suitable genotypes for survival in this new oviposit in red scale but many of the para- environment, a process called winnowing sitoid eggs and some larvae become encap- by Spurway (1955) or, more widely, but sulated without any parasitoid development less appropriately, ‘forcing insects through (Brewer, 1971). However, the red scale bio- a bottleneck’ (e.g. Boller, 1979). Host Specificity in Arthropod Biological Control 47

Variability in performance traits is usu- irrelevant chemicals, the so-called noise ally abundantly present in natural popula- (Dicke, 2000). Composition of infochemi- tions (Prakash, 1973; Hoekstra, 2003; cals may vary with genotype of the pro- Nunney, 2003) and can remain great even ducer (host plant or host), with biotic, and in inbred populations (Yamazaki, 1972). with abiotic conditions (Dicke and van The size of the founder population will Loon, 2000). The value of a certain info- directly affect how much variation will be chemical may also depend on the simulta- retained from the native gene pool neous presence of other cues (Dicke, (Hoekstra, 2003; Nunney, 2003) and differ- 2000). This all stresses the importance of ences between field and laboratory envi- a proper set of (infested) host plant and ronments will eventually result in host stimuli to be provided in order to differences in variability. Although there obtain reliable host preference data. is no agreement on the size of founder During testing, the target and non-target populations needed for starting a mass hosts should be offered in a natural host production, a minimum number of a thou- distribution pattern, on the natural host sand individuals is suggested (Bartlett, plant or part of that or on an alternative 1985; van Lenteren, 2003). Founder popu- host plant, which is not repellent to the lations are usually much smaller, creating natural enemy (van Dijken et al., 1986; a serious risk with regard to whether host- Sands, 1998; Follett et al., 2000). range assessment is representative for the species in question. It is often difficult to produce the desired numbers of individ- Choice of non-target species ual agents for release, and the only option may be to rear many generations in the The choice of non-target species is diffi- laboratory, with the resultant risks of cult but critical. For a detailed discussion inbreeding. Another obstacle for labora- of this issue, see Kuhlmann et al. (Chapter tory production is the lack of techniques 2, this volume). In addition to what is pre- for preventing selection pressures leading sented there, we would like to stress that to genetic deterioration of organisms. available knowledge about the ecological Through such deterioration, natural ene- and physiological attributes that are mies may also show different host prefer- explored by a natural enemy in its native ence patterns. area can help in narrowing down the Characterization of natural enemy number of non-targets for which tests strains by DNA fingerprinting may help in need to be designed (Waterhouse and identification of certain strains of natural Sands, 2001; Kenis et al., 2003; Kuhlmann enemies and in following up changes in and Mason, 2003). laboratory populations of field-collected Host–parasitoid and predator–prey asso- material (see Stouthamer, Chapter 11, this ciations have been catalogued from publica- volume). Benchmark testing of host prefer- tions of the periods 1913–1937 (Thompson, ence with a certain set of non-target hosts 1943–1965) and 1938–1962 (Herting, may also help in discovering changes. 1971–1982). Major sources of information for parasitoids, predators, their hosts and prey can also be found in the Review of Relevant multitrophic perspective Agricultural Entomology (formerly Review for testing of Applied Entomology, Series A) and electronic databases, including CAB Abstracts, Natural enemy behaviour is influenced by Agricola, Biosis and Zoological Record. other trophic levels (Price et al., 1980; Vet Books summarizing biological control pro- and Dicke, 1992; Dicke et al., 2003). The grammes may include much relevant infor- natural environment of a biological con- mation, e.g. global (Clausen, 1978), Canada trol agent is composed of relevant consti- (Mason and Huber, 2002), USA (Coulsen et tutive and induced chemicals, as well as al., 2000), Caribbean (Cock, 1985), Europe 48 J.C. van Lenteren et al.

(Greathead, 1976), Africa (Greathead, 1971; Special consideration should be given to Neuenschwander et al., 2003), Pacific designing tests for prey ranges of (Waterhouse and Norris, 1987), South-east polyphagous predators, where host size Asia (Waterhouse, 1998a), China (Water- and location might be a better guideline house, 1998b), Australia (Waterhouse and than phylogenetic relatedness. Moreover, a Sands, 2001) and New Zealand (Cameron et wider prey range needs to be tested than al., 1989). with many parasitoids because more intra- Early literature may have useful infor- guild predation is expected, as well as mation. For example, Compsilura concin- higher up trophic level effects (DeClerq, nata (Meigen), introduced from Europe 2002; van Lenteren et al., 2003). Also, into the USA against Gypsy moth, some adult predators accept a wider range Porthetria dispar (L.), was known to of prey than do their immature stages. develop on many non-target species in Others may have different prey require- Europe before it was released in the USA. ments or preferences to their immature More specialized literature on parasitoids, stages and require separate prey-range tests for example, Austin and Dowton (2000), if being considered as biological control often provides details of hosts for natural agents. For example, Causton et al. (2004) enemies in their countries of origin. tested, separately, adults and larvae of the Several early authors (e.g. in Clausen, coccinellid, Rodolia cardinalis (Mulsant), 1978) discussed alternative hosts of para- with a range of potential prey including the sitoids and prey as part of the biology of target – cottony cushion scale, Icerya pur- the agents in their native range. These chasi Maskell. They found that neonate lar- records when available give an indication vae of the predator were able to prey on of potential host range but often only pest only one of the non-target species tested, a species were documented and other, non- fluted scale, Margarodes similis Morrison, target, hosts were unrecorded. Only occa- but larvae were unable to moult to second sionally has the host range of a parasitoid instar or survive to complete development. been intentionally evaluated in the country In contrast, adults of this predator were of origin before its introduction somewhere able to survive on this non-target species of else. For example, Jones and Sands (1999) prey for periods of up to 13 days and have tested a eulophid larval parasitoid been known to subsist on a wider range of (Euplectrus melanocephalus Girault) of other insects and nectar for up to three fruit-piercing moths (Eudocima spp.) with months (Sands and Van Driesche, 2003). other non-target noctuid moth larvae to Other categories needing care with testing determine if it was suitable as an agent for are generalist parasitoids and (facultative) introduction into the Pacific region against hyperparasitoids (e.g. Sands and Van the major pest species, Eudocima fullonia Driesche, 2003). (Clerck). National, regional and global taxonomic works and databases should be consulted, Framework for Host-range Testing and will often provide useful supporting evidence and clues for appropriate host- All the above considerations may lead to specificity test organisms. Examples of the conclusion that host-range testing is too important sources include Krombein et al. complicated and produces unreliable (1979) on North American Hymenoptera, results. But based on the very limited num- Noyes (1998) on global Chalcidoidea, Yu ber of negative non-target effects known, and Horstmann (1997) on global we may conclude that biological control Ichneumonidae, etc. The availability of this workers have generally done an excellent type of information on the internet is con- job in making predictions about such stantly and rapidly growing, and a search effects in the past. That such predictions will reveal important new and relevant were, in addition to knowledge of system- sources. atics and field studies, often based on gut Host Specificity in Arthropod Biological Control 49

feeling, green fingers and informed guesses for specific situations. For example, steps 1 of biological control experts, does not and 2 can often be combined. Further, lessen our respect for our predecessors. when the behaviour of the natural enemy is Below and in Figure 3.1 we present a known, observations for steps 2 and 3 can design for a testing scheme to determine be automated, thereby reducing costs of host ranges of insect natural enemies. observation and data analysis. Because of the large variation in natural Additionally, the test sequence we present enemy-host relationships, this testing may be simplified if this can be based on sequence should be considered as a basic the biology of the natural enemy (e.g. approach, which will need to be adapted Babendreier et al., 2003a,b). Depending on

Step 1: Small arena no-choice black-box test No Insignificant NT Are non-target species attacked? effect

Yes

No, or at Step 2: Small arena no-choice behavioural test end of Insignificant NT Are non-target species attacked? observation effect

Yes, consistently

No, low Step 3: Large arena choice behavioural test rate, or no Insignificant NT Are non-target species attacked? switching effect

Yes, Significant NT effect consistently

Next step only for inundative control with native species or exotics that cannot establish

Step 4: Field test No Insignificant NT Are non-target species attacked? effect

Yes Significant NT effect

Fig. 3.1. Flow chart summarizing host-range assessment (testing does not necessarily start at step 1). NT = non-target. 50 J.C. van Lenteren et al.

the multitrophic system under considera- appropriate stage on the relevant part (e.g. tion, one does not necessarily have to start the leaf or a root) of its natural host plant? with step 1, but can start with approaches A positive control is performed with the in e.g. large arenas that allow a much more target species; a negative control is per- precise estimate of the host range. formed with the target and non-target Host-range testing can be carried out species without the natural enemy to check either as no-choice or choice. No-choice survival etc. of target species under test tests produce results that can easily be conditions. Detailed behavioural observa- analysed statistically, whereas choice test tions are not performed in step 1, but it is are more complicated to analyse. Attack suggested to check the activity (searching rates on targets and non-targets are not or not) of the natural enemy at the start of independent data, and the encounter rate testing, and after a certain interval (e.g. with targets and non-targets depends upon about 30 minutes) to be sure that lack of the depletion of the available hosts (unless attack in tests is not the effect of poor con- they are replaced as they are attacked). dition of natural enemies, but of rejection Thus the ratio of target to non-target hosts of the non-target. Consider that extensive does not remain stable over the course of stinging and superparasitism can lead to the experiment. If only one target host host mortality and prevent parasitoid remains in the arena and 20 non-target development, and thus potentially under- hosts are still available, the situation can- estimation of the host range. For predators, not be compared with a situation where consider the effect of cannibalism on prey both kinds of host would be available in range. equal numbers. On the other hand, no- choice tests may lead to the acceptance of PARAMETERS TO BE MEASURED FOR PARASITOIDS. non-target hosts under situations where no ● Number of hosts killed and not killed attack would occur in the presence of (predation, stinging, host feeding). target species. This would represent situa- ● Number of hosts parasitized and not tions where the target pest species in the parasitized (dissection, emergence of field are not yet present or have disap- adult parasitoids (emergence data may peared, or where natural enemies would underestimate the number of hosts para- disperse into habitats where only non-tar- sitized because of egg/larval/pupal mor- get species occur. Thus this approach tality and encapsulation of hosts)). might considerably overestimate the risk of ● Host suitability for parasitoid (attack attack on non-target species under field versus development). conditions. The tests described below are examples. For predators, analogous variables, such as There are a great many potential designs, number of prey attacked, development of and these will be determined by the nature immature stages, longevity and production of the interaction between the natural of offspring can be measured. enemy (parasitism, predation) and the habitat occupied by the organism. METHODS FOR ANALYSIS. Simple statistical For all tests, careful consideration of the tests suffice to show significant differences number of replicates is essential (see in host or prey attack. Hoffmeister et al., Chapter 13, this volume). This is of particular importance for INTERPRETATION. If none of the non-targets behavioural and host-choice tests. is attacked (with use of a sufficiently high number of replicates (see Hoffmeister et al., Chapter 13, this volume)) and the target Step 1: Small arena no-choice black-box test species (= positive control = pest species) The aim of this test is to answer the ques- is attacked at a rate approaching that in the tion: does the biological control agent field, one can stop testing, because no attack the non-target organism in the direct effects on the tested non-target Host Specificity in Arthropod Biological Control 51

species in field are expected. If non-target ● Encounter and attack rate over time for hosts are attacked, even at very low rates, non-target species to determine possible further testing is mandatory (see Step 2). increase in acceptance due to increasing oviposition/predation pressure. ● Latency time to first attack. Step 2: Small arena no-choice ● Adapt variables to be measured for behavioural test predators. The aim of this test is to answer the question: does the biological control agent con- METHODS FOR ANALYSIS. A comparison of the sistently attack the non-target organism on proportion of target and non-target hosts the appropriate substrate of its natural killed is best performed with a generalized host plant? A positive control is performed linear model with binomial distribution and with the target species; a negative control logit link function (see Hoffmeister et al., is done with the target and non-target Chapter 13, this volume). The positive con- species without the natural enemy. trol acts as a statistical control against the Superparasitism in the confines of a small treatment and the negative control. arena may lead to unnatural mortality of Alternatively, proportional values might be the host. Therefore, special precautions arcsine transformed and analysed with an may be necessary to deprive individual ANOVA-like approach. The latency times hosts of repeated oviposition after first until the first target and non-target hosts, oviposition to avoid host mortality. For respectively, are attacked can be analysed example, after first oviposition by C. eri- with survival analysis (Cox proportional onotae in a larva of Erionota thrax, hazard model (see Hoffmeister et al., Chapter repeated oviposition by parasitoids killed 13, this volume)). The attack rates over time the host, thus preventing any assessment should be analysed as number of accepted for parasitoid development (D.P.A. Sands, hosts vs number of rejected hosts for differ- unpublished results). With predators, the ent time intervals of the experiment. Since possibility of cannibalism in small arenas more than one data point from each individ- needs to be taken into account. ual enters the analysis, such data are appro- This no-choice test can overestimate the priately analysed with a Generalized risk of including the non-target species in Estimating Equations (GEE) generalized lin- the host range of the natural enemy. Large ear model for repeated measurements. arena tests with entire host plants (see below) can safeguard against this overesti- INTERPRETATION. If the target host (= positive mated hazard. Alternatives are to apply control = pest species) is attacked at a rate sequential alternate exposure of target and approaching that in the field, and the non- non-target species to avoid overestimating target host is not attacked at all (with a suffi- risk (Sands and Coombs, 1999), and to ciently high number of replicates (see compare ovipositional display of a para- Hoffmeister et al., Chapter 13, this volume)), sitoid on its known host with its behaviour one can stop testing, because no direct on a non-target species (Sands and Van effects on non-target species in the field are Driesche, 2003). expected. If attack rates are above zero for target and non-target hosts, but the attack on

TO BE MEASURED non-target hosts is signiﬁcantly lower than on target hosts, the hazard to non-target ● Number of hosts killed and not killed hosts under ﬁeld conditions might be low to (predation, stinging, host feeding). acceptable, and further testing should be ● Number of hosts parasitized and not considered. If non-targets are attacked only parasitized (dissection, emergence of at the end of the observation period (long adult parasitoids). latency time), then the risk of direct effects ● Host suitability for parasitoid (attack on these species is small. If non-target versus development). species are consistently attacked, with a 52 J.C. van Lenteren et al.

latency time similar to the target, and attack ● Adapt variables to be measured for rates on target and non-target hosts do not predators. differ significantly, non-target effects might be considerable and further testing is manda- METHODS FOR ANALYSIS. The negative con- tory. trol is used to correct for mortality of target and non-target hosts that is independent of the natural enemy under study. Using a Step 3: Large arena choice behavioural test generalized linear model with binomial The aim of this test is to answer the ques- distribution and logit link function (see tion: does the biological control agent Hoffmeister et al., Chapter 13, this vol- attack non-targets when target and non- ume), the proportion of non-target hosts target species are present in a semi-natural killed in the choice test is compared to the situation on their natural host plants? proportion of target hosts killed in the no- Present multiple host plants each with choice control and to the proportion of their own non-target species and the target non-target hosts killed in the no-choice species in a large arena; offer target and control. Note that the attack rate on target non-target hosts in as natural a situation as hosts in the choice test is not used in order possible and on their natural host plants; to achieve independent data. The latency positive controls are done in the same type times until the first target and non-target of cage with the natural enemy and the tar- hosts are attacked can be analysed with get host only, and the natural enemy and survival analysis (Cox proportional hazard the non-target host only; a negative control model (see Hoffmeister et al., Chapter 13, is performed with the target species and this volume)). Again, latency times on non- non-target species, but without the natural target hosts in the choice test are compared enemy. Care should be taken that the same with latency times on non-target and target number of total hosts is present at the start hosts in no-choice controls. The attack of each treatment. The experiments should rates over time should be analysed as num- be terminated before the target host is elim- ber of accepted hosts vs number of rejected inated, or in case of parasitoids, before hosts for different time intervals of the most target hosts are parasitized. Consider experiment. Since more than one data that extensive stinging and superparasitism point from each individual enters the can lead to host mortality and prevent par- analysis, such data are appropriately asitoid development, and thus to potential analysed with a GEE generalized linear underestimation of the host range. model for repeated measurements. In the choice test, only the data of the non-target TO BE MEASURED species are used because of the depen- ● Number of target and non-target hosts dency of data from target and non-target killed and not killed (predation, sting- species within the same cage. For preda- ing, host feeding). tors, special considerations apply, related ● Number of target and non-target hosts to cannibalism and mutual predation parasitized and unparasitized (dissec- between non-target/target and the predator. tion, emergence of adult parasitoids). If behavioural observation of the natural INTERPRETATION. Non-target species that are enemy is feasible, the latency time to easily attacked on their natural host plants, attack, as well as encounter and attack i.e. with similar latency times to target rates over time, should be noted in order hosts and with similar attack rates, pose a to determine host preference, eventual high risk for non-target effects. If latency changes in preference and a possible times of attack on a non-target species are increasing attack pressure of normally much higher and attack rates are much non-attacked hosts when the preferred lower than in the target control, the natural host is less available at the end of the enemy displays a strong preference for the observation period. target species, but may be prone to attack Host Specificity in Arthropod Biological Control 53

the non-target species under situations INTERPRETATION. If target species is easily where the target species is not present. If attacked, and no or low attack of non-target latency times in the choice test and the species occurs, a low risk for direct effects non-target control are much higher than in on non-target species is expected. If the the target control and the attack rates are biological control agent easily attacks non- much lower in the choice test and non- target species on their host plants in their target control than in the target control, the natural habitat, it poses a very high risk for risk of direct effects on the non-target non-target effects. species under ﬁeld conditions is small.

Interpretation of Data Obtained with Step 4: Field test Host-range Testing The aim of this test is to answer the question: does the biological control agent The first thing to consider when interpret- attack the non-target when the non-target ing host-range data is whether there might and the target species are present in their be any confusing effects of test conditions respective habitats? This test can only be (van Dijken et al., 1986; Sands and Van done safely in the area of release if the Driesche, 2000). Regularly observed con- biological control agent cannot establish fusing effects of test design are: in this area (e.g. agents from tropical areas ● Overestimated host ranges, in which to be used in greenhouses in temperate non-hosts are used by agents when climates). The test can be done in the deprived for long periods of their nor- native area of the natural enemy if the mal hosts. non-target species also occur in this area. ● Overestimated host ranges in which Sometimes surrogate species, i.e. close non-hosts are used when in close prox- relatives of the non-target species that imity to the normal host due to transfer- occurs in the planned area of release, can ence of stimuli. be used for testing, but it must be remem- ● Underestimated host ranges in which bered that some agents exhibit a high valid, but less preferred, hosts are degree of specificity and the surrogate ignored in the presence of a more pre- may not necessarily be a potential host. ferred host. Release the natural enemy in the non- target habitat, and determine if there is This is one reason why we do not suggest any attack of non-target species. Control: choice tests in small arenas and why a non- put target species on target host plant in target control is essential in a large arena the non-target habitat. Replicate the test. The disruption to insect behaviour approach in a number of plots. when they are held in confinement, or outdoors in cages, is well known for biological TO BE MEASURED. Number of hosts killed control agents generally (Sands, 1993) and (predation, stinging, host feeding) and not more especially for arthropod agents killed, number of hosts parasitized and (Sands and Papacek, 1993). Sometimes a unparasitized (dissection, emergence of particular host will be accepted in labora- adult parasitoids). Adapt variables to be tory trials but when released into the field, measured for predators. the agent will ignore it. This anomaly commonly leads to overestimated host-range METHODS FOR ANALYSIS. Use generalized predictions for an agent and may lead to linear models with binomial distribution discontinuation of evaluation studies and logit link function for analysis of mor- which, if continued, might have shown tality rates of target and non-target hosts. high degrees of host specificity. Use plot as factor to control for the Laboratory evaluation for host prefer- deviance that is explained by the plot per ences, in contrast to host acceptance, is se (prevalence of natural enemy). even more difficult for accurate predictions 54 J.C. van Lenteren et al.

for an effective agent. For example, the a rather restricted host range, were found ladybird beetle, Curinus coeruleus to attack a number of other species in the (Mulsant), was introduced into Hawaii from area of release (e.g. Brower, 1991; Barratt et Mexico in 1922 as a general predator pri- al., 1997). Perhaps even more unantici- marily to control a coconut mealybug, labo- pated was the finding that a natural enemy, ratory tests having shown the agent as shown to be polyphagous at one location, thriving on this prey. Although this lady- appeared to perform as a monophagous bird beetle became established, it remained natural enemy after introduction in another scarce and ineffective as an agent against region (Salerno et al., 2002). Conclusions the target mealybug. However, in 1984 the about host specificity can, therefore, sel- ladybird beetle suddenly increased in abun- dom be made purely on data collected in dance following introduction from Central the area of origin of the biological control America of a more suitable host, a psyllid, agent, although this is an important first Heteropsylla cubana Crawford. Curinus step (Kuhlmann et al., 2000). coeruleus has since been recognized as a The most difficult group for interpreta- most important agent almost specifically tion of host-range data will be the more adapted to H. cubana in many countries pronounced oligophagous and slightly where the latter has become a pest polyphagous biological control agents. (Waterhouse and Norris, 1987). Not all These agents might first of all not be the potential agents are affected by confine- most efficient natural enemies and result ment during tests for host preference or in intermediate or partial control, and may specificity but it is important to be wary of also show more severe non-target effects this problem arising and, depending on the when compared to strongly polyphagous suspected nature of the problem, to adjust species. However, hosts in the native range the design of experiments to minimize or may all be closely related to the target prevent overestimated host ranges in species and closely related species may be agents. If laboratory host-range tests remain absent in a receiving country, greatly inconclusive, decisions whether or not to reducing the risks of non-target attack. release an agent may depend on informa- This group of natural enemies needs to be tion from its native range or from countries studied carefully, and more case studies where it has already been introduced. are needed. Next, there is the problem of when to Host-range data have earlier been used reject a natural enemy for release. How to reject introductions. For example, Sands many non-target species should be in the and Van Driesche (2000) reported that four host range of a biological control agent in egg parasitoids in the genus Ooencyrtus order to decide it is unsafe? How much were not released in the USA for control of population reduction of a non-target can be Nezara viridula because they were shown accepted before it should be rejected for to attack at least 20 species of unrelated release? native Heteroptera. The decision not to For mono- or slightly oligophagous, and release them was based on their wide host for clearly polyphagous, biological control ranges and lack of evidence that they were agents, the above host-range testing frame- effective in suppressing the target pest in work will usually lead to clear answers their native ranges (Jones, 1988). We do not about risks for non-target species. Indeed, know of any other clear examples stressing in a number of cases, host-specificity data the importance of efficacy in selecting or from mono- or slightly oligophagous rejecting a natural enemy for release (but species found in the literature were con- see van Lenteren and Woets, 1988), and we firmed when exposed to new non-target propose that this point should be consid- host species (e.g. Cameron and Walker, ered more seriously in future evaluation 1997), but exceptions do occur. For programmes. example, natural enemy species that were In another case, host-range data were considered to be monophagous, or to have used to release parasitoids in some coun- Host Specificity in Arthropod Biological Control 55

tries, but not in others. Two egg parasitoids region (González and Cock, 2004). from Papua New Guinea (Telenomus lucul- Nevertheless, such host-range expansions, lus Nixon and Ooencyrtus sp. papilionis host shifts, or host race formations seem species group) were evaluated in contain- not to occur so often that they represent a ment for their suitability as biological con- major concern for the release of otherwise trol agents for the fruit-piercing moth, host-specific insectan natural enemies. Eudocima fullonia, in Australia and the Pacific region. Studies on the host specificity of both parasitoids indicated that Conclusions their host range was confined to noctuid species belonging to the genus Eudocima, Determination of host specificity of (gener- of which several were also pest species. alist) natural enemies will always be a Both egg parasitoids were shown to com- complicated and time-consuming affair. plete development on the common pest First, there is the problem of the selection species of Eudocima, but a rare Australian of appropriate non-target species to be species, E. iridescens, could not be tested (see Kuhlmann et al., Chapter 2, this obtained for testing (D.P.A. Sands, unpub- volume). Next, a set of tests needs to be lished results). The decision not to release chosen which is suitable, and thus usually the egg parasitoids in Australia was made quite specific to the natural enemy under even though the rare non-target species, E. evaluation. The sequential host-range iridescens, was also indigenous to Papua assessment design presented in this chap- New Guinea. In contrast, the two para- ter is new, although it is constructed from sitoids were approved for introduction into elements that have been developed and Samoa, Fiji and Tonga (Sands et al., 1993), tested earlier. Step 1 and 2 tests have previ- countries where E. iridescens does not ously been used in decision-making about occur. The parasitoids subsequently release or not. Step 3 tests have been used became established without any observed in a few cases only. Step 4 tests have not detrimental impacts on non-target species yet been used and we would expect their in those three countries. use to be infrequent. We propose to use This is not to say that host-range expan- this sequential test when the environmen- sions, host shifts, host race formation or tal risks of new exotic natural enemies speciation cannot occur in introduced bio- need to be determined. We have already logical control agents. While, to our knowl- indicated that, depending on the type of edge, no recent example is available for natural enemy and the ecosystem where it introduced insect parasitoids, there are will be released, the testing sequence might reports of relatively generalist indigenous need to be adapted. We also realize that parasitoids adapting over several years to this sequential design will undergo attack introduced pests. Equally, some her- changes with growing experience. bivorous insects such as tephritid fruit flies After host-range testing, there is the provide a well-known example of evolu- issue of interpretation of data obtained tionary host race formation in ecological from the various tests. For all these phases, time (Berlocher and Feder, 2002). Apple arthropod biological control workers have maggot flies, Rhagoletis pomonella just started to develop a theoretical and (Walsh), seem to have switched to cherries methodological background. Finally, the within the last century (Jones et al., 1989). risk posed by and the benefits resulting There are several similar examples from from the release of the exotic biological the pest literature, e.g. a castniid, Telchin control agent should be weighted against licus (Drury), now known as the large moth the risks and benefits of any other control borer of sugar cane, adapted to sugar cane method under consideration (van Lenteren as a new host in Guyana at the beginning of et al., 2003; van Lenteren and Loomans, the 20th century, about two centuries after Chapter 15, this volume; Bigler and sugar cane was first introduced to the Kölliker-Ott, Chapter 16, this volume). 56 J.C. van Lenteren et al.

Several reviews address the issue of erate non-target mortality high enough non-target impacts in biological control to imply a population-level impact. (e.g. Howarth, 1983, 1991; Pimentel et al., Less than 10% of these agents are esti- 1984; Harris, 1990; Lockwood, 1996; mated to have caused a population- Simberloff and Stiling, 1996; Samways, level impact. 1997; Stiling and Simberloff, 1999; Louda ● In augmentative/inundative types of et al., 2003; van Lenteren et al., 2006). biological control many of the natural Earlier papers raised questions regarding enemies used are generalists, but cannot specific biological control introductions, establish and, therefore, their use is con- and brought up many conceptual issues sidered sufficiently safe because they regarding the potential complexity of only cause transitory effects. Still, sev- such effects (e.g. Howarth, 1983, 1991; eral quite serious local population Harris, 1990). More recent papers, such as effects were found. Stiling and Simberloff (1999), begin to ● A large proportion (about 35%) of cases tackle the problem in a more quantitative where agents have established on the manner. However, there is still a need for target, but have not led to a biological further quantitative analysis, for the control success, have been recorded as bringing together of a more exhaustive inducing non-target effects or minor list of examples, and in general to go fur- impact (meaning some attack of non- ther beyond the anecdotal. Most would targets, but without reducing population agree that the examples discussed in densities of the non-target). Howarth (1991), Simberloff and Stiling (1996), Louda et al. (2003), and in other The exhaustive data search of Lynch et al. similar papers, while they highlight the (2001), in which more than 5000 recorded potential pitfalls of biological control and biological control cases were analysed and the potential complexity of non-target 30 international biological control experts effects in practice, do not provide enough were contacted for additional information, evidence to make rational assessments has underlined our ignorance of the degree about non-target effects (Lynch et al., to which non-target effects occur. Host- 2001; van Lenteren et al., 2003). range testing, combined with pre- and An extensive evaluation of data of hun- post-release studies, need to become stan- dreds of biological control projects by dard procedures in each biological control Lynch et al. (2001) showed the following project (Coombs, 2003). That this does not with regard to host specificity and non- necessarily result in fewer introductions of target effects: exotic biological control agents has been ● Of the more than 5000 classical intro- shown by the recent evaluation of the ductions of insects against insects, 80 IPPC Code of Conduct (Kairo et al., 2003), (i.e. 1.5%) cases had one or more non- but it does lead to higher costs and delay target effect record associated with of introduction. However, if higher costs them. It should be realized, however, and later introduction do result in fewer that only a minority of these cases serious mistakes, the investments are cer- included a careful evaluation of non- tainly justified. target effects. On the other hand, if strong non-target effects had appeared, they would have been perceived and Acknowledgements recorded. ● These cases suggest that most of the Peter Mason, David Gillespie and Eric agents used in classical biological con- Conti are thanked for reviewing this chap- trol which utilized non-target hosts, ter and for suggesting several important did so at a low level, and did not gen- improvements. Host Specificity in Arthropod Biological Control 57

References

Austin, A.D. and Dowton, M. (2000) Hymenoptera Evolution, Biodiversity and Biological Control. CSIRO Press, Melbourne, Australia. Babendreier, D., Kuske, S. and Bigler, F. (2003a) Non-target host acceptance and parasitism by Trichogramma brassicae Bezd. (Hym.: Trichogrammatidae) in the laboratory. Biological Control 26, 128–138. Babendreier, D., Kuske, S. and Bigler, F. (2003b) Parasitism of non-target butterflies by Trichogramma brassicae Bezd. (Hym.: Trichogrammatidae) under field and cage conditions. Biological Control 26, 139–145. Barratt, B.I.P., Evans, A.A., Ferguson, C.M., Barker, G.M., McNeill, M.R. and Phillips, C.B. (1997) Laboratory non-target host range of the introduced parasitoids Microctonus aethiopoides and Microctonus hyperodae (Hymenoptera: Braconidae) compared with field parasitism in New Zealand. Environmental Entomology 26, 694–702. Barratt, B.I.P., Philips, C.B., Ferguson, C.M. and Goldson, S.L. (2003) Predicting non-target impacts of parasitoids: where to go from here? In: Van Driesche, R.G. (ed.) Proceedings of the International Symposium on Biological Control of Arthropods, Honolulu, Hawaii, 14–18 January 2002. FHTET-2003-05. United States Department of Agriculture, Forest Service, Morgantown, West Virginia, pp. 378–386. Bartlett, A.C. (1984a) Establishment and maintenance of insect colonies through genetic control. In: King, E.G. and Leppla, N.C. (eds) Advances and Challenges in Insect Rearing. United States Department of Agriculture, Agricultural Research Service, Southern Region, New Orleans, Louisiana, p. 1. Bartlett, A.C. (1984b) Genetic changes during insect-domestication. In: King, E.G. and Leppla, N.C. (eds) Advances and Challenges in Insect Rearing. United States Department of Agriculture, Agricultural Research Service, Southern Region, New Orleans, Louisiana, pp. 2–8. Bartlett, A.C. (1985) Guidelines for genetic diversity in laboratory colony establishment and maintenance. In: Singh, P. and Moore, R.F. (eds) Handbook of Insect Rearing, Vol 1. Elsevier, Amsterdam, pp. 7–17. Berlocher, S.H. and Feder, J.L. (2002) Sympatric speciation in phytophagous insects: Moving beyond controversy? Annual Review of Entomology 47, 773–815. Bjørnson, S. and Schütte, C. (2003) Pathogens of mass-produced natural enemies and pollinators. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 133–165. Boeye, J., Laborius, G.A. and Schultz, F.A. (1992) The response of Teretriosoma nigrescens Lewis (Col.: Histeridae) to the pheromone of Prostephanus truncatus (Horn) (Col.: Bostrichidae). Anzeiger für Schädlingskunde, Pflanzenschutz, Umweltschutz 65, 153–157. Boller, E.F. (1979) Behavioral aspects of quality in insectary production. In: Hoy, M.A. and McKelvey, J.J. (eds) Genetics in Relation to Insect Management. Rockefeller Foundation, New York, pp. 153–160. Booth, R.G., Cross, A.E., Fowler, S.V. and Shaw, R.H. (1995) The biology and taxonomy of Hyperaspis pantherina (Coleoptera: Coccinellidae) and the classical biological control of its prey, Orthezia insignis (Homoptera: Ortheziidae). Bulletin of Entomological Research 85, 307–314. Borgemeister, C., Holst, N. and Hodges, R.J. (2003) Biological control and other pest management options for larger grain borer Prostephanus truncatus. In: Neuenschwander, P., Borgemeister, C. and Langewald, J. (eds) Biological Control in IPM Systems in Africa. CABI Publishing, Wallingford, UK, pp. 311–328. Brewer, R.H. (1971) The influence of the parasite, Comperiella bifasciata How., on populations of two species of armoured scales, Aonidiella aurantii (Mask.) and A. citrina (Coq.) in South Australia. Australian Journal of Zoology 19, 53–63. Brower, J.H. (1991) Potential host range and performance of a reportedly monophagous parasitoid, Pteromalus cerealellae (Hymenoptera: Pteromalidae). Entomological News 102, 231–235. Cameron, P.J., Hill, R.L., Bain, J. and Thomas, W.P. (1989) A Review of Biological Control of Invertebrate Pests and Weeds in New Zealand 1874 to 1987. Technical Communication No. 10, CAB International Institute of Biological Control, CAB International, Farnham Royal, UK. 58 J.C. van Lenteren et al.

Cameron, P.J. and Walker, G.P. (1997) Host specificity of Cotesia rubecula and Cotesia plutellae, parasitoids of white butterfly and diamondback moth. In: O’Callaghan, M. (ed.) 50th Conference Proceedings of the New Zealand Plant Protection Society Incorporated, Lincoln University, Canterbury, New Zealand. 18–21 August 1997. The New Zealand Plant Protection Society Incorporated, New Zealand, pp. 236–241, http://www.hortnet.co.nz/publications/nzpps/proceedings/97/97_236.pdf (accessed 1 September 2004). Causton, C.E., Lincango, M.P. and Poulsom, T.G.A. (2004) Feeding range studies of Rodolia cardinalis (Mulsant), candidate biological control agent of Icerya purchasi Maskell in the Galápagos Islands. Biological Control 29, 315–325. Clausen, C.P. (1978) Introduced Parasites and Predators of Arthropod Pests and Weeds: A World Review. Agricultural Handbook No. 480. United States Department of Agriculture, Washington DC, USA. Cock, M.J.W. (1985) A Review of Biological Control of Pests in the Commonwealth Caribbean and Bermuda up to 1982. Technical Communication No. 9, Commonwealth Institute of Biological Control, Commonwealth Agricultural Bureaux, Farnham Royal, UK. Cock, M.J.W. (2003) Risks of non-target impact versus stakeholder benefits in classical biological control of arthropods: selected case studies from developing countries. In: Van Driesche, R.G. (ed.) Proceedings of the International Symposium on Biological Control of Arthropods, Honolulu, Hawaii, 14–18 January 2002. FHTET-2003-05. United States Department of Agriculture, Forest Service, Morgantown, West Virginia, pp. 25–33. Conti, E., Salerno, G., Bin, F. and Vinson, S. (2004) The role of host semiochemicals in parasitoid specificity: a case study with Trissolcus brochymenae and Trissolcus simoni on pentatomid bugs. Biological Control 29, 435–444. Coombs, M. (2003) Post-release evaluation of Trichopoda giacomellii (Diptera: Tachinidae) for efficacy and non-target effects. In: Van Driesche, R.G. (ed.) Proceedings of the International Symposium on Biological Control of Arthropods, Honolulu, Hawaii, 14–18 January 2002. FHTET-2003-05. United States Department of Agriculture, Forest Service, Morgantown, West Virginia, pp. 399–406. Coulsen, J.R., Vail, P.V., Dix, M.E., Nordlund, D.A and Kauffman, W.C. (2000) 110 Years of Biological Control Research and Development in the United States Department of Agriculture: 1883–1993. United States Department of Agriculture Agricultural Research Service. DeClerq, P. (2002) Dark clouds and their silver linings: exotic generalist predators in augmentative biological control. Neotropical Entomology 31, 169–176. Dicke, M. (1999) Direct and indirect effects of plants on beneficial organisms. In: Ruberson, J.R. (ed.) Handbook of Pest Management. Marcel Dekker, New York, pp. 105–153. Dicke, M. (2000) Chemical ecology of host-plant selection by herbivorous arthropods: a multitrophic perspective. Biochemical Systematics and Ecology 28, 601–617. Dicke, M. and van Loon, J.J.A. (2000) Multitrophic effects of herbivore-induced plant volatiles in an evolutionary context. Entomologia Experimentalis et Applicata 97, 237–246. Dicke, M. and Vet, L.E.M. (1999) Plant-carnivore interactions: evolutionary and ecological consequences for plant, herbivore and carnivore. In: Olff, H., Brown, V. and Drent, R.H. (eds) Herbivores between Plants and Predators. Blackwell Science, Oxford, UK, pp. 483–520. Dicke, M., de Boer, J.G., Höfte, M. and Rocha-Granados, M.C. (2003) Mixed blends of herbivore- induced plant volatiles and foraging success of carnivorous arthropods. Oikos 101, 38–48. Doutt, R.L. (1959) The biology of parasitic Hymenoptera. Annual Review of Entomology 4, 161–182. Follett, P.A., Duan, J., Messing, R.H. and Jones, V.P. (2000) Parasitoid drift after biological control introductions: re-examining Pandora’s box. American Entomologist 46, 82–94. Fransen, J.J. and van Lenteren, J.C. (1993) Host selection and survival of the parasitoid Encarsia formosa on greenhouse whitefly, Trialeurodes vaporariorum, in the presence of hosts infected with the fungus Aschersonia aleyrodes. Entomologia Experimentalis et Applicata 69, 239–249. González, J.M. and Cock, M.J.W. (2004) A synopsis of the Castniidae (Lepidoptera) of Trinidad and Tobago. Zootaxa 762, 1–19. Goodwin, R.H. (1984) Recognition and diagnosis of diseases in insectaries and the effects of disease agents on insect biology. In: King, E.G. and Leppla, N.C. (eds) Advances and Challenges in Insect Rearing. United States Department of Agriculture, Agricultural Research Service, Southern Region, New Orleans, Louisiana, pp. 96–129. Host Specificity in Arthropod Biological Control 59

Greathead, D.J. (1971) A Review of Biological Control in the Ethiopian Region. Technical Communication No. 5, Commonwealth Institute of Biological Control. Commonwealth Agricultural Bureaux, Farnham Royal, UK. Greathead, D.J. (1976) A Review of Biological Control in Western and Southern Europe. Technical Communication No. 7, Commonwealth Institute of Biological Control. Commonwealth Agricultural Bureaux, Farnham Royal, UK. Grenier, S. and DeClerq, P. (2003) Comparison of artiﬁcially vs. naturally reared natural enemies and their potential for use in biological control. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 115–131. Harris, P. (1990) Environmental impact of introduced biological control agents. In: Mackauer, M., Ehler, L.E. and Roland, J. (eds) Critical Issues in Biological Control. Intercept Ltd, Andover, UK, pp. 289–300. Harvey, J.A., van Dam, N.M. and Gols, R. (2003) Interaction over four trophic levels: food-plant quality affects development of a hyperparasitoid as mediated through a herbivore and its primary parasitoid. Journal of Animal Ecology 72, 520–531. Heimpel, G.E. and Rosenheim, J.A. (1998) Egg limitation on parasitoids: a review of the evidence and a case study. Biological Control 11, 160–168. Herting, B. (1971–1982) A Catalogue of Parasites and Predators of Terrestrial Arthropods. 9 parts in 3 sections. Commonwealth Agricultural Bureaux, Farnham Royal, UK. Hoekstra, R.F. (2003) Adaptive recovery after ﬁtness reduction: the role of population size. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 89–92. Hopper, K.R. (2001) Research needs concerning non-target impacts of biological control introductions. In: Wajnberg, E., Scott, J.C. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 39–56. Howarth, F.G. (1983) Classical biological control: Panacea or Pandora’s box. Proceedings of the Hawaiian Entomological Society 24, 234–244. Howarth, F.G. (1991) Environmental impacts of classical biological control. Annual Review of Entomology 36, 485–509. IPPC (International Plant Protection Convention) (1996) Code of conduct for the import and release of exotic biological control agents. International Standards for Phytosanitary Measures No. 3, 23 pp. Food and Agricultural Organization of the United Nations, Rome, Italy. Jones, P. and Sands, D.P.A. (1999) Euplectrus melanaocephalus Girault (Hymenoptera: Eulophidae), an ectoparasitoid of larvae of fruit piercing moths (Noctuidae: Catocalinae) from northern Queensland. Australian Journal of Entomology 37, 377–381. Jones, V.P., Davis, D.W., Smith, S.L. and Allred, D.B. (1989) Phenology of apple maggot, Rhagoletis pomonella (Diptera: Tephritidae) associated with cherry and hawthorn in Utah. Journal of Economic Entomology 82, 788–792. Jones, W.A. (1988) World review of the parasitoids of the southern green stink bug, Nezara viridula (L.) (Heteroptera: Pentatomidae). Annals of the Entomological Society of America 81, 262–273. Kairo, M.T.K., Pollard, G.V., Peterkin, D.D. and Lopez, V.F. (2000) Biological control of the hibiscus mealybug, Maconellicoccus hirsutus Green (Hemiptera: Pseudococcidae) in the Caribbean. Integrated Pest Management Reviews 5, 241–254. Kairo, M.T.K., Cock, M.J.W. and Quinlan, M.M. (2003) An assessment of the use of the Code of Conduct for the Import and Release of Exotic Biological Control Agents (ISPM No. 3) since its endorsement as an international standard. Biocontrol News and Information 24, 15N–27N. Kareiva, P. and Sahakian, R. (1990) Tritrophic effects of a simple architectural mutation in pea plants. Nature 345, 433–434. Kenis, M., Haye, T., Casagrande, R.A., Gold, M.S. and Tewksbury, L.A. (2003) Selection and importation of European parasitoids for the biological control of the lily leaf beetle in North America, and prospects for control in Europe. In: Van Driesche, R.G. (ed.) Proceedings of the International Symposium on Biological Control of Arthropods, Honolulu, Hawaii, 14–18 January 2002. FHTET-2003-05. United States Department of Agriculture, Forest Service, Morgantown, West Virginia, pp. 416–419. Krombein, K.V., Hurd, Jr. P.D., Smith, D.R. and Burks, B.D. (1979) Catalog of Hymenoptera in America North of Mexico. Smithsonian Institution Press, Washington DC. 60 J.C. van Lenteren et al.

Kuhlmann, U. and Mason, P.G. (2003) Use of field host range surveys for selecting candidate non- target species for physiological host specificity testing of entomophagous biological control agents. In: Van Driesche, R.G. (ed.) Proceedings of the International Symposium on Biological Control of Arthropods, Honolulu, Hawaii, 14–18 January 2002. FHTET-2003-05. United States Department of Agriculture, Forest Service, Morgantown, West Virginia, pp. 370–377. Kuhlmann, U., Mason, P.G. and Foottit, R.G. (2000) Host specificity assessment of European Peristenus parasitoids for classical biological control of native Lygus species in North America: use of field host surveys to predict natural enemy habitat and host ranges. In: Van Driesche, R.G., Heard, T.A., McClay, A.S. and Reardon, R. (eds) Proceedings: Host Specificity Testing of Exotic Arthropod Biological Control Agents: the Biological Basis for Improvement in Safety. Xth International symposium on Biological Control of Weeds, July 4–14, 1999, Bozeman, Montana. FHTET-99-1. USDA Forest Service Bulletin, Morgantown, West Virginia, pp. 84–95. Lewis, W.J., Vet, L.E.M., Tumlinson, J.H., van Lenteren, J.C. and Papaj, D.R. (2003) Variations in natural-enemy foraging behaviour: essential element of a sound biological-control theory. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 41–58. Lockwood, J.A. (1996) The ethics of biological control: understanding the moral implications of our most powerful ecological technology. Agriculture and Human Values 13, 2–19. Lopez, V.F. and Kairo, M.T.K. (2003) Host range of Nephaspis bicolor Gordon (Coleoptera: Coccinellidae), a potential biocontrol agent of Aleurodicus dispersus and other Aleurodicus spp. (Aleyrodidae: Homoptera). International Journal of Pest Management 49, 75–88. Louda, S.M., Pemberton, R.W., Johnson, M.T. and Follett, P.A. (2003) Nontarget effects: the Achilles’ Heel of biological control? Retrospective analyes to reduce risk associated with biocontrol introductions. Annual Review of Entomology 48, 365–369. Lynch, L.D., Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Gao, Z.-H., Kuske, S., Loomans, A., Menzler-Hokkanen, I., Thomas, M.B., Tommasini, G., Waage, J., van Lenteren, J.C. and Zeng, Q.-Q. (2001) In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 99–125. Mansfield, S. and Mills, N.J. (2004) A comparison of methodologies for the assessment of host preference of the gregarious egg parasitoid Trichogramma platneri. Biological Control 29, 323–340. Mason, P.G. and Huber, J.T. (2002) Biological Control Programmes in Canada, 1981–2000. CABI Publishing, Wallingford, UK. Morrison, R.K. and King, E.G. (1977) Mass production of natural enemies. In: King, E.G. and Leppla, N.C. (eds) Advances and Challenges in Insect Rearing. United States Department of Agriculture, Agricultural Research Service, Southern Region, New Orleans, Louisiana, pp. 183–217. NAPPO (North American Plant Protection Organization) (2004) Guidelines for Construction and Operation of a Containment Facility for Insects and Mites used as Biological Control Agents. RSPM No. 22 (See also http://www.nappo.org/Standards/NEW/RSPM%20No22-e.pdf (accessed 1 December 2004)). Neuenschwander, P. and Markham, R. (2001) Biological control in Africa and its possible effects on biodiversity. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 127–146. Neuenschwander, P., Borgemeister, C. and Langewald, J. (2003) Biological Control in IPM Systems in Africa. CABI Publishing, Wallingford, UK. Noyes, J.S. (1998) Catalogue of Chalcidoidea of the World. CD-ROM. Expert Center for Taxonomic Identification (ETI), Amsterdam, The Netherlands. (See also http://www.nhm.ac.uk/entomology/ chalcidoids/index.html (accessed 1 December 2004)). Nunney, L. (2003) Managing captive populations for release: a population-genetic perspective. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 73–87. Paine, R.W. (1935) The control of the coconut spike moth (Tirathaba trichogramma Meyr.) in Fiji. Fiji Department of Agriculture Bulletin 18, 1–30. Paine, R.W. (1994) Recollections of a Pacific Entomologist 1925–1966. ACIAR Monograph 27. Australian Centre for International Agricultural Research, Canberra, Australia. Papaj, R.D. and Vet, L.E.M. (1990) Odor learning and foraging success in the parasitoid, Leptopilina heterotoma. Journal of Chemical Ecology 16, 3137–3150. Pimentel, D., Glenister, C., Fast, S. and Gallahan, D. (1984) Environmental risks of biological pest controls. Oikos 42, 283–290. Host Specificity in Arthropod Biological Control 61

Prakash, S. (1973) Patterns of gene variation in central and marginal populations of Drosophila robusta. Genetics 75, 347–369. Price, P.W., Bouton, C.E., Gross, P., McPheron, B.A., Thompson, J.N. and Weis, A.E. (1980) Interactions among three trophic levels: influence of plant on interactions between insect herbivores and natural enemies. Annual Review of Ecology and Systematics 11, 41–65. Quinlan, M.M., Mumford, J.D., Waage, J.K. and Thomas, M. (2003) Proposal for revision of Code of Conduct. Biocontrol News and Information 24, 1N–14N. Rees, D.P., Rodriguez Rivera, R. and Herrera Rodriguez, F.J. (1990) Observations of the ecology of Teretriosoma nigrescens Lewis, (Col: Histeridae) and its prey Prostephanus truncates (Horn) (Col.: Bostrichidae) in the Yucatan peninsula, Mexico. Tropical Science 30, 153–165. Salerno, G., Colazza, S. and Bin, F. (2002) Nezara viridula (Heteroptera: Pentatomidae) parasitism by the tachinid fly Trichopoda pennipes ten years after its accidental introduction into Italy from the New World. BioControl 47, 617–624. Samways, M.J. (1997) Classical biological control and biodiversity conservation: what risks are we prepared to accept? Biodiversity and Conservation 6, 1309–1316. Sands, D.P.A. (1993) Artifacts of confinement in parasitoid/host interactions: interpretation and assessment for biological control of arthropod pests. In: Corey, S.A., Dall, D.J. and Milne, W.M. (eds) Pest Control and Sustainable Agriculture. CSIRO Press, Melbourne, Australia, pp. 196–199. Sands, D.P.A. (1998) Guidelines for testing host specificity of agents for biological control of arthropod pests. In: Zalucki, M.P., Drew, R. and White, G. (eds) Pest Management – Future Challenges. Proceedings of the Sixth Australian Applied Entomological Research Conference, Brisbane, 29 September–2 October 1998. University of Queensland Press, Brisbane, Australia, pp. 556–560. Sands, D.P.A. and Coombs, M.T. (1999) Evaluation of the Argentinian parasitoid, Trichopoda giacomellii (Diptera: Tachinidae), for biological control of Nezara viridula (Hemiptera: Pentatomidae) in Australia. Biological Control 15, 19–24. Sands, D.P.A. and Papacek, D.F. (1993) Specificity requirements of exotic agents for biological control of arthropod pests. In: Corey, S.A., Dall, D.J. and Milne, W.M. (eds) Pest Control and Sustainable Agriculture. CSIRO Press, Melbourne, Australia, p. 495. Sands, D.P.A. and Van Driesche, R.G. (2000) Evaluating host specificity of agents for biological control of arthropods: rationale, methodology and interpretation. In: Van Driesche, R.G., Heard, T.A., McClay, A.S. and Reardon, R. (eds) Proceedings: Host Specificity Resting of Exotic Arthropod Biological Control Agents: the Biological Basis for Improvement in Safety. Xth International symposium on Biological Control of Weeds, July 4–14, 1999, Bozeman, Montana. FHTET-99-1. USDA Forest Service Bulletin, Morgantown, West Virginia, pp. 69–83. Sands, D.P.A. and Van Driesche, R.G. (2003) Host range testing: techniques for parasitoids and predators. In: Van Driesche, R.G. (ed.) Proceedings of the International Symposium on Biological Control of Arthropods, Honolulu, Hawaii, 14–18 January 2002. FHTET-2003-05. United States Department of Agriculture, Forest Service, Morgantown, West Virginia, pp. 41–53. Sands, D.P.A., Lukins, R.G. and Snowball, G.J. (1986) Agents introduced into Australia for the biological control of Gascardia destructor (Newstead) (Hemiptera: Coccidae). Journal of the Australian Entomological Society 25, 51–59. Sands, D.P.A., Liebregts, W.J.M.M. and Broe, R.J. (1993) Biological control of the fruit piercing moth, Othreis fullonia (Clerck) (Lepidoptera: Noctuidae). Micronesica Suppl. 4, 25–31. Schoonhoven, L.M., Jermy, T. and van Loon, J.J.A. (1998) Insect-Plant Biology: from Physiology to Evolution. Chapman and Hall, London, UK. Shapiro, M. (1984) Micro-organisms as contaminants and pathogens in insect rearing. In: King, E.G. and Leppla, N.C. (eds) Advances and Challenges in Insect Rearing. United States Department of Agriculture, Agricultural Research Service, Southern Region, New Orleans, Louisiana, pp. 130–142. Sikorowski, P.P. (1984) Microbial contamination in insectaries. In: King, E.G. and Leppla, N.C. (eds) Advances and Challenges in Insect Rearing. United States Department of Agriculture, Agricultural Research Service, Southern Region, New Orleans, Louisiana, pp. 143–153. Simberloff, D. and Stiling, P. (1996) How risky is biological control. Ecology 77, 1965–1974. Singh, P. and Moore, R.F. (1985) Handbook of Insect Rearing, 2 Volumes. Elsevier, Amsterdam, The Netherlands. 62 J.C. van Lenteren et al.

Smith, D., Beattie, G.A.C and Broadley, R. (1997) Citrus Pests and their Natural Enemies. Department of Primary Industries, Brisbane, Australia. Spurway, H. (1955) The causes of domestication: an attempt to integrate some ideas of Konrad Lorenz with evolution theory. Journal of Genetics 53, 325–362. Stiling, P. and Simberloff, D. (1999) The frequency and strength of non-target effects of invertebrate biological control agents of plant pests and weeds. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 31–44. Stouthamer, R. (2003) The use of unisexual wasps in biological control. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 93–113. Taylor, T.H.C. (1935) The campaign against Aspidiotus destructor in Fiji. Bulletin of Entomological Research 26, 1–102. Thompson, W.R. (1943–1965) A Catalogue of the Parasites and Predators of Insect Pests. 18 parts in 4 sections. Commonwealth Agricultural Bureaux, Farnham Royal, UK. Tothill, J.D., Taylor, T.H.C. and Paine, R.W. (1930) The Coconut Moth in Fiji. A History of its Control by Means of Parasites. Imperial Bureau of Entomology, London, UK. Turnbull, A.L. and Chant, D.A. (1961) The practice and theory of biological control of insects in Canada. Canadian Journal of Zoology 39, 697–753. van Dijken, M.J., Kole, M., van Lenteren, J.C. and Brand, A.M. (1986) Host-preference studies with Trichogramma evanescens Westwood (Hym., Trichogrammatidae) for Mamestra brassicae, Pieris brassicae and Pieris rapae. Journal of Applied Entomology 101, 64–85. van Lenteren, J.C. (1997) From Homo economicus to Homo ecologicus: towards environmentally safe pest control. In: Rosen, D., Tel-Or, E., Hadar, Y. and Chen, Y. (eds) Modern Agriculture and the Environment. Kluwer Acadamic Publishers, Dordrecht, The Netherlands, pp. 17–31. van Lenteren, J.C. (2003) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK. van Lenteren, J.C. and de Ponti, O.M.B. (1990) Plant-leaf morphology, host-plant resistance and biological control. Proceedings of 7th International Symposium of Insect-Plant Relationships, 3–8 June 1989, Budapest, Hungary. Sympia Biologia Hungarica 39, 365–386. van Lenteren, J.C. and Woets, J. (1988) Biological and integrated pest control in greenhouses. Annual Review of Entomology 33, 239–269. van Lenteren, J.C., Babendreier, D., Bigler, F., Burgio, G., Hokkanen, H.M.T., Kuske, S., Loomans, A.J.M., Menzler-Hokkanen, I., Rijn, van P.C.J., Thomas, M.B., Tomassini, M.C. and Zeng, Q.-Q. (2003) Environmental risk assessment of exotic natural enemies used in inundative biological control. BioControl 48, 3–38. van Lenteren, J.C., Bale, J., Bigler, F., Hokkanen, H.M.T. and Loomans, A.J.M. (2006) Assessing risks of releasing exotic biological control agents. Annual Review of Entomology 51, 609–634. Vet, L.E.M. (2001) Parasitoid foraging efﬁciency links behaviour to populations processes. Applied Entomology and Zoology 36, 399–408. Vet, L.E.M. and Dicke, M. (1992) Ecology of infochemical use by natural enemies in a tritrophic context. Annual Review of Entomology 37, 141–172. Vet, L.E.M., Lewis, W.J. and Cardé, R.T. (1995) Parasitoid foraging and learning. In: Cardé, R.T. and Bell, W.J. (eds) Chemical Ecology of Insects 2. Chapman and Hall, New York, pp. 65–101. Vet, L.E.M., Lewis, W.J., Papaj, D.R. and van Lenteren, J.C. (2003) A variable-response model for parasitoid foraging behaviour. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 25–39. Waeckers, F.L. (2003) The parasitoids’ need for sweets: sugars in mass rearing and biological control. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 59–72. Wapshere, A.J. (1974) A strategy for evaluating the safety of organisms for biological weed control. Annals of Applied Biology 77, 201–211. Wapshere, A.J. (1975) A protocol for programmes for biological control of weeds. Pest Articles and News Summaries (PANS) 21, 295–305. Waterhouse, D.F. (1998a) Biological Control of Insect Pests: Southeast Asian Prospects. ACIAR Monograph No 51. Australian Centre for International Agricultural Research, Canberra, Australia. Host Speciﬁcity in Arthropod Biological Control 63

Waterhouse, D.F. (1998b) Prospects for the classical biological control of major insect pests and weeds in southern China. Entomologica Sinica 5, 320–341. Waterhouse, D.F. and Norris, K.R. (1987) Biological Control: Paciﬁc Prospects. Inkata Press, Melbourne, Australia. Waterhouse, D.F. and Sands, D.P.A. (2001) Classical Biological Control of Arthropods in Australia. ACIAR Monograph No. 77, Australian Centre for International Agricultural Research, Canberra, Australia. Yamazaki, T. (1972) Detection of single gene effect by inbreeding. Nature 240, 53–54. Yu, D.S. and Horstmann, K. (1997) A Catalogue of World Ichneumonidae (Hymenoptera). The American Entomological Institute, Gainesville, Florida. 4 Measuring and Predicting Indirect Impacts of Biological Control: Competition, Displacement and Secondary Interactions

Russell Messing,1 Bernard Roitberg2 and Jacques Brodeur3 1University of Hawaii, Kauai Agricultural Research Station, 7370 Kuamoo Rd., Kapaa, Hawaii, 96746 USA (email: [email protected]; fax number: +1-808-822-2190); 2Biological Sciences, Simon Fraser University, 8888 University Drive, Burnaby, BC, V5A 1S6, Canada (email: [email protected]; fax number: +1-604-291-3496); 3Institut de Recherche en Biologie Végétale, Université de Montréal, 4101, rue Sherbrooke Est, Montréal (Québec), H1X 2B2, Canada (email: [email protected]; fax number: +1-514-872-9406)

Abstract

In recent years concern over the potential environmental impact of biological control agents has broadened to include indirect ecological interactions with other species, such as competition and apparent competition. It is extremely difﬁcult to predict the outcome of such relationships based on pre-release quarantine testing. Nevertheless, regulators increasingly ask for such data, and biological control practitioners must be prepared to address the issue. In this chapter we review the best available current methods to measure and predict indirect impacts resulting from competition, displacement and other subtle secondary interactions of newly imported biological control agents. We provide a framework for considering both top-down and bottom-up effects, and we review how descriptive studies (using small arenas, focal observations, and molecular and biochemical tools) and manipulative experiments (including large-cage trials and surrogate experiments) can complement historical, theoretical and phylogenetic considerations to provide a comprehensive overview of the organism’s role in the ecological community.

Introduction short time since then, as circumstantial evidence mounted indicating that intro- Until the mid-1980s, it was widely duced predators and parasitoids have at accepted that the practice of biological pest least the potential to signiﬁcantly impact control was so far superior to chemical non-target species (Howarth, 1990; control in terms of environmental safety Simberloff and Stiling, 1996), the applied that it was considered a ‘safe’ technology sub-discipline of natural enemy risk analy- (Coulson et al., 1991; DeBach and Rosen, sis has begun to come to terms with the dif- 1991; Greathead, 1995). In the relatively ﬁculties inherent in extrapolating from ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 64 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Measuring and Predicting Indirect Impacts of Biological Control 65

highly simplified, structured, artificial been called a form of ‘biological pollution’ quarantine environments to complex, (Howarth, 1991), and the decline in some dynamic, natural ecosystems. endangered avian species has been blamed Increasing numbers of research papers, in part on introduced arthropod natural funded grants, review articles and books enemies competing with native forest birds (Follett and Duan, 2000; Lockwood et al., for Lepidopterous prey (Howarth, 1990). 2001; Wajnberg et al., 2001; Louda et al., Extrapolations from simple malaise trap 2002) attest to the commitment with collections of introduced parasitoids in which biological control practitioners and Hawaiian rainforests have led some to the applied ecologists have addressed risk conclusion that native parasitoids are analysis in recent years. Yet, despite these declining due to competition, and that ‘the efforts, it must be admitted that the major- purposeful introduction of parasitoid and ity of studies to date have focused on sim- predatory insects into Hawaii should be ple two-species interactions. Researchers discontinued’ (Asquith and Miramontes, have barely begun to come to grips with 2001). Even host-specific natural enemies the complexities of subtle, indirect inter- have been implicated in negative environ- actions such as competition and apparent mental impacts, via mechanisms such as competition. ecological replacement, compensatory The nature of competition in itself has responses and food web interactions long been a source of debate and contro- (Pearson and Callaway, 2003). versy for those studying the ecology of Practitioners and regulators of biological organisms, both in native habitats and fol- control are thus faced with a daunting task: lowing invasions (Connell, 1980, 1983; while theoretical and empirical studies Cooper, 1993). Given the difficulties inher- provide the merest beginnings of a frame- ent in quantifying, or even documenting, work to guide the prediction and evalua- the existence of competition in the field, it tion of indirect non-target impacts and risk is perhaps not surprising that the ability to analysis, concrete and responsible deci- predict the effects of competition and other sions must nevertheless be made if classi- indirect effects of newly introduced organ- cal and augmentative biological control isms has proved extremely frustrating, as programmes are to continue as viable and the following quotes attest: respected components of integrated pest management. As an example, a recent per- ‘the ability to predict indirect effects, given mit application to introduce host-specific that the quantification of direct interactions is so intractable, seems a long way off.’ parasitoids of Mediterranean fruit fly, (Lonsdale et al., 2001.) Ceratitis capitata (Wiedemann) (Diptera: ‘the best data require years of painstaking Tephritidae), into Hawaii was required to field work … such data are simply not yet provide data on potential interactions of widely available.’ (Stiling and Simberloff, the new parasitoid with extant fruit fly par- 2000.) asitoids, and with other tephritids used in ‘most species live in a complex web of biological control of weeds (Bokonon- interactions … this makes it difficult to Ganta et al., 2005). predict the response of even well-understood It is our goal in this chapter to focus on systems … some ecologists even despair of the best available current methods for finding general patterns.’ (Holt and Hochberg, 2001.) investigators for measuring and predicting possible indirect impacts on non-target Despite the acknowledged difficulty in pre- species resulting from competition, dis- dicting the outcome of competition and placement and other secondary interactions other indirect ecological interactions, crit- of newly imported or released biological ics of biological control continue to press control agents. The emphasis is necessarily the case that these may be responsible for on approaches that can be used in a quaran- profound negative ecological impacts. In tine facility prior to field release of newly Hawaii, introduced natural enemies have imported organisms, as it is generally 66 R. Messing et al.

accepted that once an arthropod is released biological control. However, in this chapter in the field it is extremely difficult, if not (due in part to the authors’ own experience impossible, to mitigate or eradicate it and background) we concentrate more on should unacceptable consequences ensue. the arthropod biological control perspec- However, we also discuss novel methods of tive, recognizing that many of the prin- investigation that, while not yet normally ciples and techniques can be adapted applied to non-target risk analysis, never- across the board to any organism. theless have potential for application in this context to circumvent some of the limitations and pitfalls of the restrictive quaran- A Synthesis of Approaches tine environment. We offer and discuss a preliminary conceptual classification of the In considering the possibilities of competi- types of interaction that may occur, review tion and displacement among natural ene- experimental techniques with appropriate mies in the biological control of weeds, the examples, and give some indication of the emphasis has generally been on a bottom- feasibility and relative predictive capability up approach: i.e. looking at effects medi- of each of these methods. ated through a common host plant. In a Historically speaking, concern over non- frequently cited paper, McEvoy and target impacts (both direct and indirect) Coombs (2000) used the following frame- has been much greater for plants than for work to characterize the types of interac- arthropods; this is based in large part on tions of concern among weed biological the more easily recognized economic value control agents (Fig. 4.1). of many plant species (i.e. food, forage, Of particular note is the fact that all fibre crops and ornamentals). Arthropods, interactions in McEvoy and Coombs (2000) except for very few well-recognized polli- framework are either directly between the nators and biological control agents, were biological control agents themselves, or generally not considered from a conserva- else are a function of the agents’ effects on tion perspective. Therefore, practitioners of their food source; higher trophic levels are weed biological control usually had more not considered (Fig. 4.1). Note that the experience and a better established frame- arrows point up, the traditional direction work for dealing with non-target issues of energy flow in trophic webs, indicating a than had practitioners of insect and mite bottom-up approach.

(A) Predation (B) Interference (C) Exploitation

Carnivore/ Herbivore 3

Herbivore 2 2 3 2 3

Plant 1 1 1

Fig. 4.1. Interactions between populations in a weed biological control system including (A) predation, (B) interference competition and (C) exploitation competition. Populations are represented as circles, a positive effect of one population on another is represented by an arrow while a negative effect is represented by a ﬁlled circle. No arrow means no direct interaction between two variables. Measuring and Predicting Indirect Impacts of Biological Control 67

In contrast to this, and from a perspec- sitoids may kill their competitors through tive focused particularly on biological con- direct combat without necessarily feeding trol of arthropods rather than weeds, Holt on the killed competitor). and Hochberg (2001) use a different con- In terms of competition, we distinguish ceptual framework, in which interactions between direct competitive effects (those in are influenced primarily by higher trophic which a natural enemy or its semiochemi- levels (Fig. 4.2). Note that arrows point cals (synthetic or metabolic products) come down, emphasizing a top-down approach. into direct physical contact with a com- In complex ecosystems, interactions can petitor) and indirect competitive effects (in occur at all trophic levels simultaneously which the interaction among competing (in ecological time), and a comprehensive natural enemies is mediated via a third risk analysis must consider both bottom-up organism). and top-down effects. The approaches of The direct impacts (killing and interfer- McEvoy and Coombs (2000) and of Holt ence competition) act on natural enemies and Hochberg (2001) can be combined to in the same trophic level, in contrast to give us a more unified perspective that exploitation competition (which is medi- allows us to view all direct and indirect ated via a lower trophic level) and appar- non-target effects in a single framework, ent competition (which is mediated regardless of the type of biological control through a higher trophic level). The cate- agent that is being imported (Fig. 4.3). gory of circuitous competition is, admit- In this framework we attempt to stan- tedly, rather ill-defined, and is used to refer dardize the terminology across weed and to more complicated interactions that may arthropod sub-disciplines (i.e. rather than involve multiple trophic levels (both the term ‘predation’ of McEvoy and higher and lower) and permutations of Coombs (2000), we use the term ‘killing’ in interaction that are clearly recognized as recognition of the fact that larval para- feasible, if not well documented.

(a) Agent Shared predation (apparent competition) Target Non-target

(b) Agent Mixed predation and competition Target Non-target Competition

(d) Agent Native predator Enrichment Target Non-target

(e) Agent Hidden natural enemy Intra-guild predation Target Non-target

Fig. 4.2. Holt and Hochberg’s (2001) framework for depicting ‘community module’ interactions in arthropod biological control. 68 R. Messing et al.

Trophic Mechanism Effect level ApparencyRisk Terms used in literature

Killing direct same high high Predation (McEvoy and Coombs, 2000) Lethal interference (Collier et al., 2002) Intra-guild predation (Rosenheim et al., 1995) Intrinsic competition (general usage) Multi-parasitism (general usage)

Interference direct same Host discrimination (general usage) competition

Exploitation indirect lower Extrinsic competition (general usage) competition

Apparent indirect higher competition

Circuitous indirect mixed low low Enrichment (Holt and Hochberg, 2001) competition

Fig. 4.3. Comprehensive framework for direct and indirect non-target effects, encompassing terminology of both weed and arthropod biological control.

In broad terms, direct mechanisms (in ledge that the unique and idiosyncratic particular killing) are more visible to the nature of multi-species interactions will scientific observer and thus more readily provide numerous exceptions to most gen- observed, measured and analysed by eral patterns that we can outline, particu- researchers than are indirect mechanisms. larly in an emerging field such as We posit a gradient of apparency such that non-target risk analysis. Certainly we can the ease in experimentally analysing and, document scenarios in which apparent hence, reliably predicting these types of competition has overwhelming importance species interactions increases as one moves in determining the competitive outcome of from the bottom to the top of Fig. 4.3 (dark interactions. A great deal more experimen- arrow). This implies that regulators may tation and targeted retrospective analyses place more confidence in predictions of are necessary to determine if patterns such direct impact than of indirect impact, and as these can serve as useful guidelines for certainly there are more reliable laboratory decision-makers and regulatory officials methods established for the former cate- concerned with evaluating new biological gory (see below). control programmes. As a working hypothesis, we very tenta- Further complicating any analysis of tively suggest that direct mechanisms have impact is the relationship between individ- a more frequent or profound impact on ual and population performance. Even in population levels of competing species cases where researchers demonstrate com- than do mechanisms mediated through petitive harm to individuals in laboratory increasing levels of trophic interaction or field bioassays, it does not necessarily (dashed arrow in Fig. 4.3). We recognize mean that significant harm will occur at that the greater apparency referred to above the population level (i.e. a population may, imputes a built-in bias to generalizations or may not, suffer from removal of its mem- regarding the empirical record when com- bers). This can easily be demonstrated with paring documented examples of natural a simple but more realistic form of the enemy competition. We clearly acknow- usual logistic-type model: Measuring and Predicting Indirect Impacts of Biological Control 69

Descriptive studies  γ  dN  N  = N 1–   r (1) dt   K   Direct observations and predation/parasitism tests conducted in the laboratory, in where: K is carrying capacity, r is intrinsic cages or under field conditions can provide growth rate and ␥ is a shape parameter. a preliminary assessment of interactions This simple model assumes that intra- among competing species. These may specific competition occurs, but that the include assays to measure foraging parame- strength of such competition depends upon ters (handling time, patch time allocation, population size. Thus, there are at least etc.), discriminating capacity and prey/host two ways in which a population’s perfor- acceptance. Ecosystem size and complexity mance may be seemingly impervious to are the primary constraints restricting the loss of its individual members. First, when extent of pre-release (quarantine) studies: a population is large in number (relative to any size arena that can reasonably fit inside the carrying capacity of its prey popula- a quarantine facility can be used in the tar- tion), removal of an individual barely get country. impacts per capita performance. Second, when gamma values are large, reduction of Petri dish population size may be compensated for by increased performance of survivors. This Petri dish experiments are commonly used may occur either simultaneously, or subse- to establish diet breadth and trophic rela- quently, with population reduction (May et tionships among biological control agents. al., 1981). The two-dimensional arena reduces or Of course, these are simple situations; eliminates to a very large extent the host- Holt and Hochberg (2001) provide a num- finding component, and maximizes poten- ber of less obvious examples where tial interactions among individuals (Lucas impacts on individuals do not translate et al., 1998; Wang and Messing, 2002, into population level effects. It is crucial 2003). These simple experiments may pro- that regulators do not simply extrapolate vide opportunities for identifying underly- from observations of feeding or para- ing mechanisms. This is particularly true sitism on individual arthropods in a labo- for choice experiments in which attack ratory cohort and erroneously conclude rates are variable and depend upon interac- that this implies a significant population tions with other species, such as when effect. choice varies in the presence or absence of There are a number of approaches avail- a natural enemy (Schmitz et al., 1997). able for explicating indirect interactions. Because there is an almost inexhaustible These include descriptive studies, manipu- set of contexts for such choice tests, this lative experiments and theoretical models. kind of work should be done in tandem These are complementary methods that with theoretical considerations that iden- work best when developed hand in hand. tify critical switch points (see Roitberg, Not all of these approaches will be applic- 2000; Holt and Hochberg, 2001). able in any given project, or for all interac- To identify indirect interactions, the tion categories. Below, we briefly describe procedure should incorporate a wide range and provide examples of the most com- of non-target organisms, including those monly used methods. Some approaches from the same trophic level (guild mem- (e.g. Petri dish studies) will generate data bers). For example, parasitism bioassays to help make an informed decision about conducted in Petri dishes allowed Pérez- whether or not to release a particular can- Lachaud et al. (2004) to identify complex didate agent; post-release field studies, on trophic and guild interactions in five the other hand, will give us broader tempo- species of indigenous and introduced ral and spatial perspectives to help inform bethylid wasps deployed to control the future decision making. coffee berry borer and lepidopteran pests of 70 R. Messing et al.

coconuts and almonds. They showed that and should allow for construction of quan- Cephalonomia hyalinipennis Ashmead titative ethograms that may facilitate (Hymenoptera: Bethylidae) not only understanding of competitive interactions displays conspecific and allospecific ovi- with similarly behaving species (Wang and cide and larvicide, but may also develop as Messing, 2002, 2003). Once again, how- a facultative hyperparasitoid, thereby ever, this approach runs the risk of over- threatening the establishment and sur- simplifying a range of mitigating factors. vivorship of other bethylid species. More realistic behaviours can be tracked in Likewise, Wang and Messing (2004a,b) natural settings in the country of origin, showed that the ectoparasitic pupal para- albeit with a different suite of associated sitoids Pachycrepoideus vindemmiae species. (Rondani) (Hymenoptera: Pteromalidae) and Focal observations circumvent the prob- Dirhinus giffardii Silvestri (Hymenoptera: lem of confinement associated with Petri Chalcididae) not only compete with each dish or cage experiments. One good other within the same guild, but can also example comes from the study of Cisneros develop as facultative hyperparasitoids on and Rosenheim (1998), who characterized the primary braconid parasitoids that con- the diet of nymphs and adults of Zelus tribute to the biological control of tephritid renardii Konelati (Heteroptera: Reduviidae), fruit flies in Hawaii. a generalist predatory bug in cotton fields. These small-scale and short-term experi- Using a behavioural event recorder, they ments have, however, several drawbacks, observed predators foraging freely in the as they are conducted in an artificial envi- field for a total of 94 h and noted informa- ronment that has little in common with the tion about their activity, distribution on the natural foraging conditions usually experi- plant and type of prey attacked. They quan- enced by natural enemies in the field, and tified ontogenetic changes in within-plant they do not allow the complete repertoire distribution of the predators and showed of behaviours to be expressed. Further- how these changes modulated the preva- more, such simplified environments may lence of trophic and guild interactions. A prevent the expression of mediated interac- similar example that focused on tions and population level processes. They Hemipteran predators of spider mites can are unlikely, therefore, to provide sufficient be found in Rosenheim (2005). Time-lapse information for the accurate prediction of video recording may also be used to reduce risk associated with some of the more com- the drawbacks of direct observations, such plex types of competitive interaction. Yet, as intensity of labour and observer-caused in smaller quarantine facilities they are disturbance (Jervis and Kidd, 1996). often the most that can be accomplished on Empirical observations are also essential site. for determining mechanisms that underlie complex competitive interactions. This would be especially true of trait-mediated Focal observations effects (Schmitz et al., 1997), wherein the Although labour intensive, continuous impact of a biological control agent is tracking of a freely foraging natural enemy brought about by altering one or more traits helps to characterize the ecological niche of the focal organism. For example, in the of a species by determining its distribution presence of an introduced predator a native in the habitat, its patterns of activity and herbivore might reduce its range of host diet. This approach has been used with a plants, thereby altering inter-specific com- wide range of arthropods (Kareiva and petition as well as predator–prey interac- Odell, 1987; Heimpel et al., 1997; Casas, tions. Further, as noted by Lima (1998), a 2000). When restricted to a quarantine set- very common response by prey to the pres- ting, cage studies should be designed to ence of natural enemies is to reduce activ- replicate as much as possible the essential ity levels. This will probably mean a features of an oviposition environment, reduction of interactions with other mem- Measuring and Predicting Indirect Impacts of Biological Control 71

bers of the community, including non- tions at the level of the population (e.g. target species. How might one deal with survivorship rates of natural enemies, this problem? Observing rates of change is growth rates of herbivore populations) one valuable way of predicting overall among treatments, including different com- effects (i.e. don’t use observation to docu- binations of natural enemies and herbivo- ment the phenomenon, but rather to quan- rous pests. tify it). However, because such effects are context dependent, it is unlikely that Large-cage experiments observations alone will provide data sufficient to determine degree of risk from These kinds of experiments have great release of an introduction. As mentioned potential for identifying risk, so long as above, a well-honed theory will determine they provide sufficient scale and complex- what sorts of effects are critical and where ity to afford ample expression of predation to look for them. and oviposition behaviours. Attack rate and distribution of a nabid predator, for example, were shown to depend strongly Molecular and biochemical studies upon the spatial scale of the experiment Dissections of a predator’s gut, serology (Ostman and Ives, 2003). Conducting a (e.g. enzyme-linked immunosorbent assay macrocosm experiment under large-cage (ELISA)), prey labelling and electrophore- conditions does allow for the control of sis have been used for several decades to certain parameters (e.g. presence/absence, identify prey and to detect parasitoids population densities, etc.) that are particu- within their hosts (reviewed in Powell et larly useful in predicting indirect effects. al., 1996; Symondson, 2002). New molecu- This can be especially important when pre- lar approaches using polymerase chain dation rates are frequency and/or density reaction (PCR) primers have been devel- dependent (Abrams, 2004). For example, oped to amplify the DNA of prey species the tendency of predators to express from the gut contents of predators. These switching behaviour may be density approaches increase both the probability dependent; thus, simple experiments that and duration of prey detection work with a small set of densities may (Hoogendoorn and Heimpel, 2001). To our cause researchers to predict strong interac- knowledge, none of these techniques have tions between target and non-target species been employed to characterize guild inter- in the absence of switching, and vice versa actions within a community of natural ene- (Abrams and Matsuda, 2003). Again, this is mies. However, they can be powerful particularly important when complex non- adjuncts in demonstrating that predatory or linear interactions occur (Peacor, 2002). parasitic interactions are in fact occurring, Finally, Holt (1995) suggests that we break and at rates sufficient to cause (or alleviate) down complex communities into smaller, concern. manageable modules for study. Large-cage (macrocosm) studies would allow for isolation of modules for semi-field study. Manipulative experiments Although not in common usage, larger- scale arenas or microcosms could be con- A second, powerful way to identify and structed within quarantine settings, analyse direct and indirect interactions in finances permitting, and would allow more an arthropod community is to run inclu- realistic extrapolations and risk analyses sion/exclusion experiments in large cages, prior to natural enemy release. to use surrogates, or to conduct surveys or Different types of devices have been manipulative experiments in the area of employed to exclude all natural enemies or origin of a potential new natural enemy to prevent specific groups of natural ene- before its introduction. The principle mies from interacting with focal organisms behind this approach is to compare interac- (e.g. aerial or surface-dwelling arthropods): 72 R. Messing et al.

mesh cages placed over plants, branches, lished populations in nature can only leaves; clip cages; or other physical barriers rarely be eradicated, but mitigation may be (Jervis and Kidd, 1996). Rosenheim et al. possible in carefully controlled circum- (1993) used field cages in cotton fields to stances. explore the effect of combining the green Manipulation of a community to quan- lacewing Chrysoperla carnea (Stephens) tify interactions among populations can (Neuroptera: Chrysopidae) with three also be achieved in open-plot experiments, species of hemipteran predators on popula- either post-release or in the country of ori- tion densities of the cotton aphid, Aphis gin, where insecticides are employed to gossypii Glover (Homoptera: Aphididae). selectively suppress species or groups of Aphids were controlled less effectively by natural enemies. The imported red fire ant a combination of predators than when Solenopsis invicta Buren (Hymenoptera: C. carnea was released alone. This non- Formicidae), an invasive species in the additive effect was caused by predatory southern United States, is a voracious gen- bugs feeding on lacewings. Similar experi- eralist predator that threatens native inver- ments were performed by Colfer and tebrates and vertebrates. To experimentally Rosenheim (2000), who examined indirect document interference between ants and interactions between the convergent lady other natural enemies, Eubanks et al. beetle Hippodamia convergens Guérin- (2002) suppressed fire ant populations in Méneville (Coleoptera: Coccinellidae) and large cotton plots (>1.2 ha) with insecticide the braconid Lysiphlebus testaceipes baits. They compared densities of arthro- Cresson (Hymenoptera: Braconidae) on pod predators throughout the growing sea- caged cotton plants. Intra-guild predation son in treated vs control plots, and were played an important role in decreasing par- able to quantify the predators’ susceptibil- asitoid densities, as coccinellids destroyed ity to predation by the fire ant. Colfer et al. a large proportion of mummified aphids. In (2003) recently used a similar approach to another study, Hoogendoorn and Heimpel examine the role of naturally occurring (2004) showed that the native coccinellid generalist arthropod predators on the estab- Coleomegilla maculata (DeGeer) lishment and efficacy of a predatory mite, (Coleoptera: Coccinellidae) re-located to Galendromus occidentalis (Nesbitt) different parts of a plant in response to the (Acarina: Phytoseiidae), that is commonly presence of the introduced coccinellid released for the control of the spider mite Harmonia axyridis Pallas (Coleoptera: Tetranychus urticae Koch (Acarina: Coccinellidae). This movement was pre- Tetranychidae). They first used small field sumed to decrease the amount of intra- cages to test interactions with different guild predation between the two lady combinations of predators over short-term beetles, but may have led C. maculata to periods in cotton fields. Next, they occupy less rewarding foraging patches. employed insecticide manipulations to Field-cage (i.e. mesh bags) studies were examine long-term interactions on a larger also used by Borer et al. (2004) to explain spatial scale. They concluded that how parasitoids of California red scale hemipteran predators have a negative could co-exist in citrus groves. impact on predatory mite populations via There have been a few precedents, par- intra-guild predation. However, generalist ticularly in Hawaii, for regulatory authori- predators did not curtail the long-term bio- ties to allow release of a new natural logical control of spider mites, because enemy from quarantine solely for the pur- their addition to the T. urticae–G. occiden- pose of further testing in laboratory and talis system caused a significant overall field cage studies. This approach recog- reduction in pest densities. nizes the increased, intermediate level of To a large extent the methods referred to risk that ensues from quarantine removal above cannot be used in the target country and restriction to caged environments (in prior to release of a particular natural the laboratory or in the field); truly estab- enemy in question. They can, however, be Measuring and Predicting Indirect Impacts of Biological Control 73

of great value when conducted post-release close and realistic stand-in for the natural to help establish patterns and principles enemy in question. For example, substantial that guide overall analyses of indirect differences in the intrinsic rate of increase impact and risk assessment. For individual between the surrogate and focal species arthropod introductions it may be possible could render such experiments moot. to conduct similar studies in the country of In an elegant field demonstration of origin, prior to collection and importation. indirect impacts, van Nouhuys and Hanski In one example, Liu et al. (2004) obtained (2000) showed how apparent competition baseline information on species interac- mediated by a generalist hyperparasitoid tions with natural enemies of the soybean might be predicted using a surrogate pri- aphid, Aphis glycines Matsumura mary parasitoid. The specialist braconid (Hemiptera: Aphidae), in China, prior to wasp Cotesia melitaearum (Wilkinson) their importation to North America. While (Ichneumonoidae: Braconidae), which not giving the kinds of detailed informa- attacks the Granville fritillary butterfly tion alluded to above (because some of the Melitaea cinxia (Linnaeus) (Lepidoptera: species from the target country will not be Nymphalidae) on islands near Finland, is present in the country of origin), neverthe- itself attacked by the generalist ichneu- less some basic patterns may be discerned. monid hyperparasitoid Gelis agilis Biological control projects are practical (Fabricius) (Ichneumonoidae: Cryptinae). experiments in applied ecology, and the The researchers experimentally added to extent of pre-release testing is invariably the system a second braconid host of G. limited by logistical considerations such as agilis (Cotesia glomerata (L.)), which does funding, time constraints, manpower and not compete with C. melitaearum for political realities. In many cases it will be resources (thus controlling for any effects logistically or economically impossible to of exploitation competition). Their repli- conduct the extent of research desired in cated experiments in the field were able the country of origin. In recent explo- convincingly to demonstrate that the addi- rations for Mediterranean fruit fly para- tion of the new primary parasitoid sitoids in Kenya, for example, our research increased extant populations of the hyper- efforts were pummelled by floods, impass- parasitoid, which subsequently reduced able roads, worker illness and lethal terror- populations of C. melitaearum in all repli- ist attacks. Nevertheless, even when cates (so much so, in fact, that two of the logistical considerations preclude complex original populations were driven to extinc- manipulative experiments, simple surveys tion). of diet breadth and habitat use in the coun- One can envisage how, in a similar man- try of origin can provide invaluable infor- ner, surrogates could be used to test for mation that should not be overlooked. possible indirect impacts of introducing a new parasitoid in addition to an existing, partially effective, parasitoid in a biological control programme. The key, of course, is Surrogate experiments having an available surrogate species that Even with the seemingly intractable prob- already exists in the target region (i.e. does lems associated with predicting competitive not itself have to go through quarantine), interactions prior to the release of a new and one that is biologically similar to the biological control agent into a complex prospective import. While it is unlikely ecosystem, it may be possible in some situa- that the risk of apparent competition could tions to use surrogate species in field experi- be quantified definitively using this ments. These types of experiments have method, it could add a valuable dimension great potential after theoretical explorations to a comprehensive risk analysis, and offer have identified critical features of the inter- guidelines for post-release follow-up stud- action, and subsequent analyses demon- ies should release of the new parasitoid be strate that the surrogate is a biologically approved. 74 R. Messing et al.

Rules of Thumb histories will always require detailed analyses of individual species and even of Biological control risk analysis is a very sub-species genetic cohorts. new discipline, and is still struggling to come to terms with methods for measuring even direct impacts of predators and Conclusions parasitoids. For subtle indirect effects, there is still much that needs to be All of the techniques that have been men- learned in order to improve, integrate and tioned in this chapter have their own make best use of the methods discussed advantages and their own limitations. above. In the near future the choice, out- None of them, in themselves, are able to come and interpretation of these types of predict accurately the full extent of com- tests will necessarily have to be integrated petitive and other indirect interactions that with common sense and our best current will follow upon the introduction of a new understanding of parasitoid (or predator) species into an existing community matrix. ecology and community dynamics. The Natural ecosystems, and even simplified current biological control-permitting sys- agricultural environments, are usually too tem in most countries makes use, impli- complex and their relationships too subtle citly, of expert opinion in providing for us to know in advance to what extent guidance to decision-makers. It may be new species will alter existing patterns. advantageous to make this approach Nevertheless, as in many fields of explicit, and to formalize the ‘expert sys- human endeavour, decisions must be made tems’ approach so as to take fullest advan- even though our knowledge is imperfect. tage of our current knowledge, imperfect Biological control is but one option for as it may be. There is ample precedent for managing invasive species, and these inva- using expert systems in other aspects of sives often have significant negative en- integrated pest management (e.g. Messing vironmental and economic impacts. et al., 1989). Alternative choices for pest management, In very general terms there may be including the choice to do nothing, have some ‘rules of thumb’ based on arthropod their own risks and also proceed with life history parameters that can help deci- imperfect knowledge. sion-makers generalize to some extent In order to minimize risk when intro- about the risk of particular importations. ducing new biological control agents, we Most obvious is the breadth of host (or suggest that a comprehensive overview of prey) range (see van Lenteren et al., the organism’s role in the ecological com- Chapter 3, this volume); highly munity be outlined, using a combination of polyphagous species will generally be the techniques mentioned here along with riskier than monophagous or a thorough literature evaluation of the stenophagous ones. Hymenoptera that can species and its congeners in the area of ori- act as facultative hyperparasitoids are gin. We also argue that a sustained and more likely to have indirect effects than well-funded effort to retrospectively evalu- are obligate primary parasitoids (Brodeur, ate the case histories from prior biological 2000). Some parasitoid taxa are known to control programmes would help shore up be more vulnerable to hyperparasitism; the empirical data base upon which theory these indicate an increased risk for appar- and modelling can build a broader picture ent competition with native parasitoids of community dynamics and the response (Heimpel et al., 2004). While bearing in to insertion of new species. While risk can- mind these considerations, however, one not be eliminated, it can be managed with must guard against oversimplification, increasing confidence as our understanding and recognize that the idiosyncratic of community dynamics grows incremen- nature of extremely diverse parasitoid life tally. Measuring and Predicting Indirect Impacts of Biological Control 75

Acknowledgements NSERC Operating grants to BDR and JB. We also thank George Heimpel and an anony- This work was supported in part by USDA- mous reviewer for constructive comments ARS grant No. 5853208147 to RHM and on an earlier version of this chapter.

References

Abrams, P. (2004) Trait-initiated indirect effects due to changes in consumption rates in simple food webs. Ecology 85, 1029–1038. Abrams, P.A. and Matsuda, H. (2003) Population dynamical consequences of reduced predator switching at low total prey densities. Population Ecology 45, 175–185. Asquith, A. and Miramontes, E. (2001) Alien parasitoids in native rainforests: the ichneumonoid wasp community in a Hawaiian rain forest. In: Lockwood, J., Howarth, F. and Purcell, M. (eds) Balancing Nature: Assessing the Impact of Importing Non-Native Biological Control Agents. Thomas Say Publications in Entomology, ESA, Lanham, Maryland, pp. 54–69. Bokonon-Ganta, A.H., Ramadan, M.M., Wang, X.G. and Messing, R.H. (2005) Biological performance and potential of Fopius ceratitivorus (Hymenoptera: Braconidae), an egg-pupal parasitoid of tephritid fruit flies, newly imported to Hawaii. Biological Control 33, 238–247. Borer, E.T., Murdoch, W.W. and Swarbrick, S.L. (2004) Parasitoid coexistence: linking spatial field patterns with mechanism. Ecology 85, 667–678. Brodeur, J. (2000) Host specificity and trophic relationships of hyperparasitoids. In: Hochberg, M.E. and Ives, A.R. (eds) Parasitoid Population Biology. Princeton University Press, Princeton, New Jersey, pp. 163–183. Casas, J. (2000) Host location and selection in the field. In: Hochberg, M.E. and Ives, A.R. (eds) Parasitoid Population Biology. Princeton University Press, Princeton, New Jersey, pp. 17–26. Cisneros, J.J. and Rosenheim, J.A. (1998) Changes in the foraging behavior, within-plant vertical distribution and micro-habitat selection of a generalist predator: an age analysis. Environmental Entomology 27, 949–957. Colfer, R.G. and Rosenheim, J.A. (2000) Predation on immature parasitoids and its influence on aphid population suppression. Oecologia 126, 292–304. Colfer, R.G., Rosenheim, J.A., Godfrey, L.D. and Hsu, C.L. (2003) Interactions between the augmenta- tively released predaceous mite Galendromus occidentalis (Acari: Phytoseiidae) and naturally occurring generalist predators. Environmental Entomology 32, 840–852. Collier, T., Kelly, S. and Hunter, M. (2002) Egg size, intrinsic competition, and lethal interference in the parasitoids Encarsia pergandiella and Encarsia formosa. Biological Control 23, 254–261. Connell, J.H. (1980) Diversity and the coevolution of competitors, or the ghost of competition past. Oikos 35, 131–138. Connell, J.H. (1983) On the prevalence and relative importance of interspecific competition: evidence from field experiments. American Naturalist 122, 661–669. Cooper, G. (1993) The competition controversy in ecology. Biology and Philosophy 8, 359–384. Coulson, J.R., Soper, R.S. and Williams, D.W. (1991) Biological Control: Needs and Procedures. Proceedings Workshop, US Department of Agriculture, Agricultural Research Service, Washington DC. DeBach, P. and Rosen, D. (1991) Biological Control by Natural Enemies. Cambridge University Press, Cambridge, UK. Eubanks, M.D., Blackwell, S.A., Parrish, C.J., Delamar, Z.D. and Hull-Sanders, H. (2002) Intraguild predation of beneficial arthropods by red imported fire ants in cotton. Environmental Entomology 31, 1168–1174. Follett, P.A. and Duan, J.J. (2000). Nontarget Effects of Biological Control. Kluwer, Norwell, Massachusetts. Greathead, D.J. (1995) Benefits and risks of classical biological control. In: Hokkanen, H. and Lynch, J. (eds) Biological Control: Risks and Benefits. Cambridge University Press, Cambridge, UK, pp. 53–63. Heimpel, G.E., Rosenheim, J.A. and Mangel, M. (1997) Predation on adult Aphytis parasitoids in the field. Oecologia 110, 346–352. 76 R. Messing et al.

