sign in sign up
<<
Home , Arrestin, Teneurin

  

Arrestin-independent constitutive endocytosis of GPR125/ADGRA3

Spiess, Katja; Bagger, Sofie O.; Torz, Lola J.; Jensen, Kristian H. R.; Walser, Anna L.; Kvam, Jone M.; Mogelmose, Ann-Sofie K.; Daugvilaite, Viktorija; Junnila, Riia K.; Hjorto, Gertrud M.; Rosenkilde, Mette M.

Published in: Annals of the New York Academy of Sciences

DOI: 10.1111/nyas.14263

Publication date: 2019

Document version Publisher's PDF, also known as Version of record

Document license: CC BY-NC

Citation for published version (APA): Spiess, K., Bagger, S. O., Torz, L. J., Jensen, K. H. R., Walser, A. L., Kvam, J. M., Mogelmose, A-S. K., Daugvilaite, V., Junnila, R. K., Hjorto, G. M., & Rosenkilde, M. M. (2019). -independent constitutive endocytosis of GPR125/ADGRA3. Annals of the New York Academy of Sciences, 1456, 186–199 . https://doi.org/10.1111/nyas.14263

Download date: 02. okt.. 2021 Ann. N.Y. Acad. Sci. ISSN 0077-8923

ANNALS OF THE NEW YORK ACADEMY OF SCIENCES Special Issue: Adhesion G –Coupled Receptors ORIGINAL ARTICLE Arrestin-independent constitutive endocytosis of GPR125/ADGRA3

Katja Spiess, Sofie O. Bagger, Lola J. Torz, Kristian H. R. Jensen, Anna L. Walser, Jone M. Kvam, Ann-Sofie K. Møgelmose, Viktorija Daugvilaite, Riia K. Junnila, Gertrud M. Hjortø, and Mette M. Rosenkilde Laboratory for Molecular Pharmacology, Department of Biomedical Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Copenhagen, Denmark

Address for correspondence: Mette M. Rosenkilde, Laboratory for Molecular Pharmacology, Department of Biomedical Sciences, Faculty of Health and Medical Sciences, University of Copenhagen, Blegdamsvej 3B, Copenhagen 2200, Denmark. [email protected]

The orphan receptor GPR125 (ADGRA3) belongs to subgroup III of the adhesion −coupled receptor (aGPCR) family. aGPCRs, also known as class B2 GPCRs, share basic structural and functional properties with other GPCRs. Many of them couple to G and activate G protein−dependent and −independent signal- ing pathways, but little is known about aGPCR internalization and β-arrestin recruitment. GPR125 was originally described as a spermatogonial stem cell marker and studied for its role in Wnt signaling and cell polarity. Here, using cell-based assays and confocal microscopy, we show that GPR125 is expressed on the cell surface and under- goes constitutive endocytosis in a β-arrestin−independent, but -dependent manner, as indicated by colo- calization with transferrin receptor 1, an early marker. These data support that the constitutive internal- ization of GPR125 contributes to its biological functions by controlling receptor surface expression and accessibility for ligands. Our study sheds light on a new property of aGPCRs, namely internalization; a property described to be important for signal propagation, signal termination, and desensitization of class A (-like) and B1 (VIP/secretin) GPCRs.

Keywords: adhesion GPCR; GPR125; ADGRA3; internalization; endocytosis; β-arrestin