Heimpel, G.E., Ragsdale, D.W., Venette, R.C., Hopper, K.R., O’Neil, R.J., Rutledge, C.E. and Wu, Z. (2004) Prospects for importation biological control of the soybean aphid: anticipating potential costs and benefits. Annals of the Entomological Society of America 97, 249–258. Holt, R.D. (1995) Community modules. In: Gange, A.C. and Brown, V.K. (eds) Multitrophic Interactions in Terrestrial Systems. Blackwell Science, Oxford, UK, pp. 333–350. Holt, R.D. and Hochberg, M.E. (2001) Indirect interactions, community modules and biological control: a theoretical perspective. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 13–37. Hoogendoorn, M. and Heimpel, G.E. (2001) PCR-based gut content analysis of insect predators: using ribosomal ITS-1 fragments from prey to estimate predation frequency. Molecular Ecology 10, 2059–2067. Hoogendoorn, M. and Heimpel, G.E. (2004) Competitive interactions between an exotic and a native ladybeetle: a field cage study. Entomologia Experimentalis et Applicata 111, 19–28. Howarth, F.G. (1990) Environmental impacts of classical biological control. Annual Review of Entomology 36, 485–509. Howarth, F.G. (1991) Hawaiian terrestrial arthropods: an overview. Bishop Museum Occasional Papers 30, 4–26. Jervis, M.A. and Kidd, N.A.C. (1996) Insect Natural Enemies. Chapman and Hall, London. Kareiva, P. and Odell, G. (1987) Swarms of predators exhibit ‘preytaxis’ if individual predators use area-restricted search. American Naturalist 130, 233–270. Lima, S.L. (1998) Stress and decision making under the risk of predation: recent developments from behavioral, reproductive, and ecological perspectives. Advances in the Study of Behavior 27, 215–290. Liu, J., Wu, K., Hopper, K.R. and Zhao, K. (2004) Population dynamics of Aphis glycines (Homoptera: Aphididae) and its natural enemies in soybean in Northern China. Annals of the Entomological Society of America 97, 235–239. Lockwood, J.A., Howarth, F.G. and Purcell, M.F. (2001) Balancing Nature: Assessing the Impact of Importing Non-Native Biological Control Agents (An International Perspective). Thomas Say Publications in Entomology, ESA, Lanham, Maryland. Lonsdale, W., Briese, D. and Cullen, J. (2001) Risk analysis and weed biological control. In: Wajnberg, E., Scott, J. and Quimby, P. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 185–210. Louda, S., Pemberton, R., Johnson, M. and Follett, P.A. (2002) Non-target effects – the Achilles heel of biological control? Retrospective analyses to reduce risk associated with biocontrol introductions. Annual Review of Entomology 48, 365–396. Lucas, E., Coderre, D. and Brodeur, J. (1998) Intraguild predation among aphid predators: characterization and influence of extraguild prey density. Ecology 79, 1084–1092. May, R.M., Hassell, M.P., Anderson, R.M. and Tonkyn, D.W. (1981) Density dependence in host-parasitoid models. Journal of Animal Ecology 50, 855–865. McEvoy, P. and Coombs, E. (2000) Why things bite back: unintended consequences of weed biological control. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer, Norwell, Massachusetts, pp. 167–194. Messing, R.H., Croft, B.A. and Currans, K. (1989) Using expert system technology in natural resource management. Applications in Natural Resource Management 3, 1–11. Ostman, O. and Ives, A.R. (2003) Scale-dependent indirect interactions between two prey species through a shared predator. Oikos 102, 505–514. Peacor, S.D. (2002) Positive effect of predators on prey growth rate through induced modifications of prey behaviour. Ecology Letters 5, 77–85. Pearson, D.E. and Callaway, R.M. (2003) Indirect effects of host-specific biological control agents. Trends in Ecology and Evolution 18, 456–461. Pérez-Lachaud, G., Batchelor, T.P. and Hardy, I.C.W. (2004) Wasp eats wasp: facultative hyperparasitism and intra-guild predation by bethylid wasps. Biological Control 30, 149–155. Powell, W., Walton, M.P. and Jervis, M.A. (1996) Populations and communities. In: Jervis, M. and Kidd, N. (eds) Insect Natural Enemies. Chapman and Hall, London, pp. 223–292. Roitberg, B. (2000) Threats, flies and protocol gapes: can behavioral ecology save biological control? In: Ives, A. and Hochberg, M. (eds) Parasite Population Biology. Princeton University Press, Princeton, New Jersey, pp. 254–265. Measuring and Predicting Indirect Impacts of Biological Control 77

Rosenheim, J.A. (2005) Intraguild predation of Orius tristicolor by Geocoris spp.; the paradox of irruptive spider mite dynamics in California cotton. Biological Control 32, 172–179. Rosenheim, J.A., Wilhoit, L.R. and Armer, C.A. (1993) Influence of intraguild predation among generalist insect predators on the suppression of an herbivore population. Oecologia 96, 439–449. Rosenheim, J.A., Kaya, H.K., Ehler, L.E., Marois, J.J. and Jaffee, B.A. (1995) Intraguild predation among biological-control agents – theory and evidence. Biological Control 5, 303–335. Schmitz, O.J., Beckerman, A.P. and O’Brien, K.M. (1997) Behaviorally mediated trophic cascades: Effects of predation risk on food web interactions. Ecology 78, 1388–1399. Simberloff, D. and Stiling, P. (1996) How risky is biological control? Ecology 77, 1965–1974. Stiling, P. and Simberloff, D. (2000) The frequency and strength of non-target effects of invertebrate biological control agents of plant pests and weeds. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer, Norwell, Massachusetts, pp. 31–44. Symondson, W.O.C. (2002) Molecular identification of prey in predator diets. Molecular Ecology 11, 627–641. van Nouhuys, S. and Hanski, I. (2000) Apparent competition between parasitoids mediated by a shared hyperparasitoid. Ecology Letters 3, 82–84. Wajnberg, E., Scott, J. and Quimby, P. (2001) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, New York. Wang, X.G. and Messing, R.H. (2002) Newly imported larval parasitoids pose minimal competitive risk to extant egg-larval parasitoid of fruit flies in Hawaii. Bulletin of Entomological Research 92, 423–429. Wang, X.G. and Messing, R.H. (2003) Intra- and interspecific competition by Fopius arisanus and Diachasmimorpha tryoni (Hymenoptera: Braconidae), parasitoids of Mediterranean fruit fly Ceratitis capitata (Diptera: Tephritidae). Biological Control 27, 251–259. Wang, X.G. and Messing, R.H. (2004a) Potential interactions among pupal and egg- or larval-pupal parasitoids of tephritid fruit flies. Environmental Entomology 33, 1313–1320. Wang, X.G. and Messing, R.H. (2004b) Two different life-history strategies determine the competitive outcome between Dirhinus giffardii (Chalcididae) and Pachycrepoideus vindemmiae (Pteromalidae), ectoparasitoids of cyclorrhaphous Diptera. Bulletin of Entomological Research 94, 473–480. 5 Risks of Interbreeding Between Species Used in Biological Control and Native Species, and Methods for Evaluating Their Occurrence and Impact

Keith R. Hopper,1 Seth C. Britch1 and Eric Wajnberg2 1USDA, ARS, Beneﬁcial Insects Introduction Research Laboratory, 501 South Chapel Street, Newark, Delaware 19713, USA (email: [email protected]; [email protected]; fax number: +1-302-737-6780); 2INRA, 400 Route des Chappes, BP 167, 06903 Sophia-Antipolis Cedex, France (email: [email protected]; fax number: +33-4-92-38-6557)

Abstract

Insect species introduced or augmented for biological control of insect pests may interbreed with native species, which may change ﬁtness or cause evolution, which may in turn alter abundances. By ‘interbreeding’, we mean any reproductive interactions between species. We review the literature on factors affecting the likelihood of interbreeding between insect species and the impacts when these occur. We discuss phylogenetic relatedness, geographical distribution, spatial and temporal barriers to mating, mate recognition, copulation and sperm use, hybrid inviability and sterility, hybrid speciation, reproductive character displacement and introgression. We concentrate on the risks from introduced species, but we also address the risks from augmentation of native species. We propose methods for pre-introduction or pre-augmentation assessment of the likelihood and potential impact of interbreeding between native species and insects used in biological control. Finally, we propose methods for evaluating the occurrence and impact of interbreeding after insect species are introduced or augmented.

Introduction (Simberloff and Stiling, 1996). Native species augmented in abundance for bio- Exotic species introduced into a new logical control may also court, mate or region may court, mate, hybridize or hybridize with other native species, which introgress with native species, and these may cause changes in their fitness and alter interactions may change fitness (Oliver, their abundances (Pinto et al., 2003). By 1979; Rawlings, 1985; Presgraves, 2002) or ‘court’, we mean recognize one another as cause evolution (Ewel et al., 1999; Cox, potential mates, but not necessarily suffi- 2004), which may in turn alter abundances ciently to copulate. By ‘mate’ we mean ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 78 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Risks of Interbreeding Between Species 79

copulation, with or without sperm transfer, differ in traits like host specificity (Davis which may or may not produce progeny. et al., 1987; Nyman, 2002). Native sibling By ‘hybridize’, we mean produce hybrid species are unlikely to be at risk from bio- progeny, which may or may not be viable logical control introductions because can- or fertile. By ‘introgress’, we mean transfer didates for introduction would not be of DNA sequences between species, which considered if what appeared to be the may or may not affect fitness, behaviour or same species already occurred in the tar- ecology, and may or may not persist and get region. However, native species might spread in the receiving species. By ‘inter- be at risk from interbreeding with sibling breeding’, we mean any or all such repro- species augmented for biological control. ductive interactions between species. The Because data on interbreeding as a result risks of interbreeding apply to intentional of biological control introductions or aug- introductions, like those in the horticul- mentations are rare, we draw on the tural and pet trades (Frank and McCoy, broader literature about interbreeding 1995; Young et al., 1999; Walker et al., among insect species, while concentrating 2002), as well as to accidental introduc- on evidence from the orders most fre- tions (Yukawa, 1996; Sagarra and Peterkin, quently used to control insect pests: Diptera 1999; Swanson et al., 2000). Insect species and Hymenoptera (Clausen, 1978). Research introduced for biological control of insect on species in the genus Trichogramma pests may interbreed with native species (Hymenoptera: Trichogrammatidae) pro- (Huxel, 1999; Mooney and Cleland, 2001), vides examples on how to measure several although we have found few studies on attributes important in risk assessment of such interbreeding, and only one potential interbreeding. Thus, we use this research as case of hybridization (Yara et al., 2000). a case history throughout the paper. Here we review the literature on factors Although we cover published literature in affecting the likelihood of interbreeding our review, useful data (e.g. concerning geo- between insect species and the impacts graphic distribution and habitats and hosts when these occur. We concentrate on the used) for particular projects can be obtained risks from introduced species, but we also from museum collections and other unpub- discuss the risks from augmentation of lished sources (project reports, quarantine native species. We propose methods for records). pre-introduction or pre-augmentation Encounters between introduced and assessment of the likelihood and potential native insect species in biological control impact of interbreeding between native are necessarily contacts between newly species and insects used in biological con- sympatric species that were previously trol. Finally, we propose methods for eval- allopatric. Thus, the literature on inter- uating the occurrence and impact of breeding between allopatric species after interbreeding after insect species have been secondary contact (Mayr, 1963; Dobzhansky, introduced or augmented. 1970; Kohlmann and Shaw, 1991; Brennan We deal primarily with interbreeding and Fairbairn, 1995; Shoemaker et al., among species, rather than groups below 1996; Sperling et al., 1996; Willett et al., the level of species, because we assume 1997) is directly relevant. However, we do that introductions of subspecies or popu- not mean to say that introduced and native lations of species that already occur in species arose by allopatric speciation. the target region are rare except for mul- Indeed, native versus introduced species tiple introductions of exotic agents. considered in biological control could have Distinguishing closely related species can arisen by any of the proposed mechanisms be difficult, particularly among parasitic of speciation: sympatric, allopatric, peri- Hymenoptera (Davis et al., 1987; Danforth patric or parapatric; mediated by ecological et al., 1998; Hoy et al., 2000). Indeed, taxa selection, sexual selection, allopolyploidy, described as species have been found to genetic drift or symbiotes. be complexes of sibling species which The literature on hybrid zones (Endler 80 K.R. Hopper et al.

1977; Moore, 1977; Barton and Hewitt, edness and the likelihood or impact of inter- 1981, 1985; Harrison, 1986; Howard, 1986; breeding varies among taxa and depends as Barton and Gale, 1993) is relevant to inter- well on whether species are allopatric ver- breeding between native species and sus sympatric, or ecologically and behav- insects introduced or augmented for biolog- iourally similar versus dissimilar (Coyne ical control. For introduced insects, the and Orr, 1997). In insects, all reported cases appropriate hybrid zone model is likely to of hybridization are among species in a change with time after introduction. single genus or in a species complex within Initially, the distribution of introduced pop- a genus (Table 5.1). Lack of observations of ulations may overlap completely with interbreeding among more distantly related native species at risk of interbreeding, but species may arise from a bias towards native species may have large regions of searching for such interactions only where allopatry. This is very different from the one expects to find them. Nonetheless, effort usual models of hybrid zones where both on interbreeding in biological control species have regions of allopatry with a should concentrate on closely related more or less narrow region of sympatry species in the same complex or genus. A where hybridization can occur. Further centrifugal approach, like that used in host along after introduction, introduced species range testing, may prove useful (see van may spread throughout the region where Lenteren et al., Chapter 3, this volume). target pests occur and may broadly overlap the distribution of native species. On the Case history other hand, introduced species may not initially overlap distributions of some native Pinto et al. (1992) examined molecular species and may only come into contact genetic differences among 22 cultures of with them after some period of spread. The the Trichogramma minutum Riley complex width and stability of hybrid zones will and established phylogenetic groups that depend on dispersal, habitat specificity and strongly predicted reproductive compati- the relative fitness of hybrids versus bility. In contrast, Pinto et al. (1991) parental populations. For augmented native showed that taxonomic grouping of T. pre- species, the distribution of hybrid zones tiosum Riley, T. deion Pinto and Oatman will depend on the spatial distribution of and T. minutum, based on morphology, releases and on dispersal rates. correlated poorly with reproductive compatibility, even among populations considered conspecific.

Factors Affecting Interbreeding Geographic distribution Phylogenetic relatedness Climatic, habitat and geographic barriers to Species that are phylogenetically close are the spread of the introduced species may more likely to interbreed than species that prevent sympatry with some native species, are phylogenetically distant (Coyne and Orr, even after introduction. Thus, whether a 1997). Phylogenetic relatedness can be particular native species is at risk for inter- determined using molecular, behavioural breeding depends on its distribution, the and morphological data. Thus, one could climatic tolerances of the introduced perhaps delimit native species at risk for species and the ability of the introduced interbreeding with introduced species based species to disperse across habitat and geo- on phylogenetic proximity. However, for graphic barriers like grasslands, deserts and many taxa, we have no phylogenies, only mountains. For augmentative releases, the taxonomic keys based on morphology and geographic distribution of augmentation only loosely related to phylogeny. programmes will determine which native Furthermore, the relationship between relat- species are at risk of interbreeding. Risks of Interbreeding Between Species 81 , 2000) , 2001) , 1996) et al. , 1997) , 2000) , 1999) , 2002) et al. et al. , 2003) , 2002) , 1997) , 2003) et al. , 1988) , 2000) , 2003) et al. et al. et al. et al. et al. et al. et al. et al. et al. et al. (Umphrey and Danzmann, 1998) x (Clarke x (Polukonova and Beljanina, x (Sherron and Rai, 1984) Cockerell x and Craig, 1985) (Taylor A. kesseli ϫ C. plumosus Say x (Cornel Hardy x (Pike A. hendersoni Meigen x x (Michailova, 1998) Belkin Giles x (Thelwell Patton x (Besansky Macquart x (Dos Santos Yasumatsu and KamijoYasumatsu x (Yara Dyar and Knab x 1990) (Taylor, Forel x x (Shoemaker Zavortink, A. cooki G. glaucus A. obliqua A. gambiae B. neohumeralis A. arabiensis Goetghebuer) 2002) T. beneﬁcus T. S. richteri C. quinquefasciatus Riley spp. x (Pinto spp. x (Rao and DeBach, 1969) Meigen, Wiedemann complex x (Selivon A. brelandi A. zoosophus Loginiva and Belyanina ( Zucchi, White, Pallas group x (Miao Giles, Burks x (Morales-Ramos Fitch x (Craig Buren, Kamijo, Walker group ( Walker Froggatt, Say, Say, Hartig spp. x (Walker spp. x C. behningi Linnaeus, Aphelinus ϫ spp. x x 1997) (Coyne and Orr, spp., spp. Linnaeus Huang and Hitchcock) Solenopsis invicta Andricus kollari sinensis Torymus Apis Trichogramma minutum Trichogramma Acanthomyops Catolaccus grandis Aedes triseriatus Aedes triseriatus Aphytis Anopheles hyrcanus Bactrocera tryoni Anastrepha fraterculus Anopheles bwambae Aedes scutellaris Culex pipiens Anopheles gambiae Eurosta solidaginis Drosophila Anastrepha sororcula Glyptotendipes pallens Chironomus usenicus Formicidae Cynipidae Culicidae Culicidae Torymidae Apidae Culicidae Culicidae Trichogrammatidae Formicidae Pteromalidae Culicidae Culicidae Culicidae Tephritidae Tephritidae Chironomidae Tephritidae Drosophilidae Tephritidae Studies showing hybrids between insect species in orders with taxa used for biological control. Hymenoptera Aphelinidae Table 5.1. Table OrderDiptera Family Chironomidae Species Lab. Field Publication 82 K.R. Hopper et al.

Methods for prediction 1982; Feder et al., 1993; Morrow et al., 2000), and habitat specificity can involve Field data on climatic distributions of can- differences in choice of host plant species didates for introduction and native species for mating (Feder and Bush, 1989; Wood et at risk should allow assessment of whether al., 1999). Some courtship and mating may they will become sympatric after introduc- happen even with very little spatial or tem- tion, assuming no barriers to dispersal. poral overlap (Deverno et al., 1998; Haegele, Computer programs, such as BIOCLIM (Nix, 1999). Although rare courtship and mating 1986) and GARP (Chen and Peterson, 2000), are unlikely to affect demography, they have been developed for climate matching may lead to introgression. Whether rare and these may be useful for predicting dis- mating leads to introgression depends on tributions of biological control agents after post-zygotic barriers (inviability, sterility introduction. If climatic distributions over- and reduced fitness of hybrids) and on the lap but there are geographic or habitat bar- selective advantage or disadvantage con- riers between the region of introduction ferred by introgressed sequences. New and the region harbouring a native species introgression is unlikely for augmentation at risk, the dispersal capacity of the candi- of native species, unless the augmentation date for introduction must be assessed. is in seasons or habitats where the aug- Given that climatic tolerances of intro- mented species does not ordinarily occur. duced species may evolve, it would be useful to measure genetic variation in climatic tolerances in the material to be introduced. Methods for prediction Field data on habitat and seasonal distribu- Methods for detection tions of candidates for introduction and native species at risk will allow assessment Field data on actual distribution of a bio- of whether they will encounter one another logical control agent after introduction and in sympatry. For augmentative releases, the spread will reveal which closely related habitat and seasonal distribution of aug- native species are actually at risk of inter- mentation programmes can be used to pre- breeding. dict which native species are at risk of interbreeding. Field and laboratory data on Case history diurnal periodicity and on host plant fidelity of mating behaviour could show Pak and Oatman (1982) and Glenn et al. whether individuals of different species (1997) measured development times for will encounter one another at smaller spa- several populations of Trichogramma tial and temporal scales. across California and Australia, respectively, and showed that species pairs or complexes were differently adapted to tem- Methods for detection perature regimes or to temperature require- Field data on habitat and seasonal distribu- ments of their hosts. tions of introduced agents and native species will show whether they are likely to encounter one another in sympatry. Spatial and temporal barriers to mating Because introgression may occur even with rare matings, survey for such introgression Sympatric species that mate in different may prove useful. Techniques for detecting seasons or in different habitats will rarely, introgression are discussed below. if ever, interbreed because they rarely meet (Feder et al., 1994; Bush and Smith, 1998; Case history Tilmon et al., 1998). Temporal isolation could extend to differences in diurnal To assay seasonal activity of several rhythm of courtship (Wood and Guttman, species of Trichogramma over two years, Risks of Interbreeding Between Species 83

Thorpe (1984) placed Heliothis virescens court and couple only with conspecifics in Fabricius (Lepidoptera: Noctuidae) eggs in the laboratory, this is likely to hold in the experimental plots of soybean, weedy vege- field as well. However, if candidate and tation and trees. Parasitism was temporally native species court or couple with one partitioned among four Trichogramma another, this may or may not mean they species in the first year, but was more will do so in the field. evenly distributed in the second year. Methods for detection Mate recognition Field observations of courtship and mating in areas where introduced or augmented Species whose mating periods and habitats species and native species commonly co- more or less overlap must still recognize occur would show whether they recognize one another as potential mates. Mate recog- one another as mates. Such observations nition cues include colours, shapes, scents, are difficult with small, possibly nocturnal songs and dances (Cibrian and Mitchell, insects, especially if one or the other 1991; Heady and Denno, 1991; Monti et al., species is rare. Traps baited with virgin 1995; Haegele, 1999; Dos Santos et al., females (Davis et al., 1987; Brodeur and 2001; Deering and Scriber, 2002). To what McNeil, 1994) may help in showing extent such cues are recognized between whether scents or songs are recognized species varies with taxonomic group, phy- between species. If interspecific courtship logenetic proximity and whether species or mating is common enough to affect pop- are sympatric or allopatric (Coyne and Orr, ulation dynamics, the effects may be mea- 1997). Partial recognition of cues which sured by comparing reproductive rates or does not lead to mating or hybridization stage distributions before versus after intro- can still mean time wasted courting. duction or augmentation, or in areas with versus without the introduced or augmented species. Methods for prediction Field and laboratory data on mate recogni- Case history tion cues will reveal whether species are likely to recognize one another as mates. Production of female offspring in matings Laboratory mating trials will show whether between T. minutum and Trichogramma they do indeed recognize one another as platneri Nagarkatti from different geo- mates, how frequently they do so and to graphic regions is rare (Pinto et al., 2003). what degree (courtship could reach various Stouthamer et al. (2000) measured mate levels of completion up to copulation). choice between T. minutum and T. platneri Candidates for introduction must be reared in the laboratory by observing female for at least one generation in the laboratory behaviour in the presence of conspecific for host-range testing, identification, and and heterospecific males. Although no clearing of hyperparasitoids and pathogens. female offspring resulted from mating with Thus, introduction candidates include only heterospecific males, females did not prefer species that will mate in the laboratory. males of either species. Thus releasing one Candidates for augmentation also must species in the range of the other might mate in the laboratory, otherwise they can- affect population dynamics (Pinto et al., not be augmented. Given that native species 2003). at risk are closely related to candidates for introduction or augmentation, it is likely that they will mate in the laboratory as Copulation and sperm use well. In any case, within-species crosses can serve as controls for between-species Species may recognize one another as crosses. If candidate and native species mates sufficiently to attempt copulation, 84 K.R. Hopper et al.

but be unable to copulate normally because Methods for prediction of morphological differences in genitalia Examination of genitalia might reveal (Arnqvist, 1998). Such differences can lead whether morphological incompatibilities to injury or death of the female, or death of would be likely between candidates for both partners if they become locked in cop- introduction or augmentation and native ula (Sota and Kubota, 1998). Even if the species (but see Porter and Shapiro, 1990; partners survive, females may act as if they Goulson, 1993; Eberhard, 2001). Laboratory have been mated, even though no sperm crosses would show whether interspecific has been transferred. If sperm is trans- mating compromised intraspecific recep- ferred, it may not fertilize heterospecific tiveness and whether sperm was trans- eggs (Jamart et al., 1995) or may be less ferred and used interspecifically. competitive in multiple-mated females (Robinson et al., 1994; Howard, 1999). Females of some insect species cease to Methods for detection court, or reject males, after copulation or To determine whether native or introduced insemination (Allen et al., 1994; females were sterilized without sperm trans- Fleischmann et al., 2001; Jang, 2002). Thus, fer, one could collect females in the field, if inseminated with heterospecific sperm test whether they are receptive to mating first, these females may have reduced or no with conspecific males in the laboratory, receptivity towards conspecific males. and then dissect the females to determine Interspecific mating may have no measur- whether they carry sperm. To determine able effects, especially if females readily whether native or introduced females were remate (Albuquerque et al., 1996). However, sterilized by copulations with sperm trans- if interspecific matings are common, they fer, one could collect females in the field, could reduce the net reproductive rates of allow them to oviposit in the laboratory, and one or both species. The worst-case sce- then dissect them to determine whether nario would be where an introduced they carried sperm. Eggs which produced species, ineffective at controlling an abun- no progeny (or only male progeny for haplo- dant pest, was maintained at high numbers diploids) would reveal that females had and mated with a rare native species whose been sterilized. One would need to test females did not remate. This could lead to females mated with conspecific males the native species being swamped with (either in the laboratory or in regions with- interspecific matings. Augmentative out the other species) to control for levels of releases could have this effect where den- sterility/infertility within species. As with sity was increased, but the effect should courtship or mating without copulation or not extend beyond the dispersal range of sperm transfer, one could measure demo- the augmented species. A second scenario graphic impacts by comparing population would be where an introduced species, dynamics before versus after introduction or while still rare, mated with a common augmentation or in areas with versus with- native species, so that the introduced out introduced or augmented species. species was swamped with interspecific matings. At low densities, Allee effects, for Case history example from failure to find appropriate mates, might become important and extinc- Genital morphology, correlated with repro- tion possible (Hopper and Roush, 1993). In ductive incompatibility between Tricho- the second scenario, this would mean gramma species (Rohi and Pintureau, effort wasted in a failed introduction; in 2003), was used to estimate interspecific the first scenario, this would mean the loss divergences among species groups of a native species. Such interactions are (Pintureau, 1993). On the other hand, like pest control using sterile males, which Nagarkatti and Fazaluddin (1973) found has been effective in several cases (Gould production of hybrids in the laboratory did and Schliekelman, 2004). not correlate with morphological, and in Risks of Interbreeding Between Species 85

particular genitalic, similarity, geographic the likely effects of sterile hybrids between proximity or habitat similarity. Although introduced or augmented species and native heterogamic insemination was frequent, species. production of interspecific hybrids was rare, and most cases of hybrid progeny Methods for prediction were unidirectional. Stouthamer et al. (2000) describe methods for observing Laboratory crosses could show whether sperm transfer, and Damiens et al. (2002) hybrid progeny are produced and whether describe a method for measuring viability these progeny are inviable or sterile. of sperm in spermathecae of females. However, fertility and survival may be intermediate, with either all hybrids showing intermediate fertility or survival or Impacts of Interbreeding with some crosses producing inviable/sterile hybrids and others producing fit Hybrid progeny: inviability and sterility hybrids (Oliver, 1979; Collins, 1997; Coyne and Orr, 1997; Presgraves, 2002). Within- If species mate and reproduce, the hybrid species crosses would provide controls for progeny may show reduced viability or fer- level and between-family distribution of tility. If interspecific matings are common, survival or fertility. production of inviable progeny could affect population dynamics like copulation, which Methods for detection effectively sterilizes females. Thus, the two scenarios described under the section on To determine whether native or introduced copulation apply here as well: (1) a rare females are producing inviable hybrid native species being swamped by hybridiza- progeny, one could collect females from tion with an ineffective introduced biologi- the field, allow them to oviposit in the lab- cal control agent or with an augmented oratory, dissect the females to determine native species, or (2) a newly introduced whether mated, and then measure the species being swamped by hybridization number of progeny (or female progeny for with a common native species. If hybrid haplodiploids) reaching adulthood. One progeny are viable but sterile, these two sce- would need controls of females known to narios would be worsened because hybrids be mated with conspecific males. These would also mate with, and thus effectively could be obtained from areas where the sterilize, individuals of one or both species. species did not overlap or from laboratory The most abundant species would mostly crosses. mate intraspecifically, but the least abun- To determine whether native or intro- dant species would either mate interspecifi- duced females are producing viable hybrids, cally or with hybrids. This interaction one could search for hybrids in field collec- would be like the project to control tions. Hybrids would be easiest to find Heliothis virescens using sterile-male where introduced and native species are hybrids from crosses between H. virescens about equal in abundance. Hybrids could be and H. subflexa Guenée (King et al., 1985; identified either by phenotype using, for Proshold et al., 1986). Although this project instance, the hybrid character index had mixed success, it showed sufficient (Anderson, 1936; Howard et al., 1993) or promise at suppression to be pursued for a genotype (Nason and Ellstrand, 1993; decade, suggesting that interspecies Anderson and Thompson, 2002). If hybrids hybridization might reduce abundances of show readily identifiable morphological either native species or introduced biologi- phenotypes, clearly distinguishable from cal control agents. The Heliothis-hybrid pro- both introduced and native parents, screen- ject produced a series of mathematical ing by phenotype might be simplest. On the models (Roush and Schneider, 1985; Laster other hand, hybrids between closely related et al., 1996) that could be used to analyse species might be difficult to identify by 86 K.R. Hopper et al.

phenotype. In this case, hybrids could be so even if hybrids are sterile. The most detected as heterozygotes of fixed molecular worrisome shift in host use would be to differences between native species and attack species used by the native species introduced or augmented species. Once yielding the hybrid. fixed molecular differences between native and introduced or augmented species are Methods for prediction established, the presence of such heterozygotes could easily be detected. If the hosts of the native species producing Insertions/deletions in nuclear ribosomal hybrids are of concern, the host range of genes like ITS1 and ITS2, or in introns hybrids could be measured in laboratory flanked by conserved exons, might be easi- experiments like those for evaluation of est to detect because they would not require host use by candidates for introduction or sequencing (e.g. Zhu et al., 2000). Single augmentation (see van Lenteren et al., nucleotide polymorphisms (SNPs) that dis- Chapter 3, this volume). tinguish native versus introduced or augmented haplotypes could also be detected Methods for detection without sequencing (e.g. Morlais and Severson, 2002). Rare hybrids would be dif- Collecting from hosts of native species at ficult to detect by either phenotypic or geno- risk for interbreeding should reveal typic screening. However, for hybridization whether hybrids are parasitizing these without introgression to affect population hosts. The techniques for detecting such dynamics of native or introduced species, hybrids are discussed above under ‘Hybrid hybrids would have to be common. progeny: inviability and sterility’. One could measure effects of introduced or augmented species on dynamics of native species by comparing populations Hybrid speciation before versus after introduction or augmentation, or in areas with versus without the Hybrids between species may not cross introduced or augmented species. with parental species but cross among Measuring effects of native species on themselves, which could give rise to a new demography of introduced species would species (Arnold, 1997; Barton, 2001). Such be more difficult, unless there were areas in hybrid speciation is much more likely in the region of introduction where hybridiza- plants than in insects (Rieseberg et al., tion was absent or at least less common. In 1995; Rieseberg, 1997), but is being discov- the latter case, one could compare intro- ered in a growing number of animals duced species dynamics with and without (Bullini, 1994). Augmentation of native hybridization with the native species. species is unlikely to produce new, hybrid species. If a hybrid species were to result from a biological control introduction, it Case history would be as if two species had been intro- Although interspecies hybrids were rare, duced, one with known traits and the other Nagarkatti and Fazaluddin (1973) found in with some combination of traits from the all instances where hybrids were pro- introduced and native parents. duced, hybrids were viable and fertile. Methods for prediction Hybrid progeny: host range shifts Laboratory crosses among hybrids and between hybrids and their parental species If viable hybrids are produced, they could could show whether hybrids would be affect unexpected non-target species if most likely to cross among themselves or hybrid host range differed from that of the backcross to the parental species after introduced or augmented species. This is introduction. Risks of Interbreeding Between Species 87

Methods for detection Secor, 1997). This is true even if hybrid fitness is low and successful backcrosses rare To determine whether hybrids were breed- (Barton, 2001). However, the genomes of ing among themselves or backcrossing to species sufficiently close to hybridize are the introduced or native parents, one could quite similar (Hewitt, 1988; Barton, 2001), collect insects from the field and screen for so that many introgressed sequences will hybrid phenotypes and genotypes. Hybrids have no effect, either not changing mating among themselves would show seg- sequences or not changing function, and regation of genes from both parents. thus not changing fitness. Augmentation of Segregation should be detectable with phe- native species is unlikely to increase intro- notypic and molecular markers, even if gression much. However, native and intro- some hybrid genotypes are more favoured duced species presumably differ, at least in than others. host range or impact on the target pest; otherwise the candidate for introduction would not be under consideration. The fate Reproductive character displacement and impact of introgressed sequences depends on the selective advantage or dis- If species commonly hybridize, but hybrids advantage they confer, the frequency of have lower fitness than either parental introgression, and dispersal rates (Barton species, reproductive traits of one or both and Gale, 1993; Barton, 2001). If hybrids species may diverge (Dobzhansky, 1940). and backcrosses are common, neutral and Such reproductive character displacement even mildly deleterious genes could has often been invoked in discussions of become common in the area of contact, sympatric speciation and reinforcement although they would be unlikely to spread after secondary contact between allopatric far beyond the hybrid zone (Barton and species (McLain, 1986; Bordenstein et al., Hewitt, 1981). As discussed above under 2000; Kawano, 2002). Some are sceptical ‘Hybrid progeny: inviability and sterility’, about the likelihood of reinforcement which species would be most affected (Moore, 1957; Mayr, 1963; Barton and depends on relative abundances. A rare Hewitt, 1981), but recent models and data native, swamped by backcrosses with of sympatric speciation (Via, 2001) and of hybrids from a common introduced reinforcement (Howard, 1993) suggest that species, could have high levels of intro- reproductive character displacement may gression, and the same applies to a rare be more common than many have thought. introduced species swamped by back- Post-introduction evolution in reproduc- crosses with hybrids from a common native. tive traits of introduced species is probably High levels of introgression would be rela- not of concern, unless it would affect suc- tively easy to detect using molecular mark- cess in biological control, which seems ers. Introgressed sequences that are strongly unlikely. On the other hand, some would deleterious, either through direct effects on consider evolution in reproductive traits of traits fitness components or through break- native species undesirable (Simberloff and up of co-adapted gene complexes, would be Stiling, 1996; Mooney and Cleland, 2001), strongly selected against and thus unlikely although such evolution would not neces- to persist or spread. Thus, the major effect of sarily mean changes in abundance. introgression of deleterious sequences would be demographic. If hybrids and successful backcrosses Introgression are rare, introgressed sequences would be unlikely to persist or spread unless they Fertile hybrids between species may back- are selectively advantageous (Barton and cross to either parental species and thus Hewitt, 1985; Barton and Gale, 1993; Linder introgress DNA sequences from one species et al., 1998). However, if an introgressed into another (Anderson, 1953; Dowling and sequence is selectively advantageous, it 88 K.R. Hopper et al.

could rapidly sweep to fixation with mod- introductions, introgression-driven evolu- est levels of selective advantage and dis- tion of host range, especially to attack persal (Barton, 2001). Unfortunately, such a native species, is clearly undesirable. The selective sweep could be very difficult to likelihood of such introgressive changes in detect if it involved a small, unknown host range is unknown; no examples are sequence affecting a trait not previously available in the literature. measured. On the other hand, introgression of sequences affecting previously measured Methods for prediction traits, like host specificity or climatic tolerances, would be relatively easy to detect. Laboratory crosses could show with what Introgression of sequences affecting frequency backcross progeny are produced traits like host use or climatic tolerances from crosses of hybrids with either candi- could have major, and perhaps unwanted, dates for introduction or native species. If consequences. Introgression of sequences backcross progeny are produced, one could affecting climatic tolerances or diapause measure their host range, climatic toler- conditions could allow range expansions ances, mating behaviour and other traits of of native species or increase the realized interest. Within-species crosses would be ranges of an introduced species. On the needed as controls for expected levels of other hand, introgressed genes affecting traits. climatic tolerances could act like conditional lethals, spreading because of fitness Methods for detection advantage under current conditions and then causing heavy mortality when condi- If backcrosses are common, one could mea- tions change. Introgression of such genes sure introgression using molecular mark- resembles proposals for genetic control, ers. If backcrosses are rare, it will be which although seldom implemented, difficult to measure introgression using show much promise for pest management molecular markers, unless one has markers (Gould and Schliekelman, 2004). Nonethe- for specific genes of interest. For rare intro- less, such a catastrophic outcome seems gression, measurement of phenotypic unlikely by chance given the similarity changes will be easier. Beside changes in between genomes of species that will host range and climatic tolerances mea- hybridize. sured in the laboratory crosses, one could Introgression of sequences affecting measure morphological traits after various host range raises the most worrisome and generations of backcrossing to determine plausible scenarios for interbreeding. whether introgression could be detected by Sequences introgressed from an intro- screening morphological phenotypes. duced species into a native species could One could measure demographic effects allow the native species to attack species of introgression from introduced species beyond its original range, including the into native species by comparing popula- target pest. The latter would not be bad in tion dynamics before versus after introduc- itself, and indeed might provide useful tion, or in populations where introgression control, but some hold that any such intro- had or had not occurred. The latter gression-driven evolution is a form of approach depends on being able to detect environmental pollution and thus should introgression. Measuring demographic be avoided (Mooney and Cleland, 2001; effects of introgression from native species Allendorf and Lundquist, 2003). Sequences into introduced species would be more dif- introgressed from a native species into an ficult, unless there were areas in the region introduced species could cause a rapid of introduction where introgression was shift in host range, allowing the intro- absent. In this case, one could compare duced species to attack hosts of the native introduced species dynamics with and species. Given that host specificity is without introgression with the native essential for the safety of biological control species. Risks of Interbreeding Between Species 89

Case history Recommendations and Conclusions Because T. minutum and T. platneri hybridized occasionally in the laboratory We organized the tests described above into and there was concern about gene flow flowcharts for predicting the risks of inter- between these species in the wild, Pinto et breeding from introduction (Fig. 5.1) and al. (2003) tested for introgression where augmentation (Fig. 5.2), and for assessing these species are sympatric in the Pacific impacts of interbreeding with introduced North-west and found no introgression of (Fig. 5.3) or augmented species (Fig. 5.4). species-specific alleles at the Pgm locus. Decision makers must realize that these Although hybrids are expected to differ flowcharts are extremely schematic. The phenotypically from parents and thus be details of the biology of each biological con- detectable, Nagarkatti and Fazaluddin trol candidate, and what is known about that (1973) found hybrids invariably resembled biology, may require modifications in the the maternal parent. As evidence that flowcharts or in the tests proposed above. introgression could be deleterious, The major differences between procedures hybridizing geographical populations of for introductions (Figs 5.1 and 5.3) and aug- Trichogramma and selecting hybrids for mentation (Figs 5.2 and 5.4) are that those tolerance of temperature extremes pro- for introductions address the risk of introduced a weak response and actually gression of novel genes, while those for aug- reduced parasitism in the laboratory mentation concentrate on the demographic (Ashley et al., 1974). effects of mating and hybridization. The

Closely related (

Yes

Likely geographical overlap? No

Yes

Likely habitat/seasonal overlap? No

Yes

Recognize as mates? No

Yes

Hybridize? No

Yes

Hybridize often (>1/10)?

No Yes Further study

Hybrids viable and fertile? No

Yes Accept

Further study Fig. 5.1. Pre-introduction tests to predict interbreeding between species introduced for biological control and native species. See text for description of tests. 90 K.R. Hopper et al.

Closely related (

Yes

Likely geographical overlap? No

Yes

Likely habitat/seasonal overlap? No

Yes

Recognize as mates? No

Yes

Hybridize? No

Yes

Hybridize often (>1/2)? No

Yes Accept

Further study Fig. 5.2. Tests to predict interbreeding between native species augmented for biological control and other native species. See text for description of tests.

major difference between predicting impacts Japan. However, a species in the A. varipes (Figs 5.1 and 5.2) and assessing impacts complex, which does not parasitize D. (Figs 5.3 and 5.4) is that the latter involve noxia, already occurs in Japan. Because the field measurements of mating, hybridization Georgian and Japanese species are closely and introgression. Where post-introduction related, the answer to the first question in tests show effects on populations of non- Fig. 5.1 would be ‘Yes’. The climate in target species, further releases of introduced Georgia where the parasitoids were col- species and augmentation of native species lected matches fairly well the target cli- should be stopped, and similar candidates mate in Japan (Walter and Lieth, 1967), so should be avoided in the future. the species are likely to overlap in geo- To illustrate how one might proceed graphical range after introduction, and the with these flowcharts, we will use our answer to the second question in Fig. 5.1 results on the Aphelinus varipes complex would be ‘Yes’. Because they overlap (Hymenoptera: Aphelinidae) (K.R. Hopper, broadly in host range, with the exception J.B. Woolley, J.M. Heraty, A.M.I. Farias, of D. noxia, they are also likely to occur in S.C. Britch, unpublished results). The A. the same habitats, and the answer to the varipes complex comprises a group of sib- third question in Fig. 5.1 would be ‘Yes’. ling species in Eurasia. One species from Their DNA sequences differ across several the Republic of Georgia parasitizes genes, indicating they have had separate Diuraphis noxia (Mordvilko) (Hemiptera: evolutionary histories for several hundred Aphididae), the Russian wheat aphid. If D. thousand years, but these species readily noxia were accidentally introduced into mate and produce viable offspring in labo- Japan and became a pest (as has occurred ratory experiments. Thus, the answers to in the United States), this Georgian species the remaining questions in Fig. 5.1 would would be a candidate for introduction into also be ‘Yes’. Given that the introgression Risks of Interbreeding Between Species 91

Closely related (

Yes

Geographical overlap? No

Yes

Habitat/seasonal overlap? No

Yes

Recognize as mates in field? No

Yes Effects on populations? No

Hybridize in field? No

Yes

Hybridize often (>1/10)? No

NoYes Effects on populations? No

Hybrids viable and fertile? No

Yes

Introgression occurs? No

Yes Effects on populations? No

No impact detected Fig. 5.3. Post-introduction tests to measure occurrence and impact of interbreeding between species introduced for biological control and native species. See text for description of tests. Where there are effects on populations of non-target species, further releases should be stopped and similar candidates should be avoided in the future. seems likely, further study would be this research will not only improve the needed according to Fig. 5.1. However, safety of biological control, but will also because the species differ in host use and shed light on the behaviour, ecology and introgression could lead to an evolutionary genetics of courtship, mating and shift in host use, in either the introduced hybridization, and thus on the mechanisms or native species, we would recommend of speciation. against releasing the Georgian species in Japan, particularly because there are other candidates with narrower host ranges that Acknowledgements do not mate with the Japanese species. In our opinion, the risks are small of We thank the participants of the Engelberg large impacts from interbreeding between workshop of June 2004 for providing native species and insects used in biologi- insightful discussions, and an anonymous cal control. But data are lacking about both reviewer for comments on the manuscript, the likelihood and impact of interbreeding, and USDA-ARS and INRA for their support so more research is needed. Fortunately, during the preparation of this chapter. 92 K.R. Hopper et al.

Closely related (

Yes

Geographical overlap? No

Yes

Habitat/seasonal overlap? No

Yes

Recognize as mates in field? No

Yes Effects on populations? No

Hybridize in field? No

Yes

Hybridize often (>1/10)? No

Yes Effects on populations? No

No impact detected Fig. 5.4. Tests to measure occurrence and impact of interbreeding between species augmented for biological control and native species. See text for description of tests. Where there are effects on populations of non-target species, augmentation should be stopped and further studies conducted.

References

Albuquerque, G.S., Tauber, C.A. and Tauber, M.J. (1996) Postmating reproductive isolation between Chrysopa quadripunctata and Chrysopa slossonae: Mechanisms and geographic variation. Evolution 50, 1598–1606. Allen, G.R., Kazmer, D.J. and Luck, R.F. (1994) Post copulatory male behaviour, sperm precedence and multiple mating in a solitary parasitoid wasp. Animal Behaviour 48, 635–644. Allendorf, F.W. and Lundquist, L.L. (2003) Introduction: Population biology, evolution, and control of invasive species. Conservation Biology 17, 24–30. Anderson, E. (1936) Hybridization in American Tradescantias. Annals of the Missouri Botanical Gardens 23, 511–525. Anderson, E. (1953) Introgressive hybridization. Biological Reviews 28, 280–307. Anderson, E.C. and Thompson, E.A. (2002) A model-based method for identifying species hybrids using multilocus genetic data. Genetics 160, 1217–1229. Arnold, M.L. (1997) Natural Hybridization and Evolution. Oxford University Press, New York. Arnqvist, G. (1998) Comparative evidence for the evolution of genitalia by sexual selection. Nature 393, 784–785. Ashley, T.R., Gonzalez, D. and Leigh, T.F. (1974) Selection and hybridization of Trichogramma. Environmental Entomology 3, 43–48. Barton, N.H. (2001) The role of hybridization in evolution. Molecular Ecology 10, 551–568. Barton, N.H. and Gale, K.S. (1993) Genetic analysis of hybrid zones. In: Harrison, R.G. (ed.) Hybrid Zones and the Evolutionary Process. Oxford University Press, New York. Barton, N.H. and Hewitt, G.M. (1981) Hybrid zones and speciation. In: Atchley, W.R. and Woodruff, D.S. (eds) Evolution and Speciation: Essays in Honor of M. J. D. White. Cambridge University Press, Cambridge, UK. Barton, N.H. and Hewitt, G.M. (1985) Analysis of hybrid zones. Annual Review of Ecology and Systematics 16, 113–148. Risks of Interbreeding Between Species 93

Besansky, N.J., Lehmann, T., Fahey, G.T., Fontenille, D., Braack, L., Hawley, W.A. and Collins, F.H. (1997) Patterns of mitochondrial variation within and between African malaria vectors, Anopheles gambiae and Anopheles arabiensis, suggest extensive gene flow. Genetics 147, 1817–1828. Bordenstein, S.R., Drapeau, M.D. and Werren, J.H. (2000) Intraspecific variation in sexual isolation in the jewel wasp Nasonia. Evolution 54, 567–573. Brennan, J.M. and Fairbairn, D.J. (1995) Clinal variation in morphology among eastern populations of the waterstrider, Aquarius remigis Say (Hemiptera: Gerridae). Biological Journal of the Linnean Society 54, 151–171. Brodeur, J. and McNeil, J.N. (1994) Seasonal ecology of Aphidius nigripes (Hymenoptera: Aphidiidae), a parasitoid of Macrosiphum euphorbia (Homoptera: Aphididae). Environmental Entomology 23, 292–298. Bullini, L. (1994) Origin and evolution of animal hybrid species. Trends in Ecology and Evolution 9, 422–426. Bush, G.L. and Smith, J.J. (1998) The genetics and ecology of sympatric speciation: A case study. Researches on Population Ecology 40, 175–187. Chen, G.J. and Peterson, A.T. (2000) A new technique for predicting distribution of terrestrial vertebrates using inferential modeling. Zoological Research 21, 231–237. Cibrian, T.J. and Mitchell, E.R. (1991) Courtship behaviour of Heliothis subflexa (Gn.) (Lepidoptera: Noctuidae) and associated backcross insects obtained from hybridization with Heliothis virescens (F.). Environmental Entomology 20, 419–426. Clarke, K.E., Rinderer, T.E., Franck, P., Quezada-Euan, J.J.G. and Oldroyd, B.P. (2002) The Africanization of honeybees (Apis mellifera L.) of the Yucatan: A study of a massive hybridization event across time. Evolution 56, 1462–1474. Clausen, C.P. (1978) Introduced Parasites and Predators of Arthropod Pests and Weeds: a World Review. Agriculture Handbook No. 480. Agricultural Research Service, USDA, Washington, DC. Collins, M.M. (1997) Hybridization and speciation in Hyalophora (Insecta: Lepidoptera: Saturniidae): A reappraisal of W. R. Sweadner’s classic study of a hybrid zone. Annals of Carnegie Museum No. 14. 66, 411–455. Cornel, A.J., McAbee, R.D., Rasgon, J., Stanich, M.A., Scott, T.W. and Coetzee, M. (2003) Differences in extent of genetic introgression between sympatric Culex pipiens and Culex quinquefasciatus (Diptera: Culicidae) in California and South Africa. Journal of Medical Entomology 40, 36–51. Cox, G.W. (2004) Alien Species and Evolution. Island Press, Washington, DC. Coyne, J.A. and Orr, H.A. (1997) ‘Patterns of speciation in Drosophila’ revisited. Evolution 51, 295–303. Craig, T.P., Horner, J.D. and Itami, J.K. (1997) Hybridization studies on the host races of Eurosta solidaginis: Implications for sympatric speciation. Evolution 51, 1552–1560. Damiens, D., Bressac, C., Brillard, J.P. and Chevrier, C. (2002) Qualitative aspects of sperm stock in males and females from Eupelmus orientalis and Dinarmus basalis (Hymenoptera: Chalcidoidea) as revealed by dual fluorescence. Physiological Entomology 27, 97–102. Danforth, B.N., Mitchell, P.L. and Packer, L. (1998) Mitochondrial DNA differentiation between two cryptic Halictus (Hymenoptera: Halictidae) species. Annals of the Entomological Society of America 91, 387–391. Davis, F.M., Bird, T.G., Sloderbeck, P.E., Lewis, B.E., Yochim, R.S., Knutson, A.E., Ng, S.S., Gallardo, J.L., Pedroza, A.S. and Mihm, J.A. (1987) Southwestern corn borer attractiveness to synthetic pheromone. Southwestern Entomologist 12, 57–65. Deering, M.D. and Scriber, J.M. (2002) Field bioassays show heterospecific mating preference asym- metry between hybridizing North American Papilio butterfly species (Lepidoptera: Papillonidae). Journal of Ethology 20, 25–33. Deverno, L.L., Smith, G.A. and Harrison, K.J. (1998) Randomly amplified polymorphic DNA evidence of introgression in two closely related sympatric species of Coniferophagous choris- toneura (Lepidoptera: Tortricidae) in Atlantic Canada. Annals of the Entomological Society of America 91, 248–259. Dobzhansky, T. (1940) Speciation as a stage in evolutionary divergence. American Naturalist 74, 312–321. Dobzhansky, T. (1970) Genetics of the Evolutionary Process. Columbia, New York. 94 K.R. Hopper et al.

Dos Santos, P., Uramoto, K. and Matioli, S.R. (2001) Experimental hybridization among Anastrepha

species (Diptera: Tephritidae): Production and morphological characterization of F1 hybrids. Annals of the Entomological Society of America 94, 717–725. Dowling, T.E. and Secor, C.L. (1997) The role of hybridization and introgression in the diversification of animals. Annual Review of Ecology and Systematics 28, 593–619. Eberhard, W.G. (2001) Species-specific genitalic copulatory courtship in sepsid flies (Diptera: Sepsidae: Microsepsis) and theories of genitalic evolution. Evolution 55, 93–102. Endler, J.A. (1977) Geographic Variation, Speciation, and Clines. Princeton University Press, Princeton, New Jersey. Ewel, J.J., O’Dowd, D.J., Bergelson, J., Daehler, C.C., D’Antonio, C.M., Gomez, L.D., Gordon, D.R., Hobbs, R.J., Holt, A., Hopper, K.R., Hughes, C.E., Lahart, M., Leakey, R.R.B., Lee, W.G., Loope, L.L., Lorence, D.H., Louda, S.M., Lugo, A.E., McEvoy, P.B., Richardson, D.M. and Vitousek, P.M. (1999) Deliberate introductions of species: Research needs–benefits can be reaped, but risks are high. Bioscience 49, 619–630. Feder, J.L. and Bush, G.L. (1989) Gene frequency clines for host races of Rhagoletis pomonella in the midwestern USA. Heredity 63, 245–266. Feder, J.L., Hunt, T.A. and Bush, G.L. (1993) The effects of climate, host-plant phenology and host fidelity on the genetics of apple and hawthorn infesting races of Rhagoletis pomonella. Entomologia Experimentalis et Applicata 69, 117–135. Feder, J.L., Opp, S.B., Wlazlo, B., Reynolds, K., Go, W. and Spisak, S. (1994) Host fidelity is an effective premating barrier between sympatric races of the apple maggot fly. Proceedings of the National Academy of Sciences of the USA 91, 7990–7994. Fleischmann, I., Cotton, B., Choffat, Y., Spengler, M. and Kubli, E. (2001) Mushroom bodies and postmating behaviors of Drosophila melanogaster females. Journal of Neurogenetics 15, 117–144. Frank, J.H. and McCoy, E.D. (1995) Introduction to insect behavioral ecology – the good, the bad, and the beautiful – non-indigenous species in Florida. Florida Entomologist 78, 1–15. Glenn, D.C., Hercus, M.J. and Hoffmann, A.A. (1997) Characterizing Trichogramma (Hymenoptera: Trichogrammatidae) species for biocontrol of light brown apple moth (Lepidoptera: Tortricidae) in grapevines in Australia. Annals of the Entomological Society of America 90, 128–137. Gould, F. and Schliekelman, P. (2004) Population genetics of autocidal control and strain replacement. Annual Review of Entomology 49, 193–217. Goulson, D. (1993) Variation in the genitalia of the butterfly Maniola jurtina (Lepidoptera: Satyrinae). Zoological Journal of the Linnean Society 107, 65–71. Haegele, K. (1999) Hybrid syndrome-induced postzygotic reproductive isolation: A second reproduction barrier in Chironomus thummi (Diptera: Chironomidae). Journal of Zoological Systematics and Evolutionary Research 37, 161–164. Harrison, R.G. (1986) Pattern and process in a narrow hybrid zone. Heredity 56, 337–350. Heady, S.E. and Denno, R.F. (1991) Reproductive isolation in Prokelisia planthoppers (Homoptera: Delphacidae): Acoustic differentiation and hybridization failure. Journal of Insect Behavior 4, 367–390. Hewitt, G.M. (1988) Hybrid zones – natural laboratories for evolutionary studies. Trends in Ecology and Evolution 3, 158–167. Hopper, K.R. and Roush, R.T. (1993) Mate finding, dispersal, number released, and the success of biological-control introductions. Ecological Entomology 18, 321–331. Howard, D.J. (1986) A zone of overlap and hybridization between two ground cricket species. Evolution 40, 34–43. Howard, D.J. (1993) Reinforcement: Origin, dynamics, and fate of an evolutionary hypothesis. In: Harrison, R.G. (ed.) Hybrid Zones and the Evolutionary Process. Oxford University Press, New York. Howard, D.J. (1999) Conspecific sperm and pollen precedence and speciation. Annual Review of Ecology and Systematics 30, 109–132. Howard, D.J., Waring, G.L., Tibbets, C.A. and Gregory, P.G. (1993) Survival of hybrids in a mosaic hybrid zone. Evolution 47, 789–800. Hoy, M.A., Jeyaprakash, A., Morakote, R., Lo, P.K.C. and Nguyen, R. (2000) Genomic analyses of two populations of Ageniaspis citricola (Hymenoptera: Encyrtidae) suggest that a cryptic species may exist. Biological Control 17, 1–10. Huxel, G.R. (1999) Rapid displacement of native species by invasive species: Effects of hybridization. Biological Conservation 89, 143–152. Risks of Interbreeding Between Species 95

Jamart, J.A., Casares, P., Carracedo, M.C. and Pineiro, R. (1995) Consequences of homospecific and heterospecific rapid remating on the fitness of Drosophila melanogaster females. Journal of Insect Physiology 41, 1019–1026. Jang, E.B. (2002) Physiology of mating behavior in Mediterranean fruit fly (Diptera: Tephritidae): Chemoreception and male accessory gland fluids in female post-mating behavior. Florida Entomologist 85, 89–93. Kawano, K. (2002) Character displacement in giant rhinoceros beetles. American Naturalist 159, 255–271. King, E.G., Hartley, G.G., Martin, D.F. and Laster, M.L. (1985) Large-scale rearing of a sterile backcross of the tobacco budworm Heliothis virescens (Lepidoptera: Noctuidae). Journal of Economic Entomology 78, 1166–1172. Kohlmann, B.C. and Shaw, D.D. (1991) The effect of a partial barrier on the movement of a hybrid zone. Evolution 45, 1606–1617. Laster, M.L., Hardee, D.D. and Schneider, J.C. (1996) Heliothis virescens (Lepidoptera: Noctuidae): Influence of sterile backcross releases on suppression. Southwestern Entomologist 21, 433–444. Linder, C.R., Taha, I., Seiler, G.J., Snow, A.A. and Rieseberg, L.H. (1998) Long-term introgression of crop genes into wild sunflower populations. Theoretical and Applied Genetics 96, 339–347. Mayr, E. (1963) Animal Species and Evolution. Belknap Press, Cambridge, Massachusetts. McLain, D.K. (1986) Niche differentiation and the evolution of ethological isolation in a soldier beetle hybrid zone. Oikos 47, 159–167. Miao, J., Pan, J. and Jang, W. (1988) Hybridization and chromosome observations on six species of the Anopheles hyrcanus group in China (Diptera: Culicidae). Zoological Research 9, 231–238. Michailova, P.V. (1998) Cytogenetic analysis of a hybrid, Glyptotendipes pallens (Mg.) ϫ Glyptotendipes glaucus (Mg.) (Diptera: Chironomidae): Evolutionary considerations. Journal of Zoological Systematics and Evolutionary Research 36, 185–189. Monti, L., Lalanne-Cassou, B., Lucas, P., Malosse, C. and Silvain, J.F. (1995) Differences in sex pheromone communication systems of closely related species: Spodoptera latifascia (Walker) and S. descoinsi (Lalanne-Cassou and Silvain) (Lepidoptera: Noctuidae). Journal of Chemical Ecology 21, 641–660. Mooney, H.A. and Cleland, E.E. (2001) The evolutionary impact of invasive species. Proceedings of the National Academy of Sciences of the USA 98, 5446–5451. Moore, J.A. (1957) An embryologist’s view of the species concept. In: Mayr, E. (ed.) The Species Problem. American Association for the Advancement of Science, Washington, DC. Moore, W.S. (1977) An evaluation of narrow hybrid zones in vertebrates. Quarterly Review of Biology 52, 263–277. Morales-Ramos, J.A., Rojas, M.G. and King, E.G. (2000) Differences in reproductive potential of two populations of Catolaccus grandis (Hymenoptera: Pteromalidae) and their hybrids. Florida Entomologist 83, 137–145. Morlais, I. and Severson, D.W. (2002) Complete mitochondrial DNA sequence and amino acid analysis of the cytochrome-c oxidase subunit I (COI) from Aedes aegypti. DNA Sequence 13, 123–127. Morrow, J., Scott, L., Congdon, B., Yeates, D., Frommer, M. and Sved, J. (2000) Close genetic similarity between two sympatric species of tephritid fruit fly reproductively isolated by mating time. Evolution 54, 899–910. Nagarkatti, S. and Fazaluddin, M. (1973) Biosystematic studies on Trichogramma species (Hymenoptera: Trichogrammatidae). 2. Experimental hybridization between some Trichogramma spp. from the New World. Systematic Zoology 22, 103–117. Nason, J.D. and Ellstrand, N.C. (1993) Estimating the frequencies of genetically distinct classes of individuals in hybridized populations. Journal of Heredity 84, 1–12. Nix, H.A. (1986) A biogeographic analysis of the Australina elapid snakes. In: Longmore, R. (ed.) Atlas of Elapid Snakes, Australian Flora and Fauna Series No. 7, 4–15. Australian Government Publishing Service, Canberra. Nyman, T. (2002) The willow bud galler Euura mucronata Hartig (Hymenoptera: Tenthredinidae): One polyphage or many monophages? Heredity 88, 288–295. Oliver, C.G. (1979) Genetic differentiation and hybrid viability within and between some Lepidoptera species. American Naturalist 114, 681–694. Pak, G.A. and Oatman, E.R. (1982) Comparative life table, behavior and competition studies of Trichogramma brevicapillum and Trichogramma pretiosum. Entomologia Experimentalis et Applicata 32, 68–79. 96 K.R. Hopper et al.

Pike, N., Wang, W.Y.S. and Meats, A. (2003) The likely fate of hybrids of Bactrocera tryoni and Bactrocera neohumeralis. Heredity 90, 365–370. Pinto, J.D., Stouthamer, R., Platner, G.R. and Oatman, E.R. (1991) Variation in reproductive compatibility in Trichogramma and its taxonomic significance (Hymenoptera, Trichogrammatidae). Annals of the Entomological Society of America 84, 37–46. Pinto, J.D., Kazmer, D.J., Platner, G.R. and Sassaman, C.A. (1992) Taxonomy of the Trichogramma minutum complex (Hymenoptera, Trichogrammatidae) – allozymic variation and its relationship to reproductive and geographic data. Annals of the Entomological Society of America 85, 413–422. Pinto, J.D., Platner, G.R. and Stouthamer, R. (2003) The systematics of the Trichogramma minutum species complex (Hymenoptera: Trichogrammatidae), a group of important North American biological control agents: The evidence from reproductive compatibility and allozymes. Biological Control 27, 167–180. Pintureau, B. (1993) Morphometric analysis of the genus Trichogramma Westwood (Hymenoptera, Trichogrammatidae) in Europe. Canadian Entomologist 125, 367–378. Polukonova, N.V. and Beljanina, S.I. (2002) On the possibility of hybridogenesis in the origin of midge Chironomus usenicus Loginova et Beljanina (Chironomidae: Diptera). Genetika 38, 1635–1640. Porter, A.H. and Shapiro, A.M. (1990) Lock and key hypothesis: Lack of mechanical isolation in a butterfly (Lepidoptera: Pieridae) hybrid zone. Annals of the Entomological Society of America 83, 107–114. Presgraves, D.C. (2002) Patterns of postzygotic isolation in Lepidoptera. Evolution 56, 1168–1183. Proshold, F.I., King, E.G. and Hartley, G.G. (1986) Survival, emergence, and release of laboratory- reared backcross tobacco budworm Heliothis virescens (Lepidoptera: Noctuidae) pupae shipped from Stoneville, Mississippi to St. Croix, USA (Virgin Islands). Journal of Economic Entomology 79, 541–544. Rao, S.V. and DeBach, P. (1969) Experimental studies on hybridization and sexual isolation between some Aphytis species (Hymenoptera: Aphelinidae). III. The significance of reproductive isolation between interspecific hybrids and parental species. Evolution 23, 525–533. Rawlings, S.P. (1985) The genetics of hybrid sterility between subspecies of the complex of Glossina morsitans (Diptera: Glossinidae). Bulletin of Entomological Research 75, 689–700. Rieseberg, L.H. (1997) Hybrid origins of plant species. Annual Review of Ecology and Systematics 28, 359–389. Rieseberg, L.H., Vanfossen, C. and Desrochers, A.M. (1995) Hybrid speciation accompanied by genomic reorganization in wild sunflowers. Nature 375, 313–316. Robinson, T., Johnson, N.A. and Wade, M.J. (1994) Postcopulatory, prezygotic isolation: Intraspecific and interspecific sperm precedence in Tribolium spp., flour beetles. Heredity 73, 155–159. Rohi, L. and Pintureau, B. (2003) Are Trichogramma bourarachae and the perkinsi species group really distinct from Trichogramma buesi and the pintoi group, respectively? Journal of Applied Entomology 127, 265–268. Roush, R.T. and Schneider, J.C. (1985) An analytical model for genetic-control of Heliothis virescens incorporating the effects of sterile males. Theoretical and Applied Genetics 71, 472–477. Sagarra, L.A. and Peterkin, D.D. (1999) Invasion of the Caribbean by the hibiscus mealybug, Maconellicoccus hirsutus Green (Homoptera: Pseudococcidae). Phytoprotection 80, 103–113. Selivon, D., Perondini, A.L.P. and Morgante, J.S. (1999) Haldane’s rule and other aspects of reproductive isolation observed in the Anastrepha fraterculus complex (Diptera: Tephritidae). Genetics and Molecular Biology 22, 507–510. Sherron, D.A. and Rai, K.S. (1984) Genetics of speciation in the Aedes scutellaris group (Diptera: Culicidae). 3. The genetic relationship of Aedes cooki with Aedes kesseli. Journal of Medical Entomology 21, 540–547. Shoemaker, D.D., Ross, K.G. and Arnold, M.L. (1996) Genetic structure and evolution of a fire ant hybrid zone. Evolution 50, 1958–1976. Simberloff, D. and Stiling, P. (1996) Risks of species introduced for biological control. Biological Conservation 78, 185–192. Sota, T. and Kubota, K. (1998) Genital lock-and-key as a selective agent against hybridization. Evolution 52, 1507–1513. Risks of Interbreeding Between Species 97

Sperling, F., Byers, R. and Hickey, D. (1996) Mitochondrial DNA sequence variation among pheromo- types of the dingy cutworm, Feltia jaculifera (Gn.) (Lepidoptera: Noctuidae). Canadian Journal of Zoology 74, 2109–2117. Stouthamer, R., Jochemsen, P., Platner, G.R. and Pinto, J.D. (2000) Crossing incompatibility between Trichogramma minutum and T. platneri (Hymenoptera: Trichogrammatidae): Implications for application in biological control. Environmental Entomology 29, 832–837. Swanson, J., Lancaster, M., Anderson, J., Crandell, M., Haramis, L., Grimstad, P. and Kitron, U. (2000) Overwintering and establishment of Aedes albopictus (Diptera: Culicidae) in an urban La Crosse virus enzootic site in Illinois. Journal of Medical Entomology 37, 454–460. Taylor, D.B. (1990) Genetics of interspecific hybridization in the Triseriatus and Zoosophus groups of Aedes (Protomacleaya) (Diptera: Culicidae). Annals of the Entomological Society of America 83, 1181–1191. Taylor, D.B. and Craig, G.B. (1985) Unidirectional reproductive incompatibility between Aedes (P.) berlandi and Aedes (P.) hendersoni (Diptera: Culicidae). Annals of the Entomological Society of America 78, 769–774. Thelwell, N.J., Huisman, R.A., Harbach, R.E. and Butlin, R.K. (2000) Evidence for mitochondrial introgression between Anopheles bwambae and Anopheles gambiae. Insect Molecular Biology 9, 203–210. Thorpe, K.W. (1984) Seasonal distribution of Trichogramma (Hymenoptera, Trichogrammatidae) species associated with a Maryland soybean field. Environmental Entomology 13, 127–132. Tilmon, K.J., Wood, T.K. and Pesek, J.D. (1998) Genetic variation in performance traits and the potential for host shifts in Enchenopa treehoppers (Homoptera: Membracidae). Annals of the Entomological Society of America 91, 397–403. Umphrey, G.J. and Danzmann, R.G. (1998) Electrophoretic evidence for hybridization in the ant genus Acanthomyops (Hymenoptera: Formicidae). Biochemical Systematics and Ecology 26, 431–440. Via, S. (2001) Sympatric speciation in animals: The ugly duckling grows up. Trends in Ecology and Evolution 16, 381–390. Walker, P., Leather, S.R. and Crawley, M.J. (2002) Differential rates of invasion in three related alien oak gall wasps (Cynipidae: Hymenoptera). Diversity and Distributions 8, 335–349. Walter, H. and Lieth, H. (1967) Climate Diagrams – World Atlas. Gustav Fischer, Jena, Germany. Willett, C.S., Ford, M.J. and Harrison, R.G. (1997) Inferences about the origin of a field cricket hybrid zone from a mitochondrial DNA phylogeny. Heredity 79, 484–494. Wood, T.K. and Guttman, S.I. (1982) Ecological and behavioral basis for reproductive isolation in the sympatric Enchenopa binotata complex (Homoptera: Membracidae). Evolution 36, 233–242. Wood, T.K., Tilmon, K.J., Shantz, A.B., Harris, C.K. and Pesek, J. (1999) The role of host-plant fidelity in initiating insect race formation. Evolutionary Ecology Research 1, 317–332. Yara, K., Yano, E., Sasawaki, T. and Shiga, M. (2000) Detection of hybrids between introduced Torymus sinensis and native T. beneficus (Hymenoptera: Torymidae) in central Japan, using malic enzyme. Applied Entomology and Zoology 35, 201–206. Young, C.W., Onore, G. and Proano, K. (1999) First occurrence of Tipula (Tipula) oleracea Linnaeus (Diptera: Tipulidae) in the New World, with biological notes. Journal of the Kansas Entomological Society 72, 226–232. Yukawa, J. (1996) Identification of paedogenetic gall midge, Mycophila speyeri (Diptera: Cecidomyiidae) and possibility of accidental introduction to Japan. Japanese Journal of Applied Entomology and Zoology 40, 135–143. Zhu, Y.C., Burd, J.D., Elliott, N.C. and Greenstone, M.H. (2000) Specific ribosomal DNA marker for early polymerase chain reaction detection of Aphelinus hordei (Hymenoptera: Aphelinidae) and Aphidius colemani (Hymenoptera: Aphidiidae) from Diuraphis noxia (Homoptera: Aphididae). Annals of the Entomological Society of America 93, 486–491. 6 Assessing the Establishment Potential of Inundative Biological Control Agents

Guy Boivin,1 Ursula M. Kölliker-Ott,2 Jeffrey Bale3 and Franz Bigler2 1Horticultural Research and Development Center, Agriculture and Agrifood Canada, 430 Boul. Gouin, St-Jean-sur-Richelieu, Québec, J3B 3E6 Canada (email: [email protected]; fax number: +1-450-346-7740); 2Agroscope FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstrasse 191, 8046 Zürich, Switzerland (email: [email protected]; [email protected]; fax number: +41-44-377-7201); 3School of Biosciences, University of Birmingham, Edgbaston, Birmingham, B15 2TT, UK (email: [email protected]; fax number: +44-121-414-5925)

Abstract

Establishment of exotic natural enemies in the area of release is not a desirable attribute in inundative releases as it increases the risks of non-target effects on native species. To evaluate the risks of non-target effects, this chapter focuses on factors which may limit the establishment of introduced natural enemies, either for a season or permanently. From a risk assessment perspective, the risk associated with the release of a species with seasonal persistence capacity is limited in time. The establishment of natural enemies in a novel habitat depends on several factors, some abiotic and some biotic. Among the abiotic factors, climate is a major factor. Temperature and humidity, especially when soil moisture is considered in species that spend part of their development in the soil, are the components of weather that have the major impact on the survival and establishment of exotic species. Biotic factors, and especially the occurrence of alternate host/prey, also play an important role in the probability that an organism will become established. We describe in this chapter the methods that should be used to assess the probability that exotic natural enemies can become established, based on these factors. We recommend ﬁrst evaluating to what extent temperature may limit establishment. Only where the risk of establishment based on thermal requirements is determined to be higher than ‘insignificant’, should the availability and suitability of host or prey for overwintering in the non- target habitat or the impact of humidity be investigated.

Introduction release is not a desirable attribute in inundative releases. Establishment of an In contrast to classical biological control or introduced organism increases the risks of inoculative releases, the ability of an exotic non-target effects on native species. Such natural enemy to establish in the area of risks include displacement of native preda- ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 98 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Establishment Potential of Inundative BCA 99

tor or parasitoid species and a decrease in factors are well characterized in most areas the population density of native species and the response of natural enemies to the used as prey or host. To evaluate the risks conditions expected in the area of release of non-target effects, this chapter focuses can be tested. In fact, the impact of factors on factors which may limit the establish- such as temperature and humidity should ment of introduced natural enemies. be among the first ones to be tested, espe- One of the risks that has to be assessed cially in areas where extreme conditions before releasing a biological control agent is are expected. The importance of abiotic the potential for the establishment of a nat- factors, and mostly temperature, on the ural enemy in areas where it is not indige- probability of establishment of a natural nous. For example, a risk of establishment of enemy is highlighted by the fact that most exotic natural enemies is present if individu- of the successes in classical biological con- als escape from greenhouses in which inocu- trol programmes have occurred in warm lative or inundative releases are made. Mass climates (DeBach, 1964). Data on tempera- release of predators or parasitoids in the ture and humidity can be used to predict field may also result in the establishment of the distribution of species that have been these species, either for a season or perma- previously introduced. However, in situa- nently. Seasonal persistence is the survival tions in which outdoor establishment is and reproduction of a species throughout undesirable, such as with escapes from one season, with seasonally occurring condi- greenhouses, it is now apparent that cli- tions preventing further survival. Inability to mate matching between native and intro- overwinter due to the occurrence of low duced ranges may not be a sound basis for temperatures is probably the most frequent predicting long term survival (Hart et al., reason for failure to establish long-term pop- 2002a,b), and more comprehensive analy- ulations. Permanent establishment is the sur- ses of thermal tolerance are required. vival of a species for several years. From a Biotic factors also play an important risk assessment perspective, the risks associ- role in the probability that an organism ated with the release of a species with sea- will become established. The occurrence of sonal persistence capacity is limited in time. alternate host/prey, the presence of com- If negative effects are found after the release, petitors or natural enemies and, finally, these effects will last for only one season. access to other food sources, are all factors For species with the capacity to establish that are important in the capacity for an permanently, any damage will also be per- organism to establish itself in an area. manent. The risk factors linked to these two These factors are more difficult to assess types of establishment should therefore be than the abiotic factors and, for many different. organisms, the information available from The establishment of natural enemies in both the area of origin and the area of intro- a novel habitat depends on several factors, duction is often lacking or patchy. some abiotic and some biotic. Among the Finally, the interaction of abiotic and abiotic factors, climate is a major factor, biotic factors will act together on both the and it has long been advocated that climate host/prey and the natural enemy. The prob- matching of the recipient system and the ability of establishment of organisms in native range should help predict dispersal temperate climates is affected both by mor- and potential geographic spread (Louda et tality due to climatic extremes and by the al., 2003; Cock et al., Chapter 12, this vol- difficulty in adjusting and synchronizing ume). Temperature is the component of their lifecycle with that of their host, espe- weather that has the major impact on the cially when these hosts enter quiescence or survival and establishment of exotic diapause stages during the season when species. Humidity can also be a limiting extremes are reached (Bale, 1991a). This factor, especially when soil moisture is ability to synchronize with their host/prey considered in species that spend part of is especially critical in specialist natural their development in the soil. These abiotic enemies because they cannot use alternate 100 G. Boivin et al.

hosts/prey to either survive until emer- the range of their distribution once estab- gence or sustain populations between gen- lished. Both low and high temperatures are erations of the host/prey. The current trend to be considered, although the meaning of toward using specialist species is sound, ‘high’ and ‘low’ will vary according to the both from an environmental perspective area of origin of the organism. Temperature and because it decreases the probability of can affect the probability of establishment establishment. The use of specialist species either through the thermal budget of an is thus generally preferable, and is particu- organism or through direct mortality caused larly useful for greenhouses, where their by exposure to low or high temperature. external establishment is undesirable. The thermal budget refers to the accumula- We will consider in this chapter only tion of day degrees necessary to complete a factors that could prevent establishment of generation and can be used to assess the a natural enemy. Factors that affect the effi- number of generations that are theoretically cacy of the introduced organism but that possible per year. When the total number of will not prevent a species from establishing day degrees available in an area is either will not be covered. The occurrence of food below the minimum needed for a genera- sources is one such factor. The availability tion, or is such that at the end of summer of an adequate food source is known to the organism is in a stage where it cannot increase parasitoid efficacy but it may be survive winter, establishment is unlikely. impossible to demonstrate that no food Direct mortality attributable to temperature source is available and that this absence can be due either to short exposure to lethal will render establishment impossible. temperatures or to prolonged exposure to Other factors not likely to be decisive in sub-optimal temperatures that become preventing establishment include competi- lethal over time. tion with other natural enemies and the Most insect species have a thermal opti- presence of predators or hyperparasitoids. mum at which survival and development Therefore, we will concentrate on tempera- are normal. As the temperature decreases, ture and humidity among the abiotic fac- the insect eventually enters a sub-optimal tors, and on the presence of host/prey in zone, where mortality will occur after a the area of release among biotic factors. certain time at that temperature. Below that In this chapter we will briefly describe temperature, the insect enters the tempo- the methods that can be used to quantify rary cold stupor zone, where vital func- these factors and ultimately determine the tions such as feeding and mating are risk of establishment. strongly reduced. Finally, it enters the chill coma, where movement becomes slower and eventually stops (Vannier, 1994). Factors Preventing Establishment When the temperature of the insect body falls below 0°C, the haemolymph (or other Abiotic factors tissues) eventually freezes at the supercooling point. The methods that can be used to measure A similar gradation can be found as the abiotic factors that may limit the establish- temperature increases. The insect will ment of exotic natural enemies are summa- enter the temporary heat stupor zone, rized in Table 6.1. The table includes a short where it shows loss of coordination and description of the methods, the information short episodes of lethargy. As the tempera- gained from the experiments, and lists the ture increases, the insect becomes motion- equipment needed to perform the tasks. less in the thermostupor zone (heat coma). The insect eventually dies when the temperature reaches the upper thermal death Temperature point (Vannier, 1994). Temperature influences the probability of As for all invertebrates, the rate of establishment of insect natural enemies and development of insects varies with temper- Establishment Potential of Inundative BCA 101

ature. Several models have been used to the presence of polyols is common, and describe the relationship between tempera- these products protect the frozen tissues ture and the developmental rate of insects from frost damage. but most have in common that above a cer- The majority of overwintering insects tain temperature, the base temperature, day are freeze-intolerant (Bale, 1991b) and are degrees start to accumulate. Above the base killed at the moment they freeze at the temperature, rate of development increases supercooling point. These species must gradually, often with a positive slope, up to avoid freezing, either by behavioural or a certain temperature where the slope physiological adaptations. Behavioural becomes negative. This sigmoid curve adaptations include selection of protected reaches a peak temperature at which the overwintering sites and migration away rate of development is at a maximum. from the geographical area where tempera- Above this temperature, rate of develop- tures lower than the supercooling point ment decreases, often quite rapidly, down occur. Physiological adaptations involve to the point where no development occurs emptying the gut to avoid the presence of at all (Fig. 6.1). Two factors are important ice-nucleating particles and synthesis of from the perspective of establishment. The cryoprotectants. ﬁrst is the base temperature, as it is needed The use of the supercooling point to to calculate the accumulation of day assess the cold-hardiness of a species, and degrees, and the second is the thermal bud- therefore its probability of establishment in get, which is the number of day degrees an area based on the lowest temperature necessary for an organism to complete a occurring in this area, is relevant only for generation. species where winter mortality occurs pre- Exposure to low temperature can kill dominantly at or close to the freezing tem- insects either by freezing or by cumulative perature of the insect. A well-known cold damage, without freezing. Two strate- example is the autumnal moth, Epirrita gies have been described by which insects autumnata (Borkhausen) (Lepidoptera: survive at low temperature: freeze toler- Geometridae), that occurs on mountain ance and freeze intolerance. Freeze-tolerant birch in northern Europe. The overwinter- species generally freeze at relatively high ing eggs of this species have a mean super- temperatures (above Ϫ10°C) and can cooling point of Ϫ35.9°C and egg survival recover when they thaw. In these species, correlates well with the lowest tempera-

Fig. 6.1. Example of a temperature response curve (based on the equation of Brière et al., 1999). 102 G. Boivin et al.

tures during winter (Tenow and Nilssen, individual may die or when sub-lethal 1990), an indication that for this species effects that reduce the fitness of the indi- the supercooling point is an accurate mea- vidual appear, such as reduced fecundity. sure of cold hardiness. Depending on the climate of the areas of Classification of insects as freeze-toler- origin and on the introduction of a natural ant or freeze-intolerant takes into account enemy, different cold-related indices have only freezing as a cause of death. Although been proposed to assess the probability of this factor is relevant for species in temper- establishment of alien species in the UK ate or subarctic climates that survive well (Bale and Walters, 2001). When these at low temperatures above their supercool- indices are used, it can be informative to ing point, for most species, mortality test both the natural enemy to be intro- caused by low temperature occurs at tem- duced and a native related species. The peratures much higher than the supercool- native species is known to survive in the ing point (Bale and Walters, 2001). area of introduction and results may differ- Exposure at temperatures above the super- entiate between this species and the exotic cooling point induces mortality, following species, in which case an assessment can cumulative-cold injuries, that is propor- be made of the likelihood of establishment tional to both the temperature and the of the non-native species. duration of the exposure. This mortality appears to result from membrane phase LITERATURE STUDY. If the climate in the area transitions and protein conformational of origin differs greatly from the area of changes at low temperature (Sinclair et al., introduction, then establishment of the 2003). For these species, the supercooling introduced organism in the release area point is an unreliable index of cold-toler- may be unlikely. Information on the biol- ance and the impact of sub-freezing tem- ogy (e.g. overwintering stages, diapause perature must be measured. In tropical characteristics), ecology (e.g. overwintering species, cumulative-cold damage may sites, migratory performance) and thermal occur even at temperatures above 0°C. requirement (e.g. base temperature, thermal While the damage caused by brief budget) of the introduced organisms (if periods of chill coma is readily reversible, available) may also help to determine their long periods of low temperature may prove potential to establish in a specific area. fatal (Denlinger and Lee, 1998). Some of This information should also cover all the damage caused by low-temperature aspects related to the capacity of the organ- exposure can be reduced if the organism is ism to adapt to a new environment, includ- exposed to pulses of higher temperature. ing its response to humidity. For example, These periods at higher temperature could the ability of an organism to enter diapause enable insects to regenerate certain energy in its area of origin is likely to increase the resources or cryoprotectants that are pro- chance of establishment in the area of gressively depleted at low temperature introduction. (Denlinger and Lee, 1998). DEVELOPMENTAL THRESHOLDS. The lower METHODS OF ASSESSING TEMPERATURE EFFECTS. developmental threshold, or base tempera- When the effect of low-temperature expo- ture, is the temperature below which no sure is measured, the timing of the observa- development occurs. This temperature is tion is important. Mortality can increase established by obtaining the rate of devel- progressively when the individuals are opment of the organism at different tem- returned to favourable conditions and peratures and then calculating the therefore an early mortality assessment can temperature at which the development underestimate the effect of the cold expo- rate is zero. No development will occur sure (Bale, 1991a). In addition, the effect of during periods where the maximum daily cold exposure can be apparent only at a temperature is below the base tempera- later stage of development, either when the ture. The upper developmental threshold Establishment Potential of Inundative BCA 103

is the temperature above which no devel- vent its establishment. When it is of inter- opment occurs. These thresholds can be est to consider partial development (i.e. used to calculate the number of day number of day degrees necessary to com- degrees required for a species to complete plete diapause or speciﬁc stages of the life a generation. cycle), a similar approach is used and the Day degrees have been used quite exten- accumulation of day degrees recorded each sively to express insect development over day until the desired phase of development the growing season. Most published esti- is completed. mates of day degree accumulation include the lower developmental threshold temper- SUPERCOOLING POINT. The supercooling ature (Tbase), but only a few include the point (SCP) is the temperature at which an optimum or higher developmental thresh- individual freezes. For freeze-intolerant old temperature (Tsup). species, death occurs at or above this tem- The development rate of an organism perature. Although is it recognized that (i.e. 1/day) in relation to temperature is death can occur at temperatures much generally linear over the optimum tempera- above the supercooling point, this temperature range but becomes curvilinear close to ture is still relevant, especially for species the Tbase and Tsup (Fig. 6.1). The use of a originating from cold areas. Also, the linear regression to estimate the Tbase (the supercooling point indicates the tempera- intercept on the x-axis) may thus lead to ture above which the incidence of pre- important errors at temperatures close to freeze mortality can be investigated. the thermal extremes of the organism. Non- The supercooling point is determined linear equations are therefore preferable to by detecting the small increase of tempera- express development rate as a function of ture resulting from the release of latent temperature. These can be classiﬁed into heat when body water freezes. The organ- three broad categories based on their ism is cooled at a constant rate (typically capacity to determine Tbase and Tsup as 1°C/min) while its temperature is continu- summarized below: (i) direct estimations of ously recorded. Microthermocouples, of

Tbase and Tsup (e.g. Brière et al., 1999), (ii) type T (copper-constantan) or K (chromel– indirect estimations of Tbase and Tsup (e.g. alumel), are normally used and tempera- Duthie, 1997) and (iii) indirect estimations ture recording done on either a paper chart of Tbase and direct estimation of Tsup (e.g. or a data logger (Hance and Boivin, 1993). Lactin et al., 1995). Preparation of the organism is also critical In most cases, these equations provide as age, feeding status, surface particles or accurate estimates of optimum tempera- water ﬁlm can modify the freezing temper- ture when appropriate data of insect ature through the presence of ice nucle- development as a function of temperature ators or ice crystals. In addition, although a are available. cooling rate of 1°C/min is usually used, this rate is much higher than occurs in nat- THERMAL BUDGET. The thermal budget is ural situations (Sinclair, 2001). Variation in the number of day degrees required by a cooling rate has little effect on the SCP, but species to complete a generation. The base may modify the ability of insects to survive temperature (developmental threshold) the freezing event. must be established before this index can Cooling at a constant rate can be be calculated. When the annual accumula- achieved by apparatus using a water- tion of day degrees in an area is below that cooled Peltier effect module linked to an required to complete a generation, a nat- electronic control unit (Bale et al., 1984; ural enemy will not be able to establish. In Panneton et al., 1995). Such systems con- addition, if the day degree accumulation trol the temperature within ± 0.2°C. It is permits the development of partial genera- also possible to achieve an approximately tions, the impact could be either to reduce linear decrease of temperature by placing the size of the population or even to pre- the insect in an insulated container within 104 G. Boivin et al.

Ϫ a large freezer at 30°C (Hance and Boivin, LETHAL TIME 50 (LT50). This index is based 1993). However, the decrease in tempera- on the duration of exposure at a given tem- ture tends to become curvilinear as the perature sufﬁcient to cause 50% mortality temperature within the insulated container in a population. In a sense it is the reverse approaches the temperature of the freezer. of LTemp50 but with constant exposure Care must be taken to test the develop- temperatures. Choosing the temperatures to mental stage of the organism that will be tested may, however, prove difﬁcult. normally overwinter. Organisms that over- These temperatures should be chosen so as winter in diapause must also be in dia- to be similar to the low temperatures likely pause when tested, as diapause often to be experienced in the area where the changes the supercooling point or, more natural enemy will be released. importantly, the cold tolerance. Several containers containing individuals to be tested are placed at the selected

LETHAL TEMPERATURE 50 (LTEMP50). The temperatures and, at intervals, replicate LTemp50 is the temperature at which 50% samples are removed, placed at a standard of a population dies. However, in some temperature (i.e. 20°C or 25°C) and survival species, the determination of this tempera- of the individuals is assessed. Survival ture depends on the duration of exposure. should be assessed 24 h and 48 h after

As exposure time decreases, the LTemp50 removal from the low-temperature environ- may be closer to the supercooling point. ment, and the data analysed by probit or Since the purpose of estimating the logit. Although low temperature can affect

LTemp50 is to identify the temperature at longer-term survival or reproduction (Bale, which 50% of a population are killed, 1991a), experiments that can detect such organisms are usually cooled at 1°C/min effects are long and costly and unlikely to and exposed to a series of decreasing sub- be performed on a routine basis. zero minimum temperatures for 1 min with mortality assessed 24 and 48 h after expo- OUTDOOR CAGE TESTS. If local regulations sure. The organism should be placed in a permit, outdoor cages should be used to closed container, to avoid damage through assess winter survival. Survival of a desiccation and to buffer the decrease and species under semi-natural conditions in increase in temperature that will occur at an outdoor cage is as close an approxima- both the beginning and the end of the tion of natural conditions as can be experiment. The range of temperatures to obtained. Multiple cages should be used as be tested should be based on the low tem- independent replicates. However, it should peratures experienced by the species in its be noted that conditions within the cages natural habitat, but should be above the may differ from the habitat where the measured supercooling point. Ideally the release will be made, and that atypical organism should be in a state compatible to winters may over- or underestimate mortal- that which overwinters, i.e. for many ity. Temperature recording inside the out- species low-temperature exposure occurs door cages may help to explain unexpected when the insect is in forms of dormancy, results. The results from outdoor cage tests such as diapause or quiescence. The data can be used to verify the ﬁndings obtained are obtained as percentage mortality at in the laboratory tests and the predictions decreasing temperatures and are then on winter survival and hence the likeli- analysed by probit or logit to derive an esti- hood of permanent establishment. As an mate of the LTemp50. It is important to example, outdoor cage studies were per- recognize that this index assesses mortality formed with Trichogramma brassicae but does not take into account any sub- Bezd. to assess overwintering in six differ- lethal effects such as reduction of ent host eggs under natural conditions in longevity, fecundity or modiﬁcation of Switzerland (Babendreier et al., 2003). A behaviour that may occur in surviving summary of the methods discussed above insects. is tabulated in Table 6.1. Establishment Potential of Inundative BCA 105

Table 6.1. Summary of methods that can be used to assess the likelihood of establishment of an introduced natural enemy based on abiotic factors.

Assessment Description of method Equipment needed Information gained

Temperature Literature study Climate matching No special equipment If climates differ then between the area of needed establishment is unlikely; origin and introduction; thermal requirements of the ecological information organism (if available) on the organism Developmental The organisms are reared Climatic chamber with Base temperature threshold at different temperatures controlled temperature Thermal budget The organisms are reared Climatic chamber with Day degree requirement to at different temperatures controlled temperature complete one generation Supercooling point The organism is cooled at Microthermocouples, Cold tolerance, constant rate (1°C/min) temperature recording acclimation ability while its temperature is either on a paper chart recorded or a data logger, water- cooled Peltier effect module controlled by an electronic control unit or insulated container within a large freezer at Ϫ30°C Lethal temperature Mortality at 24 or 48 h at Climatic chamber with Cold tolerance as a a specific temperature controlled temperature function of exposure temperature; acclimation ability Lethal time Mortality after certain Climatic chamber with Cold tolerance as a lapse of time at a specific controlled temperature function of exposure time; temperature acclimation ability Field cage tests Mortality Field or outdoor cages Ability to overwinter under near field conditions Humidity Assess survival, fecundity Climatic chamber with Tolerance to different etc. at different controlled temperature, temperature/humidity temperatures and desiccators with salt combinations humidities solutions

Humidity terrestrial arthropods to maintain water While temperature is usually the predomi- balance. Water is gained by drinking, eat- nant abiotic factor preventing establishing, metabolizing food items and absorbing ment, humidity may influence long-term vapour from the atmosphere. For the survival of introduced species if the area of majority of species, water in the diet is suf- origin and introduction differ in humidity ficient to balance losses. The processes by conditions. Evaluating performance and which water is lost include cuticular and survival at low and high humidities may respiratory transpiration, passive diffusion help to predict limitations to the establish- from oral and anal openings and water loss ment of introduced natural enemies. associated with excretion. Cuticular tran- While temperature directly influences spiration constitutes the major avenue of development and survival, humidity water loss despite the presence of a highly effects may be less pronounced since waterproofed integument in most species. organisms have the ability to regulate their In terrestrial arthropods, the epicuticle pro- body water content to some extent. Hadley vides the principal barrier to water loss. (1994) describes the mechanisms used by Quantitative differences in cuticular lipids 106 G. Boivin et al.

may contribute to the lower water loss humidities, as well as the temperatures rates and hence increased desiccation chosen for the experiment, should reflect resistance of some species (Hadley, 1994). the conditions in the non-target habitat For most species, absolute water loss when humidity conditions become increases at lower humidities as a result of extreme. Desiccation tolerance is influ- the lower saturation of the surrounding air. enced by a variety of factors including age, In contrast, the calculated permeability of sex and life history stage (Eckstrand and the cuticle (corrected for saturation deficit) Richardson, 1980; Lamb, 1984; Hadley, often increases as humidities rise. This 1994). The free-living stages may be more may facilitate water loss and thus prevent susceptible to humidity extremes than the arthropod from becoming overhydrated stages protected within hosts. These facts (Hadley, 1994). should be taken into account when select- If the humidity conditions become ing individuals for the test. unfavourable for species survival, individu- Experiments assessing humidity effects als of the free-living stages may be able to on introduced species should include a reduce or avoid dehydration stress by clus- taxonomically related resident species as a tering (Yoder and Barcelona, 1995; Yoder control (as was done for temperature in and Smith, 1997), by moving into micro- Bale and Walters (2001)) and for compari- habitats more suitable for survival, or by son of results. If, for example, the local using avoidance behaviours such as bur- species dies at the humidity extremes natu- rowing and nocturnal activity. The desic- rally occurring in the non-target area, then cating conditions present on the surface can protected microhabitats with more largely be avoided by moving a few cen- favourable environmental conditions may timetres into the soil, or by restricting the be available for survival during unfavour- surface activity to night-time hours when able environmental conditions. humidities are higher (Hadley, 1994). In order to assess if local humidity con- Humidity can also be higher in above- ditions can cause lethal or sub-lethal ground microshelters, e.g. condensation on effects on the exotic natural enemy, the the undersides of rocks may provide water. introduced species may be reared at or Soil moisture may influence survival of exposed to different temperatures and natural enemies with life stages living in humidities in small chambers (incubators). the soil. The diameter of pores between For economic reasons, not all tempera- soil particles decreases with increasing ture/humidity combinations that occur in depth. A portion of the pore system is often the area of release can be tested in practice, filled with water that accumulates from hence we propose that the most current rainfall or rises as capillary groundwater. extremes of temperature and humidity The remainder of the pore system contains should be identified (from climate records) air that is saturated with water vapour and the relevant stages tested under these (Eisenbeis and Wichard, 1987). While conditions. The parameters used to assess mobile life stages may undertake horizon- humidity effects may include egg hatch tal and vertical migrations to retain access rate, development time, pre-imaginal sur- to moisture during hot and dry periods, vival, fecundity or longevity. immobile life stages (i.e. eggs, pupae) may be affected by changes of humidity within soil pores. Biotic factors

METHODS OF ASSESSING HUMIDITY EFFECTS. A Host/prey range of relative humidities can be generated using saturated salt solutions (Winston Among other factors, establishment of an and Bates, 1960) or glycerol–water mixtures exotic natural enemy depends on the avail- (Johnson, 1940). Calcium sulphate (Drierite) ability and suitability of hosts or prey and provides 0% relative humidity. The relative their spatial and temporal synchronization Establishment Potential of Inundative BCA 107

with the introduced organism. First, a list of both the host and the natural enemy and of potential hosts or prey that are taxonom- to make sure that they are in dormancy if ically related and occur in habitats similar they overwinter in this condition. to that in which the new agents would be released has to be established. Then, it has to be determined which of these hosts or Case Studies Using Temperature to prey match in space and time with the Assess the Establishment Potential introduced organism, e.g. do they occur at of Non-native Biological Control the same altitude and time as the natural Agents in the UK enemy (for more details see Kuhlmann et al., Chapter 2, this volume). Next, the The protocols for the practical assessment acceptance and suitability of the remaining of establishment potential of non-native species can be assessed in host specificity invertebrate biological control agents can tests (for more details see van Lenteren et be developed from a theoretical analysis of al., Chapter 3, this volume). the requirements of such species when Permanent establishment is only pos- introduced into a new environment. In sible if overwintering hosts are available. simple terms, if a non-native species is The indigenous alternate hosts or prey may introduced into a greenhouse ecosystem, in not be adequate for overwintering of the a region with a winter season, for outdoor natural enemy, either because of their establishment to occur, any escaping indi- intrinsic capacity to survive harsh condi- viduals will require a combination of (i) a tions at the stage during which they are thermal budget above the developmental attacked, because of a lack of synchroniza- threshold sufficient to complete at least tion with the exotic natural enemy, or one generation per year, (ii) one or more because its type of dormancy is unsuitable life stages able to survive at low tempera- for the parasitoid or predator. When the ture, (iii) the ability to enter quiescent or host is not at a suitable stage for winter sur- diapause states, and (iv) sources of host or vival at the time the natural enemy is prey. In the context of this chapter, the preparing for winter, no permanent estab- interrelationships between temperature lishment will occur. This is the case for and development and winter survival have several Trichogramma species that need recently been investigated in a number of diapausing eggs of their host to survive insect and mite greenhouse biological con- winter (Boivin, 1994). trol agents introduced into the UK over the past 15 years. The work was conducted to METHODS OF ASSESSING HOST/PREY EFFECTS. seek ecophysiological explanations for the The methods for obtaining a list of potential ‘unexpected’ establishment of some intro- hosts or prey and for testing their suitability ductions and, in turn, to develop experi- for survival and reproduction of the natural mental approaches that could be used to enemy are described by Kuhlmann et al. assess the establishment potential of candi- (Chapter 2, this volume) and by van date species under current or future con- Lenteren et al. (Chapter 3, this volume). sideration for import and release. After a list of potential hosts or prey has The predatory mite Neoseiulus been established, the availability and suit- (Amblyseius) californicus (McGregor) ability for overwintering of the introduced (Acari: Phytoseiidae) was first released in organism and the abundance and ecological UK greenhouses in 1991 and within ten significance of these species can be deter- years was reported to have established mined. The methods described in the tem- wild populations in areas close to release perature and humidity sections should be sites. The predatory mirid Macrolophus used to assess survival of the exotic natural caliginosus Wagner (Heteroptera: Miridae) enemy in the overwintering stage of the was released in 1995 and has been potential hosts or prey. Care must be taken observed outside of greenhouses at differ- to use the appropriate developmental stage ent times of the year, though establishment 108 G. Boivin et al.

has not yet been confirmed. Two other degrees above the developmental threshold species, the parasitoid Eretmocerus eremi- of 7.7°C varied from 1059 to 1347 (mean cus Rose and Zolnerowich (Hymenoptera: 1253) over the ten-year period from 1991 to Aphelinidae) and the predatory ladybird 2000, indicating that in all but one year, M. Delphastus catalinae (Horn) (Coleoptera: caliginosus would have been able to com- Coccinellidae), are both licensed for release plete two (but never three) generations. By in the UK, with no reports of winter sur- inspection of the monthly totals of avail- vival or establishment. Currently, another able day degrees it is possible to determine predatory mite, Typhlodromips montdoren- whether development is restricted to the sis (Schicha) (Acari: Phytoseiidae), is being summer months, or can proceed through considered as a candidate species for winter. Also, the development data for a release. particular species or strain can be related A range of experimental procedures to climate records for any release site, in have been applied to these species to deter- different countries or regions of the world. mine their developmental threshold tem- Cold-tolerance assessments were made perature, thermal budget (day degree) on two age groups: first/second instar requirement per generation, potential nymphs and fifth instar/adults. The likeli- annual voltinism, cold tolerance (freezing hood of winter survival is increased if indi- temperature, lethal temperatures and times) viduals escaping from greenhouses are able and acclimation ability, and response to to acclimate at lower temperatures. In most diapause-inducing cues and winter field insects capable of an acclimation response, survival. Using M. caliginosus as a case significant changes in one or more indices study to exemplify this approach (Hart et of cold tolerance are usually detectable al., 2002a), the threshold temperature for after seven to ten days at 5–10°C. development from egg to adult was esti- Acclimation regimes are therefore intended mated to be 8.4°C (simple linear regres- to detect the ability to acclimate rather sion) and 7.7°C (weighted linear than to produce ‘fully acclimated winter- regression) with thermal budget require- hardy’ populations. The mean supercool- ments of 472 and 495 day degrees, respec- ing points of the two tested age groups of tively, above the threshold. Analysis of M. caliginosus with and without acclima- developmental data for a range of species tion at 10°C for seven days in a 12:12 LD suggests that a line derived from simple cycle varied from Ϫ19.0 ± 0.6° to Ϫ20.3 ± linear regression does not fit closely with 0.3°C, with no significant difference data points at the lowest experimental tem- between the groups. Supercooling points of perature, sometimes resulting in an inaccu- many insects lie in the range of Ϫ15° to rate estimate of the threshold temperature; Ϫ25°C, but low freezing temperatures are in most cases, this problem can be over- not, in isolation, a reliable indicator of cold come by the application of weighted linear tolerance. regression. For some species it may be Lethal temperatures (LTemp) of M. calig- valuable to examine differences in thresh- inosus were calculated by cooling replicate old temperatures between different life samples of the four treatment groups at cycle stages to identify possible ‘rate-limit- 0.5°C/min to temperatures between Ϫ5° ing’ stages. For example, the threshold tem- and Ϫ19°C (mean supercooling point of the peratures for the egg and nymphs of M. ‘least’ cold-hardy age group), with expo- caliginosus calculated by weighted linear sure of 1 min at the minimum temperature. regression are 8.7° and 7.2°C, respectively. Probit analysis of the data provides esti- Estimates of the developmental temper- mates of the temperatures required to kill ature and thermal budget can then be given proportions of each treatment group, related to climate records for any intended typically, 10, 50 and 90%. The lethal tem- release site to determine the likely annual peratures of the two age groups were simi- voltinism. For instance, in the Midlands lar, with no acclimation response and Ϫ area of the UK, the annual number of day LTemp50 values consistently around 15°C, Establishment Potential of Inundative BCA 109

indicating some ‘pre-freeze’ mortality. fore an essential component in the risk Estimates of supercooling points and lethal assessment of establishment potential. temperatures often show values that are Biological control agents may escape lower than the minimum temperatures from greenhouse environments at any time likely to be experienced in the region or of the year, and therefore encounter condi- country of release; for instance, tempera- tions that may be temporarily favourable or tures of Ϫ15°C or lower rarely occur in the more or less immediately lethal. More UK. However, the supercooling point and speciﬁcally, organisms that escape at the

LTemp50 are both indices that are measured end of the summer will have to survive in after very brief exposures. It is likely, there- the field for six months or longer before fore, that estimates of the duration of sur- favourable conditions return, whereas, for vival at less severe temperatures will those escaping in mid-winter, the cold and provide a more informative guide to sur- starvation stress will be less prolonged. vival under field conditions. Whilst this difference in the time of escape When replicate samples of the different is unlikely to affect permanent establish- M. caliginosus age and acclimation groups ment, it may allow a species to persist in were exposed at Ϫ5°, 0° and 5°C for increas- the field until the next winter. When ing periods of time, the lethal time (LT) val- nymphs and adults of M. caliginosus (with ues increased at the higher temperatures, no whitefly prey) were placed in the field with LT50 values at 5°C of around 20–30 in November and January (to represent days for the different groups. These early- and mid-winter escapes from green- extended exposure experiments are more houses), there was a progressive decline in realistic in terms of natural conditions, but survival, with 100% mortality after 40 and other factors, such as starvation, may affect 60 days for nymphs and adults, respec- the observed survival. During intermittent tively, with the microhabitat temperature periods of higher winter temperatures, nat- rarely falling below 0°C. A similar pattern ural enemy species may search for hosts and was observed in the following winter, with prey and extend their survival. Laboratory maximum nymph and adult survival times experiments should therefore include treat- of 40–60 days with the temperature falling ments that provide access to prey. to Ϫ5°C on some occasions. However, in When the LT experiments at 5°C were the same winter, when M. caliginosus were repeated with greenhouse whitefly, provided with whitefly prey, adult survival Trialeurodes vaporariorum (Westwood) increased to 75 days, and more impor- (Homoptera: Aleyrodidae), added as prey, tantly, some nymphs developed in the field 50% survival time of ‘fed adults’ increased and were still alive after 200 days, the from 30 to 50 days, with 10% still alive duration of a full temperate winter (Hart et after 75–80 days. Whilst these ‘time’ exper- al., 2002a). iments approximate more to field situa- We conclude from these case studies tions, insects and mites will usually be that there are other considerations to take subject to fluctuating temperatures. There into account in the planning and interpre- are now many examples where duration of tation of field experiments. First, if a survival is increased when insects, kept at species is able to enter a diapause state, constant low and stressful temperatures which is usually associated with increased (often in chill coma), are periodically trans- cold tolerance and the ability to withstand ferred to higher ‘recovery’ temperatures, starvation, winter survival and long-term and thus able to move and feed. For these establishment is more likely to occur. The reasons it is possible that laboratory expo- diapause trait in some source populations sures, even at 5°C, will underestimate the of N. californicus is a major contributing field survival of insects and mites originat- factor to its establishment in the UK. There ing from Mediterranean or tropical cli- is, though, a second important factor, also mates, especially during mild winters. exemplified by N. californicus. Some insect Assessment of survival in the field is there- and mite biological control agents have 110 G. Boivin et al.

rapid generation times, such that, even at obtained from a relatively rapid laboratory lower temperatures, the individual that assay. Clearly, this approach is likely to be starts the winter will never survive until attractive to biological control companies the end of winter. However, if escaping in the production of the environmental risk individuals can reproduce in the field, assessment dossier that accompanies a their progeny may be able to sustain the licence application, as it focuses limited population until the following spring research and development budgets on a which, in turn, obviates the need to enter a critical range of experiments. In this diapause state (Hart et al., 2002b). respect, whilst the ‘LT50 prediction’ pro- The application of the experimental provides an accurate ‘retrospective’ ecophysio- tocol described for M. caliginosus to other logical explanation for the establishment species provides an opportunity to investi- success and failure of a range of species gate the combined datasets to identify labo- released in the UK over the past 15 years, ratory indices that are reliable predictors of there also some caveats to be considered at field survival in winter. This has been done this time. First, whilst the species so far for M. caliginosus (Hart et al., 2002a), N. investigated are drawn from different taxo- californicus (Hart et al., 2002b), E. eremi- nomic groups and from different trophic cus (Tullett et al., 2004), T. montdorensis guilds (predators and parasitoids), it is (Hatherly et al., 2004) and D. catalinae. For likely that there will be some exceptions these species, a strong correlation has been that will not conform with the emerging found between the LT50 at 5°C in the labo- laboratory–field relationship described in ratory and the duration of winter field sur- Fig. 6.2. It is probably too early for regula- vival (Fig. 6.2). On the basis of this tory authorities and biological control com- relationship, it appears that a reliable pre- panies to rely exclusively on the laboratory diction of winter field survival can be LT 50 to predict establishment potential; it

Fig. 6.2. Relationship between LT50 in the laboratory and ﬁeld survival of the same life cycle stages of ﬁve non-native biological control agents. Establishment Potential of Inundative BCA 111

would be valuable to apply the full range risk of establishment based on thermal of approaches described in the risk assess- requirements is determined to be higher ment protocol to further species in order to than ‘insignificant’ (for definition of gain confidence in the predictive power of ‘insignificant’ see below), should the avail- the laboratory experiments. Secondly, the ability and suitability of host or prey for

LT 50 winter field survival relationship is overwintering in the non-target habitat or not intended to predict with ‘precise’ accu- the impact of humidity be investigated. We racy the maximum survival times of suggest that experiments should start with escaped populations of non-native biologi- temperature as a limiting factor for the fol- cal control agents. Rather, the system lowing reasons: (i) temperature is the most should be viewed as a mechanism by likely abiotic factor to limit establishment; which to categorize candidate biological (ii) temperature data for the release area are control agents into different ‘risk’ groups. often available from meteorological offices Thus with reference to Fig. 6.2, E. and their acquisition requires minimal eremicus, D. catalinae and T. montdorensis effort; (iii) testing for the temperature comprise a ‘low or no risk’ group, where all requirements and limitations is simpler field populations die out in winter after than testing for host or prey specificity; (iv) approximately one month. Macrolophus humidity alone is seldom a limiting factor; caliginosus is in a ‘marginal risk’ group, most often it acts together with tempera- where extended survival in winter could ture; (v) other biotic factors such as food be expected, but long-term and widespread sources (pollen, nectar, etc.), or competi- establishment may not occur. The ability to tion with other natural enemies, have move flexibly in winter between the green- rarely been reported to be the sole factors house and outdoor locations (as is believed preventing establishment; and (vi) a combi- to be the case with M. caliginosus) would nation of thermal budget, lethal tempera- increase the occurrence of such species ture (LT50) and outdoor cage experiments outdoors. Finally, N. californicus falls into may provide reliable data with adequate a ‘high risk’ group, where establishment is effort for predicting establishment. likely, attributable to both the cold-hardy However, outdoor cage tests with exotic diapause strains and non-diapause popula- natural enemies may require ‘contained tions that are sufficiently cold hardy to release’ licences from the national regula- develop and reproduce in winter, at least tory authority, which may not be granted. in a temperate climate. Of course, as As Hart et al. (2002a,b) and Tullett et al. emphasized at the outset, if the species is (2004) have shown, LT50 by itself may be a sufficiently cold hardy to survive through reliable predictor of field survival (Fig. winter, establishment will then depend on 6.2). However, more tests are needed to access to host or prey. confirm the power of prediction using LT50 In a wider perspective, knowledge that in isolation from other experiments. establishment is likely to occur is in itself not Based on the comparison of the thermal a reason to prohibit the import and release of requirements and tolerances of the exotic a non-native species. It is the acquisition of natural enemy to the temperature in the that knowledge that allows a rational and area of introduction, the likelihood and informed decision to be made after an appro- magnitude for establishment in non-target priate evaluation of the risks and benefits. habitats can be categorized. The likelihood of establishment can be classified as ‘very unlikely’, ‘unlikely’, ‘possible’, ‘likely’ or Conclusions and Recommendations ‘very likely’, and the magnitude as ‘minimal’, ‘minor’, ‘moderate’, ‘major’ or ‘mas- When assessing the establishment potential sive’ (for description of risk classes see van of an exotic natural enemy, we recommend Lenteren et al. (2003), van Lenteren and first evaluating to what extent temperature Loomans (Chapter 15, this volume, Tables may limit establishment. Only where the 15.1, 15.2 and 15.3)). 112 G. Boivin et al.

Based on the temperature requirements limiting establishment. For organisms of a species, the likelihood and magni- with seasonal persistence, the probability tude of establishment can be assessed for permanent establishment is catego- qualitatively and combined in a risk rized as ‘very unlikely’ and the magni- matrix, resulting in risk levels of tude as ‘minimal’, therefore the risk is ‘insigniﬁcant’, ‘low’, ‘medium’ and ‘high’ ‘insigniﬁcant’. If the risk of establishment (van Lenteren and Loomans, Chapter 15, is categorized as ‘low’, ‘medium’ or this volume, Table 15.1). The matrix can ‘high’, evaluation of other factors limiting be used as a tool by the risk assessment establishment, such as availability, accep- authorities to conclude whether and to tance and suitability of overwintering what extent temperature conditions are hosts, will be needed.

References

Babendreier, D., Kuske, S. and Bigler, F. (2003) Overwintering of the egg parasitioid Trichogramma brassica in Northern Switzerland. BioControl 48, 261–273. Bale, J.S. (1991a) Implications of cold hardiness for pest management. In: Lee, R.E. and Denlinger, D.L. (eds) Insects at Low Temperature. Chapman and Hall, New York, pp. 461–498. Bale, J.S. (1991b) Insects at low temperature: a predictable relationship? Functional Ecology 5, 291–298. Bale, J.S. and Walters, K.F.A. (2001) Overwintering biology as a guide to the establishment potential of non-native arthropods in the UK. In: Atkinson, D. and Thorndyke, M. (eds) Environment and Animal Development. Genes Life Histories and Plasticity. Bios, Oxford, UK, pp. 343–354. Bale, J.S., O’Doherty, R., Atkinson, H.J. and Stevenson, R. (1984) An automatic thermoelectric cooling method and computer-based recording system for supercooling point studies on small invertebrates. Cryobiology 21, 340–347. Boivin, G. (1994) Overwintering strategies of egg parasitoids. In: Wajnberg, E. and Hassan, S.A. (eds) Biological Control with Egg Parasitoids. CABI Publishing, Wallingford, UK, pp. 219–244. Brière, J.F., Pracros, P., Le Roux, A.Y. and Pierre, J.S. (1999) A novel rate model of temperature- dependent development for arthropods. Environmental Entomology 28, 22–29. DeBach, P. (1964) Biological Control of Insect Pests and Weeds. Chapman and Hall, London, UK. Denlinger, D.L. and Lee, R.E. (1998) Physiology of cold sensitivity. In: Hallman, G.J. and Denlinger, D.L. (eds) Temperature Sensitivity in Insects and Application in Integrated Pest Management. Westview Press, Boulder Colorado, pp. 55–96. Duthie, J.A. (1997) Models of the response of foliar parasites to the combined effects of temperature and duration of wetness. Phytopathology 87, 1088–1095. Eckstrand, I.A. and Richardson, R.H. (1980) Comparison of some water balance characteristics in several Drosophila species which differ in habitat. Environmental Entomology 9, 716–720. Eisenbeis, G. and Wichard, W. (1987) Atlas on the Biology of Soil Arthropods. Springer Verlag, Berlin, Germany. Hadley, N.F. (1994) Water Relations of Terrestrial Arthropods. Academic Press, New York. Hance, T. and Boivin, G. (1993) Effect of parasitism by Anaphes sp. (Hymenoptera: Mymaridae) on the cold hardiness of Listronotus oregonensis (Coleoptera: Curculionidae) eggs. Canadian Journal of Zoology 71, 759–764. Hart, A.J., Bale, J.S., Tullett, A.G., Worland, M.R. and Walters, K.F.A. (2002a) Effects of temperature on the establishment potential of the predatory mite Amblyseius californicus McGregor (Acari: Phytoseiidae) in the UK. Journal of Insect Physiology 48, 593–599. Hart, A.J., Tullett, A.G., Bale, J.S. and Walters, K.F.A. (2002b) Effects of temperature on the establishment potential in the UK of the non-native glasshouse biocontrol agent Macrolophus caliginosus. Physiological Entomology 27, 112–123. Hatherly, I.S., Bale, J.S., Walters, K.F.A. and Worland, M.R. (2004) Thermal biology of Typhlodromips montdorensis: implications for its introduction as a glasshouse biological control agent in the UK. Entomologia Experimentalis et Applicata 111, 97–109. Johnson, C.G. (1940) The maintenance of high atmospheric humidities for entomological work with glycerol-water mixtures. Annals of Applied Biology 27, 295–299. Establishment Potential of Inundative BCA 113

Lactin, D.J., Holliday, N.J., Johnson, D.L. and Craigen, R. (1995) Improved rate model of temperature- dependent development by arthropods. Environmental Entomology 24, 68–75. Lamb, M.J. (1984) Age related changes in the rate of water loss and survival time in dry air of active Drosophila melanogaster. Journal of Insect Physiology 30, 967–973. Louda, S.M., Pemberton, R.W., Johnson, M.T. and Follett, P.A. (2003) Nontarget effects – the Achilles’ heel of biological control? Retrospective analyses to reduce risk associated with biocontrol introductions. Annual Review of Entomology 48, 365–396. Panneton, B., St-Laurent, G. and Boivin, G. (1995) Un générateur de fonction de température pour l’étude de la résistance au froid des insectes. Canadian Agricultural Engineering 37, 287–293. Sinclair, B.L. (2001) Field ecology of freeze tolerance: interannual variation in cooling rates, freeze–thaw and thermal stress in the microhabitat of the alpine cockroach Celatoblatta quin- quemaculata. Oikos 93, 286–293. Sinclair, B.J., Vernon, P., Klok, C.J. and Chown, S.L. (2003) Insects at low temperature: an ecological perspective. Trends in Ecology and Evolution 18, 257–262. Tenow, O. and Nilssen, A. (1990) Egg cold hardiness and topoclimatic limitations to outbreaks of Epirrita autumnata in northern Fennoscandia. Journal of Applied Ecology 27, 723–734. Tullett, A.G., Hart, A.J., Worland, M.R. and Bale, J.S. (2004) Assessing the effects of low temperature on the establishment potential in Britain of the non-native biological control agent Eretmocerus eremicus. Physiological Entomology 29, 1–9. van Lenteren, J.C., Babendreier, D., Bigler, F., Burgio, G., Hokkanen, H.M.T., Kuske, S., Loomans, A.J.M., Menzler-Hokkanen, I., van Rijn, P.J.C., Thomas, M.B., Tommasini, M.G. and Zeng, Q.-Q. (2003) Environmental risk assessment of exotic natural enemies used in inundative biological control. BioControl 48, 3–38. Vannier, G. (1994) The thermobiological limits of some freezing intolerant insects: the supercooling and thermostupor points. Acta Oecologica 15, 31–42. Winston, P.W. and Bates, D.H. (1960) Saturated solutions for the control of humidity in biological research. Ecology 41, 232–237. Yoder, J.A. and Barcelona, J.C. (1995) Food and water-resources used by the Madagascan hissing- cockroach mite, Gromphadorholaelaps schaeferi. Experimental and Applied Acarology 19, 259–273. Yoder, J.A. and Smith, B.E. (1997) Enhanced water conservation in clusters of convergent lady beetles, Hippodamia convergens. Entomologia Experimentalis et Applicata 85, 87–89. 7 Methods for Monitoring the Dispersal of Natural Enemies from Point Source Releases Associated with Augmentative Biological Control

Nick J. Mills,1 Dirk Babendreier 2 and Antoon J.M. Loomans3 1Environmental Science, Policy and Management, 127 Mulford Hall, University of California, Berkeley, CA 94720-3114, USA (email: [email protected]; fax number: +1-510-643-5438); 2Agroscope FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstr. 191, 8046 Zürich, Switzerland (email: [email protected]; fax number: +41-44-377-7201); 3Plant Protection Service, Section Entomology, PO Box 9102, 6700 HC Wageningen, The Netherlands (email: [email protected]; fax number: +31-317-421701)

Abstract

Mark–release–recapture (MRR) experiments are considered the best approach to use in monitoring the dispersal of natural enemies from the target environment, in an assessment of the risk of non-target impacts from augmentative releases. Starting from some general considerations of the difficulties of using MRR, we specifically address marking techniques, the design of recapture grids and the limitations imposed by different sampling strategies for the recapture of the natural enemies released. Subsequently, we describe both an exponential and a diffusion model for dispersal that can be used to analyse the time-integrated density–distance data generated from MRR experiments, pointing out the need to examine and correct the data for directionality, if possible, or to use a diffusion model with displacement when correction is not possible. The application of the exponential and diffusion models of dispersal to the estimation of dispersal distance and density, the two most important metrics to consider in a risk assessment of non-target impacts of augmented natural enemies, is also discussed. Finally, we present a case study of an inundative release of Trichogramma brassicae in a meadow in Switzerland to illustrate how the data from an MRR experiment can be fitted to a dispersal model to estimate dispersal distance and the density of dispersing individuals at different distances from the release point.

©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 114 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Methods for Monitoring the Dispersal of Natural Enemies 115

Introduction entomopathogenic nematodes are mass produced by an increasing number of com- The risk of non-target impacts has become mercial suppliers and government research of increasing concern in the biological con- institutes worldwide, and are widely avail- trol of arthropod pests (Simberloff and able for augmentative release for the sup- Stiling, 1996; Follett and Duan, 2000; pression of a variety of arthropod pests of Louda et al., 2003). The focus of attention managed crops and livestock production has been on understanding the host range (van Lenteren, 2003). of imported natural enemies used for the Using the approach of Hickson et al. control of invasive pests, the potential for (2000), van Lenteren et al. (2003) proposed evolutionary host range expansion of that non-target impacts of augmentative imported natural enemy populations and biological control agents be assessed from the consequences of natural enemy impacts the likelihood (probability) and the magni- on non-target species at the population tude (consequences) of adverse effects level (Hoddle, 2004). Although the risk of based on the following five risks relating to non-target impacts from imported natural the ecology of the natural enemy: (i) estab- enemies poses the greatest concern to ecol- lishment in the target region if the natural ogists and environmentalists, inundative enemy is exotic, (ii) dispersal from the tar- biological control agents, or those natural get environment, (iii) host range, (iv) direct enemies that are mass reared to locally effects on non-target organisms and (v) inundate managed ecosystems for the con- indirect effects on other organisms in the trol of arthropod pests (Daane et al., 2002), target environment. In this chapter we will also have the potential to cause non-target focus exclusively on dispersal from the tar- impacts in the surrounding landscape get environment, and discuss methods (Lynch et al., 2001). With this in mind, an used to quantify and analyse the dispersal initial step in the evaluation of the envi- of natural enemies from a central release ronmental risks of augmentative biological point, taking Trichogramma brassicae control has been made by van Lenteren et Bezdenko as a case study. al. (2003), who recently developed a risk index for the commercially available inundative control agents used in green- Potential for Adverse Impacts of house or open-field crops in Europe. Natural Enemies on Non-targets from Augmentative biological control Dispersal includes both the inoculative release of smaller numbers of natural enemies for Dispersal is the exploratory, undirected season-long control of arthropod pests and movement of individuals away from the the inundative release of very large num- habitat of origin (den Boer, 1990). In the bers of mass-produced natural enemies for context of environmental impacts of aug- the rapid, but only temporary, suppression mentative biological control, this repre- of arthropod pests (Daane et al., 2002). The sents the undirected movement of natural natural enemies used in augmentative bio- enemies away from the release site and logical control may either be indigenous or into the surrounding landscape. In most exotic, and while all groups of arthropod cases, the dispersal of natural enemies will natural enemies have been considered, we be by flight in the adult stage, as the move- will focus here on invertebrate natural ene- ment of juvenile stages is restricted to a mies in accordance with the OECD (2004) very local scale. There are two interesting Guidance for Regulation of Invertebrates as exceptions, however, one in which disper- Biological Control Agents (IBCAs). Insect sal of juvenile entomopathogenic nema- parasitoids, insect and mite predators and todes occurs through flight of the adult 116 N.J. Mills et al.

host (Lacey et al., 1995), and a second in count or flux of marked individuals caught which dispersal of adult female parasitoids at a delimited boundary surrounding a cen- (T. brassicae) is facilitated through a tral release point. Fagan (1997) used this phoretic association with adult female but- technique to determine the dispersal rate of terflies (Fatouros et al., 2005). mantids as they moved out from a central In considering the risk of non-target point and were caught on tanglefoot bands impacts from the dispersal of natural ene- at the perimeter of square plots. Although mies released for augmentative biological this is an interesting alternative approach, control, two factors of potential concern are it has yet to be used more extensively and the likely distance of dispersal and the den- is more complex, but may be particularly sity of natural enemies at given distances well suited to the measurement of biases in from the release point. Although dispersal dispersal (Turchin, 1998). The third distance is potentially a species-specific approach is to record the movement of trait, as it is dependent upon longevity and individual insects, to map their paths, and power of flight, there is often an overriding to use temporal and spatial coordinates to influence of the abiotic and biotic charac- estimate dispersal rates. Although this is a teristics of the surrounding landscape. In powerful approach (Turchin, 1998), and contrast, the number of natural enemies has been used for a number of larger dispersing, and thus their density at a given insects, particularly butterflies (e.g. distance from the release point, is primarily Turchin et al., 1991), it is not suitable for influenced by the number of natural ene- monitoring dispersal of small insects and is mies released, and the abundance of the better applied to investigations of the pest relative to the foraging requirements of effects of environmental heterogeneity on the released natural enemies. As a result, movement. Thus, the methodology that is inoculative releases of natural enemies best suited for the assessment of dispersal often pose a much reduced environmental as an environmental risk of mass releases risk in comparison to inundative releases, of invertebrate natural enemies is the by virtue of the far smaller numbers of nat- analysis of MRR experiments. ural enemies released at a site.

General considerations for mark–release– Approaches to Quantifying recapture (MRR) experiments Movement In estimating the pattern of dispersal of There have been three different approaches natural enemies from a central release point used to quantify the dispersal of insects through time in MRR studies, there are sev- (Fagan, 1997; Turchin, 1998): (i) the analy- eral key issues that need to be considered: sis of density curves in relation to distance ● It is essential to be able to distinguish from a release point, (ii) the analysis of the dispersing natural enemies from ﬂuxes of individuals crossing a boundary individuals in the wild population. This and (iii) the analysis of movement paths. is not a problem if the natural enemy is The recapture of marked individuals in an exotic species without locally estab- traps placed at successive distances from a lished populations or, if as happens in release point, and the subsequent analysis some cases, that wild populations of an of density–distance curves, were pioneered indigenous species are absent in the tar- by Dobzhanzky and Wright (1943) in a get region. In many cases, however, study of the movement of Drosophila indigenous natural enemies will have species. Mark-release-recapture (MRR) has wild-type counterparts in the ﬁeld, and been the most widely used approach in the distinguishing between mass-released analysis of dispersal and has been applied and wild individuals will be a major to insects of all sizes. The second approach concern requiring use of some form of is based on observations of the cumulative natural or applied marker. Methods for Monitoring the Dispersal of Natural Enemies 117

● Dispersal from a central point is subject ways, and can lead to interference if to an area-dilution effect, whereby as their range of attraction is greater than individuals move further away from a the distance between recapture points. central release point they are spread In addition, recapturing too great a num- over a progressively greater area and ber of individuals before they have com- consequently become more difficult to pleted their dispersal can itself bias the recapture (Turchin, 1998). To improve dispersal process, posing a dilemma in the accuracy of recapture data a greater terms of the trade-off between sampling number of recapture points some dis- efficiency and bias (Yamamura et al., tance from the release point could be 2003). used, although it is often impractical to ● Time is an important variable in any monitor a greater number of traps effec- MRR experiment, and its influence on tively. Alternatively, baits, in the form of the analysis of dispersal data has often foods, hosts, or kairomones, have been been underestimated. Dispersal is a con- used to increase the attractiveness of tinuous process and the pattern of recapture points, and provide a more recaptures in relation to distance from a practical approach to counteracting the central release point changes dramati- dilution effect. Some caveats, however, cally with time (Fig. 7.1). Some recap- are that baits often have an unknown ture techniques, such as sweep netting sphere of attraction, which may affect or traps deployed for very short time the dispersal of individuals in unknown intervals (<4 h), provide instantaneous

Survivorship curve integrated over distance ) t , r ( C Recaptures,

Time, t

Radial distance,

Instantaneous density Density–distance curve –distance curves integrated over time

Fig. 7.1. A schematic representation of the pattern of recaptures in a mark–release–recapture experiment in relation to both distance from the release point and time since release. Integrating the recaptures over distance provides an estimate of the survivorship curve for the released individuals, and integration over time provides a time-integrated density–distance curve. 118 N.J. Mills et al.

estimates of density versus distance at inexpensive to use and their detection can intervals over the course of the experi- be enhanced by use of UV light. Larger ment. However, most MRR experiments insects can be tumbled in the dusts to mark make use of traps or trap hosts that are them, while more delicate insects need a monitored at daily intervals or longer, more cautious approach. Drawbacks of and generate partial cumulative recap- using fluorescent dusts are that they have tures that need to be integrated been found to reduce longevity in some (summed) over the full lifespan of the insect parasitoids (Messing et al., 1993; N.J. dispersing individuals. Mills, unpublished results), and the dusts ● Male insects tend to be much wider can be transferred to unmarked individuals ranging in their dispersal than females, following release in the field. and thus it is essential to distinguish the As internal markers, oil-soluble dyes sexes when recoveries are made from have been used extensively, as they can be the traps (e.g. Bellamy and Byrne, 2001). incorporated into the diet of insects at low This latter point is of particular concern cost. However, they are not always easily in the context of the environmental risk detectable, and many have proved to be of dispersal of mass-released parasitoids toxic to insects. Nonetheless, acridine as it is only the movement of females orange has been recommended for marking that poses a risk to non-target hosts. adult Hymenoptera and Diptera through incorporation into honey (Strand et al., 1990), and a resin-based dye has been used Markers to mark parasitoids of diamondback moth under field conditions (Schellhorn et al., A variety of markers can be used to distin- 2004). Trace element markers, particularly guish released natural enemies from indi- rubidium and strontium, have also been viduals in the wild population, and these used extensively to mark many types of have been extensively reviewed by Hagler insects, including insect parasitoids and Jackson (2001) and Lavandero et al. (Corbett et al., 1996; Fernandes et al., 1997; (2004). As external markers, tags and muti- Gu et al., 2001; Hougardy et al., 2003). By lation marking have been used extensively incorporating RbCl into the diet of preda- in vertebrate studies. However, they are of tors, and into either host diets or adult far less value for invertebrates, particularly foods for parasitoids, natural enemies can insects, as only the larger, more robust be marked in large numbers, although the species such as bees, carabid beetles and detection of elemental markers through butterflies can be successfully marked this atomic absorption spectroscopy is both way, and the method is too time consum- time-consuming and expensive. More ing for marking large groups of insects for recently, immunological or protein markers MRR. Visible genetic markers, such as eye have been developed for use either inter- colour, have been used as natural markers nally or externally on the surface of (e.g. Dobzansky and Wright, 1943), but are insects. Vertebrate immunoglobulins (IgG) unlikely to be available for most commer- have been used most frequently and have cial natural enemies. Paints have been used proved effective for parasitoids of all sizes, both to mark individual insects, and also to as well as for a number of insect predators mark larger groups of insects (Jones et al., (Hagler and Jackson, 1998; Hagler et al., 1996; van der Werf et al., 2000), but again 2002a). Internal marking is achieved the approach is better suited to larger through incorporation of the proteins into insects and must first be tested for poten- the diet, and external marking by fogging tial toxicity. More commonly, fluorescent with either an atomizer for larger insects or dusts have been used to mark insects for a nebulizer in the case of small parasitoids. dispersal studies (Corbett and Rosenheim, The marker is detected through use of a 1996; Prasifka et al., 1999). These dusts are sandwich enzyme-linked immunosorbent available in a variety of colours, they are assay based on vertebrate-specific antibod- Methods for Monitoring the Dispersal of Natural Enemies 119

ies. This marking procedure has the advan- Recapture grids tages of being quick and easy to imple- ment, but one drawback is that the cost of In all MRR experiments it is necessary to the IgG proteins is relatively high for use in recapture the marked and released individu- MRR studies. Similarly, while the marking als at various distances from the release of natural enemies with genetically engi- point over time. Configurations of trapping neered proteins is not practical at the cur- or sampling grids (Fig. 7.2) for monitoring rent time, due to regulatory constraints, it dispersal have varied from linear transects may prove to be an effective marking pro- (Kuske et al., 2003) to simple orthogonal cedure for MRR studies in the future. transects (Dobzhansky and Wright, 1943; Whatever marker is used, there is McDougall and Mills, 1997), rectangular or always a concern that the marker may square lattices (Plant and Cunningham, reduce longevity or influence dispersal 1991; Corbett and Rosenheim, 1996; ability. While it is easy to compare the Schneider, 1999) and radiating (so-called longevity of marked and unmarked indi- wagon wheel) designs with either linear viduals it is less easy to determine effects (Turchin and Theony, 1993; van der Werf et on dispersal ability. One approach to al., 2000) or curved arms (Messing et al., addressing this problem is double mark- 1995). The two most important aspects of the ing, using two different marking proce- design of a recapture grid are that it extends dures to mark two groups of individuals far enough, and recapture points are located and releasing both groups simultaneously at uniform distances. Clearly, it is wasteful if to monitor their patterns of dispersal. Two recapture locations are so far from the different marking techniques are unlikely release point that no marked individuals are to influence the natural enemies in the recaptured, but it is best to extend the grid same way, and thus it can be concluded far enough that no more than 10% of dis- that marking has no influence on dispersal persers are able to extend beyond the ability if both groups show similar pat- bounds of the grid (Turchin, 1998). In many terns of behaviour. cases, the likely dispersal distance may not be known initially, and thus it may be necessary to run a preliminary pilot test.

Fig. 7.2. Examples of the recapture grids that have frequently been used in mark–release–recapture experiments, showing (a) linear, (b) orthogonal, (c) lattice and (d) radiating or wagon wheel designs. 120 N.J. Mills et al.

In addition to the extent of the grid, there persal behaviour of the insects and mites must be a sufficient number of recapture that they trap, but as a result the number of points through the grid for distance from the individuals trapped tends to be very low. release point, as the dependent variable, to Intercept traps have been used successfully fully characterize the dispersal pattern. It is to monitor the dispersal of parasitoids often considered that the number of arms in (Messing et al., 1994; Kuske et al., 2003) a wagon-wheel design might be important, and mite predators (Charles and White, but in reality it is the number of regularly 1988; McDermott and Hoy, 1997). An inter- spaced recapture points along an arm of the esting variant on an intercept trap is the wheel that will provide a better description use of small suction traps (Hagler et al., of dispersal. It is best to use at least six dis- 2002b). These have proved to be effective tance points in a MRR grid, and to use either in trapping small parasitoids and may also a concentric circle or regular lattice design. be applicable to other small arthropods, such as insect and mite predators. As an alternative to intercept traps, traps Sampling strategies and trap types with various forms of attractants can be used, such as colour, shape and various The aim of MRR experiments is to obtain forms of bait, including food and infochem- an estimate of the spatial density of marked icals. Yellow or white sticky or water traps individuals throughout the recapture grid. have frequently been used to trap arthropod Thus, recaptures of marked individuals natural enemies (e.g. Corbett and over time can be achieved either through Rosenheim, 1996), and sticky spheres sampling of absolute numbers per unit rather than flat sheets may be particularly area, using techniques such as sweep nets effective for parasitoids of fruit-boring pests (e.g. van der Werf et al., 2000), or through (e.g. Messing et al., 1995). Examples of the sampling of relative numbers per unit area use of various baits for monitoring natural as in the case of traps. The reader is enemy dispersal include use of natural referred to Sutherland (1996), Southwood enemy sex pheromones (e.g. Suckling et al., and Henderson (2000) and Leather (2005) 2002), synomones in the form of pumpkin for further details of sampling techniques. puree for tephritid fruit fly parasitoids (e.g. As the monitoring of natural enemy disper- Messing et al., 1995), kairomones in the sal through MRR experiments will, in most form of host sex pheromones for parasitoids cases, involve the use of traps, we will of scales and aphids (e.g. Gabrys et al., focus on this sampling strategy for the 1997) and aggregation pheromones and host remainder of the chapter, and a brief dis- tree volatiles for predators of scolytids (e.g. cussion of trap types is included here. Mills and Schlup, 1989). While these vari- Pitfall traps have been used extensively ous forms of attractants can help to trap suf- for monitoring the dispersal of epigeal ficient numbers of dispersing natural invertebrates, and have been used exten- enemies for quantitative analysis of disper- sively in MRR experiments for carabids sal behaviour, it must be remembered that (Garcia et al., 2000; Raworth and Choi, the attractive range of these attractants is 2001). However, for natural enemies that generally unknown with regard to interfer- disperse by flight, a greater range of trap ence between traps in the grid, and that it is types have been used, including intercept also unknown whether the attractants influ- traps, attractant traps and sentinel host ence the normal dispersal behaviour of the traps. Intercept traps consist of transparent natural enemy. plastic sheets (McDermott and Hoy, 1997) Sentinel or trap hosts have also been or large Petri dishes (Messing et al., 1994) widely used to monitor dispersal of insect that are coated with glue or oil to intercept parasitoids. Non-feeding host stages, and trap the aerial dispersal of insects and including eggs, puparia and pupae, have mites. Intercept traps have the advantage been used most frequently in MRR studies that they do not influence the flight or disas they can easily be placed in natural set- Methods for Monitoring the Dispersal of Natural Enemies 121

tings in the field, and recoveries are gener- distance curves generated by MRR experi- ally good if the sentinel hosts are protected ments. Taylor (1978) investigated the suit- in some way from predation. Deployment ability of a wide range of empirical models of potted trap plants with feeding stages of for describing the decline in density with sedentary hosts such as aphids (Muratori et distance and found that the following al., 2000), whiteflies (Loomans, 2002) and special case of the gamma distribution diamondback moth (Mitchell et al., 1999) provided the best fit to a variety of insect has also proved effective for monitoring dispersal data: parasitoid dispersal. Host eggs have fre- C(r) = exp[a + br 0.5] (1) quently been used to monitor dispersal of Trichogramma species (McDougall and where C(r) is the mean number of individu- Mills, 1997; Fournier and Boivin, 2000), als per trap at radial distance r from the Trissolcus basalis (Justo et al., 1997) and release point, and a and b are fitted con- host puparia for parasitoids of filth flies stants. This exponential model has also (Floate et al., 2000; Skovgård, 2002). been found to provide a good description of However, trap hosts differ from other forms density–distance curves by a number of of traps for monitoring dispersal in that other authors (Freeman, 1977; Plant and they monitor parasitism rather than para- Cunningham, 1991; Kishita et al., 2003). It sitoid numbers. This has one advantage in should be noted that time is not explicit in that it monitors the dispersal of females this model, and thus separate models can only, but significant disadvantages include be fitted for each recapture interval of the the indirect nature of the measurement experiment (Plant and Cunningham, 1991), variable, trap saturation and that trapping or a single model can be fitted to a time- efficiency that varies with time. Parasitism integrated metric such as the total recap- is an indirect measurement of dispersal and tures per trap over the course of the can only be used as a presence/absence experiment recovered at each radial dis- measurement, as it is impossible to separate tance from the release point (Kishita et al., the number of adult parasitoids visiting the 2003). The two constants of the exponential trap from the number of hosts parasitized model are more accurately estimated using by each parasitoid female (Gross and Ives, a least-squares fitting procedure, rather than 1999). Thus, in place of a density–distance using linear regression of lnC(r) on r. The curve, trap hosts provide a probability of an exponential model can also be used to encounter–distance curve that is not describe probability of encounter–distance applicable to the diffusion models dis- curves generated through the use of trap cussed below. In addition, it seems likely hosts. However, its greatest drawback is that traps placed closer to the central that the fitted constants have no inter- release point would experience greater sat- pretable biological meaning. uration than other forms of trap, and that ageing of trap hosts during the monitoring interval could lead to variation in suscepti- Diffusion model bility to parasitism. As an alternative to the exponential model, dispersal can be modelled as a simple diffu- Models for Analysing sion process, where movement of individu- Density–Distance Curves Generated als is assumed to be radially symmetric and by MRR Data to occur at a constant rate in a homogeneous environment (Okubo, 1980; Kareira, Exponential model 1983; Turchin, 1998). It has been shown that dispersal of a range of phytophagous Assuming a lack of directionality in the insects can adequately be described by dif- data, either empirical or diffusion models fusion (Kareiva, 1983), which generates a can be used to describe the density– density–distance curve of the form: 122 N.J. Mills et al.

␣ ␲ Ϫ 2 ␦ C(r,t) = ( No/4 Dt)exp[( r /4Dt) – t] (2) As suggested by Plant and Cunningham (1991), the rate of disappearance of individ- where C(r,t) is the mean number of individuals over the course of a MRR experiment uals recaptured per trap at radial distance r (␦) can be estimated from a survivorship from the release point at time t, N is the o curve (Fig. 7.1), relating the total trap catch number of marked individuals released, ␣ from all traps in the recapture grid (C(t)) in is a constant recapture efficiency of the relation to time interval since release (t), traps used, D the diffusion coefficient or rate of dispersal, and ␦ is a constant rate of using the simple exponential model: disappearance of individuals due to a com- C(t) = aexp(Ϫ␦t) (4) bination of mortality during dispersal and In addition, we can also use this relation- settlement of individuals at sources of suit- ship to estimate the recapture efficiency (␣) able hosts. Thus the diffusion model gener- of the traps in the recapture grid from ␣ = ates a time-specific density–distance curve, a/N , where the fitted constant a estimates and each one of its parameters has a clear 0 the total number of individuals that would biological interpretation. have been trappable within the recapture As noted by Turchin (1998), however, grid in the absence of disappearance. Using most MRR experiments use traps to recap- these two estimated constants, the rate of ture the dispersing individuals, and traps dispersal (D) of the natural enemies can be accumulate individuals either continu- estimated either from B, if the cumulative ously or over fixed periods of time. Thus, density–distance curve approaches the x MRR experiments using traps require a axis, or from A. Although not yet used for time-integrated approach to quantifying natural enemies, the time-integrated diffu- dispersal and, as shown by Turchin and sion model has been used effectively to Thoeny (1993), the time-integrated form of quantify dispersal of bark beetles (Turchin equation (2) can be represented as: and Thoeny, 1993), tobacco budworm Ϫ C(r) = Ar 0.5exp(Ϫr/B) (3) (Schneider, 1999), a stem-galling fly where C(r) is the mean cumulative recap- (Cronin et al., 2001) and glassywing sharp- tures per trap at radial distance r from the shooter (Blackmer et al., 2004). release point over the course of the experi- ␣ ␲ 0.5 3␦ 0.25 ment, A = ( No)/[(8 ) (D ) ] and B = (D/␦)0.5. Similarly to exponential model (1), The problem of directionality the time-integrated diffusion model (3) is also exponential, but has the advantage One potential problem associated with the that the parameters have clear biological estimation of dispersal from MRR experi- interpretation. A is a scale parameter pro- ments through the analysis of density–dis- portional to the total number of marked tance curves is that dispersal is assumed to individuals released and the recapture effi- occur at random and to be radially sym- ciency of the traps, and B represents the metrical. In reality, however, the dispersal spatial scale of dispersal as determined by of natural enemies may be influenced by the rate of dispersal and disappearance of environmental factors such as wind direc- released individuals. Although the model tion, or linear features of the landscape can be linearized by taking logs, a more such as hedgerows. One useful way in accurate estimate of the constants A and B which MRR data can be examined for evi- is obtained using a non-linear least-squares dence of directionality is to examine the fitting procedure. It should be noted that if mean displacement of recaptures along two too many natural enemies disperse beyond orthogonal axes and to test the two mean the end of the recapture grid, such that the displacements for departure from zero with cumulative density–distance curve remains a t-test (Turchin and Thoeny, 1993; too far above the x axis at the greatest Blackmer et al., 2004). The mean displace- radial distances, then the value of B will be ment (x–) along the x axis for a particular large and cannot be accurately estimated. replicate of a MRR experiment is given by: Methods for Monitoring the Dispersal of Natural Enemies 123

xxCC= ∑∑n n where C(x,y,t) is the number of individuals 11i ii/ (5) trapped at coordinates x and y from a cen- where xi is the x coordinate of the location tral release point at time t, and c is the rate of trap i from the central release point, Ci is and ␾ the angle of displacement. This latter the number of individuals recaptured in model has been used to analyse dispersal trap i and n is the number of traps in the of Mediterranean fruit flies (Plant and experiment. The mean displacement (y៮) Cunningham, 1991) and leafhopper egg along the y axis can be calculated similarly, parasitoids (Corbett and Rosenheim, 1996). and then both sets of displacements tested While the disappearance rate (␦) and recap- for departure from zero to check for signifi- ture efficiency (␣) can be estimated inde- cant directionality. Turchin (1998) notes pendently from the associated survivorship that this t-test can generate a significant curve, as noted above for the symmetrical difference even when the magnitude of the diffusion model, the diffusion rate (D), dis- departure is small relative to the overall placement rate (c) and angle (␾) must be scale of the dispersal, and suggests ignor- estimated using least squares or maximum ing directionality if the mean displacement likelihood techniques. is less than 10% of the root mean square of the dispersal distance. If the directionality is moderate, it may Applying Models to the Estimation be possible to identify and exclude indi- of Dispersal Distance and vidual replicates from the data set, or if the Density of Dispersers problem is restricted to particular traps then these traps, plus equivalent traps In assessing non-target impacts of natural located at the same distance in the oppo- enemy augmentation, the distance dis- site direction, can be removed from the persed and the density at a given distance data set (Turchin, 1998). However, in some from the release point are the factors of cases, directionality is unavoidable, and interest. For the distance dispersed, one the analysis of the MRR data must be modi- option in analysing data collected from a fied to allow for a directional tendency. MRR experiment is to use the greatest dis- This general problem has been of particular tance at which an individual was recap- importance in the analysis of the passive tured to define the radius of potential dispersal of atmospheric pollutants, pollen non-target impacts in an environmental and spores, and has been resolved by risk analysis. In some cases, the maximum incorporating wind speed and direction distance reached by an individual may be into the diffusion model to generate of particular importance, such as when Gaussian plume or tilted plume models of exotic natural enemies from a directed dispersal (Okubo and Levin, 1989; Mediterranean climate are employed in Turchin, 1998). This approach has been augmentation programmes for glasshouse used in the development of a risk analysis pests in a temperate region. The escape and for fungal spores used in the biological long-distance dispersal of even a single control of weeds (de Jong et al., 1999, exotic natural enemy into a climatic region 2002) and for dispersal of predatory mites where it is able to persist in the natural (Jung and Croft, 2001). For most inverte- environment poses a potential risk. brate natural enemies, however, dispersal Whether such long-distance dispersal can is an active process and any directionality be detected in MRR experiments is ques- in dispersal may be driven as much by tionable however, due to the impracticality landscape features as by wind. In this case, of extending recapture grids to sufficient the diffusion model can be modified to distances to recapture these individuals, allow for displacement to give the follow- and to the severe dilution effect that ing density–distance function: reduces the probability of recapture at C(x,y,t) = (␣N /4␲Dt)exp{Ϫ␦t Ϫ[((ct Ϫxcos␾ greater distances. In contrast, for indigenous o (6) Ϫysin␾)2 + (Ϫxsin␾ + ycos␾)2)/4Dt]} natural enemies, long-distance dispersal is 124 N.J. Mills et al.

less relevant, with the dispersal distance of model with displacement (6), as the extent the majority of the dispersers being more of dispersal is not symmetrical and representative of the likelihood of non-tar- depends on the strength of the directional- get impacts. ity. In this case, the full two-dimensional Alternative dispersal distance metrics pattern of dispersal must be analysed and that may be more indicative of the likely the rate of diffusion (dispersal) estimated sphere of non-target impacts include the from the fitted model, as illustrated by mean distance from the point of release Plant and Cunningham (1991) and Corbett (Hawkes, 1972; Turchin and Thoeny, 1993; and Rosenheim (1996). Kishita et al., 2003) and the median, or The density of natural enemies at a given some other quantile, distance representing radial distance from the release point can the radius of a circle that encloses a spe- similarly be estimated from the density– cific proportion of dispersing individuals distance curve. It may be valuable to con- (Plant and Cunningham, 1991; Turchin and sider the mean density of natural enemies Thoeny, 1993; Schneider, 1999; Smith et enclosed within a circle of radial distance al., 2001; Blackmer et al., 2004). The mean r(p) from the central release point during dispersal distance is given by: the dispersal period, which is given by: ∞∞ 2 ␲ 2 rrrdrrCrdr= ∫∫22ππC( ) ( ) Nr (p) = N0p/ r(p) (10) 0 0 (8) where C(r) is the recaptures per trap at where N0 is the initial number released and radial distance r. This equation simplifies p is the proportion of the population to r៮ = 20/b2 for the exponential model (1), enclosed within the circle from equation and to r៮ = 1.5B for the time-integrated dif- (9). Equivalently, the mean density of nat- fusion model (3). Alternatively, any quan- ural enemies dispersing beyond a circle of Ј tile dispersal distance r(p) is given by: radial distance r(p ) during the dispersal period is: rp() ∞ p= ∫∫22ππ rC() r dr rC () r dr (9) 00 Ј ␲ 2 Ϫ Ј 2 Nr(pЈ) = N0p / (rmax r(p ) ) (11) where p is the chosen proportion of the where r is either the greatest observed population of dispersers and r(p) is the max distance dispersed by the natural enemy or estimated radial distance of the circle that some arbitrary outer radial distance of encloses that proportion of dispersers interest. Then finally, to estimate more gen- (Turchin and Thoeny, 1993), such that p = erally the density of dispersing natural ene- 0.5 for estimation of the median radial dis- mies within a concentric ring of width x, at tance dispersed, or p = 0.95 for estimation a particular radial distance r from the cen- of the 95th quantile radial distance that tral release point, is given by: encloses 95% of the dispersing individu- x als. Either the exponential model (1) or the =  r+05. ππ∞  Nr N0∫ − 22 rC() r dr∫ rC () r dr diffusion model (3) can be used to substi- r 05. x 0 22 (12) tute for C(r) in equation (9), and the equa- /π[](.)(.)rxrx+−−05 05 tion must be solved numerically using any mathematical software package. It may also be of value in the context of augmentative releases of natural enemies to use equation Trichogramma as a Case Study of (9) to estimate pЈ, the proportion of indi- Dispersal in the Context of viduals that pass beyond a specified radial Non-target Impacts distance r(pЈ) from the central release point. In this case, the integral for the A full assessment of the environmental numerator in equation (9) would run from risks from dispersal of mass-released nat- r(pЈ) to ∞ rather than from 0 to r(p), and ural enemies would need to consider a the equation would be solved for pЈ. There number of components, including the fol- is no direct equivalent for the mean or lowing dispersal-related questions: (i) how median dispersal distance for the diffusion far do natural enemies fly from a central Methods for Monitoring the Dispersal of Natural Enemies 125

release point and how does their density days, and the number of T. brassicae males decline with distance? (ii) do they pass and females on each side of each trap was potential barriers to dispersal such as counted under a dissecting microscope. For hedgerows? and (iii) do they move into and simplicity, we consider here only the cumu- settle in non-target habitats? For the pur- lative number of recaptured female para- poses of this chapter, we concentrate on sitoids from both sides of the two traps the first question only, and use data from (high and low) at each location. the dispersal of Trichogramma brassicae as The recapture data for T. brassicae an example, a biological control agent females showed significant directionality, widely used for inundative releases against with a mean displacement of 4.2 m in the European cornborer. westerly direction (t = 3.33, P < 0.003), A set of 100,000 unmarked adult T. bras- although no significant displacement sicae, 59% female, were released from a occurred along the north–south transect. point source in an extensively managed The directionality was caused primarily by meadow near Zürich in Switzerland in June, the long distance dispersal of a few individ- 2000, where wild T. brassicae were virtually uals trapped 64 m to the west of the release absent. Using an orthogonal transect design, point, and was reduced to less than 10% of sticky traps were installed above the vegeta- the root mean square displacement by tion at distances of 2, 4, 8, 16, 32 and 64 m excluding, as outliers, three of the eight from the central release point. Traps con- traps from 64 m west and, equivalently, sisted of a plastic transparent sheet (30 ϫ three of the eight traps from 64 m east (as 21 cm) which was sprayed with glue recommended by Turchin, 1998). The (Soveurode®) on both sides. At each dis- recaptures per trap, integrated over the tance for each of the four directions, we four-day trapping period, were then fitted to installed one ‘low’ trap at 40–70 cm height both the exponential model (1) and the and one ‘high’ trap at 100–130 cm. All traps time-integrated diffusion model (3). Both were replaced daily over a period of four models provided a good description of the ) r

( 120 C

100 C(r) = exp(7.05 – 2.34r 0.5), R 2 = 0.99

80 C(r) = 166.08 r –0.5 exp(r/1.94), R 2 = 0.99

Number of recaptured females per trap, 0 0 10203040506070 Radial distance (m) from release point, r Fig. 7.3. The observed time-integrated pattern of recaptures per trap in relation to radial distance from the central release point for female Trichogramma brassicae from the MRR experiment (solid circles). Both an exponential model (black) and a diffusion model (grey) provide an excellent ﬁt to the data, and the projections are almost identical, such that the diffusion curves mostly obscure the exponential curve. 126 N.J. Mills et al.

data (Fig. 7.3), accounting for 99% of the contained by radii of 7.6–11.0 m depending variation in observed densities in relation on the model. Examination of the total trap to radial distance from the release point. recaptures in relation to days since release Using equations (8) and (9), the mean and (Fig. 7.4), generated an estimate of the rate quantile dispersal distances of female T. of disappearance of 1.34 ± 0.06 per day dur- brassicae were calculated for each of the ing the course of the dispersal experiment. two ﬁtted models (Table 7.1). In general, the Using this estimate of the disappearance dispersal distance of the parasitoids was rate, the diffusion rate calculated from limited, with the exponential model pre- equation (3) was 5.04 m2/day. These esti- dicting slightly greater distances than the mates indicate that the dispersal distance of diffusion model. Thus, 67% of the dispers- T. brassicae is limited and characterized by ing individuals did not travel further than a very low rate of dispersal and a high rate 3.3–3.7 m within four days and 95% were of disappearance. While part of the disap-

Table 7.1. Estimating dispersal distance and density of females for a release of Trichogramma brassicae from a central release point using both the exponential and diffusion models of dispersal. Dispersal distance in m was estimated as the median r(0.5), 67th quantile r(0.67), 95th quantile r(0.95) and mean ៮ 2 r. Densities per m were estimated both for parasitoids contained within circles Nr (p) represented by Ј these radial distances and for parasitoids outside of these circles Nr (p ) and within an arbitrary outer circle of 30 m. The density estimates also include an arbitrary radius of 5 m.

Parameter Exponential model Diffusion model

Estimate SE Estimate SE a or A 7.05 0.42 166.08 33.69 b or B 2.34 0.28 1.94 0.35 Ј Ј Distance Nr (p) Nr (p ) Distance Nr (p) Nr (p ) r(0.5) 2.46 1555.85 10.50 2.30 1781.42 10.49 r(0.67) 3.78 881.56 7.07 3.30 1152.65 7.04 r(0.95) 10.95 148.71 1.20 7.58 310.19 1.11 r៮ 3.64 923.94 7.35 2.91 1348.12 8.25 r = 5 m 576.10 5.00 630.27 3.46

200 ) t 160

C(t) = 669.54 exp(–1.34t), R 2 = 0.99 120

40 Total number recaptured, C( Total

0 012345 Days since first released Fig. 7.4. The observed distance-integrated estimate of the survivorship curve for female Trichogramma brassicae from the mark–release–recapture experiment. An exponential mortality model provides an excellent ﬁt to the data. Methods for Monitoring the Dispersal of Natural Enemies 127

pearance will have been due to settling of represented by these dispersal radii were individuals during the dispersal process, much lower. For example, the density of the greatest loss is probably due to mortal- dispersers found outside of a circle repre- ity, as the longevity of Trichogramma adults senting the median dispersal distance and under field conditions is often short (e.g. within an arbitrary larger circle of 30 m Mansfield and Mills, 2002). In addition, radial distance from the release point was these results confirm that the sticky panels only 10.5 per m2 (Table 7.1). had a very low trapping efficiency of 0.011 From this analysis we can conclude that (estimated from equation (4)) as would be dispersal of female T. brassicae from a cen- expected of an intercept trap in the absence tral release point where 59,000 females of any attractant. were released was extremely limited in The mean density of T. brassicae females both distance and time. With few individu- per m2 in relation to radial distance from als dispersing beyond a radial distance of the release point was estimated from equa- 10 m, the risk of non-target impacts from tion (12) using diffusion model (3). While a release of this size are unlikely to be of the estimated densities were high at dis- significance. tances very close to the release point, they declined rapidly to a negligible level at a distance of greater than 10 m from the Conclusions and Recommendations release point (Fig. 7.5). Similarly, the mean density of parasitoid females enclosed The quantification of dispersal by natural within circles of different radial distances enemies from a central release point pre- from the central release point were as large sents many practical difficulties, as noted as 1555–1781 per m2 for the median dis- in the discussion above. Dispersal contin- tance travelled, but dropped to 148–310 per ues to be one of the most difficult popula- m2 for the radial distance travelled by 95% tion parameters to estimate accurately, but of the population (Table 7.1). It is worth recent advances in marking techniques and noting that for a natural enemy with such improvements in quantification of disper- limited dispersal, the corresponding mean sal, through use of variants of the diffusion densities over the period outside of the area model, have greatly improved our ability

5000 30 2 25

4000 20

females per m 3000 10

5 2000

T. brassicae T. 0 0 5 10 15 20 1000 Density of 0 0 10203040506070

Radial distance (m) from release point, r Fig. 7.5. The estimated density of female Trichogramma brassicae per m2 in relation to the radial distance from the release point in the MRR experiment. The inset graph provides ﬁner detail of densities at distances from 6–20 m. 128 N.J. Mills et al.

to conduct dispersal experiments more and ensure that it extends a sufficient effectively. Nonetheless, it is important to distance from the central release point, understand that estimates of dispersal dis- with traps placed at regular distances tance and density can be strongly influ- within the grid. enced by the type of landscape, the ● Analyse the recapture data for evidence intervening landscape matrix and the cli- of directionality. matic conditions prevailing at the time of ● If directionality can be ignored or cor- the experiment. Thus we recommend the rected, use either the exponential model following set of procedures for an assess- (1) or the diffusion model (3) to analyse ment of dispersal by natural enemies in the the time-integrated recapture data and context of non-target impacts from augmen- estimate dispersal distance and density. tative releases of biological control agents: ● If directionality is strong, use the diffusion model with displacement (6) to ● Use MRR as the most effective approach determine the dispersal rate of the nat- to the study of the dispersal of natural ural enemy, and consider which cli- enemies. matic or landscape factors might have ● Conduct MRR experiments in a homo- influenced the displacement. geneous landscape with low-growing ● Whenever possible, conduct a series of vegetation, such as a meadow, to pro- replicate MRR experiments to permit vide maximum estimates of dispersal quantification of the variation (SD or SE) potential. in estimates of dispersal distance and ● Use a non-disturbing marking technique, density for the natural enemy, and to such as an immunological marker, that relate the individual estimates from can be used to mark a large number of each replicate to the specific climatic individuals quickly and effectively. conditions (e.g, wind speed, tempera- ● Use a lattice or wagon-wheel grid to ture) that prevailed during the course of recapture the released natural enemies each experiment.

References

Bellamy, D.E. and Byrne, D.N. (2001) Effects of gender and mating status on self-directed dispersal by the whitefly parasitoid Eretmocerus eremicus. Ecological Entomology 26, 571–577. Blackmer, J.L., Hagler, J.R., Simmons, G.S. and Cañas, L.A. (2004) Comparative dispersal of Homalodicsa coagulata and Homalodisca liturata (Homoptera: Cicadellidae). Environmental Entomology 33, 88–99. Charles, J.G. and White, V. (1988) Airborne dispersal of Phytoseiulus persimilis (Acarina: Phytoseiidae) from a raspberry garden in New Zealand. Experimental and Applied Acarology 5, 47–54. Corbett, A. and Rosenheim, J.A. (1996) Quantifying movement of a minute parasitoid, Anagrus epos (Hymenoptera: Mymaridae), using fluorescent dust marking and recapture. Biological Control 6, 35–44. Corbett, A., Murphy, B.C., Rosenheim, J.A. and Bruins, P. (1996) Labeling an egg parasitoid, Anagrus epos (Hymenoptera: Mymaridae), with rubidium within an overwintering refuge. Environmental Entomology 25, 29–38. Cronin, J.T., Hyland, K. and Abrahamson, W.G. (2001) The pattern, rate and range of within-patch movement of a stem-galling fly. Ecological Entomology 26, 16–24. Daane, K.M., Mills, N.J. and Tauber, M.J. (2002) Biological pest controls: augmentative controls. In: Pimentel, D. (ed.) Encyclopedia of Pest Management. Marcel Dekker, New York, pp. 36–38. de Jong, M.D., Aylor, D.E. and Bourdot, G.W. (1999) A methodology for risk analysis of plurivorous fungi in biological weed control: Sclerotinia sclerotiorum as a model. Biocontrol 43, 397–419. de Jong, M.D., Bourdot, G.W., Hurrell, G.A., Saville, D.J., Erbrink, H.J. and Zadoks, J.C. (2002) Risk Methods for Monitoring the Dispersal of Natural Enemies 129

analysis for biological weed control: Simulating dispersal of Sclerotinia sclerotiorum (Lib.) de Bary ascospores from a pasture after biological control of Cirsium arvense (L.) Scop. Aerobiologia 18, 211–222. den Boer, P.J. (1990) The survival value of dispersal in terrestrial arthropods. Biological Conservation 54, 175–192. Dobzhanzky, T. and Wright, S. (1943) Genetics of natural populations. X. Dispersion rates in Drosophila pseudoobscura. Genetics 28, 304–340. Fagan, W.F. (1997) Introducing a ‘boundary-flux’ approach to quantifying insect diffusion rates. Ecology 78, 579–587. Fatouros, N.E., Huigens, M.E., van Loon, J.J.A., Dicke, M. and Hilker, M. (2005) Butterfly anti-aphro- disiac lures parasitic wasps. Nature 433, 704. Fernandes, O.A., Wright, R.J., Baumgarten, K.H. and Mayo, Z.B. (1997) Use of rubidium to label Lysiphlebus testaceipes (Hymenoptera: Braconidae), a parasitoid of greenbugs (Homoptera: Aphididae), for dispersal studies. Environmental Entomology 26, 1167–1172. Floate, K.D., Coghlin, P. and Gibson, G.A.P. (2000) Dispersal of the filth fly parasitoid Muscidifurax raptorellus (Hymenoptera: Pteromalidae) following mass releases in cattle confinements. Biological Control 18, 172–178. Follett, P.A. and Duan, J.J. (2000) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Dordrecht, The Netherlands. Fournier, F. and Boivin, G. (2000) Comparative dispersal of Trichogramma evanescens and Trichogramma pretiosum (Hymenoptera: Trichogrammatidae) in relation to environmental conditions. Environmental Entomology 29, 55–63. Freeman, G.H. (1977) A model relating numbers of dispersing insects to distance and time. Journal of Applied Ecology 14, 477–487. Gabrys, B.J., Gadomski, H.J., Klukowski, Z., Pickett, J.A., Sobota, G.T., Wadhams, L.J. and Woodcock, C.M. (1997) Sex pheromone of cabbage aphid Brevicoryne brassicae: Identification and field trapping of male aphids and parasitoids. Journal of Chemical Ecology 23, 1881–1890. Garcia, A.F., Griffiths, G.J.K. and Thomas, C.F.G. (2000) Density, distribution and dispersal of the carabid beetle Nebria brevicollis in two adjacent cereal fields. Annals of Applied Biology 137, 89–97. Gross, K. and Ives, A.R. (1999) Inferring host-parasitoid stability from patterns of parasitism among patches. American Naturalist 154, 489–496. Gu, H., Waeckers, F., Steindl, P., Gunther, D. and Dorn, S. (2001) Different approaches to labelling parasitoids using strontium. Entomologia Experimentalis et Applicata 99, 173–181. Hagler, J.R. and Jackson, C.G. (1998) An immunomarking technique for labelling minute parasitoids. Environmental Entomology 27, 1010–1016. Hagler, J.R. and Jackson, C.G. (2001) Methods for marking insects: Current techniques and future prospects. Annual Review of Entomology 46, 511–543. Hagler, J.R., Jackson, C.G., Henneberry, T.J. and Gould, J.R. (2002a) Parasitoid mark–release–recapture techniques: II. Development and application of a protein marking technique for Eretmocerus spp., parasitoids of Bemisia argentifolii. Biocontrol Science and Technology 12, 661–675. Hagler, J.R., Machtley, S.A. and Leggett, J.E. (2002b) Parasitoid mark–release–recapture techniques: I. Development of a battery-operated suction trap for collecting minute insects. Biocontrol Science and Technology 12, 653–659. Hawkes, C. (1972) The estimation of the dispersal rate of the adult cabbage root fly (Erioischia brassicae) in relation to Brassica crop. Journal of Applied Ecology 11, 83–89. Hickson, R., Moeed, A. and Hannah, D. (2000) HSNO, ERMA and risk assessment. New Zealand Science Review 57, 72–77. Hoddle, M.S. (2004) Restoring balance: Using exotic species to control invasive exotic species. Conservation Biology 18, 38–49. Hougardy, E., Pernet, P., Warnau, M., Delisle, J. and Gregoire, J.-C. (2003) Marking bark beetle parasitoids within the host plant with rubidium for dispersal studies. Entomologia Experimentalis et Applicata 108, 107–114. Jones, T.H., Godfray, H.C.J. and Hassell, M.P. (1996) Relative movement patterns of a tephritid fly and its parasitoid wasps. Oecologia 106, 317–324. Jung, C. and Croft, B.A. (2001) Aerial dispersal of phytoseiid mites (Acari: Phytoseiidae): Estimating falling speed and dispersal distance of adult females. Oikos 94, 182–190. Justo, H.D. Jr, Shepard, B.M. and Elsey, K.D. (1997) Dispersal of the egg parasitoid Trissolcus basalis 130 N.J. Mills et al.

(Hymenoptera: Scelionidae) in tomato. Journal of Agricultural Entomology 14, 139–149. Kareiva, P. (1983) Local movements in herbivorous insects: applying a passive diffusion model to mark-recapture field experiments. Oecologia 57, 322–327. Kishita, M., Arakaki, N., Kawamura, F., Sadoyama, Y. and Yamamura, K. (2003) Estimation of population density and dispersal parameters of the adult sugarcane wireworm, Melanotus okinawen- sis Ohira (Coleoptera: Elateridae) on Ikei Island, Okinawa, by mark-recapture experiments. Applied Entomology and Zoology 38, 233–240. Kuske, S., Widmer, F., Edwards, P.J., Turlings, T.C.J., Babendreier, D. and Bigler, F. (2003) Dispersal and persistence of mass released Trichogramma brassicae (Hymenoptera: Trichogrammatidae) in non-target habitats. Biological Control 27, 181–193. Lacey, L.A., Kaya, H.K. and Bettencourt, R. (1995) Dispersal of Steinernema glaseri (Nematoda: Steinernematidae) in adult Japanese beetles, Popillia japonica (Coleoptera: Scarabaeidae). Biocontrol Science and Technology 5, 121–130. Lavandero, B., Wratten, S., Hagler, J. and Jervis, M. (2004) The need for effective marking and tracking techniques for monitoring the movements of insect predators and parasitoids. International Journal of Pest Management 50, 147–151. Leather, S.R. (2005) Insect Sampling in Forest Ecosystems. Blackwell Publishing, Oxford, UK. Loomans, A.J.M. (2002) Case study 1: inoculative releases of specialist parasitoids in glasshouse systems. In: Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Kuske, S., van Lenteren, J.C., Loomans, A., Menzler-Hokkanen, I., van Rijn, P.C.J., Thomas, M.B., Tommasini, G. and Zeng, Q.-Q. (eds) Evaluating Environmental Risks of Biological Control Introductions into Europe: Final Report. European Community Quality of Life Programme, Brussels, Belgium. Louda, S.M., Pemberton, R.W., Johnson, M.T. and Follett, P.A. (2003) Nontarget effects: The Achilles’ heel of biological control? Retrospective analyses to reduce risk associated with biocontrol introductions. Annual Review of Entomology 48, 365–396. Lynch, L.D., Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Gao, Z.H., Kuske, S., Loomans, A., Menzler-Hokkanen, I., Thomas, M.B., Tommasini, G., Waage, J.K., van Lenteren, J.C. and Zeng, Q.-Q. (2001) Insect biological control and non-target effects: a European perspective. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, New York, pp. 99–125. Mansfield, S. and Mills, N.J. (2002) Direct estimation of the survival time of commercially produced adult Trichogramma platneri Nagarkatti (Hymenoptera : Trichogrammatidae) under field conditions. Biological Control 25, 41–48. McDermott, G.J. and Hoy, M.A. (1997) Persistence and containment of Metaseiulus occidentalis (Acari: Phytoseiidae) in Florida: Risk assessment for possible releases of transgenic strains. Florida Entomologist 80, 42–53. McDougall, S.J. and Mills, N.J. (1997) Dispersal of Trichogramma platneri Nagarkatti (Hym., Trichogrammatidae) from point-source releases in an apple orchard in California. Journal of Applied Entomology 121, 205–209. Messing, R.H., Klungness, L.M., Purcell, M.F. and Wong, T.T.Y. (1993) Quality control parameters of mass-reared opine parasitoids used in augmentative biological control of tephritid fruit flies in Hawaii. Biological Control 3, 140–147. Messing, R.H., Klungness, L.M. and Purcell, M.F. (1994) Short-range dispersal of mass-reared Diachasmimorpha longicaudata and D. tryoni (Hymenoptera: Braconidae), parasitoids of tephritid fruit flies. Journal of Economic Entomology 87, 975–985. Messing, R.H., Purcell, M.F. and Klungness, L.M. (1995) Short range dispersal of mass-reared Psyttalia fletcheri (Hymenoptera: Braconidae), parasitoids of Bactrocera cucurbitae (Diptera: Tephritidae). Environmental Entomology 24, 1338–1343. Mills, N.J. and Schlup, J. (1989) The natural enemies of Ips typographus in Central Europe: impact and potential use in biological control. In: Kulhavy, D.L. and Miller, M.C. (eds) Potential for Biological Control of Dendroctonus and Ips Bark Beetles. Stephen F. Austin, State University Press, Nacogdoches, Texas, pp. 131–146. Mitchell, E.R., Hu, G.Y., Okine, J.S. and Carpenter, J.E. (1999) Parasitism of diamondback moth (Lepidoptera: Plutellidae) larvae by Cotesia plutellae (Hymenoptera: Braconidae) and Diadegma insulare (Hymenoptera: Ichneumonidae) in cabbage fields after inundative releases of C. plutellae. Journal of Entomological Science 34, 101–112. Methods for Monitoring the Dispersal of Natural Enemies 131

Muratori, F., Levie, A. and Hance, T. (2000) Parasitoid dispersion in cereal crop following a mass release. Mededelingen Faculteit Landbouwkundige en Toegepaste Biologische Wetenschappen Universiteit Gent 65, 245–252. OECD (2004) Guidance for Information Requirements for Regulation of Invertebrates as Biological Control Agents (IBCAs). Series on Pesticides, 21. OECD, Paris. Okubo, A. (1980) Diffusion and Ecological Problems: Mathematical Models. Springer, Berlin. Okubo, A. and Levin, S.A. (1989) A theoretical framework for data analysis of wind dispersal of seeds and pollen. Ecology 70, 329–338. Plant, R.E. and Cunningham, R.T. (1991) Analyses of the dispersal of sterile Mediterranean fruit flies (Diptera: Tephritidae) released from a point source. Environmental Entomology 20, 1493–1503. Prasifka, J.R., Krauter, P.C., Heinz, K.M., Sansone, C.G. and Minzenmayer, R.R. (1999) Predator conservation in cotton: using grain sorghum as a source for insect predators. Biological Control 16, 223–229. Raworth, D.A. and Choi, M.-Y. (2001) Determining numbers of active carabid beetles per unit area from pitfall-trap data. Entomologia Experimentalis et Applicata 98, 95–108. Schellhorn, N.A., Siekmann, G., Paull, C., Furness, G. and Baker, G. (2004) The use of dyes to mark populations of beneficial insects in the field. International Journal of Pest Management 50, 153–159. Schneider, J.C. (1999) Dispersal of a highly vagile insect in a heterogeneous environment. Ecology 80, 2740–2749. Simberloff, D. and Stiling, P. (1996) How risky is biological control? Ecology 77, 1965–1974. Skovgård, H. (2002) Dispersal of the filth fly parasitoid Spalangia cameroni (Hymenoptera: Pteromalidae) in a swine facility using fluorescent dust marking and sentinel pupal bags. Environmental Entomology 31, 425–431. Smith, M.T., Bancroft, J., Li, G., Gao, R. and Teale, S. (2001) Dispersal of Anoplophora glabripennis (Cerambycidae). Environmental Entomology 30, 1036–1040. Southwood, T.R.E. and Henderson, P.A. (2000) Ecological Methods, Blackwell Science, Oxford, UK. Strand, M.R., Roitberg, B.D. and Papaj, D.R. (1990) Acridine orange a potentially useful internal marker of Hymenoptera and Diptera. Journal of the Kansas Entomological Society 63, 634–637. Suckling, D.M., Gibb, A.R., Burnip, G.M. and Delury, N.C. (2002) Can parasitoid sex pheromones help in insect biocontrol? A case study of codling moth (Lepidoptera: Tortricidae) and its parasitoid Ascogaster quadridentata (Hymenoptera: Braconidae). Environmental Entomology 31, 947–952. Sutherland, W.J. (1996) Ecological Census Techniques: a Handbook. Cambridge University Press, Cambridge, UK. Taylor, R.A.J. (1978) The relationship between density and distance of dispersing insects. Ecological Entomology 3, 63–70. Turchin, P. (1998) Quantitative Analysis of Movement. Sinauer Associates, Sunderland, Massachusetts. Turchin, P., Odendaal, F.J. and Rauscher, M.D. (1991) Quantifying insect movement in the field. Environmental Entomology 20, 955–963. Turchin, P. and Thoeny, W.T. (1993) Quantifying dispersal of southern pine beetles with mark-recapture experiments and a diffusion model. Ecological Applications 3, 187–198. van der Werf, W., Evans, E.W. and Powell, J. (2000) Measuring and modelling the dispersal of Coccinella septempunctata (Coleoptera: Coccinellidae) in alfalfa fields. European Journal of Entomology 97, 487–493. van Lenteren, J.C. (2003) Commercial availability of biological control agents. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents; Theory and Testing Procedures. CABI Publishing, Wallingford, UK, pp. 167–179. van Lenteren, J.C., Babendreier, D., Bigler, F., Burgio, G., Hokkanen, H.M.T., Kuske, S., Loomans, A.J.M., Menzler-Hokkanen, I., van Rijn, P.C.J., Thomas, M.B., Tommasini, M.G. and Zeng, Q.-Q. (2003) Environmental risk assessment of exotic natural enemies used in inundative biological control. BioControl 48, 3–38. Yamamura, K., Kishita, M., Arakaki, N., Kawamura, F. and Sadoyama, Y. (2003) Estimation of dispersal distance by mark recapture experiments using traps: correction of bias caused by the artificial removal by traps. Population Ecology 45, 149–155. 8 Risks of Plant Damage Caused by Natural Enemies Introduced for Arthropod Biological Control

Ramon Albajes,1 Cristina Castañé,2 Rosa Gabarra2 and Òscar Alomar2 1Universitat de Lleida, Centre UdL-IRTA, Rovira Roure 191, 25198 Lleida, Spain (email: [email protected]; fax number: +34-973-238301); 2IRTA, Centre de Cabrils, 08348 Cabrils (Barcelona), Spain (email: [email protected]; [email protected]; [email protected]; fax number: +34-937-533954)

Abstract

Although the capacity to feed on both prey and plants is relatively widespread among pest natural enemies, mostly in predators, crop damage has rarely been reported. Little is known about the mechanisms governing crop damage occurrence by predators that can also facultatively feed on plants. This chapter aims to provide guidance on how to assess the risks of crop damage by introduced invertebrate biological control agents. Risks of crop damage do not seem to be characteristic and constant for each species but variable, depending on external factors. Based on the experience gained with the management of native facultative predators in conservation biological control, we discuss the role of variables linked to the predator, the crop plant and the target habitat when assessing risks of crop damage by introduced natural enemies. Among the variables related to the predator, capacity to consume and to injure plants and to vector plant pathogens are associated most with high risk of crop damage. When this information is not reliably available in the literature, pre-release tests must be carried out. These should include observations on plant-feeding activity and its confirmation by using chemical or immunological markers and gut content analyses. Specific trials, designed to test whether damage is caused, should take into account the variables linked to the crop that may affect its susceptibility: crop species, cultivar, growth stage and tissue. Risks posed by plant-feeding predators should be analysed in relation to the potential benefits expected from such predators for biological control.

Introduction risks of crop damage have rarely been considered in the protocols for the evaluation It has been commonly thought that natural of potential biological control agents. The enemies introduced to control arthropod growing realization that there are preda- pests are safe for crop plants, and hence ceous arthropods and parasitoids that can ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 132 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Risks of Plant Damage Caused by Natural Enemies 133

occasionally or regularly feed on plants or has received attention due to its implica- plant products has become a concern, as if tions for biological and chemical control of plant feeding would inevitably lead to crop agricultural pests (Alomar and Wieden- damage. However, the facultative herbivory mann, 1996; Coll and Guershon, 2002). The in natural enemies does not mean that they alternation of prey- and plant-feeding will necessarily feed on plants and, even if stages during the life cycle of arthropods is they do, that they will injure the plant or a common feature. For example, many that injury will result in yield loss. predatory insects feed upon plants at the Fortunately, plant damage occurs only in adult stage by consuming floral or extra- very few situations, despite the fact that floral nectar, pollen, seeds, plant saps and many biological control agents regularly other plant materials, whereas they are car- feed on plants. For instance, in a thorough nivorous in juvenile stages. This is the case review of most predator groups by Hagen et with many predators and parasitoids that al. (1999), plant feeding is mentioned sev- have been used successfully in biological eral times, but crop damage is very rarely control. Less frequently, but not rarely, noticed. Crop damage is the result of com- insect predators may feed on plants and/or plex interactions between the morphologi- on prey at the same developmental stage. cal, physiological and behavioural traits of These so-called ‘facultative predators’ may the natural enemy, and some environmen- switch from prey feeding to plant feeding tal features. and vice versa (Albajes and Alomar, 2004). The objective in this chapter is to pro- Due to the difficulty in assigning the rela- vide guidance on how to assess plant feed- tive position within a range stretching from ing and damage by invertebrate biological strict zoophagy to strict phytophagy, there control agents introduced for arthropod are many terms found in the literature control. In order to predict the effects of related to facultative predators, such as plant feeding by natural enemies it is nec- zoophytophages, phytozoophages, plant- essary first to determine the factors respon- feeding omnivores, facultative phyto- sible for facultative phytophagy, then to phagous predators, facultative herbivores assess the possible resultant yield loss, and and opportunistic predators (Alomar, finally to identify the level of phytophagy 2002). by the natural enemy in the target agricul- In this chapter we will consider plant- tural ecosystem. At the end of the chapter feeding predators as being those that can we propose some criteria and procedures alternate between zoophagy and phyto- that may help to assess risks of negative phagy in different developmental stages, as effects on plants caused by candidate nat- well as those that may feed facultatively on ural enemies. plants and prey in the same developmental stage. The term ‘plant-feeding predators’ therefore includes true omnivores, zoophy- Feeding Habits of Arthropod tophages, facultative predators and equiva- Natural Enemies lent terms. Insects that feed on plants and prey in Arthropods have been considered to belong different stages are represented in most to a unique trophic level, that is, to be insect orders, even if herbivores with can- either herbivores or carnivores. However, nibalistic habits are not considered. Most insect feeding studies are increasingly parasitoids feed on plant-derived products showing that many insect species are at the adult stage. Several families of instead omnivores, that is, they can use insect and mite natural enemies may foods of more than one trophic level (Pimm ingest plant products in at least one devel- and Lawton, 1978). The capacity to feed on opmental stage (Hagen et al., 1999). This is both prey and plants (zoophytophagy) is a the case with many predatory Heteroptera special case of omnivory, called true (Anthocoridae, Miridae, Nabidae, omnivory by some authors. True omnivory Geocoridae, Pentatomidae), Thysanoptera 134 R. Albajes et al.

(Aeolothripidae), Neuroptera (both green concerns salivary glands. Heteropteran and brown lacewings), Coleoptera phytophages have less complex salivary (Carabidae, Coccinellidae), Diptera glands in comparison with true predatory (Cecidomyiidae, Syrphidae), Hymenoptera organisms. In general among insects, (Formicidae, Vespidae and many para- predatory species have a shorter and sim- sitoid families) and of at least four arach- pler midgut than herbivorous species. Most nid families, among which the physiological and biochemical adaptations Phytoseiidae are prominent predators. to omnivory involve digestive enzymatic Facultative predation is relatively com- traits. Because of the differences in the mon among arthropods. For example, composition of prey- and plant-based diets, Albajes and Alomar (2004) give a list of in particular in the protein:carbohydrate taxa including at least one species with fac- ratio, different spectra of enzymes are ultative predation habits. It contains 18 found in phytophages and carnivores, and orders and 84 families of mostly insects, a simultaneous occurrence of several types but some arachnids are also included. in omnivores can be expected. Proteases Cannibalism, haematophagy and host feed- and phospholypases, for example, are more ing by parasitoids, but not saprophagy, are common among predatory insects, whereas excluded from the list. Many of the original pectinases and amylases are more likely to references reviewed in the literature of fac- occur in plant feeders. The presence of ultative predation are only occasional symbionts in the gut has been associated observations, and a more careful study of with plant-feeding insects, to which they the feeding behaviour of predatory arthro- provide nutritional factors that are depau- pods could greatly increase the list. perate in plant tissues. Behavioural traits of Zoophytophagy could have special plant-feeding predators are linked to their structural and behavioural traits adapted to capacity to respond to stimuli from plants, omnivory or to blend characteristics of although for some authors other non-nutri- both phytophagous and carnivorous tive factors linked to predator foraging insects. Omnivory has probably evolved behaviour may help in understanding the from strict carnivores, but also from origi- causes and consequences of omnivory. nal herbivores (Whitman et al., 1994). Few studies, however, have been devoted to the evolution of morphological, physiological Plant-feeding Predators in and behavioural traits associated with Biological Control omnivory, and whether they have evolved in correlation. This lack of studies prevents The ecological role of true omnivory us from unequivocally associating certain morphological structures, physiological Most investigations on plant-feeding preda- characteristics and behavioural patterns of tors have emphasized the benefits and natural enemies with plant feeding or risk costs for predator fitness derived from to the crop plant. Cohen (1996) and Coll mixed diets. However, understanding the and Guershon (2002) (the former restricted full ecological relevance of true omnivory to Heteroptera) reviewed the most common may help to incorporate it into the theory traits associated with plant-feeding habits of population and food web dynamics, and in predatory arthropods. to gain more predictability of the benefits The morphology of mouthparts is and risks of plant-feeding predators in bio- closely related to feeding regimes. For logical control. example, zoophagous heteropterans are The benefits may stem, first, from nutri- armed with back-curving teeth, whereas tional considerations. Plant food tends to phytophagous heteropterans have be more abundant, stable, aggregated and mandibular teeth that curve forward easier to obtain than prey food, particularly towards the food, or may have no teeth at in agricultural ecosystems. Furthermore, it all. Another differential morphological trait has been widely reported that predators Risks of Plant Damage Caused by Natural Enemies 135

that are able to complement or supplement suppression show that the result of feeding their carnivorous diet with plant materials on plants by predators is uncertain and enhance one or more of their fitness com- depends on many factors (Eubanks and ponents, such as developmental rate, sur- Denno, 2000). vival, fecundity or longevity. But other However, plant-feeding predators offer non-nutritive factors may also explain the advantages for use in biological control, so advantages of omnivory. Although they management programmes must minimize have historically received little attention in risks while maximizing their benefits ecological research, advantages such as (Alomar, 2002). There is some experimental reduced competition for prey with other evidence – still poorly investigated – that predators, toxin dilution and reduction of plant-feeding predators are able to establish predation risks have been cited as benefits themselves on the crop early in the season obtained from mixed food regimes. even before colonization by pests, a particu- The costs for predators of feeding on larly positive trait in annual crops that have plants are traditionally said to be a conse- to be recolonized every season. Once they quence of the poor quality of plant food in are established, the possibility of feeding on comparison with prey food; plant tissues plant tissues may allow predators to remain are, in general, poorer in their C:N ratio on the crop even in the absence or shortage than those at higher trophic levels, even of prey. This ability, however, may be when particularly N-rich plant tissues (e.g. greatly influenced by the plant. The need pollen, seeds, flowers, fruit) are selected for pollen, for example, causes Orius spp. (Denno and Fagan, 2003). This could (Heteroptera: Anthocoridae) to leave low diminish some of the above-mentioned fit- pollen-producing cucumber varieties, ness components and counterbalance their whereas they can remain on the crop at low benefits. Increased food intake may com- densities in varieties with higher pollen pensate for lower food quality, although production. Plant characteristics may medi- this also has some potential limitations and ate prey preferences by predators, which disadvantages. Feeding strategies in true may avoid foraging or ovipositing on omnivores thus respond to the compromise certain plant species or varieties. Again, between benefits and costs of zoophyto- Orius spp. are rarely observed on tomato phagy within the limits established by phy- even if it hosts high numbers of thrips, their logenetic constraints. target prey.

Limitations and advantages of plant- Damage to Crop Plants feeding predators for biological control Nutrients obtained from plants by plant- The potential of plant-feeding predators for feeding predators biological pest control has traditionally been neglected, mainly due to the risk that To answer the question of which nutrients feeding on crop plants may result in eco- or, at least, which type of nutrients plant- nomic damage as a direct consequence feeding predators obtain when feeding on either of injuries to plant tissues or indi- plants, it is necessary to explain the rectly by inoculating pathogens that cause behaviour of facultative predators, which crop diseases. Another reason is their com- may help us to understand the extent of mon nature as generalist predators, a group plant feeding and therefore the risk of of natural enemies believed to be less effec- damage. However, studies in this ﬁeld are tive in maintaining pests under economic extremely rare and most of them refer thresholds, and in this case even less effec- to the speciﬁc case of Heteroptera. tive because it is said that plant consump- Predaceous Heteroptera need a substantial tion may decrease prey ingestion. Recent amount of water in order to feed on their studies on the role of omnivory in pest prey due to their extra-oral digestion. In 136 R. Albajes et al.

this type of feeding, also called ‘flush and 1996), a hypothesis that led to the imple- macerate’, the insect injects into the prey a mentation of a predator/prey management considerable amount of digestive enzymes programme on field tomatoes aimed at from its salivary glands. These enzymes avoiding the coincidence of high predator are diluted in water and, together with the populations with low prey (greenhouse action of the insect’s stylets, they pierce whitefly) densities (Albajes and Alomar, prey tissues and macerate them with the 1999; Lucas and Alomar, 2002). watery saliva, forming slurry that will be However, other behavioural studies ingested and finally digested in the gut conducted on D. tamaninii have shown (Cohen, 1995). This process involves a that time spent feeding on leaves does not great demand for water. The high invest- vary with prey density (Montserrat et al., ment in enzymes that this type of feeding 2004). This suggests different behaviour involves means that they must be collected patterns of plant feeding for leaves and back from the prey or plant, resulting in fruits in this predator. On the other hand, very efficient predators in relation to prey prey feeding enhances feeding on leaves in consumption, because they consume most another predator of the same genus, D. of the food contents. Moreover, water is hesperus Knight (Sinia et al., 2004). In the additionally needed to maintain their latter, water has been reported as the main physiological status. Due to this high factor obtained from plant feeding demand for water that Heteropteran preda- (Gillespie and McGregor, 2000), although tors derive mainly from plant tissues, the risk of damaging fruits is low phytophagy in these predators may be con- (McGregor et al., 2000), because these bugs sidered not as facultative but compulsory prefer to feed on leaves. (Gillespie and McGregor, 2000; Sinia et al., Gillespie and McGregor (2000) proposed 2004). considering three categories of functional Facultative predators obtain not only relationships between prey and plant feed- water from plants but also other substances ing that might result in different risks of that allow them to maintain their fitness. crop damage. The negative relationship – What they obtain varies to a great extent plant feeding decreases as prey feeding according to the predator and the plant increases – represents a favourable situa- (and plant part) considered. Whereas cer- tion for using facultative predators in bio- tain plant species can sustain predator logical control. The positive relationship development, and even some reproduction occurs when water, or any other resource in the absence of prey, other plants are only able to maintain the adults alive for a limiting predation, is the main component period of time (Stoner, 1970; Naranjo and of the plant diet in the predator. As more Stimac, 1985; Perdikis and Lykouressis, prey is ingested, more water is needed for 2000; Sanchez et al., 2004). Also, different digestion and other physiological functions plant parts may have different nutritive of the prey. This situation may or may not values. While seeds and pollen frequently lead to crop damage, depending on the contain up to 10% nitrogen, leaves often plant part used as water source. A third contain as little as 0.7%, and phloem and category is when plant and prey feeding xylem tissues even less (<0.005%) are independent; this scenario occurs when (Eubanks et al., 2003). the predator needs to consume plant It is not clear to what extent plant feed- resources to acquire a certain amount of a ing by some predators is characteristic and critical element not available in the prey constant for each species, or is variable and not directly related to foraging, ingest- depending on external factors. For exam- ing and digesting the prey. Only if the ple, injury to tomato fruits by Dicyphus amount of the critical element needed by tamaninii Wagner (Heteroptera: Miridae) is the predator is high may this functional more likely to occur under prey shortage relationship limit the use of the predator in (Salamero et al., 1987; Alomar and Albajes, biological control. Risks of Plant Damage Caused by Natural Enemies 137

Plant injury by plant-feeding predators from simple punctures in the green fruit, which become discoloured spots in the Heteroptera have been much used both in mature fruit (tomatoes) (Alomar and conservation and augmentation biological Albajes, 1996), to diverse depressions control, and provide a useful framework (pits) and scars, which are very well for discussion of the complexity of the fac- described in apples (Boivin and Stewart, tors involved in damage (Alomar, 2002). 1982). In many cases, injured tissues show Injuries caused by plant-feeding predators a brownish area internally, as in the case can affect plant growing tissues, stems, of the mirid bug N. tenuis, which may feed leaves or fruits. The damage is species- on the vascular tissues of tomato plants. specific, that is, a predatory species may This type of damage (toxaemia) is the damage certain crops, but not others. result of several concurrent processes, Campyloma verbasci (Meyer) (Heteroptera: such as the mechanical destruction of cells Miridae) is responsible for damage on by the stylet, together with the action of apples, but very rarely on pears, in Canada the salivary enzymes on the tissues and (Thistlewood and Smith, 1996); Dicyphus the wound-response reaction by the plant. tamaninii may cause damage to tomatoes This response is characterized by the under prey shortage but not to cucumbers release of phenolic compounds that are or melons (Alomar and Albajes, 1996; oxidized to quinones and subsequently Castañé et al., 2000; Alomar et al., 2003), form non-toxic polymers, producing the and the same has been observed with characteristic brown discolouration of Macrolophus caliginosus Wagner wounded tissues (Raman et al., 1984). This (Heteroptera: Miridae) for courgettes or type of internal tissue lesion has been cherry tomatoes, whereas it is safe for regu- associated with other predaceous and lar tomatoes (Lucas and Alomar, 2002; phytophagous Heteroptera (Schaefer and Castañé et al., 2003). Crop susceptibility to Panizzi, 2000; Wheeler, 2001). predator feeding may change even with the crop cultivar or crop growth stage. Damage caused by C. verbasci is concentrated dur- Criteria for Risk Assessment ing the blooming period, early in the season, and is greater in ‘Delicious’ than in Plant damage assessment within current other apple varieties such as ‘McIntosh’ regulations (Reding and Beers, 1996). The local conditions can also alter the damage potential of Until now, regulations on the importation a plant-feeding predator; while damage by and release of exotic biological control M. caliginosus to tomatoes has been agents have mostly been aimed at limiting claimed by English growers (Sampson and the risks for native non-target species, in Jacobson, 1999), the bug has been widely addition to characterizing biological con- introduced by growers in continental trol agents and their efficacy. This is the European greenhouses without major case for most of the currently available reported problems. Similarly, Nesidiocoris guidance documents produced by several tenuis (Reuter) (Heteroptera: Miridae) may international organizations, including FAO severely injure tomato plants in the south (1996), EPPO (2002), OECD (2004), and by of France and in Sicily, while in the state administrations or scientists (van Spanish areas of Valencia, Murcia and the Lenteren et al., 2003). The FAO Code of Canary Islands damage is only occasionally Conduct for the Import and Release of observed, and the predator is now commer- Exotic Biological Control Agents and EPPO cially produced and released in vegetable Standards PM 6/1 and 6/2 provide guide- greenhouses in southern Spain (Carnero- lines for assessing and reducing the risks Hernández et al., 2000; BioBulletin, 2004). associated with release of invertebrate nat- In the case of Heteroptera, the type of ural enemies, but say nothing specific injury that is observed externally varies about the risks of damage to crop plants. 138 R. Albajes et al.