Introduction ClassB2ofthesuperfamilyofGPCRscon- sists of 33 adhesion GPCRs (aGPCRs) in humans. Gprotein−coupled receptors (GPCRs) are versa- Like other GPCRs, aGPCRs are membrane-located tile, seven-transmembrane domain (7TM) proteins proteins that possess the signature 7TM domain, that regulate a variety of intracellular signaling cas- with a structural hallmark containing a large cades in response to extracellular stimuli, such as extracellular N-terminus with adhesion properties. hormones, neurotransmitters, ions, photons, and Many aGPCRs are autoproteolytically cleaved at odorants.1 They are among the most intensively the GPCR proteolytic site (GPS), which lies within studied drug targets due to their substantial involve- the GPCR autoproteolysis−inducing domain. This ment in human pathophysiology and pharmaco- results in the N-terminal fragment (NTF) that is logical tractability2 with up to 35% of all mar- noncovalently linked to the C-terminal fragment keted drugs acting via GPCRs.3 Ligand-mediated (CTF) containing the 7TM domain.4,5 Multiple activation of GPCRs initiates signaling through molecular mechanisms of G protein activation have heterotrimeric G proteins, as well as through G been proposed for aGPCRs, involving the position- protein−independent pathways. Moreover, some ingoftheNTFrelativetotheCTF,whichenablesthe GPCRs also show constitutive activity that can be Stachel (also called stalk) located downstream of the further modulated by ligands of different efficacies.1 GPS motif to act as tethered agonist.6,7 doi: 10.1111/nyas.14263 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences 1 published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes. Constitutive endocytosis of GPR125/ADGRA3 Spiess et al.

Figure 1. Cladogram of class B2 adhesion GPCRs (aGPCRs). aGPCR amino acid sequences were aligned using MAFFT and the cladogram was constructed using PhyML; Likelihood-joining. Class B2 receptors are divided into nine different subfamilies marked by the different colors of the branches. GPR125 (ADGRA3) belongs to subfamily III, together with GPR123 (ADGRA1) and GPR124 (ADGRA2).

In contrast to class A rhodopsin−like receptors, ligands.25 To our knowledge, little is known about where several G protein−recognizing motifs have intracellular trafficking of aGPCRs compared with been identified,8 there is so far no conserved aGPCR class A, B1, and C receptors, apart from certain domain that would determine whether the recep- aGPCR’s interaction with β-arrestin and endoso- tor interacts with G proteins. Despite this, ligand- mal proteins.17,18,26–28 The arrestin family consists mediated9–15 and constitutive16 G protein signaling of four members: arrestin-1 and arrestin-4, also have been described for several aGPCRs involving known as visual , are exclusively expressed activation of all four major subclasses of G proteins in the retina,29 whereas the two β-arrestin iso- (Gαs,Gαi,Gαq,andGα12) and a variety of intracel- forms, β-arrestin-1 and β-arrestin-2 (also named lular signaling second messengers leading to many arrestin-2 and arrestin-3, respectively), are ubiqui- different functional endpoints.16–24 tously expressed in most tissues.30 After internalization, the receptors are either tar- GPR125 (ADGRA3) belongs to subfamily III of geted for degradation or recycled back to the cell aGPCRs (Fig. 1), also denoted as ADGRA,31 and surface where they can be stimulated again by their was initially identified as a spermatogonial stem