The OECD’s Guidance for Information Variables related to the predator (or par- Requirements for Regulation of asitoid) include its taxonomical affinity Invertebrates as Biological Control Agents with species with proven plant-feeding is the only document that specifically activity, adaptation of its morphology and requests that ‘effects on plants should be physiology to ingesting and digesting plant provided if the biological control agent is tissues, its measured capacity to consume potentially a facultative herbivore and if and to injure plants and, finally, its capac- there is a potential for phytotoxic effects’. ity to vector plant pathogens or to cause Finally, van Lenteren et al. (2003) refer to plant toxaemias. These produce symptoms omnivory by saying that ‘some natural ene- of plant disease induced from the effects of mies also feed on plant materials during salivary compounds (phytotoxins) intro- part of their life cycle … and information duced by insect feeding. on the effect on plants by these agents The closer the taxonomical affinity should be provided’, but nothing is said between the candidate species and other about how to proceed in assessing risks of species with proven damage potential, the crop damage. In conclusion, very little con- higher is the risk of damage to the crop. trol is mandatory on the interactions This implies the correct identification of between the biological control agent and the predator: even the identification of the the plant in any of the current regulatory biotype may be necessary as some preda- documents relating to natural enemies. tors may show different feeding behaviour according to their origin. The availability of fully developed and reliable molecular Variables and Associated Values for tools may facilitate and speed up the cor- Assessing Risks of Crop Damage rect identification of the candidate (Symondson and Hemingway, 1997). In the preceding sections we discussed the However, crop damage risks are difficult variables that may be involved in determin- to assess only on the basis of a taxonomi- ing crop damage by plant-feeding predators cal affinity. Some morphological and released for biological control purposes. In physiological traits of the predator may this section each of the variables is associ- complement indications provided by taxo- ated with risk levels in order to predict the nomical affinity. Some of them are easy to conditions in which damage to crops is more observe, while others may be difficult to likely to occur. Risk assessments ideally check for non-specialists. While each of operate with predictive models; for model the morphological and physiological traits building we need to establish clearly quanti- by itself represents a low risk of crop tative or, at least, qualitative relationships damage, co-occurrence of all or most of between variables (causes) and response the traits may lead to a moderate or even (crop damage), and estimate the likelihood high risk. of the response occurring. As mentioned, The predator’s capacities for feeding on these relationships between predator, crop plants and injuring them are of course the and habitat variables and crop damage risks most relevant variables for risk assessment. are fairly unknown and no formal models If a predator can ingest crop plant materi- are available. However, assessments may als, this does not necessarily lead to injury. still be made less formally from the list of Only when injury actually occurs is the the most relevant variables and variable risk of crop damage really high. In addition traits included in Table 8.1, which are asso- to the intrinsic capacity of the predator to ciated with risk levels. Risks are categorized injure the plant, other variables related to as low (+), moderate (++) or high (+++) for predator (e.g. physiological status, age), each of the variable traits. Data on the traits predator population (density) or predator should be surveyed first in the literature, and diet requirements (functional relationship when they are not available they must be between plant and prey feeding) may com- acquired through pre-release evaluations. plementarily determine the amount and Risks of Plant Damage Caused by Natural Enemies 139

Table 8.1. Variables and their traits involved in risks of crop damage caused by introduced biological control agents. Risks of crop damage by the plant-feeding activity of the predator may be low (+), moderate (++) or high (+++).

Variable relating Traits and level of associated risk of crop to the: Variable damage

Predator Taxonomical afﬁnity Records of crop injury by individuals of the same family (+), genus (++) or species (+++) Morphology and physiology Hypognathous head (+) Mouthpart traits associated with herbivory (+) Less chitinized and toothed fore-gut (+) Complex mid-gut (+) Presence of symbionts (+) Presence of amylases and pectinases (+) Capacity to feed on plants and to Ingestion of plant materials (++) injure them Injury to crop plants (+++) Capacity to vector plant pathogens Sucking mouthparts (++) and to produce plant toxaemias High frequency of transmission/toxaemia records in individuals of the same family (+), genus (++) or species (+++) High damage potential (+++) Crop Crop susceptibility Records of crop damage by the predator have been recorded in plants of the same family (+), genus (++), species (+++) and variety (+++) Presence of susceptible plant tissues and growth stages (++) Crop cycle Possible co-occurrence of susceptible growth stage and high predator density (++) Habitat Favourability for predator High ecological compatibility for predator establishment establishment (+) Favourability for epidemics of Presence of non-agricultural pathogen- diseases vectored by the predator susceptible plants (++) Large amount of disease inoculum (+++)

severity of the injuries. Other variables tored by plant-feeding predators could be modulating the inﬂuence of predator considered as low, but in the case of capacity for injuring plants on crop damage pathogens with high damaging potential risks are related to the crop (see below). these risks are high. Crop susceptibility The release of natural enemies that are able and favourable conditions in the habitat for to vector plant diseases or to cause phyto- disease development lead to higher risks. toxaemias is particularly risky. However, There are two main variables related to records in the literature of plant-feeding the crop to be considered in risk assess- predators that have caused crop damage by ment: its susceptibility and its phenology. vectored plant diseases or by phytotox- Crop susceptibility may affect crop aemias are very rare, although this may be response to feeding injuries. This feature potentially suspected in predators with is variable within the same plant family, sucking mouthparts or in those that are tax- but also within the same genus, and even onomically close to proven efﬁcient vec- in the same species, depending on to the tors. Based on this low record frequency, cultivar. Given a predator, the risk of crop risks of crop damage by plant diseases vec- damage on a certain crop ranges from low 140 R. Albajes et al.

to high as damage is recorded in plants of Testing procedures the same family, genus, species and variety, respectively. The predator may also The proposed methods do not differ sub- display preferences for certain tissues stantially from common practice in applied within a plant, and risks of crop damage entomology, but researchers should take may be high if the preferred tissue is the into consideration those factors (such as marketed one (e.g. fruit) or one that plant species, plant growth stage and greatly contributes to yield (young amount of prey) that may affect plant feed- leaves). As crop plants differ in their sus- ing, injury and damage. The book by Dent ceptibility to crop damage by plant-feed- and Walton (1997) may be consulted in ing predators during their growth, the selecting the methods to follow for measur- risk varies with the crop growth stage. ing some of the traits included in Table 8.1. Crop cycles leading to high probability of There now follow some indications about co-occurrence of susceptible crop growth how to proceed for testing plant feeding stages and of high predator densities are and injuring capabilities in candidates for more at risk. importation. The favourability of the habitat for To confirm or reject the plant-feeding predator establishment increases the risk of capability in the predator, simple tests can crop damage whenever injury might be be performed in the laboratory with small caused. Conditions for natural enemy cages. Food-deprived (24 h) individuals of establishment are discussed by Boivin et the predator (immatures and females) can al. (Chapter 6, this volume); here, it is be caged on different parts and tissues of remarked only that the establishment of the plant, which must be devoid of prey in potentially injurious predators in the new order to force the predator to feed. During habitat increases the risk of crop damage as the trial period, which can take a variable the time of plant exposure to the potential number of days depending on the environ- hazard is higher, and the range of plants mental conditions and predator, but which exposed may include more susceptible has to be not less than 15 days, survival plants than if the predator activity is and presence of injury on the plant must be restricted to one crop season. For predators periodically checked. Control cages, that can potentially transmit plant dis- (a) with plants but without predators, and eases, their presence in the habitat of (b) with no plants but large numbers of plants susceptible to the disease and a high prey, should be set up. The trial should be amount of inoculum increase the risk of carried out for two crop growth stages per damage to the crop where the predator has crop screened. Crops to be screened should to be released. be selected according both to their eco- Data on most of the variable traits nomic importance in the release area and included in Table 8.1 are seldom available to their taxonomic affinity to the plant that in the literature, and at least some of them hosted the predator in the original habitat. will have to be obtained by specific proce- Chemical (e.g. rubidium) or immunolog- dures before importation of natural ene- ical markers and gut content analysis will mies for classical biological control. confirm whether the individuals have Pre-release screenings cannot cover all the ingested plant materials. Other methods items mentioned in Table 8.1, and they developed for detecting prey consumption thus have to be prioritized. As there are (Agustí et al., 2003) or dispersal (e.g. more indications in the literature of crop Silberbauer et al., 2004) may also be used damage risks by a candidate, more pre- to identify plant feeding. Predator capacity release trials have to be carried out. Direct to transmit plant diseases or phytotox- observation of plant feeding, plant injury aemias may be tested with common proce- and derived damage caused by a candidate dures used in this type of study. Even gives by far the best evidence of crop dam- pathogens may be used as markers of plant age risk. feeding by the predator. Risks of Plant Damage Caused by Natural Enemies 141

Whenever plant feeding is confirmed, of populations of native predators such as specific trials for potential injury to the Dicyphus tamaninii and Macrolophus crop are needed. Damage to the plant may caliginosus in southern Europe, and D. become apparent long after injury has hesperus in Canada. It is an important been caused. Therefore, these trials should fact that neither the likelihood nor the be done in large exclusion cages during a magnitude of recorded yield losses by sufficient period of time. Crops to be those predators seems to indicate a major tested should follow the same criteria as cause for concern of immediate risk. above. The following factors should be However, based on our experience, cau- considered: plant (species, cultivar, tion is needed when requesting importa- growth stage and plant part or tissue), tion of plant-feeding predators for release. developmental stage and density of the In spite of the amount of information candidate predator, and type and amount acquired in recent years, little is still of prey. The most important factors should known about the mechanisms governing be selected and tested according to prior crop damage by some plant-feeding information. Injuries to the tissues that are predators. We feel that the growing real- directly marketed or that have a high con- ization of the importance of generalist tribution to the yield pose greater risks predators in Conservation Biological than those to less valuable tissues, and Control will also provide more detailed should always, therefore, be included in insights as to the real risks posed by some the trials. omnivores. Therefore, we suggest that augmentation of omnivores in their native habitats should also include follow-up Conclusions schemes that allow identification and quantification of damage risks under real- Recent awareness of risks involved in the istic conditions. These data can then be practice of biological control against used when defining risks for importation. invertebrate pests has dealt mainly with Particularly significant is the fact that the the potential impacts of introduced nat- risk varies according to the geographic ural enemies on native fauna. This is location: for example Nesidiocoris tenuis increasingly taken into consideration in is considered as a pest in northern the international and national regulations Mediterranean areas, whereas it is mass concerning importation of natural ene- reared and sold for inoculative biological mies for biological pest control. Much control in greenhouses further south with less attention has been paid to the poten- no reported damage to crops. tial negative effects on crop plants caused More data are needed to predict when, by introduced natural enemies. This is where and how some predators switch probably because there are few records in from prey to plant feeding in order to the literature of negative effects of inten- obtain more precise risk assessment meth- tionally released invertebrate biological ods. Meanwhile, regulations on importing control agents on crop plants. Even in and releasing natural enemies should take the case of some predators introduced into consideration predators that can into Europe for inoculative biological potentially feed on plants as relatively control that have proved to be feeding on non-risky, except when several of the plants, like Podisus maculiventris risky traits co-occur in the predator, the (Say) (Heteroptera: Pentatomidae) and targeted crop and the habitat. In addition, Orius insidiosus (Say) (Heteroptera: when a plant-feeding predator is being Anthocoridae), no crop damage has been considered for introduction into a new reported. area, the risks of crop damage must be Much of the experience gained with analysed in relation to the potential bene- the use of facultative predators in biologi- fits expected from introduction of such cal control comes from the management predators. 142 R. Albajes et al.

References

Agustí, N., Shayler, S., Harwood, J.D., Vaughan, I.P., Sunderland, K.D. and Symondson, W.O.C. (2003) Collembola as alternative prey sustaining spiders in arable ecosystems: prey detection within predators using molecular markers. Molecular Ecology 12, 3467–3475. Albajes, R. and Alomar, O. (1999) Use and potentialities of polyphagous predators. In: Albajes, R., Gullino, M.L., van Lenteren, J.C. and Elad, Y. (eds) Integrated Pest and Disease Management in Greenhouse Crops. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 265–275. Albajes, R. and Alomar, O. (2004) Facultative predators. In: Capinera, J. (ed.) Encyclopedia of Entomology. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 818–823. Alomar, O. (2002) Facultative predation as biological control. In: Pimentel, D. (ed.) Encyclopedia of Pest Management. Marcel Dekker Inc, New York, http://www.dekker.com/servlet/product/DOI/ 101081EEPM120003824 (accessed 26 March 2005). Alomar, O. and Albajes, R. (1996) Greenhouse whitefly (Homoptera: Aleyrodidae) predation by the zoophytophagous predator Dicyphus tamaninii (Heteroptera: Miridae). In: Alomar, O. and Wiedenmann, R.N. (eds) Zoophytophagous Heteroptera: Implications for Life History and Integrated Pest Management. Thomas Say Publications in Entomology, ESA, Lanham, Maryland, pp. 89–112. Alomar, O. and Wiedenmann, R.N. (1996) Zoophytophagous Heteroptera: Implications for Life History and Integrated Pest Management. Thomas Say Publications in Entomology, ESA, Lanham, Maryland. Alomar, O., Riudavets, J. and Castañé, C. (2003) Macrolophus caliginosus in the biological control of Bemisia tabaci in greenhouse melons. IOBC/WPRS Bulletin 26(10), 125–129. Bio-Bulletin (2004) BioBest Biological Systems, S.L., http://207.5.71.37/biobest/en/bulletin/ canarische_eilanden.htm (accessed 26 March 2005). Boivin, G. and Stewart, R.K. (1982) Identification and evaluation of damage to McIntosh apples by phytophagous mirids (Hemiptera: Miridae) in southwestern Quebec. Canadian Entomologist 114, 1037–1045. Carnero-Hernández, A., Díaz-Hernández, S., Amador-Martín, S., Hernández-García, M. and Hernández-Suárez, E. (2000) Impact of Nesidiocoris tenuis Reuter (Hemiptera: Miridae) on whitefly populations in protected tomato crops. IOBC/WPRS Bulletin 23(1), 259. Castañé, C., Alomar, O. and Riudavets, J. (2000) Dicyphus tamaninii in the biological control of cucumber pests. IOBC/WPRS Bulletin 23(1), 253–256. Castañé, C., Alomar, O. and Riudavets, J. (2003) Potential risk of damage to zucchinis caused by mirid bugs. IOBC/WPRS Bulletin 26(10), 135–138. Cohen, A.C. (1995) Extra-oral digestion in predaceous terrestrial Arthropoda. Annual Review of Entomology 40, 85–104. Cohen, A.C. (1996) Plant feeding by predatory Heteroptera: evolutionary and adaptational aspects of trophic switching. In: Alomar, O. and Wiedenmann, R.N. (eds) Zoophytophagous Heteroptera: Implications for Life History and Integrated Pest Management. Thomas Say Publications in Entomology, ESA, Lanham, Maryland, pp. 1–17. Coll, M. and Guershon, M. (2002) Omnivory in terrestrial arthropods: mixing plant and prey diets. Annual Review of Entomology 47, 267–97. Denno, R.F. and Fagan, W.F. (2003) Might nitrogen limitation promote omnivory among carnivorous arthropods? Ecology 84, 2522–2531. Dent, D.R. and Walton, M.P. (1997) Methods in Ecological and Agricultural Entomology. CABI Publishing, Wallingford, UK. EPPO (2002) EPPO Standards. Safe use of biological control. PM 6/3 (2), http://www.eppo.org/PUB- LICATIONS/biocontrol/biocontrol.htm (accessed 26 March 2005). Eubanks, M.D. and Denno, R.F. (2000) Host plants mediate omnivore-herbivore interactions and influence prey suppression. Ecology 81, 936–947. Eubanks, M.D., Styrsky, J.D. and Denno, R.F. (2003) The evolution of omnivory in Heteropteran insects. Ecology 84, 2549–2556. FAO (1996) Code of Conduct for the Import and Release of Exotic Biological Control Agents. FAO, publication No. 3, Rome, Italy. Gillespie, D.R. and McGregor, R.R. (2000) The functions of plant feeding in the omnivorous predator Dicyphus hesperus: water places limit on predation. Ecological Entomology 25, 380–386. Risks of Plant Damage Caused by Natural Enemies 143

Hagen, K.S., Mills, N.J., Gordh, G. and McMurtry, J.A. (1999) Terrestrial arthropod predators of insect and mite pests. In: Bellows, T.S. and Fisher, T.W. (eds) Handbook of Biological Control. Academic Press, San Diego, California, pp. 383–503. Lucas, E. and Alomar, O. (2002) Impact of Macrolophus caliginosus presence on damage production by Dicyphus tamaninii (Heteroptera: Miridae) on tomato fruits. Journal of Economic Entomology 95, 1123–1129. McGregor, R.R., Gillespie, D.R., Park, C.G., Quiring, D.M.J. and Foisy, M.R.J. (2000) Leaves or fruit? The potential for damage fruits by the omnivorous predator, Dicyphus hesperus. Entomologia Experimentalis et Applicata 95, 325–328. Montserrat, M., Albajes, R. and Castañé, C. (2004) Behavioral responses of three plant-inhabiting predators to different prey densities. Biological Control 30, 256–264. Naranjo, S.E. and Stimac, J.L. (1985) Development, survival and reproduction of Geocoris punctipes (Hemiptera: Lygaeidae): effects of plant feeding on soybean and associated weeds. Environmental Entomology 14, 523–530. OECD (2004) Guidance for Information Requirements for Regulation of Invertebrates as Biological Control Agents (IBCAs). OECD Environment, Health and Safety Publications, Paris, France, http://www.oecd.org/dataoecd/6/20/28725175.pdf (accessed 26 March 2005). Perdikis, D. and Lykouressis, D. (2000) Effects of various items, host plants, and temperatures on the development and survival of Macrolophus pygmaeus Rambur (Hemiptera: Miridae). Biological Control 17, 55–60. Pimm, S.L. and Lawton, J.H. (1978) On feeding on more than one trophic level. Nature 275, 542–544. Raman, K., Sanjayan, K.P. and Suresh, G. (1984) Impact of feeding injury of Cyrtopeltis tenuis Reut. (Hemiptera: Miridae) on some biochemical changes in Lycopersicon esculentum Mill. (Solanaceae). Current Science 53, 1092–1093. Reding, M.E. and Beers, E.H. (1996) Influence of prey availability on survival of Campylomma verbasci (Hemiptera: Miridae) and factors influencing efficacy of chemical control on apples. In: Alomar, O. and Wiedenmann, R.N. (eds) Zoophytophagous Heteroptera: Implications for Life History and Integrated Pest Management. Thomas Say Publications in Entomology, ESA, Lanham, Maryland, pp. 141–154. Salamero, A., Gabarra, R. and Albajes, R. (1987) Observations on predatory and phytophagous habits of Dicyphus tamaninii. IOBC/WPRS Bulletin 1987/X/2, 165–169. Sampson, C. and Jacobson, R.J. (1999) Macrolophus caliginosus Wagner (Heteroptera: Miridae): a predator causing damage to UK tomatoes. IOBC/WPRS Bulletin 22(1), 213–216. Sanchez, J.A., Gillespie, D.R. and McGregor, R.R. (2004) Plant preference in relation to life history traits in the zoophytophagous predator Dicyphus hesperus. Entomologia Experimentalis et Applicata 112, 7–19. Schaefer, C.W. and Panizzi, A.R. (2000) Heteroptera of Economic Importance. CRC Press, Boca Raton, Florida. Silberbauer, L., Yee, M., Del Socorro, A., Wratten, S., Gregg, P. and Bowie, M. (2004) Pollen grains as markers to track the movements of generalist predatory insects in agroecosystems. International Journal of Pest Management 50, 165–171. Sinia, A., Roitberg, B., McGregor, R.R. and Gillespie, D.R. (2004) Prey feeding increases water stress in the omnivorous predator Dicyphus hesperus. Entomologia Experimentalis et Applicata 110, 243–248. Stoner, A. (1970) Plant feeding by a predaceous insect, Geocoris punctipes. Journal of Economic Entomology 63, 1911–1915. Symondson, W.O.C. and Hemingway, J. (1997) Biochemical and molecular techniques. In: Dent, D.R. and Walton, M.P. (eds) Methods in Ecological and Agricultural Entomology. CABI Publishing, Wallingford, UK, pp. 293–340. Thistlewood, H.M.A. and Smith, R.F. (1996) Management of the mullein bug, Campyloma verbasci (Heteroptera: Miridae), in pome fruit orchards of Canada. In: Alomar, O. and Wiedenmann, R.N. (eds) Zoophytophagous Heteroptera: Implications for Life History and Integrated Pest Management. Thomas Say Publications in Entomology, ESA, Lanham, Maryland, pp. 119–140. van Lenteren, J.C., Babendreier, D., Bigler, F., Burgio, G., Hokkanen, H.M.T., Kuske, S., Loomans, A.J.M., Menzler-Hokkanen, I., van Rijn, P.C.J., Thomas, M.B., Tomassini, M.G. and Zeng, Q.-Q. (2003) Environmental risk assessment of exotic natural enemies used in inundative biological control. BioControl 48, 3–38. 144 R. Albajes et al.

Wheeler, A.G. Jr. (2001) Biology of the Plant Bugs (Hemiptera: Miridae) Pests, Predators, Opportunists. Comstock Publishing Associates, Ithaca, New York. Whitman, D.W., Blum, M.S. and Slansky, F. Jr (1994) Carnivory in phytophagous insects. In: Ananthakrishnan, T.N. (ed.) Functional Dynamics of Phytophagous Insects. Oxford and IBH Publishing Co. Pvt Ltd, New Delhi, India, pp. 161–205. 9 Methods for Assessment of Contaminants of Invertebrate Biological Control Agents and Associated Risks

Mark S. Goettel and G. Douglas Inglis Lethbridge Research Centre, Agriculture and Agri-Food Canada, 5403–1st Avenue South, Lethbridge, Alberta T1J 4B1, Canada (email: [email protected]; [email protected]; fax number: +1-403-382-3156)

Abstract

With the importation or transport of any commodity, there exists the hazard that unwanted organisms or substances (i.e. ‘contaminants’) will be conveyed and introduced. Invertebrate biological control agents (IBCAs) can be contaminated with numerous biotic and abiotic entities such as parasitoids, hyperparasitoids, pathogenic and/or non-pathogenic microorganisms, other organisms, pesticide residues, unwanted packaging materials, etc. Therefore, assessment of the risk posed by the contaminant must be addressed in the commerce of IBCAs. In this chapter, we provide an overview of possible contaminants of IBCAs and of the methods used to detect them. We consider two major factors when assessing risk. These are: (i) whether the IBCA is field collected or insectary reared; and (ii) whether the IBCA is exotic, being introduced for classical biological control or is indigenous and to be used for inundative biological control. We conclude that minimal risk is posed by contaminants of commercially mass-produced IBCAs, that are established in the area of use and are to be used inundatively. For such IBCAs, we recommend that the standards established for importation of most commodities, such as many foodstuffs, plants, vegetables, fruits etc. (i.e. quality control assurances by the producers) be adopted. Field-collected IBCAs, on the other hand, have a much higher potential for harbouring unknown contaminants that may represent a risk. We recommend that feral IBCAs to be released outside of the area from which they were collected should be kept for at least one generation under quarantine, if at all possible, and that the appropriate quarantine protocols are applied. This would allow the detection and elimination of biotic contaminants. We stress that the key to the regulation of IBCAs is to address the extent of the possibility that a contaminant could pose a hazard to the commodity or to the environment of the commodities’ final destination, and, if warranted, to ensure that such harm does not take place. The extent to which measures for prevention of transfer of contaminants are implemented must be weighed in relation to the present transfer of unknown or unwanted substances by other means. If the cautionary approach is strictly implemented for all possible contaminants, then almost certainly the international movement of IBCAs would grind to a halt. The ramifications of this must be weighed against the presently known benefits of IBCAs in our agriculture and forestry industries.

©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) 145 146 M.S. Goettel and G.D. Inglis

Introduction could affect the IBCA’s efficacy, the health of the user, or which could become estab- In the importation or transport of any com- lished or pollute the new environment. modity, there is always a concern that Possibilities include pathogenic or non- ‘contaminants’ will be conveyed and intro- pathogenic microorganisms, parasitoids, duced. Before we proceed, it is first neces- hyperparasitoids, misidentified inverte- sary to define what constitutes a brates, pesticide residues, unwanted pack- contaminant. According to Merriam- aging materials, etc. In this chapter, we Webster’s Medical Dictionary (2003), a con- characterize possible contaminants as taminant is defined as: ‘a substance that either microorganisms, invertebrates or abi- contaminates; to contaminate is to soil, otic agents. stain or corrupt by contact; to tarnish; to pollute; contamination is the act of contaminating or polluting including (either Microorganisms intentionally or accidentally) unwanted substances or factors.’ The key word in this Microorganisms are ubiquitous and they definition is ‘unwanted’. Restricting the are always found in association with both definition to unwanted presents a cadre of field-collected and mass-reared inverte- problems. What is ‘unwanted’ as far as an brates, including IBCAs. Their associations invertebrate biological control agent (IBCA) are complex, and their associations with is concerned? Human-pathogenic bacteria IBCAs can be considered as either inciden- associated with IBCAs may be unwanted, tal, mutualistic, pathogenic or commensal- yet the introduction of a small number of istic. It is important to emphasize that cells of a relatively weak human-patho- these categories are not necessarily exclu- genic microorganism does not necessarily sive of each other. A number of arthropods pose a serious threat. Microorganisms are vector mammalian (e.g. West Nile Virus) ubiquitous and no invertebrates are devoid and plant pathogens. Furthermore, micro- of them unless special measures are taken. organisms associated with IBCAs may be How does one determine whether a micro- pathogens of invertebrates, plants or verte- organism falls into the ‘unwanted’ cate- brates, including humans. Groups of micro- gory? To determine this, the definition of organisms dealt with in this chapter contaminant must also address risk, and include the viruses, bacteria, fungi and this paper defines contamination as the protozoa. For convenience, we also include inclusion of any unwanted substance or the nematodes in this section. Numerous factor (i.e. a contaminant) in the commerce examples of pathogens of beneficial arthro- of IBCAs that poses an unacceptable risk. pods are provided by Vinson (1990), and of In defining unacceptable risk, we limit our mass-produced IBCAs by Bjørnson and discussion to the impacts of contaminants Schütte (2003). on the health of the IBCAs or on humans, and their potential impact on ecosystems Viruses (e.g. introduction of non-indigenous microorganisms). We also compare risk assess- Viruses are obligate, intracellular ments applied to other invertebrates in pathogens that consist of double-stranded some OECD (Organization for Economic or single-stranded nucleic acid (DNA or Cooperation and Development) countries. RNA) encased in a protective coating called a capsid. Collectively, the nucleic acid and capsule are termed a nucleocap- Contaminants Associated with sid. Depending on the virus, some nucleo- Invertebrates capsids are enclosed within a lipid envelope. Virions are the infectious unit of Using the above definitions, a contaminant a virus. In enveloped viruses, the virions could be one of numerous factors that consist of the nucleocapsid (i.e. nucleic Methods for Assessment of Contaminants of Invertebrate BCAs 147

acid and capsid) and the envelope. In non- by the hymenopteran parasitoid, Cotesia enveloped viruses, the virions are com- marginiventris (Cresson) (Hymenoptera: prised only of the nucleocapsid. Viruses do Braconidae), from infected to healthy not possess the ability to replicate them- Spodoptera larvae (Lepidoptera: selves independently of a living host, and Noctuidae) (Hamm et al., 1985). Viral thus cannot be cultured on microbiological pathogens are also present in numerous media. They, in essence, highjack the meta- mite and insect species that are used in bolic machinery of the host cell and trick it biological control (Bjørnson and Schütte, into producing progeny viruses. A number 2003). For instance, cytovirus and nuclear- of entomopathogenic viruses produce polyhedroviruses are known from the occlusion bodies (OBs), in which the viri- aphid predator, Chrysoperla (Neuroptera: ons are embedded within a paracrystalline Chrysopidae) (Martignoni and Iwai, 1986). protein matrix. The OBs protect the virions Unidentified, non-occluded virus particles (i.e. from ultraviolet light) and increase were observed in the yolk of predatory persistence of the virions outside of the Neoseiulus cucumeris (Oudemans) host; their formation has important conse- (Mesostigmata: Phytoseiidae) and quences for their disease-producing poten- Phytoseiulus persimilis Athias-Henriot tial. They may also serve an important (Mesostigmata: Phytoseiidae) mites; how- function in the infection process. ever, the effects of these on predatory effi- Most of the viruses associated with cacy were not established (Bjørnson et al., insects belong to one of 12 viral families, 1997). More information on entomopatho- but many remain unclassified. Of particular genic viruses can be found in Granados concern to IBCAs are viruses in the families and Federici (1986), Adams and Bonami Baculoviridae, Poxviridae, Parvoviridae, (1991a), Tanada and Kaya (1993), Miller Reoviridae and Polydnaviridae. Some of (1997), Hunter-Fujita et al. (1998) and these viruses possess restricted host ranges Miller and Ball (1998). affecting insects in a specific genus, whereas others can affect a variety of hosts Bacteria belonging to different orders. For most viruses of IBCAs, the primary route of The bacteria represent a very large and infection is through the alimentary canal diverse group of prokaryotes. There are two after ingestion. However, other routes of main types of prokaryotes, the archaeabac- infection do occur (e.g. mechanical intro- teria and the eubacteria (collectively duction of virions on infested ovipositors). referred to as bacteria). Although all bacte- In some instances, viruses are restricted to ria lack a nucleus and organelles, they are specific tissues (e.g. midgut epithelium), very diverse, both in morphology and but other viruses spread systemically, thus physiology. Some are single-celled, while affecting the entire body. As a general rule, others form filaments or aggregates. They viruses that are restricted to specific tissues may be spherical, rod-shaped, spiral or incite chronic disease, whereas systemi- lobed. Their size varies in diameter from cally transmitted viruses often cause acute 0.1 to more than 15 ␮m (filaments up to disease. Virions are typically released into 200 ␮m). Most produce a well-defined cell the environment in frass or from cadavers. wall. The archaebacteria differ from the Epizootics in natural populations are com- eubacteria in many important respects, mon and, periodically, entire colonies can such as: (i) their cell walls lack the carbo- be wiped out in mass-rearing operations. hydrate, peptidoglycan; (ii) their lipid Viruses are often intimately associated bilayer membranes consist of branched with both parasitoids and predators and chain hydrocarbons linked by ether link- their hosts and prey (Vinson, 1990). ages to glycerol; and (iii) many archaebac- Parasitoids are often implicated in the teria live in extreme environments and are transmission of the virus to the host. For very difficult to culture. Phylogenetic stud- example, an ascovirus can be transmitted ies indicate that the archaeabacteria are 148 M.S. Goettel and G.D. Inglis

close relatives of the eukaryotes. The vast Muscidifurax, Nasonia and Trichogramma, majority of bacteria associated with IBCAs and in predators such as Adalia, are eubacteria, and they can be divided Phytoseiulus, Neoseiulus and Metaseiulus into two groups based on cell wall mor- (Stouthamer et al., 1999). In a survey of phology (i.e. Gram positive or negative). pest and beneficial arthropods studied by Most eubacteria are saprotrophs, but some researchers at Agriculture and Agri-Food are facultative or obligate pathogens, and Canada, infections of Wolbachia were some form mutualistic symbioses with detected in 40 of the 65 species examined. IBCAs. A number of bacteria associated Taxa within the Acari (Tetranychidae), with arthropods are pathogenic to verte- Anoplura (Haematopinidae, Linognathidae, brates, including humans. Pediculidae) Coleoptera (Chrysomelidae, Normally, IBCAs are never devoid of Curculionidae), Diptera (Muscidae, bacteria, whether they are feral or reared in Calliphoridae), Hymenoptera (Braconidae, captivity. Saprotrophs catabolize non- Encyrtidae, Pteromalidae, Tricho- living organic matter and are common grammatidae), Mallophaga and Siphon- within the alimentary canal of IBCAs, as aptera (Pulicidae) were all infected (G. well as on their external integuments. Kyei-Poku and K. Floate, Alberta, 2004, Although they may be commensalistic, in personal communication). some instances they have been shown to be Serratia marcescens Bizio (Entero- beneficial to the arthropod, providing a bacteriales: Enterobacteraceae) is a com- degree of protection from pathogenic mon contaminant in reared insects. In microorganisms. They may also be general, it is not a very virulent pathogen, pathogens themselves (i.e. facultative), able causing disease only when insect vigour is to infect arthropods under stress. This is a greatly reduced (Sikorowski and Lawrence, common scenario in rearing settings (Inglis 1997). For example, Lighthart et al. (1988) and Sikorowski, 2005a). Other bacteria are found that a high-temperature pulse (i.e. a more specialized pathogens. The best physiological stressor) before inoculation known of insect-pathogenic bacteria is the with S. marcescens greatly increased the spore-forming Bacillus thuringiensis (Bt) susceptibility of Metaseiulus occidentalis Berliner (Baciliales: Bacillaceae). Other (Nesbitt) (Mesostigmata: Phytoseiidae) to entomopathogenic bacteria are found in the the bacterium. Greany et al. (1977) found genera Bacillus, Aeromonas, Clostridium, that optimizing Opious longicaudatus Paenibacillus, Photorhabdus, Pseudomonas, Ashmead (Hymenoptera: Braconidae) host- Rickettsia, Rickettsiella, Serratia, Wolbachia rearing conditions greatly reduced para- and Xenorhabdus. Some are opportunistic sitoid mortality attributed to bacteria, pathogens, whereas others are highly including S. marcescens. evolved pathogens. Other bacterial taxa Readers are referred to Tanada and Kaya also form symbioses with arthropods, but (1993), Charles et al. (2000), Glare and their effect is beneficial to the host and the O’Callaghan (2000) and Siegel (2000) for bacterium (i.e. a mutualistic symbiosis); in more information on entomopathogenic many situations, the presence of the bac- bacteria. terium is essential to the survival of the arthropod. Fungi Wolbachia is commonly associated with a diverse array of organisms. It is an intra- Fungi represent a diverse assemblage of cellular parasite, and it may have pro- non-phylogenetically related microorgan- found negative effects on the reproductive isms (representing at least three fitness of IBCAs, although not necessarily Kingdoms). They are grouped together on host fitness (Zchori-Fein et al., 2000). since they are all eukaryotes, they usually Among beneficials, Wolbachia is ubiqui- produce hyphae and possess rigid cell tous and it has been found in parasitoids walls, and they are all heterotrophs (i.e. such as Aphytis, Encarsia, Lysiphlebus, organisms that utilize organic matter as a Methods for Assessment of Contaminants of Invertebrate BCAs 149

source of energy). Some fungi are adapted Protozoa to existence in liquid environments and The protozoa are also a diverse assemblage produce unicellular growth forms (i.e. of non-phylogenetically related eukaryotic yeasts). Reproduction may be sexual or microorganisms. They can exist in mutual- asexual; some types of fungi produce both istic symbioses with insects. For example, types of spores, others produce either sex- the hindgut in termites houses protozoa ual or asexual spores. Fungi are primarily that hydrolyse cellulose. This is an obligate decomposers of non-living organic matter, symbiosis, and neither the protozoa nor the but some have evolved highly specialized termites can survive without each other. relationships with arthropods. Some form Protozoan pathogens of arthropods are typ- mutualistic relationships with those such ically single-celled organisms possessing as leafcutting ants or Ambrosia beetles, varied characteristics and little taxonomic which cultivate fungi as a source of food, affinity among groups (Solter and Becnel, and with polyphagous chrysopid adults, 2000). Many species are obligate pathogens which utilize yeasts to provide essential and have complicated life cycles, some nutrients. Other relationships with fungi with intermediate hosts. Most infections are benign or detrimental. Most ento- are chronic and non-lethal, but typically mopathogenic fungi are members of two result in reduced fecundity. divisions, the Zygomycota and the The phylum Apicomplexa contains the Ascomycota. Some are obligate pathogens insect-pathogenic gregarines. The most infecting specific species, some are less commonly encountered are eugregarines specialized, able to infect a variety of host with species within Gregarina, whereas species, whereas others are facultative Farinocystis, Mattesia and Ophryocystis are pathogens, only able to infect insects that neogregarines commonly producing lethal are immunocompromised. Fungal epi- infections in dipteran, coleopteran and zootics are common in some insect species, hemipteran hosts. Most neogregarines have while others are rarely affected. Fungi are narrow host ranges; however, others, such unique among the insect pathogens as their as Farinocystis tribolii Weiser and Mattesia primary route of entry into the host is via grandis McLaughlin (Neogregarinorida: the external integument. Lipotrophidae), have a relatively wide host Many beneficial invertebrates are sus- range. Many neogregarines are found as ceptible to entomopathogenic fungi contaminants in insectaries. Members of (Goettel et al., 1990; Bjørnson and Schütte, the phylum Ciliophora are usually found 2003; Vestergaard et al., 2003). For in the larval and adult stages of dipterans. instance, Neozygites spp. have been found The two most common genera are infecting Neoseiulus and Macrochelus. Lambornella and Tetrahymena. The phy- Some species, such as Beauveria bassiana lum Rhizopoda includes the amoebas such Balsamo (Vuillemin) (Hypocreales: as Malameba locustae (King and Taylor) – Clavicipitaceae), are ubiquitous and have a infecting acridids, and Malpighamoeba very wide host range, infecting many mellificae Prell (Amoebida: Amoebidae) – IBCAs. This fungus is often found infecting infecting honeybees. overwintering coccinelids. Some fungal The phylum Microsporidia have tradi- taxa may also adversely affect humans, but tionally been considered to be primitive pro- this is primarily restricted to rearing set- tozoa. However, recent evidence indicates tings in which facultative pathogens colo- that they are actually highly evolved intra- nize organic materials (e.g. insect diets) cellular fungi (Keeling and Fast, 2002). and propagules are released into the rear- Nonetheless, we discuss them here as proto- ing environment (Inglis and Sikorowski, zoa, largely because they are traditionally 2005a,b). Readers are referred to Samson et handled with this phylogenetically diverse al. (1988), Tanada and Kaya (1993) and group of microorganisms. The microsporidia Butt et al. (2001) for more information on is a large group (approximately 1000 species) entomopathogenic fungi. of obligate intracellular pathogens affecting a 150 M.S. Goettel and G.D. Inglis

variety of vertebrates and invertebrates. externally on the exoskeleton or internally Approximately 600 species have been in the reproductive, respiratory, digestive reported as infecting insects. Insects in virtu- or excretory systems, or within the haemo- ally all orders possess members in which coel, where they subsist causing very little microsporidial infections have been docu- or no apparent damage to their host. Some mented. Some species of entomopathogenic of these commensal nematodes are microsporidia possess a narrow host range phoretic, utilizing insects for dispersal. (e.g. one host species), whereas other species Other nematodes, including free-living possess a wide host range, which includes nematodes, are saprotrophs, and may uti- vertebrates. lize insect cadavers merely as a nutrient Protozoa are of concern as pathogens of source. Many nematodes are animal and IBCAs; they primarily incite sublethal, plant parasites that use the insects as vec- debilitating disease, although acute disease tors. Examples include those nematodes may occur in some instances and they are responsible for onchocerciasis, eyeworm common in mass-reared IBCAs. The most and elephantiasis in humans, and for common entomopathogenic genus is canine heartworm, while plant-parasitic Nosema, which has more than 150 nematodes vectored by insects include described species reported from at least 12 those responsible for pine wilt and red ring insect orders. For instance, N. muscidifu- disease of coconut. racis Becnel and Geden (Microsporidia: The most commonly encountered ento- Nosematidae) is prevalent in mass-reared mopathogenic nematodes are included in Muscidifurax used for fly control (Geden et three major families, the Mermithidae, al., 1995). Infected parasitoids have an Steinernematidae and Heterorhabditidae. extended developmental time, are shorter All are obligate insect pathogens and gain lived and have a much reduced fecundity. entry through the cuticle, spiracles, mouth, Microsporidians have been found in anus or via mechanical injury. many genera of beneficial insects, includ- Although steinernematid and het- ing Coccinella, Cotesia, Encarsia, and erorhabditid nematodes are generally non- Phytoseiulus (Bjørnson and Shütte, 2003), specific insect pathogens, natural Metaseiulus (Olsen and Hoy, 2002) and epizootics caused by entomopathogenic Tachinaephagus (Ferreira del Almeida et nematodes are relatively rare in nature, and al., 2002). Recently, a microsporidian was nematodes are not commonly encountered found to be responsible for the decline of in rearing settings. In addition, infections the weed biological control weevils, in field populations of beneficial insects Neochetina eichorniae Warner and N. such as predators and parasitoids are rare, bruchi Hustache (Coleoptera: Erirhinidae), even after inundative nematode applica- originally introduced from South America tions (Akhurst, 1990). and mass produced in Florida for control of water hyacinth (ARS, 2004). This microsporidian was found to decrease sur- Invertebrates vival rates of the weevils by 30%, and their reproductive capacity by 60 to 70%. The Invertebrates are almost always associated original source of this contaminant within in one way or another with other insects. the rearing facility is not known. Sweep samples from field collections are an attestation to the biodiversity of insects within ecosystems. Insects can harbour Nematodes commensals such as phoretic mites; pseu- Thirty families of nematodes within six doscorpions and the like; ectoparasites orders are associated with insects. The such as parasitic mites; and endopara- most common association between nema- sitoids such as tachinid flies, or endo- todes and insects is apparently commensal- hyperparasitoids such as braconid wasps. istic. Such nematodes can be found Insect–insect associations can be mutualis- Methods for Assessment of Contaminants of Invertebrate BCAs 151

tic, such as the classic relationship taminant, especially if it is a species that is between aphids and some ants. not the same target host species, or if it sig- Hyperparasitoids often occur in IBCAs. nificantly increases the pest population in For instance, Mesochorus curvulus the area of introduction. For example, Thompson (Hymenoptera: Ichneumonidae) whitefly puparia can accompany ship- is a hyperparasitoid of Peristenus spp. ments of Encarsia puparia. In addition, (Hymenoptera: Braconidae), a biological other incidental species could co-occur control agent of European lygus bugs, Lygus with the IBCA. For instance, a number of rugulipennis Poppius and L. pratensis soil-dwelling mites could co-occur in ship- Linnaeus (Hemiptera: Miridae) (Day, 2002); ments of the predatory soil mites, various aphidiine braconids and aphelinids Hypoaspis spp. in the genera Aphelinus, Aphidius, Ephedrus, Lysiphlebus and Trioxys are parasitized by a variety of hyperparasitoids; Abiotic contaminants many Encarsia species are facultative hyperparasitoids of other primary para- Inanimate compounds or agents that are sitoids; and convergent ladybird beetles either detrimental to the efficacy of the field-collected in California and exported as agent or to the safety of the user or environ- IBCAs may be parasitized by Dinocampus ment of introduction could conceivably spp. (Hymenoptera: Braconidae). accompany biological control agents. The IBCAs can be contaminated with species list of possible inanimate contaminants is of similar appearance or a species can be limitless. Unless intentionally introduced, shipped in error. For instance, predatory existence of contaminants that may harm mite species in the genus Amblyseius the biological agent itself are more probable (Acari: Phytoseiidae) look very much alike, than those that may harm the environment even to taxonomic specialists. European or user. Such compounds could include species of Orius are very similar to species chemically contaminated packaging mater- such as Orius insidiosus (Say) (Hemiptera: ial, inappropriate substrates that harbour the Anthocoridae), and could easily be insects, pesticide residues, etc. Inanimate shipped mistakenly to an importer who contaminants that harm the environment or might not recognize the error. Whenever user are more difficult to contemplate. any host plant material has to be shipped However, some possible contaminants in with insects, it can be difficult to find and this category could include toxic com- exclude eggs or young instars of predators pounds used to rear or decontaminate the that are small, inconspicuous and/or hid- insects from microorganisms. For example, den in leaf folds, under veins or in debris. fumigation of leafcutting bee cocoons with In shipments of aphids, such problem paraformaldehyde is carried out prior to predators have included syrphids and export, in order to decontaminate the cells cecidomyiids, in particular. of spores of Ascosphaera aggregata Skou Another problem that may occur is (Ascomycota: Ascosphaeraceae). Improper hitch-hiking facultatively polyphagous or aeration after fumigation could result in the saprophytic mites on field-collected host build-up of potentially dangerous levels material, sometimes phoretic on the target of formalin gases within the shipping insects. It can be very difficult to exclude containers, which in turn could potentially all of these from every shipment. Such be harmful to the recipient of the ship- arthropods have caused problems from ment. time to time in the quarantine cultures of olive fruit flies and artificial diets for other insects at the USDA European Biological Diagnostic and Detection Techniques Control Laboratory in Montpellier, France. Finally, the species used as a host in the The ability to detect and intercept the mass production of the IBCA can be a con- importation or transfer of contaminants 152 M.S. Goettel and G.D. Inglis

associated with IBCAs will very much and moulting insects are often erroneously depend on the diagnostic and detection suspected of being diseased. Insects sus- techniques available for the specific conta- pected of being diseased should first be minants in question. Here, we provide an examined externally, followed by dissec- overview of the techniques that are tion and macroscopic examination of the presently available for the detection of internal organs and tissues, at first with the such contaminants. naked eye, and thence with the aid of a stereomicroscope. Although this can provide valuable information on the identity Microorganisms of the pathogen, it is usually insufficient to make a conclusive identification. Detailed Many commercialized techniques have observations involving microscopic exami- been developed for quick diagnosis of cer- nation of suspect tissues are usually tain microorganisms, mostly for rapid and required. Non-destructive diagnosis can routine diagnosis for presence of pathogens sometimes be made by examination of the of human concern. They can be divided haemolymph, faecal pellets or meconium. into methods involving: microscopy; Microscopic examinations are made classical microbiology; physiological char- using light or electron microscopy. The acters; protein detection and characteriza- first procedure usually entails use of a wet- tion; and nucleic acid detection and mount, wherein the whole insect, or spe- characterization. These methods can be cific tissues, are gently crushed in a drop of applied in vitro (if a microorganism is cul- water between the microscope slide and turable) and/or in vivo. Since many of the cover slip. Some entomopathogens can be microorganisms of concern incite disease, easily observed at the light microscope diagnostic methods involved with patho- level using many of the light microscopy genesis have been developed. They are: (i) techniques available. In some instances, differential diagnosis, where signs and tissues must be prepared for histological symptoms and postmortem changes are examination using standard sectioning and compared in a systemic manner between staining techniques for light and electron different diseases to distinguish one dis- microscopy. ease from another; (ii) preliminary diagno- While nematodes, fungi, bacteria and sis, which is the first cursory examination protozoa can be observed readily at the of a diseased insect; (iii) tentative diagno- light microscopy level with phase contrast sis, which is made after general macro- without the use of stains, use of differential scopic and microscopic examination and stains can greatly enhance visualization of some cursory laboratory tests; and (iv) these, as well as other, pathogens. For more definitive diagnosis, in which a final con- information on histological techniques clusion is made, and the disease-causing used to diagnose entomopathogens, the organism is identified. Facts to be collected reader is referred to Becnel (1997) and on which to base the definitive diagnosis Evans and Shapiro (1997). The reader is include: (i) history of disease; (ii) physical referred to Lacey and Brooks (1997) for a examination; and (iii) ancillary examina- key to the major groups of ento- tion. It is also important to stress that quan- mopathogens. titative assessments (i.e. how many Molecular methods for detecting the microorganisms are present) are critical in presence of microorganisms have advanced many risk-assessment schemes. tremendously in recent years and are rou- Common symptoms of the presence of tinely being used to detect microorganisms pathogens within IBCAs include sluggish- in the agri-food, veterinary and medical ness, reduced or cessation of feeding, sciences and related industries. The two colour change and reduced fecundity. primary strategies use either immunologi- Unfortunately, many of these symptoms are cal or nucleic acid-based methodologies. also associated with the moulting process, Immunological detection of insect Methods for Assessment of Contaminants of Invertebrate BCAs 153

pathogens relies on the application of specific template (e.g. a gene). This can mono- or polyclonal antibodies to antigens then be extrapolated to numbers of of the microorganism produced in mam- pathogens (e.g. virions) present. The reader mals or birds. Methods such as enzyme- is referred to reviews of Innis et al. (1990), linked immunosorbent assay (ELISA) are Persing (1996) and Caetano-Anollés and frequently used. In ELISA, the breakdown Gresshoff (1997) for more information on of a substrate bound to the antibody by an PCR-based detection of pathogens. enzyme causes a colour change, indicating In the following sections, we briefly out- the presence of the antigen. One of the line the techniques presently available for major problems with immunological meth- detection of specific groups of microorgan- ods is poor sensitivity to low amounts of isms from invertebrates. For detailed pro- antigens. cedures, the readers are referred to Poinar Nucleic acid-based methods for micro- and Thomas (1984), Lacey (1997) and organism detection can be much more sen- Inglis and Sikorowski (2005a,b), and refer- sitive. Initially, hybridization methods, ences therein. including Northern (i.e. RNA) and Southern (i.e. DNA) blots were used to Viruses qualitatively detect insect pathogens (St Leger and Joshi, 1997, and references All viruses are obligate parasites and they therein). Another, more powerful, method are typically detected and/or quantified in that relies on hybridization is fluorescence situ or following extraction of virions from in situ hybridization (FISH). The most insect tissues. The application of molecular powerful and widely adopted method uses detection methods targeting viral proteins the polymerase chain reaction (PCR). PCR or nucleic acids is now commonplace. multiplies specific regions of nucleic acid. However, microscopic examination using Following the amplification, nucleic acid light or electron microscopy can still pro- specific to the microorganism can be vide valuable information on the aetiology detected by electrophoresis with or with- of viral diseases. Light microscopy can be out hybridization. The use of nested PCR is used to visualize occlusion bodies, but is often necessary to obtain adequate levels of limited to observing tissue abnormalities sensitivity while providing specific ampli- (e.g. hypertrophy of the midgut epithelium) fication. Although PCR can be exception- for viral diseases in which occlusion bod- ally sensitive and specific, it must be ies are not produced. More specific proto- stressed that extreme care must be taken in cols for virus diagnosis and identification developing PCR methods. The inclusion of can be found in Adams and Bonami an internal amplification control (IAC) is (1991b), Tompkins (1991), Evans and becoming mandatory for diagnostic PCR; Shapiro (1997) and Inglis and Sikorowski an IAC is a non-target nucleic acid (2005a). sequence present in the same sample reaction tube, which is coamplified simultane- Bacteria ously with the target sequence. If an IAC is not included, it is unknown whether a neg- Bacteria associated with arthropods are pri- ative response represents a true or false marily saprotrophs (including facultative negative (i.e. the reaction could be inhib- pathogens), but some are obligate parasites. ited due to malfunction of the thermal Detection and quantification of sapro- cycler, incorrect PCR mixture, poor poly- trophic bacteria is often accomplished by merase activity and/or the presence of isolation of cells using selective or non- inhibitory materials). Recently, the applica- selective media. For qualitative assess- tion of real-time quantitative PCR (RTQ- ments of bacteria, insects are typically PCR), in which the amplification process is homogenized and the homogenate plated monitored in real time, has made it is pos- on an appropriate agar medium. Individual sible to estimate the initial quantity of a colonies are then subcultured to ensure 154 M.S. Goettel and G.D. Inglis

purity. Once in pure culture, bacteria are incubated for more than several days, as typically identified based on morphologi- eventually saprotrophic fungi will over- cal (e.g. cell shape and cell wall structure), come any insect cadaver placed under physiological (e.g. assimilation of carbohy- humid conditions. However, if an ento- drates) and/or molecular (e.g. 16S rDNA mopathogen was the cause of death, it will sequence) characters. Quantitative assess- usually surface on the cadaver before ments of cell densities using microbiologi- saprotrophic fungi do. Some entomophtho- cal methods typically involve the use of ralean fungi do not readily grow in culture, the dilution spread-plate or most probable and therefore identification must be made number methods. Detection of intracellular from material obtained directly from the obligate parasites can typically be made cadaver. only by using molecular techniques. This If diagnosis is necessary prior to death, usually involves the visualization of cells the insect can be sacrificed and a wet of a particular taxon by microscopy using mount of the haemocoel can be examined in situ hybridization, or the application of for the presence of hyphal bodies (some- conventional PCR-based detection meth- times termed ‘blastospores’), which are ods. For conventional PCR, taxon-specific essentially short fragments of mycelium. primers (i.e. short segments of DNA that The appearance and size of the hyphal anneal to complementary sequences in the bodies may provide some evidence as to target nucleic acid) using universal genes the type of fungus involved; however, posi- (e.g. 16S rRNA genes), or specific to genes tive identification to the genus level is usu- unique to the taxon of interest, are used. ally not possible. For example, to detect Wolbachia infec- Many of the fungi associated with tions, primers specific to genes encoding arthropods are saprotrophic, and thus they proteins on the surface of the cell wall are can be cultured on microbiological media. used (Zhou et al., 1998; Stouthamer et al., As with the bacteria, fungi are typically 1999; Kyei-Poku et al., 2003). The use of isolated on selective or non-selective real-time quantitative PCR is becoming media. Identifications of filamentous fungi more popular in detection of bacteria in (i.e. fungi producing hyphae) are primarily situ; this method also allows for the quan- based on sporogenesis. In contrast, the tification of fastidious bacteria and obligate identification of yeasts primarily relies on parasites. physiological characters. However, molecu- More information on entomopathogenic lar methods are becoming more widely bacteria and their detection can be found used to characterize fungi. The most com- in Tanada and Kaya (1993), Klein (1997), monly used genes are the 18S and 26S Thiery and Frachon (1997), Charles et al. rRNA genes and regions between them. (2000) and Inglis and Sikorowski (2005a). Accurate quantification of filamentous fungi using microbiological media is problematic given their growth form. For exam- Fungi ple, many fungi are r-selection organisms Entomopathogenic fungi are most easily producing copious quantities of asexual diagnosed on insect cadavers. If an ento- spores. Each propagule is capable of pro- mopathogenic fungus is suspected, and no ducing a colony on an agar medium, and outward growth of mycelia is visible on the therefore microbiological quantification cadaver, placement of the cadaver in a ster- methods grossly overestimate biomass of ile humid chamber will induce outward such fungi. Some fungi associated with growth of mycelia and production of coni- arthropods (e.g. many entomophthoralean dia on the cadaver surface. The fungus can and all laboulbinalean fungi) cannot be then be isolated into pure culture by asep- cultured on agar media. Therefore, they tically transferring the conidia or hyphae to must be allowed to sporulate directly on an appropriate agar medium. Care must be the cadaver before they can be identified taken to ensure that the cadaver is not microscopically. Methods for Assessment of Contaminants of Invertebrate BCAs 155

For more information on entomopatho- microsporidia (Weiss and Vossbrinck, genic fungi and their diagnosis, readers are 1999), the most likely target for primers to referred to Poinar and Thomas (1984), detect entomopathogenic microsporidia is Samson et al. (1988), Goettel and Inglis the universal 18S rRNA gene. Primers to (1997), Humber (1997), Lacey and Brooks other genes have been used to detect (1997), Papierok and Hajek (1997), Butt et human-pathogenic taxa, and these may al. (2001) and Inglis and Sikorowski prove useful in detecting some ento- (2005a). mopathogenic microsporidia as well (Weiss and Vossbrinck, 1999). Keys to entomopathogenic protozoa and Protozoa more details on classical diagnosis of Characterization of entomopathogenic pro- infected insects can be obtained by con- tozoa is difficult and currently relies sulting Brooks (1988), Undeen and Vávra almost exclusively on microscopic charac- (1997), Becnel and Andreadis (1999), ters. However, detection of spores within Solter and Becnel (2000) and Inglis and the insect is relatively easy. It is often pos- Sikorowski (2005a). sible to make preliminary diagnoses through direct observation of the squashed Nematodes cadaver in wet mounts, where large numbers of spores are usually visible. Spores Nematodes can be easily visualized under can readily be detected in smears using magnifications of 10 to 100 ϫ under a Giemsa, Trichome or Buffalo Black stains stereomicroscope. In some cases, the nema- with bright-field microscopy, or using cal- todes can be seen within the body of the cofluor with fluorescence microscopy intact insect. The insect can be dissected to (Vavra and Chalupsky, 1982; Didier et al., liberate the nematodes, but identification 1994; Inglis and Sikorowski, 2005a). In of most species of entomopathogenic addition, there have been efforts to develop nematodes requires the adult stage. indirect antibody detection of However, the stages that are present microsporidia (Didier et al., 1994; Green et within, or emerge from, the host are usual., 2000). ally not the adult stage and must be held Development of molecular characters to under appropriate conditions until they detect entomopathogenic protozoa in situ mature. The reader is referred to Gaugler would simplify diagnostics; however, this and Kaya (1990) and Kaya and Stock (1997) area of investigation is still in its infancy. for more details and for a key to ento- Primers to detect specific human-patho- mopathogenic nematodes. genic enteric microsporidia either in water or in faecal samples have been developed (Muller et al., 2001; Dowd et al., 2003). Invertebrates However, the tremendous diversity of entomopathogenic microsporidia and the lack Most invertebrate contaminants such as of economic incentive to develop primers ectoparasitoids, commensals and inciden- have hindered the development and appli- tals are visible to the naked eye. cation of PCR-based detection methods for Consequently, close examination of the entomopathogenic taxa. One example shipment or anaesthetized biological con- where PCR has been applied for detection trol agents with the aid of a hand lens of an entomopathogenic microsporidian is would reveal the presence of such inverte- Thelohania solenopsae Knell, Allen and brates. Early stages of parasitism are very Hazard (Microsporidia: Thelohaniidae) difficult to detect and may be facilitated by infections of red imported fire ants, molecular methods. For instance, Ratcliffe Solenopsis invicta Buren (Hymenoptera: et al. (2002) used PCR to detect the pres- Formicidae) (Valles et al., 2002; Milks et ence of early-stage parasitoids in fly pupae. al., 2004). As with other taxa of On the other hand, it is possible to detect 156 M.S. Goettel and G.D. Inglis

later stages through dissection and exami- sible contamination of IBCAs by abiotic nation, by the naked eye or under magnifi- contaminants. Such contamination would cation. However, it is difficult to observe be very difficult to predict a priori. hyperparasitoids through dissection, as their larvae are inside their primary parasitoid, which is inside the primary host. Defining the Risk Posed by IBCA Another method would be to rear the Contaminants insects through a generation, as virtually all invertebrate parasites will have completed In risk assessment, risk is usually defined their life cycle and emerged as adults as ‘hazard ϫ probability’ (Zadoks, 1998). A within the lifespan of their host. For hazard is any imaginable adverse effect instance, European Peristenus species are that can be identified. Once a hazard has obtained as cocoons that have emerged been identified, it is then necessary to from parasitized, field-collected lygus assign a probability or likelihood of occur- nymphs and these are shipped to North rence. With biological entities such as America. The cocoons usually require over- microorganisms, hazards typically remain wintering in quarantine in North America imprecise. Furthermore, assigning a prob- before emerging the following spring. The ability that the hazard will occur to benefi- hyperparasitoid Mesochorus is screened out cial organisms is difficult. As a result, at emergence from the Peristenus. Recently, decisions regarding risks associated with Ashfaq et al. (2005) developed PCR primers biological organisms are rarely based which were used successfully to detect purely on scientific data. Nevertheless, rel- Mesochorus spp. within Peristenus within atively strict approval standards are cur- the lygus primary hosts. rently imposed on the application of Proper recognition and identification of microorganisms (e.g. plant protection prod- the IBCA is necessary to prevent accidental ucts) in many jurisdictions throughout the introduction of similar-appearing species. world, and guidelines for commerce in Voucher specimens can be sent to special- IBCAs are being considered for implemen- ists for taxonomic verification (see tation. Therefore, one way or another, risk Stouthamer, Chapter 11, this volume). assessments must be made. Observations on behaviour and life history attributes can also often signal the possibility that one is dealing with a contaminating Microorganisms species. Pathogens of invertebrates or plants Abiotic contaminants Many microorganisms have been developed as commercial microbial control As mentioned above, the types or nature of agents, or have been used in the classical conceivable inanimate contaminants that biological control of pest insects, with no could potentially affect the agent’s efficacy or minimal impact on biodiversity or envi- or harm the environment of introduction ronmental health (Laird et al., 1990; are virtually limitless, especially if the con- Goettel and Hajek, 2001; Goettel et al., tamination is intentional. Detection of abi- 2001; Hokkanen and Hajek, 2003). There otic agents, such as toxins and poisons, are also numerous examples of how ento- that may affect an agent’s efficacy is diffi- mopathogens can be used safely in con- cult; however, these often can be narrowed junction with IBCAs (e.g. Laird et al., 1990; down in many cases to suspected sources Hokkanen and Hajek, 2003). of contamination (e.g. fumigation at point Microorganisms pathogenic to IBCAs of arrival, etc.). It is beyond the scope of are a primary concern as far as the efficacy this chapter to cover the methods that of the IBCAs themselves is concerned. would be required to determine the pos- Disease incited by pathogens is often detri- Methods for Assessment of Contaminants of Invertebrate BCAs 157

mental to the host, resulting in reduced into four categories based on the threat longevity and death. Pathogenic micro- they represent to human and animal health organisms are divided into obligate or fac- (Health Canada, 2004). These include: (i) ultative pathogens. As a general rule, level 2 pathogens, which represent a mod- obligate invertebrate pathogens possess erate individual risk and limited commu- narrow host ranges, whereas facultative nity risk; (ii) level 3 pathogens, which pathogens infrequently incite disease in represent a high individual risk but a low vertebrate hosts. Furthermore, facultative community risk; and (iii) level 4 pathogens are ubiquitous, whereas obligate pathogens, which represent a high individ- pathogens are typically intimately associ- ual risk and a high community risk. Of the ated with their hosts. In addition to direct human pathogens, level 2 microorganisms effects on IBCAs, the possibility of trans- are most commonly found associated with mission to other invertebrates exists for invertebrates. These include representa- pathogens possessing wide host ranges. tives of bacteria, fungi, protozoa, nema- IBCAs can conceivably be contami- todes and other parasitic microorganisms. nated with plant pathogens, especially if Examples of level 2 pathogens sometimes host plant material is transported along found in association with invertebrates with the IBCA. For instance, concerns include: Aspergillus spp., Bacillus cereus have been raised regarding the possibility Frankland and Frankland (Bacillales: of Macrolophus caliginosus Wagner Bacillaceae), Clostridium spp., Crypto- (Hemiptera: Miridae) transmitting pepino coccus spp., Enterobacter spp., Lacto- mosaic virus to tomatoes (Bolckmans, bacillus spp., Micrococcus spp., 2003). Pseudomonas spp., Salmonella spp., The risk is dramatically greater if the Serratia spp., Staphylococcus aureus contaminating microorganism is exotic (i.e. Rosenbach (Bacillales: Staphylococcaceae), it does not already occur in the area of Streptococcus spp., and Yersinia spp. introduction) rather than indigenous (i.e. it Although they are capable of inciting dis- is already present in the area of introduc- ease in animals, level 2 pathogens are tion), and it is capable of establishing itself unlikely to be a serious hazard to healthy in the area of introduction. Certainly, humans, the community, livestock or the exotic pathogens as contaminants of IBCAs environment (Health Canada, 2004). In are a potential hazard, and therefore pose a healthy animals, exposure levels required higher risk and should be avoided. The dif- to incite infection are typically high. ficulty lies in assessing the probability of Furthermore, effective treatment and pre- their occurrence and of quantifying the ventive measures are available and the risk hazard they represent. The reader is of spread is limited. Therefore, the risk referred to Cook et al. (1996), Goettel and posed by level 2 pathogens associated with Hajek (2001) and Hajek et al. (2003) for fur- IBCAs is very low. For instance, some ento- ther discussions on the potential risks of mopathogenic microsporidia can infect the introduction of exotic pathogens. vertebrates (e.g. a Nosema species that infects mosquitoes also infects the cooler body parts of mice such as the tail, ears Pathogens of vertebrates and feet), but the zoonotic risk of insect- Insects reared in captivity frequently pos- pathogenic microsporidia is considered sess a bacterial microflora more typical of minimal at present. that found associated with humans. Since Most fungi associated with reared humans typically carry human-pathogenic insects originate from decomposing vegeta- bacteria within their gastro-intestinal tion. Some are human pathogens, and their tracts, respiratory organs, skin or hair, it is proliferation on organic matter (e.g. artifi- not surprising that insects reared in captiv- cial diets) and subsequent liberation of ity also carry human-pathogenic micro- large numbers of propagules can impact organisms. Human pathogens are classified negatively on the health of insectary work- 158 M.S. Goettel and G.D. Inglis

ers. Fungi such as Aspergillus, Penicillium, pathogen of grasshoppers, Entomophaga Rhizopus and a variety of yeast and yeast- praxibuli Humber, Milner and Soper like organisms can colonize insect diets (Entomophthorales: Entomophthoraceae), and may be hazardous to employees. Such in a classical biological control programme fungi may be capable of infecting humans for control of native grasshoppers in North directly, they may produce secondary America, might competitively displace or metabolites which can be toxic to humans even cause extinction of the native if they are ingested, or they can act as aller- Entomophaga grasshopper pathogens. gens. Inhalation of airborne fungal propag- However, in reality, infection levels were ules can cause allergic rhinitis or sinusitis, low and declining, suggesting that the hypersensitivity pneumonitis due to sensi- pathogen had little chance of establishing tization to fungal spores, and/or organic itself (Bidochka et al., 1996). To date, there dust syndrome caused by inhalation of is no evidence of displacement of an large quantities of toxin-containing micro- indigenous pathogen due to introduction of bial particles. Although such problems a microorganism for classical biological may be apparent in insectaries, they should control. The advent of molecular diagnostic normally not pose a problem as far as cont- techniques that enable one to track particu- aminants of IBCAs are concerned. Unless lar genotypes of a pathogen provides an contaminated diet is present with the opportunity to conduct more detailed stud- IBCA, quantities of fungal propagules car- ies on the potential of competitive dis- ried on the external exoskeletons of insects placement of native entomopathogenic or in their alimentary canal would typi- microorganisms by non-indigenous ones. cally be small. In some instances, insects that come in contact with faeces from humans or live- Invertebrates stock may be contaminated with more serious pathogens (e.g. verotoxigenic Throughout history, many invertebrates Escherichia coli (Migula) Castellani and have been either intentionally or uninten- Chalmers (Enterobacteriales: Enterobacter- tionally introduced into new ecosystems, iaceae) or Campylobacter jejuni (Jones et where they have caused detrimental effects al.) Véron and Chatelain (Campylo- or become serious pests (Pimentel, 2002). bacterales: Campylobacteraceae). Such Furthermore, most predators and para- pathogens would be more prevalent in feral sitoids have the potential to seriously affect insects, but normally this would not occur the efficacy of the IBCA in question. in reared insects. Consequently, every effort must be made to avoid the presence of unknown invertebrate contaminants in shipments of IBCAs. Competitive displacement Evidence indicates that introduction of most microorganisms into an ecosystem Abiotic contaminants (e.g. soil) has only a transient effect on the indigenous microflora (Alabouvette and As mentioned above, contamination due to Steinberg, 1998). The most common micro- abiotic elements would be very difficult to organisms associated with mass-rearing of predict a priori. Unless intentional, it is insects (see above) are ubiquitous and difficult to conceive that such contami- would not normally pose a hazard to the nants would pose a hazard beyond that of microbial flora if conveyed with the IBCA. the user or immediate vicinity of use. However, concerns have been raised regard- Details on source and treatment of the ing possible displacement of indigenous IBCAs prior to shipment would aid in the obligate insect pathogens. For instance, identification for possible presence of cont- Lockwood (1993) suggested that the intro- aminants. By and large, abiotic contami- duction of an exotic obligate fungal nants should pose a minimum risk. Methods for Assessment of Contaminants of Invertebrate BCAs 159

Guidelines for Assessing the Risk Australia (AQIS, 2004), quarantine standards for importation of living organisms Although risk cannot be scientifically are generally specific to recognized defined, standards based on the precau- pathogens, and do not encompass non- tionary principle and familiarity are typi- pathogenic contaminants. cally relied upon. However, application of In considering risk acceptance of conta- such standards may not be relevant to cont- minants in IBCAs, the following points aminants associated with IBCAs. The should be considered. amount of effort used to detect potential ● IBCAs used are diverse and their pro- contaminants should be in direct propor- duction involves substantially different tion to the risks they pose to the user, to methods. the environment and to the IBCA itself. ● Microbial contaminants associated with A number of recommendations regard- insects are diverse and, in many ing risk assessment of microorganisms instances, their biology is poorly under- were agreed upon by participants of the stood. ‘Microbiological Plant Protection Products ● The risk of introduction of an obligate Workshop on the Scientific Basis for Risk pathogen of an IBCA is higher if the Assessment’, held in Stockholm, Sweden IBCA is field-collected than if it was (Anon, 1998). One of the six points agreed laboratory-reared. upon is directly relevant to contaminants ● There are currently no quality control of IBCAs. Within the production control (QC) standards for contaminants associ- heading, it was indicated that the ‘level of ated with IBCAs. acceptable contaminants should be judged ● Given the diversity of contaminants from a “risk acceptance” point of view’. encountered, logistics of testing are dif- The goal is to define ‘risk acceptance’ with ficult. respect to contaminants associated with ● Where testing of IBCA for contaminants IBCAs. is applied, the methods and comprehen- Guidelines for regulation of IBCAs must siveness of testing vary tremendously. be addressed and implemented relative to ● Contaminants associated with the IBCA the commerce of other commodities, typically occur in relatively small num- including invertebrates. For instance, cur- bers. rently there are no regulations for the ● Epizootics of disease in an insect popu- importation of many invertebrates such as lation are dependent on more than all species of aquatic snails, leeches, scor- simply dose. pions, spiders, the German cockroach, the ● There is global commerce in plants and Russian cockroach and Drosophila animals, yet for the most part, no or melanogaster Meigen (Diptera: minimal standards exist for contami- Drosophilidae) into many countries such nants associated with these entities. as Canada. As far as amphibians and rep- ● There is global movement of people tiles are concerned, the present Canadian with no standards applied as far as Food Inspection Agency (CFIA) policy human pathogens or commensal micro- reads ‘Please be advised that amphibians organisms are concerned. and reptiles (excluding turtles and tor- toises) are no longer regulated under the Health of Animals Regulations and as a result, no CFIA import permit is required, Recommendations nor a health certificate and no inspection will normally be done at the border. We consider that routine contamination Imports are permitted from any country, by incidental or commensal micro- for any use, to any destination in Canada’ organisms is to be expected and no addi- (CFIA, 2004). Even in countries with very tional precautions are needed. Although strict quarantine standards, such as such organisms may not necessarily be 160 M.S. Goettel and G.D. Inglis

‘wanted’, they are inevitable and in most exporters must be very vigilant regarding instances should pose a minimal risk. contaminants that affect efficacy of their Such organisms would normally not be product. Furthermore, many mass- very different to those that are found in produced IBCAs destined for export are numerous commodities that are exported relatively cosmopolitan species for use in large quantities around the world. In against cosmopolitan pests. Therefore we addition, abiotic contaminants should consider that minimal risk is posed by also be of minimal risk and should not contaminants of mass-produced IBCAs normally warrant special consideration. that are established in the area of use and Exceptions would be in situations where are to be used inundatively. It is expected there is fear of deliberate sabotage (e.g. that there is minimum concern regarding bioterrorism). contaminants if the IBCAs come from a The contaminants which warrant con- well-established and reputable rearing sideration are biotic agents that pose a source. However, we recommend that the threat to the IBCAs themselves, or to the principles established for importation of ecosystem of introduction. We consider most commodities such as many food- two factors that could affect the risk posed stuffs, plants, vegetables, fruits, etc. be by a contaminant in an IBCA that could be adopted for reared IBCAs (i.e. mandatory used when assessing risk. These are: (i) documentation of the QC status of IBCAs whether the IBCA is field-collected or with regard to contaminants). This would insectary-reared; and (ii) whether the eliminate the need to scrutinize every insect is exotic, being introduced primar- shipment. With respect to contaminants ily for classical biological control or is and risk, the key factors to consider are: indigenous and used primarily for (i) correct identity of the IBCAs; (ii) QC inundative biological control. Risk of data on natural enemies of the IBCAs (e.g. presence of pathogens within commer- pathogenic microorganisms and para- cially produced IBCAs should presumably sitoids); and (iii) information on the rear- be low, as good QC and pathogen manage- ing systems used (e.g. source of insects, ment should be an integral part of mass quarantine status, rearing systems, etc.), rearing (Inglis and Sikorowski, 2005a). In which would be important in gleaning contrast, use of feral insects provides an information on the potential for contami- increased risk, as it is difficult to predict nation (e.g. plant material used to rear or detect the presence of pathogens or IBCAs that may be potentially contami- parasitoids in feral populations. nated by phytopathogens). Although no recognized standards Field-collected IBCAs, in contrast to exist to date, there are attempts to adopt insectary-reared IBCAs where appropriate international QC standards for mass- QC standards have been applied, have a produced IBCAs (van Lenteren, 2003). much higher potential for harbouring Adoption of such QC standards will facil- unknown parasitoids, pathogens or other itate the detection of contaminants asso- contaminants. There is also a much ciated with mass-reared IBCAs that may greater potential that these may include have a detrimental impact on their effi- misidentified contaminants (i.e. similar- cacy, especially if sound detection appearing species). Certainly, every effort methodologies for microorganisms are must be made to prevent introduction of applied (Inglis and Sikorowski, 2005a,b). contaminants that could affect the IBCA As part of QC, natural enemies of the itself, or that could become established IBCAs should be routinely screened for in and become a pest per se. Consequently, commercial rearing insectaries. The unless already well established in the area impacts on success of the IBCA, and of introduction, field-collected IBCAs therefore of customer satisfaction, are warrant much stricter scrutiny for conta- such that the IBCA producers and minants. It is standard practice in many Methods for Assessment of Contaminants of Invertebrate BCAs 161

countries that such agents be held in an commodity final destination, and, if war- approved containment or quarantine facil- ranted, ensure that such harm does not ity (e.g. ARS, 1991) prior to release, and take place. The extent to which measures we recommend that this practice be for prevention of transfer of contaminants adopted for most field-collected IBCAs are implemented must be weighed in being introduced for the first time to an relation to the present transfer of eco-region. Ideally, such insects should be unknown or unwanted substances by kept for at least one generation under other means. For example, presently there quarantine. This would allow detection are no regulations for the importation of and elimination of any parasitoids and/or many invertebrates. Consequently, one pathogens that may have been included must compare the possibility of introduc- with the imported insects. For insects that tion of contaminants via IBCAs with can not be reared or for which there are other methods (i.e. transportation of limited numbers, representative samples people, forestry and agricultural prod- plus suspect individuals can be sacrificed ucts, etc.). for a contaminant (i.e. pathogen) check Certainly, regulations regarding importa- (see Inglis and Sikorowski, 2005a for the tion of invertebrates to be used in biologi- strategies used to detect and eliminate cal control must not be more stringent than entomopathogens from insectary-reared those for other organisms, as far as most IBCAs). The numbers used would depend contaminants are concerned. Exceptions upon their relative risk of harbouring may be those substances, more specifically pathogens or parasites. Such information microbial and other living organisms that may be obtained from monitoring the par- may be detrimental to the environment of ent feral populations. Strict QC and moni- introduction, especially those that could toring of viability will facilitate the become established. elimination of entomopathogens. We have identified two major points However, the detection of ento- that need to be considered in assessing mopathogens inciting disease in IBCAs as potential risk: (i) whether IBCAs are field- part of QC protocol is often overlooked. collected or mass-reared in an insectary; Furthermore, the detection and assess- and (ii) whether they are indigenous and ment of the risk represented by a contami- destined for use primarily in inundative nant requires considerable expertise. We biological control, or whether they are recommend that insect-rearing personnel exotic and destined for use primarily in obtain the appropriate training in the classical biological control. As a mini- methodologies used for diagnosis, and to mum, it is evident that QC procedures for assess the potential risk posed by contam- commercialized IBCAs should include inates, or alternatively, to obtain assistance from specialists. This is not only monitoring for entomopathogens. Field- essential in QC of IBCAs to be used in bio- collected IBCAs destined for use in classi- logical control programmes, but is a pre- cal biological control warrant a higher requisite for applying strategies within degree of scrutiny. rearing settings for management of entomopathogens and disease. Acknowledgements

Conclusions We wish to thank the following for their help in providing information and sugges- The key to regulation of IBCAs is to tions in completing this chapter: James address the extent of the possibility that a Becnel, Dave Gillespie, Kim Hoelmer, Jeff contaminant could pose a hazard to the Littleﬁeld, Charles Pickett and Charles commodity, or to the environment of the Vossbrink. 162 M.S. Goettel and G.D. Inglis

References

Adams, J.R. and Bonami, J.R. (1991a) Atlas of Invertebrate Viruses. CRC Press, Boca Raton, Florida. Adams, J.R. and Bonami, J.R. (1991b) Preparation of invertebrate viruses and tissue for examination. In: Adams, J.R. and Bonami, J.R. (eds) Atlas of Invertebrate Viruses. CRC Press, Boca Raton, Florida, pp. 9–30. Akhurst, R.J. (1990) Safety to non-target invertebrates of nematodes of economically important pests. In: Laird, M., Lacey, L.A. and Davidson, E.W. (eds), Safety of Microbial Insecticides. CRC Press, Boca Raton, Florida, pp. 233–240. Alabouvette, C. and Steinberg, C. (1998) Fate of microorganisms introduced into soil, effects on autochthonous communities and activities. In: Alabouvette, C., Möllby, R., Steffen, M. and Zadoks, J.C. (eds) Proceedings Microbial Plant Protection Products – Workshop on the Scientific Basis for Risk Assessment. KEM, Stockholm, Sweden, pp. 57–64. Anon (1998) Agreed Document. In: Alabouvette, C., Möllby, R., Steffen, M. and Zadoks, J.C. (eds) Proceedings Microbial Plant Protection Products – Workshop on the Scientific Basis for Risk Assessment. KEM, Stockholm, Sweden, pp. 65–68. AQIS (2004) Australian Quarantine Inspection Service, http://www.aqis.gov.au (accessed 26 May 2005). ARS (1991) Biological Control Quarantine: Needs and Procedures. Publication ARS-99, USDA, Beltsville, Maryland. ARS (2004) Study reveals cause of disease in beneficial insects. Agricultural Research, April 2004, http://www.ars.usda.gov/lis/AR/archive/apr04/insect0404.htm (accessed 26 May 2005) Ashfaq, M., Erlandson, M. and Braun, L. (2005) Hyperparasitism by Mesochorus spp. (Hymenoptera: Ichneumonidae) in Peristenus sp. (Hymenoptera: Braconidae) and development of PCR primers for hyperparasitoid detection. Biological Control 32, 371–377. Becnel, J.J. (1997) Complementary techniques: preparations of entomopathogens and diseased specimens for more detailed study using microscopy. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 338–353. Becnel, J.J. and Andreadis, T.G. (1999) Microsporidia in insects. In: Wittner, M. (ed.) The Microsporidia and Microsporidiosis. American Society for Microbiology, Washington DC, pp. 447–501. Bidochka, M.J., Walsh, S.R.A., Ramos, M.E., St Leger, R.J., Silver, J.C. and Roberts, D.W. (1996) Fate of biological control introductions: monitoring an Australian fungal pathogen of grasshoppers in North America. Proceedings of the National Academy of Sciences USA 93, 918–921. Bjørnson, S. and Schütte, C. (2003) Pathogens of mass-produced natural enemies and pollinators. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Control Agents. CABI Publishing, Wallingford, UK, pp. 133–165. Bjørnson, S., Steiner, M.Y. and Keddie, B.A. (1997) Birefringent crystals and abdominal discoloration in the predatory mite Phytoseiulus persimilis (Acari: Phytoseiidae). Journal of Invertebrate Pathology 69, 85–91. Bolckmans, K.J.F. (2003) State of affairs and future directions of product quality assurance in Europe. In: van Lenteren, J.C. (ed.) Quality Control and Production of Biological Agents. CABI Publishing, Wallingford, UK, pp. 215–224. Brooks, W.M. (1988) Entomogenous protozoa. In: Ignoffo, C.M. and Mandava, N.B. (eds) Handbook of Natural Pesticides, Vol V, Microbial Pesticides, Part A. CRC Press, Boca Raton, Florida, pp. 1–149. Butt, T.M., Jackson, C.W. and Magan, N. (2001) Fungi as Biocontrol Agents. CABI Publishing, Wallingford, UK. Caetano-Anollés, G. and Gresshoff, P.M. (1997) DNA Markers: Protocols, Applications, and Overviews. Wiley and Sons, New York. CFIA (2004) Pet Imports Canadian Food Inspection Agency, Animal Products, Animal Health and Production Division, http://www.inspection.gc.ca/english/anima/heasan/import/petse.shtml (accessed 26 May 2005). Charles, J.-F., Delécluse, A. and Nielsen-LeRoux, C. (2000) Entomopathogenic Bacteria: From Laboratory to Field Application. Kluwer Academic Publishers, Dordrecht, The Netherlands. Cook, R.J., Bruckart, W.L., Coulson, J.R., Goettel, M.S., Humber, R.A., Lumsden, R.D., Maddox, J.V., McManus, M.L., Moore, L., Meyer, S.F., Quimby, P.C., Stack, J.P. and Vaughn, J.L. (1996) Safety of microorganisms intended for pest and plant disease control: A framework for scientific evaluation. Biological Control 7, 333–351. Methods for Assessment of Contaminants of Invertebrate BCAs 163

Day, W.H. (2002) Biology, host preference, and abundance of Mesochorus curvulus (Hymenoptera: Ichneumonidae), a hyperparasite of Peristenus spp. (Hymenoptera: Braconidae) parasitizing plant bugs (Miridae: Hemiptera) in alfalfa-grass forage crops. Annals of the Entomological Society of America 95, 218–222. Didier, E.S., Orenstein, J.M., Aldras, A., Bertucci, D., Rogers, L.B. and Janney, F.A. (1994) Comparison of three staining methods for detecting microsporidia in fluids. Journal of Clinical Microbiology 33, 3138–3145. Dowd, S.E., John, D., Eliopolus, J., Gerba, C.P., Naranjo, J., Klein, R., Lopez, B., de Mejia, M., Mendoza, C.E. and Pepper, I.L. (2003) Confirmed detection of Cyclospora cayetanesis, Encephalitozoon intestinalis, and Cryptosporidium parvum in water used for drinking. Journal of Water Health 1, 117–123. Evans, H. and Shapiro, M. (1997) Viruses. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 18–53. Ferreira de Almeida, M.A., Gedfen, C.J., Boohene, C.K., Becnel, J.J. and Pires do Prado, A. (2002) Microsporidosis of Tachinaephagus zealandicus Ashmead (Hymenoptera: Encyrtidae) Memorias do Instituto Oswaldo Cruz, Rio de Janeiro 97, 527–530. Gaugler, R. and Kaya, H.K. (1990) Entomopathogenic Nematodes in Biological Control. CRC Press, Boca Raton, Florida. Geden, C.J., Long, S.J., Rutz, D.A. and Becnel, J.J. (1995) Nosema disease of the parasitoid Muscidifurax raptor (Hymenoptera: Pteromalidae): prevalence, patterns of transmission, management, and impact. Biological Control 5, 607–614. Glare, T.R. and O’Callaghan, M. (2000) Bacillus thuringiensis: Biology, Ecology and Safety. John Wiley and Sons, Chichester, UK. Goettel, M.S. and Hajek, A.E. (2001) Evaluation of non-target effects of pathogens used for management of arthropods. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 81–97. Goettel, M.S. and Inglis, G.D. (1997) Fungi: Hyphomycetes. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 213–249. Goettel, M.S., Poprawski, T.J., Vandenberg, J.D., Li, Z. and Roberts, D.W. (1990) Safety to nontarget invertebrates of fungal biocontrol agents. In: Laird, M., Lacey, L.A. and Davidson, E.W. (eds) Safety of Microbial Insecticides. CRC Press, Boca Raton, Florida, pp. 209–232. Goettel, M.S., Hajek, A.E., Siegel, J.P. and Evans, H.C. (2001) Safety of fungal biocontrol agents. In: Butt, T., Jackson, C. and Magan, N. (eds) Fungal Biocontrol Agents – Progress, Problems and Potential. CABI Publishing, Wallingford, UK, pp. 347–375. Granados, R.R. and Federici, B.A. (1986) The Biology of Baculoviruses. CRC Press, Boca Raton, Florida. Greany, P.D., Allen, G.E., Webb, J.C., Sharp, J.L. and Chambers, D.L. (1977) Stress-induced septicemia as an impediment to laboratory rearing of the fruit fly parasitoid Biosteres (Opius) longicaudatus (Hymenoptera: Braconidae) and the Caribbean fruit fly Anastrepha suspensa (Diptera: Tephritidae). Journal of Invertebrate Pathology 29, 153–161. Green, L.C., LeBlanc, P.J. and Didier, E.S. (2000) Discrimination between viable and dead Encephalitozoon cuniculi (microsporidian) spores by dual staining with Sytox Green and Calcofluor White M2R. Journal of Clinical Microbiology 28, 3811–3814. Hajek, A.E., Delalibera, I. Jr. and Butler, L. (2003) Entomopathogenic fungi as classical biological control agents. In: Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 15–34. Hamm, J.J., Nordlund, D.A. and Marti, O.G. (1985) Effects of a nonoccluded virus of Spodoptera frugiperda (Lepidoptera: Noctuidae) on the development of a parasitoid, Cotesia marginiventris (Hymenoptera: Braconidae). Environmental Entomology 14, 258–261. Health Canada (2004) Laboratory Biosafety Guidelines. Publication No. 4252. Minister of Public Works and Government Services, Ottawa, Ontario, Canada. Hokkanen, H.M.T. and Hajek, A.E. (2003) Environmental Impacts of Microbial Insecticides. Kluwer Academic Publishers, Dordrecht, The Netherlands. Humber, R.A. (1997) Fungi: identification. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 154–185. Hunter-Fujita, F.R., Entwistle, P.F., Evans, H.F. and Crook, N.E. (1998) Insect Viruses and Pest Management. John Wiley and Sons, Chichester, UK. 164 M.S. Goettel and G.D. Inglis

Inglis, G.D. and Sikorowski, P.P. (2005a) Entomopathogens and their impact on insect rearing. In: Schneider, J.C. (ed.) Principles and Procedures for Rearing Quality Insects. Mississippi State University, Massachusetts (in press). Inglis, G.D. and Sikorowski, P.P. (2005b) Microbial contaminants and their impact on insect rearing. In: Schneider, J.C. (ed.) Principles and Procedures for Rearing Quality Insects. Mississippi State University, Massachusetts (in press). Innis, M.A., Gelfand, D.H., Sninski, J.J. and White, T.J. (1990) PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, California. Kaya, H.K. and Stock, S.P. (1997) Techniques in insect nematology. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 281–324. Keeling, P.J. and Fast, N.M. (2002) Microsporidia: biology and evolution of highly reduced intracellular parasites. Annual Review of Microbiology 56, 93–116. Klein, M.G. (1997) Bacteria of soil-inhabiting insects. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 101–116. Kyei-Poku, G., Benkel, B., Goettel, M.S. and Floate, K. (2003) Elimination of Wolbachia from Urolepis rufipes (Ashmead) (Hymenoptera: Pteromalidae) with heat and antibiotic treatments: implications for host reproduction. Biocontrol Science and Technology 13, 341–354. Lacey, L.A. (1997) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California. Lacey, L.A. and Brooks, W.M. (1997) Initial handling and diagnosis of diseased insects. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 1–15. Laird, M., Lacey, L.A. and Davidson, E.W. (1990) Safety of Microbial Insecticides. CRC Press, Boca Raton, Florida. Lighthart, B., Sewall, D. and Thomas, D.R. (1988) Effect of several stress factors on the susceptibility of the predatory mite, Metaseiulus occidentalis (Acari: Phytoseiidae), to the weak bacterial pathogen Serratia marcescens. Journal of Invertebrate Pathology 52, 33–42. Lockwood, J.A. (1993) Environmental issues involved in biological control of rangeland grasshoppers (Orthoptera: Acrididae) with exotic agents. Environmental Entomology 22, 503–518. Martignoni, M.E. and Iwai, P.J. (1986) A Catalogue of Viral Disease of Insects, Mites, and Ticks. US Department of Agriculture, Forest Service, Pacific Northwest Research Station, General Technical Report PNW-195. Merriam-Webster Medical Dictionary (2003) http://www.intelihealth.com/IH/ihtIH/WSIHW000/ 9276/9276.html (accessed 26 May 2005). Milks, M.L., Sokolova, Y.Y., Isakova, I.A., Fuxa, J.R., Mitchell, F., Snowden, K.F. and Vinson, S.B. (2004) Comparative effectiveness of light-microscope techniques and PCR in detecting Thelohania solenopsae (Microsporidia) infections in red imported fire ants (Solenopsis invicta). Journal of Eukaryote Microbiology 51, 187–191. Miller, L.K. (1997) The Baculoviruses. Plenum Press, New York. Miller, L.K. and Ball, L.A. (1998) The Insect Viruses. Plenum Press, New York. Muller, A., Bialek, R., Kamper, A., Fatkenheuer, G., Salzberger, B. and Franzen, C. (2001) Detection of Microsporidia in travelers with diarrhea. Journal of Clinical Microbiology 39, 1630–1632. Olsen, L.E. and Hoy, M.A. (2002) Heat curing Metaseiulus occidentalis (Nesbitt) (Acari: Phytoseiidae) of a fitness-reducing microsporidium. Journal of Invertebrate Pathology 79, 173–178. Papierok, B. and Hajek, A.E. (1997) Fungi: Entomophthorales. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 187–212. Persing, D.H. (1996) PCR Protocols for Emerging Infectious Diseases. ASM Press, Washington DC. Pimentel, D. (2002) Biological Invasions. CRC Press, Boca Raton, Florida. Poinar, G.O. Jr. and Thomas, G.M. (1984) Laboratory Guide to Insect Pathogens and Parasites. Plenum Press, New York. Ratcliffe, S.T., Robertson, H.M., Jones, C.J., Bollero, G.A. and Weinzieri, R.A. (2002) Assessment of parasitism of house fly and stable fly (Diptera: Muscidae) pupae by pteromalid (Hymenoptera: Pteromalidae) parasitoids using polymerase chain reaction assay. Journal of Medical Entomology 39, 52–60. Samson, R.A., Evans, H.C. and Latgé, J-.P. (1988) Atlas of Entomopathogenic Fungi. Springer-Verlag, Berlin, Germany. Siegel, J.P. (2000) Bacteria. In: Lacey, L.A. (ed.) Field Manual of Techniques in Invertebrate Pathology. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 209–230. Methods for Assessment of Contaminants of Invertebrate BCAs 165

Sikorowski, P.P. and Lawrence, A.M. (1997) Major Diseases of Heliothis virescens and Helicoverpa zea in Mississippi Field and Insectaries. Mississippi Agriculture and Forestry Experiment Station Technical Bulletin 218. Solter, L.F. and Becnel, J.J. (2000) Entomopathogenic Microsporida. In: Lacey, L.A. (ed.) Field Manual of Techniques in Invertebrate Pathology. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 231–254. St Leger, R.J. and Joshi, L. (1997) The application of molecular techniques to insect pathology with emphasis on entomopathogenic fungi. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 367–394. Stouthamer, R., Breeuwer, J.A. and Hurst, G.D. (1999) Wolbachia pipientis: microbial manipulator of arthropod reproduction. Annual Review of Microbiology 53, 71–102. Tanada, Y. and Kaya, H.K. (1993) Insect Pathology. Academic Press, London. Thiery, I. and Frachon, E. (1997) Identification, isolation, culture and preservation of entomopathogenic bacteria. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 55–77. Tompkins, G.J. (1991) Purification of invertebrate viruses. In: Adams, J.R. and Bonami, J.R. (eds) Atlas of Invertebrate Viruses. CRC Press, Boca Raton, Florida, pp. 31–40. Undeen, A.H. and Vávra, J. (1997) Research methods for entomopathogenic protozoa. In: Lacey, L.A. (ed.) Manual of Techniques in Insect Pathology. Academic Press, San Diego, California, pp. 117–151. Valles, S.M., Oi, D.H. and Williams, D.F. (2002) Detection of Thelohania solenopsae (Microsporidia: Thelohaniidae) in Solenopsis invicta (Hymenoptera: Formicidae) by multiplex PCR. Journal of Invertebrate Pathology 81, 196–201. van Lenteren, J.C. (2003) Quality Control and Production of Biological Control Agents. CABI Publishing, Wallingford, UK. Vavra, J. and Chalupsky, J. (1982) Fluorescence staining of microsporidian spores with the brightener ‘Calcofluor White M2R’. Journal of Protozoology 29, 530. Vestergaard, S., Cherry, A., Keller, S. and Goettel, M. (2003) Hyphomycete fungi as microbial control agents. In: Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 35–62. Vinson, S.B. (1990) Potential impact of microbial insecticides on beneficial arthropods in the terrestrial environment. In: Laird, M., Lacey, L.A. and Davidson, E.W. (eds) Safety of Microbial Insecticides. CRC Press, Boca Raton, Florida, pp. 43–64. Weiss, L.M. and Vossbrink, C.R. (1999) Molecular biology, molecular phylogeny, and molecular diagnostic approaches to the microsporidia. In: Wittner, M. and Weiss, L.M. (ed.) The Microsporidia and Microsporidiosis. ASM Press, Washington DC. Zadoks, J.C. (1998) Risk analysis of beneficial micro-organisms – wild types and genetically modified. In: Alabouvette, C., Möllby, R., Steffen, M. and Zadoks, J.C. (eds) Proceedings Microbial Plant Protection Products – Workshop on the Scientific Basis for Risk assessment. KEM, Stockholm, Sweden, pp. 9–38. Zchori-Fein, E., Gottlieb, Y. and Coll, M. (2000) Wolbachia density and host fitness components in Muscidifurax uniraptor (Hymenoptera: Pteromalidae). Journal of Invertebrate Pathology 75, 267–272. Zhou, W., Rousset, F. and O’Neil, S. (1998) Phylogeny and PCR-based classification of Wolbachia strains using wsp gene sequences. Proceedings of the Royal Society of London, Series B 265, 509–515. 10 Post-release Evaluation of Non-target Effects of Biological Control Agents

Barbara I.P. Barratt,1 Bernd Blossey2 and Heikki M.T. Hokkanen3 1AgResearch Invermay, Private Bag 50034, Mosgiel, New Zealand (email: [email protected]; fax number: +64-3-489-3739); 2Department of Natural Resources, Fernow Hall, Cornell University, Ithaca, New York 14853, USA (email: [email protected]; fax number: +1-607-255-0349); 3Department of Applied Zoology, University of Helsinki, PO Box 27, 00014 Helsinki, Finland (email: heikki.hokkanen@helsinki.ﬁ; fax number: +358-9191-58463)

Abstract

In this chapter, post-release evaluation of non-target impacts of introduced biological control agents is discussed, with emphasis on parasitoids used for biological control, but examples are also given for insect pathogens and herbivores for weed biological control where they provide illustrative examples and useful comparisons. The scope of non- target effects of biological control agents is discussed in relation to: direct effects on native non-target species; direct effects on beneficial or valued exotic species; direct effects on non-target pest species; competition with, or displacement of other natural enemies; and indirect effects on the same or other trophic levels. Three case studies from recent and on-going research on post-release impacts are presented. These include first, a classical biological control release of the braconid, Microctonus aethiopoides, introduced to control a pest weevil in New Zealand. Secondly, examples of inundative application of entomopathogenic nematodes are given which highlight aspects of non-target effects on insect populations in the field, competition between endemic and exotic species at the application site, and post-application persistence or dispersal. The third case study describes indirect effects of biological control of spotted knapweed in North America. Finally, a summary of possible approaches to post-release monitoring and impact assessment of a biological control release is presented.