2 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Spiess et al. Constitutive endocytosis of GPR125/ADGRA3 cell marker.32 The receptor is broadly expressed cellswasgeneratedaspreviouslydescribed38 in various tissues with a particularly high expres- and grown the same as parental HEK293 cells. sion reported in the murine choroid plexus, where GPR125 knockdown (KD) HEK293 cells (see itisupregulatedafterbraininjury.33 GPR125 below for the generation of these cells) were has been suggested to be essential during devel- grown the same as parental HEK293 cells in the opment as a modulator of planar cell polarity medium supplemented with 5 μg/mL puromycin. (PCP) in zebrafish.34 Using genetically manipu- CHO-K1 EA-arrestin2 cells were grown in Ham’s lated zebrafish, it has been shown that GPR125 F-12 medium containing 10% FBS, 2 mM glu- regulates noncanonical Wnt signaling by recruiting tamine, 180 units/mL penicillin, 45 μg/mL strep- Dishevelled (Dvl) proteins to the cell surface, and tomycin, and 250 μg/mL hygromycin. HEK293 thereby directing cellular orientation during con- cells were transfected using LipofectamineR vergence and extension movements in gastrulating 2000 (Invitrogen) according to the manufac- zebrafish.32,34 GPR125 has also been studied in the turer’s recommendation for the -linked context of cancer. Specifically, its ability to mod- immunosorbent assay (ELISA) and the β-arrestin-1 ulate Wnt signaling leads to increased survival of and β-arrestin-2 recruitment bioluminescence res- patients with colorectal cancer,35 thereby suggest- onance energy transfer (BRET) experiments. The ing that GPR125 is acting as a tumor suppressor calcium phosphate method for transfection was in it. However, in myeloid sarcoma, GPR125 seems used in the β-arrestin-1 recruitment BRET assay to have an oncogenic effect as its upregulation con- in GPR125 KD cells, as previously described.37 For tributes to tumor formation.36 immunohistochemistry and PathHunterR GPCR Inspired by the regulation of GPR125 expression β-arrestin-2 experiments, HEK293 and CHO-K1 in cancer, we decided to investigate the cellular dis- EA cells were transfected using the FuGENER tribution of this receptor and how β-arrestin and transfection reagent (Promega) according to the clathrinareinvolvedintheregulationofGPR125 manufacturer’s recommendation. All experiments expression on the cellular surface. were performed 24 h after transfection, unless otherwise stated. Materials and methods Generation of GPR125 KD HEK293 cells Phylogenetic analysis HEK293 cells were seeded in a 96-well plate. Forphylogeneticanalysisofthe33humanaGPCRs Thenextday,themediawaschangedand (Table S1, online only), amino acids were aligned hexadimethrine bromide (at a final concentra- using MAFFT plug-in Geneious Pro Version 10.2.6 tion of 8 μg/mL) was added to each well (100 μL (Biomatters Ltd). The was con- total volume). The cells were transduced with structed with the neighbor-joining module, and the lentivirus transduction particles—shRNA human reliabilityofthetreewasanalyzedbybootstrapanal- GPR125 (clone ID NM-145290.2_3261s1c1; Sigma) ysis (100-fold resampling). according to the manufacturer’s recommendation. Constructs and cloning Treatment with puromycin (5 μg/mL) was initiated GPR125 (codon-optimized for mammalian 2 days post transduction and continued until con- cell expression) with N-terminal flag-tag in trol cells (nontransduced HEK293 cells) were dead. pcDNA3.1(+) vector was obtained from Gen- The receptor KD was confirmed by real-time qPCR. Script. To reintroduce GPR125 expression, stable GPR125 KD cells were transfected with codon-optimized Cells and culture conditions and transfection GPR125 plasmid DNA that could not be targeted by HEK293 cells were grown in Dulbecco’s modi- the shRNA due to an altered nucleotide sequence. fied Eagle’s medium with 10% fetal bovine serum (FBS), 180 units/mL penicillin, and 45 μg/mL Real-time qPCR on cell lysates streptomycin. The clustered regularly interspaced RNA was extracted using the RNeasyR Micro short palindromic repeats (CRISPR)-modified Kit (Qiagen). Approximately 1 μg of total RNA β-arrestin-1/2 gene knockout (KO) and parental was reverse transcribed with the High Capac- HEK293 cells were grown as previously described.37 ity cDNA Reverse Transcription Kit (Thermo The stable clone of inducible GPR125 HEK293 Fisher Scientific). qPCR was performed using

Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences 3 published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Constitutive endocytosis of GPR125/ADGRA3 Spiess et al. the QuantStudioTM 6 Flex Real-Time PCR Western blots using HEK293 cell lysates System (Thermo Fisher Scientific) and the HEK293 cells were lysed using 150 μL RIPA lysis PowerUP SYBRR Green Master Mix (Thermo buffer (Milipore), containing cOmpleteR Mini 20 Fisher Scientific). Cycle threshold (Ct) values protease inhibitor cocktail (Roche) and phosphatase were obtained using the QuantStudio Real-time inhibitor cocktail 3 (Sigma) and 50 μL 4× Laemmli’s PCR Software, and the –Ct method was sample buffer containing 50 mg/mL dithiothreitol. used to calculate the relative fold change of The cell lysates were sonicated and centrifuged at cDNA levels compared with a reference gene 13,000 × g for10minat4°C. (glyceraldehyde-3-phosphate dehydrogenase The samples were incubated at 30 °C for 30 min (GAPDH)). Sequences of the forward and reverse before running on an SDS gel (4−15% TGX Stain- GPR125 primers were CTGGCACATGCTTGT- Free Precast Gels (Bio-Rad)). The proteins were GAACT and GGCAAGGGTGGAATAGTGAA, blotted on a polyvinylidene difluoride membrane respectively. using the Trans-Blot turbo transfer system (Bio- Rad). For the antibody staining, the membrane was Surface expression determined by ELISA first blocked with× 2 Odyssey blocking buffer (Li- Transiently transfected HEK293 cells were fixed Cor) for 30 min, incubated with primary antibody for 10 min with 3.7% formaldehyde, washed with (mouse anti-FLAG M1 1:2000, Sigma) in 1× block- TBS/CaCl2, and blocked for 30 min at room tem- ing buffer/PBS/CaCl2 for1hatRT,washedwithPBS perature (RT) with 2% BSA/TBS/CaCl2.Fortotal + 0.01% Tween 20 (Sigma), and incubated with sec- GPR125 cell content, cells were permeabilized with ondary antibody (goat anti-mouse IRDye 800CW 0.2% saponin (Sigma) after fixation. Cells were Li-COR) in 1× blocking buffer/PBS/CaCl2 for 1 h incubated with primary antibody (mouse M1 anti- at RT. After washing twice with PBS + 0.01% Tween flag 1:2250, Sigma) in 1% BSA/TBS/CaCl2 for 1h 20 (Sigma) and once with PBS, the membrane was at RT, washed with TBS/CaCl2,andincubatedwith imaged using a Li-Cor scanner and analyzed with secondary antibody (goat anti-mouse HRP 1:1000, the Image StudioTM software. The experiment was Thermo Fisher Scientific) in 1% BSA/TBS/CaCl2 performed at least three times independently. for 1 h at RT. They were subsequently exposed to Immunocytochemistry and confocal 3,3,5,5-tetramethylbenzidine for 5 min, and the microscopy reaction stopped with 0.2M H2SO4.Absorbanceat Inducible HEK293 cells were cultured on glass cov- 450 nm was measured with the EnVision R plate erslips placed in 24-well plates, and receptor expres- reader (PerkinElmer). The experiment was per- sion was induced with tetracycline (0.25 μg/mL). formed in triplicate at least three times indepen- Cells were fixed 24 h after tetracycline induction dently. Data were analyzed using GraphPad Prism with 3.7% formaldehyde, washed with PBS, per- (GraphPad Software, San Diego, CA). meabilized in 0.1% TritonTM X-100 for 10 min at RT, blocked in PBS with 0.1% Tween 20 and 2% Internalization bovineserumalbuminfor1hatRT,andthen HEK293 cells were seeded and transiently trans- incubated with primary antibody (mouse M1 anti- fected. Twenty-four hours posttransfection, cells FLAG, 1:2250, Sigma) for 1 h at RT. After wash- were incubated in cold DMEM containing primary ing with PBS, the cells were incubated with sec- antibody (mouse M1 anti-flag 1:2250, Sigma) for ondary antibody (donkey anti-mouse conjugated to 1 h at 4 °C. After three washes with cold DMEM, Alexa Fluor 568, 1:500, Life Technologies) for 1 h at cells were either immediately fixedt ( = 0) or incu- RT. Cells were nuclear stained with 4 ,6-diamidino- bated with prewarmed DMEM at 37 °C for various 2-phenylindole (DAPI) and mounted in Mowiol R periods of time (t = 10, 20, 30, 40, and 50 min) (Sigma) before imaging on a confocal microscope to induce internalization before being fixed at the (LSM 700, Zeiss) with a 63× oil immersion plan- given time points. From there on, the procedure fol- apochromat objective. lowed that of the ELISA described above. The exper- iment was performed in quadruplicate at least three Antibody feeding experiments times independently. Data were analyzed in Graph- Fibronectin-coated glass slides were placed in 24- Pad Prism. well plates and HEK293 cells or β-arrestin-1 and