Introduction that have been or could be used to measure non-target impacts. While regulators have a Other chapters have been directed mainly keen interest in this area because it will at pre-release methods and risk assessment enable them to validate their own pre- for arthropod biological control agents. In release predictions and inform future deci- this chapter, however, we have changed the sions, they are often not able to fund this emphasis to post-release impacts of biolog- research, or require that post-release moni- ical control agents, particularly methods toring be carried out. Exceptions to this can ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 166 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Post-release Evaluation of Non-target Effects of BCAs 167

occur in New Zealand where the regulatory that the impact on a non-target species agency, the Environmental Risk would be greater if, in addition to sustain- Management Authority (ERMA New ing a higher attack rate, it had a lower Zealand), can, under some circumstances, intrinsic rate of increase than the target, so approve a biological control release on con- clearly attack rates alone do not adequately dition that post-release monitoring on non- describe risk to non-target species. target impacts is carried out. Also the The European Union funded a four-year USDA ARS policy commits researchers to project on ‘Evaluating environmental risks monitoring non-target effects of introduced of biological control’, which aimed to biological control agents (Delfosse, 2000; review current and past practices as well as Van Driesche, 2004). However, the actual to develop guidelines for improved biologi- implementation and extent of monitoring cal control practices in the future. A litera- vary considerably among programmes. ture review for biological control of insects Concerns over potential non-target showed that data on post-release impacts impacts of introduced biological control were reported for less than 2% (of over agents have been expressed since the early 5000) of classical biological control intro- implementation of control programmes ductions (Lynch et al., 2001). Extrapolating (Perkins, 1897), but particularly so in from their data, they estimated that just recent years (e.g. Howarth, 1983; under 10% of instances of non-target attack Lockwood, 1993; Simberloff and Stiling, may have led to population impacts, and 1996). However, study of such effects has hence over 600 non-target insect species received very little attention from biologi- may have been affected at the population cal control researchers or ecologists; level throughout the history of biological indeed, information on post-release control. The authors of the review sug- impacts on target effects is often minimal. gested that there exists major under-report- Much anecdotal evidence for dwindling ing of adverse effects of biological control numbers of particular, sometimes iconic, agent introductions. species after biological control agents have For weed biological control, the safety been introduced has been provided (Gibbs, record appears to be very high, with only 1980; Howarth, 1983; Boettner et al., 2000), two of over 300 species that have been but until recently little quantitative evi- released worldwide affecting non-target dence was available to substantiate these species at the population level (see below). reports. Investigations which suggest that Post-release monitoring is not routine in population decline of charismatic non- weed biological control programmes, and target species is the result of biological so under-reporting of non-target effects control releases are, in fact, sometimes the may exist; however, herbivores and their result of unrelated, but coincidental impact on plants are easier to assess than species decline (Johnson et al., 2005). effects of parasitoids, invertebrate preda- Many studies have shown that non- tors or entomopathogens. target species are attacked in the ﬁeld by In this contribution the scope of non- introduced biological control agents (par- target effects is reviewed and discussed, ticularly parasitoids), but Hopper (1998) with emphasis on parasitoids used for clas- drew attention to the fact that few studies sical, inundative and inoculative biological demonstrated that such attack had any control, but reference to insect pathogens impact on population density of a non- and herbivores for weed biological control target species. Stanley and Julien (1998) will be made where they provide illustra- pointed out that too few biological control tive examples and useful comparisons. programmes continued their efforts to the Examples of case studies from recent and point where pre-release predictions were ongoing research are provided, and ﬁnally, validated by post-release studies of biologi- suggestions for protocol development of cal control agents. Holt and Hochberg post-release studies and monitoring are (2001) concluded from theoretical studies presented. 168 B.I.P. Barratt et al.

Scope of Non-target Effects releases. These studies can provide valuable information, although often lack com- Impacts of biological control agents on parative pre-release data. Consequently, non-target species are often classified as there is no real baseline for comparison, direct, or indirect. Direct effects are those particularly for attempts at measuring exerted by the biological control agent on impacts on population density of non- species other than the target host. Non- target species or food webs. Therefore, ret- target species may include native species, rospective studies have been used mostly introduced beneficials or other pest for comparing pre-release predictions with species. Indirect effects are much more dif- realized post-release impacts (Barratt et al., ficult to classify, since they can involve 2000a), cataloguing numbers of non-target effects at the same trophic level, such as species attacked in the field by a biological natural enemy displacement by an intro- control agent (Barratt et al., 1997; Stiling duced parasitoid, or wider ecological and Simberloff, 2000; Asquith and impacts resulting from changes in food Miramontes, 2001) and quantifying the web composition and structure (Lynch and proportion of a non-target species popula- Ives, 1999; see Messing et al., Chapter 4, tion attacked by an introduced biological this volume), some of which can be control agent (Barratt et al., 2000a,b). entirely unpredictable (Polis and Strong, Louda et al. (2003) analysed characteris- 1996; Polis, 1998). For this discussion on tics of non-target effects from retrospective evaluation of non-target effects five cate- studies of herbivorous and entomophagous gories will be adopted: (parasitoids and predators) biological con- ● Direct effects on native non-target trol agents where quantitative data were species. available, and found that several patterns ● Direct effects on beneficial or valued emerged. These led the authors to make a exotic species. number of recommendations including: the ● Direct effects on other pests. avoidance of generalist or adventive biolog- ● Competition with or displacement of ical control agents; more extensive host other natural enemies. range testing; consideration of ecological ● Indirect effects on the same or other risk; prioritization of agents; and consider- trophic levels. ation of potential for genetic adaptation. Faunal surveys are another way in which non-target effects of biological con- Direct effects on native non-target trol agents have been studied. In a survey species of ichneumonids and braconids of rainforest in Hawaii, a total of 17 parasitoid Most research on non-target effects of bio- species was collected. Only two were logical control agents has been carried out deliberately introduced parasitoid species, on weed biological control agents but they represented about 45% of the total (Pemberton, 2000; Blossey et al., 2001), catch, and they were known to utilize despite the fact that only 300–400 herbi- native hosts. Of 32 biological control vores have been used for weed biological species of ichneumonids and braconids in control (Julien and Griffiths, 1998), com- Hawaii, seven have now been found to pared with over 2000 species of parasitoids have additional recorded hosts (Asquith and predators released for classical biologi- and Miramontes, 2001). cal control of insect pests (Greathead and Observations on decline of conspicuous Greathead, 1992). However, less than 50 or iconic species have prompted some exotic pathogens have been released for investigations of non-target impacts of bio- biological control (Fuxa, 1987). logical control agents. One such case in Much of the evidence on post-release New Zealand was the observation that the non-target impacts has come from retro- numbers of the native red admiral butterfly, spective investigation of biological control Bassaris gonerilla (F.), had declined since Post-release Evaluation of Non-target Effects of BCAs 169

the release of pupal parasitoids to control Direct non-target impacts of microbial white butterfly, Pieris rapae (L.) (Gibbs, insecticides using insect pathogens for bio- 1980). This led to a field study by Barron et logical control, and methods of assessing al. (2003) who found, in fact, that pupal them, have been studied and reviewed mortality of B. gonerilla from P. rapae para- extensively (e.g. Miller, 2000; Goettel and sitoids was relatively low compared with Hajek, 2001; Glare and O’Callaghan, 2003; egg parasitism by a (possibly native) sce- Hokkanen and Hajek, 2003; Lacey and lionid, Telonomus sp., and pupal mortality Merritt, 2003). To date there is no evidence by an accidentally introduced ichneu- of substantial mortality in a non-target monid, Echthromorpha intricatoria (F.). species, or other environmental impacts Similarly, the decline in numbers of the from these introductions (Goettel and native koa bug, Coleotichus blackburniae Hajek, 2001), possibly because pathogens White, in Hawaii was attributed to the used for classical introductions are typi- introduction of parasitoids for the southern cally relatively host specific, and usually green stink bug, Nezara viridula (L.). A life high numbers of inocula are required for table analysis showed that the role of these any infection. Mass applications of Bacillus parasitoids was minor in comparison with thuringiensis kurstaki in forest ecosystems a complex of egg predators, and it was also for gypsy moth control in Oregon resulted concluded that habitat loss has been a in significant decreases in the abundance major factor in koa bug decline (Johnson et (55–86%) and species richness (20–67%) of al., 2005). non-target Lepidoptera during the year of Transient effects can occur very soon application and the following year, return- after biological control agent release, ing close to normal (0–44% reductions) in resulting from high densities of the biologi- the second year post-treatment (Miller, cal control agent which have developed on 2000). Goettel and Hajek (2001) point out the target host, subsequently attacking non- that sometimes abundance and species target species, even if they are less pre- richness of non-target Lepidoptera can ferred than the target (Holt and Hochberg, increase (Sample et al., 1996), possibly due 2001; Lynch et al., 2002). The latter authors to reduced competition from the target pest, point out that in theoretical models such in this case gypsy moth. effects can be significant, even causing One of the best-studied cases concern- local extinctions of non-target populations, ing direct non-target effects of classical and recommend that monitoring pro- introductions of microbial agents is that of grammes should be in place to measure Entomophthora maimaiga Humber, transient effects before the release of the Shimazu, Soper and Hajek, a fungal biological control agent. Brief transient pathogen of Lepidoptera in the tussock effects have been reported in weed biologi- moth family (Lymantriidae) (for a review cal control programmes, when large herbi- see Hajek et al., 2003). Comprehensive vore populations build up and deplete the non-target studies in the laboratory and in target plant resource. However, the non- the field were carried out in 1997–2001, target plants attacked in this situation can involving 50 endemic lymantriid species be entirely unpredictable. For example, and related Lepidoptera. Only four non- Cactoblastis cactorum (Berg) feeding on target species were found infected, usually Opuntia species in Australia was found single individuals among the large num- attacking tomatoes and melons when host bers collected (typically 0.3–1.0% infection populations collapsed and larvae ran out of levels). However, one non-target species, food. Similarly, Galerucella calmariensis Dasychira obliquata (Grote and Robinson) L., a biological control agent of purple was on one occasion found to suffer 35.7% loosestrife (Lythrum salicaria L.), was infection, the highest non-target rate found on a number of plant species grow- observed (Hajek et al., 2003). ing in the vicinity of emerging teneral The evidence for non-target effects in over adults (Blossey et al., 2001). 1200 weed control programmes conducted 170 B.I.P. Barratt et al.

worldwide, targeting 133 plant species by For example, releases of Trichogramma egg releasing 350 species of insects and parasitoids in maize can be regionally pathogens (Julien and Griffiths, 1998), has restricted if there is evidence that there is a been reviewed extensively (McFadyen, 1998; possible threat to a refuge of rare butterflies. Pemberton, 2000; Blossey et al., 2001; Similarly, applications of the fungus Gassmann and Louda, 2001). While the exis- Beauveria bassiana (Balsamo) Vuillemin tence of hidden or unreported non-target could be avoided on flowering crops effects cannot be excluded, available data favoured by bumblebees, and in some cases, suggest that host-range tests are scientifically spray applications of entomopathogens reliable, and evidence for non-target effects is could be replaced by soil applications to extremely limited. Throughout the history of minimize non-target impacts. Ultimately, weed biological control, concerns that weed negative impacts of inoculative or inunda- biological control agents may become less tive releases of biological control agents can host specific and attack non-target species be avoided simply by discontinuing the use (Secord and Kareiva, 1996; Simberloff and of those particular agents. Stiling, 1996; Louda et al., 1997) have not materialized. However, two ‘high-profile cases’ involve non-target impacts of the seed- feeding weevil, Rhinocyllus conicus Direct effects on beneficial or valued Fröhlich, attacking native North American exotic species Cirsium species (Louda et al., 1997), and of the moth, Cactoblastis cactorum Berg, whose Parasitoids have been known to attack ben- larvae are now attacking rare native Opuntia eficial insects, including species intro- species in Florida (Simberloff and Stiling, duced themselves as biological control 1996). The currently reported adverse envi- agents, particularly for weeds. This is an ronmental impacts of these two species are unfortunate situation that does little to per- the result of the poor decision-making suade the public that biological control processes in place before 1970. Such deci- practitioners are competent. In New sions resulted in the release of R. conicus, Zealand, Microctonus aethiopoides Loan which was known not to be host-specific, introduced to control the lucerne pest and C. cactorum in the Caribbean, despite Sitona discoideus Gyllenhal, has been frequent imports of horticultural plant mater- found in the field to successfully attack R. ial from the area into southern Florida and conicus, the nodding thistle receptacle the potential for natural dispersal (Simberloff weevil (Ferguson et al., 1999; Murray et al., and Stiling, 1996; Pemberton, 2000; 2002). Despite the fact that R. conicus was Gassmann and Louda, 2001). In neither included as a test species when M. instance has pre-release study failed to pre- aethiopoides was being evaluated in quar- dict attack on non-target plants (in fact both antine in the early 1980s, it was not found species are known to have broad host to be attacked. A possible explanation for ranges), but decisions to import and release this is that quarantine tests with R. conicus were made by regulators despite the evi- were carried out in autumn, when the wee- dence. Current regulations (USDA, 1999) vils were in diapause and had become qui- incorporate measures to avoid similar mis- escent. Microtonus aethiopoides requires a takes occurring in the future (Gassmann and mobile host in order to oviposit success- Louda, 2001). fully, and so the attack upon R. conicus Inundative and inoculative forms of bio- may not have occurred in these tests. This logical control have several advantages in highlights the importance of understanding terms of non-target concerns. Several mech- the biology/phenology of the organisms anisms can be employed to minimize the concerned in the programme. possibility of unwanted consequences, Entomopathogens with a broad ability to including the timing and location of control infect insects sometimes have the potential agent releases, and the mode of application. directly to infect beneficial insects, such as Post-release Evaluation of Non-target Effects of BCAs 171

other natural enemies of pest species. An example from weed biological con- Natural infections by B. bassiana in lady- trol is the accidental introduction of the bird beetles are well known, but their inci- aquatic moth, Acentria ephemerella Dennis dence is usually low (Hokkanen et al., and Schiffermüller, in north-eastern North 2003a). Natural infections in other preda- America. This species attacks a number of tory beetles have been studied (e.g. submersed aquatic plants, but the strong Steenberg et al., 1995; Hokkanen et al., preference for Eurasian watermilfoil 2003a), but applications of fungi or nema- (Myriophyllum spicatum L.) has resulted in todes in the field have been shown not to substantial control of M. spicatum in cen- result in increased incidence of infections tral New York (Johnson and Blossey, 2002). in these non-target species (Hokkanen et Fortuitous biological control arose from al., 2003a). Interestingly, it appears that using the fungus Lecanicillium lecanii predators are more resistant to infections by (Zimmermann) Zare and Gams, which was entomopathogenic fungi than their herbivo- introduced into Seychelles to successfully rous counterparts, and that the degree of control Lecaniinae scales. This resulted in herbivory (in omnivores) may predict the gradual disappearance of the small, black susceptibility to the pathogen (Hokkanen ant, Technomyrmex albipes (Smith) a and Zeng, 2001; Hokkanen et al., 2003a). household pest, possibly as a consequence Insect parasitoids are sometimes affected by of the lower numbers of scale-insects microbial pesticides to the same extent as (Hajek et al., 2003). their hosts (Husberg and Hokkanen, 2001; There is some evidence that ento- Hokkanen et al., 2003a). Honeybees have mophagous biological control agents can been shown to be relatively safe from fun- become adapted to hosts in their new gal infections partly due to high hive tem- range; for example, the parasitoid peratures, but bumblebees may be at risk, Bathyplectes curculionis Thoms was intro- especially from B. bassiana treatments, duced to California to control the alfalfa because their hive temperature is lower weevil Hypera postica (Gyllenhal). It also (Hokkanen et al., 2003b). attacked a related pest species, Hypera brunneipennis (Boheman), and initially encapsulation rates were very high, but Direct effects on other pests (fortuitous after a number of years the parasitoid biological control) developed successfully in this host 95% of the time (Salt and van den Bosch, 1967). When a biological control agent attacks Furthermore, Berberet et al. (2003) showed another pest after release, this has been that, over a 28-year period, the effective- termed ‘fortuitous’ biological control, or a ness of encapsulation in protecting H. pos- positive non-target effect (Ehler, 2000). tica from parasitism by B. curculionis has There are examples of this in the literature, diminished. The authors considered that but few have been quantified. For example, strain or biotype variability accounted for M. aethiopoides was introduced to control some of these differences in host immuno- S. discoideus, but it also attacks suppression ability. There have been no Listronotus bonariensis (Kuschel), another reported cases of evolution of host speci- introduced weevil pest (McNeill et al., ficity in herbivorous biological control 1993); however, levels of parasitism rarely agents. reach more than 10% in the field. The encyrtid parasitoid Anagyrus indicus Shafee, Alam and Agarwal, although not a Competition with, or displacement of, deliberate introduction, has provided effec- other natural enemies tive biological control of the spherical mealybug, Nipaeococcus viridis Bennett (1993) noted that few pre-release (Newstead) on Guam and the Marianas studies have been carried out which would Islands (Nechols, 2003). enable competitive displacement of a 172 B.I.P. Barratt et al.

natural enemy by an introduced biological insect biological control programmes control agent to be verified; however, he where intra-guild predation may lead to provided several examples where there is reduced herbivore suppression strong evidence to suggest that this has (Rosenheim, 1998; Rosenheim et al., 1999). occurred. Shiga (1999) showed that the There is no published evidence for replace- parasitoid Torymus sinensis Kamijo, intro- ment of a successful control agent by an duced to control Dryocosmus kuriphilus unsuccessful agent in weed biological con- Yasumatsu (chestnut gall wasp) in Japan, trol. Instead, the success in reducing weed partially displaced a polyphagous native populations increases with the increased parasitoid, Megastigmus nipponicus number of control agents that are released Yasumatsu and Kamijo, which had become (Denoth et al., 2002). a primary parasitoid of the gall wasp, and almost eliminated the congeneric native parasitoid Torymus beneficus Yasumatsu Indirect effects on other trophic levels from chestnut groves. This interaction was further complicated by hybridization Biological control agent release can lead to between the two Torymus species, which complex and unpredictable impacts on may have repressed T. sinensis’ reproduc- ecosystems, and several authors have sug- tive capability in the early stages of estab- gested ways in which this can be lishment. approached. Simberloff and Stiling (1996) Wang and Messing (2002) gave exam- suggested that the keystone-species con- ples of competitive displacement of fruit cept might be useful in predicting environ- fly parasitoids in Hawaii, evidence which mental impacts of species used for has led to tighter regulation of biological biological control agents. Those species control for fruit fly management. Goldson which are likely to eliminate a taxon, et al. (2003) demonstrated in quarantine which in turn might make a substantial laboratory experiments that the introduc- change to the habitat, can possibly be iden- tion of a European strain of M. tified pre-release (see van Lenteren et al., aethiopoides to control Sitona lepidus Chapter 3, this volume). Alternatively, the Gyllenhal, in addition to the Moroccan future development and monitoring of strain already established in New Zealand bioindicators that are identified locally or for S. discoideus management, could lead regionally (National Research Council, to hybridization between the strains. The 2000) might allow broad-scale assessments results from the experiments showed that to be made of indirect effects of biological the efficacy of the hybrids was reduced, control, and a better understanding of the suggesting that introducing the European true ecological and economic costs and strain would potentially reduce the efficacy benefits of biological control to be realized. of both strains on their intended target Waage (2001), in introducing a sympo- hosts. This has led to a proposal to release sium on the subject of the indirect effects a parthenogenetic strain to avoid compro- of biological control agents, suggested that mising existing and future biological con- our ability to predict the outcome of bio- trol efficacy (S.L. Goldson, personal logical control programmes depended communication). Risks to non-target nat- upon experience from past programmes, ural enemies from hybridization are dis- retrospective hypothesis testing and the cussed in detail by Hopper et al. (Chapter application of sound pre-release principles 5, this volume). and biological control agent selection. In In biological control programmes where the same volume, Holt and Hochberg multiple species are introduced to control (2001) consider that fundamental prin- a single pest, competitive interactions are ciples of community assembly are essential likely to occur, raising concerns that less in evaluating indirect impacts of biological successful species may suppress more suc- control: establishment, impact and land- cessful ones. This is well established for scape context. Post-release Evaluation of Non-target Effects of BCAs 173

Lockwood (2000) argued that we should been able to provide sufficient or relevant not be trying to measure non-target effects data for environmental assessments or only on species, but also on ecological effective natural resource management processes. While he admitted that this can (Goebel, 1998). The dearth of information be extremely difficult, and subject to lags, internationally about the status of ecologi- he argued that just as pest control should cal and natural resources presents a serious be measured in terms of reduction of pest problem for any evaluation of effects asso- damage rather than by reduction in pest ciated with any human activity, including numbers, impacts of biological control the release of biological control agents. should be measured in terms, not of reduction of non-target species, but of impacts on ecological processes. Case Studies The construction of food webs may provide a better understanding of the ecology The three case studies described below of biological control, the impact that bio- provide examples of direct non-target logical control agents have on community impacts of a parasitoid used in classical and ecosystem function, and trophic rela- biological control, non-target effects of tionships (Memmott, 2000). In a study car- entomopathogenic nematodes used in ried out in a wilderness preserve in inundative biological control, and indirect Hawaii, a quantitative food web was con- post-release impacts of weed biological structed for plants, Lepidoptera and para- control. sitoids, which showed that 83% of parasitoid individuals reared from Lepidoptera were biological control agents, Case study 1: post-release impact of the and 3% were native (Henneman and parasitoid Microctonus aethiopoides Memmott, 2001). The use of stable isotopes holds additional promise for measuring The braconid M. aethiopoides was intro- how resource flows are redirected in duced into New Zealand in 1982 to control response to invasions or biological control the forage pest weevil S. discoideus. releases (e.g. McCutchan et al., 2003). Microctonus aethiopoides is a solitary, Any serious evaluation of the impacts of koinobiont endoparasitoid of the adult invasive plants or insects on native species stage of the target weevil. It was selected as and ecosystems, as well as an assessment a retrospective case study along with of how biological control programmes another braconid in the same genus, M. affect the species composition and func- hyperodae (introduced to control L. bonar- tioning of ecosystems, has to rely on long- iensis), with the objective of investigating term data on species abundance and and improving upon the value of quaran- ecosystem function at various spatial scales tine testing for predicting post-release non- (Blossey, 1999). In the USA, monitoring target effects (Barratt et al., 1997, 2000a,b, programmes associated with agriculture 2003). have an extensive history. One of the most Surveys throughout New Zealand sophisticated of these is the National showed that M. aethiopoides had become Resource Inventory (NRI), administered well established in S. discoideus popula- every five years through the Natural tions in lucerne-growing areas (Stufkens et Resource Conservation Service (NRCS). al., 1987; Ferguson et al., 1994), where it The NRI relies increasingly on remote- had been shown to suppress S. discoideus sensing techniques (Nusser and Goebel, populations (Goldson et al., 1993). 1997), but it does not collect information Microctonus aethiopoides was, however, about the presence or abundance of any released with limited host range testing in plant or animal species other than crop quarantine, which revealed no evidence of species. Therefore, the long-term monitor- attack on non-target species (M. Stufkens, ing activities of the NRI have so far not personal communication). Since its release, 174 B.I.P. Barratt et al.

M. aethiopoides has been found to be rela- lar vegetation composition. Three years tively polyphagous. In the field the wasp post-release, parasitism levels in non-target had been found to parasitize 13 New species are very low, but should this build Zealand and four exotic species of weevils up to higher levels; data from this study from five tribes and two subfamilies of will be used to test the model outlined Curculionidae (Barratt et al., 2000b; B.I.P. below. Barratt, unpublished results). The native weevil species which appeared to be most Modelling non-target impacts at risk from non-target attack by M. aethiopoides were in the subfamily A population model has been developed Entiminae. This finding has led to concern (Barlow et al., 2004) to quantify the impact in New Zealand about the impacts of bio- of M. aethiopoides on the abundance of a logical control agents on non-target species non-target host, based on the host intrinsic (e.g. Barratt et al., 2000a,b), particularly rate of increase, the average abundance of given the 90% endemism at the species the host in the presence of parasitism and level of indigenous Coleoptera found in the estimated mortality caused by the para- New Zealand (Klimaszewski and Watt, sitoid. The data were taken from the two 1997). studies outlined above. The non-target host Research aimed at evaluating post- population was modelled in the presence of release impacts of M. aethiopoides has pro- parasitism, and the impact quantified as the gressed along the following four main lines increase in equilibrium host density when of investigation. parasitism was removed from the model. In low-altitude pasture, parasitism over three years averaged 15%, and the model esti- Seasonality of parasitism in non-target mated an 8% reduction of the host. In weevil populations higher-altitude native grassland the method Regular sampling of several native weevil was applied in reverse to predict the para- populations allowed the phenology of non- sitoid’s impact if it did establish, and target species to be determined, along with reached 15% parasitism. Here, the model the seasonality of parasitism by M. predicted a 30% suppression of population aethiopoides (Barratt et al., 2000b). The density. The host’s intrinsic rate of increase, study showed that the main period of rm, estimated from both sites, accounted for reproductive activity of some native wee- this difference in predicted impact. The vils was asynchronous with periods of impact was small at the low-altitude area peak non-target parasitism (when the target where rm was high, and larger at the higher host was absent), and probably reduced the altitude site where rm was lower. non-target impact as a consequence. However, other weevil species with different phenologies were more heavily para- Spatial distribution of non-target parasitism sitized during their periods of reproductive activity. A final study, still under investigation, examines the altitudinal distribution of non-target parasitism by M. aethiopoides Introduction of Microctonus aethiopoides into from valley-floor forage systems up to new environment native grassland. Native weevil density and A release of M. aethiopoides was made in parasitism is being measured, and will be an upland area of native grassland where it analysed using the model above to estimate was thought not to be established, but impacts. where long-term data on native weevil In summary, the approaches taken to population abundance were known. Three determine post-release impacts of M. spatially separated release sites were aethiopoides have been to investigate sea- matched with three control sites with simi- sonality and phenology of non-target hosts Post-release Evaluation of Non-target Effects of BCAs 175

with parasitoid activity in the field, to Poinar and Heterorhabditis megidis Poinar, determine whether M. aethiopoides can Jackson and Klein, and were conducted by establish in native grassland environments Rethmeyer (1991), Buck and Bathon (1993) some distance from the target host habitat and Koch and Bathon (1993) over a three- and to use the data to develop a predictive year period on 100 m2 plots in different model of non-target population density habitats, to investigate non-target impacts, reduction. This work has involved consid- but with no clear target pest. The results erable resources, which will not always be have been summarized by Bathon (1996). A available for biological control agent post- total of approximately 400,000 arthropod release impact investigations, but might specimens were collected from the release facilitate future studies and suggest pos- plots, and the treatment impacts evaluated. sible approaches. Densities of a few species were reduced (although some increased) after the entomopathogenic nematode (EPN) application; Case study 2: non-target impacts of however, reductions were temporally and inundative application of spatially restricted. In general, the impact entomopathogenic nematodes on the non-target populations was negligible. Insect-killing nematodes of the genera In cases of effective target pest control Steinernema and Heterorhabditis are by EPNs, reductions in populations of spe- widely used against a variety of horticul- cific natural enemies of the pest can be tural and ornamental crop pests, as well as expected. Indeed, H.M.T. Hokkanen on turf grass and home gardens. These are (unpublished results) obtained a 94% usually inundative applications with high reduction in pollen beetle, Meligethes numbers of individuals, which decline to aeneus (F.), numbers by inundative release low population levels or die out within a of S. feltiae in oilseed rape, but observed a few weeks or months. Non-target effects of similar reduction in the numbers of the such applications have been studied inten- specific parasitoid, Phradis morionellus sively in the laboratory and in the field (Holmgren), emerging from the treated (Bathon, 1996; Ehlers and Hokkanen, 1996; plots. Reductions in the numbers of other Peters, 1996; Barbercheck and Millar, 2000; non-target insects did not occur. Ehlers, 2003), but there appears to be no Barbercheck and Millar (2000) studied single, representative case study which has the possible competition between inun- examined more than one of the critical fea- dated exotic EPNs and naturally occurring, tures at a time. The most important of these local species. They introduced the exotic studies in the context of this chapter have Steinernema riobravis Cabanillas, Poinar focussed on the reduction of non-target and Raulston from Texas on plots in North insect populations in the field, on competi- Carolina containing endemic populations of tion between endemic and exotic species at S. carpocapsae (Weiser) and H. bacterio- the application site, and on post-applica- phora. The introduction resulted in a tion persistence or dispersal, which can be reduction of insect mortality caused by the used as proxy measures for non-target endemic species when soil samples were safety (Hokkanen et al., 2003c). In order to baited with Galleria mellonella (L.). Their cover these aspects, we look briefly here at data suggest that coexistence of the three several case studies involving entomopath- nematode species in the field was possible, ogenic nematodes. and that the risk for local extinction of the native nematodes was minimal. However, the results also indicate that the exotic Direct post-application impacts species can cause a (often transient) reduc- The most comprehensive investigations tion in local EPN populations. If the exotic have involved Steinernema feltiae species does become established it will (Filipjev), Heterorhabditis bacteriophora most likely co-exist with the local species, 176 B.I.P. Barratt et al.

assisted by the typically highly aggregated 1996). For example, S. scapterisci was distribution of EPN populations. Their rela- recorded as moving 10 cm in five days after tively low mobility is likely to result in application to the soil surface (Nguyen and fragmented populations with an aggregated Smart, 1990). EPNs can, however, be spread distribution (Barbercheck and Millar, 2000), passively by other organisms, and the which will ensure that parts of the popula- potential for this should be considered tion will survive while other parts might be when investigating post-release non-target transiently eliminated by an introduction of effects. Parkman et al. (1993) recorded a exotic populations. These metapopulation mean maximum cumulative distance of dis- dynamics are of major importance for the persal of 60 m and a cumulative area occu- survival and coexistence of species pied by S. scapterisci of 4.2 ha, recorded 21 (Harrison and Taylor, 1997). months after application. The possibility of phorecy via infected hosts has been shown several times, for example by Timper et al. Persistence of EPNs (1988), who recorded that adult noctuids If an introduced biological control agent (Spodoptera exigua (Hübner)) infected with cannot persist in the new environment, its S. carpocapsae dispersed up to 11 m from non-target impacts, if any, will be transient. the site of infection. Lacey et al. (1995) Therefore, post-release monitoring of EPN demonstrated the potential of infected adult persistence at the release site can give scarabaeids (Popillia japonica (Newman)) some indication of the possibility for non- to disperse Steinernema glaseri (Steiner) by target effects. Successful establishment of flight, and in Florida, mole crickets EPNs requires optimal environmental con- (Scapteriscus spp.) infected with the exotic ditions during application and the continu- nematode S. scapterisci were collected in ous presence of susceptible hosts (Ehlers, sound traps 23 km from the nearest release 2003). Even then, the majority of the site, indicating long-distance dispersal and applied nematodes do not survive for long. area-wide establishment. Since its release, Smits (1996) recorded 70% loss of the no detrimental effects on non-target organ- applied nematode population after one isms have been recorded (Parkman and week, and 90% loss two weeks following Smart, 1996). an application on turf. The potential to per- In conclusion, numerous studies have sist can, however, differ between species. shown that since the first application of the Strong (2002) estimated that heterorhabdi- EPN S. glaseri against the white grub P. tid populations have a half-life of approxi- japonica in New Jersey (USA) (Glaser and mately one month, whereas the half-life for Farrell, 1935), no ecological problems steinernematids usually exceeds one caused by inundative applications of month. Some exotic EPN species are able nematodes are evident. Several factors con- to establish in new environments. Parkman tribute to this, including poor persistence et al. (1993) released the South American after application, low ability to disperse nematode species Steinernema scapterisci and the high density of infective juveniles Nguyen and Smart to control exotic mole necessary over a large area for an impact at crickets in Florida, and reported successful the population level. So far, only one case establishment at all sites, and persistence of a permanent impact of EPNs on the den- for over five years. The continuous pres- sity of an insect is known: the lowering of ence of potential hosts seems to be essen- mole cricket populations in Florida (artifi- tial for successful establishment. cially high population densities of exotic Gryllotalpa species), caused by the exotic nematode S. scapterisci, resembling a clas- Dispersal of EPNs sical introduction of a biological control EPNs have been considered exceptionally agent rather than a typical inundative safe, partly due to their relative immobility application, with no known non-target in the release area (Ehlers and Hokkanen, effects reported. Post-release Evaluation of Non-target Effects of BCAs 177

Case study 3: indirect effects of introduced gall fly biological control agents knapweed biological control – how subsidize native deer mouse populations. biological control agents may affect Increasing the functional complexity human health (diversity and trophic linkages) is generally considered to improve ecosystem health Centaurea maculosa Lamarck (spotted and stability (Neutel et al., 2002). It has knapweed) is a herbaceous Eurasian peren- been argued (Blossey, 2003) that the intro- nial weed now widespread in temperate duction of biological control agents, even if grasslands across North America. Dry unsuccessful in controlling the target weed, rangelands in western North America are may constitute an improvement in ecosys- particularly vulnerable to invasion by spot- tem health because of the ability of higher ted knapweed, which affects native species trophic levels to exploit a new resource, (Callaway et al., 2003) and cattle and sheep and not as a negative non-target effect. ranchers (Story, 2002). Of the many herbi- Alternatively, (Pearson et al., 2000) and vore species attacking C. maculosa in (Ortega et al., 2004) argue that subsidies Europe, 12 insect species were screened provided by Urophora gall flies, and many and released in North America (Story, other biological control agents that build 2002). Two tephritid flies, Urophora large populations but fail to control their quadrifasciata (Meigen) and Urophora affi- host, may have strongly negative effects on nis Frauenfeld, have become particularly associated arthropod communities and widespread and very abundant in knap- potential human health. Deer mice con- weed sites across North America. Larvae sume many other invertebrates and seeds; overwinter in the galled flower heads, until mouse populations with access to fly larvae they pupate and emerge in the spring; how- in the winter may build up large popula- ever, these seed-feeders are not affecting tions that may overexploit other prey items, knapweed abundance despite reducing potentially resulting in population collapse. seed output by 40% or more (Story, 2002). While the authors offer no data to support The abundance of fly larvae in spotted this hypothesis, it is clear from experiments knapweed stands has attracted secondary using a closely related species, the white- consumers, including a number of birds, footed mouse (Peromyscus leucopus), that deer, chipmunks and mice (Pearson et al., subsidized rodent populations may exert 2000). One of the most abundant species strong predation pressures on arthropods. using this newly available resource is the Experiments in oak forests in eastern North deer mouse (Peromyscus maniculatus). America revealed complicated trophic link- This omnivorous rodent has a diverse diet ages between mast fruiting events of oaks, of grains, nuts, fruits and invertebrates, but gypsy moth (Lymantria dispar), mice, deer particularly over the winter may consume and ticks, which are the main vector of several hundred Urophora larvae/day Lyme disease (Jones et al., 1998). In years (Pearson et al., 2000), constituting its major following high acorn production, mice were food item (>80%). Mouse populations are able completely to suppress gypsy moth up to threefold larger in invaded habitats outbreaks, but incidence of Lyme disease compared to sites with native vegetation, vectors was high when rodent populations and over-winter mortality of mice is greatly were high. In the case of spotted knapweed reduced in the presence of knapweed flies subsidizing deer mouse populations, (Ortega et al., 2004). However, spotted concerns are not only that rippling effects knapweed sites cannot support similarly may have negative consequences for high mouse populations during the sum- ecosystems and native taxa through direct mer mouse-breeding season when no fly mouse predation, but also that human larvae are available, because alternative health may be affected (Ortega et al., 2004). food sources provided by native species are Deer mice are the main carrier of Sin diminished by spotted knapweed invasion Nombre hantavirus, which can cause signif- (Ortega et al., 2004). But it is clear that icant human mortality (Childs et al., 1994). 178 B.I.P. Barratt et al.

The linkages between knapweed flies target host environment, requiring a differ- and increased deer mouse populations ent approach. An outline is given below for have been well established; however, possible approaches for measuring post- assessing whether this strong pairwise release impacts of biological control agents interaction results in associated arthropod using the categories of non-target effects declines or even an increase in hantavirus discussed above. incidence in human populations requires additional experimental work. The study linking oaks, moths, mice, deer and ticks Direct effects on non-target, beneficial or (Jones et al., 1998) provides an inspiring valued species example of how such work can be conducted. At a minimum it is clear that the In preparation for post-release studies, pre- complicated linkages (direct and indirect) release opportunities can be taken to in food webs are affected by introduction enhance robust post-release investigations: of biological control agents. Often such ● linkages may result in unpredictable and Population monitoring of a range of surprising effects. Awareness of the poten- potential ‘high risk’ non-target species tial for such effects, while still unpre- to give a baseline for post-release evalu- dictable in direction (negative or positive) ation. The species list can come from: or magnitude, could guide future investiga- – knowledge of host range in country tions towards the direct and indirect effects of origin; of biological control introductions. A true – quarantine host range studies in assessment of the magnitude of changes in country of proposed new release food webs as a result of biological control which indicate potential non-target introductions needs access to pre-pest hosts (see van Lenteren et al., invasion data. For example, in the knap- Chapter 3, this volume); weed fly system, knapweed invasion – literature on known non-target hosts reduced plant diversity, and most likely from releases elsewhere; seed output and associated invertebrate – knowledge of phylogenetic and eco- communities. Whether mouse populations, logical affinities of target with fauna now supported through overwintering fly in country of proposed release; larvae, are indeed higher than before knap- – known beneficial species in proposed weed invasion remains unclear. country of release; – surveys of fauna and ecosystem processes in proposed country of Recommendations for Evaluating release. Non-target Impacts See also Kuhlmann et al. (Chapter 2, this volume). Using previously published information ● Life table analysis for one or two ‘high and case studies as outlined above, a series risk’ non-target species so that post- of recommendations can be made for post- release impacts can be quantified. release studies of impacts of biological con- Candidate species can be selected from trol agents. In practical terms, a logical quarantine data where potential non- method of evaluating non-target effects is target effects have been determined. to combine this with measuring target ● Surveys of potential non-target species effects using similar methods as far as pos- in the target host environment. sible. This can be appropriate when target ● Surveys to determine if and where the and potential non-target hosts are in the target pest occurs, outside of the envi- same environment: for example, in early ronment within which it is known as a post-release studies and in cases where the pest, can indicate potential environ- biological control agent is very immobile; ments in which non-target effects could however, impacts often extend beyond the occur. Post-release Evaluation of Non-target Effects of BCAs 179

● Similarly, surveys outside of the target ● Once a biological control agent is estab- host environment can be useful for col- lished in a non-target population, life lecting information on the range and table analysis is ideal for estimating distribution of native hosts phylogeneti- impact if feasible. The dynamics here cally related to the target host. are likely to change over time and space. ● For some biological control agents, phy- In weed-control programmes, long-term logenetic ‘relatedness’ to potential non- monitoring of target and non-target pop- target species is less important than ulations is essential. Attack alone does habitat, e.g. some leaf-miner parasitoids not imply that a population level effect are able successfully to attack leaf min- will materialize, but declines or ers from a number of insect orders, but increases in plant populations should be might show specificity to the host plant recorded. of the leaf miner complex. ● Consider developing and testing a pre- ● Information on the mobility of the pro- dictive model of population impact. posed biological control agent and the ● Match pre-release predictions with post- target host is useful. Even if the biologi- release evaluation. If they match up cal control agent is relatively immobile, a poorly, ascertaining reasons for this is of host capable of wide dispersal can poten- value to practitioners and regulators for tially carry the agent to new habitats. future biological control proposals. ● If a beneficial species is attacked, it Then post-release: might be necessary to determine how ● Determine which, if any, non-target this affects the benefits for which the species (including beneficials and other species is valued. pest species where appropriate) are If non-target impact is not identified in the attacked in the field by sampling in the field: target pest habitat and beyond; determine which species and the proportion ● Maintain a low-intensity monitoring of non-target populations being programme if possible, e.g. annual sam- attacked. pling at a small number of key sites near ● Field evaluation of non-target attack such release sites, or at areas of high tar- should incorporate appropriate spatial, get impact, and presumably of high bio- temporal and seasonal scales. logical control agent activity. If a ● For predators, gut analysis methods can biological control agent is very effective be used to determine diet breadth (e.g. in reducing target populations, there Hoogendorn and Heimpel, 2003). may be a period when the agent is under ● For herbivorous control agents, long- pressure to locate suitable alternative term monitoring using standardized hosts. techniques plus regular observations. ● Development of food web models using stable isotope ratios may be helpful in Competition with or displacement of quantifying how invasions and biologi- other natural enemies cal control introductions at various trophic levels affect resource flows in ● Pre-release information on existing nat- different habitats. ural enemies (parasitoids, pathogens, predators and herbivores) of the target If non-target impact is identified in the host, and particularly on identified field: potential non-target hosts, is useful, so ● Regular sampling programme is useful that indirect effects can be ascertained for determining comparative phenology post-release. of the target host and one or more iden- ● Post-release, non-target hosts can be tified non-target species to help predict sampled over time to determine the impact. extent of displacement of natural 180 B.I.P. Barratt et al.

enemies by the newly released biologi- agents, is impossible unless such impacts cal control agent and these results com- can reliably be distinguished from natural pared with pre-release data. This can be oscillations or plant succession. Lag effects integrated with the investigations of make the detection and mitigation of direct non-target effects, above. impacts even more challenging (Parker et al., 1999; Byers and Goldwasser, 2001). See Messing et al. (Chapter 4, this volume) Laboratory and small-scale field experi- for further information. ments can not adequately replicate interactions that occur in the field. The only way to capture the full range of ecological Indirect effects on other trophic levels effects of the release of biological control and food webs agents is by observations in actual ecosystems. Specific recommendations in this area are extremely difficult, and studies need to be designed on a case-by-case basis. In gen- Conclusions eral, the ecology of the system within which non-target parasitism is occurring Monitoring non-target impacts of biological needs to be very well known if realistic control agents is likely to be the most effec- indirect effects are to be measured. The tive means by which real progress can be ultimate goal of the release of biological made in improving the pre-release deci- control agents is the restoration of invaded sion-making process. Only by field-testing ecosystems. Uninvaded reference sites or assumptions made in the artificial environ- long-term documentation of communities ment of laboratories or quarantine facilities before release of biological control agents can the level of scientific uncertainty be would provide useful benchmarks reduced, and the confidence of biological (Blossey, 1999). The current poor availabil- control practitioners and regulators ity of biological inventories will make true improve in the future. Given that in the assessments of indirect impacts on food foreseeable future we will never achieve webs and species difficult. complete certainty of knowledge of the Monitoring protocols need to be able to extremely complex ramifications of releas- detect the extent to which the release of ing a new species into any new environ- biological control agents can drive popula- ment, there is potential for a progressive tion fluctuations or changes in ecosystem improvement that can be attained by feed- function. Natural ecosystems are ing back information from field releases to immensely complex, although invaded sys- each new biological control proposal. The tems may have lost a degree of their origi- significance of this improvement will nal complexity. However, the prevalence of depend upon the quality, scale and time- organism interactions makes it difficult to scale of post-release information that can predict the response of even well-under- be obtained, and upon the availability of stood systems to environmental change or funding for long-term monitoring. perturbations (Yodzis, 1988; Polis and At the present time, we have no accepted Strong, 1996). For example, large fluctua- standards and approaches for post-release tions in the populations of birds, insects evaluations in biological control, and the and mammals can be associated with the development of such techniques is of high North Atlantic Oscillation and the El Niño priority. Investigations to determine Southern Oscillation (Sillett et al., 2000; whether keystone species or bioindicator Mysterud et al., 2001). Consequently, argu- approaches may provide useful information ing with confidence that conditions have need to be implemented so that these ecologically improved or deteriorated, or approaches can be refined over time. Any are simply different due to changes associ- assessment of the true ecological and eco- ated with spread of biological control nomical impacts of biological control will Post-release Evaluation of Non-target Effects of BCAs 181

require sophisticated monitoring pro- mental monitoring programmes to provide grammes to provide meaningful data. Most sufficient detail to detect environmental importantly, while the focus of this book is changes precipitated by biological control. on non-target impacts, monitoring tech- Such monitoring programmes and stan- niques developed to assess direct and indi- dards are in place, for example for marine rect effects of biological control will also environments and monitoring of green- allow us to assess potential ecological bene- house gases. For monitoring impacts of bio- fits. These benefits may outweigh potential logical control this situation seems to be a and realized non-target effects, but at pre- long way off, and so our recommendations sent we lack the ability to assess these. for post-release monitoring are, by default, Ideally, such monitoring efforts would second best. However, given appropriate be embedded in nationally or internation- and well-resourced effort, it might be pos- ally organized and implemented environ- sible to move the goalposts slightly nearer.

References

Asquith, A. and Miramontes, E. (2001) Alien parasitoids in native forests: the ichneumonoid wasp community in Hawaiian rainforest. In: Lockwood, J.A., Howarth, F.G. and Purcell, M. (eds) Balancing Nature: Assessing the Impact of Importing Non-Native Biological Control Agents (an International Perspective). Entomological Society of America, Lanham, Maryland, pp. 54–67. Barbercheck, M.E. and Millar, L.C. (2000) Environmental impacts of entomopathogenic nematodes used for biological control in soil. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control Introductions. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 287–308. Barlow, N.D., Barratt, B.I.P., Ferguson, C.M. and Barron, M.C. (2004) Using models to estimate parasitoid impacts on non-target host abundance. Environmental Entomology 33, 941–948. Barratt, B.I.P., Evans, A.A., Ferguson, C.M., Barker, G.M., McNeill, M.R. and Phillips, C.B. (1997) Laboratory nontarget host range of the introduced parasitoids Microctonus aethiopoides and Microctonus hyperodae (Hymenoptera: Braconidae) compared with ﬁeld parasitism in New Zealand. Environmental Entomology 26, 694–702. Barratt, B.I.P., Goldson, S.L., Ferguson, C.M., Phillips, C.B. and Hannah, D.J. (2000a) Predicting the risk from biological control agent introductions: A New Zealand approach. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control Introductions. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 59–75. Barratt, B.I.P., Evans, A.A., Ferguson, C.M., McNeill, M.R. and Addison, P. (2000b) Phenology of native weevils (Coleoptera: Curculionidae) in New Zealand pastures and parasitism by the introduced braconid, Microctonus aethiopoides Loan (Hymenoptera: Braconidae). New Zealand Journal of Zoology 27, 93–110. Barratt, B.I.P., Phillips, C.B., Ferguson, C.M. and Goldson, S.L. (2003) Predicting non-target impacts of parasitoids: where to from here? In: Van Driesche, R. (ed.) Proceedings of First International Symposium on Biological Control of Arthropods, Honolulu, Hawaii. Forest Health Technology Enterprise Team, Morgantown, West Virginia, pp. 378–386. Barron, M.C., Barlow, N.D. and Wratten, S.D. (2003) Non-target parasitism of the endemic New Zealand red admiral butterﬂy (Bassaris gonerilla) by the introduced biological control agent Pteromalus puparum. Biological Control 27, 329–335. Bathon, H. (1996) Impact of entomopathogenic nematodes on non-target hosts. Biocontrol Science and Technology 6, 421–434. Bennett, F.D. (1993) Do introduced parasitoids displace native ones? Florida Entomologist 76, 54–63. Berberet, R.C., Zarrabi, A.A., Payton, M.E. and Bisges, A.D. (2003) Reduction in effective parasitism of Hypera postica (Coleoptera: Curculionidae) by Bathyplectes curculionis (Hymenoptera: Ichneumonidae) due to encapsulation. Environmental Entomology 32, 1123–1130. Blossey, B. (1999) Before, during, and after: the need for long-term monitoring in invasive plant species management. Biological Invasions 1, 301–311. Blossey, B. (2003) A framework for evaluating potential ecological effects of implementing biological control of Phragmites australis. Estuaries 26, 607–617. 182 B.I.P. Barratt et al.

Blossey, B., Casagrande, R., Tewksbury, L., Landis, D.A. and Wiedenmann, R.N. (2001) Nontarget feeding of leaf-beetles introduced to control purple loosestrife (Lythrum salicaria L.). Natural Areas Journal 21, 368–377. Boettner, G.H., Elkinton, J.S. and Boettner, C.J. (2000) Effects of a biological control introduction on three nontarget native species of saturniid moths. Conservation Biology 14, 1798–1806. Buck, M. and Bathon, H. (1993) Auswirkungen des Einsatzes entomopathogener Nematoden Heterorhabditis sp. im Freiland auf die Nichtzielfauna. 2. Teil: Diptera. Anzeiger für Schädlingskunde Pflanzenschutz, Umweltschutz 66, 84–88. Byers, J.E. and Goldwasser, L. (2001) Exposing the mechanism and timing of impact of nonindigenous species on native species. Ecology 82, 1330–1343. Callaway, R.M., Mahall, B.E., Wicks, C., Pankey, J. and Zabinski, C. (2003) Soil fungi and the effects of an invasive forb on grasses: neighbor identity matters. Ecology 84, 129–135. Childs, J.E., Ksiazek, T.G., Spiropoulou, C.F., Krebs, J.W., Morzunov, S., Maupin, G.O., Gage, K.L., Sarinsky, J., Enscore, R., Frey, J., Peters, C.J. and Nichol, S.T. (1994) Serologic and genetic identification of Peromyscus maniculatus as the primary rodent reservoir for a new hantavirus in the southwestern United States. Journal of Infectious Diseases 169, 1271–1280. Delfosse, E.S. (2000) Biological control: important tool for managing invasive species. Agricultural Research (USDA, ARS) 48, 2. Denoth, M., Frid, L. and Myers, J.H. (2002) Multiple agents in biological control: Improving the odds? Biological Control 24, 20–30. Ehler, L.E. (2000) Critical issues related to nontarget effects in classical biological control of insects. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control Introductions. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 3–13. Ehlers, R.U. (2003) Biocontrol nematodes. In: Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Need and Methods for Risk Assessment. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 177–220. Ehlers, R.U. and Hokkanen, H.M.T. (1996) Insect biocontrol with non-endemic entomopathogenic nematodes Steinernema and Heterorhabditis spp.: conclusions and recommendations of a combined OECD and COST workshop on scientific and regulatory policy issues. Biocontrol Science and Technology 6, 295–302. Ferguson, C.M., Roberts, G.M., Barratt, B.I.P. and Evans, A.A. (1994) The distribution of the parasitoid Microctonus aethiopoides Loan (Hymenoptera: Braconidae) in southern South Island Sitona discoideus Gyllenhal (Coleoptera: Curculionidae) populations. In: Popay, A.J. (ed.) Proceedings of the 47th New Zealand Plant Protection Conference. New Zealand Plant Protection Society Inc, Auckland, New Zealand, pp. 261–265. Ferguson, C.M., Barratt, B.I.P. and Cresswell, A.S. (1999) Field parasitism of the weed biological control agent Rhinocyllus conicus by the introduced braconid, Microctonus aethiopoides. In: O’Callaghan, M.R. (ed.) Proceedings of the 52nd New Zealand Plant Protection Society Conference. New Zealand Plant Protection Society Inc, Auckland, New Zealand, p. 275 (abstract). Fuxa, J.R. (1987) Ecological considerations for the use of entomopathogens in IPM. Annual Review of Entomology 32, 225–251. Gassmann, A. and Louda, S.M. (2001) Rhinocyllus conicus: initial evaluation and subsequent ecological impacts in North America. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 147–183. Gibbs, G.W. (1980) New Zealand Butterflies: Identification and Natural History. Collins, Auckland, New Zealand. Glare, T.R. and O’Callaghan, M. (2003) Environmental impacts of bacterial biopesticides. In: Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Need and Methods for Risk Assessment. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 119–150. Glaser, R.W. and Farrell, C.C. (1935) Field experiments with the Japanese beetle and its nematode parasite. Journal of the New York Entomological Society 43, 345. Goebel, J.J. (1998) The National Resources Inventory and its role in US Agriculture. Agricultural Statistics 2000. In: Holland, T.E. and van den Broecke, M.P.R (eds) Proceedings of the International Conference on Agricultural Statistics. International Statistical Institute, Voorburg, The Netherlands, pp. 181–192. Post-release Evaluation of Non-target Effects of BCAs 183

Goettel, M.S. and Hajek, A.E. (2001) Evaluation of non-target effects of pathogens used for management of arthropods. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Eco- logical Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 81–97. Goldson, S.L., Proffitt, J.R. and Barlow, N.D. (1993) Sitona discoideus (Gyllenhal) and its parasitoid Microctonus aethiopoides Loan: a case study in successful biological control. In: Corey, S., Dall, D. and Milne, W. (eds) Pest Control and Sustainable Agriculture. CSIRO, Division of Entomology, Canberra, Australia, pp. 236–239. Goldson, S.L., McNeill, M.R. and Proffitt, J.R. (2003) Negative effects of strain hybridisation on the biocontrol agent Microctonus aethiopoides. New Zealand Plant Protection 56, 138–142. Greathead, D.J. and Greathead, A.H. (1992) Biological control of insect pests by insect parasitoids and predators: the BIOCAT database. Biocontrol News and Information 13, 61N–68N. Hajek, A.E., Delalibera, I. Jr. and Butler, L. (2003) Entomopathogenic fungi as classical biological control agents. In: Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 15–34. Harrison, S. and Taylor, A.D. (1997) Empirical evidence for metapopulation dynamics. In: Hanski, I. and Gilpin, M.E. (eds) Metapopulation Biology, Ecology, Genetics and Evolution. Academic Press, San Diego, California, pp. 27–42. Henneman, M.L. and Memmott, J. (2001) Infiltration of a Hawaiian community by introduced biological control agents. Science 293, 1314–1316. Hokkanen, H.M.T. and Hajek, A.E. (2003) Environmental Impacts of Microbial Insecticides. Need and Methods for Risk Assessment. Kluwer Academic Publishers, Dordrecht, The Netherlands. Hokkanen, H.M.T. and Zeng, Q.-Q. (2001) Non-target risk from mycoinsecticide treatments: does the trophic level matter? 34th Annual Meeting of the Society for Invertebrate Pathology. Abstract book, FP32, Noordwijkerhout, The Netherlands, p. 51. Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Kuske, S., van Lenteren, J.C., Loomans, A.J.M., Menzler-Hokkanen, I., van Rijn, P.C.J., Thomas, M.B., Tommasini, M.G. and Zeng, Q.-Q. (2003a) Evaluating Environmental Risks of Biological Control Introductions into Europe. Final report of project EU-FAIR5-CT97-3489 (‘ERBIC’), Commission of the European Communities, Brussels. Available at: http://honeybee.helsinki.fi/MMSBL/MAEL/Hankkeet/ERBIC/index.htm (accessed May 2005). Hokkanen, H.M.T., Zeng, Q.-Q. and Menzler-Hokkanen, I. (2003b) Assessing the impacts of Metarhizium and Beauveria on bumblebees. Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Need and Methods for Risk Assessment. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 63–72. Hokkanen, H.M.T., Bigler, F., Burgio, G., van Lenteren, J.C. and Thomas, M.B. (2003c) Ecological risk assessment framework for biological control agents. In: Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Need and Methods for Risk Assessment. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 1–14. Holt, R.D. and Hochberg, M.E. (2001) Indirect interactions, community modules and biological control: a theoretical perspective. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 13–37. Hoogendorn, M. and Heimpel, G.E. (2003) PCR-based gut content analysis of insect predators: A field study. In: Van Driesche, R. (ed.) Proceedings of First International Symposium on Biological Control of Arthropods, Honolulu, Hawaii. Forest Health Technology Enterprise Team, Morgantown, West Virginia, pp. 91–97. Hopper, K.R. (1998) Assessing and improving the safety of introductions for biological control. In: Zalucki, M., Drew, R. and White, G. (eds) Pest Management – Future Challenges: Proceedings of the 6th Australasian Applied Entomological Research Conference. The Cooperative Research Centre for Tropical Pest Management, Brisbane, Australia, pp. 501–510. Howarth, F.G. (1983) Classical biological control: panacea or Pandora’s box. Proceedings of the Hawaiian Entomological Society 24, 239–244. Husberg, G.B. and Hokkanen, H.M.T. (2001) Effects of Metarhizium anisopliae on the pollen beetle Meligethes aeneus and its parasitoids Phradis morionellus and Diospilus capito. BioControl 46, 261–273. Johnson, R.L. and Blossey, B. (2002) Eurasian watermilfoil. In: Van Driesche, R., Blossey, B., Hoddle, M., Lyon, S. and Reardon, R. (eds) Biological Control of Invasive Plants in the Eastern United States. Forest Health Technology Enterprise Team, Morgantown, West Virginia, pp. 79–90. 184 B.I.P. Barratt et al.

Johnson, M.T., Follett, P.A., Taylor, A.D. and Jones, V.P. (2005) Impacts of biological control and invasive species on a non-target native Hawaiian insect. Oecologia 142, 529–540. Jones, C.G., Ostfeld, R.S., Richard, M.P., Schauber, E.M. and Wolff, J.O. (1998) Chain reactions linking acorns to gypsy moth outbreaks and Lyme disease risk. Science 279, 1023–1026. Julien, M.H. and Griffiths, M.W. (1998) Biological Control of Weeds. A World Catalogue of Agents and their Target Weeds. CABI Publishing, Wallingford, UK. Klimaszewski, J. and Watt, J.C. (1997) Coleoptera: Family-Group Review and Keys to Identification. Manaaki Whenua Press, Auckland, New Zealand. Koch, U. and Bathon, H. (1993) Results of the outdoor application of entomopathogenic nematodes on nonobjective fauna. 1 Coleoptera. Anzeiger für Schädlingskunde Pflanzenschutz, Umweltschutz 66, 65–68. Lacey, L.A. and Merritt, R.W. (2003) The safety of bacterial microbial agents used for black fly and mosquito control in aquatic environments. In: Hokkanen, H.M.T. and Hajek, A.E. (eds) Environmental Impacts of Microbial Insecticides. Need and Methods for Risk Assessment. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 151–168. Lacey, L.A., Kaya, H.K. and Bettencourt, R. (1995) Dispersal of Steinernema glaseri (Nematoda: Steinernematidae) in adult Japanese beetles, Popillia japonica (Coleoptera: Scarabaeidae). Biocontrol Science and Technology 5, 121–130. Lockwood, J.A. (1993) Environmental issues involved in biological control of rangeland grasshoppers (Orthoptera: Acrididae) with exotic agents. Environmental Entomology 22, 504–518. Lockwood, J.A. (2000) Nontarget effects of biological control: what are we trying to miss? In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control Introductions. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 15–30. Louda, S.M., Kendall, D., Connor, J. and Simberloff, D. (1997) Ecological effects of an insect introduced for the biological control of weeds. Science 277, 1088–1090. Louda, S.M., Pemberton, R.W., Johnson, M.T. and Follett, P.A. (2003) Nontarget effects – the Achilles’ heel of biological control? Retrospective analyses to reduce risk associated with biocontrol introductions. Annual Review of Entomology 48, 365–396. Lynch, L.D. and Ives, A.R. (1999) The use of population models in informing non-target risk assessment in biocontrol. Aspects of Applied Biology 53, 181–188. Lynch, L.D., Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Gao, Z.-H., Kuske, S., Loomans, A., Menzler-Hokkanen, I., Thomas, M.B., Tommasini, G., Waage, J.K., van Lenteren, J.C. and Zeng, Q.-Q. (2001) Insect biological control and non-target effects: a European perspective. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 99–125. Lynch, L.D., Ives, A.R., Waage, J.K., Hochberg, M.E. and Thomas, M.B. (2002) The risks of biocontrol: transient impacts and minimum nontarget densities. Ecological Applications 12, 1872–1882. McCutchan, J.H., Lewis, Jr. W.M., Kendall, C. and McGrath, C.C. (2003) Variation in trophic shift for stable isotope ratios of carbon, nitrogen, and sulfur. Oikos 102, 378–390. McFadyen, R.E.C. (1998) Biological control of weeds. Annual Review of Entomology 43, 369–393. McNeill, M.R., Phillips, C.B. and Goldson, S.L. (1993) Diagnostic characteristics and biology of three Microctonus spp. (Hymenoptera: Braconidae, Euphorinae) parasitoids of weevils (Coleoptera: Curculionidae) in New Zealand pasture and lucerne. New Zealand Entomologist 16, 39–44. Memmott, J. (2000) Food webs as a tool for studying nontarget effects in biological control. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control Introductions. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 147–163. Miller, J.C. (2000) Monitoring the effects of Bacillus thuringiensis kurstaki on nontarget Lepidoptera in woodlands and forests of Western Oregon. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 277–286. Murray, T.J., Barratt, B.I.P. and Ferguson, C.M. (2002) Field parasitism of Rhinocyllus conicus Froehlich (Coleoptera: Curculionidae) by Microctonus aethiopoides Loan (Hymenoptera: Braconidae) in Otago and South Canterbury. New Zealand Plant Protection 55, 263–266. Mysterud, A., Stenseth, N.C., Yoccoz, N.G., Langvatn, R. and Steinheim, G. (2001) Nonlinear effects of large-scale climatic variability on wild and domestic herbivores. Nature 420, 1096–1099. National Research Council (2000) Ecological Indicators for the Nation. National Academy Press, Washington DC. Post-release Evaluation of Non-target Effects of BCAs 185

Nechols, J.R. (2003) Biological control of the spherical mealybug on Guam and in the northern Marianas Islands: a classic example of fortuitous biological control. In: Van Driesche, R.G. (ed.) 1st International Symposium on Biological Control of Arthropods, Honolulu, Hawaii. USDA Forest Service, Morgantown, West Virginia, pp. 324–329. Neutel, A.M., Heesterneck, J.A.P. and de Ruiter, P.C. (2002) Stability in real food webs: weak links in long loops. Science 296, 1120–1123. Nguyen, K.B. and Smart, Jr. G.C. (1990) Vertical dispersal of Steinernema scapterisci. Journal of Nematology 22, 574–578. Nusser, S.M. and Goebel, J.J. (1997) The national resources inventory: a long-term multi-resource monitoring programme. Environmental and Ecological Statistics 4, 181–204. Ortega, Y.K., Pearson, D.E. and McKelvey, K.S. (2004) Effects of biological control agents and exotic plant invasion on deer mouse populations. Ecological Applications 14, 241–253. Parker, I., Simberloff, D., Lonsdale, M., Goodell, K., Wonham, M., Kareiva, P., Williamson, M., von Holle, B., Moyle, P., Byers, J.E. and Goldwasser, L. (1999) Impact: toward a framework for understanding the ecological effects of invaders. Biological Invasions 1, 3–19. Parkman, J.P. and Smart, Jr. G.C. (1996) Entomopathogenic nematodes, a case study: Introduction of S. scapterisci in Florida. Biocontrol Science and Technology 6, 413–419. Parkman, J.P., Frank, J.H., Nguyen, K.B. and Smart, Jr. G.C. (1993) Dispersal of Steinernema scapterisci (Rhabditida: Steinernematidae) after inoculative applications for mole cricket Orthoptera: Gryllotalipidae control in pastures. Biological Control 3, 226–232. Pearson, D.E., McKelvey, K.S. and Ruggiero, L.F. (2000) Non-target effects of an introduced biological control agent on deer mouse ecology. Oecologia 122, 121–128. Pemberton, R.W. (2000) Predictable risk to native plants in weed biocontrol. Oecologia 125, 489–494. Perkins, R.C.L. (1897) The introduction of beneficial insects into the Hawaiian Islands. Nature 55, 499–500. Peters, A. (1996) The natural host range of Steinernema and Heterorhabditis spp. and their impact in insect populations. Biocontrol Science and Technology 6, 389–402. Polis, G.A. (1998) Stability is woven by complex webs. Nature 395, 744–745. Polis, G.A. and Strong, D.R. (1996) Food web complexity and community dynamics. The American Naturalist 147, 813–846. Rethmeyer, U. (1991) Auswirkungen eines Einsatzes entomopathogener Nematoden auf die Bodenfauna verschiedener Biotope. Dissertation, Technische Hochschule, Darmstadt, Germany. Rosenheim, J.A. (1998) Higher-order predators and the regulation of insect herbivore populations. Annual Review of Entomology 43, 421–447. Rosenheim, J.A., Limburg, D.D. and Colfer, R.G. (1999) Impact of generalist predators on a biological control agent, Chrysoperla carnea: Direct observations. Ecological Applications 9, 409–417. Salt, G. and van den Bosch, R. (1967) The defense reactions of three species of Hypera (Coleoptera: Curculionidae) to an ichneumon wasp. Journal of Invertebrate Pathology 9, 164–177. Sample, B.E., Butler, L., Zivkovich, C., Whitmore, R.C. and Reardon, R. (1996) Effects of Bacillus thuringiensis Berliner var. kurstaki and defoliation by the gypsy moth (Lymantria dispar (L.) (Lepidoptera: Lymantriidae)) on native arthropods in West Virginia. Canadian Entomologist 128, 573–592. Secord, D. and Kareiva, P. (1996) Perils and pitfalls in the host specificity paradigm. Bioscience 46, 448–453. Shiga, M. (1999) Classical biological control of the chestnut gall wasp, Dryocosmus kuriphilus: present status and interactions between an introduced parasitoid, Torymus sinensis, and native parasitoids. In: Yano, E., Matsuo, K., Shiyomi, M. and Andow, D.A. (eds) Biological Invasions of Ecosystem by Pests and Beneficial Organisms. National Institute of Agro-Environmental Sciences, Tsukuba, Japan, pp. 175–188. Sillett, T.S., Holmes, R.T. and Sherry, T.W. (2000) Impacts of global climate cycle on population dynamics of a migratory songbird. Science 288, 2040–2042. Simberloff, D. and Stiling, P. (1996) How risky is biological control? Ecology 77, 1965–1974. Smits, P.H. (1996) Post-application persistence of entomopathogenic nematodes. Biocontrol Science and Technology 6, 379–387. Stanley, J.N. and Julien, M.H. (1998) The need for post-release studies to improve risk assessments and decision making in classical biological control. In: Zalucki, M., Drew, R. and White, G. (eds) Pest Management – Future Challenges: proceedings of the 6th Australasian Applied 186 B.I.P. Barratt et al.

Entomological Research Conference. The Cooperative Research Centre for Tropical Pest Management, Brisbane, Australia, pp. 561–564. Steenberg, T., Langer, V. and Esbjerg, P. (1995) Entomopathogenic fungi in predatory beetles (Col: Carabidae and Staphylinidae) from agricultural fields. Entomophaga 40, 77–85. Stiling, P. and Simberloff, D. (2000) The frequency and strength of nontarget effects of invertebrate biological control agents of plant pests and weeds. In: Follett, P.A. and Duan, J.J. (eds) Nontarget Effects of Biological Control Introductions. Kluwer Academic Publishers, Norwell, Massachusetts, pp. 31–43. Story, J. (2002) Spotted knapweed. In: Van Driesche, R., Blossey, B., Hoddle, M., Lyon, S. and Rearden, R. (eds). In: Biological Control of Invasive Plants in the Eastern United States. Forest Health Technology Enterprise Team, Morgantown, West Virginia, pp. 169–180. Strong, D.R. (2002) Populations of entomopathogenic nematodes in foodwebs. In: Gaugler, R. (ed.), Entomopathogenic Nematology. CABI Publishing, Wallingford, UK, pp. 225–240. Stufkens, M.W., Farrell, J.A. and Goldson, S.L. (1987) Establishment of Microctonus aethiopoides, a parasitoid of the sitona weevil in New Zealand. In: Popay, A.J. (ed.) Proceedings of the 40th New Zealand Weed and Pest Control Conference. The New Zealand Weed and Pest Control Society, Quality Inn, Nelson, New Zealand, pp. 31–32. Timper, P., Kaya, H.K. and Gaugler, R. (1988) Dispersal of the entomogenous nematode Steinernema feltiae (Rhabditida: Steinernematidae) by infected adult insects. Environmental Entomology 17, 546–550. USDA (1999) Reviewers Manual for the Technical Advisory Group for Biological Control Agents of Weeds. Manual Unit of Plant Protection and Quarantine, Animal Plant Health Inspection Service (APHIS), United States Department of Agriculture, Annapolis, Maryland. Van Driesche, R. (2004) Predicting host ranges of parasitoids and predacious insects – what are the issues. In: Van Driesche, R. and Reardon, R. (eds) Assessing Host Ranges for Parasitoids and Predators Used for Classical Biological Control: a Guide to Best Practice. USDA Forest Service. Morgantown, West Virginia, pp. 1–3. Waage, J.K. (2001) Indirect ecological effects of biological control: the challenge and the opportunity. In: Wajnberg, E., Scott, J.K. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 1–12. Wang, X.G. and Messing, R.H. (2002) Newly imported larval parasitoids pose minimal competitive risk to extant egg–larval parasitoid of tephritid fruit flies in Hawaii. Bulletin of Entomological Research 92, 423–429. Yodzis, P. (1988) The indeterminancy of ecological interactions. Ecology 69, 508–515. 11 Molecular Methods for the Identification of Biological Control Agents at the Species and Strain Level

Richard Stouthamer Department of Entomology, University of California, Riverside, CA 92521, USA (email: [email protected]; fax number: +1-951-827-3086)

Abstract

Natural enemies used in biological control programmes are sometimes difficult to identify because of their small size and lack of distinguishing morphological characters. This applies in particular to parasitoid wasps, which form the most important group of natural enemies. There are two aspects of identification that are important: the correct recognition of a taxon and its name. With the current availability of molecular methods, our ability unambiguously to recognize an individual as belonging to a particular taxon has vastly improved. These methods can now be applied by people with little training in insect taxonomy for determining if an unknown specimen belongs to a molecularly known taxon or not. However, the formal naming and description of taxa does require the specialized knowledge of insect systematists. Descriptions and cost estimates are given for the use of: Randomly Amplified Polymorphic DNA (RAPD), Microsatellite DNA, Inter Simple Sequence Repeats (ISSR), the Internal Transcribed Spacers (ITS1 and ITS2), the D2 expansion regions of the 28s ribosomal gene and the Cytochrome Oxidase I and II of the mitochondria. Examples are given of the application of these techniques in biological control projects such as: development of molecular keys to recognize different taxa; methods for the recognition of only a single species when the knowledge of the identity of other species is not important; recognition of released wasps in an already established population of the same species; and recognition of contamination in mass rearing.

Introduction species is difficult to distinguish from other species in the genus. Two aspects of Identification of natural enemies used in the recognition of the potential biological biological control programmes is often control agent are important: the unambigu- problematic. For many reasons it can be ous recognition of the taxon, and its name. difficult to name a natural enemy: (i) the Much is gained if the name of a species is systematics of the group to which the known because it will allow access to the species belongs is not well developed; (ii) existing knowledge of the species in the the species is new to science; or (iii) the literature. Furthermore, the name of the ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) 187 188 R. Stouthamer

species is often required for importation field collected material requires a substan- and release permits. While it is desirable to tial involvement of taxonomists who are not be able to recognize and have a name for really waiting to do this routine identifica- the natural enemy, for biological control tion. Also, because this identification sys- purposes it is enough to have an unam- tem is based on male characters only, many biguous recognition system and to wait for of the collected specimens (females) cannot the systematics of the group to catch up be identified. Consequently, additional char- with our ability to recognize the taxon. acters have been developed to identify the When the recognition of species was species, such as allozymes (Pinto et al., purely based on morphological characters, 1992; Pintureau, 1993) and the DNA the involvement of taxonomists was sequences of various genes (Vanlerberghe- needed. However, with the arrival of a vast Masutti, 1994; Stouthamer et al., 1999). array of molecular methods it is now possi- The genus Trichogramma is a good test ble to develop a system unambiguously to case for developing and testing the useful- recognize different taxa without necessar- ness of molecular identification systems ily finding morphological characters that because thorough morphological and cross- distinguish them from closely related taxa. ing studies have been done for the species In this chapter I will review a number of in this genus (Pinto, 1999). This allows for a methods that have recently been used for comparison between the molecular data and the identification of different insect species. the characters used in the traditional This review is based to a large extent on the approach to species recognition. In addi- work that has been done on the recognition tion, Trichogramma species have been sam- of Trichogramma species using molecular pled from many different populations and markers (Pinto et al., 1997; Silva et al., 1999; sometimes also over a wide geographical Stouthamer et al., 1999; Stouthamer et al., range, which allows the determination of 2000a,b; Ciociola et al., 2001a,b; Pinto et al., the stability of the molecular identification 2002, 2003; Borghuis et al., 2003; de system. While the emphasis in this chapter Almeida and Stouthamer, 2003). is on Trichogramma, the same approach can Trichogramma are minute parasitoid wasps be used for other biological control agents. that parasitize the eggs of mainly Here, the different molecular methods Lepidoptera (Pinto and Stouthamer, 1994). for the recognition of species will be dis- The wasps of this genus are applied in large cussed followed by examples of: (i) how to numbers in biological control programmes develop a molecular key for a group of of moths and butterflies (Smith, 1996). The taxa, (ii) how molecular methods can be genus is distributed worldwide and at least used to specifically discriminate one taxon 200 species have been described. Both in from other closely related taxa, and (iii) North America and in Europe, systematic how released wasps of a particular species work has been done on this genus; most can be distinguished from the resident recently, the North American fauna has population of that species. been treated thoroughly by Pinto (1999). Their small size and the lack of distinguishing morphological features make them diffi- Molecular Methods Used to cult to identify to the species level. Recognize Different Natural Enemy Characters that are used for their identifica- Species and Strains tion are largely based on the structure of the male genitalia (Nagarkatti and Nagaraja, When two populations are separated from 1971). Extensive preparation of specimens each other and cannot interbreed, they will is required to make these structures visible no longer exchange genes. If one of the (Platner et al., 1999). This identification sys- populations experiences a random muta- tem poses a number of problems from the tion, then the chance that the same muta- applied point of view. If wasps are released tion happens in the second population is for biological control, the identification of negligible. The longer the populations are Molecular Methods for the Identification of BCAs 189

isolated from each other, the more differ- Microsatellite DNA consists of short repeats ences accumulate. At some point, these dif- (two to six base pairs) that are tandemly ferences become so large that these two repeated ten to 100 times. These microsatel- different populations are now considered lite loci are found throughout the genome of to be two different species. DNA sequences most insect species. Many microsatellite can then be used to differentiate between loci have a large number of alleles that differ these taxa. Some genes accumulate muta- from each other in the number of repeats. tions more rapidly than do other genes. This allelic polymorphism makes Consequently, the DNA sequence of almost microsatellites such good markers for deter- any gene can be used to tell two unrelated mining, for instance, the mating structure of species apart, but for closely related a population. PCR is used to amplify the species only rapidly evolving genes can be microsatellite locus, and the PCR product used. Here, we will discuss the most com- then needs to be analysed on an automatic monly used genes for distinguishing taxa, sequencer to determine its exact size. from the most rapidly evolving genes to the Finding microsatellite loci in the genome of more slowly evolving genes. a species is labour intensive. In general, it involves extracting the genomic DNA of the species, followed by a step to enrich the Randomly amplified polymorphic DNA DNA for the presence of microsatellite (RAPD) repeats and cloning this enriched DNA and, finally, determining the sequences of the RAPD PCR (Polymerase Chain Reaction) is cloned DNA. Those clones that contain based on the use of short, ten base pair microsatellite sequences are then used to (bp)-long, primers. Sets of primers with dif- design primers. Subsequently, the primers ferent sequences can be bought and tested. are tested and those that consistently No a priori knowledge is needed of the amplify the microsatellite are then used to genome of the insect to be studied. The determine if the population shows variation primers will amplify a stretch of DNA from in that microsatellite locus. Developing those places in the genome where a prim- microsatellite primers is a long process and, ing site on the forward and on the reverse while in principle it is not difficult, having strands occur less than approximately 2500 this done by a specialist company saves bp from each other. Per primer, several both money and time. At present, the cost products of different sizes will be ampli- for developing microsatellites by a com- fied. If there is variation in the genome of mercial laboratory is approximately the species for these priming sites, differ- $10,000–12,000. The cost of determining the ent banding patterns will be visible after genotype on an individual is high because electrophoresis. The RAPD technique is in addition to doing a PCR reaction per indi- inexpensive to develop and may give infor- vidual, using labelled primers, the PCR mation on the species status of individuals product needs to be analysed on an auto- if species-specific differences in RAPD pro- mated sequencer. Therefore, the cost per files exist (Kazmer et al., 1995). The draw- individual equals the number of different back of this identification system is the microsatellite PCR reactions performed per often poor reproducibility of the results. individual plus the cost of determining the Because of these reproducibility problems size of the PCR products on an automated this technique is used less and less. sequencer. Microsatellites are applied for population studies and can answer such questions as the area of origin of a particular Microsatellite DNA population from the total geographic area in which a species occurs. Additionally, they A large part of the genome of insects con- can be used to determine how much an aug- sists of repetitive DNA, where a DNA mentative release improves the immediate sequence is repeated many times. parasitization of a pest (see below). 190 R. Stouthamer

Inter simple sequence repeats (ISSR) generally utilized to ask questions about the species/biotype status of different indi- ISSR is the ‘poor man’s’ version of viduals. ITS1 and ITS2 are the internal microsatellites. To apply this method, no transcribed spacers of the ribosomal sequence information is needed of the cistron. The ribosomal cistron consists of genome of the species to be studied. It uses the genes that code for the RNA that forms primers that consist of an anchored the backbone of ribosomes. It consists of microsatellite repeat. The ﬁve prime end of three genes that actually code for the ribo- the primer consists of a microsatellite somal RNA (18s, 5.8s and 28s), two spacers repeat while the three prime end has a (ITS1 and ITS2) that separate these genes non-repetitive sequence, for instance and a spacer (Intergenic spacer) that sepa- ATATATATATATGT, etc. Sets of these rates the cistron from the next cistron (Fig. primers can be bought and they need to be 11.1). The genes coding for the ribosomal tested in order to select the ones that show RNA are highly conserved: this means that the appropriate level of variation. Similarly there are not many differences in the DNA to RAPD PCR, only a single primer is used, sequences of these genes between unre- and it will bind to those places in the lated groups of animals. Consequently, genome where the binding sites on the for- these genes are not very useful for telling ward and on the reverse strand are sepa- the difference between closely related rated from each other by less than 2500 bp. species. However, the spacers do not code The PCR products of ISSR PCR are made for any RNA that ends up in the ribosomes, visible on agarose gels. ISSRs can be used although the spacers do play some role in for population studies, similarly to RAPD allowing the ribosomal RNA to fold prop- studies. The advantage of ISSR PCR over erly. Mutations in these spacers are not RAPD PCR is that there are less repeatabil- selected against very strongly and, conse- ity problems with this technique. The costs quently, large differences exist in these of applying this technique are the cost of sequences when different species are com- extracting DNA from individual insects, pared. Spacers are very suitable for telling performing a PCR reaction and determining differences between species. Per genome, the size of the bands on an agarose gel. up to 1000 copies of the ribosomal cistron can exist (Collins et al., 1989) in an area of the chromosome called the nuclear orga- Internal transcribed spacers (ITS1 nizing region (NOR). NORs are found and ITS2) either on a single chromosome or on a number of different chromosomes. The dif- While the previous methods are used ferent copies of the ribosomal cistron mainly for population studies, the determi- remain very similar through a process nation of DNA sequences of individuals is called ‘concerted evolution’ (Li and Graur,

Intergenic Internal Internal Intergenic spacer transcribed transcribed spacer spacer 1 spacer 2

28s 18s 5.8s 28s 18s rRNA rRNA rRNA

Fig. 11.1. Organization of the ribosomal cistron consisting of the intergenic spacer, 18s rRNA gene, internal transcribed spacer 1, 5.8s rRNA gene, internal transcribed spacer 2 and the 28s rRNA gene. This ribosomal cistron is tandemly repeated hundreds of times. Molecular Methods for the Identiﬁcation of BCAs 191

1991). While in general this appears to otic RNA though the expansion regions work for all the copies of this cistron in the (Linares et al., 1991). The core regions are genome of an individual, sometimes the highly conserved, but the expansion copies on different chromosomes will dif- regions are less conserved. The expansion fer somewhat from each other. In that way regions that are often used for identifying two slightly different ‘gene families’ will species or higher taxa are the D2 and D3. In occur in the same individual. For instance, Hymenoptera the D2 sequence is some- copies of the ITS2 of the deer tick, Ixodes times used for species identification ricinus (L.) (Acari: Ixodidae), differed by (Babcock and Heraty, 2000). Within an up to 4% of the nucleotides (Rich et al., individual, the sequence of D2 does not 1997). ITS1 and ITS2 are very useful for vary so the cost of determining the creating keys for the identification of sequences consists of: (i) PCR reaction; (ii) arthropods because these spacer regions do purifying the PCR product; and (iii) the not vary only in DNA sequence between cost of two sequencing reactions on the species, but often also in their length. The automated sequencer. length of a spacer is a good trait because it can be determined easily by simply doing gel electophoresis using the PCR product of Cytochrome oxydase (COI and COII) the particular spacer. Closely related species can have spacers that are very dif- In contrast to the ribosomal spacers and ferent in length. However, even if species expansion regions that are found on the have the same length of spacer region, they nuclear chromosomes, the Cytochrome generally differ substantially in DNA Oxydase I and II are located in the mito- sequence. To determine the sequence of chondrial genome of the organism. ITS products, it is necessary to clone the Mitochondria are maternally inherited. PCR product first before it can be Although only a single variant of these sequenced. The reason for this is that indi- genes is present in the mitochondrial viduals can harbour several slightly differ- genome, sometimes copies of these genes ent ITS sequences. If a PCR product, have been transferred to the nuclear containing slightly different sequences, is genome. These nuclear genes of mitochon- sequenced directly, this mixture of drial origin (pseudogenes) generally lose sequences can not be read reliably by the their original function and will rapidly automated sequencer. accumulate mutations. Pseudogenes can be The cost of determining a sequence for a recognized when the amino acid sequences spacer consists of: (i) performing a PCR of these genes are compared with known reaction; (ii) the cost of cloning the PCR functional copies of COI and COII. The product; (iii) performing a second PCR reac- pseudogenes will often have stop codons tion on the cloned DNA; and (iv) sending in their sequence. COI and COII are used the purified PCR product to the automated for species identification. Some within- sequencer for two sequencing reactions. species variation exists, which may make their application for identification difficult. Within an individual the sequence of COI Expansion domain D2 of the ribosomal and COII will not vary (except if pseudo- 28s genes are amplified as well), so the cost of determining the sequences consists of: (i) The 28s ribosomal RNA consists of core PCR reaction; (ii) purifying the PCR prod- areas and a series of expansion regions. uct; and (iii) the cost of two sequence reac- These expansion regions are numbered D1, tions on an automated sequencer. If D2, etc. While the core regions are defined pseudogenes are also amplified, a cloning as those regions of the ribosomal RNA that step needs to be inserted in the procedure, are also found in prokaryotes, the eukary- and several clones may need to be otic RNA has expanded from the prokary- sequenced to find the ‘true’ sequence. 192 R. Stouthamer

Primers for the different applications the advantage that much more template is present in an individual insect, and conse- Table 11.1 gives an overview of which quently even in somewhat degraded DNA DNA sequences and methods are the most it is still possible to amplify these genes. suitable for different biological control Examples of multi-copy genes are the genes applications. Primers can be found for and spacers in the ribosomal cistron and many of the different gene regions genes on mitochondria. The ribosomal described here in the following publica- spacers (genus Nasonia, Trichogramma, tions: Brower and DeSalle (1994) – primers etc.) (Campbell et al., 1994; Stouthamer et for nuclear genes such as ITS1, ITS2, D2; al., 1999) and the D2 region of the 28s Simon et al. (1994) – primers for mitochon- rRNA (genus Encarsia) (Babcock and drial genes COI, COII, etc. Small amounts Heraty, 2000) have been used successfully of primers for many different gene regions for the recognition of different species of can be bought from different vendors. The parasitoid wasps. For most genes, differ- University of British Columbia sells sets of ences will be found between species; how- primers for RAPD, ISSR, mitochondrial ever, if the goal of the identification DNA and nuclear DNA of insects method is to develop an inexpensive way (http://www.michaelsmith.ubc.ca/ser- for reliably identifying the species then the vices/NAPS/Primer_Sets/). spacer regions are often most suitable. The spacers (ITS1 and ITS2) have the advantage that they not only differ in sequence Molecular Recognition of Taxa between species, but also in size, and because many copies exist per haploid set If the species in a group are well character- they are relatively easy to amplify. Most of ized and there is no question regarding the the genes encoding for proteins such as the species identity of individuals, molecular mitochondrial COI and COII, and the ribo- methods for identification may still be somal regions such as D2, differ in advantageous, for instance, to identify lar- sequence but not in size. It is much more val stages or adults if the morphological inexpensive to determine the size of a PCR identification requires extensive specimen product than to determine its sequence. preparation. Different genes may be most There can be considerable difference in the suitable for different taxa. Two different size of the spacers between species, for type of genes can be used, i.e. single-copy instance in the North American genes (i.e. one copy of the gene per haploid Trichogramma species the ITS2 spacer set) or multi-copy genes (i.e. many copies varies in size from 389 in Trichogramma per haploid set or many copies in the cyto- itsybitsi to 510 in Trichogramma interius plasm of the cell). Multi-copy genes have (Pinto et al., 2002). Similarly, there is large

Table 11.1. Molecular methods that are most suitable for different biological control applications.

Application Method

Population studies Mating structure Microsatellites, ISSR Geographic origin of populations Microsatellites, ISSR, COI, COII Recognition of released specimens Microsatellite, ISSR Identification of different species Species recognition ITS1, ITS2, D2, COI, COII Identification key ITS1, ITS2 Phylogeny COI, COII, D2 Quality control: species ID of reared material ITS1, ITS2 Molecular Methods for the Identification of BCAs 193

variation in the size of the ITS1 sequence In general, the size character is useful if in many closely related species (Chang et the size of the PCR product of the species al., 2001). differs by at least 20 nucleotides for PCR Once a gene has been chosen, many products in the range of 300–600. The individuals of each species need to be larger the PCR product, the larger the dif- sequenced to establish that the variation in ference in size needs to be for a reliable the DNA sequence within a species is low distinction of the products using agarose and that consistent differences exist gels. If all the species in the group differ by between species. In addition, for multi- more than 20 nucleotides in size then the copy genes (such as the ribosomal spacers) species in the group can be distinguished several clones of a PCR product of a single simply based on the size character. In a individual need to be sequenced because number of cases this is as far as one needs within-individual variation may exist (Rich to go. For instance, Alvarez and Hoy (2002) et al., 1997; Fenton et al., 1998). found that the two Ageniaspis species, The information presented above is released in Florida for the biological con- based on the assumption that the species trol of the citrus leaf miner, differed in the are well characterized. However, the same size of their ITS2 by 300 nucleotides. approach can be applied if the group is not Sometimes different species have a well known and consists of one or several similar-sized PCR product. To be able still species. To accomplish this, initially to distinguish them, the PCR product may sequence several genes, for instance a ribo- be cut by restriction enzymes into different- somal spacers (ITS1 and ITS2) and a mito- sized fragments. For the restriction frag- chondrial gene (COI or COII) of many ment characters we need to determine the different collections, and determine if locations within each of the sequences groups (= taxa) can be recognized in this where the restriction enzymes cut. This assemblage. Next, try to establish several can be done using computer programs that lines of each of the taxa that have been rec- are available free on the web. For instance, ognized using the sequences and perform the sequence alignment editor BioEdit crossing experiments to verify crossing (www.mbio.ncsu.edu/BioEdit/bioedit.htm) compatibility between the different puta- contains links to the program WebCutter tive species. Once consistency is found (www.firstmarket.com/cutter/cut2.html), between crossing compatibility and that can be used to generate restriction sequence groups, the taxa belonging to a maps of the sequences. These programs different sequence group can be assumed have as output the size of the fragments to be different species. If two lines that resulting from the cutting action of a par- share the same sequence are incompatible ticular restriction enzyme. Once the restric- in the crossing experiments, they should be tion enzymes have been identiﬁed that tested to exclude the involvement of micro- allow the distinction of species with simi- bial symbionts as a cause of the incompati- lar-sized PCR products, their price per unit bility (Stouthamer, 2004). should be checked. The price of some restriction enzymes prohibits their routine application. The best restriction enzyme Development of molecular keys to for distinguishing two species with a identify different species similar-sized PCR product is one that will cut both PCR products into differently Once the ITS sequences are known, a sized fragments. Such restriction enzymes molecular key based on the PCR product have the advantage that it is immediately can be constructed using as characters: (i) clear that, indeed, the restriction reaction the size of the PCR product; and (ii) differ- has worked. Sometimes it is necessary to ences based on the size fragments follow- choose a restriction enzyme that will cut ing digestion of the PCR product with the product of only one species. This situa- restriction enzymes. tion is less desirable because if a PCR 194 R. Stouthamer

product is not cut then the question These spacers can only be used if the remains whether the restriction digest has variation of the ITS2 sequence within a failed or whether it is, indeed, the species species is limited so that all sequences that lacks the restriction site for that partic- derived from that species are more similar ular restriction enzyme. to each other than to the sequences from other species. Two types of within-species sequence variation are commonly encoun- Case study: the development of a tered: (i) the presence of two slightly differ- molecular recognition system for species ent gene families; and (ii) variation in the of the genus Trichogramma number of microsatellite repeats within the sequence. An example of different gene In close cooperation with Dr J.D. Pinto, we families within an individual is found in have developed a molecular-based system the species Trichogramma kaykai (Pinto et to identify the different species of North al., 1997; Stouthamer et al., 1999). These American Trichogramma species. This sys- wasps are polymorphic for an ITS2 tem is based on the sequences of the sequence that either does or does not con- Internally Transcribed Spacer 2 (ITS2) of tain an EcoR1 restriction site (Table 11.2). the ribosomal cistron. As a first test of the Both sequences are found within some molecular identification system, we com- individuals and restricting the ITS2 PCR pared the ITS2 sequences of closely related product of this species with the enzyme Trichogramma species of the pretiosum EcoR1 results in a banding pattern that group. This group consists of five closely consists of three bands: one band for the related species that are difficult to distin- uncut PCR product (i.e. the sequence that guish morphologically. Using the ITS2 lacks the EcoR1 site), and two bands for sequence, consistent differences were the PCR product (i.e. the sequence with found between these species. The ITS2 dif- the EcoR1 site) that is cut at the restriction fered not only in sequence but also in the site. A similar polymorphism was found size of the ITS2 spacer in some of the in the green peach aphid (Fenton et al., species. Two traits of the ITS2 were used to 1998). design a key for these species: (i) the size of A much more common pattern of varia- the PCR product obtained from them, as tion within the ITS2 of a species is the can be visualized on an agarose gel; and (ii) presence of microsatellite repeats of differ- the ability of different restriction enzymes ent copy numbers. Microsatellite repeats to cut the PCR product in different-sized are tandem repeats of short DNA bands (Table 11.2). sequences, for instance: ATATATAT or

Table 11.2. Size (in number of nucleotides) of the PCR product of the ITS2 and ﬂanking regions of the 5.8s and 28s rDNA genes, and the restriction fragments generated by the restriction enzymes Mse1 and EcoR1 of several species belonging to the Trichogramma pretiosum complex. (Modiﬁed from Stouthamer et al., 1999.)