4 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Spiess et al. Constitutive endocytosis of GPR125/ADGRA3

β-arrestin-2 KO cells were allowed to adhere before HEK293 cells and stably transduced GPR125 KD transfection the next day. Twenty-four hours post- cells were transiently transfected with the follow- transfection, the cells were incubated with primary ing plasmids: GPR125, the human glucagon-like antibody (mouse M1 anti-FLAG, 1:2250, Sigma) peptide-1 (GLP-1) receptor (GLP-1R, positive in media at 4 °C for 1 hour. They were then control), or empty pcDNA3.1(+)vector(neg- fixed immediately (t = 0) or incubated in nor- ative control), in combination with the BRET mal media for 30 min at 37 °C to induce inter- donors Renilla luciferase−fused arrestins RLuc8– nalization (t = 30) before fixation. All samples arrestin-2–Sp1 or RLuc8–arrestin-3–Sp1, the BRET were blocked in 2% BSA before incubation with acceptor mem-linker-citrine-SH3, and GPCR Alexa Fluor 488−conjugated goat anti-mouse anti- kinases 2 or 6 (GRK2 or GRK6) to facilitate body (1:500, Invitrogen) for 1 h at RT. Cells were β-arrestin-1 and β-arrestin-2 recruitment. One then permeabilized with 0.2% saponin (Sigma) and day (for Lipofectamine-transfected cells) or 2 days incubated with Alexa Fluor 568−conjugated don- (for cells transfected with the calcium-phoshate key anti-mouse antibody (1:500, Life Technologies) method, i.e., GPR125 KD cells) later, the cells were for 1 h at RT. The glass slides were removed from washed with PBS and resuspended in PBS with the 24-well plate and mounted on slides, sealed, 5mmol/Lglucose.Weadded85μLofcellsuspen- andimagedasdescribedabove.Tostudycolocaliza- sion to each well on a 96-well isoplate followed by tion, GPR125 was cotransfected with GFP-tagged the addition of PBS with 5 μmol/L coelenterazine h plasmids containing either transferrin receptor 1 (final concentration). After 10 min at RT, increasing (TfR1) or lysosomal-associated 1 concentrations of GLP-1 were added to the positive (LAMP1). Here, GPR125 was detected by Alexa control cells. Luminescence was measured by EnVi- Fluor 568−conjugated antibodies but otherwise, sion plate reader (PerkinElmer) (RLuc8 at 485 ± the procedure was the same as described above. 40 nm and YFP at 530 ± 25 nm). The experiment CoLocalizer Pro 5.4.3 (CoLocalization Research was performed in triplicate at least three times Software) was used to detect colocalization of the independently. red and green fluorescence emitted by GPR125 PathHunter GPCR β-arrestin-2 experiments (red) and TfR1 (green) or LAMP1 (green), and The recruitment of β-arrestin-2 was measured to calculate Pearson’s correlation coefficients (Pr). using the PathHunter β-arrestin assay as described To quantify the amount of internalized receptor in previously.29 Briefly, cDNA encoding GPR125 and parental HEK and in β-arrestin-1 and β-arrestin-2 US28 (positive control) was fused to the ProLinkTM KO cells after 30 min, 10 images were taken, respec- (PK) C-terminal protein tag and the small frag- tively, using a confocal microscope (LSM 710, Zeiss) ment of β-galactose (β-gal) and cloned into the and a plan apochromat 63×/1.40 Oil DIC M27 PK2 vector. The experiments were performed using objective. For the red fluorescence signal quantifi- theCHO-K1EAarrestincelllinewiththesta- cation, the following settings were used: 8.21 airy ble expression of β-arrestin coupled to the β-gal units, optical section 7-micron, 561 nm laser at 2%, large fragment. One day after seeding the cells (96- and averaging four times (fixed for all quantified well plate), they were transfected at a cell density images). For the green fluorescence signal quantifi- of 60–80% with FuGENE reagent using different cation, the following settings were used: 9.59 airy amounts of cDNA (GPR125, US28, and PK2 (vec- units, optical section 7-micron, 488 nm laser at 1%, tor control)). β-Arrestin-2 recruitment was detected and averaging four times (fixed for all quantified as β-gal activity using the PathHunter detection images). Data analysis was performed using the Zen kit (DiscoverX). Chemiluminescent substrate com- software (Zeiss). posed of Galacton-StarTM substrate, Emerald-IITM Real-time β-arrestin-1 and β-arrestin-2 solution, and PathHunter cell assay buffer in a recruitment experiments ratio of 1:5:19, respectively, was added to the cells The BRET experiments were carried out as pre- (50 μL/well). The luminescent signal was deter- viously described.29,39 Briefly, 1 day after seeding mined after 60 min incubation using the EnVision cells in a 6-well plate, 60–80% confluent parental Multilabel Plate Reader (PerkinElmer).

Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences 5 published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Constitutive endocytosis of GPR125/ADGRA3 Spiess et al.

Figure 2. Cell surface expression of GPR125. (A) Diagram of the GPR125 receptor construct with the indicated motifs: GPS, 7TM proteolytic site; HBD, hormone-binding domain; IG, immunoglobulin domain; and LRR, leucine-rich region. (B) Cell surface expression of GPR125 (red bar) in transiently transfected HEK293 cells determined by ELISA against the N-terminal flag-tag, using pcDNA vector (gray bar) as baseline. The total amount of the receptors was measured by permeabilizing the cell membrane (striped bars). GPR39 was included as a positive control (white bar). (C) GPR125 is mainly expressed on the cell surface (red) of stably transfected HEK293 cells (pool clones) 24 h after induction with tetracycline. The nucleus is stained with DAPI (blue) and the cell outline is shown in D. Error bars in B indicate SEM for at least three independent biological replicates.

Statistical analysis internalization event, followed by cell permeabi- Data were analyzed using a paired Student’s t-test lization to allow intracellular staining (Fig. 3A and or a one-way ANOVA (multiple comparisons). B). Consistent with the surface expression deter- P values < 0.05 were considered statistically mined by ELISA and microscopy (Fig. 2B and significant. C), GPR125 was initially detected on the cell sur- face at 4 °C (Fig. 3A and B). After 30 min at Results 37 °C to allow internalization, GPR125 was mainly GPR125 is expressed on the cell surface and located in intracellular vesicles (Fig. 3C and D). undergoes constitutive internalization These data were corroborated in transiently trans- To determine the localization pattern of GPR125, fected nonpermeablized HEK293 cells, by mea- we used an N-terminally flag-tagged construct suring GPR125 cell surface expression over time (Fig. 2A). GPR125 surface expression was deter- after a temperature shift from 4 to 37 °C. After mined by ELISA in transiently transfected HEK293 30 min, the cell surface expression of GPR125 had cells (Fig. 2B) and the overall cellular localization decreased to 48% of the initial level, and after 1 h was observed in inducible GPR125 HEK293 cells by only 29% GPR125 remained on the cell surface microscopy (Fig. 2C and D). We found that GPR125 (Fig.3E).TheclassAreceptorGPR183(alsoknown is mainly expressed on the cell surface of HEK293 as EBI-2) was included as a positive control. This cells, as the total amount of GPR125 expressed in receptor is predominantly cell surface−expressed41 these cells was comparable with surface-expressed and internalizes constitutively as well as ligand GPR125 (Fig. 2B). This was also the case for the dependently (after addition of the endogenous ago- positive control, GPR3940 (Fig. 2B). The internal- nist 7α,25-dihydroxycholesterol (7α,25-OHC)).42,43 ization of GPR125 was determined using an anti- Consistent with a previous report,43 23.5% of body feeding approach, in which primary antibod- surface-expressed GPR183 was constitutively inter- ies were directed against the N-terminal flag-tag of nalized after 30 min (Fig. 3F), whereas the addi- GPR125. Differently labeled secondary antibodies tion of 7α,25-OHC enhanced the internalization distinguished surface expression (green) and intra- to 43% (Fig. 3G), that is, to comparable levels cellularly located receptors (red). This is done by with the constitutive internalization of GPR125 application before (green, t = 0min)andafter(red, (Fig. 3E). In summary, GPR125 is mainly expressed t = 30 min) a temperature shift that induced the on the cell surface and undergoes constitutive