Fragment sizes after digestion with Size of PCR Trichogramma species product Mse1 EcoR1

T. deion collection 1 511 383, 61, 67 511 T. deion collection 2 517 389, 128 517 T. kaykai collection 1 582 359, 223 312, 279 T. kaykai collection 2 575 352, 223 575 T. sathon collection 553 424, 129553 T. pratti collection 569 569 313, 256 T. pretiosum collection 1 522 522 522 Molecular Methods for the Identiﬁcation of BCAs 195

GATGATGAT, etc. Variation in the number Examples of keys developed for of repeats is commonly found in ITS Trichogramma species are: (i) those occur- sequences of a single species; for instance, ring in orchards in North America (Pinto et Trichogramma deion commonly has seven al., 2002); (ii) the species occurring in TC repeats starting at position 24, but in Portugal (Silva et al., 1999); and (iii) the some cases six, and in others nine (Table species known from Brazil (Ciociola et al., 11.3) (Stouthamer et al., 1999). 2001a). Similar ITS-based keys have also From the size and restriction data (Table been developed for the ticks of North 11.2) we can develop a molecular key America (Poucher et al., 1999). (Table 11.4). Initially, the size character is All Trichogramma species that can be used to separate all taxa in groups that can distinguished using morphological charac- be distinguished by size, and for those ters can also be distinguished using ITS2 cases where the size criterion alone does sequences. However, the morphologically not work (i.e. the combinations T. pretio- indistinguishable species T. minutum and sum/T. deion and T. kaykai/T. pratti) we T. platneri also have indistinguishable ITS2 also use the restriction enzymes. sequences (Stouthamer et al., 2000a).

Table 11.3. Aligned sequences of a part of the ITS2 of several collections of Trichogramma deion (modiﬁed from Stouthamer et al., 1999). The shaded area shows the variation in the number of microsatellite repeats. Dashes indicate gaps in the aligned sequence.

Name of T. deion line Partial ITS2 sequence

DRIV GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTCTCTCGCAAGAGAAA––GAGAG DIRV GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTCTCTCGCAAGAGAAA––GAGAG DEUR GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTC––––GCAAGAGAAAGAGAGAG DMEN GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTC––––GCAAGAGAAA––GAGAG DTSN GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTC––––GCAAGAGAAAGAGAGAG DSHE GTTTATAAAAACGAACCCGACTGCTCTCTCACTCTCTC––––GCAAGAGAAAGAGAGAG DLC1 GTTTATAAAAACGAACCCGACTGCTCTCTCACTCTCTC––––GCAAGAGAAAGAGAGAG DPTL GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTC––––GCAAGAGAAA–GAGAG DCLO GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTC–––– GCAAGAGA–AGAGAGAG DRV1 GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTCTC––––GCAAGAG–GAGAGAGAG DSVP GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTC––––––GCAAGAGA–AGAGAGAG DMRY GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTC––––––GCAAGAGA–AGAGAGAG DPIN GTTTATAAAAACGAACCCGACTGCTCTCTCTCTCTC––––––GCAAGAGAAAGAGAGAG

Table 11.4. Molecular key to the species of the T. pretiosum complex based on the ITS2 PCR product and restriction digest with the enzymes EcoR1 and Mse1 (modiﬁed from Stouthamer et al., 1999).

1. Size of the PCR product greater than 540bp 2 Size of the PCR product less than 540bp 5 2. PCR product not cut by EcoR1 3 PCR product cut or partially cut by EcoR1 4 3. Size of the PCR product 580 bp T. kaykai Size of the PCR product 550 bp T. sathon 4. PCR product restricted with Mse1 gives two bands T. kaykai PCR product not restricted by Mse1 T. pratti 5. PCR product restricted with Mse1 gives two or three bands T. deion PCR product restricted with Mse1 gives one band T. pretiosum 196 R. Stouthamer

These two species differ in their distribu- also occur. As an example we could use the tion, with T. minutum occurring generally release of Trichogramma brassicae Bezdenko in the eastern part of North America and T. in maize in Switzerland, where it is impor- platneri occurring to the west of the Rocky tant to know if the released wasps are also Mountains. In Idaho and Washington their found in the surrounding natural areas. For ranges overlap (Pinto et al., 2003). These the wasps collected from those areas it may species are incompatible: in crosses not be important to know their identity: the between the species the fertilized eggs die. only information we want to learn is if the There does not appear to be any prezygotic collected wasps are T. brassicae or not. isolation between them. When a female is Under such circumstances specific primers placed with males from both species, the can be designed that will amplify only a mating appears to be random (Stouthamer gene region of T. brassicae. To do this we et al., 2000b). Because these two taxa are will need to know the ITS2 sequence of the clearly different species we determined the other Trichogramma species that may occur sequence of the mitochondrial COII as a in that area. Species-specific primers can be species-specific marker. For the COII the developed by first aligning all the ITS2 species differed consistently in five of the sequences of the species found in the region, 365 nucleotides of the COII fragment that in order to identify those parts of the we amplified. Based on these differences, a sequence where the species differ from each restriction enzyme was found that was able other. Primers can then be designed for these to distinguish the two species from each regions, but care should be taken to avoid other (Borghuis et al., 2003). problems caused by primer dimers, hairpins etc. (Sambrook and Russell, 2001). It is also possible to use primer design computer pro- Modifications of the identification method grams. Commercial programs are available for primer design such as Primer Premier® While in the key above only the ITS2 was (Biosoft International) and Oligo® (Molecular used, it is possible to make the identifica- Biology Insights). Files can be submitted to tion method more user friendly by per- these programs that contain the DNA forming a multiplex PCR reaction, which sequences of the different species occurring allows for the identification of several in a particular area, and the program will species in a single step. Multiplex PCR is a select primers that will amplify only one of PCR reaction using primers that amplify the species. These commercial programs are more than a single gene region. For expensive. Free web-based primer design instance, one could put in the PCR reaction programs are also available, but in general mix both ITS1 and ITS2 primers, which these do not allow the submission of more results in two PCR products in the same than a single sequence for analysis. reaction – one for ITS1 and one for ITS2. An example of the use of specific Since both spacers vary in size, these sizes primers is given in Zhu et al. (2000). can be used as an additional character that Specific primers were designed that may allow us to distinguish species that amplify only the DNA from the imported have an ITS2 product of the same size, but aphid parasitoids Aphelinus hordei differ in the size of the ITS1. Kurdjumov (Hymenoptera: Aphelinidae) and Aphidius colemani Viereck (Hymenoptera: Braconidae), and not the Methods for the recognition of only a DNA from the native aphid parasitoid single species when the knowledge of the species in North America. These primers identity of other species is not important allowed the identification of the parasitoid inside the aphid mummies, thus reducing Often, it is important to know if a newly the time and effort in keeping the para- released species persists in an area where sitized aphids in the laboratory until the closely related species of the same genus parasitoids emerged. Molecular Methods for the Identification of BCAs 197

Recognition of released wasps in an of the relative importance of wasp size for already established population of the the success of inundative biological control same species using T. pretiosum. In principle, any marker gene can be used for these experiments, In augmentative biological control it is often including mitochondrial variants and even important to know the effectiveness of the presence or absence of symbionts; how- released wasps in already established popu- ever, for this type of application, microsatel- lations of the same species. Different lite DNA markers have special advantages. methods have been used, such as the mark- First of all, there are many different alleles ing of the released individuals using fluores- per microsatellite locus, which necessarily cent dust; however, such releases give an results in many rare alleles. Therefore, it is insight only into the presence and dispersal possible to generate many different unique of the released individuals. These marking lines with rare markers that may be used for methods cannot tell us much about the num- release in the field. Such marked lines can ber of hosts parasitized by the released indi- be used in succession in field releases. viduals. The use of genetic markers can give us the same information as the fluorescent markers, but in addition we can determine Contamination of mass rearing the effectiveness of the released wasps, because we can recognize their offspring. If Molecular methods can be used to check if we are releasing individuals into a sexual contaminations have taken place in mass population, then the marked individuals rearing. Particularly, in species that are will interbreed with the established popula- small, contamination of mass rearing by a tion and the direct effect of the release can different species has taken place in the only be measured in the generation immedi- past, resulting in the unintended release of ately following the release. To find a suitable the wrong species for biological control genetic marker for the recognition of wasps (Rosen and DeBach, 1977). These contami- to be released, one needs to find a genetic nation problems are not trivial. In North variant of, for instance, a microsatellite or an America, T. minutum and T. platneri are allozyme that is rare in the established popu- commonly used for the biological control lation. Next, individuals that carry the rare of moth pests in orchards, and these variant need to be cultured to generate off- species are often reared in the same insec- spring that are homozygous for the rare tary. These species are exceedingly difficult marker. These offspring will then be used to to identify, are morphologically identical create a mass rearing for release in the field. and have the same ITS2 sequences. They After the release of the marked parasitoids, can be recognized using the mitochondrial hosts can be collected from the field to deter- COII sequences. The geographic distribu- mine what fraction of the population carries tion of these species is such that they do the rare marker. This approach has been not overlap, except for areas in Idaho and used by Kazmer and Luck (1995) to deter- Washington. However, these species are mine the importance of size for the success completely incompatible, and releasing a of Trichogramma in inundative releases. species in the native area of the other will Lines were created that were homozygous result in a suppression of the wasps, coun- for rare allozyme variants, which occurred teracting the intended biological control only at low frequencies in the established (Stouthamer et al., 2000b). population. Releases were done in tomato fields where trap cards containing host eggs had been distributed. These trap cards were replaced daily. In the laboratory all of the Vouching specimens for DNA analysis wasps emerging from the trap cards were tested to determine the allozyme variant that It is also important to vouch specimens of they carried. This allowed for an estimation species that are released for biological 198 R. Stouthamer

control purposes in such a way that their approximately $20. Each PCR reaction that DNA can be studied at later dates. It is is performed costs approximately $1–2 in important to do this, even for species supplies. whose identity seems to be clear. In some cases we later discover that a single species consists of two or more morphologically Cost of developing microsatellites for indistinguishable cryptic species. a species Specimens for DNA analysis should be pre- served by keeping them in 95% ethanol in Commercial laboratories will perform the the refrigerator or freezer. work for approximately $10,000 and guaran- tee you some primer pairs that will amplify microsatellite regions within a period of two Cost of Molecular Identiﬁcation months. The work to accomplish this can be done without too much trouble in a well- In the past, many of these molecular tech- equipped laboratory for approximately niques were very expensive to apply $5000 in supplies, but the amount of time it because both the machines and the chemi- takes in labour makes the commercial price cals needed to do the work were expensive. very competitive. The cost of determining Many of these costs have now reduced, and the size of the microsatellites, i.e the allelic PCR machines are now commonly found in proﬁle, ranges from $1 (in-house price at laboratories. universities) to $3 per individual for commercial laboratories.

Cost of developing an ITS-based identiﬁcation system Discussion

If we assume that the group is completely In the past, biological control workers had unknown, then we need to collect at least to rely completely on taxonomists special- 50 different lines of the species from the ized in the natural enemy that was to be field. Determine the ITS2 sequence of each considered for biological control introduc- of these lines. Cost for three ITS sequences tions. This has led to circumstances where per line is approximately $30 in supplies biological control workers, without much and sequencing cost; for the 50 lines it formal, systematic training, became the tax- will, therefore, be $1500. Next, these onomic specialists for particular groups. sequences should be imported into a This has not always led to a clear and sequence editor and similar sequences stable taxonomy of the taxa that were con- should be grouped. Depending on the num- sidered. For instance, as recently as 1968, ber of different groups that are found, addi- only ten Trichogramma species were recog- tional lines can be collected to improve the nized (Flanders, 1968). The species identi- possibility that all species which are pre- fication was based on the colour of the sent are detected. Once all the groups have wasps. Now we know that there are at least been identified and the variation within 200 species of Trichogramma and the the groups is clear, a key can be developed. colour of individuals of a species depends Initially, the sizes of the PCR products for to some extent on the rearing temperature the individual groups can be compared of the wasps (Pinto, 1999). Nowadays, and, if need be, restriction enzymes can be many molecular methods are available for identified and tested to distinguish species characterizing insects that are new to sci- with a similar-sized PCR product. The cost ence or that are difficult to identify using of the restriction enzyme reaction can vary morphological characters. These tools can from ten cents per digest to several dollars. now be used by scientists to group individ- Specific primers can be developed and uals according to the sequence of particular ordered, and the price of a primer pair is genes. If distinctly different groups are Molecular Methods for the Identification of BCAs 199

found then there is a good chance that enemy has reached adulthood. Using mole- these are indeed different species. This cular methods for identification, both sexes assumption should next be verified by and all stages of the insect can be recog- crossing experiments both between the nized. This can save a lot of expense, and groups and within the groups. If there is can also give more accurate estimates of consistent compatibility within the groups, parasitization rates from field-collected and incompatibility between groups, these samples. two groups represent different species. The development of recognition sys- To recognize these species from field tems for natural enemies used in biologi- samples, PCR reactions can be developed cal control is already at an advanced stage; that either amplify only the species of however, for release permits it is still nec- interest, or will allow for the identification essary to have a name attached to the of all closely related species. Such methods taxon that we may want to release. It are not difficult to develop, are inexpensive would be of considerable help if the regu- and have many advantages over morpho- latory agencies would recognize the value logical methods. For identification based of these new methods that can now be as on morphology, adult specimens, often of a precise, or even more precise, in the recog- particular sex, are needed. Sometimes this nition of species than some of the morpho- requires the expensive maintenance of the logical characters upon which we relied field-collected material until the natural previously.

References

Alvarez, J.M. and Hoy, M.A. (2002) Evaluation of the ribosomal ITS2 DNA sequences in separating closely related populations of the parasitoid Ageniaspis. Annals of the Entomological Society of America 95, 250–256. Babcock, C.S. and Heraty, J.M. (2000) Molecular markers distinguishing Encarsia formosa and Encarsia luteola (Hymenoptera: Aphelinidae). Annals of the Entomological Society of America 93, 738–744. Borghuis, A., Pinto, J.D., Platner, G.R. and Stouthamer, R. (2003) Partial cytochrome oxidase II sequences distinguish the sibling species Trichogramma minutum Riley and Trichogramma platneri Nagarkatti. Biological Control 30, 90–94. Brower, A.V.Z. and DeSalle, R. (1994) Practical and theoretical considerations for choice of a DNA sequence region in insect molecular systematics, with a short review of published studies using nuclear gene regions. Annals of the Entomological Society of America 8, 702–716. Campbell, B.C., Steffen-Campbell, J.D. and Werren, J.D. (1994) Phylogeny of the Nasonia species complex as inferred from an internal transcribed spacer and 28srDNA. Insect Molecular Biology 2, 225–237. Chang, S.C., Hu, N.T., Hsun, C.Y. and Sun, C.N. (2001) Characterisation of differences between two Trichogramma wasps by molecular markers. Biological Control 21, 75–78. Ciociola, A.I., Querino, R.B., Zucchi, R.A. and Stouthamer, R. (2001a) Molecular tool for identiﬁca- tion of closely related species of Trichogramma (Hymenoptera: Trichogrammatidae): T. rojasi Nagaraja and Nagarkatti and T. lasallei Pinto. Neotropical Entomology 30, 575–578. Ciociola, A.I., Zucchi, R.A. and Stouthamer, R. (2001b) Molecular key to seven Brazilian species of Trichogramma (Hymenoptera: Trichogrammatidae) using sequences of the ITS2 region and restriction analysis. Neotropical Entomology 30, 259–262. Collins, F.H., Paskewich, S.M. and Finnerty, V. (1989) Ribosomal RNA genes of the Anopheles gambiae species complex. Advances in the Disease Vector Research 6, 1–28. de Almeida, R.A. and Stouthamer, R. (2003) Molecular identiﬁcation of Trichogramma cacoeciae Marchal (Hymenoptera: Trichogrammatidae): A new record for Peru. Neotropical Entomology 32, 269–272. Fenton, B., Malloch, G. and Germa, F. (1998) A study of variation in rDNA ITS regions shows that two haplotypes coexist within a single aphid genome. Genome 41, 337–345. 200 R. Stouthamer

Flanders, S.E. (1968) The validity of Trichogramma pretiosum. Annals of the Entomological Society of America 61, 1122–1124. Kazmer, D.J. and Luck, R.F. (1995) Field tests of the size-fitness hypothesis in the egg parasitoid Trichogramma pretiosum. Ecology 76, 412–425. Kazmer, D.J., Hopper, K.R., Coutinot, D.M. and Heckel, D.G. (1995) Suitability of random amplified polymorphic DNA for genetic markers in the aphid parasitoid, Aphelinus asychis Walker. Biological Control 5, 503–512. Li, W.-H. and Graur, D. (1991) Fundamentals of Molecular Evolution. Sinauer, Sunderland, Massachusetts. Linares, A.R., Hancock, J.M. and Dover, G.A. (1991) Secondary structure constraints on the evolution of Drosophila 28S Ribosomal RNA expansion segments. Journal of Molecular Biology 219, 381–390. Nagarkatti, S. and Nagaraja, H. (1971) Redescription of some known species of Trichogramma, showing the importance of male genitalia as a diagnostic character. Bulletin of Entomological Research 61, 13–31. Pinto, J.D. (1999) Systematics of the North American species of Trichogramma Westwood (Hymenoptera: Trichogrammatidae). Memoirs of the Entomological Society of Washington 22, 1–287. Pinto, J.D. and Stouthamer, R. (1994) Systematics of the Trichogrammatidae with emphasis on Trichogramma. In: Wajnberg, E. and Hassan, S.A. (eds) Trichogramma and other Egg Parasitoids. CABI Publishing, London, UK, pp. 1–36. Pinto, J.D., Kazmer, D.J., Platner, G.R. and Sassaman, C.A. (1992) The taxonomy of the Trichogramma minutum complex: allozymic variation and its relationship to reproductive and geographic data. Annals of the Entomological Society of America. 85, 413–422. Pinto, J.D., Stouthamer, R. and Platner, G.R. (1997) A new cryptic species of Trichogramma (Hymenoptera: Trichogrammatidae) from the Mojave Desert of California as determined by morphological, reproductive and molecular data. Proceedings of the Entomological Society of Washington 99, 238–247. Pinto, J.D., Koopmanschap, A.B., Platner, G.R. and Stouthamer, R. (2002) The North American Trichogramma (Hymenoptera: Trichogrammatidae) parasitizing certain Tortricidae (Lepidoptera) on apple and pear, with ITS2 DNA characterizations and description of a new species. Biological Control 23, 134–142. Pinto, J.D., Platner, G.R. and Stouthamer, R. (2003) The systematics of the Trichogramma minutum species complex (Hymenoptera: Trichogrammatidae), a group of important North American biological control agents: the evidence from reproductive compatibility and allozymes. Biological Control 27, 167–180. Pintureau, B. (1993) Enzymatic analysis of the genus Trichogramma (Hym.: Trichogrammatidae) in Europe. Entomophaga 38, 411–431. Platner, G.R., Velten, R.K., Planoutene, M. and Pinto, J.D. (1999) Slide-mounting techniques for Trichogramma (Trichogrammatidae) and other minute parasitic Hymenoptera. Entomological News 110, 56–64. Poucher, K.L., Hutcheson, H.J., Keirans, J.E., Durden, L.A. and Black, W.C. (1999) Molecular genetic key for the identification of 17 Ixodes species of the United States (Acari: Ixodidae): A methods model. Journal of Parasitology 85, 623–629. Rich, S.M., Rosenthal, B.M., Telford, S.R., Spielman, A., Hartl, D.L. and Ayala, F.J. (1997) Heterogeneity of the internal transcribed spacer (ITS-2) region within individual deer ticks. Insect Molecular Biology 6, 123–129. Rosen, D. and DeBach, P. (1977) Use of scale insect parasites in Coccoidea systematics. Virginia Polytechnic and State University, Research Division Bulletin 127, 5–21. Sambrook, J. and Russell, D.W. (2001) Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Silva, I.M.M.S., Honda, J., van Kan, F.J.P.M., Hu, J., Neto, L., Pintureau, B. and Stouthamer, R. (1999) Molecular differentiation of five Trichogramma species occurring in Portugal. Biological Control 16, 177–184. Simon, C., Frati, F., Beckenbach, A., Crespi, B., Liu, H. and Flook, P. (1994) Evolution, weighting, and phylogenetic utility of mitochondrial gene sequences and a compilation of conserved polymerase chain reaction primers. Annals of the Entomological Society of America 87, 651–701. Molecular Methods for the Identification of BCAs 201

Smith, S.M. (1996) Biological control with Trichogramma: Advances, successes, and potential of their use. Annual Review of Entomology 41, 375–406. Stouthamer, R. (2004) Sex ratio distorters and other selfish genetic elements: Implications for biological control. In: Ehler, L., Sforza, R. and Mateille, T. (eds) Genetics, Evolution and Biological Control. CABI Publishing, Wallingford, UK, pp. 235–252. Stouthamer, R., Hu, J., van Kan, F.J.P.M., Platner, G.R. and Pinto, J.D. (1999) The utility of internally transcribed spacer 2 DNA sequences of the nuclear ribosomal gene for distinguishing sibling species of Trichogramma. BioControl 43, 421–440. Stouthamer, R., Gai, Y., Koopmanschap, A.B., Platner, G.R. and Pinto, J.D. (2000a) ITS-2 sequences do not differ for the closely related species Trichogramma minutum and T. platneri. Entomologia Experimentalis et Applicata 95, 105–111. Stouthamer, R., Jochemsen, P., Platner, G.R. and Pinto, J.D. (2000b) Crossing incompatibility between Trichogramma minutum and T. platneri (Hymenoptera: Trichogrammatidae): Implications for application in biological control. Environmental Entomology 29, 832–837. Vanlerberghe-Masutti, F. (1994) Molecular identification and phylogeny of parasitic wasp species (Hymenoptera: Trichogrammatidae) by mitochondrial DNA RFLP and RAPD markers. Insect Molecular Biology 3, 229–237. Zhu, Y.C., Burd, J.D., Elliott, N.C. and Greenstone, M.H. (2000) Specific ribosomal DNA marker for early polymerase chain reaction detection of Aphelinus hordei and Aphidius colemani from Diuraphis noxia. Annals of the Entomological Society of America 93, 486–491. 12 The Usefulness of the Ecoregion Concept for Safer Import of Invertebrate Biological Control Agents

Matthew J.W. Cock,1 Ulrich Kuhlmann,1 Urs Schaffner,1 Franz Bigler2 and Dirk Babendreier2 1CABI Bioscience Switzerland Centre, Rue des Grillons 1, 2800 Delémont, Switzerland (email: [email protected]; [email protected]; [email protected]; fax number: +41-32-421-4871); 2Agroscope FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstrasse 191, 8046 Zürich, Switzerland (email: [email protected]; [email protected]; fax number: +41-44-377-7201)

Abstract

From a scientiﬁc perspective it is clear that ecological boundaries are more relevant than national boundaries when assessing the hazards and risks of non-target effects of biological control agents, including invertebrate biological control agents (IBCAs). Different published approaches to categorizing terrestrial ecoregions are introduced and discussed. Movement of species between countries in the same ecoregion is clearly less risky than moving species between disjunct similar ecoregions, and the risk increases the further the separation between disjunct similar ecoregions, e.g. whether on the same continent or on different continents. The implications for movement of IBCAs within Europe are discussed in light of ecoregion classiﬁcations and examples of natural and human-mediated spread of introduced insects in the same region. In order to safely regulate the introduction of biological control agents, there needs to be consultation within an ecoregion. An ecoregion approach can be useful in predicting the likelihood that a classical IBCA will become established, but cannot robustly predict that an inundative IBCA will fail to become established. An ecosystem approach can be useful for assessing and managing risks associated with moving organisms within a contiguous land mass.

Introduction consider that the ecoregion approach can be applied to all biological control agents, In this chapter, the core focus is on inver- we would not necessarily extend all argu- tebrate biological control agents (IBCAs) ments to pathogen biological control for controlling arthropods and, speciﬁcally agents, without further consideration of in this chapter, also weeds. Although we the issues. ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 202 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 203

Decisions regarding the approval of that on individual species. Individual introduction of biological control agents, species will adapt to changing local condi- including IBCAs, are usually made at the tions (Bale et al., 2002), or they will move to national level. There are good reasons for areas that match their existing optimum con- this being related to national sovereignty ditions (Coope 1978, 1995; Parmesan et al., and responsibility, clearly defined geo- 1999), or they will become extinct (Thomas graphical boundaries and (in many cases), et al., 2004). Similarly, ecoregions will decision-making systems already in place. change, move or disappear. In general, we On the other hand, it is well known that expect that arthropods will change their biological control agents, once established, range in response to global warming, and will spread to the limits of their ecological broadly speaking will move with their exist- tolerance. In doing so, they encounter new ing preferred ecoregion (Coope, 1978), so habitats, species, climates, etc. and this can that risks to new non-target species encoun- change the hazards and risks of non-target tered will not necessarily be great. Compared impact. From a scientific perspective it is to the overall impact of global warming on clear that ecological boundaries are more humans and ecosystems, we consider this relevant than national boundaries when potentially increased risk to be trivial. assessing the hazards and risks of non- In this chapter we shall explore the target effects of biological control agents. extent to which the ecoregion concept can Ecoregion is a term that ecologists can be useful in aspects of the science of bio- understand quite well at an intuitive level, logical control. We start by reviewing some but which can be very difficult to derive of the ecoregion classifications that have and use objectively. Ecoregion could be a been proposed. We have included figures useful concept in aspects of biological con- in shades of grey of part or all of these clas- trol, although different definitions do sifications to illustrate the scale and detail appear in the literature. Ecoregion has been of mapping, illustrate particular aspects, defined as a physical region that is defined and to explore the particular situation in by its ecology, which includes meteorologi- central Europe, but for practical use, the cal factors, elevation, plant and animal spe- original colour figures will need to be con- ciation, landscape position and soils sulted. We then consider current usage of (US-EPA, 1996). A comparable definition is the ecoregion approach in biological con- an area of similar climate, landform, soil, trol, the spread of alien insects in Europe potential natural vegetation, hydrology, or in relation to ecoregions and the pathways other ecologically relevant variables (Clark they define, leading to a working model for et al., 1998). Related terms include ecoarea quarantine needs when moving insects and ecosystem, but we will use the term within Europe for study purposes, and ecoregion throughout this chapter except finally draw some conclusions. where referring to work which utilizes other specific terms. The ecoregion concept was developed Ecoregion Classifications based on natural distribution patterns of species, but we recognize that this pattern Various workers have attempted ecoregion has been overlaid, and sometimes obscured, classifications at the regional or global by land-use change, particularly the devel- scale, for a variety of reasons. Although opment of agriculture, as well as by human- there are different systems for terrestrial, mediated introductions of alien species. We freshwater and marine environments, we are also aware that global warming will restrict our consideration to terrestrial sys- affect ecoregions, but do not consider the tems, as these cover almost all targets hith- implications of this in detail here. We sug- erto considered for biological control. In gest that for the assemblage of species that our analysis, for pragmatic reasons, we will characterize an ecoregion, the combined focus primarily on Eurasia, but the argu- impact of global warming will be similar to ments can be extended to other regions. 204 M.J.W. Cock et al.

Usually, the first parameter considered defined regions are conceptually straightfor- in an ecoregion classification is climate, ward on this broad scale. particularly patterns of temperature and At the next level down, there can be rainfall. This classification can be modified many more ecoregions. Differences are by important factors such as altitude, soil apparent between different approaches, and vegetation systems. Alternatively, veg- and patterns can become less clear. Bailey etation, which can be considered to reflect (1996) synthesizes the ecoregion approach the ecological parameters, can be taken as to a global scale in his ‘Ecosystem the starting point. Very few systems Geography’, and provides a global analysis attempt to include animal associations, and at the division level, i.e. continental scale it can be argued that the animal associa- (see also Bailey, 1998). The Times (1998) tions will be a function of plant associa- presents a vegetation-based analysis based tions. Depending upon the weighting partially on the work of P.E. James (e.g. applied to different factors, some classifica- James, 1966), which tends to highlight tions show high concurrence with each mountainous areas. Compare Bailey’s other, but others can be very different. (1996) treatments of the division-level The larger the scale of analysis, the fewer ecoregions of Eurasia with that of The categories there will be in the classification Times (1998), as shown in Fig. 12.2. There and the closer the concurrence is likely to are substantial similarities, but minor be between systems. The four ecoclimatic differences. zones, as illustrated by Bailey (1996) are not Cleland et al. (1997), presenting a very contentious (Fig. 12.1). Europe to the national hierarchical framework of ecolog- Urals is mostly ‘humid temperate’ and simi- ical units for the USA, recognize three cat- lar, but disjunct, areas occur in Asia, North egories of ecoregion: domains at the global America, South America, southern Africa scale, divisions at the continental scale and south-eastern Australia. Thus, the and provinces at the regional scale, as pre-

Fig. 12.1. The four ecoclimatic zones of the earth (Bailey, 1996). Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 205

Fig. 12.2. Ecoregions of Eurasia: (a) after Bailey (1996) and (b) after The Times (1998). The numbers in the figure from Bailey (1996) refer to his ecoregions; thus, those from 100 refer to the Polar Domain (e.g. 120, Tundra Division; 130, Subarctic Division), those from 200 refer to the Humid Temperate Domain (e.g. 210, Warm Continental Division; 220, Hot Continental Division; 230, Marine Division; 240, Marine Division Mountains; 250, Prairie Division; 260, Mediterranean Division); those from 300 to the Dry Domain (e.g. 330, Temperate Steppe Division); and those with the prefix M denoting Mountain areas. Note how the Urals (1) separate European Russia (2) from Asian Russia (3), the Caucasus region (4) separates southern Russia (5) from south-west Asia (6), and the mountains running from Pakistan to north-east Russia (7) separate China (8) from the rest of temperate Asia (9). sented by Bailey (2001) (Fig. 12.3). The that only at the domain level is it appar- subdivision of ecological regions can con- ent that there are similarities between tinue downwards into smaller and more eastern and western USA, separated by a homogeneous units, and Cleland et al. different ecoregion; at the domain and (1997) recognize nine levels in their hier- province levels this aspect is partially archy. The hierarchical nesting of eco- obscured. region classifications is a useful feature, Recent initiatives have been driven by enabling the scale to be rapidly changed the conservation movement, which needed within the same classification. Comparing objective methods in order to classify the the three levels of scale in Fig. 12.3 shows world’s biodiversity as a starting point for 206 M.J.W. Cock et al.

(a)

(b)

(c)

Fig. 12.3. (a)–(c): Three hierarchical levels of ecoregion for the USA: domains, divisions and provinces (Bailey, 2001). Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 207

identifying priorities for conservation of The Use of Ecoregions in Current ecosystems. One of the early attempts in Biological Control Practice this area was that of the International Union for Conservation of Nature and It is incumbent on a country considering Natural Resources (IUCN) (Dasmann, 1973, the introduction of a biological control 1974; Udvardy, 1975), which identified 193 agent to consult its neighbours. For exam- distinct biotas on a global scale, and was ple, NAPPO (North American Plant an important starting point for some of the Protection Organization) maintains a more recent systems, e.g. Olson et al. Biological Control Panel (NAPPO, 2004), (2001) below. one assignment of which is to exchange For Europe, there are two useful recent information on biological control activities classifications: The Digital Map of in the three NAPPO countries (Canada, European Ecological Regions (ETCNPB, Mexico, USA). The International Plant 2000) and the Biogeographical Regions of Protection Convention addresses this in Europe, 2001, prepared by the European International Standards for Phytosanitary Environment Agency (EEA, 2003). The lat- Measures (ISPM) No. 3, ‘Code of Conduct ter is based on earlier vegetation mapping for the Import and Release of Exotic (Noirfalise, 1987; Bohn et al., 2000), and Biological Control Agents’, section 3.1.12: recognizes official delineations used in the ‘Consult with authorities in neighbouring Habitats Directive (92/43/EEC) and for the countries within the same ecoarea and EMERALD Network set up under the with relevant regional organizations to Convention on the Conservation of clarify and resolve any potential conflicts European Wildlife and Natural Habitats of interest that may arise between coun- (Bern Convention) (Roekaerts, 2002). tries’ (IPPC, 1996). Ecoarea is defined in Building on these earlier works, Olson ISPM No. 3 as ‘an area with similar fauna, et al. (2001) have attempted a new global flora and climate and hence similar con- synthesis of terrestrial ecoregions in sup- cerns about the introduction of biological port of conservation of biodiversity, control agents’. The use of the term ecoarea resulting in 867 distinct ecoregion units. seems to originate in this document and be These units are categorized into 14 hierar- more or less restricted to it and to other chical biomes and eight biogeographic documents based on it. Thus, it is not realms. The biogeographical realms clearly and objectively defined, nor is it Nearctic, Neotropic, Palaearctic, clear how to use this term in practice. In Afrotropic, Indo-Malay and Australasia the absence of a precise practical definition (Sclater, 1858; Wallace, 1876), together we shall treat the term ecoarea as synony- with Oceania and Antarctic (Fig. 12.5), are mous with ecoregion, and explore further well established. The 14 biomes offer a below how the concept can be used in level of detail, slightly less than the aspects of the science of biological control. Biogeographical Regions of Europe (EEA, ISPM No. 3 has recently been revised and 2003), and intermediate between Bailey’s the new version is available on the inter- four ecoclimatic zones (Fig. 12.1) and the net, although it has not yet been formally more detailed ecoregions of Bailey (1996), published (IPPC, 2005). The revised stan- DMEER (ETCNPB, 2000) and Olson et al. dard focuses on the pest risk assessment (2001). process, and does not specifically use the The detailed mapping into 867 terres- term ecoarea, or advise countries to consult trial ecosystems of Olson et al. (2001) pro- their neighbours. However, this advice vides a level of resolution that we shall from the original standard remains relevant show may be more detailed than is useful today, and demonstrates that more practi- for most biological control purposes. cal guidelines on biological control proce- Nevertheless, as the starting point for a dures with practical advice will be needed global hierarchical classification, this to help inexperienced countries carry out seems a major step forward. biological control responsibly. 208 M.J.W. Cock et al.

(a)

(b)

Fig. 12.4. Two non-hierarchical levels of ecoregion for Europe: (a) Biogeographical Regions of Europe (EEA, 2003); in addition to the Alps, the so called ‘Alpine Region’ (indicated by an ‘A’) includes the Pyrenees, Scandinavian mountain chain, from the Alps south-west to Macedonia, a small part of the Appeninno Abruzzese in Central Italy, the mountains of Bulgaria, the Carpathians, the Urals and the Caucasus and Transcaucasus Mountains; (b) DMEER, Digital Map of European Ecological Regions (ETCNPB, 2000); the ‘Alps conifer and mixed forests’ region is restricted to the Alps (see Fig. 12.8(a)). Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 209

Fig. 12.5. The eight biogeographic realms and 14 hierarchical biomes as presented by Olson et al. (2001). The biomes are shown in shades of grey, and the original colour publication should be consulted for detailed use.

Ecoregions and the Distribution and and of The Times (1998) shown in Fig. 12.2 Spread of Insects for Eurasia, but becomes increasingly obscure as finer-scale divisions are considered (e.g. It is obvious and well known that oceans see Fig. 12.3). The north–south barriers in the present the most substantial barriers to the Americas reflect the presence of major moun- movement and introduction of alien terres- tain barriers, whereas the east–west corridors trial species. Furthermore, the majority of in Eurasia reflect climate differences as one damaging introductions have involved the moves south or north. transfer of species across oceans. Such The Biogeographical Regions of Europe movements can still be intra-national, e.g. (EEA, 2003; Fig. 12.4a) shows that most bio- between mainland USA and Hawaii, or geographical regions of Europe form con- between France and France d’Outre-mers tiguous units. In contrast, the presence of (i.e. Guadeloupe, Martinique, Guyane, La similar ecoclimatic zones in the east and Réunion and territories, which are politi- west of North America, divided by physical cally part of France), and such introductions (mountain) and ecological barriers, means should be regulated, most especially when that moving organisms between these coasts there are similar climates or broad-scale can lead to the establishment of damaging ecoregions (Bailey’s (1996) ecoclimatic zones alien species. For example, a cicadellid, the or Olson et al.’s (2001) biomes) in both areas. glassy-winged sharpshooter, Homalodisca However, we do not focus on this point here, coagulata (Say), which is a vector of the but rather focus on the less obvious risks bacterium Xylella fastidiosa, a plant associated with the spread of species within pathogen that causes a variety of plant dis- a land mass, and the introduction of species eases – including phony peach disease of from another part of the same land mass. peach and Pierce’s disease of grape – was At the broadest scale of ecoregion classifi- accidentally introduced from south-eastern cation into four ecoclimatic zones (Fig. 12.1), USA to the west coast of USA, and is now a it is noteworthy that the Americas are major agricultural pest problem (Purcell and divided north to south, whereas Eurasia and Saunders, 1999). Hence, one may generalize Africa are divided east to west. This remains that for the northern hemisphere temperate apparent, e.g. in the schemes of Bailey (1996) ecoregions, moving organisms between east 210 M.J.W. Cock et al.

and west in North America would be a leaf miner, Phyllonoryctor leucographella higher risk than moving organisms within (Zeller) (Lepidoptera: Gracillariidae) has Europe, and to a lesser extent between spread through Europe in the last 20–30 Europe and central Asia. years on its Mediterranean hosts, Pyracantha Unlike other Biogeographical Regions, spp., which are widely planted as exotic the so-called ‘Alpine’ Biogeographical ornamentals (Nash et al., 1995; UK Moths, Region (Fig. 12.4a) is not contiguous within 2005). Europe. In addition to the Alps, this region This pattern of spread of species within includes the Pyrenees, Scandinavian moun- Europe will now be interpreted in terms of tain chain, from the Alps south-west to the ecoregion classification systems available, Macedonia, a small part of the Appeninno particularly the barriers and corridors which Abruzzese in Central Italy, the mountains of ecoregions may present for colonization and Bulgaria, the Carpathians, the Urals and the spread (Figs 12.2, 12.4). There is a notewor- Caucasus and Transcaucasus Mountains. thy homogeneity from northern Spain to Movement of organisms between these simi- Denmark, and from lowland Switzerland, in lar, but disjunct, areas, must carry a higher both Bailey (1996) and The Times (1998) (Fig. degree of risk than between parts of other, 12.2b), and northern Italy is similar but dis- contiguous Biogeographical Regions of junct. Bailey (Fig. 12.2a) shows differences Europe. The significant differences in the further east, although The Times (Fig. 12.2b) flora and fauna of distinct Eurasian moun- shows similar vegetation extending to the tain regions are best shown in the ecoregion Urals. Movement of organisms between low- classification of DMEER (ETCNPB, 2000) land areas and mountain areas throughout (Fig. 12.4b), whereas the similarities are evi- this region would be low risk – if they could dent in the Biogeographical Regions of have spread, they probably would have, or Europe (EEA, 2003) (Fig. 12.4b). We con- soon will through man’s activities. clude that disjunct similar ecoregions are a The Mediterranean region is distinct potential source of alien species that can from, but contiguous with, the rest of become established, whereas within contin- Europe at the level of the Biogeographical uous ecosystems and contiguous dissimilar Region (Fig. 12.4) or of the biome (Fig. ecoregions this is much less likely to occur. 12.5). The ability of species to spread From where do alien invasive species within the Mediterranean region is cur- originate, and what can this tell us about rently being shown by the geranium blue the barriers which ecoregions may present butterfly, Cacyreus marshalli Butler to their natural dispersal and spread? The (Lepidoptera: Lycaenidae), which was acci- majority of aliens are extra-continental, but dentally introduced from South Africa and some are intra-continental (both categories is spreading steadily. It was introduced into can be inter-national or intra-national). Mallorca in the Balearic Islands in 1987, A recent analysis of the sources of alien and was found on Spain’s Mediterranean insects established in Switzerland (M. Kenis, coast in 1992 (Sarto i Monteys, 1992). Since CABI Switzerland, 2004, personal communi- then it has spread to the Canary Islands, cation) shows that of the 304 alien insect Portugal, France, Italy and Morocco. A species provisionally listed for Switzerland, summer population in England was eradi- the great majority are inter-continental intro- cated, but probably would not have sur- ductions. However, four are considered to vived the winter, and winter temperatures have come from eastern Europe and 39 from will probably limit the final distribution to the Mediterranean region, but none from the the warmer parts of Europe. remainder of Europe. Furthermore, the Movement of organisms between the spread of most of these species from within Mediterranean region and the rest of Europe Europe is associated with human activities, is relatively low risk – again, if it were possi- e.g. glasshouse pests, pests of exotic orna- ble, it would probably have happened mentals, pests of human habitations and already. Thus, those species limited to the stored products. For example, the firethorn Mediterranean region are likely to be climate Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 211

limited, if there are not other more funda- movement, probably as immatures stages mental constraints, such as availability of carried in leaves by road and rail transport food plants. As noted, most species from the (Gilbert et al., 2004). We conclude that alien Mediterranean that have spread into Europe species that are suited to Europe north of have been able to do so because man’s activi- the Mediterranean region can be expected to ties have provided suitable habitats – alien spread throughout mainland Europe with plants, glasshouses, habitations, etc. little hindrance from natural barriers. Alien insects have shown how open the Thanks to human movement and trade, corridors of movement are within Europe. even the English Channel has not stopped For example, the western corn rootworm, the horse chestnut leafminer (Fig. 12.7), and Diabrotica virgifera virgifera LeConte already the western corn rootworm has been (Coleoptera: Chrysomelidae), has spread reported in the UK (Fig. 12.6). from its initial appearance in Serbia in 1992 The small-scale ecoregions, e.g. DMEER within ten years as far as France, and looks (ETCNPB, 2000) (Fig. 12.4b), show no cor- set to reach all major maize-growing areas in relation with the spread of the two species the next few years (Fig. 12.6), unless it is considered above. The medium-scale sys- limited by climatic factors (Hemerik et al., tems (Fig. 12.2) of Bailey (1996) and The 2004). The horse chestnut leafminer, Times (1998) are also not very useful. It is Cameraria ohridella Deschka and Dimic really only at the scale of biomes (Olson et (Lepidoptera: Gracillariidae), has also al., 2001; Fig. 12.5) or of ecoclimatic zones moved rapidly through Europe (Fig. 12.7) (Bailey, 1996; Fig. 12.1) that the limits to through a combination of natural local dis- spread start to become apparent. This is not persal and human-facilitated long-distance to say that the small-scale DMEER ecore-

Fig. 12.6. The spread of Diabrotica virgifera virgifera LeConte in Europe since ﬁrst found in 1992 (FAO/Kiss and Edwards, 2004). 212 M.J.W. Cock et al.

Fig. 12.7. The spread of horse chestnut leafminer, Cameraria ohridella Deschka and Dimic, since it was first found in Europe in 1984 (M. Kenis, CABI Switzerland, 2004, personal communication). gions would not be useful for predicting the IBCAs should also be able to build up out- spread of a more specialized alien species, break populations and to spread quite eas- e.g. one tied to a particular host plant of ily, so are comparable with invasive species. limited distribution. However, when it Introduced IBCAs that are able to establish comes to species of major economic impor- in one part of Europe can therefore be tance, or those with the ability to change expected to disperse widely within their ecosystem functioning, such species are ecological limits over relatively few years. likely to be less specific in their ecological For those exotic IBCAs that are used in needs and so the broader scale ecoregion inundative biological control, much classifications should be more appropriate. depends on their potential to establish (see The examples presented above illustrate Boivin et al., Chapter 6, this volume) and that species which in recent years have disperse (see Mills et al., Chapter 7, this vol- caused major concern and evident impact ume). Often, these IBCAs have limited dis- have spread rather freely within Europe. persal capacities but if they can establish, Invasive species such as western corn root- this will only slow down their spread with- worm and horse chestnut leafminer are out reducing the area finally covered. It often characterized by a set of species traits should also be considered that the enor- that favour high population growth rates mous volume of movement of materials by and a rapid spread (Kolar and Lodge, 2001). road and rail transport, particularly in the In the classical biological control approach, more developed and politically united con- Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 213

tinents, can frequently facilitate the rapid between neighbouring countries or further. long-distance spread of species, and that All this should be considered against a back- physical barriers such as mountains and ground in which human movement and rivers are no barrier to this movement. trade is high volume and long distance Therefore it is not sensible for countries within Europe; things will be redistributed within Europe to act in isolation, and a freely and easily, and many species have the common facilitating procedure would be opportunity to extend their range with unin- appropriate, similar to the plant pest quar- tentional human assistance if they are able to antine system. The same conclusion can be do so. In practice, relatively few do. applied to other large land masses, such as What are the implications of movement North America and Africa, where there is of insects for study within Europe? At one already a more or less firm basis for consul- extreme, movement of a few kilometres tation through the North American Plant across common land borders within the Protection Organization and the Inter- same ecoregion is trivial and does not African Phytosanitary Council, respectively. merit regulation. At the other extreme, movement of species between disjunct similar ecoregions carries a risk and should be Ecoregions and Movement of regulated. What regulations are needed, Arthropods for Scientific Study and what guidelines to inform them? Movement of known exotic pests within Research organizations, producers and dis- Europe to areas where they do not occur is tributors of IBCAs may wish to import exotic obviously not to be countenanced and species to investigate their prospects as bio- should not be permitted except under per- logical control agents. Import of such organ- mit under appropriate quarantine condi- isms may carry risks to the environment if tions. Nevertheless, it would be pragmatic not handled under appropriate conditions to recognize that if an exotic insect in Europe can spread and establish more that prevent escape. At the time of import, widely, it will do so in time. As noted many biological and ecological characteris- above, movement between east and west tics of the organism may not be known and coastal North America, and between east the purpose of import may be to investigate and west Russia, i.e. within the same coun- this. In particular, if the organism has been try, is likely to be associated with higher collected in the wild and the organism is not risks than many movements within Europe, or little known, it should be kept in contain- i.e. across national borders. Would an open- ment (e.g. under quarantine) in order to borders policy for living material within identify and eliminate contaminants (see Europe be the simplest and most cost- Goettel and Inglis, Chapter 9, this volume). effective option, or are regulations needed? Thus, scientists and biological control We explore this question by discussing the practitioners need to move arthropods specific case of Switzerland, below. around to study them as potential IBCAs. In order to take the origin of IBCAs, Often, this will involve relatively short field potential hazard and adequate containment trips to collect material for study, but some- into account when importing IBCAs to times populations are easier to collect at Switzerland, CABI Bioscience Switzerland greater distances from the laboratory, e.g. Centre and Agroscope FAL Reckenholz con- species associated with particular crops not ducted two short workshops in 2002. The grown locally, or species associated with outcome is the proposal of a matrix with native plants that are only common in parts five classes of origin of the organism, three of their range. In a continent of small coun- groups of expected hazard if the organism tries, such as Europe, this might well involve should escape and establish in Switzerland movement of arthropods across borders. and four classes of containment options to Does this need to be regulated, and if so, handle the organism after import. These how? It is also likely that scientists and ama- proposals have led to the matrix shown in teur entomologists regularly move insects the Case Study below (Box 12.1). 214 M.J.W. Cock et al.

Box 12.1 CASE STUDY: A model for the movement of insects for study within Europe. The following protocol is under discussion in Switzerland with regard to the movement of insects within Europe for purposes of scientiﬁc study.

Containment options for insects for study based on a classiﬁcation according to origin and perceived hazard.

Hazard (low to high) Class Origin of organism and containment (1 to 4)

Low Medium High

1 Native to Switzerland and to countries close to it 1 na na 2a Populations of species native to class (1) countries, imported from other European countries 1 2 na 2b Populations of species native to class (1) countries, imported from outside Europe 1 2–3 4 3 Native to Europe, but not to class 1 countries 1 2 3 4 Non-native residents 1 2–3 4 5 Exotic 1–2 3–4 4

na This combination is not anticipated.

Explanatory Notes Origin of organism Class 1: Switzerland, mainland France, Belgium, The Netherlands, Luxemburg, Germany, Denmark, Czech Republic, Austria, Liechtenstein, northern Italy. Class 2: Populations of species native to class 1 countries, but collected outside that range of distribution. Class 3: ‘Europe’ includes Russia as far east as the Ural Mountains, and south to the Caucasus Mountains (but including neither mountain range), the Mediterranean islands and the European part of Turkey, but does not include the Atlantic off-shore islands: Madeira, Azores, Canaries, Iceland, Greenland. Class 4: Non-native species that are established as resident in class 1 countries (the level of hazard would depend partially on upon how close the nearest resident populations were to the research facility). Class 5: Not native to Europe (i.e. class 1 and class 3 countries). Hazard (any imaginable adverse effect of escape by the organism) Low: Biology/ecology of species is known and safe (e.g. narrowly host speciﬁc, cannot establish/survive winters in Switzerland, already widely established in the proposed area of study). Medium: Biology/ecology of species/strain is only partially known, but hazard appears to be low. High: Known adverse effects or biology/ecology of species unknown and adverse effects possible. Containment options Option 1: Experimental use of imported organism without containment. Option 2: Experimental use of imported organism in open laboratory and greenhouse. Option 3: Experimental use of imported organism in closed laboratory/climatic chamber only. There is much that could be done under level 3 without going to level 4 ‘full quarantine’: e.g. increase the number of doors between the facility and the outside, use of handling boxes in the laboratory, safe disposal of associated materials, etc. Option 4: Experimental use of imported organism only in a suitable quarantine facility as permitted by the appropriate government authority. Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 215

Let us re-examine this approach in light nearly all of Poland; Lithuania and south- of the ecoregion classification schemes dis- ern Estonia; southern Moldavia; a small cussed above. What scale of ecoregion con- part of western Russia; most of western cept is being proposed? Can the designated Ukraine; western Slovakia; Hungary; west- areas be better defined in terms of one of ern Bulgaria; Slovenia; Croatia; northern the ecoregion schemes? and western Serbia; most of Bosnia; Switzerland (Fig. 12.8a) comprises part Montenegro; most of Italy; all mainland of two DMEER (ETCNPB, 2000) ecore- France except the Pyrenees; Belgium; gions: (1) ‘Alps conifer and mixed forests’ Netherlands; and western Denmark. The and (2) ‘Western European broadleaf addition of the small ecoregion (11) ‘Baltic forests’. It would be entirely reasonable to mixed forests’ in eastern Denmark, north- anticipate that, within an ecoregion, eastern Germany and north-western species that are able to disperse will Poland would simplify applying the ecore- spread widely with no barriers, i.e. there gions along political boundaries, although would be no quarantine risks to there is no scientific justification for this Switzerland from within these two ecore- beyond the fact that most of these ecoregions. The two ecoregions which comprise gions are varieties of mixed forest. Note Switzerland extend to south and central that the Pyrenees, Italian mountains and Germany, much of the Czech Republic, Carpathian mountains are still excluded. most of Austria, part of Slovenia, the far Thus, this grouping falls between class (1) north of Italy, much of eastern France, and class (3) of the suggested system, but Luxembourg and southern Belgium. One highlights the fact that disjunct mountain ecoregion that almost extends into the systems may represent a risk. Swiss Ticino (3) ‘Po Basin mixed forests’, Turning to Bailey’s (1996) ecoregions is limited to northern Italy. This group of (Figs 12.2a and 12.8a), Switzerland is com- three ecoregions correlates closely with prised of groups 240 and 240M, i.e. the original class 1 countries in the matrix. ‘Marine division’ and ‘Marine Regime If two more ecoregions were added to this Mountains’. Ecoregion 240 is closest to the group – (4) ‘Southern temperate Atlantic’ outer ring of DMEER categories and rather and (5) ‘Northern temperate Atlantic’, it close to the class (1) countries of the would closely approximate the class 1 matrix. It includes northern Spain, much of countries proposed, and justify the use of the British Isles and southern Scandinavia these political units. – which were previously excluded, but An argument can also be made that if a does not extend as far to the east as the species can cross from one ecoregion to outer DMEER grouping. Adding ecoregions the next, i.e. along a common border, there 210 (‘Warm Continental Division’), 220 is nothing that would have stopped that (‘Hot Continental Division’) and 250 species from spreading into and through (‘Prairie Division’) to this group would the second ecoregion if it could. On this bring the area in line with Vegetation Type basis, in addition to the three ecoregions (6) Broadleaf Forest (deciduous) of The mentioned above, the two ecoregions Times (1998) (Fig. 12.2b), and extend the which cover Switzerland themselves bor- region in a narrow tongue as far as the der five more DMEER regions: (6) ‘Central Urals. European mixed forests’; (7) ‘Pannonian The situation for Switzerland with mixed forests’; (8) ‘Dinaric mountains regard to the Biogeographical Regions of mixed forest’; (9) ‘Italian sclerophyllous the European Environment Agency (EEA, and semi-deciduous forests’; and (10) 2003) is instructive (Fig. 12.8b) – on the ‘North-eastern Spain and southern France one hand it includes part of the Mediterranean’. This area would extend Continental Region, which extends from the area from which invasions would have France to the Urals to Bulgaria, but on the happened if they could have happened: to other hand it includes the Alpine Region, most of Germany; all the Czech Republic; which groups the main mountain ranges of 216 M.J.W. Cock et al.

(a)

(b)

Fig. 12.8. Ecoregions around Switzerland: (a) DMEER (ETCNPB, 2000) regions around Switzerland (cf. Fig. 12.4(b): 1, Alps conifer and mixed forests; 2, Western European broadleaf forests; 3, Po Basin mixed forests; 4, Southern temperate Atlantic; 5, Northern temperate Atlantic; 6, Central European mixed forests; 7, Pannonian mixed forests; 8, Dinaric mountains mixed forest; 9, Italian sclerophyllous and semi-deciduous forests; 10, North-eastern Spain and southern France Mediterranean; 11, Baltic mixed forests; (b) Biogeographical Regions of Europe (EEA, 2003) around Switzerland (cf. Fig. 12.4(a): 1, Alpine; 2, Continental; 3, Atlantic; 4, Mediterranean; 5, Pannonian. Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 217

Europe. Thus, movement of organisms Discussion and Conclusions within the Continental Region would be low risk, movement between adjacent bio- An ecoregion approach is more scientifi- geographic regions (which would include cally valid than one based simply on politi- most of Europe) would be a slightly higher cal boundaries. Selection of the risk, whereas movement of organisms appropriate scale is critical for making the between the disjunct mountainous areas of approach work, but interpretation will the ‘Alpine’ Biogeographical Region would always be needed – i.e. there are unlikely be undesirable. to be simple decision rules. The minimum Combining the two Vegetation Types inclusive group within which a country (6) ‘Broadleaf Forest (deciduous)’ and (1) should consult regarding a possible biolog- ‘Mountain Vegetation’ from The Times ical control release is probably the biome (1998) (Fig. 12.2b) would produce an area (Olson et al., 2001) or Biogeographic very similar to the European section of the Region (EEA, 2003). This suggests that ‘Humid Temperate’ zone in Bailey’s four within Europe there is a role for a regional ecoclimatic zones (Fig. 12.1). This is still consultation process. Although there is no less than all of Europe, which includes two such process in place at present for IBCAs, other ecoclimatic zones: ‘Polar’ and ‘Dry’. future discussion of mechanisms and regu- Whether insects from these two ecocli- lation of the introduction of biological con- matic zones could represent a possible trol agents will need to address this aspect. threat to the rest of Europe is not clear, but There are other approaches to ecological a priori it seems unlikely that they could classification that may be at least as rele- survive if they were not already wide- vant for biological control purposes as the spread. ecoregion approach. For example, to pre- So, in general, looking at the position of dict the spread of a phytophagous insect, Switzerland in relation to these different the distribution of its potential host plants ecoregion schemes available, this broadly is obviously a useful parameter. No phy- supports the intuitive suggestions pro- tophagous insect can become established in an area where there are no suitable host posed based on political boundaries. plants. Equally, insects can be limited by However, the ecoregion approach now factors other than food plants, so that there shows that it would be appropriate to exer- may be extensive areas of apparently suit- cise caution and regulate the movement of able food plants where phytophagous insects from the disjunct mountain ranges insects are unable to persist. Specialist rare of Europe (Pyrenees, Italy, Carpathians, insects are especially likely to be very Scandinavia, Urals, Caucacus, etc.) to much more limited than the mere availabil- Switzerland, whereas, for lower-altitude ity of their food plants would suggest. areas the risks seem relatively small, and Conversely, adaptable and economically regulation, at least for contiguous and adja- damaging insects may well spread to the cent ecoregions, need be little more than a limits of their available food plants (see notification process. above discussion of western corn rootworm Similar analyses can be performed for and horse chestnut leafminer). other countries in Europe or elsewhere. In addition to vegetation, climate can be Movement within contiguous, similar a powerful predictor of distribution. The ecoregions carries minimal risk, and will computer programme CLIMEX has been seldom merit substantial regulation, even if developed as a climate-matching tool cross-border movements are involved. In (Sutherst and Maywald, 1985; Sutherst, contrast, movement of material between 1991, 2003; Sutherst et al., 1999), and has similar, but disjunct, ecoregions will been used quite extensively in biological always carry risks and needs to be regu- control. Most studies are either retrospec- lated, even if the movements are within tive and explanatory (e.g. Byrne et al., one country. 2002), attempt to predict spread of 218 M.J.W. Cock et al.

introduced pests or biological control ing optimum strategies for introduction of agents (e.g. Julien et al., 1995; Scott and classical biological control agents in order Yeoh, 1999; Mason et al., 2003) or select to obtain establishment, but it is less likely areas in the native range for surveys with a to be useful in predicting subsequent climate that is similar to the invaded range spread. (e.g. Goolsby et al., 2003). There is a short- It is also important to consider whether age of studies evaluating predictions in an ecoregions approach could be used for light of subsequent events (e.g. Goolsby et predicting whether an exotic inundative al., 2005), but over time, data will accumu- IBCA would fail to become established late on the accuracy of this approach so where released. This is generally that it can be refined. Using a general cli- unwanted, and incorrectly predicting that a mate model misses the opportunity to species would fail to become established identify which of the many climatic factors could lead to serious non-target effects. In may be the key to the potential distribution practice, establishment and subsequent of a species; supplementary studies can be spread is likely to be limited by specific carried out to look at some of the more factors, or a combination of factors, e.g. obvious physiological parameters, in order minimum winter temperature or availabil- to refine and improve predictions (e.g. ity of a particular host plant, which is Byrne et al., 2002; see also Boivin et al., likely to differ from specific vegetation, cli- Chapter 6, this volume). mate or ecoregion classifications. We there- The INSIM programme (Mols and fore consider an ecoregions approach Diederik, 1996) is a simpler approach, unsuitable for making robust predictions based upon actual weather data and the that an introduced IBCA cannot become day-degree requirements for a species to established in a particular area. complete at least one generation per year. However, an ecoregion approach offers a Hemerik et al. (2004) use this approach to useful tool for interpreting and managing predict the natural rate of spread and limits the risks of moving organisms within a to spread of the western corn rootworm, country, or within a continent. The matrix Diabrotica virgifera virgifera in Europe (cf. model developed for this purpose in Fig. 12.6). They conclude that the number Switzerland (Box 12.1), which is actually of generations will decrease as the beetle based on countries, is reasonably compati- spreads north and into the mountainous ble with the biome (Olsen et al., 2001; Fig. areas, such as the Alps, until it reaches the 12.5) or biogeographical region (EEA, 2003; limit where it is unable to complete a gen- Fig. 12.4a) level of ecoregion classification. eration in a year. Thus, the matrix can be used to combine Obviously, predictions using this the relevance of an ecoregion approach approach can only be based on climatic with the practicalities of using political parameters – altitude, soil, vegetation and boundaries. other biotic factors are not considered, and these factors can cause errors in predictions (Samways et al., 1999; National Acknowledgements Research Council, 2002; Samways, 2003). Using ecoregions to predict the ability of The development of the ‘matrix model’ an insect to become established may well presented in Box 12.1 benefited from inter- have some advantages over these active discussions with Dr Hans Dreyer approaches, since ecoregions are a way of and Dr Alfred Klay of the Swiss Federal combining vegetation and climate data. Office of Agriculture. Discussions at the Matching ecoregions for the source area of Engelberg workshop, and specific com- classical biological control agents could ments by Dr Guy Boivin and Dr Kim optimize the chances of establishment in Hoelmer helped us crystallize our ideas. the target area. An ecoregion approach may We thank Dr Robert G. Bailey and thus be considered as one tool for predict- Springer for permission to use Figs 12.1 Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 219

and 12.2 (upper), Professor J. Kiss for per- Biodiversity and the World-wide Fund For mission to use Fig. 12.6 and Dr Marc Kenis Nature for making publicly available Figs for allowing us to use data from his unpub- 12.3, 12.4a, 12.4b and 12.5, respectively. lished inventory of alien insects in We also thank Dr Tim Haye (CABI Switzerland and Fig. 12.7, hitherto unpub- Bioscience Switzerland Centre) for helping lished. We appreciate and thank the United to redraw Fig. 12.2b from The Times (1998) States Department of Agriculture, and edit Fig. 12.4a, and Riccardo de Filippi European Environment Agency, European (Agroscope FAL Reckenholz) for help in Topic Centre on Nature Protection and editing Fig. 12.5.

References

Bailey, R.G. (1996) Ecosystem Geography. Springer Verlag, New York. Bailey, R.G. (1998) Ecoregions. The Ecosystem Geography of the Oceans and Continents. Springer Verlag, New York. Bailey, R.G. (2001) Description of the ecoregions of the United States. United States Department of Agriculture – Forest Service, http://www.fs.fed.us/land/ecosysmgmt/ecoreg1_home.html (accessed 27 May 2005). Bale, J.S., Masters, G.J., Hodkinson, I.D., Awmack, C., Bezemer, T.M., Brown, V.K., Butterfield, J., Buse, A., Coulson, J.C., Farrar, J., Good, J.G., Harrington, R., Hartley, S., Jones, T.H., Lindroth, R.L., Press, M.C., Symrnioudis, I., Watt, A.D. and Whittaker, J.B. (2002) Herbivory in global climate change research: direct effects of rising temperature on insect herbivores. Global Change Biology 8, 1–16. Bohn, U., Gollub, G. and Hettwer, C. (2000) Karte der natürlichen Vegetation Europas. Maßstab 1:2.500.000 Karten und Legende. Bundesamt für Naturschutz, Bonn, Germany. Byrne, M.J., Currin, S. and Hill, M.P. (2002) The influence of climate on the establishment and success of the biocontrol agent Gratiana spadicea, released on Solanum sisymbriifolium in South Africa. Biological Control 24, 128–134. Clark, G.M., Maret, T.R., Rupert, M.G., Maupin, M.A., Low, W.H. and Ott, D.S. (1998) Quality in the Upper Snake River Basin, Idaho and Wyoming, 1992–1995: US. Geological Survey Circular 1160, (see also http://water.usgs.gov/pubs/circ1160 (accessed 27 May 2005)). Cleland, D.T., Avers, P.E., McNab, W.H., Jensen, M.E., Bailey, R.G., King, T. and Russell, W.E. (1997) National hierarchical framework of ecological units. In: Boyce, M.S. and Haney, A. (eds) Ecosystem Management: Applications for Sustainable Forest and Wildlife Resources. Yale University Press, New Haven, Connecticut, pp. 181–200. Coope, G.R. (1978) Constancy of insect species versus inconstency of Quaternary environments. In: Mound, L.A. and Waloff, N. (eds) Diversity of Insect Faunas. Blackwell Scientific Publications, Oxford, UK, pp. 176–187. Coope, G.R. (1995) The effect of Quaternary climate changes in insect populations: lessons from the past. In: Harrington, R. and Stork, N.E. (eds) Insects in a Changing Environment. Academic Press, San Diego, California, pp. 30–48. Dasmann, R.F. (1973) A System for Defining and Classifying Natural Regions for Purposes of Conservation. IUCN Occasional Paper no. 7. International Union for Conservation of Nature and Natural Resources, Morges, Switzerland. Dasmann, R.F. (1974) Biotic Provinces of the World: Further Development of a System for Defining and Classifying Natural Regions for Purposes of Conservation. IUCN Occasional Paper no. 9. International Union for Conservation of Nature and Natural Resources, Morges, Switzerland. EEA (European Environment Agency) (2003) Europe’s Environment: the Third Assessment. Environmental Assessment Report No. 10. Luxembourg: Office for Official Publications of the European Communities, Luxembourg, (see also http://reports.eea.eu.int/environmental_assess- ment_report_2003_10/en (accessed 27 May 2005)). ETCNPB (European Topic Centre on Nature Protection and Biodiversity) (2000) DMEER: Digital Map of European Ecological Regions. http://dataservice.eea.eu.int/atlas/viewdata/viewpub.asp?id=7 (accessed 27 May 2005). 220 M.J.W. Cock et al.

FAO / Kiss, J. and Edwards, C.R. (2004) Spread of western corn rootworm in Europe 1992–2003, FAO WCR Network. WCR Net: Information page on the Western Corn Rootworm (Diabrotica virgifera virgifera LeConte) supported by the Food and Agriculture Organization (FAO) of the United Nations, http://www.mkk.szie.hu/dep/nvtt/wcrnet/wcrnet-2.htm (accessed 27 May 2005). Gilbert, M., Grégoire, J.-C., Freise, J.F. and Heitland, W. (2004) Long-distance dispersal and human population density allow the prediction of invasive patterns in the horse chestnut leafminer Cameraria ohridella. Journal of Animal Ecology 73, 459–468. Goolsby, J.A., Wright, A.D. and Pemberton, R.W. (2003) Exploratory surveys in Australia and Asia for natural enemies of Old World climbing fern, Lygodium microphyllum: Lygodiaceae. Biological Control 28, 33–46. Goolsby, J.A., De Barro, P., Kirk, A.A., Sutherst, R., Ciomperlik, M., Ellsworth, P., Gould, J., Hoelmer, K., Naranjo, S., Rose, M., Roltsch, W., Ruiz, R., Pickett, C. and Vacek, D. (2005) Post-release evaluation of the biological control of Bemisia tabaci biotype ‘B’ in the USA and the development of predictive tools to guide introductions for other countries. Biological Control 32, 70–77. Hemerik, L., Busstra, C. and Mols, P. (2004) Predicting the temperature-dependent natural population expansion of the western corn rootworm, Diabrotica virgifera. Entomologia Experimentalis et Applicata 111, 59–69. IPPC (International Plant Protection Convention) (1996) Code of Conduct for the Import and Release of Exotic Biological Control Agents. International Standards for Phytosanitary Measures. Part 1 – Import Regulations. Food and Agriculture Organization of the United Nations, Rome, Italy. IPPC (International Plant Protection Convention) (2005) Guidelines for the export, shipment, import and release of biological control agents and other beneficial organisms. International Standards for Phytosanitary Measures. No. 3. https://www.ippc.int/servlet/CDSServlet?status=ND0xMz M5OS43NjA0NyY2PWVuJjMzPXB1YmxpY2F0aW9ucyZzaG93Q2hpbGRyZW49dHJ1ZSYzNz1p bmZv#koinfo (accessed 16 November 2005). James, P.E. (1966) A Geography of Man. Ginn-Blaisdell Publishing, Waltham, Massachusetts. Julien, M.H., Skarratt, B. and Maywald, G.F. (1995) Potential geographical distribution of alligator weed and its biological control by Agasicles hygrophila. Journal of Aquatic Plant Management 33, 55–60. Kolar, C.S. and Lodge, D.M. (2001) Progress in invasion biology: predicting invaders. Trends in Ecology and Evolution 16, 199–204. Mason, P.G., Olfert, O., Sluchinski, L., Weiss, R., Boudreault, C., Grossrieder, M. and Kuhlmann, U. (2003) Actual and potential distribution of an invasive canola pest, Meligethes viridescens (Coleoptera: Nitidulidae), in Canada. Canadian Entomologist 135, 405–413. Mols, P.J.M. and Diederik, D. (1996) INSIM a simulation environment for pest forecasting and simulation of pest natural enemy interaction. Acta Horticultura 416, 255–262. NAPPO (North American Plant Protection Organization) (2004) Nappo panel reports for 2003–2004. NAPPO, 21 pp. http://www.nappo.org/Reports/Reports-04-03-e.pdf (accessed 27 May 2005). Nash, D.R., Agassiz, D.J.L., Godfray, H.C.J. and Lawton, J.H. (1995) The pattern of spread of invading species: two leaf-mining moths colonizing Great Britain. Journal of Animal Ecology 64, 225–233. National Research Council (Committee on the Scientific Basis for Predicting the Invasive Potential of Nonindigenous Plants and Plant Pests in the United States) (2002) Predicting Invasions of Nonindigenous Plants and Plant Pests. National Academy Press, Washington DC. Noirfalise, A. (1987) Map of the Natural Vegetation of the Member Countries of the European Community and of the Council of Europe. Office for Official Publications of the European Communities, Luxembourg. Olson, D.M., Dinerstein, E., Wikramanayake, E.D., Burgess, N.D., Powell, G.V.N., Underwood, E.C., D’Amico, J.A., Itoua, I., Strand, H.E., Morrison, J.C., Loucks, C.J., Allnutt, T.F., Ricketts, T.H., Kura, Y., Lamoreux, J.F., Wettengel, W.W., Hedao, P. and Kassem, K.R. (2001) Terrestrial ecoregions of the world: a new map of life on Earth. BioScience 51, 933–938. (see also http://www.worldwildlife.org/science/pubs/bioscience.pdf (accessed 26 May 2005)). Parmesan, C., Ryrholm, N., Stefanescu, C., Hill, J.K., Thomas, C.D., Descimon, H., Huntley, B., Kaila, L., Kullberg, J., Tammaru, T., Tennent, W.J., Thomas, J.A. and Warren, M. (1999) Poleward shifts in geographical ranges of butterfly species associated with regional warming. Nature 399, 579–583. Purcell, A.H. and Saunders, S.R. (1999) Glassywinged sharpshooter expected to increase plant disease. California Agriculture 53, 26–27. Usefulness of the Ecoregion Concept for Safer Import of Invertebrate BCAs 221

Roekaerts, M. (2002) The Biogeographical Regions Map of Europe. Basic Principles of its Creation and Overview of its Development. European Environment Agency, Copenhagen, Denmark. Samways, M.J. (2003) Critical response from Professor Michael J. Samways. Journal of Biogeography 30, 817. Samways, M.J., Osborn, R., Hastings, H. and Hattingh, V. (1999) Global climate change and accuracy of prediction of species’ geographical ranges: establishment success of introduced ladybirds (Coccinellidae, Chilocorus spp.) worldwide. Journal of Biogeography 26, 795–812. Sarto i Monteys, V. (1992) Spread of the Southern African lycaenid butterﬂy, Cacyreus marshalli Butler, 1898, (Lep: Lycaenidae) in the Balearic Archipelago (Spain) and considerations on its likely introduction to continental Europe. Journal of Research on the Lepidoptera 31, 24–34. Sclater, P.L. (1858) On the general geographical distribution of the members of the class Aves. Journal of the Proceedings of the Linnean Society: Zoology 2, 130–145. Scott, J.K. and Yeoh, P.B. (1999) Bionomics and the predicted distribution of the aphid Brachycaudus rumexicolens (Hemiptera: Aphididae). Bulletin of Entomological Research 89, 97–106. Sutherst, R.W. (1991) Predicting the survival of immigrant pests in new environments. Crop Protection 10, 331–333. Sutherst, R.W. (2003) Prediction of species geographical ranges. Journal of Biogeography 30, 805–816. Sutherst, R.W. and Maywald, G.F. (1985) A computerised system for matching climates in ecology. Agriculture, Ecosystems and Environment 13, 281–299. Sutherst, R.W., Maywald, G.F., Yonow, T. and Stevens, P.M. (1999) CLIMEX: Predicting the Effects of Climate on Plants and Animals. CSIRO Publishing, Collingwood, Australia. The Times (1998) The Times Atlas of the World. Times Books, London, UK. Thomas, C.D., Cameron, A., Green, R.E., Bakkenes, M., Beaumont, L.J., Collingham, Y.C., Erasmus, B.F.N., Ferreira de Siqueira, M., Grainger, A., Hannah, L., Hughes, L., Huntley, B., van Jaarsveld, A.S., Midgley, G.F., Miles, L., Ortega-Huerta, M.A., Peterson, A.T., Phillips, O.L. and Williams, S.E. (2004) Extinction risk from climate change. Nature 427, 145–148. Udvardy, M.D.F. (1975) A Classiﬁcation of the Biogeographical Provinces of the World. IUCN Occasional Paper No. 18. International Union for Conservation of Nature and Natural Resources, Morges, Switzerland. UK Moths (2005) 332a Firethorn Leaf Miner Phyllonorycter leucographella (Zeller, 1850), http://cgi.ukmoths.force9.co.uk/show.php?bf=332a. (accessed 26 May 2005). US-EPA (United States Environmental Protection Agency) (1996) Draft TMDL Program Implementation Strategy. Glossary, http://www.epa.gov/owow/tmdl/strathp.pdf (accessed 26 May 2005). Wallace, A.R. (1876) The Geographical Distribution of Animals. With a Study of the Relations of Living and Extinct Faunas as Elucidating the Past Changes of the Earth’s Surface. 2 vols. Macmillan and Co., London. 13 Statistical Tools to Improve the Quality of Experiments and Data Analysis for Assessing Non-target Effects

Thomas S. Hoffmeister,1 Dirk Babendreier2 and Eric Wajnberg3 1Institute of Ecology and Evolutionary Biology, University of Bremen, Leobener Str. NW2, D-28359 Bremen, Germany (email: [email protected]; fax number: +49-421-218-4504); 2Agroscope FAL Reckenholz, Reckenholzstr. 191, 8046 Zürich, Switzerland (email: [email protected]; fax number: +41-44-377-7201); 3INRA, 400 Route des Chappes, BP 167, 06903 Sophia-Antipolis Cedex, France (email: [email protected]; fax number: +33-4-92-38-6557)

Abstract

When testing non-target effects of biological control agents, it is essential that conclusions can be drawn with high precision and confidence. However, testing non-target effects confronts the experimenter with a number of difficulties. First of all, biologically positive cases of not finding any non-target effect are more difficult to substantiate, since in standard statistical hypothesis testing, we can only associate a precise probability to err with rejecting the null hypothesis that assumes no effect, but not with accepting it. The main problem here is the effect size, i.e. the difference from the null hypothesis that is considered biologically meaningful. Secondly, there will usually be a trade-off between the costs associated with increased sample sizes and the confidence of the results of non-target effects testing. Often, sample size will be a limiting factor due to a shortage of animals, space for testing arenas, research funding, etc. Thus, it becomes especially important to optimize the experimental design and to use the most powerful statistical tools to obtain maximum confidence in the test results. Here, we will briefly (i) introduce the reader to common pitfalls of experimental design, (ii) explain the nature of errors in statistical testing, (iii) point towards methods that determine the power of statistical tests, (iv) explain the distribution of the most commonly encountered types of data, and (v) provide an introduction to powerful statistical tests for such data.

Introduction on design and statistical approaches in the life sciences (e.g. Crawley, 1993; Hilborn The last two decades have seen almost a and Mangel, 1997; Crawley, 2002; Grafen revolution in statistical methods used in and Hails, 2002; Quinn and Keough, 2002; ecological investigations, as can be wit- Ruxton and Colegrave, 2003), and from nessed from a number of recent textbooks changes in approaches used in more recent ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 222 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Statistical Tools to Improve the Quality of Experiments 223

publications. This reflects both the This example inspired us to use a increased awareness that conclusions in computer-generated data set in this chapter ecological studies need to be drawn in a to elucidate some of the problems of design quantitative manner with high precision and analysis of non-target effect studies, the and confidence, and that, for a number of non-independence of data that leads to reasons, large sample sizes are often difficult pseudoreplicates, the lack of statistical to obtain. Thus, the need for powerful statis- power and the difference between powerful tical tools that allow precise analysis from and less powerful statistical techniques. limited sample sizes is evident. Formerly, Imagine the following research question and the statistical analysis of data in ecological set-up: we wanted to know whether plant- investigations has been fraught with the dif- ing genetically modified plants that are ficulty that many, if not most, of the data resistant to a target pest species would affect sampled for this purpose are not normally the biodiversity of non-target insects in the distributed, and are thus not suitable for the crop field. For this, we were allowed to do parametric ‘standard’ approaches of our experiments on a single large field. Analysis of Variance (ANOVA) and Student Imagine further that we partitioned our field t-tests. Instead, non-parametric statistics into three sections; thus, we had one section such as, e.g. Kruskal-Wallis and Mann- with the GMO treatment, adjacent to the Whitney U-Tests, have been used that are section with the conventional crop (serving known to be less powerful. In theory, the as control), and on the last section an isoline lack of power of non-parametric statistics of the genetically modified crop, which does may be compensated by larger sample sizes. not express the resistance against the herbi- However, an increase in sample size is vore pest (serving as a second control), was often unfeasible for agricultural entomolo- sown. We sampled the biodiversity of non- gists, who are usually limited by the time target insects at ten spots within each of the that can be invested, the money that can be field sections. Altogether, we received ten spent on experiments, and/or the number of data points for each of the three treatments. replicates that can be obtained, through a Imagine we found that the biodiversity of shortage of either experimental fields or non-target insects in one treatment, e.g. the insects to work with. Besides such restric- GMO treatment, was significantly lower. tions, several other problems might arise, Can we conclude with confidence that the most of which can be well illustrated by the GMO crop affects the biodiversity of non- following example. A couple of years ago, target insects negatively? Not necessarily. one of the authors of the present chapter Remember that all the samples for the heard a talk at an entomological conference, GMO treatment came from one region of where an investigation into the possible the field. It is possible that the biodiversity side-effects of genetically modified organ- of non-target insects had been lower on isms (GMO) on biodiversity in crop fields this side of the field, e.g. due to its proxim- was presented. The authors did not find sig- ity to a road. Thus, our spatial clustering of nificant treatment effects in most of their samples has made it impossible to attribute tests, but we found it difficult to decide the biodiversity effect to the GMO treat- whether the lack of treatment effects was ment with confidence, and our ten samples due to a non-optimal experimental design per field section must be considered as and analysis of the data or whether the con- being pseudoreplicates. clusion of no effect could be drawn with Now, assume we had chosen to do our confidence. Non-target effects of GMOs are experiment in 30 fields, each allotted to one an issue of risk assessment that corresponds of the three treatments at random, such that well with investigations on non-target we obtained ten fields per treatment. We effects of natural enemies, and thus is used then find a small trend of decreased biodi- here for an illustration of general problems versity in the GMO treatment compared in design and analysis of risk assessment with the two control treatments. However, studies. using a Kruskal-Wallis test (because data are 224 T.S. Hoffmeister et al.

not normally distributed), this trend does support such a conclusion. This piece of not appear to be statistically significant. Can information is still stated only rarely in we conclude with confidence that the GMO research papers, and powerful statistics are treatment had no negative effect? To eluci- not yet always employed or even available. date this, we turned our investigation Therefore, in the present chapter, we will upside down. Let us assume now that we briefly outline the logic of statistical testing have an effect of the GMO treatment that and point towards important advances in reduces the biodiversity by 20%. Using a statistical techniques for the testing of non- sample size of ten randomly drawn data target effects. We will refer to many of the points from a Poisson distribution (note that measurement variables mentioned in other our index of biodiversity is based on species chapters of this book and provide sugges- counts, and that counts are usually Poisson tions for their analysis. That does not say distributed), with appropriate means for that we can and do cover everything of each of our three treatments, how often importance for the design and analysis of would we find a statistically significant dif- testing non-target effects. However, if we ference using a Kruskal-Wallis test? In fact, can increase awareness of possible pitfalls we would find a significant difference in of experimental design and point towards only about 23 out of 100 cases. Thus, the solutions or refer to some of the excellent power of this test is relatively low. Using statistics primers, this chapter might help to more powerful statistical tests would improve the precision and accuracy of such increase the power slightly: using a experiments. Though this chapter focuses Generalized Linear Model with appropriate on non-target effects of biological control Poisson distribution we would find a signifi- agents, we would further like to stress its cant difference in about 27 out of 100 cases. relevance for other studies dealing with risk Even if powerful statistical approaches assessment, e.g. non-target effects of pesti- are employed, the amount of replicates nec- cides or GMOs. essary to allow conclusions with high preci- In the following sections, we will start sion can be enormous. In our example given by reviewing the very basics of statistical here, 126 instead of 30 fields would have to testing, i.e. the hypotheses involved in sta- be studied to detect a reduction of 20% in tistical testing and the errors associated biodiversity with confidence. In the largest with accepting or rejecting those hypothe- study conducted so far on the side-effects of ses. Subsequently, we will discuss the GMO, a power analysis has suggested that effect size and power of statistical tests, 60 fields per crop had to be sampled across measurements that are of high relevance three years to detect effects of ecological sig- given a statistical test does not return significance (Perry et al., 2003; Rothery et al., nificant results. Further, the need to obtain 2003). An experimental design of this extent independent data for statistical testing and will perhaps be impossible in most cases the danger of pseudoreplication will be where we wish to test possible non-target explained, and also how randomization effects of biological control agents, and it can prevent pseudoreplication. Building will not even always be necessary. What upon this, we present powerful statistical will be necessary, instead, is a robust design tools, such as Generalized Linear Models and the decision by the researchers about and Cox regressions, for the analysis of the what magnitude of an effect is desirable to kind of data that will typically be gener- be detected. This requires knowledge of the ated when assessing non-target effects. power of the statistical testing procedures applied, and in the case of insignificant results, stating the power of the statistical Two Ways to Err in Statistical Testing test used. It is only then that we can evalu- (α- and β-errors) ate whether an insignificant finding is likely to mean that there is no ecological effect, or By performing an experiment it remains whether the data are not strong enough to impossible to prove, for example, that a nat- Statistical Tools to Improve the Quality of Experiments 225

ural enemy will never attack a non-target rejected, we have two ways to err (Table host or prey. Using a sound experimental 13.1). An α-error (also called Type I error) design, we can aim only at achieving high occurs if our experimental results suggest accuracy and precision in what we conclude there is an effect of the factor of interest on from the sample that we have tested. Yet, the variable we wish to explain (the so- using standard statistical procedures, there is called ‘dependent variable’) when in fact always some possibility that our interpreta- there is none, thus if we reject H0 provided β tion of the data is wrong. This is due to the that H0 is correct. A -error (also called Type fact that all the measurement variables we II error) occurs if there is a true effect of the are interested in are usually subject to ran- factor in question, but our experiment fails dom variation (i.e. variation between sample to detect this effect, thus if we do not accept units that cannot account for a treatment fac- H1 when H0 is wrong (Fig. 13.1, Table 13.1). tor under consideration), and that our con- Only the α-error can be immediately quanti- clusion is based on a sample rather than on ﬁed: the P-value associated with a test statis- the entire population. Since we conclude tic immediately provides the probability of from a statistical test either that the null committing an α-error. Usually, the null hypothesis (H0) is wrong, and can thus be hypothesis is rejected if the probability of rejected, or that the alternative hypothesis committing an α-error is 0.05 or less. In that

(H1) is wrong, and thus H0 cannot be case, the alternative hypothesis is accepted.

Interpretation:

Do not reject H0 Reject H0 Do not accept H1 Accept H1

␤-error ␣-error Fig. 13.1. Graphical representation of α-error (area hatched in white and black) and β -error (area hatched in grey and black) probabilities, using a one-sided t-test, comparing, e.g. encounter rates of biological control agents with non-target hosts. The curves on the left (for the null hypothesis) and right (for a specified alternative hypothesis) represent the probability sampling distribution of the statistical test done. Note that, usually, the alternative hypothesis is not specified, i.e. H1 is just different from H0, and the probability distribution of the statistical test done for H1 is unknown (modified from Quinn and Keough, 2002).

Table 13.1. Hypothesis testing: the truth associated with a decision derived from a statistical test when the null hypothesis is in fact true or not true.

Decision

H0 is not rejected H0 is rejected α Truth according to model H0 true correct -error (type I) β H0 not true -error (type II) correct 226 T.S. Hoffmeister et al.

It should be noted, however, that while the side of caution, is that it might be more statistical test returns a precise error prob- important to know the probability that an ability for rejecting H0, it is not possible to effect actually exists, given we did not find associate a precise error probability with an effect (the β-error), than accurately quan- α α α accepting H1 (see Fig. 13.1, where the -error tifying the -error. An -error fixed at 0.05 is is associated with the probability distribu- not necessarily meaningful. What we need to tion of H0 and not with H1). Moreover, it is know instead is the power of the statistical important to mention that the α-level is test (see next section, below), which might equal to the P-value of the test only if we lead us even to compromise between α- and perform a single test on a given set of data. If β-errors (see below). we wish to perform multiple pairwise comparisons between, e.g. means from an experiment with more than two treatments, the Example probability of making at least one α-error by chance among those tests increases with the Taking one of our above-mentioned data number of tests performed. This probability sets about the effects of GM-plants on the of making one or more α-error is called the biodiversity of non-target insects, our null family-wise α-error rate. When such tests are hypothesis would be that in plots with all not independent from each other, e.g. if one three treatments (GMO, non-GM isoline data set is used more than once in a test, the and conventional crop) the insect biodiver- family-wise α-error rate becomes difficult, if sity would be the same. Now, we will not not impossible to calculate precisely. Yet, use a Kruskal Wallis test (K-W-test) as in several procedures have been put forward to the introduction, because it would not be correct for multiple testing. The best known easy to calculate the β-error associated is the Bonferroni procedure, where the α- with the K-W-test. Instead, by using an error is divided by the number of tests per- ANOVA on square-root transformed data formed to obtain a new significance (to achieve Gaussian distribution of data), threshold and to keep a global α-error for the we find that the α-error is P = 0.584. Thus, whole testing procedure. However, this pro- rejecting the null hypothesis and accepting cedure is overly conservative, i.e. in danger that there is an effect of plant treatment on of committing β-errors (to elucidate this, biodiversity, one would err in 58.4% of the imagine shifting the border between accept- cases. Using a programme for Power analy- ing and rejecting H0 in Fig. 13.1 to the right; sis (see below) one can calculate the while α-error decreases, β-error increases). β-error. In our case, the β-error is 0.768, if The standard procedure for correcting for we wish to be able to detect a 20% differ- multiple testing is the sequential Bonferroni ence in biodiversity of non-target insects. procedure suggested by Holm (1979), where Thus, by not rejecting the null hypothesis, P-values of all m tests are ranked from and consequently, by not accepting the largest to smallest: the smallest P-value is alternative hypothesis, one would err in tested at α/m, the second smallest is tested at 76.8% of the cases. Obviously, this data set α/(mϪ1) and so on, until the first non-signif- is insufficient for either accepting the alter- icant result occurs. Recently, this procedure native hypothesis or for not rejecting the has also been criticized for being too conser- null hypothesis with confidence. vative (Moran, 2003), and there is an ongoing discussion about the optimal way to correct for multiple testing (Garcia, 2004; Ecological Effect Size, Replicate Neuhäuser, 2004; Verhoeven et al., 2005). Number and the Power of Statistical For a good overview on this topic, we Tests recommend the reader consults Quinn and Keough (2002). An important aspect that Statistical power is the probability that a needs particular attention when testing for given test will result in rejection of the null non-target effects, if we want to err on the hypothesis when that null hypothesis is, Statistical Tools to Improve the Quality of Experiments 227

indeed, false. Hence, power = 1Ϫβ. For any which form the basis of large parts of the particular test, power is dependent on the criticism of post hoc PA (Hoenig and α-level, the sample size, the sampling vari- Heisey, 2001; Di Stefano, 2003). Actually, ance and the so-called ‘effect size’ (ES). the P-value and power are dependent on The ES can be regarded as the magnitude the observed effect size such that tests with of the departure from the null hypothesis high P-values tend to have lower power, (observed ES), or as the difference between and vice versa. Therefore, calculating the values considered in the null and the power based on observed effect size and alternative hypotheses (see Fig. 13.1 and variance adds no new information to the below). analysis (Thomas, 1997). There are two general approaches in The second approach is to use a pre- Power Analysis (PA). The first one is defined effect size and observed variance. a priori PA, where one aims to estimate the Although it can be often difficult to define number of replicates necessary to reach a effect size properly, a useful approach, given power in an experiment. This can be especially in the context of assessing non- done by specifying the effect size, the α- target effects, has been to estimate an effect level, the desired power and (dependent on that can be considered biologically signifi- the type of analysis) the standard devia- cant. For instance, if an earlier study tion, which has to be estimated from pre- showed that 40% mortality caused popula- liminary experiments or from the tions to decrease in a wider context, this literature. It should be stressed, however, figure could be used as effect size for that estimates for the assumed variance of another study. As was shown in detail and the data are crucial. Carey and Keough exemplified with an example by Thomas (2002) have shown that the calculated sam- (1997), this second approach appears valu- ple size can vary by an order of magnitude able and allows one to evaluate whether depending on what dataset was used as a the sample size and α-level were likely to baseline for variance. The second approach result in detection of a biologically mean- is a post hoc analysis, where the researcher ingful effect. calculates the power achieved in an experi- A third approach is to establish an effect ment where the null hypothesis could not size based on the null and the alternative be rejected. While general agreement exists hypotheses. However, in this case the latter on the importance of a priori PA, there is needs to be formulated quantitatively, considerable debate on the value of which is only possible in certain instances. post hoc PA. In particular, parameters are In the absence of any strong arguments that estimated based on the sample data in are independent of the hypothesis being post hoc PA and are therefore interdepen- tested, the selection of an effect size dent. Since these estimates are subject to becomes arbitrary. However, in the case that sampling error, the computed values for effect size could neither be calculated based power are also subject to error and thus on biological significance nor from the alter- should be viewed with some caution. native hypothesis, some conventions can be Obviously, the statistical ability to used that were established by Cohen (1998). detect an effect (i.e. the power) increases He suggested using large, medium or small with the size of that effect and, in fact, effects as a convention, but the exact size of power is extremely sensitive to one’s these effects depends on the type of statisti- choice of effect size (Cohen, 1988). There cal analysis used. Many software packages are several approaches for calculating readily provide the standardized effect, post hoc power, and the effect size plays a which is basically the difference between H0 crucial role in all of them. The first and H1 divided by the standard deviation of approach is to use the observed effect size, the data. Although this avoids specifying e.g. taking the difference between the con- the sampling variance, we feel it unwise to trol and the treatment from the data, and use the standardized effect, because it is variance. However, this has clear flaws poorly related to any biologically meaningful 228 T.S. Hoffmeister et al.

effect. Rather, we recommend calculating in either direction, i.e. the actual treatment effect size based on either biological signifi- effect (D) is larger than a predefined δ | | δ cance or on a quantitative alternative (H0: D > ). The alternative hypothesis is | | δ hypothesis, but we also believe that it is the hypothesis of equivalence, or H1: D = . useful to put the ES of a study into context Again, this kind of analysis depends on the and to compare it to the procedure proposed knowledge of what a large (biologically by Cohen (1998). As a consequence of the meaningful) effect is, and the determina- importance of the ES outlined above, we tion of delta is similarly as difficult as also recommend strongly to report in detail determination of the effect size, as dis- on the ES underlying the analysis, rather cussed above. Given the large uncertainty than giving only a figure for β or power (cf. in this area, it is difficult to give advice on Steidl et al., 1997). this, though the general idea is appealing As a special case of PA, the maximum for decision-makers in risk assessment detectable effect size could be calculated; (Peterman, 1990). this can be performed easily by fixing the In conclusion, a priori PA can be a valu- power and the α-level appropriately. For able aid in the design of any study and, in instance, a researcher might wish to know particular, for monitoring programmes (see about the effects he/she would have been Barratt et al., Chapter 10, this volume). In able to detect given that the power is 0.8, a addition to the information on sample size figure that has often been used. What con- necessary to detect a given effect, it is also stitutes a sufficient power is not absolutely very valuable for reducing the cost of large- fixed, though conventions of 0.8 or 0.95 scale programmes as far as possible. have been suggested in the literature as Depending on the research question, post high power (Cohen, 1988). However, in hoc PA also can be very useful, particularly studies on environmental impact it is because it is not always possible to con- debatable why one should be satisfied with duct an ideally high number of replicates. accepting a four-times higher β- than α- It should be stressed that it is not possible error, which is the case when using the 0.8 with PA to associate an unambiguous prob- value. In contrast, one would like to be at ability of being correct in not rejecting the least as confident in avoiding β-errors and null hypothesis although, unfortunately, α-errors alike in such investigations. Thus, this has been done quite often in the past a researcher conducting experiments on (see Peterman, 1990). Instead, it is only potential non-target effects of a biological possible to argue that, with a probability of Ϫβ control agent could ask what maximum (1 ), there is no difference from the H0 possible effect size is consistent with α = β. greater than the effect size. If both the ES In this context, it is important to note that and β are small (and consequently the in studies dealing with non-target effects, it power is high), it is reasonable to conclude may be reasonable to increase the α-level, that the effect is negligible. It is particu- thereby increasing power. Eventually, it larly important in studies on non-target depends on the costs associated with spe- effects that a conclusion from a non-signifi- cific non-target effects. If the costs of com- cant statistical result should be subject to mitting β-errors are especially high, PA the same stringent probability standards as allows one to adjust α/β to reflect those a positive conclusion from a significant costs (Rotenberry and Wiens, 1985). statistical result. Power analysis could be As an alternative to classical PA, the used to provide these standards. application of confidence intervals and equivalence testing has been suggested recently (Hoenig and Heisey, 2001; Andow, Programs available 2003). Demonstrating such equivalence requires reversing the traditional burden of A comprehensive review on this topic was proof. In equivalence testing, the null written by Thomas and Krebs (1997), and hypothesis states that a large effect exists we do not attempt to provide a similar Statistical Tools to Improve the Quality of Experiments 229

detailed compilation here. Instead, we able to detect a 20% loss of biodiversity would like to refer to some published infor- (i.e. 6.4 species on average), the resulting mation – also on the internet – and high- transformed means for species numbers light a few recent developments. Since the would be 3, 3, and 2.72 for the three treat- influential paper by Thomas and Krebs ments, respectively, and the standard devi- (1997), some significant advances have been ation would be approximately 0.5 for all made, wherein some programs are able to treatments. A simple ANOVA did not calculate the power for regressions, compar- detect a significant effect. Entering the isons of means (ANOVA and General Linear above-mentioned values in a programme Models) or proportions (χ 2 tests), for corre- for PA returns an effect size of ES = 0.2828, lation tests and survival analysis. However, and thus what is conventionally described there are still several statistical tests for as medium effect size. With a total sample which PA is not available and, unfortu- size of 30 the power is (1Ϫβ) = 0.2397. nately, this includes the Generalized Linear How many replicates would be needed to Models, which can be a very powerful sta- achieve a power of 0.8 with such an effect tistical tool for data that do not follow a size? Using an a priori test in the pro- Gaussian distribution. There are also possi- gramme for PA we receive a necessary bilities for calculating power for other tests, sample size of n = 126. Thus, to demon- but efforts to do this can vary from relatively strate with high confidence that no effect simple to challenging. For instance, Monte exists would require a much larger study Carlo simulations can be used to calculate (see, e.g. Lang, 2004 for an estimate of nec- power for non-parametric tests (Peterman, essary sample sizes for non-target effects of 1990). Alternatively, data have to be trans- Bt-plants). formed to fit the assumptions of tests that Using another example, let us see how allow PA, e.g. log-transformation or square- large the sample size should be in a non- root transformation for count data, arc sine target effects study of an insect natural square-root transformation for proportions enemy. Using the above-mentioned exam- (see, e.g. Quinn and Keough, 2002, or ple of Thomas (1997), where the non-target another standard statistics textbook, for fur- population would be affected only if the ther information). Information on programs mortality were higher than 40%, we can and their strengths and weaknesses can be use 0.4 as effect size in an a priori test. If also obtained from the following home- we were to achieve a power of 0.8, the nec- pages: List of programs (from 1996) essary sample size in an experiment with (http://www.insp.mx/dinf/stat_list.html) two treatments would be n = 52. and paper by Thomas and Krebs (1997), (http://www.zoology.ubc.ca/~krebs/power. html). Avoid Being Trapped in Pseudoreplication

Examples In a seminal paper, Hurlbert (1984) published a review with respect to proper repli- Let us, again, take a look at the example cation of 176 ﬁeld experiments covering 156 data provided in the introduction. Using papers published in ecological journals ten ﬁelds for each treatment, the effect of between 1960 and 1983. Disturbingly, he GM plants on insect biodiversity was found that of the 101 studies applying infer- tested. If we were to analyse those data ential statistics, 48% contained pseudorepli- with ANOVA, we would have to transform cation. Pseudoreplication occurs whenever the species numbers to receive data with ‘inferential statistics are used to test for treat- Gaussian distribution. Square root transfor- ment effects with data from experiments mation (yЈ=√៮៮៮៮៮y+1) could be favourable in where either treatments are not replicated our case. If our control plots could harbour (though samples may be) or replicates are eight non-target species and we wish to be not statistically independent’ (Hurlbert, 230 T.S. Hoffmeister et al.