6 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Spiess et al. Constitutive endocytosis of GPR125/ADGRA3

Figure 3. Constitutive endocytosis of GPR125 and colocalization with early and late endosomal markers. (A) Cell surface local- ization of GPR125 before (green) and (B) after induction of internalization, (red). (C and D) GPR183 included as a positive control. (E) Cell surface expression of GPR125 and GPR183 (F and G) after inducing receptor internalization (+/–ligand). The expression levels were normalized to each receptor at t = 0 minute. (H and I) Colocalization of TfR1 fused to GFP expressed together with GPR125 detected before, H, and after, I, inducing receptor endocytosis (white arrows). (J and K) Colocalization of LAMP1 fused to GFP expressed together with GPR125 detected before and after induction of endocytosis. (L−P) Scatterplots of the correlation between GPR125 and TfR1 or LAMP1 in panels E−H. (M and N) Determination of Pearson’s correlation coefficient (Pr) between GPR125 and TfR1. (O and P) Pr of GPR125 and LAMP1. Error bars in E–G indicate SEM for three independent biological repli- cates. ∗P < 0.05; ∗∗P < 0.01 ∗∗∗P < 0.001; and ∗∗∗∗P < 0.0001, using one-way ANOVA analyses.

Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences 7 published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Constitutive endocytosis of GPR125/ADGRA3 Spiess et al. internalization under physiological temperatures to upon cotransfection with GRK2 or GRK6 kinases the same degree as the agonist-induced GPR183. that are both ubiquitously expressed in human cells. GPR125 expression in cells was confirmed GPR125 colocalizes with the early endosome by western blotting and its surface expression by marker TfR1 but not with the late endosome ELISA (Fig. 4G and H). Given that endogenous marker LAMP1 expression of GPR125 in HEK293 cells (Fig. S1, Having established that GPR125 is constitutively online only) may be affecting this experiment, internalized, we cotransfected GPR125 with GFP- we wanted to confirm the effect observed upon tagged marker of early (TfR1) and reintroduction of GPR125 in GPR125 KD cells. We late endosomes/early (LAMP1) to deter- used a stable lentivirus-transduced HEK293 cell mine the route taken by internalized receptors. line, where endogenous GPR125 expression was Using this approach, we would thus be able knocked down by GPR125-specific short-hairpin to describe whether GPR125 is internalized via RNA (shRNA). The KD of GPR125 was confirmed clathrin-mediated endocytosis as TfR144 (colocal- by real-time qPCR (Fig. S1A, online only). GPR125 ization of GPR125 with TfR1) or following lysoso- was reintroduced in a concentration-dependent mal protein degradation pathways (colocalization manner by transfection with engineered GPR125 of GPR125 with LAMP139). Consistent with the plasmid DNA untargetable by the shRNA (Fig. surface expression of GPR125, the colocalization S1B, online only). Under these settings, the lack between GPR125 and the endosomal markers TfR1 of β-arrestin-1 recruitment was confirmed and and LAMP1 was weak at 4 °C (Fig. 3H and J, respec- again a decrease in β-arrestin-1 was detected upon tively). For TfR1, a Pearson’s correlation coefficient cotransfection with GRK2 and GRK6, although (Pr) of –0.043 was obtained (Fig. 3L), whereas the these results did not reach statistical significance Pr of LAMP1 was –0.463 (Fig. 3N). After 30 min (Fig.S1C,onlineonly).Asapositivecontrol,we at 37 °C, GPR125 moderately colocalized with TfR1 includedtheGLP-1Rstimulatedwithincreas- (Fig. 3I) with a Pr of 0.463 (Fig. 3M), but only weakly ing concentrations