1984). Statistical independence means that plants or test cages, ensures that each individual data point might positively pseudoreplication can be avoided. For fur- or negatively deviate from the population ther reading, we encourage the reader to average due to random variation not related take a look at the section on pseudoreplica- to the deviation of another point. An tion in Ruxton and Colegrave (2003). example of lack of statistical independence is given in the introduction, where samples of a study on effects of GMOs on biodiversity Experimental Design: is were segregated by treatment and, thus, dif- Randomization Feasible? ferences attributed towards the treatment could equally well have been attributed to Basic textbooks on statistics always stress some factor typical for the section of the the point that, in order to draw relevant field the samples came from. In this case, the conclusions from an experiment, all treat- effects of treatments are potentially con- ments, replicates, etc., should be random- founded with inherent differences between ized. But what does that mean? field plots. Although the awareness of Randomization is a process that assigns researchers of avoiding pseudoreplication each replicate of each measured unit (ani- has increased and fewer studies contain mal, field, species, etc.) to each treatment analyses with pseudoreplicated samples, in a random order, rather than by choice. Heffner et al. (1996) and Ramirez et al. (2000) By doing this, any effect observed will be found, in a recent study on pseudoreplica- unequivocally attributed to the treatment tion in experiments on the olfactory studied, and not to lurking variables or response of insects, that an alarming 46% of uncontrolled factors which might vary over 105 studies were pseudoreplicated, because the length of the experiment. For example, of either a lack of independence in the stim- if one was interested in estimating the ulus or the experimental device, the host-range specificity of different potential repeated use of experimental animals or the biological control agents for a pre-release use of groups of animals. evaluation of non-target risks, he/she Thus, pseudoreplication is still an issue would sequentially offer several potential in the design of experiments, and much host species to the different biological con- care has to be taken to avoid any spatial or trol agents studied (see van Lenteren et al., temporal segregation of samples from dif- Chapter 3, this volume for a detailed ferent treatments. For example, when test- description of the proposed method to be ing the host specificity of biological control used). In this case, it would be preferable agents, it is essential that insects for the to: (i) test the different host species in a tests on non-target hosts do not come from random order for the different biological one rearing container or incubator and con- control agents, and (ii) test each host trol animals (for the test on target hosts) species, with the different biological con- come from another, or that non-target hosts trol agents taken in random order as well. are always tested in the same container or Indeed, in the case where the different host field cage or on the same plant while target species are always tested in the same order, hosts are tested in another cage or on uncontrolled factors varying with the dura- another plant. Equally, positions of experi- tion of the experiment could influence the mental units within an experimental cham- results and lead to differences that might ber or on a field plot need to be switched be wrongly interpreted as being due to dif- between treatments to avoid confounding ferences between species. Also, if all effects of differences in temperature and potential host species are tested succes- light conditions, etc. In the same manner, sively on each biological control species, a the full set of trials on non-target hosts difference observed between biological should not be conducted before tests with control species might simply be due to target hosts are carried out. Randomization uncontrolled factors varying with the total of testing order, or random assignment to duration of the experiment. Statistical Tools to Improve the Quality of Experiments 231

The goal of randomization is to produce analyses can be used to statistically test the comparable groups of replicates in terms of effect of a treatment. All these different general animal, field, etc., characteristics ‘classical’ methods assume that the distrib- and other key factors that might affect the ution of residuals around the fitted model outcome of the result obtained. In this way, (i.e. the error distribution) is normal all groups of replicates are as similar as (Gaussian). These different methods, which possible at the start of the study. At the end most readers will be familiar with, are of the study, if group outcomes differ called ‘General Linear Models’, since in its between each other, the investigators can simplest form, a linear model specifies the conclude with some confidence that the (linear) relationship between the variable treatment tested really influenced the (or response) y, to be explained (the so- results obtained. called ‘dependent’ variable), and a set of Most of the time, randomization is per- predictors, independent variables, the xs, formed by means of a computer program, such that coin flips or a table of random numbers to E(y) = b + b x + b x + … + b x (1) assign each measured unit to a particular 0 1 1 2 2 k k treatment. Advanced additional methods In this equation, b0 is the regression are sometimes used. coefficient for the intercept and the bi Is randomization always feasible, espe- values are the regression coefficients (for cially in evaluating non-target risk in bio- variables x1 to xk) computed from the data. logical control programmes? Unfortunately, So, for example, one could estimate (i.e. the answer is likely to be ‘no’. In the exam- predict) the weight of a parasitoid female as ple given above, where we wanted to esti- a function of the type and number of hosts mate the host-range specificity of different it feeds on. For many data analysis prob- potential biological control agents, it lems, estimates of the linear relationships would probably be unrealistic to design an between variables are adequate to describe experiment in which all host species tested the observed data, and to make reasonable and all potential biological control agents predictions for new observations. However, compared were randomized. Regarding the as we have seen previously (see Box 13.1), fact that the experimental scheme is based most of the biological traits that have to be on a succession of different measures (see measured to estimate non-target risks of van Lenteren et al., Chapter 3, this vol- biological control agents do not necessarily ume), having everything randomized follow a Gaussian distribution. In such would indeed imply having available, dur- cases, the relationship between the variable ing the total duration of the experiment, a (or response) y to be explained cannot ade- sufficient number of all host and biological quately be summarized by a simple linear control agent species at the right stage. In equation, for two major reasons: most cases this would simply be not feasible for economic or spatial reasons. All of DISTRIBUTION OF THE DEPENDENT VARIABLE. this should be kept in mind and, if real First, the dependent variable of interest may randomization appears not feasible, results have a non-continuous distribution and, of the experiments should thus be inter- thus, the predicted values of the statistical preted with caution. model should also follow the respective distribution. Any other predicted values are not logically possible. For example, an A Unified Approach Instead of a Menu investigator may be interested in predicting of Tests, General and Generalized one of two possible discrete outcomes (e.g. a Linear Models host is accepted or not). In that case, the dependent variable can take on only two When the traits to be analysed follow a distinct values, and the distribution of the Gaussian (also called ‘Normal’) distribu- dependent variable is said to be binomial. tion, standard t-tests, ANOVA or regression Another example would be to predict how 232 T.S. Hoffmeister et al.

Box 13.1. Measurement variables and their distribution Many ‘classical’ statistical approaches rely upon the assumption that the probability distribution of data from samples and the error terms of the statistical analyses (the residuals) are distributed normally, i.e. Gaussian. With many of the measurement variables we collect in non-target testing of biological control agents, these assumptions are not met. Count data such as, e.g. number of mature eggs of a female, are usually Poisson distributed, data for percentages are Binomial, and data for longevity are usually Exponential or sometimes Gamma distributed. In theory, it is possible to transform many kinds of data such that the assumptions of parametric tests are met, and those tests are also robust against small deviations from the assumptions; but ﬁrst of all it is hard to estimate the extent of the robustness against deviations from normality in error terms and, secondly, it is often advisable to use actual data rather than transformed data to meet assumptions. The probable most commonly collected types of data are listed in the table below. Note that deviations from the distributions mentioned in the table might occur in individual cases and that, in general in statistical testing, residuals should always be inspected for the adequacy of the model. Measurement variables often found in non-target testing of biological control agents and their distribution.

Measurement variable Distribution (most likely)

attack rate (per unit time) Gaussian dispersal capacity Gaussian, or Poisson if counts diurnal periodicity Gaussian egg load Poisson if counts or Binomial if proportion encounter rate (per unit time) Gaussian fecundity Poisson if counts or Binomial if proportion frequency of mating Poisson if counts or Binomial if proportion growth rate Gaussian host acceptance Binomial insertion/deletion of genes Poisson latency to attack Gamma morphology Gaussian rate of development Gaussian rate of predation/parasitism Binomial spatial distribution (i.e. counts) Poisson or Negative binomial survivorship/mortality Gamma thermal budget (degree-days) Gaussian

many females a male can mate with. If we LINK FUNCTION. A second reason why a were to study actual numbers and not aver- simple linear model might be inadequate to age number of matings per male, the depen- describe a particular relationship is that the dent variable (i.e. number of females mated) effect of the predictors on the dependent is discrete (i.e. a male can mate with one, variable may not be linear in nature. For two or three females and so on, but cannot example, the relationship between the mate with 3.46 females or with fewer than 0 fecundity of a synovigenic parasitoid females), and most likely the distribution of female and its age is most likely not linear that variable is highly skewed (i.e. most in nature. Under standardized conditions, males will mate with one, two or three fecundity will not markedly differ between females, fewer will mate with four or ﬁve, females of one or two days of age, whereas very few will mate with six or seven, and so such a difference will probably be greater on). In this case it would be reasonable to between older females, even with only one assume that the dependent variable follows day’s age difference. Probably some kind of a so-called Poisson distribution. a power function would be adequate to Statistical Tools to Improve the Quality of Experiments 233

describe the relationship between females’ Various link functions (see McCullagh age and fecundity, so that each increment and Nelder, 1989) can be chosen, depend- in days of age at older ages will have greater ing on the assumed distribution of the y impact on females’ fecundity, as compared variable values. Table 13.2 gives the four to each increment in days of age during main Generalized Linear Models that can early adult life. Put in other words, the link be used in experiments performed to esti- between age and fecundity is best described mate non-target risks of biological control as non-linear, or rather as a power relation- agents. ship in this particular example. The values of the regression parameters Generalized Linear Models are a gener- (and their variance and covariance) in the alization of general linear models and can Generalized Linear Model are obtained by be used to predict responses both for a so-called maximum likelihood estima- dependent variables that are not normally tion, which requires iterative computa- distributed and for dependent variables tional procedures. Several statistics which are non-linearly related to the pre- packages are currently available for doing dictors. Actually, general linear models can this. Then, tests of the signiﬁcance of the be considered as special cases of the gener- effects in the model can be performed via alized linear models. In general, in linear the Wald statistic, the likelihood ratio or models, the dependent variable values score statistic. Detailed descriptions of have a normal distribution and the link these tests can be found in McCullagh and function, which ‘connects’ the dependent Nelder (1989). variable to a linear combination of predic- In summary, Generalized Linear Models tor variables, is a simple identity function are powerful and efﬁcient tools for (i.e. the linear combination of values for analysing the sort of data collected in the predictor variables is not transformed). experiments performed to estimate non- To illustrate this, equation (1) gave the target risks of biological control agents. Just general linear model linearly associating a a brief overview has been provided here, response variable y with values on the x and there are several textbooks that pro- variables, while the relationship in the gen- vide a thorough description of this sort of eralized linear model is assumed to be statistical modelling approach (e.g. Hosmer and Lemeshow, 1989; McCullagh and E(y) = g(b + b x + b x + … + b x ) (2) 0 1 1 2 2 k k Nelder, 1989). We strongly recommend where g(…) is a function. Formally, the readers of this chapter to consult them. inverse function of g(…), say f(…), is called the link function, so that Examples f(E(y)) = b0 + b1x1 + b2x2 + … + bkxk (3) where E(y) stands for the expected value Using again our example from the introduc- of y. tion, we may analyse one of our computer-

Table 13.2. List of the main Generalized Linear Models that can be used in experiments performed to estimate non-target risk of biological control agents. Link functions indicated are the most ‘popular’ ones. Others can be used in particular cases (see McCullagh and Nelder, 1989 for an exhaustive description).

Distribution Model description Appropriate link function Type of data analysed

Normal Traditional linear model identity: ƒ(y) = y Normally distributed traits Binomial Logistic regression logit: ƒ(y) = log{y/(1Ϫy)} Fractions (proportions) Poisson Log-linear model log: ƒ(y) = log(y) Counts Gamma Gamma model with inverse: ƒ(y) = 1/y Time durations inverse link 234 T.S. Hoffmeister et al.

generated data sets using a Generalized (2) with only the non-target host and the Linear Model. Since we count the number natural enemy in the same field cage, and of species in each field plot, our data are (3) with only the target host and the natural most likely Poisson distributed. Specifying enemy in the same field cage. We are inter- a Generalized Linear Model with Poisson ested in whether the target host is killed at distribution and log link function, and a higher rate than the non-target host and using the number of species per plot as whether the mortality of the non-target host response variable and the crop treatment depends upon the fact of whether the target (GM-plants, non-GM isoline and conven- host is available to the natural enemy or tional crop) as factor, we find a P-value of not. We will not test whether the mortality 0.0962; thus, there is an insignificant trend rates of target and non-target host are equal in the data (Fig. 13.2a). An analysis of these within treatment (1), because these data data using an ANOVA on square root-trans- would not be independent. Rather, we will formed data yields a P-value of 0.147. A test whether the mortality of non-target visual comparison (Fig. 13.2b and c) and hosts in treatment (1) is equal to the mortal- statistical tests of the normality of the stan- ity of non-target hosts in treatment (2) and dardized residuals from both analyses (P = equal to that of the target hosts in treatment 0.515 and P = 0.474, respectively) suggest (3) (this is our null hypothesis). Again, we that the Generalized Linear Model is the will use computer-generated data. Given slightly more adequate approach to analyse that the mortality rates found were 4.1%, these data. Note that in both cases the sta- 10.6% and 50.5% in (1), (2) and (3), respec- tistical result is insignificant and, thus, the tively, we use a Generalized Linear Model null hypothesis of no effect cannot be with binomial distribution and logit link rejected, but also that the power analysis and find a significant effect overall and also suggests a lack of power to conclude with between treatments (Table 13.3). Thus, in confidence that there is no effect. this example, the non-target host is attacked As a second example, imagine a large at a relatively low rate, and even less so arena choice test as suggested by van when target hosts are available. This result Lenteren et al. (Chapter 3, this volume). We is visible from the estimates in Table 13.3, have three different treatments, with ten where the estimate for mortality is positive field cages each: (1) with the target host (or and thus higher in treatment (2) than in prey, which is used synonymously here) treatment (1), and much higher (more than and non-target host present in the same three times higher) in treatment (3) than in field cage together with the natural enemy, treatment (1).

Fig. 13.2. Simulated average (+ SE) effect of plant treatment on non-target insect species (panel a). The computer-generated data were analysed by means of a Generalized Linear Model with a log link function and ANOVA on square root transformed values, respectively. Panels (b) and (c) show Normality Plots for the standardized residuals of the respective tests. The relationship in panel (b) shows a slightly better ﬁt with normality assumptions than in panel (c). Statistical Tools to Improve the Quality of Experiments 235

Table 13.3. Results of a Generalized Linear Model on computer-generated data for the mortality rates of target and non-target hosts in large arena choice tests, using an experimental set-up as suggested by van Lenteren et al. (Chapter 3, this volume) (for details, see text).

Parameter Treatment Estimate DF χ-Square Pr > ChiSq

Intercept Ϫ3.2591 1 378.47 <0.0001 Target host (3) 3.2511 1 329.63 <0.0001 Non-target host in no-choice test (2) 1.0839 1 30.14 <0.0001 Non-target host in choice test* (1) 0 0 0.0000

* In the statistics package SAS, which was used here, the last treatment (in this case (1)) is set to zero by convention and the difference between the last and all other treatments (2) and (3) is tested.

Repeated Measurements in ment refers to this variable as repeated. Generalized Linear Models More details about GEE can be found, e.g. in Quinn and Keough (2002). Sometimes, the same individual insect or the same experimental plot is systemati- cally sampled more than once in the course Example of an experiment. Data from such samples violate the assumption of the indepen- Imagine the following field experiment (see dence of data points since they do not have van Lenteren et al., Chapter 3, this volume an equal probability of deviating positively for the rationale of a field test on non-target or negatively from the population average, effects of a biological control agent): we but contain some variation due to inherent wish to monitor the mortality induced by properties of the individual animal or the natural enemy on the target and non- experimental plot. They can thus be con- target hosts across a time period after the sidered pseudoreplicates that cannot be release of the natural enemy. We are espe- entered into statistical tests as independent cially interested in whether the attack rate data points. Liang and Zeger (1986) intro- on non-target hosts depends upon the den- duced Generalized Estimating Equations sity of the target host, which may decrease (GEE) to Generalized Linear Models as a over the course of the experiment. Again, method of dealing with such correlated we will use computer-generated data. In data. GEE is not available in all statistical our computer program, we select ten differ- packages that provide Generalized Linear ent field plots that we resample at five dif- Models, but at least SAS (procedure ferent times. Over time, the number of Genmod) and S-plus/R provide GEE. They target hosts per field plot decreases while require that a variable identifies the the mortality of the non-target hosts repeated subject and that the model state- increases (Table 13.4). However, in order to

Table 13.4. Computer-generated data for a ﬁeld test on non- target effects as a function of time (sampling date) and density of target hosts. Means and standard errors of ten ﬁeld plots.

Density of Mortality of Sample target host non-target host

1 996.6 ± 10.9 1 ± 0.4294 2 493.4 ± 7.86 38 ± 0.516 3 289.9 ± 5.78 5.6 ± 0.872 4 172.0 ± 2.78 7.3 ± 0.870 5 102.3 ± 3.65 11.8 ± 1.572 236 T.S. Hoffmeister et al.

elucidate the effect of target host density, Time as a Measurement Variable: Cox we enter sampling date and density of the Regression and Survival Analysis target host as covariates in the model. The Generalized Linear Model allows us to sep- To estimate the potential impact of natural arate the effect of sampling times and target enemies on their host and potential non- host density. The GEE model for repeated target host populations, it is often useful to measurements takes care of the fact that we acquire knowledge about the survival times resample the same field plots, and thus tar- of such insects. Survival data of insects are get host densities and the mortality rate of not normally distributed, but rather the the non-target hosts in each plot are not probability λ of an insect being dead at time independent. With both variables, sampling t, in the simplest case, can be considered to date and the density of the target host, in be constant. This leads to an exponential the model we do not find a significant effect distribution of the data with mean survival (Table 13.5). However, by removing the time 1/λ, well known from the decay of variable with the least explanatory power radioactive particles and a series of popula- from the model (i.e. sampling date), we find tion dynamics models, e.g. Ricker fishery that the density of the target host affects the models. Here, the arithmetic mean survival mortality rate of the non-target host (Table time is a poor predictor of the longevity 13.5). Estimates from the model show that and, usually, the median is used. Besides mortality of non-target hosts increases with considering an exponential distribution of decreasing density of the target host, indi- the survival times, predictors of a general- cating a switch of the natural enemy to a ized linear model with the more general non-preferred host when the preferred host Gamma distribution and inverse link func- is less available. tion give, as this was stated in the previous

Table 13.5. Analysis of Generalized Estimating Equations (GEE) parameter estimates of a Generalized Linear Model for repeated measurements of the mortality rate of non-target hosts in a field test (data from Table 13.4). The upper part of the table shows the analysis with both sample date and density of target host as explanatory variable, which results in an insignificant model. Removing the variable with least significance (i.e. ‘sample date’) leads to a model that demonstrates a significant and negative relationship between the density of the target host and the mortality of the non-target host (lower part of the table).

Empirical Standard Error Estimates

Parameter Estimate Standard Error Z of Wald test Pr > Z Intercept Ϫ3.2420 0.9599 Ϫ3.38 0.0007 Sample date 0.2715 0.1917 1.42 0.1568 Density target host Ϫ0.0016 0.0011 Ϫ1.44 0.1503

Score Statistics For Type 3 GEE Analysis

Source DF Chi-Square Pr > ChiSq Sample date 1 1.44 0.2304 Density target host 1 2.12 0.1451

Empirical Standard Error Estimates

Parameter Estimate Standard Error Z of Wald test Pr > Z Intercept Ϫ1.8476 0.1351 Ϫ13.68 <0.0001 Density target host Ϫ0.0031 0.0005 Ϫ5.99 <0.0001

Score Statistics for Type 3 GEE Analysis

Source DF Chi-Square Pr > ChiSq Density target host 1 9.14 0.0025 Statistical Tools to Improve the Quality of Experiments 237

section, accurate results. Since Generalized Haccou and Hemerik, 1985; Haccou and Linear Models are fully parametric, they are Meelis, 1992; Wajnberg et al., 1999; van the most powerful solution for survival Alphen et al., 2003). analysis, even though in several statistical packages the user may find other types of analyses that are mostly non- or semi-para- Example metric in the menu for survival analysis. However, there is – at least – one possible Imagine a small arena no-choice test with impediment to using Generalized Linear behavioural observation of a candidate nat- Models for survival analyses. Imagine a test ural enemy on either target or non-target performed to evaluate the effect of insecti- hosts (see van Lenteren et al., Chapter 3, cide residues on survival times. While all this volume for the setup). Observations insects in the treatment group (insecticide) are limited to one hour, after which almost are dead at day 10, 8% of the specimens in all of the target hosts were attacked, and the control group are still alive at day 20, 56.7% of the non-target hosts. However, it the planned end of the observation. What seems that while target hosts are attacked should be done with the data points from almost immediately, the natural enemies this 8% of the control group? Should they attack non-target hosts only after a rather be left out, since no data for their longevity long period of searching the small arena, have been measured? This would lead to a from which they cannot escape. The accep- loss of biologically meaningful data and, tance of non-target hosts is probably an even more disturbing, to a bias in the inter- overestimation of the host range of the nat- pretation, since we know that those indi- ural enemy (see van Lenteren et al., viduals survived until at least day 20. The Chapter 3, this volume) and we thus test only thing we do not know is for how much the latency until the host is attacked. This longer they would have lived. These data will elucidate whether there is a significant points are called ‘right-censored’. effect of the host species on the acceptance A so-called log-rank test, or, more gener- pattern of the natural enemy. In the Cox ally, a Cox regression model (= proportional regression, the 43.3% of non-target hosts hazards model), can adequately deal with that remained unattacked are entered as censored survival data (Cox, 1972). censored observations. The Cox regression Recently, a plethora of different studies have returns a highly significant (P < 0.001) used such a statistical analysis for ecological effect of host species on the probability of investigations on insects (e.g. van Alphen et being attacked. To elucidate this in detail, al., 2003). Besides using this sort of analysis we plot the cumulative hazard function. to study changes in survival time, survival This function gives the cumulated instanta- analysis can also be used when it comes, neous potential for the event (i.e. the e.g. to testing residence times or withdrawal attack) to occur, given it has not yet times of natural enemies on patches with occurred. The cumulative hazard function target and non-target hosts, or when testing is thus a useful measurement of the danger the latency until a natural enemy attacks a of being attacked at any point in time. host or prey (see van Lenteren et al., Here, it indicates that the probability of Chapter 3, this volume). Briefly, the proba- being attacked is 15.733 times higher per bility of dying, leaving a patch or attacking, unit time for target hosts compared with λ, can be modified in the course of time by non-target hosts (Fig. 13.3). covariates and the Cox regression provides estimates for how the covariates, i.e. treatment effects, modify the baseline hazard of Conclusions dying, leaving a patch or performing an attack. For further information, we recom- Conducting experiments for the assessment mend readers to consult papers that provide of non-target effects of biological control a thorough description of the method (e.g. agents will be costly in terms of the man- 238 T.S. Hoffmeister et al.

pointed out in this chapter, are the appropriate approach here, and whenever non- significant results are stated, the power and the associated effect size should be stated in order to provide the reader with information about the degree of confidence of the results. Furthermore, the experiments should be planned in detail to ensure that no pseudoreplication occurs. Recent analyses of research papers in ecology have found a relatively high prevalence of pseudoreplication (Heffner et al., 1996; Ramirez et al., 2000), in spite of Hurlbert’s (1984) seminal paper. Thus, the importance of avoiding pseudoreplication must be stressed here, and randomization should be used wherever possible to avoid interde- Fig. 13.3. Cumulative hazard functions for the pendency. Fortunately, very powerful statis- latency until target hosts (solid line) and non-target hosts (dashed line) are attacked. Target hosts tical techniques like Generalized Linear have a much higher probability per unit time of Models and survival analyses have become being attacked than non-target hosts. available and are now widely used in a variety of biological disciplines (e.g. Garrett et al., 2004). They not only help to increase power involved, the specimens provided the precision of testing results but also the for testing and the plants or plant parts accuracy of tests, since they can adequately needed for, e.g. host specificity tests etc. deal with non-normally distributed data Thus, there is a high premium on using the that we frequently encounter in non-target best experimental design and the most effects testing. With this chapter we hope to powerful statistical methods, in order to improve the awareness of the problems, obtain reliable test results from a reasonable and have indicated solutions suitable for amount of replicates. This is especially so, improving the quality of experiments since the result we are most interested in, assessing non-target effects of biological i.e. the probability that non-target effects do control agents. not exist, is not directly testable. What we can test is whether the null hypothesis of no effect on non-target species is wrong. If Acknowledgements we do not find a significant effect, it very much depends upon the power of the test We are grateful to B.D. Roitberg, L. to decide with some confidence that no Hemerik and U. Kuhlmann for reviewing effect exists. Therefore, great care should be an earlier version of this chapter and for taken to determine the appropriate replicate their helpful comments that led to impor- number of tests. A priori power analyses, as tant improvements.

References

Andow, D.A. (2003) Negative and positive data, statistical power, and conﬁdence intervals. Environmental Biosafety Research, 2, 75–80. Carey, J.M. and Keough, M.J. (2002) The Variability of Estimates of Variance, and Its Effect on Power Analysis in Monitoring Design. Environmental Monitoring and Assessment 74, 225–241. Cohen, J. (1998) Statistical Power Analysis for the Behavioural Sciences. Lawrence Erlbaum, Hillsdale, New Jersery. Statistical Tools to Improve the Quality of Experiments 239

Cox, D.R. (1972) Regression models and life-tables. Journal of the Royal Statistical Society B 34, 187–220. Crawley, M.J. (1993) GLIM for Ecologists. Blackwell Scientific Publications, Oxford, UK. Crawley, M.J. (2002) Statistical Computing: An Introduction to Data Analysis Using S-Plus. John Wiley and Sons Ltd, Chichester, UK. Di Stefano, J. (2003) How much power is enough? Against the development of an arbitrary convention for statistical power calculations. Functional Ecology 17, 707–709. Garcia, L.V. (2004) Escaping the Bonferroni iron claw in ecological studies. Oikos 105, 657–663. Garrett, K.A., Madden, L.V., Hughes, G. and Pfender, W.F. (2004) New applications of statistical tools in plant pathology. Phytopathology 94, 999–1003. Grafen, A. and Hails, R. (2002) Modern Statistics for the Life Sciences. Oxford University Press, Oxford, UK. Haccou, P. and Hemerik, L. (1985) The influence of larval dispersal in the cinnabarmoth (Tyria jacobaea) on predation by the red wood ant (Formica polyctena). An analysis based on the proportional hazards model. Journal of Animal Ecology 54, 755–769. Haccou, P. and Meelis, E. (1992) Statistical Analysis of Behavioural Data. An Approach Based on Time-Structured Models. Oxford University Press, Oxford, UK. Heffner, R.A., Butler, M.J. and Reilly, C.K. (1996) Pseudoreplication revisited. Ecology 77, 2558–2562. Hilborn, R. and Mangel, M. (1997) The Ecological Detective. Confronting Models with Data. Princeton University Press, Princeton, New Jersey. Hoenig, J.M. and Heisey, D.M. (2001) The abuse of power: the pervasive fallacy of power calculations for data analysis. American Statistician 55, 19–24. Holm, S. (1979) A simple sequentially rejective multiple test procedure. Scandinavian Journal of Statistics 6, 65–70. Hosmer, D.W. and Lemeshow, S. (1989) Applied Logistic Regression. John Wiley and Sons Inc., New York. Hurlbert, S.H. (1984) Pseudoreplication and the design of ecological field experiments. Ecological Monographs 54, 187–211. Lang, A. (2004) Monitoring the impact of Bt maize on butterflies in the field: estimation of required sample size. Environmental Biosafety Research 3, 55–66. Liang, K.-Y. and Zeger, S.L. (1986) Longitudinal data analysis using generalized linear models. Biometrika 73, 13–22. McCullagh, P. and Nelder, J. (1989) Generalized Linear Models. Chapman and Hall, New York. Moran, M.D. (2003) Arguments for rejecting the sequential Bonferroni in eccological studies. Oikos 100, 403–405. Neuhäuser, M. (2004) Testing whether any of the significant tests within a table are indeed significant. Oikos 106, 409–410. Perry, J.N., Rothery, P., Clark, S.J., Heard, M.S. and Hawes, C. (2003) Design, analysis and statistical power of the Farm-Scale Evaluations of genetically modified herbicide-tolerant crops. Journal of Applied Ecology 40, 17–31. Peterman, R.M. (1990) Statistical power analysis can improve fisheries research and management. Canadian Journal of Fisheries and Aquatic Sciences 47, 2–15. Quinn, G.P. and Keough, M.J. (2002) Experimental Design and Data Analysis for Biologists. Cambridge University Press, Cambridge, UK. Ramirez, C.C., Fuentes-Contreras, E., Rodriguez, L.C. and Niemeyer, H.M. (2000) Pseudoreplication and its frequency in olfactometric laboratory studies. Journal of Chemical Ecology 26, 1423–1431. Rotenberry, J.T. and Wiens, J.A. (1985) Statistical power analysis and community-wide patterns. American Naturalist 125, 164–168. Rothery, P., Clark, S.J. and Perry, J.N. (2003) Design of the farm-scale evaluations of genetically modified herbicide-tolerant crops. Environmetrics 14, 711–717. Ruxton, G.D. and Colegrave, N. (2003) Experimental Design for the Life Sciences. Oxford University Press, Oxford, UK. Steidl, R.J., Hayes, J.P. and Schauber, E. (1997) Statistical power analysis in wildlife research. Journal of Wildlife Management 61, 270–279. Thomas, L. (1997) Retrospective power analysis. Conservation Biology 11, 276–280. 240 T.S. Hoffmeister et al.

Thomas, L. and Krebs, C.J. (1997) A review of statistical power analysis software. Bulletin of the Ecological Society of America 78, 126–139. van Alphen, J.J.M., Bernstein, C. and Driessen, G. (2003) Information acquisition and time allocation in insect parasitoids. Trends in Ecology and Evolution 18, 81–87. Verhoeven, K.J.F., Simonsen, K.L. and McIntyre, L.M. (2005) Implementing false discovery rate control: Increasing your power. Oikos 108, 643–647. Wajnberg, E., Rosi, M.C. and Colazza, S. (1999) Genetic variation in patch time allocation in a parasitic wasp. Journal of Animal Ecology 68, 121–133. 14 Principles of Environmental Risk Assessment with Emphasis on the New Zealand Perspective

Abdul Moeed,1 Robert Hickson2 and Barbara I.P. Barratt3 1ERMA New Zealand, Environmental Risk Management Authority, PO Box 131, Wellington, New Zealand (email: [email protected]; fax number: +64-4-914-0433); 2Ministry of Research, Science and Technology, PO Box 5336, Wellington, New Zealand (email: [email protected]; fax number: +64-4-471-1284); 3AgResearch, Invermay Agricultural Centre, Private Bag 50034, Mosgiel, New Zealand (email: [email protected]; fax number: +64-3-489-3739)

Abstract

Principles of risk assessment and management for release of biological control agents are explained. An example of the application of risk assessment and management is given based on the New Zealand practice and experience. Prior to introducing any new organism into New Zealand, it is important to assess and evaluate potential adverse effects on environment and people. This paper outlines the historical basis and current legislative regime for the management of potential effects of invertebrate organisms proposed for release as biological control agents for arthropods. It describes the basis of the two main pieces of legislation – the Hazardous Substances and New Organisms (HSNO) Act 1996 and the Biosecurity Act 1993 – in the management of environmental effects of introduced organisms. The purpose of the HSNO Act is to protect the environment, and the health and safety of people and communities, by preventing or managing the adverse effects of hazardous substances and new organisms. The intentional release, in addition to importation, development, ﬁeld testing or conditional release, of all new organisms is managed under the HSNO Act. This Act is implemented by an independent agency, the Environmental Risk Management Authority (ERMA New Zealand). The prior approach taken to determine the likely environmental effects of new organisms is outlined against the criteria in the HSNO Act, as well as the risk assessment and management framework. A case study involving the release of an invertebrate biological control agent is mentioned as an example of the risk assessment framework used in New Zealand.

©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) 241 242 A. Moeed et al.

Introduction management framework (Fig. 14.1). Technically, risk assessment involves the Release of biological control agents has a analysis and evaluation of risks, but the long history, so why are principles of envi- discussion below also covers identifying ronmental risk assessment needed? and managing risks, since these will also Internationally there is increasing caution be central parts of an application for over the use of biological control agents. release of a biological control agent. This is due both to historical and scientific A systematic and transparent approach factors, and is leading to increasingly com- to identifying and assessing risks is plex risk assessment processes (Sheppard required to reduce the unknown risks, and et al., 2003). Principles help establish good to identify effective risk management practice, and this chapter identifies key options. The following focuses on risks, aspects of risk assessment (and risk man- but the same principles apply to the identi- agement) that should be considered before fication and assessment of benefits associ- a new biological control agent is released, ated with the control agent (see Bigler and regardless of whether all such steps are Kölliker-Ott, Chapter 16, this volume). required by law. The principles outlined Discussion of the potential benefits, as well here are generally applicable to any biolog- as the potential risks, will be necessary for ical control agent, and not just to inverte- informed decision-making. brates. The principles are illustrated by a case study involving the risk assessment of a biological control agent in New Zealand Identifying risks under the Hazardous Substances and New Organisms (HSNO) Act 1996. Identifying risks requires identifying what can happen, when, and how. The objective is to identify reasonably foresee- Principles of Environmental Risk able risks and benefits. This involves Assessment determining sources of risks (for example host range), areas of impact (for example Risk assessment involves several compo- native non-target arthropods or species nents and is usually part of a larger risk providing economic benefits), incidents

ESTABLISH THE CONTEXT LTATION IDENTIFY RISKS

MONITOR ANALYSE RISKS AND

REVIEW EVALUATE and RANK RISKS ASSESS RISKS

COMMUNICATION AND CONSU COMMUNICATION TREAT RISKS

Fig. 14.1. The risk management framework taken from the Australian and New Zealand risk management standard AS/NZS 4360, http://www.standards.co.nz (with permission from Standards New Zealand). Principles of Environmental Risk Assessment: the New Zealand Perspective 243

that may release the hazard’s potential Analysing risks (such as establishment in other habitats, the availability of alternative hosts) and Analysis involves determining the likeli- the exposure pathway (i.e. how the inci- hood of events occurring and the magni- dents may occur). tude or consequences if they occur. For It is critical for risk assessment to iden- example, how likely is it for a non-target tify as comprehensively as possible the host to be parasitized, and if it occurred potential risks associated with the release what would be the environmental and/or of a biological control agent, since all sub- other consequences? There may be a chain sequent steps address what is identified. of events required before an impact Poor risk identification will lead to poor occurs, and therefore the likelihood and risk assessment. An important part of the magnitude of effects need to be analysed. process is to be transparent in how risks Analysis is based upon professional were identified and assessed so that a con- judgement and information from other structive discussion can occur on the sources. Likelihoods and magnitudes can assumptions and interpretations. Risks be estimated qualitatively or quantita- that are identified but not considered to be tively, although for organisms qualitative reasonable should also be noted in the scales are usually chosen since quantita- process, with a justification as to why they tive information may be difficult to col- are not considered reasonable. lect. Some risks may be amenable to It is important to identify risks that are experimental assessment (such as testing direct, i.e. those that flow immediately host/prey preferences and host specificity from the use of the biological control in a laboratory) and/or from observations agent, such as risks related to non-target in ‘the wild’. Others may be inferred from species, and those that are indirect, i.e. known biological characteristics and past those that are a consequence of secondary experiences. effects of using the control agent, such as It is important to realize that, in addi- how the control agent may affect the abil- tion to assigning likelihood and magnitude ity of another species to control the same to each risk, values and judgements will pest. A distinction between monetary and influence how individuals perceive those non-monetary risks may also need to be risks. Analysis of the risks may therefore made. need to take account of a range of factors, There is a range of means of identifying such as: risks. These include checklists based on ● The degree to which exposure to the prior experience, brainstorming sessions, risk is involuntary. scenario analyses, interviews or consulta- ● The extent to which the risk will persist tions. A combination of ways may be or be controllable. used, and the techniques used should be ● The extent to which the risk is not identified. Brainstorming and discussions known or poorly understood. with others unfamiliar with the specifics ● Experience in managing such potential of the pest or control agent can be particu- adverse effects. larly useful for identifying risks not obvious to those involved in the pest control Even where experimental or other rigorous operation. data are available, there will usually be Some risk assessment processes may uncertainty associated with risk analysis, require identification and assessment of since behaviour in a new environment can- social and/or cultural risks as well as bio- not be completely inferred from laboratory physical risks, such as effects on air, water or other studies, or because there may be and soil. Social and cultural risks can be variability in the extent and quality of the particularly difficult to evaluate and will available data, or the assumptions and require the involvement of people with models used differ to some degree from expertise in these areas. reality. A key part of the assessment 244 A. Moeed et al.

process is to identify where key uncertain- There may be set criteria (such as pre- ties lie, and the nature of these uncertain- determined standards, or target risk levels) ties. Some uncertainties may be able to be against which the risks can be evaluated, or reduced by additional research, and these the priorities may be based on professional need to be identified. judgement. Generally, magnitude of an Some commentators (e.g. Wynne, 1992; adverse effect will be weighted more O’Riordan and Cox, 2001) make a distinc- highly than likelihood, so in the example tion between uncertainty, ignorance, inde- above the first risk would probably receive terminacy and/or ambiguity. Uncertainty is a higher priority. The case study given later where likelihood is not known but there in this chapter shows how qualitative may be some understanding of potential scales are used to evaluate risks. Criteria impacts. Ignorance is often where ‘we don’t and judgement will reflect the approach to know what we don’t know’ or where there risk – that is how risk averse or risk toler- is very little information to estimate likeli- ant the person, committee, organisation or hood and impact. Indeterminacy is an legislation is. overlap between uncertainty and igno- As with risk identification, transparency rance. Ambiguity is where the impacts are and justification of the risk evaluation unclear but likelihood of events may be process is necessary for a robust risk able to be estimated. Having clarity about assessment. Some form of risk (or cost) the reliability and relevance of information benefit analysis may often be required in and the types of uncertainty is the hall- an application to release a biological con- mark of good risk assessment. trol agent (see Bigler and Kölliker-Ott, Chapter 16, this volume).

Evaluating risks Managing risks Evaluation of risks involves determining what the risk management priorities are. Risk management is usually the primary This requires a consideration of both the responsibility of the decision-maker, but it likelihood and magnitude of specific is important for those seeking to release adverse effects to determine the signifi- biological control agents to identify and cance or importance of the risk. Risks of discuss options to manage identified risks. very low likelihood and very little impact Some risks could be managed by conduct- will rank very low in significance or prior- ing more research to reduce specific uncer- ity and may thus be largely ignored, while tainties, while some may be considered to adverse effects that are almost certain to have only minor effects so that no manage- occur and will have significant adverse ment is necessary. Other risks may be man- effects will rank very high in priority. aged by controlling the timing, size and/or There will, however, be a range of other places for the release of the agent, or by requiring post-release monitoring (see risks in between these extremes and it can Barrat et al., Chapter 10, this volume). be harder to determine which ones may However, whether post-release manage- require more attention or will be more ment options can be used will depend on likely to influence decision-makers. For legislative requirements in the country or example, how should the following two countries where the release is planned. types of risk be ranked or compared? Some management options may not be ● An adverse effect that is relatively practical due to their complexity, efficacy, unlikely to occur but if it did would cost, or because they will reduce the effec- have a substantial impact. tiveness of the biological control agent. ● An adverse effect that is more likely to A critical factor associated with manage- occur but would have a relatively lower ment of risks is the approach to risk. The impact. decision-maker may be risk averse or may Principles of Environmental Risk Assessment: the New Zealand Perspective 245

tolerate some risks that are more signifi- world, as well as in New Zealand, has gone cant. The nature and distribution of bene- through phases of increased scrutiny, start- fits associated with release of the biological ing from a cursory consideration of envi- control agent will often influence the deci- ronmental effects to an establishment of a sion-making process so, as noted earlier, comprehensive risk assessment and man- identification and assessment of benefits agement framework that is supported by need to be handled with the same rigour as statutes. risks. New Zealand has had a history of introductions of new organisms to control introduced pests that have become established Communication of risks in the environment. In this context, a new organism is one that is not found in New Release of a biological control agent is Zealand’s natural environment. During the likely to affect a range of groups or commu- last two decades, potential environmental nities. Consequently, it is advisable to effects of new organisms have gained engage with such groups early and openly greater awareness prior to their release, pri- during the risk assessment process. This, marily because some of the past introduc- however, can result in additional time and tions have become pests of national costs and so these factors may need to be significance. accounted for in the project. A range of papers and texts discusses the principles and practice of risk communication, and The Hazardous Substances and New can be accessed at http://www.centerfor- Organisms (HSNO) Act riskcommunication.com Roles and components of the Act Risk Assessment Framework in The HSNO Act 1996 (http://www.legisla- New Zealand tion.govt.nz) provides a framework for assessment and approval of applications to Requirements for risk assessments vary import, develop, test and conditionally between countries, and even between release. It applies to microorganisms, states in a country. Sheppard et al. (2003) plants and animals, including genetically recently compared requirements for releas- modified organisms (GMOs). The purpose ing biological control agents in Australia, of the Act is to protect the environment, Canada, New Zealand, South Africa and and the health and safety of people and the United States, and the reader is referred communities, by preventing or managing to this paper for more information. While the adverse effects of hazardous substances they all tend to share some common fea- and new organisms. In achieving the pur- tures, the requirements can vary markedly pose, there are principles to be recognized between these countries. The risk manage- and provided for, for example, safeguard- ment process in New Zealand comes clos- ing of the life-supporting capacity of air, est to a flawless democratic and complete water, soil and ecosystems; and mainte- process, but some concerns have been nance and enhancement of the capacity of expressed about the time and cost of the people and communities to provide for process as implemented there (Sheppard et their own economic, social and cultural al., 2003). well-being and for the reasonably foresee- Invasive species are considered to pose able needs of future generations. a significant threat to native biodiversity The agency that implements this Act is (Pimentel, 2002). To overcome this threat, the Environmental Risk Management other organisms have been introduced as Authority (the Authority). This is a quasi- biological control agents. Introduction of judicial body, whose members are selected these organisms in many parts of the to represent a ‘balanced mix of knowledge 246 A. Moeed et al.

and experience’ in the appropriate areas. and analysed by the applicant and then by The Authority is supported by the staff and the submitters (e.g. public, stakeholders), infrastructure of the government Agency, agency, and by the Authority (Table 14.1). and together, the Authority and the Agency The agency, and any additional experts form the Environmental Risk Management contracted on a case-by-case basis, evaluate Authority (ERMA New Zealand). the information in the application as well In consideration of applications for as in submissions, and then advise the release of a biological control agent, the Authority. Act requires consideration of effects on the four issues: (i) Environment, (ii) Human Criteria considered and information required health, (iii) Economy and (iv) Cultural, in risk assessment social and community aspects. Through a public consultation process a The HSNO Act framework for assessment consistent methodology (which includes of risk through its various provisions and an assessment of monetary and non-mone- explanations is outlined below. tary costs and benefits) for making decisions has been established. The Authority THE SUSTAINABILITY OF ALL NATIVE AND VALUED is required to take into account the need INTRODUCED FAUNA. The criteria are aimed for caution in managing adverse effects at consideration of the effect new introduc- where there is scientific and technical tions might have on the continued sur- uncertainty about those effects. Examples vival, at or close to population densities of ways of identifying risks are provided in that existed prior to the introduction. The ERMA New Zealand’s technical guide on key element is the sustainability of existing identifying, assessing and evaluating risks biota, meaning that organisms need a cer- costs and benefits (ERMA NZ, 2004). In the tain threshold of population density to be first instance, risks are identified, assessed, able to continue unaided existence in the

Table 14.1. Roles and components in the risk management process under the Hazardous Substances and New Organisms (HSNO) Act in New Zealand.

Risk Applicant Submitters Agency Authority

Identiﬁcation Determination of what Primary Primary Evaluation Evaluation and can happen, when, responsibility responsibility and review plus review and how any additions required Analysis Systematic Primary Optional Evaluation and Evaluation and determination of the responsibility review review likelihood of events and the magnitude of their consequences Evaluation Determination of risk Optional Optional Evaluation and Primary management priorities advice responsibility by comparing the level of risk against predetermined standards, target risk levels or other criteria Management Selection and Optional Optional Evaluation and Primary implementation of advice responsibility appropriate options for dealing with risk Principles of Environmental Risk Assessment: the New Zealand Perspective 247

environment. This population density microorganisms, plants and animals, and should be at a level that would sustain the abiotic water, air and substrates such as effects of natural population fluctuations soil, that are integral parts of the ecosys- and perturbations as a result, for example, tem. Any marked change in ecosystem of fluctuations in breeding performance, functions resulting from new introduction food supply or environmental variables. is likely to be considered as affecting the Population densities naturally fluctuate ecosystem’s intrinsic value. between years and are at times affected by abiotic factors such as climatic variables of PUBLIC HEALTH. This relates to the ability of temperature and rainfall. However, the new organisms to sting, be a vector of resilient populations normally sustain disease or form swarms of an unacceptable these fluctuations and perturbations and nuisance level such as to affect people’s therefore it is anticipated that new intro- well-being. ductions, if approved, would not affect the existing native and valued populations in IMPACT ON ORGANISMS AND ECOSYSTEMS OF CUL- such a way as to jeopardize their continued TURAL VALUE. This provision is for the con- existence. sideration of the effects that the proposed organism’s introduction is likely to have on EFFECT ON INHERENT BIODIVERSITY. A number people’s values and their way of life. It is of attributes could be used as a guide to therefore important that people are con- determining whether a particular new sulted for their views on the application to organism could become a problem by import new organisms into New Zealand. affecting New Zealand’s inherent biodiversity: THE ECONOMIC AND RELATED BENEFITS TO BE DERIVED FROM THE USE OF A NEW ORGANISM. ● Ability to disperse widely. This provision is for the risk, cost and ben- ● Ability to reproduce rapidly. efit analysis of the proposed importation of ● Life expectancy. an organism into New Zealand. The appli- ● Reproduction capacity. cants are required to present their analysis ● Niche requirements. and conclusions in support of their case for ● Geographical distribution. the importation. The inherent premise is ● Ability to hybridize. that the benefit (monetary and non-mone- ● Competition. tary) of having the organism in New ● Occurrence of natural enemies of the Zealand should outweigh its adverse new organism. effects. The evaluation of the above attributes will depend on the availability of information INTERNATIONAL OBLIGATIONS. With respect to such as taxonomic classification, distribu- new organisms in general, New Zealand is tion and habitat requirements, characteris- a party to many international agreements tics for establishment, competitors and life and therefore obliged to comply with their cycle properties. requirements.

THE INTRINSIC VALUE OF ECOSYSTEMS. The OTHER CONSIDERATIONS. The HSNO Act HSNO Act deﬁnes intrinsic value with requires the Authority to consider the fol- respect to ecosystems as those aspects of lowing for a rapid assessment of an appli- ecosystems and their constituent parts cation for release of a new organism. In which have value in their own right, general, this provision is for the considera- including their biological and genetic tion of new organisms that are obviously diversity and the essential characteristics low risk and would not normally require that determine an ecosystem’s integrity, full assessment. The organism’s release is form, functioning and resilience. In this unlikely to succeed under the rapid assess- context, constituent parts are the biotic ment provisions if the organism is likely to 248 A. Moeed et al.

displace or markedly reduce the numbers studies and experiences. In a majority of of an existing valued species so as to cause cases, even when the available information deterioration to natural habitats where the is relevant and accurate, there will be some organism establishes. residual uncertainty in risk assessment and in respect of new organisms. Qualitative descriptors of risk are generally used Public involvement because there is insufficient information An underlying aspect for public involve- for quantitative assessment. Tables 14.2 to ment is to balance the right of public 14.4 illustrate qualitative matrices for pri- access to information against the need for oritizing environmental effects and risks, confidentiality for valid commercial rea- and for identifying any risks that may be sons. Public involvement in the process is considered unacceptable on a case-by-case important because people’s values or qual- basis. The measure of the level of risk ity of life may be affected by the decisions (combination of likelihood and magnitude) taken. is specific to the application. It would It is considered important that, in the therefore be unadvisable to compare mea- assessment of new organisms, information sures of level of risk between applications. relevant to the identification of effects and benefits should be available to interested Risk management under the HSNO Act parties, unless there are compelling reasons for withholding it, to ensure public Under the HSNO Act, the Authority is confidence in the process. However, it is responsible for the management of risk. also important that industry should have The management of risk is influenced by confidence that the process contains provi- the approach to risk – for example, sions that permit legitimate confidential whether only insignificant risks are accept- information to be protected. able or if higher level of risks can be toler- ated. Since the HSNO Act framework reported in Hickson et al. (2000), the Act Risk assessment under the HSNO Act has been amended to provide for a condi- The assessment of risk requires considera- tional release option to allow for condition of the likelihood and magnitude of an tions or controls to be imposed on a release effect (risk analysis) and evaluation of risk approval. However, this can only occur if management priorities (risk evaluation). the application was specifically made for a Analysis and evaluation are based on pro- conditional release and, conversely, if fessional judgement and information application was made for a release without derived from other sources, such as other condition then no conditions can be

Table 14.2. Qualitative scales for estimating magnitude of adverse environmental effects used by ERMA New Zealand.

Description Examples

Minimal Highly localized and contained environmental impact, affecting a few individuals of communities of ﬂora or fauna; no discernible ecosystem impact Minor Localized and contained reversible environmental impact, some local plant or animal communities temporarily damaged; no discernible ecosystem impact or species damage Moderate Measurable long-term damage to local plant and animal communities, but no obvious spread beyond deﬁned boundaries; medium-term individual ecosystem damage; no species loss Major Long-term/irreversible damage to localized ecosystem but no species loss Massive Extensive irreversible ecosystem damage, including species loss Principles of Environmental Risk Assessment: the New Zealand Perspective 249

attached to that approval. The Authority scales used to characterize adverse envi- has discretion to decline applications if it ronmental effects can be applied to qualify considers that release without condition is beneficial effects. inappropriate. Likelihood in the context of risk assess- Hickson et al. (2000) gave an overview ment applies to the composite likelihood of of the risk management framework imple- the end effect and may be expressed as a mented by the Authority under the HSNO frequency or a probability of something Act. Under criteria-based risk assessment happening. Qualitative scales for determin- of the HSNO Act, a package of biophysical ing likelihood of adverse effects as used effects were considered for the assessment now by ERMA NZ are presented in Table and estimation of risks and benefits based 14.3. The set of generic likelihood descrip- on a qualitative estimate of magnitude and tors for adverse effects has evolved from a likelihood of occurrence. Assessment and five- to a seven-scale table since its publi- evaluation of effects on any application cation by Hickson et al. (2000). and its related information are based on Using the above qualitative descriptors professional judgement of the reviewers for magnitude of effects and likelihood of the and decision-makers. As noted in Hickson event occurring, an additional two-way table et al. (2000), in relation to risks associated representing a level of risk (combined likeli- with introduction of new organisms, quali- hood and magnitude) can be constructed, as tative descriptions are generally used. shown in Table 14.4. Here, seven levels of Since that publication, the qualitative effect are allocated (A to G). These terms are scales used for characterization of effects used to emphasize that the matrix is a device and risks have evolved and the current for determining which risks (and benefits) practice is outlined below as examples require further analysis to determine signifi- (Tables 14.2 to 14.4). The same qualitative cance for decision-making.

Table 14.3. Qualitative scales for determining likelihood of adverse environmental effects used by ERMA New Zealand.

Descriptor Description

Highly improbable Almost certainly not occurring, but cannot be totally ruled out. Improbable (remote) Only occurring in very exceptional circumstances. Very unlikely Considered only to occur in very unusual circumstances. Unlikely (occasional) Could occur, but is not expected to occur under normal operating conditions. Likely A good chance that it may occur under normal operating conditions. Very likely Expected to occur if all conditions are met. Extremely likely Almost certain.

Table 14.4. Qualitative scale for evaluating the level of risk by combining likelihood and magnitude of effects used by ERMA New Zealand.

Magnitude of effect

Likelihood Minimal Minor Moderate Major Massive

Highly improbable A A B C D Improbable A B C D E Very unlikely B C D E E Unlikely C D E E F Likely D E E F F Very likely E E F F G Extremely likely E F F G G 250 A. Moeed et al.

The lowest level (A) is deemed equiva- A public hearing is held if any person lent to insignificant, and in cases of uncer- interested in a particular application tainty it may be preferable to split this into wishes to be heard. This has occurred for sub-categories, with A1 being deemed to all biological control agent release applica- equate to insignificant. tions considered by the Authority to date. The Authority then reaches a decision on the application and the applicant is The ERMA New Zealand process informed and given a full explanation of The process implemented under the HSNO the issues considered in making the deci- Act encourages applicants to consult sion. The process must be completed ERMA NZ staff prior to submitting their within 100 days of formal notification of applications. Once an application to the application, unless it has been extended release a new organism is formally in order that further information that can be received, it is publicly notified in the press provided by the applicant is sought. and on the ERMA NZ web site (http://www.ermanz.govt.nz). A summary of the application is sent to major stake- Case study: application to introduce a holders, and a copy of the full application biological control agent for obscure (except for any confidential information) is mealybug in New Zealand available from ERMA NZ and from its web site. Submissions are invited from the pub- A case study is described here which high- lic and stakeholders, including the lights the particular issues which arose Department of Conservation. A project during the decision-making process for this team within ERMA NZ, including external particular application. Further case studies scientific advisors (if required), is set up to for weed biological control agents that have produce an Evaluation and Review (E&R) been processed under the HSNO Act are report for the Authority. given in Barratt and Moeed (2005). The E&R report evaluates all the infor- The obscure mealybug, Pseudococcus mation available and takes account of sub- viburni (Signoret) (Hemiptera: missions received. In its evaluation, the Pseudococcidae), first identified in New E&R report identifies the strengths and Zealand in 1922, is a pest of pipfruit. weaknesses of a particular case but does not Growers find it difficult to control this make recommendations regarding a deci- insect using pesticides because of its cryp- sion to the Authority. The purpose of the tic nature, making it difficult to achieve E&R report is to assist and support deci- adequate spray coverage. Furthermore, pes- sion-making by the Authority by consoli- ticide resistance problems have become evi- dating the information provided by the dent. The pipfruit industry group submitted applicant, submitters and from other an application to ERMA NZ to introduce sources into a common format which the parasitoid Pseudaphycus maculipennis enables conflicting and consistent informa- (Mercet) (Hymenoptera: Encyrtidae) for bio- tion to be readily identified. The report pre- logical control of obscure mealybug, after a sents the relevant information in a format research team in the Horticulture and Food and sequence which meets the decision- Research Institute of New Zealand had making requirements of the HSNO Act. The completed a risk assessment programme report provides an evaluation of the risk and also assisted in the preparation of the identification and assessments provided in application. the application, to give an opinion on its The applicant stated that Hymenoptera quality and credibility, and to identify gaps. in the family Encyrtidae, to which the genus The advice contained in the E&R report is Pseudaphycus belongs, were among the given solely on the basis of an objective and most host-specific parasitoids known, espe- expert review of the application and assess- cially those that attack mealybugs (Moore, ments of risks, costs and benefits. 1988). Worldwide, all species of parasitoids Principles of Environmental Risk Assessment: the New Zealand Perspective 251

in the genus Pseudaphycus were restricted The project team agreed with the appli- to hosts in the family Pseudococcidae, to cant’s assessment of the likely effectiveness which P. viburni belongs. P. maculipennis of the parasitoid and the Authority con- had only been recorded as parasitizing P. cluded that it was likely that the parasitoid viburni in the field, and based on this evi- would establish and exert a degree of bio- dence the applicant asserted that P. mac- logical control over P. viburni. At least 25% ulipennis was essentially monophagous. control of P. viburni infestation five years The applicant further stated that field stud- after release was considered plausible, and ies had shown that exotic mealybugs were likely to continue in the long term. only attacked by exotic parasitoids, while native mealybugs were attacked only by Human health effects native parasitoids. These data (Charles, 1993) and those of Noyes (1988), based on It was recognized that environmental bene- almost 100 years of collecting, indicate that fits could be realized if biological control of monophagy, or very narrow oligophagy, was P. viburni was effective, leading to a reduc- the norm among encyrtids that attack tion in insecticide use. In turn, this could mealybugs. Host-specificity tests had been result in reduced environmental pollution, carried out using 17 test species in 15 gen- and reduced adverse effects on non-target era in Europe, Australia and New Zealand, organisms. The Authority noted that as and had confirmed that P. maculipennis was long as the parasitoid exerted some degree effectively monophagous, conforming to the of control over P. viburni, benefits would global norm for Encyrtidae which attack arise from reduced insecticide use, result- mealybugs. The only other species found to ing in reduced pesticide residues on be attacked during host specificity testing in pipfruit for consumption, and reduced risk New Zealand was another exotic pest from spray-drift from orchards. Because of mealybug, the long-tailed mealybug the known characteristics of the organism, Pseudococcus longispinus (Targioni- the Authority concluded that there was Tozzetti). Field studies in France and negligible risk from the parasitoid biting or Australia provided further evidence that P. stinging humans, or vectoring plant, maculipennis was almost completely host- human or other animal diseases. specific to obscure mealybug. The key issues that were identified and Environmental effects addressed in the consideration of this case were the following: The Authority was concerned about potential adverse effects on the endemic mealybug, Pseudococcus zelandicus Cox, the Parasitoid efficacy only native species in this genus in New Uncertainty exists about the likelihood of Zealand. In host-range tests conducted in P. maculipennis establishing and the extent New Zealand (Cox, 1987), the applicant of its effect on P. viburni, including the failed to include this species since, despite time that it might take for the potential considerable collecting effort, they were benefits to be realized. The applicant had unable to locate a source of specimens. The provided information on P. maculipennis project team advised that a key issue deter- biological programmes overseas and results mining the relative effect on non-target of biological control programmes involving hosts was the degree of environmental over- Encyrtidae in general, in support of the lap in space (habitat, latitude and altitude), claim that a degree of biological control as this influences the degree of exposure of (either complete, substantial or partial) is non-target hosts to the parasitoid. The likely within five years of establishment applicant asserted that P. viburni and P. and continuing in the long term. If the zelandicus had no recorded host plants in parasitoid failed to establish, obviously no common and were generally found in dif- adverse effects or benefits were expected. ferent habitats. Since 1922, P. viburni had 252 A. Moeed et al.

been recorded only from exotic plants in would be any adverse effect on native modified habitats. In contrast, P. zelandicus mealybugs in the long term, due to the high had only been recorded on native plants in degree of host-specificity of the parasitoid. sub-alpine habitats. Pseudococcus viburni had never been recorded on any hosts in Cultural effects the same family as these native plants. The Authority concluded that because of the The project team noted that whilst impacts clearly demonstrated likelihood of habitat on native and valued introduced biota separation between the target host and P. were pertinent to assessing the risks to zelandicus, non-target parasitism would be Ma៮ori, the obligations under the Act very unlikely. require specific and separate considera- The Authority recognized the concerns of tion. Issues that might concern Ma៮ori are some submitters about additional non-target potential impacts on the sustainability of effects and the incomplete state of knowl- native and valued introduced biota, the edge of the insect fauna of New Zealand – impact on species particularly valued by for example, the possibility of undiscovered Ma៮ori and the effects on Ma៮ori culture and and/or undescribed species of Pseudococcus traditions. Since the project team could might occur in addition to P. zelandicus. The find no information about whether native Authority considered that in this case it mealybugs had particular cultural or tradi- must reach a decision on the basis of the tional value, the project team and the known, but incomplete, taxonomy and Authority concluded that it was unlikely description of New Zealand’s invertebrate that the release of the parasitoid would fauna. It was considered very unlikely that P. adversely affect the relationship between maculipennis would interbreed with other Ma៮ori, or their culture and traditions, with insect species in New Zealand, given there valued flora and fauna. were no native or introduced species of Pseudaphycus reported to be present in New Benefits Zealand. It was also considered very unlikely that P. maculipennis would com- It was noted that direct monetary benefits pete with or displace any native natural ene- from the biological control programme mies of mealybugs since existing exotic would accrue to pipfruit growers and the parasitoids have never been reported from pipfruit industry. Although the efficacy of native mealybugs. There were no records the parasitoid was uncertain, the economic that P. viburni was attacked by specialist nat- case for the introduction of the parasitoid ural enemies in New Zealand, and although appeared strong, and the benefits from the generalist predators may occasionally attack release of P. maculipennis would be envi- P. viburni, it was not considered that a gener- ronmental and economic. alist insect would be dependent on P. viburni The Authority considered that there was for population survival. currently a risk to biodiversity, including The Authority acknowledged that it was populations of beneficial and native insects, impossible to predict the rate of evolution of arising from the particular insecticide used host range for biological control agents in to control P. viburni and patterns of its use the long term. Evolution in the environment (several sprays each season). Use of broad- of new behaviours, development of physio- spectrum organophosphates in the pipfruit logical compatibility, and establishment of industry was expected to decline in the new genetic traits within a parasitoid popu- future due to the development of insecticide lation would be important in determining resistance in P. maculipennis. Hence adverse host range extension. This would be more environmental effects of spray programmes likely to include species that were closely to control obscure mealybug were likely to related to existing hosts, and occur in the decline in future unless replacement sprays same habitat. However, the Authority con- had similar, or worse, environmental effects. sidered it was very unlikely that there Nevertheless, the Authority considered that, Principles of Environmental Risk Assessment: the New Zealand Perspective 253

as long as the parasitoid exerted some degree Conclusions of control over P. viburni, reduced insecticide use in the pipfruit industry was likely, The HSNO Act provides a transparent, con- resulting in both reduced environmental pol- sistent and criteria-based framework for lution and reduced adverse effects on non- making decisions on applications to intro- target organisms. duce biological control agents on a case-by- case basis. However, this transparency and consistency increases costs to the appli- Other considerations cants involved in biological control pro- The project team considered that the bio- grammes. The requirement under the logical control agent was correctly identi- HSNO Act to consult fully with Ma៮ori ﬁed, and that appropriate provisions had before the application is formally submit- been made to ensure that no hyperparasites ted, the public consultation process, and or pathogens had contaminated the popula- the cost of holding public hearings, can be tions to be released from quarantine. costly. Costs payable to ERMA New The Authority considered all the envi- Zealand for processing an application have ronmental risks outlined above, as well as been ﬁxed at NZ$30,000. However, the other cultural, human health and economic preparation of the application and required effects, and concluded that the potential consultations are additional costs. It is positive effects of releasing P. maculipen- therefore advisable for the potential appli- nis outweighed the potential adverse cants to consider and include regulatory effects, and therefore approved the release costs in their overall management of the of P. maculipennis. biological control programmes.

References

Barratt, B.I.P. and Moeed, A. (2005) Environmental safety of biological control: policy and practice in New Zealand. Biological Control 35, 247–252. Charles, J.G. (1993) A survey of mealybugs and their natural enemies in horticultural crops in North Island, New Zealand, with implications for biological control. Biocontrol Science and Technology 3, 405–418. Cox, J.M. (1987) Pseudococcidae (Insecta: Hymenoptera). Fauna of New Zealand No. 11. DSIR Science Information Publishing Centre, Wellington, New Zealand. ERMA NZ (2004) Decision making: A technical guide to identifying, assessing and evaluating risks, costs and beneﬁts. March 2004. Environmental Risk Management Authority, Wellington, New Zealand, 61 pp. Hickson, R., Moeed, A. and Hannah, D. (2000) HSNO, ERMA and risk management. New Zealand Science Review 57, 72–77. Moore, D. (1988) Agents used for biological control of mealybugs (Pseudococcidae). Biocontrol News and Information 9, 209N–225N. Noyes, J.S. (1988) Encyrtidae (Insecta: Hymenoptera). Fauna of New Zealand No. 13. DSIR Science Information Publishing Centre, Wellington, New Zealand. O’Riordan, T. and Cox, P. (2001) Science, Risk, Uncertainty and Precaution. University of Cambridge Programme for Industry, Cambridge, UK. Pimentel, D. (2002) Biological Invasions: Economic and Environmental Costs of Alien Plants, Animals, and Microbe Species. CRC Press, Boca Raton, Florida. Sheppard, A.W., Hill, R., DeClerck-Floate, R.A., McClay, A., Olckers, T., Quimby, P.C. and Zimmermann, H.G. (2003) A global review of risk-beneﬁt-cost analysis for the introduction of classical biological control agents against weeds: a crisis in the making? Biocontrol News and Information 24, 91N–108N. Wynne, B. (1992) Uncertainty and environmental learning: reconceiving science and policy in the preventive paradigm. Global Environmental Change 2, 111–127. 15 Environmental Risk Assessment: Methods for Comprehensive Evaluation and Quick Scan

Joop C. van Lenteren1 and Antoon J.M. Loomans2 1Laboratory of Entomology, Wageningen University, PO Box 8031, 6700 EH Wageningen, The Netherlands (email: [email protected]; fax number: +31-317-484821); 2Section Entomology, Plant Protection Service, PO Box 9102, 6700 HC Wageningen, The Netherlands. (email: [email protected]; fax number: +31-317-421701)

Abstract

In this chapter, we ﬁrst summarize the international situation with respect to environmental risk assessment for biological control agents. Next, we present the risk assessment procedure previously developed in the OECD and EU-ERBIC projects. Then, we propose a new, comprehensive risk evaluation method consisting of a stepwise procedure, which can be used for all types of biological control agents, used in augmentative and classical biological control programmes, for species or biotypes, and for native, established exotics or as yet unestablished exotics. This new comprehensive method solves weaknesses that we encountered when using the previous assessment methods: decision criteria are more clear and the decision to advise a release is taken at relevant steps in the process, thus preventing unnecessary research. We applied the new procedure to the 92 species of natural enemies mentioned in the EPPO list of commercially available biological control agents. The elimination of obviously risky species early in the process, and the acceptance of other species that previously scored a high index, clearly show the improvements achieved the new procedure. For those natural enemies that have been in use for many years in certain ecoregions of the world we propose that environmental risks are evaluated by using a quick scan method, based on available information only. We have applied this method to all 150 species of natural enemies that are currently commercially available in north-western Europe and concluded that about 5% of these (exotic) species were considered too risky for release in this region, while information was not sufﬁcient for another 15%. However, the applicant could still try to undergo the comprehensive approach in order to get a permit for release.

©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of 254 Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) Environmental Risk Assessment 255

Introduction group is based on, and partly similar to, the FAO and EPPO guidelines, but the cri- In the past 100 years many exotic natural teria and methodology in the former two enemies have been imported, mass reared documents are more detailed than in the and released as biological control agents latter two (van Lenteren et al., 2003; for pest control (AAFC, 1962–1991; Anonymous, 2004). Albajes et al., 1999; Lynch et al., 2000; van The OECD and EU-ERBIC work Lenteren, 2000, 2003; USDA, 2001; Mason resulted in proposals to standardize the and Huber, 2002; Copping, 2004). information required for (i) a comprehen- Recently, several examples have been sive risk assessment of natural enemies reported concerning negative effects of that are proposed for import and release these releases (e.g. Boettner et al., 2000; and (ii) a quick risk assessment of natural Follett and Duan, 2000; Wajnberg et al., enemies that have already been used in 2000; Louda et al., 2003). The current pop- certain ecoregions (a region with similar ularity of biological control may in the fauna, flora and climate: FAO, 2002) for coming years result in more problems than biological control over several years. In before, as more new agents will become this chapter we first summarize the risk available and commercial biological con- evaluation method developed previously trol activities are executed by an increas- in the EU-ERBIC project and we propose a ing number of persons. new, comprehensive method based on Various organizations have developed experiences gained with the EU-ERBIC standards, including guidelines for the risk evaluation method. Subsequently, we export, import, shipment, evaluation and will present ideas for a quick scan to be release of biological control agents and used for natural enemies that are already beneficial organisms (e.g. EPPO, 2002; in use. In this way, we hope to provide IPPC, 2005). Environmental effects of bio- biological control experts and risk asses- logical control agents form a central ele- sors with the tools for a proper and uni- ment of these guidelines and a growing form evaluation of the information number of countries already apply risk provided in the application. assessment procedures prior to the import and release of a new natural enemy. Within the EU-funded ERBIC project The ERBIC/OECD Comprehensive (ERBIC = Evaluating Environmental Risks Environmental Risk Assessment of of Biological Control Introductions into New Natural Enemies Europe; van Lenteren et al., 2003) and an OECD working group (Anonymous, 2004), The risk assessment procedure initiated guidelines have been developed to harmo- during the ERBIC project and further devel- nize information requirements for import oped in the OECD project is characterized and release of invertebrate biological con- by questions on four issues: trol agents used in inoculation and inun- ● Characterization and identification of dation biological control (Eilenberg et al., biological control agent (see Stouthamer 2001). Procedures to assess natural ene- et al., Chapter 11, this volume). mies currently used by about 25 countries ● Health risks. and codes of conduct or guidelines pro- ● Environmental risks (see Moeed et al., duced by various organisations (e.g. FAO- Chapter 14, this volume). IPPC, EPPO, NAPPO, CABI) were ● Efficacy. collected, studied and summarized. The guideline and risk assessment procedure In this chapter we will concentrate on the produced by the OECD and EU-ERBIC third issue. Assessment of risks related to 256 J.C. van Lenteren and A.J.M. Loomans

releases of natural enemies demands inte- Risk identification and calculation of gration of many aspects of their biology, as risk index well as information on ecological interactions. A comprehensive risk assessment Normally, for a risk assessment, one will comprises steps such as: identify and evaluate the potential negative effects, and determine the probabilities that ● Identification and evaluation of poten- these will materialize (see also Moeed et tial risk of releasing a natural enemy. al., Chapter 14, this volume). The negative ● A plan to minimize risk and mitigate impacts of a biological control agent can be unwanted effects of biological control defined as any negative effect which can be agents (see also Moeed et al., Chapter named and measured, such as direct and 14, this volume). indirect negative effects on non-target ● A risk/benefit analysis of the proposed organisms and negative effects on the envi- release of the natural enemy, together ronment. The risk of negative effects of the with risk/benefit analyses of current and release of a biological control agent is the alternative pest management methods product of the likelihood (= probability) of (see Bigler and Kölliker-Ott, Chapter 15, impact and the magnitude of impact. The this volume). probability and magnitude of five groups The last step is essential, because the (ecological determinants) of risks are con- risk/benefit posed by the release of an sidered: establishment, dispersal, host exotic natural enemy might be considered range, direct effects and indirect non-target particularly acceptable in comparison with effects. Next, qualitative scales for prob- the risks posed by other control methods. ability and magnitude are described (Table For definition of terms used in this chapter, 15.1), after which we attempted to quantify we refer to the glossary in this book and to the scales for probability (Table 15.2) and Anonymous (2003a). magnitude (Table 15.3).

Table 15.1. Qualitative scales for probability (a), magnitude (b) and level of risk of adverse effects (c) (after Hickson et al., 2000).

(a) Probability Description Very unlikely Not impossible but only occurring in exceptional circumstances Unlikely Could occur but is not expected to occur under normal conditions Possible Equally likely or unlikely Likely Will probably occur at some time Very likely Is expected to occur (b) Magnitude Description Minimal Insigniﬁcant (repairable or reversible) environmental impact Minor Reversible environmental impact Moderate Slight effect on native species Major Irreversible environmental effects but no species loss, remedial action available Massive Extensive irreversible environmental effects (c) Level of risk of adverse effect Magnitude

Probability Minimal Minor Moderate Major Massive

Very unlikely Insignificant Insignificant Low Medium Medium Unlikely Insignificant Low Low Medium High Possible Low Low Medium Medium High Likely Low Low Medium High High Very likely Medium Medium High High High Environmental Risk Assessment 257

Finally, a numerical value is added to The overall risk index for each natural each descriptor of probability and magni- enemy is obtained by ﬁrst multiplying the tude to be able to quantify risk: values obtained for probability and magni- Probability Magnitude tude, followed by summing up the result- very unlikely = 1 minimal = 1 ing values obtained for establishment, unlikely = 2 minor =2 dispersal, host range and direct and indi- possible = 3 moderate =3 rect effects. The minimum score, therefore, likely = 4 major =4 is 5 (5 times 1 ϫ 1), and the maximum score very likely = 5 massive = 5 125 (5 times 5 ϫ 5). In a ﬁrst application of

Table 15.2. Descriptions of probability for establishment, dispersal, host range, direct and indirect effects (after van Lenteren et al., 2003; *as in Hickson et al., 2000).

Establishmenta* Dispersalb Direct* and indirect in non-target habitat potential Host rangec effects

Very unlikely <10 m 0 species Very unlikely Unlikely <100 m 1–3 species Unlikely Possible <1,000 m 4–10 species Possible Likely <10,000 m 11–30 species Likely Very likely >10,000 m >30 species Very likely aThe propensity to overcome adverse conditions (winter or summer: physical requirements) and availability of refuges. bDistance moved per release (take number of generations per season into account); determine dispersal curve, sampling points at 10, 100 and 1000 m, sampling period is 50% life span. cThe propensity to realize its ecological host range in the release area.

Table 15.3. Descriptions of magnitude for establishment, dispersal, host range and direct and indirect effects (after van Lenteren et al., 2003).

Establishmenta Dispersalb Host Directd and Magnitude in non-target habitat potential rangec indirecte effects

Minimal local (transient in time <1% species <5% mortality and space) Minor <10% <5% genus <40% mortality Moderate 10–25% <10% family <40% mortality and/or >10% short-term population suppression Major 25–50% <25% order >40% short-term population suppression, or >10% permanent population suppression Massive >50% >25% none >40% long-term population suppression or local extinction aPercentage of potential non-target habitat where biological control agent may establish. bPercentage of released biological control agent dispersing from target release area. cTaxon range that biological control agent attacks. dDirect effect: mortality, population suppression or local extinction of directly affected non-target organisms; see Lynch et al. (2001) for details. eIndirect effect: mortality, population suppression or local extinction of one or more species of non-target species that are indirectly inﬂuenced by the released biological control agent. 258 J.C. van Lenteren and A.J.M. Loomans

this methodology, van Lenteren et al. there are also cases where the natural (2003) analysed 31 cases of natural enemy enemy moved from a lower to a higher risk introductions. The risk indices obtained category. For example, Eretmocerus eremi- ranged from 7 to 105 (van Lenteren et al., cus Rose and Zolnerowich has a risk index 2003). of 19 when used in greenhouses in north- This risk assessment methodology also ern Europe because it cannot establish and points out clearly that different values for hardly disperses (lowest risk category), but the same organism will be obtained when the risk index increases to 51 (intermediate evaluated for different release areas. For risk) when used in greenhouses in example, the lowest risk index (7) found Mediterranean Europe because of the pos- was for Thripobius semiluteus Boucek, an sibility of establishment, more dispersal inundative biological control agent used in and, thus, a higher risk of direct and indi- greenhouses (no establishment, poor dis- rect non-target effects. Likewise, Encarsia persal outside greenhouse, monophagous, pergandiella Howard moved from the no direct or indirect non-target effects), but intermediate risk category (risk index 49 there was a slight increase to 12 when used when applied in greenhouses in northern in the field (some establishment, consider- Europe) to the highest risk category (risk able dispersal, monophagous, no direct or index 73) when used in the field in the indirect non-target effects). Also, the preda- Mediterranean (Table 15.4). tory mite, Phytoseiulus persimilis Athias- Based on the evaluation of 31 cases of Henriot, had a higher risk index when natural enemy introductions by the EU- released in the open field in Mediterranean ERBIC project, we proposed to use the fol- Italy (24) than when released in green- lowing risk categories: houses in temperate-climate countries (10) ● Low risk category: risk indices lower (for details about each of the criteria see than 35 points; for organisms falling van Lenteren et al., 2003). In the two previ- into this category, a proposal of no ous examples, the natural enemies still fell objection against release of the agent can into the low risk category (see below), but usually be issued.

Table 15.4. Risk indices for Encarsia pergandiella when used in northern European greenhouses and in greenhouses and ﬁelds in Mediterranean Europe.

North

Criterion Likelihood Magnitude P ϫ Ma Establishment 1 1 1 Dispersal 3 1 3 Host range 4 5 20 Direct effects 5 4 20 Indirect effects 5 1 5 SUM = risk index 49

South

Criterion Likelihood Magnitude P ϫ M

Establishment 5 5 25 Dispersal 3 1 3 Host range 4 5 20 Direct effects 5 4 20 Indirect effects 5 1 5 SUM = risk index 73

aP = probability, M = magnitude. Environmental Risk Assessment 259

● Intermediate risk category: risk indices possible in the risk assessment proce- between 35 and 70 points; for organ- dure to prevent unnecessary data col- isms falling into this category, advice lection. will be issued to come up with specific ● The numerical values calculated by this additional information before a conclu- assessment do not allow a very clear sion concerning release can be drawn. separation between risk categories. This ● High risk category: risk indices higher may result in interpretation and deci- than 70 points; for organisms falling sion-making that can be easily manipu- into this category, generally a proposal lated. ● not to release the agent will be issued. The overall risk index is obtained by adding five different categories, which Low risk indices (below 35) were found for are, in fact, not completely independent many parasitoids, several predatory mites from each other and should not be rated and one predatory insect. Intermediate risk equally. indices (between 35 and 70) were found for ● The overall score of a certain species for all guilds of natural enemies: parasitoids, a certain ecoregion might lead to estab- predatory insects, predatory mites, para- lishing an absolute value and unneces- sitic nematodes and entomopathogenic sarily strict administrative requirement fungi. Entomopathogens (Beauveria, for measures. Metarhizium and Steinernema) all score In addition, classical biological control was intermediate because of their broad host not explicitly included in the ERBIC risk range, but their very limited dispersal evaluation. In this chapter we propose a capacities strongly reduce risk. The highest new environmental risk assessment, which risk indices were found for predatory includes augmentative as well as classical insects (Harmonia axyridis Pallas, biological control approaches. It is now a Hippodamia convergens Guârin-Meneville, stepwise procedure, which includes weight Podisus maculiventris (Say), Orius insidio- factors for solving the problems mentioned sus (Say) and parasitoids (E. pergandiella, above. Trichogramma brassicae Bezdenko and Cales noacki Howard). This was not a sur- prise as they would all be classified by bio- Risk management logical control experts in the high risk category based on what is known of their The next step in a risk assessment process biology. is to discuss risk management, including Because this is the first quantitative risk risk mitigation and risk reduction. If an assessment developed, we expected that exotic biological control agent is expected the quantification system might have to be to cause significant adverse effects on adapted based on growing experience. The non-target organisms, a permit for releases main problems we encountered were the will not be issued. In some cases, risks following: may be minimized by imposing restric- tions concerning, for example, the types ● Information for the probability and mag- of crops on which the use of the organism nitude of all five areas of assessment is or is not allowed (e.g. treatment of flow- needed to be available before an evalua- ering plants with a myco-insecticide), by tion could be made. This makes the requesting specific application techniques assessment in a number of cases unnec- (e.g. soil incorporation only for insect essarily costly. pathogenic nematodes), or by specifying ● Candidate natural enemies that appear the ecoregions where the organism is to be clearly unacceptable for import allowed for use (e.g. use of tropical nat- and release based on data for one group ural enemies in greenhouses in temperate of risks should be identified as early as climates). 260 J.C. van Lenteren and A.J.M. Loomans

Risk/benefit analysis New, Comprehensive Environmental Risk Assessment for Classical and The last step in making a justified environ- Augmentative Biological Control mental risk analysis for a new biological Agents control agent is to conduct a risk/benefit analysis, which should include a compara- New, stepwise risk assessment tive performance of pest management procedure methods. The environmental benefits of use of the proposed biological control An environmental risk assessment method agent should be compared to environmen- consisting of a stepwise procedure is pro- tal effects of currently used and other alter- posed and should be useful for all types of native control methods. Then, the invertebrate biological control agents in environmental risk analysis is used in the augmentative and classical biological con- overall risk/benefit assessment where the trol, for species or biotypes (relevant, e.g. data concerning characterization, health in the case of biotypes that diapause or not, risks, environmental risks and efficacy of or biotypes with and without wings), all the control methods for a specific pest whether they are native, established will be compared (for details see van exotics or as yet unestablished exotics Lenteren et al., 2003; Bigler and Kölliker- (Table 15.5, summarized in Fig. 15.1). Ott, Chapter 16, this volume). Native species are included in the evalua-

Table 15.5. Schedule for an environmental risk assessment of an invertebrate biological control agent in a certain area of release. The determinants of the Environmental Risk Index (ERI = Probability ϫ Magnitude) should be calculated per step as indicated by van Lenteren et al. (2003), and where appropriate with weight factors as given in Fig. 15.2.

1 Origin – native GO TO 6 Origin – exotic, either absent OR present in target area GO TO 2 2 Augmentative Biological Control (ABC) programme – establishment not intended GO TO 3 Classical Biological Control (CBC) programme – establishment intended GO TO 4 3 Establishment unlikely (likelihood L = 1–2) no weight factor included GO TO 6 Establishment possible to very likely (L = 3–5), apply magnitude (M) as a weight factor – if risk threshold not crossed (ERI = less than 12) GO TO 4 – if risk threshold crossed (ERI = 12 or more) No release (upon request of applicant, GO TO 4) 4 If monophagous OR if oligophagous/polyphagous AND only related AND no valued non-targets attacked Release If oligophagous/polyphagous AND related and unrelated non-targets attacked AND/OR valued non-targets attacked No release (upon request of applicant, GO TO 5) 5 Dispersal local (L = 1–2) GO TO 6 Dispersal outside target area (L = 3 or more) AND extensive (M = 2 or more) apply magnitude (M) as a weight factor – if risk threshold is not crossed (ERI = 5 or less) GO TO 6 – if risk threshold is crossed (ERI = 6 or more) No release 6 Direct and indirect effects inside dispersal area of natural enemy unlikely (L = 1–2) AND at most transient and limited (M = 1–2) Release Direct and indirect effects inside ‘dispersal area’ likely (L = 3–5) OR permanent (M = 3–5) No release Environmental Risk Assessment 261

tion procedure as well: when natural ene- At step 1, exotic and native natural enemies are released in very large numbers for mies are distinguished. For native natural immediate control of the target pest, as in enemies only, one more step (6) in the pro- inundative biological control, direct dis- cedure needs to be followed. Dispersal persal (overﬂow, drift) from the release area (step 5) of native agents may be an impor- into the surrounding environment is of tant issue to be considered in order to great concern for direct non-target effects, address step 6 accordingly; in particular, irrespective of whether the natural enemy this is true for the evaluation of exotic species is exotic or not. Contrary to the species. For example, direct and indirect ERBIC/OECD risk assessment described in effects of a polyphagous biological control the previous section, here, the decision to agent may be strongly limited because of advise release or not is taken at relevant dispersal. However, because experimental steps in the process, thus preventing procedures to establish the dispersal poten- unnecessary research and resulting in early tial of natural enemies might be quite elimination of clearly risky natural ene- lengthy, this is not included here as a stan- mies. Deﬁnitions for terms used in the dard procedure for native natural enemies. evaluation process are given in Table 15.6. For exotic natural enemies, whether

Fig. 15.1. Simpliﬁed scheme of an environmental risk assessment of an invertebrate biological control agent. R, NR: release, no release, is recommended, respectively. 262 J.C. van Lenteren and A.J.M. Loomans

Table 15.6. Deﬁnitions of terms used in environmental risk assessment.

Term Deﬁnition exotic non-indigenous to the country of release, i.e. originating from the same geographical area or from a different one local restricted to the vicinity (<100 m) of the target area (establishment, dispersal) transient restricted to only the season of release (establishment, direct and indirect effects) permanent effect expected to occur during many seasons/years monophagous no non-targets attacked (likelihood = 1) oligophagous 1–10 non-targets attacked (likelihood = 2 or 3) polyphagous >10 species attacked (likelihood = 4 or 5) related within same genus

already present or absent in the target area, oligophagous/polyphagous and does attack this and further steps need to be followed. related and unrelated non-targets AND/OR At step 2, natural enemies that are des- valued non-targets, the agent should not be tined for augmentative biological control considered for release. However, if the (ABC) programmes, where establishment of applicant desires, they can provide data the organism in the area of release is not from studies on both dispersal (step 5) and intended, are separated from natural ene- direct/indirect non-target effects, and ask to mies destined for classical biological con- have the decision reconsidered. In that case, trol (CBC), where establishment is the aim. continue with step 5. On request, dispersal For ABC natural enemies one then needs can be considered relevant for risk assess- only to demonstrate that they cannot estab- ment of augmentative releases (see Mills et lish in step 3. al., Chapter 7, this volume). If they cannot establish (step 3, L = 1–2), At step 5, questions about dispersal of one more step of the procedure (6) needs to ABC and CBC (where appropriate and on be followed. However, if they can establish, request) agents are addressed. If dispersal the Environmental Risk Index (ERI = is local and mainly in the area of release (L Likelihood ϫ Magnitude) should be calcu- = 1 or 2, see Tables 15.2 and 15.3 and Fig. lated for establishment (see Tables 15.2 and 15.2b), the procedure can be continued at 15.3 and Fig. 15.2a). If a risk threshold is step 6. But, if dispersal is outside target crossed (L = 3–5 AND M = 3–5, Fig. 15.2a), area (L = 3 or more) AND extensive (M = 2 the natural enemy cannot be released, and or more), and thus the environmental risk is thus eliminated early in the evaluation index (ERI) crosses the value of 6 (Fig. process. However, if the applicant desires, 15.2b), the agent should not be released. If they can provide data from studies on host the ERI is 5 or less, the procedure can be range (step 4), dispersal (step 5) and continued at step 6. direct/indirect non-target effects (step 6) At step 6, issues related to direct and and ask to have the decision reconsidered. indirect non-target effects are addressed, as If the risk threshold is not crossed, the releases of exotic agents may negatively same procedure needs to be followed as for affect the abundance of native non-target CBC natural enemies in step 4. species or other natural enemies that At step 4, the host range issue (see van exploit the same resource (for precise Lenteren et al., Chapter 3, this volume) is details see Messing et al., Chapter 4, this addressed. If the ABC or CBC agent is either volume). If direct and indirect effects monophagous or oligophagous/polyphagous inside the ‘dispersal area’ are unlikely (L = and attacks only related AND not-valued 1–2) AND at most transient and limited non-targets, i.e. species not of conservation levels (M = 1–2), the agent can be released. concern, it should be considered for release. However, if direct and indirect effects On the other hand, if the agent is inside the ‘dispersal area’ are likely (L = Environmental Risk Assessment 263

3–5) OR permanent (M = 3–5), the agent ● Step 2 (n = 58 species): all 58 species should not be released (Fig. 15.2c). destined for augmentative biological To calculate risk levels for establish- control (go to 3), no species destined for ment, dispersal and direct/indirect non- classical biological control. target effects, the criteria are applied as ● Step 3 (n = 58 species): for 51 species it shown in van Lenteren et al. (2003), but is unlikely that they will establish (go to weight factors are added, and the resultant 6); of the remaining seven species (six values can easily be obtained from Fig. exotic, one southern EPPO), two exotic 15.2. If the ERI is below the risk threshold, species have an ERI of 12 or more, there- the value will be in a white box (= con- fore the risk threshold is crossed and tinue procedure/release recommended). these species cannot be released; the When the ERI is above the threshold, the other five species have an ERI lower value will be in a grey box (= discontinue than 12 (go to 4). procedure/no release recommended). ● Step 4 (n = 5 species): one species is Although threshold values as indicated in monophagous or oligophagous/poly- Fig. 15.2 are currently still based largely on phagous with attack of only related, but expert judgement, these values need justifi- no valued non-targets and can be cation and fine-tuning. This will probably released; all other four species are evolve when more data become available oligophagous/polyphagous, potentially through experimental research. could attack related and unrelated non- The final part of this new risk assess- targets and/or valued non-targets (no ment, i.e. the risk management and the release OR upon request go to 5). risk/benefit analysis, is the same as ● Step 5 (n = 4 species): none of the described in the previous section. species show limited dispersal and in small numbers; it is likely that all four species disperse out of the local area in Proposed risk assessment procedure large numbers and the risk threshold is applied to commercial natural enemies crossed, and they should not be released widely used in Europe (at this point all the exotic organisms have been evaluated). ● We have applied the stepwise risk assess- Step 6 (n = 85 species; 34 are native ment procedure described above to the nat- species coming from step 1, 51 are ural enemies in the EPPO list of exotic species coming from step 3): for commercially available agents (EPPO, all these species direct and indirect 2002). This list contains 92 species, of effects inside the dispersal area are which 34 species are native to The unlikely and, at most, transient and lim- Netherlands and the EPPO region, 22 are ited, so they can be released. native to the EPPO region but not native to Some conclusions can be drawn at this The Netherlands, and 36 species are of point: exotic origin. Of the 30 exotic species that ● have established in the EPPO region, two All 34 native species that were evalu- species have established in The ated are considered safe for release. ● Netherlands (Fig. 15.3). Exotic species intended for use in aug- Let us assume that these natural ene- mentative biological control that are mies were evaluated for release in The likely to establish and cross the risk Netherlands. We start with 92 species: threshold are detected very early in the evaluation process, and will be ● Step 1 (n = 92 species): 34 species are excluded from release without the need native (go to 6), 58 (36 outside EPPO for studying host range, dispersal and region, 22 from EPPO region but not direct/indirect non-target effects. native to The Netherlands) are exotic (go ● Exotic species that are monophagous, or to 2). oligophagous/polyphagous with a history 264 J.C. van Lenteren and A.J.M. Loomans

Magnitude (a) Establishment local <10% 10–25% 25–50% >50% % Area # 20 21 22 23 24

n.w. n.w. n.w. n.w. n.w. very unlikely 1 n.w. n.w. n.w. n.w. n.w. unlikely 2 3 6 12 24 48 possible 3 Likelihood 4 8 16 32 64 likely 4 510204080 very likely 5

Magnitude (b) Dispersal <1% <5% <10% <25% >25% % Dispersing # 20 21 22 23 24 distance n.w. n.w. n.w. n.w. n.w. <10m 1 n.w. n.w. n.w. n.w. n.w. <100m 2 3 6 12 24 48 <1000m 3 Likelihood 4 8 16 32 64 <10000m 4 510204080 >10000m 5

Magnitude Effects on (c) Effects <5%mort. <40%mort. >40%mort. >40%sps >40%lps non-target populations # 20 21 22 23 24

n.w. n.w. 4 8 16 very unlikely 1 n.w. n.w. 8 16 32 unlikely 2 3 6 12 24 48 possible 3 Likelihood 4 8 16 32 64 likely 4 510204080 very likely 5

Fig. 15.2. Ecological Risk Index matrix to determine the level of risk of adverse effects of an IBCA for three ecological determinants: (a) establishment, (b) dispersal and (c) direct and indirect effects. Ecological Risk Indices calculated as Likelihood (vertical) ϫ Magnitude (horizontal) with their respective calculation factors: 1–5 for likelihood, 2x as a weight factor for magnitude; n.w. = no weight factor included, mort. = mortality, sps = short-term population suppression, lps = long-term population suppression (see Tables 15.2 and 15.3 for descriptions of determinants). White = below threshold, grey = above threshold. Environmental Risk Assessment 265

37% 39%

Native + NL Native – NL Exotic

24% Fig. 15.3. Origin of commercially used biological control agents in EPPO region 2002, n = 92 species, The Netherlands (EPPO, 2002).

of attack of only related, and no attack of van Lenteren et al. (2003), clearly show valued non-targets, are also detected improvements in the assessment procedure early in the evaluation without the need proposed here. for studying dispersal and direct/indirect non-target effects; they can be released. ● Exotic species that are oligophagous/ Quick Scan Method for polyphagous and attack related and Environmental Risk Assessment of unrelated non-targets, and/or valued Natural Enemies Already in Use non-targets, will be excluded from release without the need for studying About 150 species of natural enemies have dispersal and direct/indirect non-target been in use for many years in certain ecore- effects. gions of the world (EPPO, 2002; Some exotic IBCAs that are not on the Anonymous, 2003b; van Lenteren, 2003; EPPO list, but are actually released com- ANBP, 2004; Copping, 2004). We propose mercially in Europe (e.g. H. axyridis, H. that these species be exempted from a com- convergens and O. insidiosus), had a high prehensive environmental risk analysis for ecological risk index in our previous these ecoregions, but should be evaluated assessment (see van Lenteren et al., 2003), with a quick scan method for estimation of indicating a high potential risk. When we potential adverse environmental effects. evaluate these exotic IBCAs for release Although a quick scan is based on the same using the proposed assessment procedure, environmental determinants and informa- they are considered unsuitable for release tion requirements as a comprehensive full at steps 3 or 4. On the other hand, a species scan (Table 15.7), there is a basic difference such as T. brassicae, also with a high risk in approach between the two tools. The index in our previous assessment (see van quick scan method is based on information Lenteren et al., 2003), is not eliminated which is already available, whereas for a early in the new procedure and can be comprehensive evaluation speciﬁc data released (establishment possible, would have to be generated as well. In the polyphagous, but dispersal is local and comprehensive evaluation the lead consid- direct and indirect effects within dispersal eration is ‘whether or not there is sufﬁcient area unlikely (see Babendreier et al., 2003; and reliable information to issue a permit Kuske et al., 2003; Mills et al., Chapter 7, for import and release’, and is based on a this volume)). The early elimination of quantitative evaluation. On the other hand, obviously risky species, and the acceptance when using the quick scan method, the of other species that scored – erroneously – question is ‘are there good reasons (e.g. are a high index in the previous assessment by there any non-target effects and environ- 266 J.C. van Lenteren and A.J.M. Loomans

mental risks known elsewhere and/or the web; producers price lists). Based on a expected in the area of release) to stop con- thorough review of the information which tinuation of release?’, and is thus based on is currently available (Table 15.7), potential a qualitative evaluation. The results of a risks of all species were evaluated. quick scan could help in establishing lists Application of the quick scan method to of species (‘white lists’) that can be used in natural enemies already in use results in certain, speciﬁed regions or (parts of) the conclusion that 5% of the species are ecoregions of the world. This would result considered too risky for release, that for in strongly reduced costs for regulation of 15% of the species more information was the major part of biological control agents needed before being able to conclude that currently used. they may be released or not (see below), We have applied this quick scan method and that the use of the remaining 80% of to all the species of natural enemies that the species releases could be continued are currently commercially available in directly (Fig. 15.4). Organisms belonging to north-western Europe (EPPO, 2002; the latter group that show non-signiﬁcant Loomans, 2004; producers information on environmental risks are listed and are

Table 15.7. Information requirements for a quick scan evaluation procedure of natural enemies (IBCAs = invertebrate biological control agents) already in use; updated OECD guidance document (Anonymous, 2004).

Available information on the following issues on the IBCA involved should be provided:

Information on characterisation and identification Identity Available information on biology and ecology Available information on effects on human health and safety Available information on environmental risks Available information on host/prey range (direct effects) Available information on potential of establishment and dispersal Available information on indirect effects Available information on environmental benefits of release Available information on efficacy

Quick scan results Quick scan approved – origin of IBCAs rejected more info. required 5% native 15% exotic 35% NWE 45%

approved native EU 80% 20% Fig. 15.4. Outcome of the quick scan of IBCAs produced or used in north-western Europe in 2003. Left: percentage approved, in doubt and rejected categories (n = 150). Right: origin of approved IBCAs in percentages (n = 123). Environmental Risk Assessment 267

exempted from further evaluation. from the Middle East, but recently other Organisms that are considered too risky for species-group members, originating release after a quick scan can be proposed from Chile and East Africa, are known by the applicant for a comprehensive eval- to have established in the Czech uation and might, based on the provision Republic (Stáry, 1999) and Germany of a complete set of data, still be granted a (Adisu et al., 2002), respectively. permit for release. However, there was a Similarly, release of a species which is group of organisms already in use (the native to the ecoregion of release might above-mentioned 15%), for which the have no or low direct risks. Replacing information currently available is either native strains by other exotic strains of inadequate, inappropriate or lacking for the same species, however, might completion of a quick scan risk assessment. change the risk potential and therefore Several questions, excluding the use of old the outcome of the procedure as well. ● synonyms or misspelling of names, remain Questions concerning the biology and about their status: ecology of a species: even for some species in use for minor applications for ● Questions concerning the taxonomic a number of years, there is a lack of status of the group pending up to date knowledge on the biology, ecology and revision (e.g. the genus Trichogramma efﬁcacy, and nothing is known about in North America (Pinto, 1999) and potential non-target effects and environ- Europe (see Stouthamer, Chapter 11, mental risks. this volume). ● Questions concerning mass release of ● Questions concerning the exact identity a native (e.g. Chrysoperla carnea of the organism: the species name is not Stephens) or established exotic species (yet) indicated exactly, but referred to as (T. brassicae) in the vicinity of a pro- ‘cf.’, ‘nr’ or only a genus name and ‘sp.’. tected area where red list species, ● Questions concerning the proper endangered species or protected species nomenclature of the species: from the are present. species name given it is not clear which ● Questions about translocation of an species is actually involved. For exotic species with known non-target instance, whether Delphastus pusillus effects into parts of the same ecoregion, LeConte is involved or D. catalinae where it does not yet occur naturally. Horn (see discussion by Booth and ● Questions concerning species widely Polaszek, 1996; Hoelmer and Pickett, distributed in part of a certain region 2003). Another example is E. eremicus, (translocation of species within the which has long been indicated as same continent): species with known Eretmocerus nr. californicus, but is also non-target effects which have not (yet) referred to as Eretmocerus californicus expanded their natural area of distribu- Howard: does the application concern E. tion to the areas of release, and which eremicus or, indeed, E. californicus? often enter these areas passively or acci- ● Questions concerning the origin of dentally (as eggs or larvae) in agricul- strains of a species: which subspecies, tural or horticultural commodities. ecotype or strain of a species is involved? A species which is currently Most of these questions could be overcome used and non-native to the ecoregion of through the time-consuming process of col- release might indicate no substantial lecting detailed information by the regulat- risks. However, replacement of commer- ing authority. But, as data collection is not cial strains in the future, by ecotypes the authority’s duty, a quick scan proce- better adapted to local (ecoregional) dure would proceed much faster if this conditions, might affect the outcome of information were provided by the produc- the risk assessment procedure. For ers and retailers (see Table 15.7). In the instance, strains of Aphidius colemani particular situation of The Netherlands, Viereck currently used largely originate when the above-mentioned questions were 268 J.C. van Lenteren and A.J.M. Loomans

addressed, it was shown that one species scan will ultimately result in a list of was not able to establish and, for the species exempt from further evaluation. others, no evidence was available on signif- Those species considered too risky for icant non-target effects. As a consequence, release are all exotic. Of the seven species it was advised that most species continue for which more information is needed to be released. In 2005, 134 species were before an issue for release can be provided, thus placed on a ‘white list’, which will be one is native and six are exotic (originating exempted from further regulatory measures either from different ecoregions in Europe in The Netherlands. Future releases of all or from the rest of the world). Of the 134 other species, biological control agents and species that are considered safe for use, other beneficial organisms will need autho- 45% are native to the area of release, while rization by derogation, i.e. conditional the remaining 55% are considered exotic licences (Loomans and Sütterlin, 2005). (originating either from different eco- The problems mentioned above illus- regions in Europe of from the rest of the trate that a proper identification of mass- world). produced natural enemies is of constant Another interesting question is whether concern for commercial producers, users we can draw conclusions about the guilds and regulators. Correct identification of a of natural enemies that create most prob- biological control agent is essential to lems. From the category of risky species, ensure quality control (van Lenteren, 87% consist of polyphagous predators 2003), the presence of contaminants and to (Heteroptera and Coleoptera) and 13% of validate biological studies and efficacy polyphagous Hymenoptera. The category trials (Hoelmer and Pickett, 2003). Also for for which more information is needed is experts assessing environmental risks, and made up of polyphagous predators (50%), for regulators providing lists of approved polyphagous and hyperparasitic or refused biological control agents and Hymenoptera (45%) and polyphagous other beneficial organisms, a correct iden- entomopathogenic nematodes (5%). tification is critical. An exact and unam- However, these last percentages do not nec- biguous description of morphological, essarily indicate the level of risk of certain biochemical or molecular characterisation, natural enemy guilds, as these species are as appropriate, and an accession number often subjected to further investigation to a voucher specimen or culture simply because very few data about their deposited in a museum or culture collec- biology are available. Provision of a few tion can overcome most of these taxo- more data might move several of these nomic ambiguities mentioned under species to the category of ‘safe for use’. points 1, 2 and 3 (Anonymous, 2004). A second point of consideration is that a quick scan, resulting in exemption of a Discussion species, e.g. A. colemani (point 3), might have the possibility of introducing ecotypes In this chapter we have summarized the which are much better adapted – but also current situation concerning environmen- more risky – to a specific ecoregion. For tal risk assessment of natural enemies, and organisms as mentioned under points 4 and we have proposed a comprehensive evalua- 5, future releases could be restricted to a tion method, as well as a quick scan for permit for that specific strain, or by subject- future use. The risk assessment methods ing the species to a comprehensive evalua- and procedures proposed here have a num- tion procedure. Potential increase of risks as ber of strengths, but still need improve- a result of mass release of biological control ment. We have gradually shifted, coming agents (point 5) in the vicinity of protected from a descriptive, more qualitative frame- areas could be overcome by restricting such work – largely based on expert judgement releases to regions away from such areas. in general (e.g. Hickson et al., 2000), via an After answering these questions, a quick overall qualitative and quantitative method Environmental Risk Assessment 269

(van Lenteren et al., 2003), to a stepwise tration procedure for natural enemies is evaluation procedure, using quantitative currently hotly debated by the biological information when needed and where possi- control industry, scientists and regulators ble. This not only allows better insight into (Blum et al., 2003; GreatRex, 2003; relevant ecological factors, but also consti- Hokkanen, 2003; van Lenteren et al., 2003; tutes a more objective approach for evalu- Anonymous, 2004). The biological control ating the risks of biological control agents. industry foresees lengthy, cumbersome However, thresholds and decision levels procedures leading to high costs and, thus, are currently still largely based on expert in some cases the impossibility of market- judgement. The quantitative parameters ing an interesting natural enemy because of used in the comprehensive evaluation were excessive costs. It is not easy to estimate chosen based on the scientiﬁc information costs at this point, as limited information is available and are subject to revision as as yet available about natural enemy evalu- additional scientiﬁc information becomes ations for registration or regulation. Such available. Methods to determine establish- costs will depend largely on the biological ment, dispersal, host range, and direct and and ecological characteristics of a natural indirect effects on non-target organisms are enemy. When dealing with a natural enemy discussed elsewhere in this book. We that has a very narrow host range, testing expect that a lot of new research will be can be limited to several person-months. In generated in the coming years to validate such a case, preparing a dossier, including and optimize evaluation methods. Contrary testing, would not take more than six per- to the previous EU- ERBIC assessment (van son-months. However, preparation of a Lenteren et al., 2003), in these new, step- dossier for an exotic polyphagous natural wise procedures, decisions are taken at rel- enemy that is able to establish could take evant steps in the process, thus preventing up to several years, particularly if experi- unnecessary research and resulting in early ments on dispersal and indirect ecological elimination of clearly risky natural ene- effects are needed. We estimate that a com- mies. Also, the decision criteria are clearer prehensive dossier could be appraised than those used in earlier assessments. within six person-weeks by governmental This stepwise risk assessment procedure agencies. Based on the experience with was then applied to the 92 species of nat- classical biological control agents reviewed ural enemies mentioned in the EPPO by peers, those evaluations, however, take (2002) list of commercially available bio- at least six months to complete (Sheppard logical control agents. The early elimina- et al., 2003). tion of obviously risky species, but the Regulators within ministries of environ- acceptance of other species that – wrongly ment and agriculture want to prevent – scored a high index in the EU-ERBIC unnecessary and risky releases of exotic assessment, clearly show improvements of organisms. The history of arthropod biologi- the new assessment procedure. We propose cal control shows that very few mistakes that the approximate number of 150 have been made to the present. This is a species of natural enemies, in use for many point in favour for the biological control years in certain ecoregions of the world, be industry, and is in strong contrast to the exposed to the quick scan based on avail- problems that have been created by acciden- able information only, instead of being tal importation of pests and diseases by evaluated with the comprehensive method. those other than biological control workers. We have applied the quick scan to all the Current activities will, hopefully, result in a 150 species of natural enemies that are cur- light and harmonized registration procedure rently commercially available in north- that is not prohibitive for the biological con- western Europe and concluded that about trol industry and will result in the pre-selec- 5% of these species (all exotic) are consid- tion of safe natural enemies. The proposed ered too risky for release in this region. quick scan method, for organisms already in The topic of implementation of a regis- use, should be considered as a kick-start 270 J.C. van Lenteren and A.J.M. Loomans

from a situation with no regulations for the preparation of a dossier for a quick scan use of biological control agents, to one will take two person-weeks, and appraisal where import and release are regulated to one to six person-days per biological con- ensure complete safety. Based on Findings trol agent. The end result of such a quick of No Significant Impacts (FONSI) – similar scan method, applied in various countries, to our suggested quick scan method – could result in lists of species that can be USDA-APHIS has put up a list of beneficial used in certain, specified regions (ecore- organisms that are permitted for import into gions) of the world. These species would the USA. From 38 biological control agents, be exempted from a comprehensive envi- 50% are native and 50% exotic to the USA ronmental risk analysis. The comprehen- (ANBP, 2004). The quick scan method sive environmental risk analysis should be applied for north-western Europe also applied to new species only. A similar pro- results in the continuation of release of a cedure with a quick scan can be applied to large number of exotic species. species that have already been used for At this moment, risk assessment proce- several years in classical biological control dures described in this chapter are being programmes, thus leading to lists of sup- considered for implementation by several posedly safe species – the so-named ‘white countries. More than 25 countries already lists’ – for certain ecoregions. The avail- apply a form of regulation of biological ability of regularly updated ‘white lists’ control agents. We recommend that coun- might stimulate the application of biologi- tries starting with regulating biological cal control worldwide. control should not apply the comprehen- All information related to regulation of sive evaluation summarized in this chapter natural enemies leads to the conclusion to the (roughly) 150 species of natural ene- that it is best (i) to look first for native nat- mies that are already in use, for a consider- ural enemies and (ii) to use host-prey- able amount of time. In these cases the specific natural enemies. ‘quick scan’ method should be used to estimate potential adverse environmental effects based on available information only. Ongoing successful and safe biological con- Acknowledgements trol programmes can then be continued without interruption, and thus obviate the Peter Mason and Franz Bigler are thanked resultant risk of falling back on chemical for their thorough editing and excellent control programmes. We estimate that suggestions for improving this paper.

References

AAFC, 1962–1991. Insect Liberations in Canada. Research Branch, Agriculture Canada Liberation Bulletin No. 25–54, Canada. Adisu, B., Stáry, P., Freier, B. and Büttner, C. (2002) Aphidius colemani Vier. (Hymenoptera, Braconidae, Aphidiinae) detected in cereal fields in Germany. Anzeiger für Schädlingskunde 75, 89–94. Albajes, R., Gullino, M.L., van Lenteren, J.C. and Elad, Y. (1999) Integrated Pest and Disease Management in Greenhouse Crops. Kluwer Publishers, Dordrecht, The Netherlands. ANBP (2004) USDA-APHIS permitted beneficials imported into the USA from other countries as of 27 Feb 2004. Available at http://www.anbp.org/beneficial%20list.htm) Anonymous (2003a) Glossary of Terms. The Second Report on Harmonisation of Risk Assessment Procedures, Appendix 2. Scientific Steering Committee, European Commission, 7 pp. Anonymous (2003b) 2004 Directory of least-toxic pest control products. The IPM Practitioner 25 (11/12), 1–40. Anonymous (2004) Guidance for Information Requirements for Regulation of Invertebrates as Biological Control Agents. OECD Series on Pesticides, 21. Available at http://www.oecd.org/ dataoecd/6/20/28725175.pdf Environmental Risk Assessment 271

Babendreier, D., Kuske, S. and Bigler, F. (2003) Parasitism of non-target butterflies by Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae) under field cage and field conditions. Biological Control 26, 139–145. Blum, B., Ehlers, R., Haukeland-Salinas, S., Hokkanen, H., Jung, K., Kuhlmann, U., Menzler- Hokkanen, I., Ravensberg, W., Strasser, H., Warrior, P. and Wilson, M. (2003) Letter to the editor. Biological control: Safety and regulatory policy. BioControl 48, 477–484. Boettner, G.H., Elkinton, J.S. and Boettner, C.J. (2000) Effects of a biological control introduction on three nontarget native species of Saturniid moths. Conservation Biology 14, 1798–1806. Booth, R.G. and Polaszek, A. (1996) The identities of ladybird beetle predators used for whitefly control, with notes on some white-fly parasitoids, in Europe. Brighton Crop Protection Conference – Pests and Diseases, 69–74. Copping, L.G. (2004) The Manual of Biocontrol Agents. BCPC Publications Sales, Alton, UK. Eilenberg, J., Hajek, A. and Lomer, C. (2001) Suggestions for unifying the terminology in biological control. BioControl 46, 387–400. EPPO (2002) List of biological control agents widely used in the EPPO region. PM6/3(2). Bulletin OEPP/EPPO Bulletin 32(3): 447–461. Available at http://www.eppo.org/standards/biocontrol/ bio_list.htm FAO (2002) Glossary of Phytosanitary Terms. International Plant Protection Convention. International Standards of Phytosanitary Measures No. 5. Available at https://www.ippc.int/IPP/En/default.jsp Follett, P.A. and Duan, J.J. (2000) Nontarget Effects of Biological Control. Kluwer Academic Publishers, Dordrecht, The Netherlands. GreatRex, R. (2003) Comments on the OECD proposal for ‘Guidance for Registration Requirements for Invertebrates as Biological Control Agents’. Available at http://www.ibma.ch/pdf/ comments_on_the_oecd_proposal.pdf Hickson, R., Moeed, A. and Hannah, D. (2000) HSNO, ERMA and risk management. New Zealand Science Review 57, 72–77. Hoelmer, K.A. and Pickett, C.H. (2003) Geographic origin and taxonomic history of Delphastus spp. (Coleoptera: Coccinellidae) in commercial culture. Biocontrol Science and Technology 13, 529–535. Hokkanen, H.M.T. (2003) Demonstrating the safety of biocontrol. BioControl 48, 1. IPPC (International Plant Protection Convention) (2005) Guidelines for the export, shipment, import and release of biological control agents and other beneficial organisms. International Standards for Phytosanitary Measures. No. 3. https://www.ippc.int/servlet/CDSServlet?status=ND0x MzM5OS43NjA0NyY2PWVuJjMzPXB1YmxpY2F0aW9ucyZzaG93Q2hpbGRyZW49dHJ1ZSYzN z1pbmZv#koinfo (accessed 16 November 2005). Kuske, S., Widmer, F., Edwards, P.J., Turlings, T.C.J., Babendreier, D. and Bigler, F. (2003) Dispersal and persistence of mass released Trichogramma brassicae (Hymenoptera: Trichogrammatidae) in non-target habitats. Biological Control 27, 181–193. Loomans, A.J.M. (2004) Biologische bestrijders en de Flora- en Faunawet: criteria voor risicoinschat- ting en toelating biologische bestrijders in Nederland. Gewasbescherming 35(1), 33–37. Loomans, A.J.M and Sütterlin, S. (2005) Regulation of invertebrate biological control agents: international context and situation in The Netherlands. IOBC/WPRS Bulletin 28(1), 179–182. Louda, S.M., Pemberton, R.W., Johnson, M.T. and Follett, P.A. (2003) Nontarget effects: the Achilles heel of biological control? Retrospective analyses to reduce risk associated with biocontrol introductions. Annual Review of Entomology 48, 365–396. Lynch, L.D., Hokkanen, H.M.T., Babendreier, D., Bigler, F., Burgio, G., Gao, Z.-H., Kuske, S., Loomans, A., Menzler-Hokkanen, I., Thomas, M.B., Tommasini, G., Waage, J., Lenteren, J.C. van and Zeng, Q.-Q. (2000) Indirect effects in the biological control of arthropods with arthropods. In: Wajnberg, E., Scott, J.C. and Quimby, P.C. (eds) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK, pp. 99–125. Mason, P.G. and Huber, J.T. (2002) Biological Control Programmes in Canada, 1981–2000. CABI Publishing, New York. Pinto, J.D. (1999) Systematics of the North American species of Trichogramma Westwood (Hymenoptera: Trichogrammatidae). Memoirs of the Entomological Society of Washington 22, 1–287. Sheppard, A.W., Hill, R., DeClerck-Floate, R.A., McClay, A., Olckers, T., Quimby, P.C. and Zimmermann, H.G. (2003) A global review of risk-benefit-cost analysis for the introduction of 272 J.C. van Lenteren and A.J.M. Loomans

classical biological control against weeds: a crisis in the making? Biocontrol News and Information 24, 91N–108N. Stáry, P. (1999) Parasitoids and biocontrol of Russian wheat aphid, Diuraphis noxia (Kurdj.) expand- ing in central Europe. Journal of Applied Entomology 123, 273–279. USDA (2001) The ROBO Database. Available at http://www.ars-grin.gov/nigrp/robo.html van Lenteren, J.C. (2000) Measures of success in biological control of arthropods by augmentation of natural enemies. In: Gurr, G. and Wratten, S. (eds) Measures of Success in Biological Control. Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. 77–103. van Lenteren, J.C. (2003) Quality Control and Production of Biological Control Agents: Theory and Testing Procedures. CABI Publishing, Wallingford, UK. van Lenteren, J.C., Babendreier, D., Bigler, F., Burgio, G., Hokkanen, H.M.T., Kuske, S., Loomans, A.J.M., Menzler-Hokkanen, I., van Rijn, P.C.J., Thomas, M.B., Tommasini, M.G. and Zeng, Q.-Q. (2003) Environmental risk assessment of exotic natural enemies used in inundative biological control. BioControl 48, 3–38. Wajnberg, E., Scott, J.C. and Quimby, P.C. (2000) Evaluating Indirect Ecological Effects of Biological Control. CABI Publishing, Wallingford, UK. 16 Balancing Environmental Risks and Beneﬁts: a Basic Approach

Franz Bigler and Ursula Kölliker-Ott Agroscope FAL Reckenholz, Swiss Federal Research Station for Agroecology and Agriculture, Reckenholzstrasse 191, 8046 Zürich, Switzerland (email: [email protected]; [email protected]; fax number: +41-44-377-7201)

Abstract

Risk–cost–benefit assessment of a biological control agent is a complex task, given that it should take into account expected risks, costs and benefits of economic values, human and animal health, and the environment. Environmental impacts can not usually be assessed in monetary terms, so therefore they are analysed in a qualitative manner. The proposed procedure for environmental risk–benefit assessment consists of identifying, analysing and evaluating (weighing up) risks and benefits. During the evaluation phase, risks are balanced against benefits by ranking them separately in decreasing order of significance. The highest ranked adverse effects are then compared to the highest ranked benefits. Even though adverse effects of biological control agents are mostly limited to effects on non-target arthropods, uncertainties of effects and the potential long-term and area-wide impacts greatly complicate risk–benefit assessments. Uncertainties are caused by insufficient data, measurement errors, lack of understanding of ecological systems, environmental stochasticity and implementation errors. An example of an environmental risk–benefit assessment demonstrates that the benefits of replacing the insecticide deltamethrin by releases of the egg parasitoid Trichogramma brassicae outweigh the risks posed by the biological control agent itself.

Introduction weigh risks and costs, the biological control agent may be approved, otherwise an The final step in the decision-making application would be declined. Adverse process of whether or not to introduce and effects associated with introductions have release an organism in a new environment been assessed in terms of probability and is to identify, assess and weigh up all magnitude and rated as risks in the preced- adverse and beneficial effects in a ing risk assessment procedure (see Moeed risk–cost–benefit assessment (ERMA NZ, et al., Chapter 14, this volume, and van 2004; OECD, 2004). Risks and costs are bal- Lenteren and Loomans, Chapter 15, this anced against benefits, and if benefits out- volume). Beneficial effects of release of a ©CAB International 2006. Environmental Impact of Invertebrates for Biological Control of Arthropods: Methods and Risk Assessment (eds F. Bigler et al.) 273 274 F. Bigler and U. Kölliker-Ott

biological control agent are assessed in Categories of Costs and Benefits comparison to currently used or alternative pest management methods (OECD, 2004). Cost–benefit assessment, preceding approval Thus, risks, costs and benefits are the val- or rejection of an application for a biological ues that can be assigned to particular control agent, is a very complex task, given adverse and beneficial effects that would that it should take into account expected arise as a result of introducing or not intro- costs and benefits on economic values, ducing an organism (ERMA NZ, 2000). human and animal health, the environment, A comprehensive assessment of risks, as well as on social and ethical aspects. costs and benefits associated with the release Thus, a structured and systematic approach of a biological control agent should be made will facilitate compilation of relevant data by the applicant and then by the regulatory and information by the applicant, and authority, and should include all reasonably enable the authority to make an informed foreseeable direct and indirect, monetary decision and a transparent communication and non-monetary, private and public risks, to the stakeholders, including the public. costs and benefits, taking into account when Costs and benefits of any pest control and where such risks, costs and benefits method are manifold and can be catego- might accrue. In the regulatory context, the rized as positive and negative effects on applicant and the authority share responsi- economy, human/animal health and the bility for identifying, analysing and control- environment (Table 16.1). The tool of ling risks, costs and benefits. The applicant’s cost–benefit assessment may be used either primary task is to identify and assess risks, analytically or descriptively. costs and benefits, while the authority has responsibility for evaluating risks and making decisions on the basis of a combined Economic costs and benefits consideration of risks, costs and benefits (see also Table 14.1 in Moeed et al., Chapter 14, Economic costs and benefits, be they direct this volume). As applicants and authorities or indirect, can usually be quantified in share the responsibility of decisions taken monetary units that are determined by the on the basis of available information, it is in market. Although many uncertainties may their mutual interest to establish a collabora- exist about such values, estimations and tive decision-making framework in which figures from previous experience can often the applicant provides relevant and suffi- be given, and may serve as the best pos- cient information and the authority provides sible indicators of the expected economics a transparent manner of evaluation and deci- of a new agent. The aim of assessing eco- sion-making. nomic costs and benefits is to calculate the This chapter first presents an overview monetary values of changes that will result of the categories of costs and benefits of for all actors (applicant, farmer, consumer, using invertebrate biological control society) if an application is approved and a agents. Furthermore, uncertainties in new organism replaces or supplements an risk–cost–benefit assessments are dis- existing pest control strategy. That is, costs cussed. The main part of the chapter and benefits of the control options that will focuses on presenting a generic procedure be replaced or supplemented must also be for balancing environmental risks and ben- known or estimated, and compared to efits by discussing identification, analysis those of the new agent. The difference and evaluation (weighing up) of adverse between the costs and benefits in the com- and beneficial effects. Subsequently, the parative scenarios will give a projection of proposed procedure will be followed by an the overall net costs or benefits of releasing example that should contribute to a better the new agent. understanding of the evaluation process, An important economic aspect of and thus facilitate decision-making in the cost–benefit assessment is the expected or regulation of biological control agents. experimentally proven efficacy of the agent Balancing Environmental Risks and Benefits 275

Table 16.1. Categories of costs and beneﬁts of using invertebrate biological control agents.

Category Costs Beneﬁts

Economy Applicant/ Development of agent (research, Sales of agent, profits, sustainable distributor rearing, dossier for application, business (estimate potential markets in marketing) space and time) Farmer Market price of agent and its Control of pest with adequate efficacy, application higher yield and quality of product, higher revenue Consumer Higher prices and apparent lower Lower prices and apparent higher quality of product (food, fibres, etc.) quality of product (food, fibres, etc.) Society Agent costs subsidized by Control of pest with no/few risks to government humans, animals and environment Human and animal Allergies No hazards (exposure of users and health Stings or bites residues in food and feed) from other Nuisance pest control options (e.g. pesticides) Environment Soil, water, air No costs Prevents pollution by alternative control options (e.g. pesticides) Biodiversity and Adverse effects on plants, Control of pest with no/little effects on ecosystems animals, microorganisms and plants, animals, microorganisms and on ecosystem functions their functions Introduced species cannot be Replacement of control options with eradicated if established high impacts on environment

compared with the ongoing efficacy of the less efficient in controlling the pest, and current pest control method. Efficacy more chemical will have to be sprayed in assessment of biological control agents is a the future. requirement listed by the OECD (2004). A direct comparison of efficacy between The role of information on efficacy in the chemical and biological control is often diffi- regulation process is to enable the regula- cult and does not give a conclusive answer, tory authority to assess the effectiveness of because of the different modes of action and the biological control agent and to prevent time scales of controlling a pest. the introduction and release of ineffective Nevertheless, both options may contribute to biological control agents. A biological con- satisfactory control of the target pest if inte- trol agent is considered to be effective if it grated in specific pest management options. can cause a statistically significant reduc- Economic costs and benefits are deter- tion in the number of pest organisms, of mined by the market and can be combined direct and indirect crop damage, or of yield easily by using monetary units. The most loss. The applicant has to prove in the sub- common approach is to combine all values mitted dossiers, either by experimental which are in similar units, to calculate the data or by plausible assumptions, that the expected values and then to adopt an eco- agent will contribute to the control of a nomic cost–benefit framework. However, pest in a way that justifies the risks of its accurate prospective economic values of release. Furthermore, it is important to pos- whether or not to release a biological con- tulate a scenario for what is expected to trol agent are difficult to gauge, and in happen if the organism is not released – most situations only best estimates can be with its economic consequences. If, for made. Often, it is not possible to combine example, the currently used pest control costs and benefits because either some or method is a chemical prone to induce all of the data are qualitative, or the units resistance in the target pest, it will become are dissimilar. 276 F. Bigler and U. Kölliker-Ott

Costs and benefits with respect to human provide qualitative estimates of environ- and animal health mental risks and benefits using categories such as ‘low’, ‘medium’ and ‘high’ (US Costs to human health can occur as a con- EPA, 1998). As it is extremely difficult to sequence of direct impacts on personnel assign monetary values to the loss of during the production and release process species or ecosystem functions (Simberloff of an inundatively used agent (e.g. allergies and Stiling, 1996; Thomas and Willis, from inhalation of scales from lepidopter- 1998), it is inevitable that environmental ans used in mass production of insect effects are discusssed in a qualitative man- eggs). Alternatively, costs can take the form ner. The scenarios of these estimates should of being simply a nuisance to the public if, be qualified by a description and made for example, introduced exotic agents mul- transparent. For example, if the release of a tiply very successfully in nature and aggre- new agent will reduce pesticide use by an gate in buildings or other places, then amount which can not be indicated by becoming a temporary nuisance. An exam- weight of product or active ingredient, it ple of an introduced agent that became a might be possible to give figures on the transient nuisance is Harmonia axyridis expected reduction in the number of pesti- Pallas (Coleoptera: Coccinellidae), the cide treatments, of the acreage no longer Multicolored Asian Lady beetle in North treated with pesticides or a combination of America. This beetle is an important bio- both. New pesticides may be expected to logical control agent, but in autumn it can have less environmental effects in general become annoying when it aggregates in than older ones, and consequently, replac- large numbers on buildings and crawls into ing new chemicals may result only in a houses (Koch, 2003), and large populations ‘medium’ environmental benefit, whereas a of migrating adults that feed on ripened ‘high’ benefit would accrue by replacing old grapes are harvested along with the grapes ones. Another possible scenario would be and taint the wine produced. Indirect bene- that one agent replaces or complements fits may stem from the release of a biologi- other agents within an IPM system which cal control agent that replaces or reduces, may be less efficacious or have slightly for example, the use of insecticides which adverse effects on biodiversity. More care- can potentially harm farm workers and ani- ful analysis is needed if the risk of the mals, and which contribute to pesticide introduced agent becoming established is residues in food and feed. Such benefits high, and adverse effects would be irre- can be valued in monetary revenue because versible since established species cannot be a proportion of consumers will buy food at eradicated. a higher price if health benefits may result. For further details on risks, costs and benefits we recommend consulting the technical guides ‘Preparing information on risks, Environmental costs and benefits costs and benefits for applications under the Hazardous Substances and New Organisms Environmental costs and benefits, which Act 1996 (ERMA NZ, 2000) and ‘A technical are the main focus of this chapter, include guide to identifying, assessing and evaluat- the valuation of changes in safeguard sub- ing risks, costs and benefits’ (ERMA NZ, jects like water, soil, air, biodiversity and 2004), published by the Environmental Risk ecosystem functions. Invertebrate biological Management Authority of New Zealand. control agents do not pollute water, soil or air (Greathead, 1995), and assessment of potential environmental effects may, in the Uncertainties first place, consider biodiversity issues. In most cases it is difficult or impossible to Applicants and authorities will usually express environmental changes in monetary have to deal with uncertainties in consider- units, and applicants will only be able to ing risks, costs and benefits. Harwell and Balancing Environmental Risks and Benefits 277

Harwell (1989) and Harwood and Stokes and the apparently random behaviour of (2003) discuss four different categories of systems that have chaotic dynamics. This uncertainties: is sometimes referred to as natural variation (Harwood and Stokes, 2003). Variations in environmental conditions Insufficient data and rare events like drought, inundations, Insufficient data, observation or measure- etc. are, in principle, not predictable in the ment errors and lack of understanding of long term and such uncertainties are inher- ecological systems and processes are intrin- ent in all ecosystems. sic to complex systems in general. For most ecosystems, a thorough knowledge of the Implementation errors biota present, their direct and indirect interactions, and their responses to environmen- For managed systems, implementation tal conditions are usually lacking. Fully errors must be taken into account. In the characterizing an ecosystem and its poten- context of biological control, this might tial modifications related to the introduction include unpredictable policy implemen- of a new biological control agent would be tation, or changes in market forces that extremely demanding of resources and time, alter the incentives for farmers and bio- an option that is not possible for virtually logical control practitioners. The intro- any single ecosystem, including less com- duction of political and economic effects plex systems such as agricultural crops. adds a human dimension to uncertainty. However, expert knowledge and historical For example, new and more stringent reg- data (including those from other systems) ulation of biological control agents might may substitute for the lack of current data delay or prevent new organisms being and system understanding. released, which might increase the costs due to extended application dossiers and possible crop losses because of inappro- Extrapolation priate or no control of the pest. Uncertainties stemming from the first cate- Promotion of environmentally friendly gory lead directly to the second uncer- production by government subsidies tainty, the necessity for extrapolation. could change the competitiveness of bio- Limited information and data gained for logical control in comparison to other particular conditions and ecosystems are control methods. used to predict processes in time and scale Each of the four categories of uncertain- for related systems. Extrapolation based ties (insufficient data and information, upon laboratory and field bioassays has its extrapolation from one system to another, limitations because test designs and stochasticity and natural variation, and methodologies reflect single components of implementation errors due to policy and an ecosystem under specific environmental market forces) has its own characteristics. conditions, not taking into account the While simplification and lack of know- multitude of species interactions and pop- ledge may be unavoidable, applicants and ulation dynamics. All models are simplifi- regulators should document what is cations of reality and thus provide an known, justify the assumptions and incomplete and potentially misleading rep- include indications of the confidence lev- resentation of systems, with the conse- els pertaining to the estimations (US EPA, quence of inducing further errors if models 1998; ERMA NZ, 2000). Uncertainty will are used for forecasting. require applicants and authorities to make subjective judgements based on available information and best assumptions taking Environmental stochasticity into account the nature and extent of the Uncertainties are associated with demo- uncertainty. Risks, costs and benefits of graphic and environmental stochasticity, biological control may have long lead 278 F. Bigler and U. Kölliker-Ott

times, and this makes the assumptions benefits of using the new biological con- even more unpredictable in agricultural trol agent against these options need to be systems in which high management estimated. Furthermore, it is important to dynamics are inherent. As uncertainties in postulate a scenario for what is expected risks, cost and benefit assessments are per- to happen if the organism is not released ceived and valued differently by stakehold- or if no control is taking place. In natural ers – including the public, there is a and less disturbed ecosystems where inva- tendency in some societies to take a cau- sive organisms became harmful to native tious approach. Thus, when an activity flora and fauna, biological control may be raises threats of harm to human health or the only realistic option for control of the the environment, precautionary measures invaded species. The baseline scenario for are taken even if a cause and effect rela- this situation would be to compare biolog- tionship is not fully established scientifi- ical control with no control of the pest, cally (Wingspread Statement on the with possible consequences for native Precautionary Principle, 1998). This biota. approach, however, should not lead to the Baseline scenarios may be dynamic interpretation that lack of full scientific and risks and benefits may change over certainty should be used as a reason for time. For example, as crop management declining an application or for postponing practice evolves, new pests may arise, or decisions about applications of biological formerly successful pest control may be control agents. eroded, e.g. through resistance build-up by the target pest, and thus become ineffi- cient. This will make innovative control Environmental Risk–Benefit strategies necessary and may open doors Assessment for biological control with new organisms. Similarly, new chemicals with less A full environmental risk–benefit frame- adverse environmental effects may come work involves basically the same compo- on the market and set a new baseline if nents as the risk assessment framework the new agent is then compared to previ- (Hickson et al., 2000; Moeed et al., Chapter ously used pesticides. These scenarios 14, this volume), and the consecutive steps include specifying an appropriate time- include identification, analysis and evalua- frame and scale, e.g. the number of years tion (weighing up) of adverse and benefi- the organism will be released until it will cial effects. be replaced by another control option. The dynamics of baseline scenarios with their related assumptions make risk–bene- Baseline scenario fit assessment extremely difficult and volatile, and they contribute to the uncer- As a risk–benefit assessment is a compara- tainties discussed above. tive tool (Lockwood, 1993; ERMA NZ, 2004), all relevant risks and benefits should be estimated against a baseline sce- Identification nario for comparison (ERMA NZ, 2000). The baseline scenario may consist of one In the identification phase, all potential or more current pest management meth- risks and benefits of releasing the new ods. In practice, the baseline scenario may organism compared to the current pest often reflect spraying pesticides, as this is control methods should be listed, be they the most frequently practised control direct or indirect, monetary or non- option. If other control options such as the monetary, or occurring at different times. use of semiochemicals (pheromones), As risks and benefits may accrue to pri- resistant plants or other natural enemies vate and public entities, it is important to are currently used, incremental risks and assign values to them as much as possible. Balancing Environmental Risks and Benefits 279

Where non-monetary risks and benefits Analysis are involved, qualitative estimates indicating relative size of values may be used Analysis involves determining the likeli- instead of quantitative values. Beneficial hood of assigned risks and benefits occur- effects on the natural environment may be ing, and the magnitude if they occur, when presented in the form of reduced risks. As releasing the agent compared to the base- an example, an environmental benefit line scenario. For each effect, the combina- might be claimed for a biological control tion of probability and magnitude agent in terms of the reduced use of a pes- determines the level of risk associated with ticide. Identification of environmental that effect. Similarly to adverse effects, risks and benefits includes safeguard sub- beneficial effects are not certain, and there- jects such as air, water, soil, biodiversity fore they will also have a probability as and ecosystem functions (see also Table well as a magnitude component (see also 16.2). It can be useful to make a prelimi- Moeed et al., Chapter 14, this volume). nary analysis to decide which risks and Based on the level of risks or benefits, the benefits need to be addressed further. In effects can be assigned to qualitative cate- some cases, risks or benefits associated gories. These categories may include the with adverse or beneficial effects of the effect classes ‘insignificant’, ‘low’, organism are so low that further consider- ‘medium’ and ‘high’, according to the level ation is not needed. In addition to pub- of the adverse or beneficial effect (see also lished data, expert knowledge, Table 15.1 in van Lenteren and Loomans, brainstorming, scenario analysis and life Chapter 15, this volume). cycle assessment may provide information The accuracy of the assignment is a func- to help in identifying risks and benefits. tion of the quantity and quality of the infor-

Table 16.2. Environmental risks posed by the use of the egg parasitoid Trichogramma brassicae and the insecticide deltamethrin to control the European corn borer, Ostrinia nubilalis, in maize in central Europe.

T. brassicae Deltamethrin

Fate and behaviour in soil 0 low water 0 0 air 0 0 Effects on non-target organisms mammals 0 0 birds 0 0 ﬁsh 0 low aquatic invertebrates 0 low algae 0 0 sediment-dwelling organisms 0 0 aquatic plants 0 0 honeybees 0 low other invertebrates (incl. nematodes) low high earthworms 0 0 soil microorganisms 0 0 plants 0 0

0: no or insigniﬁcant risks; low: low risk; medium: medium risk; high: high risk. For descriptions of risk levels see van Lenteren and Loomans (Chapter 15, this volume). 280 F. Bigler and U. Kölliker-Ott

mation available and, hence, uncertainties process or after the estimation of the level about risks and benefits are variable. of risk, should be specified in each case. Uncertainties are characterized and quali- Compilation, interpretation and catego- fied during the analysis phase. As many of rizing information from different sources is the identified risks and benefits are based on a very critical step in the process, and assumptions and prospective estimates, uncertainties can be substantially reduced there will be considerable uncertainty about if specialists from the different disciplines the realization of the qualitative values. The (e.g. ecotoxicologists, environmental uncertainty bounds on the information con- chemists, biological control scientists) are tained in the analysis should be expressed working together as an expert team. quantitatively where possible, but otherwise through narrative statements. Uncertainties should be analysed, or at Evaluation least described in terms of whether the uncertainty relates to the probability of The next step of a risk–benefit assessment occurrence, to the magnitude of the effect involves balancing the risks against the or to both, and of the source of uncer- benefits of releasing a biological control tainty, if known. Uncertainties in risk and agent, compared to the current control benefit assessments can be taken into methods. As environmental effects are usu- account in two ways (ERMA NZ, 2004). ally described in a qualitative manner, they First, when calculating the level of risk or are best compared by using a ranking sys- benefit (see also Table 15.1 in van Lenteren tem. This involves ranking adverse and and Loomans, Chapter 15, this volume), a beneficial effects separately, by listing them range of descriptors instead of a single in descending order of significance or descriptor may be used. For example, the risk/benefit level in two side-by-side probability of an effect could be described columns (see also Table 16.3). as ranging from ‘unlikely’ to ‘possible’, After the adverse and beneficial effects and the magnitude from ‘minor’ to ‘moder- have been ranked, they need to be com- ate’. This would put the range of risk as pared in order to evaluate whether the ben- ‘low’ to ‘medium’. Alternatively, the level eficial effects outweigh the adverse effects. of risk or benefit may be adjusted after it It is best to start by comparing the risk and has been estimated, on the grounds of the benefit with the highest rank. If the uncertainty. For example, a risk may be benefit with the highest rank exceeds the deemed to be ‘low’, but with high uncer- adverse effect with the highest rank, then tainty. A practical application of a precau- the next step is to determine if the highest tionary approach could consist of revising ranked benefit is greater than the combina- the level of risk from ‘low’ to ‘medium’. tion of highest and second highest adverse The way in which uncertainty is effects. If, for example, the highest ranked addressed, either during the allocation beneficial effect is determined to be lower

Table 16.3. Ranking risks and beneﬁts of releasing Trichogramma brassicae in maize compared to spraying with the insecticide deltamethrin.

Risks Beneﬁts

Rank Rating Description Rank Rating Description

1 low Effect on non-target 1 high Less toxic to non-target invertebrates invertebrates 2 low Not toxic to aquatic invertebrates 2 low Not toxic to honeybees 2 low Not toxic to ﬁsh 2 low No pollution of soil Balancing Environmental Risks and Beneﬁts 281

than the combination of the three highest butional effects of risks and benefits over ranked adverse effects, the second highest time and space differ between pesticides beneficial effect needs to be included in the and natural enemies. Pesticides can have comparison, and so forth, until all risks toxic effects on several non-target groups, have been outweighed by beneficial effects. and many species in the sprayed area are If, after ranking the effects, it is clear that killed. However, negative effects are lim- one or more effects effectively dominate all ited to the sprayed and ‘drift-covered’ area, other effects, a simple comparison of the and after the chemical has degraded, bene- dominant adverse and beneficial effects ficial species will reinvade the field from may be sufficient to weigh up the risks and adjacent untreated habitats. Therefore pes- benefits. Ranking techniques can be used to ticides usually induce transient effects, translate qualitative judgment into a ‘math- although repeated use (e.g. several times a ematical’ comparison. For example, Harris season) may create long-term effects. While et al. (1994) evaluated risk reduction in pesticide effects are most often limited in Green Bay (Lake Michigan), employing an space and time, biological control agents expert panel to compare and rank the rela- may establish and thus potentially cause tive risks of several stressors against their long-term and area-wide effects. potential effects. Experience with invading species has The great difficulty of comparing envi- shown that eradication is seldom feasible ronmental effects is to weigh up risks and once an organism has spread beyond its benefits of short-term effects of pesticides point of entry. Since established species against possible long-term effects of natural generally cannot be eradicated, the effects enemies on non-target organisms such as are irreversible. arthropods. The distribution of risks and The scenario of not releasing the new benefits should be analysed in terms of organism in case the application is time and space, and the results of this declined should be evaluated as well, as analysis should be taken into consideration this may result in increased pesticide use in the weighing-up process. In most pro- in the future with possible consequences jects, the risks and benefits will need to be for the environment. estimated over a limited time span, e.g. five to ten years. Generally, adverse environmental effects caused by chemical sprays Decision-making by the regulatory differ from those caused by biological con- authority trol agents in two ways: (i) Different systems (soil, water and air) and organism The final step is the decision-making by groups are potentially affected. In a general the authority based on the information context, pesticides are known to have the gained in the risk assessment and evalua- potential for temporary and/or persistent tion process. The decision-making process adverse effects on the biophysical environ- requires that the regulatory authority ment, to flora, fauna and ecosystem func- understands the nature of the effects, tions. In contrast, the chance of hazard related risks, costs and benefits, and is able occurring from invertebrate biological con- to make judgements about their relative trol agents to the biophysical environment significance. Many, if not most, predicted is in general negligible, except perhaps for risks, costs and benefits that need to be soil and water when exotic nematodes con- considered by the regulatory authority are taining entomopathogenic bacteria are not certain for a variety of reasons, and the released in high numbers. Potential nega- quality of the information may vary signifi- tive impacts of biological control agents on cantly. It is therefore important that risks, non-target organisms are limited to non- costs and benefit estimations include indi- target arthropods, and in exceptional cases cations of the confidence levels pertaining they can also include plants (see Albajes et to the estimate and that all assumptions al., Chapter 8, this volume). (ii) The distri- made in the estimation are known. 282 F. Bigler and U. Kölliker-Ott

Release of Trichogramma brassicae to nario. Deltamethrin is generally applied control Ostrinia nubilalis in maize – an against the ECB with one application per environmental risk–benefit assessment pest generation. Deltamethrin is a fast- acting, non-systemic insecticide with con- A practical example of assessing environ- tact and stomach action. Like all mental risks and benefits is shown in Tables pyrethroids, it prevents the transmission of 16.2 and 16.3. In this example we analyse nerve impulses and thus rapidly paralyses and evaluate the environmental risks and the insects. Deltamethrin is effective against benefits of releasing the biological control a wide range of pests (EXTOXNET, 1995). agent, Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae), to con- Identification trol the European corn borer (ECB), Ostrinia nubilalis Hübner (Lepidoptera: Crambidae), A list of environmental risks and benefits in maize in central Europe, where the pest associated with releasing T. brassicae com- insect completes one generation per year. pared to spraying deltamethrin is pre- We will follow the generic procedure dis- sented in Table 16.2. This comparison is cussed in the preceding sections of this based on the EU-Directives 95/36/EC chapter, by first choosing a baseline sce- (1995) concerning fate and behaviour of nario, then identifying, assessing, and pesticides in the environment, and finally weighing up risks and benefits. 96/12/EC (1996) concerning the ecotoxico- Balancing adverse and beneficial effects will logical studies of pesticides (active sub- reveal whether the benefits of releasing T. stances). Both directives with their annexes brassicae outweigh the risks and, therefore, are an amendment of Council Directive whether a release would be justified. 91/414/EEC, which concerns the placing of plant protection products on the market (EU-Directive 91/414/EEC, 1991) and spec- Background ifies the environmental safeguards and eco- toxicological profiles for official pesticide The egg parasitoid T. brassicae has been registration in the European Union. Other commercially used in central Europe since official documents may serve as a basis for the early 1980s to control the ECB in maize a comparative assessment depending on (Bigler, 1986). The strain of the egg para- the regulatory requirements of a particular sitoid T. brassicae used in Europe originates country. The list presented in Table 16.2 from Moldavia (northern Black Sea region) includes potential pollution of soil, water and was introduced in the early 1970s to and air, and adverse effects on those groups France. Nowadays, approximately 120,000 of non-target organisms that are considered female T. brassicae per ha are released per in the above-mentioned pesticide registra- pest generation depending on the density of tion directives. These include mammals, pest populations and the type of maize crop birds, aquatic and sediment-dwelling (sweet, seed, grain maize). There are organisms, honeybees and other inverte- approximately 100,000 ha of maize treated brates, earthworms, soil microorganisms in Europe each year (F. Kabiri, Valbonne, and plants. The selection of non-target 2004, personal communication). organisms is not based on scientific evidence alone, and it is far from being exhaustive; however, it forms a basis that Baseline scenario has been used for decades with a good Besides the use of T. brassicae, one of the track record of risks and benefits. The list current methods used to control the ECB in may be extended to other groups of organ- central Europe is spraying insecticides con- isms if there is good evidence and justifica- taining the active ingredient deltamethrin tion, but comparison to pesticides may be (pyrethroid). Application of deltamethrin difficult as data on pesticide effects are not will therefore serve as the baseline sce- available for other groups of organisms. Balancing Environmental Risks and Benefits 283

Analysis Toxicological information on deltamethrin can be found in ‘The The next step involves analysing the risks Pesticide Manual’ (Tomlin, 2000), the and benefits in terms of likelihood of occur- ‘Review report for the active substance rence and magnitude of consequence. Risks deltamethrin’ (European Commission, and benefits can be roughly evaluated and 2002) and in the ‘Pesticide Information assigned to qualitative categories. These Profile’ on deltamethrin provided by the categories may include the effect classes ‘Extension Toxicology Network’ ‘insignificant’, ‘low’, ‘medium’ and ‘high’. (EXTOXNET, 1995). When categorizing The information on environmental effects of T. brassicae is based on data risks posed by deltamethrin, the risk level gained in the EU-funded project is determined directly, since in the litera- ‘Evaluation of Environmental Effects of ture on pesticides no distinction between Biological Control Introductions into probability and magnitude of effects is Europe’ (ERBIC) from 1998 to 2002. The made. In Table 16.2, adverse environmen- relevant information has been published by tal effects of deltamethrin have been Babendreier et al. (2003a,b,c,d) and Kuske assigned to risk categories. In soil, et al. (2003, 2004). Mass release of T. bras- deltamethrin undergoes microbial degrada- sicae for biological control in maize has no tion within one to two weeks. Since it dis- adverse environmental effects except for appears from the environment within a the potential hazard to non-target insects short period of time, the risk of soil pollu- (Table 16.2). This tiny egg parasitoid is tion is considered to be low. Deltamethrin polyphagous, with its major hosts belong- in pond water is rapidly adsorbed, mostly ing to the Lepidoptera, though with some by sediment in addition to uptake by probability that its host range may extend plants and evaporation into the air, there- to other insect orders. However, the results fore the risk of water pollution under good of the ERBIC project show that parasitism agricultural practice is considered to be of non-target insects (Lepidoptera and dif- insignificant. The risk of air pollution is ferent natural enemies inhabiting maize), considered to be insignificant since assessed in different habitat types, is very deltamethrin is a lipophilic compound of low under field conditions. Experiments high molecular weight and consequent low have substantiated that female T. brassicae volatility. Deltamethrin does not or have a low host-searching efficiency on insignificantly affects mammals, birds, plants other than maize, resulting in the aquatic plants, soil microorganisms and extremely low parasitism of non-target host earthworms. There is no known phytotoxi- eggs. Although the parasitoid has estab- city to crops. However, it can negatively lished in its new environment, data from impact aquatic organisms, bees and other field surveys performed in areas where non-target arthropods. Although fishes and releases have been made annually since aquatic invertebrates are sensitive to 1990 demonstrate that the introduced deltamethrin in the laboratory, the risk of species coexists at low population levels damage in the field is low because the like- with native Trichogramma species (e.g. T. lihood of exposure is very low under good semblidis Aurivilius, T. evanescens agricultural practice. Deltamethrin is Westwood (Kuske et al., 2003)). Substantial highly toxic for honeybees under labora- populations in semi-natural habitats were tory conditions (Tomlin, 2000). However, observed only temporarily shortly after these values are not translated to signifi- mass releases. Information gained from the cant hazards under good agricultural prac- risk assessment experiments and post- tice because maize is most often treated release surveys let us conclude that, before pollen is shed, i.e. when the crop is because of the low searching efficacy of T. less attractive for honeybees, and thus brassicae in non-target habitats, the risks exposure to deltamethrin will not occur. posed by T. brassicae to non-target insects Moreover, this compound is repellent for are low or even negligible. bees and thus prevents pollen foraging in 284 F. Bigler and U. Kölliker-Ott

the crop to some degree shortly after treat- the less sensitive or less exposed pests can ment. Deltamethrin has a very broad activ- build up high populations in the absence ity spectrum and poses a high risk to of natural enemies and reduce the yield of non-target arthropods. the crop, which translates into economic The two control methods have been losses. Pesticide spray can drift into adja- evaluated thoroughly over the last thirty cent off-crop sites and affect ecologically years and the remaining uncertainties are more valuable habitats that may serve as relatively few. When decisions were made reservoirs of natural enemies, and from whether to spray deltamethrin on maize, where it is expected that natural enemies some environmental effects of this com- will re-invade crops. The overall environ- pound were known, since it had undergone mental risks would increase substantially if the registration process. The situation was secondary pests have to be controlled with different for the parasitoid as regulatory other pesticides as a consequence of procedures for natural enemies were not in deltamethrin sprays against the ECB. place in Europe when it was introduced The interpretation of this result leads to and mass released, and it was more luck the conclusion that the environmental risks than wisdom that this introduction has not of controlling the ECB with deltamethrin are caused significant environmental effects. higher than releasing the egg parasitoid. The assessment of the total environmental risks and benefits of using T. brassicae instead of Evaluation deltamethrin for ECB control shows that After adverse and beneficial effects of the benefits of the egg parasitoid outweigh the two control methods have been rated (Table risks of the minimal damage caused by the 16.2), risks and benefits are balanced against parasitoid to non-target insects. Therefore, it each other. In Table 16.3, risks and benefits would be environmentally safer if of releasing T. brassicae compared to spray- deltamethrin were replaced by T. brassicae. ing deltamethrin are listed in decreasing order of significance. The main risk – as well as the main benefit – of releasing T. Conclusions brassicae relates to the organism group ‘non-target invertebrates’, whereas the risks A comprehensive cost–benefit assessment have been rated as ‘low’ and the benefits to satisfy requirements for use of inverte- ‘high’. Since the main benefit outweighs the brate biological control agents is a complex main risk, a release is justified. and ambitious matter. Applicants and regu- The release of T. brassicae has no latory authorities should initiate communi- adverse effects on the environment in gen- cation and cooperation at an early stage in eral, with low or negligible risks for a few the process to find consensus on the type non-target insect species. Given that of information and data needed and how to deltamethrin is a broad-spectrum insecti- perform the assessment. This strategy cide, it is obvious that non-target insects should prevent all parties from performing and other arthropods are strongly affected redundant work, reduce costs and acceler- when they are exposed. As a consequence ate the regulatory process. Regulators and of deltamethrin sprays in maize, secondary external experts should request only infor- pest outbreaks (e.g. aphids, spider mites) mation that is absolutely necessary, i.e. may occur and other pesticide treatments separate data requested for curiosity from may be needed to control these pests. The those required to perform the evaluation. mechanisms behind such pest outbreaks The majority of applicants are small com- can be explained by the high sensitivity of panies (inundative release) or public predators and parasitoids occurring natu- research institutions (classical biological rally in maize at the time of deltamethrin control), and both have, in general, very treatments. While most of the sensitive nat- limited resources to spend on research and ural enemies are killed by this insecticide, development of new agents. Balancing Environmental Risks and Benefits 285

The interpretation of the precautionary biological control is now often promoted approach, as has become common practice by government policy and considered as an in many countries, should not lead to alternative to existing pest control options; applications being rejected in the absence on the other hand, more demanding soci- of full scientific information and evidence. eties are requesting more safety and better Using expert knowledge from different dis- protection of the environment. This opens ciplines might be the most efficient way to new avenues for biological control, but perform the risk–cost–benefit assessment may lead to more stringent regulation, with in a pragmatic way and with great accu- all its drawbacks for developing and imple- racy. Where scientific information is other- menting new biological control organisms. wise lacking, data generated by the Although risk–benefit analyses contribute applicant and expert consultations should to an increasing degree of safety demanded substitute them. Regulation of biological by our societies, they do render regulation control agents is a balancing act because of biological control agents more complex.

References

Babendreier, D., Kuske, S. and Bigler, F. (2003a) Non-target host acceptance and parasitism by Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae) in the laboratory. Biological Control 26, 128–138. Babendreier, D., Kuske, S. and Bigler, F. (2003b) Parasitism of non-target butterflies by Trichogramma brassicae Bezdenko (Hymenoptera: Trichogrammatidae) under field cage and field conditions. Biological Control 26, 139–145. Babendreier, D., Rostas, M., Hofte, M.C.J., Kuske, S. and Bigler, F. (2003c) Effects of mass releases of Trichogramma brassicae on predatory insects in maize. Entomologia Experimentalis et Applicata 108, 115–124. Babendreier, D., Schoch, D., Kuske, S., Dorn, S. and Bigler, F. (2003d) Non-target habitat exploitation by Trichogramma brassicae (Hymenoptera: Trichogrammatidae): what are the risks for endemic butterflies? Agricultural and Forest Entomology 5, 199–208. Bigler, F. (1986) Mass production of Trichogramma maidis Pint. et Voeg. and its field application against Ostrinia nubilalis Hbn. in Switzerland. Journal of Applied Entomology 101, 23–29. ERMA NZ (2000) Preparing information on risks, costs and benefits for applications under the Hazardous Substances and New Organisms Act 1996 (ER-TG-03–1 7/00). http://www.ermanz.govt.nz/resources/publications/pdfs/ER-TG-03-1.pdf (accessed 17 December 2004). ERMA NZ (2004) A technical guide to identifying, assessing and evaluating risks, costs and benefits (ER-TG-05-1 03/04) http://www.ermanz.govt.nz/resources/publications/pdfs/ER-TG-05-01% 200304%20DM%20Tech%20Gde.pdf (accessed 17 December 2004). EU-Directive 91/414/EEC (1991) Council Directive of 15 July 1991 concerning the placing of plant protection products on the market. Official Journal of the European Communities L 230–1. EU-Directive 95/36/EC (1995) Commission Directive 95/36/EC of 14 July 1995 amending Council Directive 91/414/EEC concerning the placing of plant protection products on the market. Official Journal of the European Communities L 172–8. EU-Directive 96/12/EC (1996) Commission Directive 96/12/EC of 8 March 1996 amending Council Directive 91/414/EEC concerning the placing of plant protection products on the market. Official Journal of the European Communities L 65. European Commission (2002) Review report for the active substance deltamethrin. http://europa.eu.int/comm/food/plant/protection/evaluation/existactive/list1-31_en.pdf (accessed 20 December 2004). EXTOXNET (1995) Pesticide information profile on deltamethrin. http://pmep.cce.cornell.edu/profiles/extoxnet/carbaryl-dicrotophos/deltamethrin-ext.html (accessed 13 June 2005). Greathead, D.J. (1995) Benefits and risks of classical biological control. In: Hokkanen, H.M.T. and Lynch, J.M. (eds) Biological Control: Benefits and Risks. Cambridge University Press, Cambridge, UK, pp. 53–63. 286 F. Bigler and U. Kölliker-Ott

Harris, H.J., Wenger, R.B., Harris, V.A. and Devault, D.S. (1994) A method for assessing environmental risk: a case study of Green Bay, Lake Michigan, USA. Environmental Management 18, 295–306. Harwell, M.A. and Harwell, C.C. (1989) Environmental decision making in the presence of uncertainty. In: Levin, S.A., Harwell, M.A., Kelly, J.R. and Kimball, K.D. (eds) Ecotoxicology: Problems and Approaches. Springer, New York, pp. 517–540. Harwood, J. and Stokes, K. (2003) Coping with uncertainty in ecological advice: lessons from ﬁsh- eries. Trends in Ecology and Evolution 18, 617–622. Hickson, R., Moeed, A. and Hannah, D. (2000) HSNO, ERMA and risk management. New Zealand Science Review 57, 72–77. Koch, R.L. (2003) The multicolored Asian lady beetle, Harmonia axyridis: A review of its biology, uses in biological control, and non-target impacts. Journal of Insect Science 3, 32. (also see http://www.insectscience.org/3.32/Koch_JIS_3_32_2003.pdf (accessed 23 May 2005)). Kuske, S., Widmer, F., Edwards, P.J., Turlings, T.C.J., Babendreier, D. and Bigler, F. (2003) Dispersal and persistence of mass released Trichogramma brassicae (Hymenoptera: Trichogrammatidae) in non-target habitats. Biological Control 27, 181–193. Kuske, S., Babendreier, D., Edwards, P.J., Turlings, T.C.J. and Bigler, F. (2004) Parasitism of non-target lepidoptera by mass released Trichogramma brassicae and its implication for the larval parasitoid Lydella thompsoni. BioControl 49, 1–19. Lockwood, J.A. (1993) Environmental issues involved in biological control of rangeland grasshoppers (Orthoptera: Acrididae) with exotic agents. Environmental Entomology 22, 503–518. OECD (2004) Guidance for information requirements for regulation of invertebrates as biological control agents (IBCAs). http://www.oecd.org/dataoecd/6/20/28725175.pdf (accessed 13 January 2005). Simberloff, D. and Stiling, P. (1996) Risks of species introduced for biological control. Biological Conservation 78, 185–192. Thomas, M.B. and Willis, A.J. (1998) Biocontrol – risky but necessary? Trends in Ecology and Evolution 13, 325–329. Tomlin, C.D.S. (2000) The Pesticide Manual. The British Crop Protection Council, Bear Farm, Binﬁeld, Bracknell, Berks RG42 5QE, UK. US EPA (1998) Guidelines for ecological risk assessment (EPA/630/R-95/002F). http://cfpub2.epa.gov/ncea/cfm/recordisplay.cfm?deid=12460 (accessed 20 December 2004). Wingspread Statement on the Precautionary Principle (1998). http://www.sehn.org/precaution.html (accessed 12 May 2005). Glossary

Adverse environmental effects: changes that are considered undesirable because they alter valued structural or functional characteristics of ecosystems or their components. Augmentative releases: either inundative or seasonal inoculative releases, i.e. those forms of biological control where mass-produced biological control agents are released to reduce a pest population without necessarily achieving continuing impact or establishment. Base temperature: the temperature above which degree-days start to accumulate. Below that temperature no development occurs. Beneficial organism: any organism directly or indirectly advantageous to plants or plant products, including biological control agents. Benefit (in risk–benefit assessment): the value of a particular positive effect expressed in monetary or non-monetary terms. Biological control: pest management strategy making use of living natural enemies, antag- onists or competitors and other self-replicating biotic entities. Biological control agent: a natural enemy, antagonist or competitor, and other self- replicating biotic entity used for pest management. Classical biological control: the intentional introduction and permanent establishment of an exotic biological agent for long-term pest suppression. Commensalism: an association between two organisms of different species in which one derives some benefit while the other is unaffected. Competitor: an organism which competes with other organisms for essential resources (e.g. food, shelter) in the environment. Contaminants (for the introduction of invertebrate biological control agents): inclusion of any unwanted organisms or substances in the commerce of IBCAs that poses a risk to the health of IBCAs, humans and/or to ecosystems. Cost (in risk assessment): the value of a particular adverse effect expressed in monetary or non-monetary terms. Direct effect of introduction of exotic biological control agent: involves physical interaction between the biological control agent and target or non-target organisms (effects can be positive, negative or neutral). Ecological host range: the range of species a natural enemy parasitizes/feeds on/infects in nature (but see ‘physiological (= fundamental) host range’).

287 288 Glossary

Ecoregion: an area with similar fauna, flora and climate and hence similar concerns about the introduction of biological control agents. Ecosystem: a complex of organisms and their environment, interacting as a defined ecological unit (natural or modified by human activity, e.g. agroecosystem), irrespective of political boundaries. Efficacy of a biological control agent: the ability to cause a statistically significant reduction in number of pest organisms, of direct and indirect crop damage, or of yield loss. Entomophagous: organisms that eat insects. Environmental risk assessment: the process that analyses the likelihood of occurrence and magnitude of consequences of an adverse environmental effect. Establishment: successful long-term survival and reproduction of a species after introduction into a new area (but see ‘seasonal persistence’). Exotic: not native to a particular country, ecosystem or ecoregion. Fundamental host range: see ‘physiological host range’. Generalist: see host specificity. Hazard: any potential adverse effect which can be named and measured (e.g. in biological control: direct and indirect adverse effects on non-target organisms and ecosystems). Host range: set of species that allow survival and reproduction of a natural enemy (see also ‘physiological (= fundamental) host range’ or ‘ecological host range’). Host specificity: a measure of the host range of a biological control agent on a scale ranging from an extreme specialist able only to complete development on a single species or strain of its host (monophagous), to a generalist with many hosts ranging over several groups of organisms (polyphagous). Hybrid: the offspring of genetically dissimilar parents or stock, especially the offspring produced by plants or animals of different varieties, species or races. Hyperparasitoid: a parasitoid that uses another parasitoid as a host. Import permit: an official document authorizing importation (of a biological control agent) in accordance with specified requirements. Inbreeding: the mating of genetically related individuals; mating between relatives. Indirect effect of introduction of exotic biological control agent: effect of introduction on other organisms not involving physical interaction with biological control agent (effects can be positive, negative or neutral). Infochemical: chemical that conveys information in an interaction between individuals, evoking in the receiver a behavioural or physiological response that is adaptive to either one of the interacts or to both. Inoculative release: the introduction of a biological control agent with the aim of obtaining establishment and long-term pest suppression e.g. classical biological control. Integrated Pest Management (IPM): a pest population management system that utilises all suitable techniques in a compatible manner to reduce pest populations and maintains them at levels below those causing economic injury. Interbreeding: breeding between different species. Intraguild predation: the killing and eating of species that otherwise use similar resources. Introduction (of a biological control agent): the release of a biological control agent into an ecoregion where it did not exist previously. Inundative release: the release of very large numbers of a mass-produced biological control agent in the expectation of achieving a rapid reduction of a pest population without necessarily achieving continuing impact or establishment. Invertebrate Biological Control Agent (= IBCA): an invertebrate natural enemy used for pest control, including entomopathogenic nematodes. Learning: an adaptive change in behaviour after experience. Legislation: any act, law, regulation, guideline or other administrative order promulgated by a government. Glossary 289

Lethal temperature50: temperature during a speciﬁc duration of exposure at which 50% of the organisms are killed.

Lethal time50: duration of exposure to a specific temperature at which 50% of the organisms are killed. Likelihood (in risk assessment): a qualitative description of probability or frequency, in relation to how likely it is that something will occur (see also ‘risk’). Magnitude (in risk assessment): a qualitative descriptor of the size of the consequences if adverse or beneficial effects occur (see also ‘risk’). Magnitude of risk of establishment: the area within which the introduced natural enemy is potentially able to establish, as a percentage of the area in which the exotic natural enemy will be licensed (e.g. a whole country or part of it). Microbial control: the use of microorganisms (including viruses) as biological control agents. Microorganism: a protozoan, fungus, bacterium, virus or other microscopic self-replicating biotic entity. Monophagous: organism that attacks one host species = species specific. Mutualism: an association between organisms of two different species in which each member benefits. Native: naturally occurring in the area of proposed releases. Natural enemy: an organism which lives at the expense of another organism and which may help to limit the population of this other organism; the term natural enemy includes parasitoids, parasites, predators and pathogens. Negligible risks: risks which are of such little significance in terms of their likelihood and magnitude that they do not require active management and/or after the application of risk management do not need to be justified by counterbalancing benefits. Non-target organism: all organisms except the target organism. Oligophagous: organism that attacks a limited group of related hosts in the same genus or subfamily. Parasite: an organism which lives on or in a larger organism, feeding upon it. Parasitoid: an insect parasitic only in its immature stages, killing its host in the process of its development, and free living as an adult. Pathogen: microorganism causing disease. Pest: any species, strain or biotype of plant, animal or pathogenic agent injurious to cropped plants or plant products. Physiological (= fundamental) host range: the range of species a natural enemy can parasitize/feed on/infect in the laboratory (but see ‘ecological host range’). Polyphagous: organism that attacks a wide range of hosts from different (sub-) families. Predator: a natural enemy that preys and feeds on other animal organisms, more than one of which are killed during its lifetime. Quarantine (of a biological control agent): official confinement of biological control agents subject to phytosanitary regulations for observation and research, or for further inspection and/or testing. Release (into the environment): intentional liberation of an organism into the environment. Release (of a consignment): authorization for entry after clearance. Risk: the combination of the likelihood of occurrence and magnitude of consequences should the effects occur. Risk assessment: a process of identifying, analysing and evaluating risks, costs or benefits associated with the introduction of a biological control agent. Risk evaluation: the evaluation by the authority of the combined assessments of risks, costs and benefits for the purposes of deciding whether the application should be approved or declined. 290 Glossary

Risk management options: risk reduction actions that may be selected, alone or in combination, to reduce identified risks to an acceptable level (= risk mitigation). Risk mitigation: see ‘risk management options’. Seasonal inoculative releases: the release of mass-produced biological control agents in the expectation of achieving a reduction of a pest population during several generations without necessarily achieving continuing impact or establishment. Seasonal persistence: survival of a population is limited to one growing season. Specialist: see host specificity. Supercooling point: temperature at which an organism freezes; for freeze-intolerant species, instantaneous death occurs at that temperature. Symbiosis: a close, prolonged association between organisms of different species that may, but does not necessarily, benefit each member. Synomone: an allelochemical that is pertinent to the biology of an organism (organism 1) that evokes in the receiver (organism 2) a behavioural or physiological response that is adaptively favourable to both organisms 1 and 2. Thermal budget: accumulation of day-degrees necessary to complete a generation. Trophic levels: a functional classification of taxa within a community that is based on feeding relationships. Unacceptable risks: risks of a type or level which the authority will not accept irrespective of any benefits that might accrue. Uncertainty: the estimated amount by which an observed value may differ from the true value due to incomplete or wrong information.

References

Dicke, M. and Sabelis, M.W. (1988) Infochemical terminology: based on cost-benefit analysis rather than origin of compounds. Functional Ecology 2, 131–139. ERMA NZ (2000) Preparing information on risks, costs and benefits for applications under the Hazardous Substances and New Organisms Act 1996 (ER-TG-03-1 7/00). http:// www.ermanz.govt.nz/resources/publications/pdfs/ER-TG-03-1.pdf (accessed 17 December 2004). ERMA NZ (2004) A technical guide to identifying, assessing and evaluating risks, costs and benefits (ER-TG-05-1 03/04). http://www.ermanz.govt.nz/resources/publications/pdfs/ER-TG-05- 01%200304%20DM%20Tech%20Gde.pdf (accessed 17 December 2004). GuruNet (2005) Answers.com – Online Encyclopedia, Thesaurus, Dictionary definitions. http://www.answers.com (accessed 4 July 2005). IPPC (1996) Code of conduct for the import and release of exotic biological control agents. International Standards for Phytosanitary Measures No. 3. International Plant Protection Convention. Food and Agricultural Organization of the United Nations, Rome, Italy, 23 pp. IPPC (2005) Guidelines for the export, shipment, import and release of biological control agents and other beneficial organisms. http://www.ippc.int/servlet/BinaryDownloaderServlet/76047_ ICPM_7_report_ISPM_0.pdf?filename=1118408473107_ISPM3_2005.pdf&refID=76047 (accessed 1 July 2005). NAPPO (2000) Guidelines for petition for release of exotic entomophagous agents for the biological control of pests, RSPM No. 12. Available at http://www.nappo.org/Standards/OLDSTDS/ RSPM12-e.pdf NAPPO (2004) NAPPO glossary of phytosanitary terms, RSPM No. 5. http://www.nappo.org/ Standards/REVIEW/RSPM5-e.pdf (accessed 1 July 2005). OECD (2004) Guidance for information requirements for regulation of invertebrates as biological control agents (IBCAs). http://www.oecd.org/dataoecd/6/20/28725175.pdf (accessed 13 January 2005). US EPA (1998) Guidelines for ecological risk assessment (EPA/630/R-95/002F). http://cfpub2. epa.gov/ncea/cfm/recordisplay.cfm?deid=12460 (accessed 20 December 2004). Index

abundance: effect of interbreeding 78, braconid wasps 6 85 budget, thermal 103 Acentria ephemerella 171 butterflies: rare species in host adaptation 55, 171 specificity testing 25 allopatry 79, 80 amphibians: import regulations 159 Anagyrus indicus 171 Cactoblastis cactorum 170 analysis, data see statistics: methods Cameraria ohridella 211, 212(fig) Aphanotorhaphopsis samarensis 24 Campyloma verbasci 137 Aphidus rosae 23 Canada 2–3, 159 Aphis glycines 73 Celatoria compressa Aphis gossypii 72 candidate for control of Diabrotica Apicomplexa 149 virgifera 27–28 Australia 3, 55, 159 ecological host range 28–31 avoidance behaviour 106 centrifugal phylogenetic method for test species selection (Wapshere) 16–17, 18 bacteria 147–148, 153–154 Cephalonomia hyalinipennis 70 Bassaris gonerilla 168–169 Chrysoperla carnea 72, 147 Bathyplectes curculionis 171 Ciliophora 149 Beauveria bassiana 170, 171 Cirsium spp. 170 behaviour: of parasites and prey 41–42 climate avoidance 106 ecoclimatic zones 204(fig) changes caused by rearing and species distribution 82, conditions 45–46 217–218 natural enemy foraging behaviour effects of introgression 88 42–44 Coleomegilla maculata 72 benefits: risk/benefit analysis see Coleotichus blackburniae 169 under risk assessment and competition and other interactions management difficulty of prediction 65 BIOCLIM 82 direct vs indirect effects 7 Bioedit sequence alignment editor 193 displacement 7, 158, 171–172

291 292 Index

competition and other interactions data: statistical analysis see statistics: continued methods killing and predation 66(fig), 67, deer mice 177–178 70, 71 Delphastus catalinae 110(fig), 111 assessment by community deltamethrin: environmental risks manipulation 72 279(tab) costs to predators of feeding on desiccation tolerance 106 plants 135 development: thresholds 102–103 facultative predation 133–134 Diabrotica virgifera 28, 211, 218 intra-guild predation 72 diagnosis: types and methods 152, 154 methods of assessment diapause: effect on host range focal observations 70–71 assessment 44–45 large-cage experiments 71–73 Dichasmimorpha spp. 22 molecular and biochemical Dicyphus tamaninii 136, 137 studies 71 diets, artificial: for test species 44 Petri dish experiments 69–70 directionality, problem of 122–123 surrogate experiments 73 Dirhinus giffardii 70 post-release studies 171–172, dispersal 8 179–180 mechanisms 115–116 threat to endangered species 65 methods of assessment 116 types 67–69 mark-release-recapture (MRR) in weed biological control 66 experiments see mark–release– Compsilura concinnata 23 recapture (MRR) experiments contamination: of biological control models 121–124 agents nematodes 176 abiotic contaminants 151, 156 in risk assessment process 261–262 bacteria 147–148, 153–154 Trichogramma case study 124–127 definition 146 displacement 7, 158, 171–172 diagnosis and detection 152–156 diurnal rhythms 82 fungi 148–149, 154–155 invertebrates 150–151, 155–156 DNA markers 153, 154, 155, 189–192 in mass rearing 197 Dryocosmus kuriphilus 172 nematodes 150, 155 protozoa 149–150, 155 risk assessment 156–158 ecological host range see under host guidelines and recommendations range and specificity 159–161 ecology, shared 19–20, 26 in test species 45 ecoregions viruses 146–147, 153 biogeographic realms and cost–benefit analysis see under risk hierarchical biomes 209(fig) assessment and management classification 203–207 Cotesia spp. 20, 22, 23, 24, 73, 147 concept and definitions 203 courting movement of arthropods for definition 78 scientific study 213–217 and diurnal rhythms 82 use in current biological control crops: damage by biological control practice 207 agents see under plants effect size 227–228 Curinus coeruleus 54 efficacy: assessment 274–275 cuticle: lipid content 105–106 ELISA (enzyme-linked immunosorbent Cydia pomonella 24 assay) 153 cytochrome oxidase: gene sequences Encarsia pergandiella 258(tab) 191 Entomophaga maimaiga 169 Index 293

Entomophaga praxibuli 158 risk assessment of commercial enzymes, restriction 193–194 natural enemies 263–268, Epiphyas postvittana 24 265–268 Epirrita autumnata 101–102 European Union EPPO (European and Mediterranean project: Evaluating environmental Plant Protection Organization) risks of biological control 167 workshop on biological control review of current regulatory status in Europe (1997) 2 3 risk assessment of agents on EPPO extrapolation: factor of uncertainty 277 list 263, 265 equivalence testing 228 ERBIC (Evaluating Environmental facultative hyperparasitoids 70, 74, 151 Risks of Biological Control FAO Code of Conduct for the Import Introductions into Europe) and Release of Exotic Biological research project (EU, Control Agents 137 see IPPC 1998–2002) 2 Code of Conduct ERBIC/OECD risk assessment feeding: insect habits 133–134 procedure 255–260 field surveys see surveys, field Eretmocerus eremicus 110(fig), 111 Fiji 40–41 Erionota thrax 20, 22 food webs 173 errors foraging: behaviour of natural enemies of implementation in managed 42–44 systems 277–278 freeze tolerance and intolerance 101, in statistical testing 224–226, 102 229–230 fruit flies 22, 172 establishment 8 fungi 148–149, 154–155, 171 abiotic factors 99, 105(tab) humidity 105–106 temperature 100–104, 107–111 Galendromus occidentalis 72 biotic factors 99 host/prey effects 106–107 GARP 82 and crop damage potential 140 Gelis agilis 73 not desirable in inundative Generalized Estimating Equations 235, releases 98–99 236 recommendations for assessing Generalized Linear Models 233–234 potential 111–112 repeated measurements 235–236 seasonal persistence vs permanent gregarines 149 establishment 99 grids, recapture 119–120 Eudocima fullonia 55 Guam: fortuitous biological control 171 eugregarines 149 gypsy moth 24 Eurasia: ecoregions 205(fig) insect spread in mountain regions 209–210 habitats 82 Europe habits, feeding 133–134 ecoregions 208(fig), 215, 216(fig), Harmonia axyridis 72, 265 217 Hawaii 3, 54, 65, 169, 172, 173 insect distribution and spread Hazardous Substances and New 209–213 Organisms (HSNO) Act (New movement of arthropods for Zealand, 1996) 3 scientific study 213–217 criteria considered and proposals for regulation and risk information required 246–250 assessment 2, 3 roles and components 245–246 294 Index

hazards: OECD information large arena choice behavioural requirements 5(tab) test 52–53, 234, 235(tab) health, human 177–178, 251, 276 no-choice vs choice tests 6, 50 Heliothis virescens 85 points to consider in test herbivore-induced synomones 24 development 42–45 Heteropsylla cubana 54 reviews 4 Heteroptera small arena no-choice behavioural injury caused to plants 137 test 51–52, 237, 238(fig) requirement for water 135–136 small arena no-choice black-box Heterorhabditis spp. 175–176 test 50–51 Hippodamia convergens 72, 265 test reliability 6 host range and specificity hosts: effect of characteristics on behavioural data required 41–42 natural enemy foraging 42–44 natural enemy foraging humans behaviour 42–44 health effects of biological control determining factors 19–20 177–178, 251, 276 difficulties of data collection 18 risk assessment of pathogens ecological host range 157–158 determination 26, 28–29 humidity: determines establishment effects of introgression 88 potential 105–106 field surveys see surveys, field hybrid zones 80 hybridization, nucleic acid 153 host specificity: purpose of testing hybridization: of progeny 40 definition 79 information from classical host range shifts 86 biological control 40–41 hybrid speciation 86–87 literature 4, 56 introgression through morphological constraints 42 backcrossing of hybrids 87–89 OECD information requirements non-viable and sterile progeny 5(tab) 85–86 physiological host range 40 and phylogenetic relatedness 80, rarely considered in the past 15–16 81(tab) in risk assessment process 262 reproductive character selection of non-target test species displacement 87 5–6, 47–48 Hypera brunneipennis 171 case study: Celatoria compressa Hypera postica 171 27–31 hyperparasitoids 70, 74, 151 centrifugal phylogenetic method 16–17, 18 lessons from weed biological idiobionts 19 control 16–18 import: regulations 159, 207, 217 literature review of criteria 20–25 inbreeding: of test species 46–47 recommendations 25–27 index, risk see under risk assessment shifted in hybrid progeny 86 and management taxonomic extrapolation 41 infection: of test species 45 test interpretation 6, 53–55 infochemicals 43, 47 test methodology information approaches presented in the from early studies of classical literature 39(tab) biological control 40–41 field test 53 inadequacy of 267–268, 277 flow chart for test scheme design OECD requirements see OECD 49(fig) guidance document Index 295

inter simple sequence repeats 190 keys, molecular 193–194, 195–196 interactions see competition and other killing see under competition and interactions other interactions interbreeding koa bugs 169 can affect abundance 78, 85 koinobionts 19 impacts host range shifts 86 hybrid speciation 86–87 larval vs non-larval parasitoids 19 non-viable or sterile progeny learning: role in host-finding 44 85–86 Lecanicillium lecanii 171 reproductive character Leptopilina heterotoma: effect of displacement 87 learning 44 relevant factors link functions 232–233 copulation and sperm use 83–85 lipids, cuticular 105–106 geographic distribution 80, 82 Listronotus bonariensis 22–23, 171 mate recognition 83 Lysiphlebus testaceipes 72 phylogenetic relatedness 80, 81(tab) spatial and temporal barriers Macrolophus caliginosus 137, 157 82–83 cold tolerance 108–109, 110(fig) test flowcharts 89–91, 92(fig) development threshold types 78–79 temperature 108 internal amplification control (IAC) 153 introduction into UK 107–108 internal transcribed spacers (ITS) Macrosiphum rosae 23 190–191, 194–196, 198 mark–release–recapture (MRR) International Standard for experiments Phytosanitary Measures No. 3 data analysis see IPPC Code of Conduct dispersal distance and disperser introgression density 123–124 definition 79 models 121–122 problem of directionality 122–123 as a result of rare courtship and key issues to consider 116–118 mating 82 markers used 118–119 through backcrossing of fertile pattern of recaptures 117(fig) hybrids 87–89 recapture grids 119–120 invertebrates recommendations 127–128 as contaminants 150–151, sampling strategies and traps 155–156 120–121 import regulations 159 Trichogramma case study risk assessment of pathogens 124–127 156–157 markers IOBC/WPRS Commission document 3 cost of molecular identification 198 IPPC Code of Conduct (1996, revised DNA markers 189–192 2005) 2, 207 molecular recognition of taxa results in delayed introduction 11 192–194 review of implementation and use Trichogramma case study 39–40 194–198 ISSR PCR 190 in recapture experiments 118–119 ITS1 and ITS2 (internal transcribed unambiguity of molecular spacers) 190–191, 194–196, methods 188 198 mating definition 78–79 mate recognition 83 Japan 172 physical incompatibilites 83–85 296 Index

mating continued National Resource Inventory (USA) 173 spatial and temporal barriers nematodes 150, 155, 171 82–83 case study of inundative release Mediterranean region: species spread 175–176 210 neogregarines 149 Megastigmus nipponicus 172 Neoseiulus californicus 110(fig), 111 Melitaea cinxia 73 Neoseiulus cucumeris 147 Mexico 2–3 Nesidiocoris tenuis 137 Microctonus aethiopoides 22–23, 170, New Zealand 171, 172 adverse impacts on valued exotic post-release impact 173–175 species 170 Microctonus hyperodae 22–23 case study of process of new microorganisms see under organism introduction 250–253 contamination competitive displacement 172 microsatellites 189, 194–195, 198 microscopy 152, 153, 155 Hazardous Substances and New microsporidians 149–150 Organisms (HSNO) Act (1996) 3 mitochondria: DNA sequences 191 post-release impact of Microctonus modelling 8 aethiopoides 173–175 in MRR experiments 121–124 post-release monitoring 166–167 non-target impacts of M. risk assessment aethiopoides 174 Hazardous Substances and New monitoring, post-release 7–8 Organisms (HSNO) Act 245–250 case studies scales for estimating adverse inundative release of nematodes environmental effects 248(fig) 175–176 survey of non-target impacts knapweed biological control and 168–169 human health 177–178 Nezara viridula 169 Microctonus aethiopoides Nipaecoccus viridis 171 173–175 Nosema spp. 150 direct effects on beneficial or valued exotic species 170–171 direct effects on non-target native oceans: main barriers to movement species 168–170 207, 209 fortuitous biological control 171 OECD guidance document 3, 4, 138, to identify competition or 255–260 displacement 171–172 information requirements 5(tab) indirect effects 172–173 omnivory, true 133, 134–135 recommendations 178–180 Ooencyrtus spp. 54–55 regulatory situation 166–167 mountains: ecoregions and insect Opuntia spp. 170 movement 209–210 Orius insidiosus 265 MRR experiments see mark–release– Ostrinia nubilalis 22, 24, 279(tab) recapture (MRR) experiments overwintering 101–102, 107 multiplex PCR 196 Myriophyllum spicatum 171 Pachycrepoideus vindemmiae 70 pathogens: risk assessment 156–158 NAPPO (North American Plant PCR see polymerase chain reaction Protection Organization) (PCR) guidelines for release of Peristenus digoneutis 6 entomophagous agents for persistence, seasonal 99 biological control 2–3, 207 Phyllocnistris citrella 22 Index 297

Phyllonoryctor leucographella 210 Pseudococcus viburni 250–253 Phytoseiulus persimilis 147, 258 Pseudococcus zelandicus 251–252 Pieris rapae 22, 169 Pseudophycus maculipennis 250–253 Pieris spp. 24 pseudoreplication 229–230 plants Psytallia fletcheri 22 effect of characteristics on natural Pyracantha spp. 210 enemy foraging 42 plant-feeding predators ecological role and use in quality control 160–161 biological control 134–135 injury caused to plants 137 nutrients obtained from plants randomization: feasibility 230–231 135–136 range: of hosts see host range and risk assessment criteria 137–138 specificity risk assessment testing RAPD (randomly amplified procedures 140–141 polymorphic DNA) PCR 189 risk assessment variables 138–141 rearing: of test species risk assessment of pathogens 157 effects of conditions on behaviour simulation of treatment on non- 45–46 target insects 234(fig) laboratory conditions 44–45 and species distribution 217 problems due to infection 45 Plutella xylostella 22 problems of inbreeding 46–47 pollution, biological 65 recapture experiments see polymerase chain reaction (PCR) 153, mark–release– recapture (MRR) 154, 155 experiments recognition: of mates 83 ISSR PCR 190 reptiles: import regulations 159 of ITS sequences 190–191, restriction enzymes 193–194 194–196, 198 Rhinocyllus conicus 170 of microsatellite DNA 189 Rhizopoda 149 of mitochondrial DNA 191 ribosomes: 28S RNA 191 multiplex PCR 196 risk assessment and management overview of methods 192 concept 242 RAPD PCR 155, 189 ERBIC/OECD procedure 255–260 in the recognition of taxa 192–194 harmonization 255 of ribosomal spacers 191 Hazardous Substances and New use of restriction enzymes 193–194 Organisms (HSNO) Act (New populations Zealand, 1996) 245–250 non-target species 9, 167 scales for estimating adverse not affected by harm to environmental effects 248(fig), individuals 68–69 249(fig) types of interactions 66–69 identification of risks 242–243, post-release monitoring see 256–257 monitoring, post-release process in New Zealand 250–253 power, statistical see statistics: proposed stepwise procedure methods 260–263, 268–270 precautionary principle 285 applied to commercial natural predation see under competition and enemies 263–265 other interactions quick scan method for agents primers: design 196 already in use 265–268 priorities, national 39 risk analysis 243–244 protozoa 149–150, 155 subject of increasing attention Pseudacteon curvatus 24 64–65 298 Index

risk assessment and management pseudoreplication 229–230 continued randomization in experimental risk evaluation 244 design 230–231 risk index calculation 257–259, shortcomings of non-parametric 260(fig), 262, 264(fig) tests 223 risk management and time as a measurement variable communication 244–245, 259 236–237 risk/benefit analysis 10, 260 unified approach to testing analysis and evaluation 231–233 279–281, 283–284 variables and their distribution baseline scenario 278, 282 232(box) Steinernema spp. 175–176 categories of costs and benefits sterility: from interbreeding 85–86 275(tab) stochasticity 277 economic costs and benefits supercooling point 101–102, 103–104 274–275 surveys, field 4–6 environmental costs and benefits faunal 168 276 problems of time limits 9 health costs and benefits 276 susceptibility, crop 139–140 identification of potential risks Switzerland and benefits 278–279, 282 movement of arthropods for regulatory decisions 281 scientific study 213–217 Trichogramma brassicae sources of alien insects 210 example 282–284 Trichogramma brassicae mark– uncertainties 276–278, 280 release–recapture study 124–127 synomones, herbivore-induced 24 safeguard species 26–27, 30–31 seasonal persistence 99 Serratia marcescens 148 taxonomy Seychelles: fortuitous biological and crop damage potential 138 control 171 difficulties of parasitoid taxonomy Sitona discoideus 22–23, 170, 171, 5, 18, 79 172, 173 extrapolation from parasitoid Sitona lepidus 172 taxonomy 41 soil: moisture 106 host taxonomy as host range determinant 19 Solenopsis spp. 24, 72 Technomyrmex albipes 171 speciation 79 Telenomus lucullus 55 in hybrids 86–87 temperature specificity, host see host range and adaptation of Trichogramma spp. specificity 82 Spodoptera spp. 147 factor determining establishment statistics: methods potential 100–102 ␣ - and ß-errors in testing 224–226 developmental thresholds Generalized Linear Models 102–103 233–234 lethal temperature 104, 110–111 repeated measurements 235–236 outdoor cage tests 104 power analysis 226–228 supercooling point 101–102, examples 229 103–104 software 228–229 thermal budget 103 power vs replicates required UK case studies 107–111 223–224 and susceptibility to bacteria 148 Index 299

tests: host range and specificity see United Kingdom: case studies on under host range and establishment 107–111 specificity United States Tetranychus urticae 72 adverse impacts on non-target thermal budget 103 plants 170 thresholds, developmental 102–103 agreement to NAPPO guidelines Thripobius semiluteus 258 2–3 ticks 177 ecoregions 206(fig) Torymus benficus 172 insect distribution and spread Torymus sinensis 172 209 traps: in recapture experiments fortuitous biological control 171 120–121 gypsy moth control 169 Trichogramma brassicae 7, 265 inconsistent Federal and State environmental risk–benefit jurisdiction 3 assessment 282–284 National Resource Inventory 173 comparison with deltamethrin post-release monitoring 167 279(tab), 280(tab) rejected introductions 54 host specificity 23 Urophora spp. 177 host specificity testing 25 mark–release–recapture study 124–127 variables, measurement 232(box) Trichogramma minutum: host range time 236–237 testing 24–25 variation, intraspecific 46 Trichogramma nubilale: risks to non- vectors: of plant diseases 139 target Lepidoptera 22 vertebrates: risk assessment of Trichogramma platneri: host range 24 pathogens 157–158 Trichogramma spp. viability: effect of interbreeding 85–86 adaptation to temperature 82 viruses 146–147, 153 development of molecular and human disease 177 recognition system 194–198 female mating preferences 83 genital incompatibility between water: requirement for feeding species 84–85 135–136 introgression 89 WebCutter 193 problems of identification 188 webs, food 173 regionally restricted releases 170 weeds: species for host specificity reproductive compatibility 80 testing 16–18 seasonal activity 82–83 Wolbachia spp. 148 Trichopoda giacomelli 6 Trignospila brevifacies 24 Typhlodromips montdorensis 110(fig), Zelus renardii 70 111 zoophytophagy see omnivory, true