of the endogenous agonist with LAMP1 (Fig. 3K) with a Pr of 0.046 (Fig. 3O). GLP-1 and observed a ligand-dependent β-arrestin In conclusion, GPR125 colocalized with TfR1 after recruitment in parental HEK293 and GPR125 KD internalization, indicating that GPR125 is predomi- cells (Fig. 4E and F and Fig. S1D, online only). To nantly endocytozed in a clathrin-mediated manner further determine if there is a direct interaction of and possibly recycled similarly to what is observed β-arrestin with GPR125, we used transiently trans- with TfR1,45 as the receptor does not follow protein fected cells, coexpressing the PK-tagged GPR125 degradation pathways within the time frames ana- and the enzyme acceptor (EA)-tagged β-arrestin-2. lyzed in these experiments. In the case of β-arrestin-2 interacting with the β-Arrestin-1 and β-arrestin-2 recruitment to receptor, the β-galactosidase enzyme fragments GPR125 (EA and PK) will reconstitute a functional enzyme Given the robust internalization of GPR125 and a chemiluminescent signal can be detected. (Fig. 3), we wanted to determine if GPR125 recruits We determined a moderate interaction of GPR125 β-arrestin to initiate internalization. To this aim, with β-arrestin-2at60min,butthisrecruitmentof we used a BRET-based real-time β-arrestin recruit- β-arrestin-2 was not comparable with the interac- ment assay, which gives a luminescence signal, tion observed with our positive control US28 (Fig. when RLuc8-fused β-arrestin (RLuc8–arrestin-2– S1E, online only). Sp1 or RLuc8–arrestin-3–Sp1, BRET donors) is To confirm that GPR125 internalization was recruited to the cell membrane in proximity to the independent of β-arrestins, the antibody feeding membrane-anchored citrine (mem-linker-citrine- experiments were performed in parental HEK293 SH3, BRET acceptor).39 Following cotransfection and β-arrestin-1 and β-arrestin-2 KO cells. GPR125 with GPR125, we did not observe any increase got internalized in both cell lines (Fig. 5A−D). in β-arrestin-1 and β-arrestin-2 recruitment to Red fluorescence intensities were measured to the cell membrane (Fig. 4A and B). In fact, a quantify the amount of internalized receptors; no decreased recruitment signal was observed in both difference was found in the amount of internal- β-arrestin-1 (Fig. 4C) and β-arrestin-2 (Fig. 4D) ized GPR125, comparing parental HEK293 and

8 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Spiess et al. Constitutive endocytosis of GPR125/ADGRA3

Figure 4. β-Arrestin recruitment by GPR125. (A and B) β-Arrestin-1 and β-arrestin-2 recruitment was determined by perform- ing BRET experiments in HEK293 cells. (C and D) β-Arrestin-1 and β-arrestin-2 recruitment of GPR125 after cotransfection with GRK2 and GRK6 in HEK293 cells. (E and F) GLP-1R−mediated β-arrestin-1 and β-arrestin-2 recruitment in a ligand-dependent manner was included as a positive control. (G and H) GPR125 expression was confirmed by western blotting and ELISA. Error bars indicate SEM for at least three independent biological replicates. ∗∗P < 0.01 and ∗∗∗P < 0.001, using one-way ANOVA analyses.

β-arrestin-1 and β-arrestin-2 KO cells (Fig. 5E). proteolytic process. Finally, no G protein−mediated Moreover, the amount of remaining surface- signaling has been described for GPR125. In this expressed GPR125 (green fluorescence signal) was manner, it resembles the two other adhesion recep- also equivalent in both cell lines (Fig. 5E). tors in the subfamily III (GPR123 and GPR124), with which it also currently shares the status of Discussion being an orphan47 (Fig. 1). In the present study, we show that GPR125 isexpressedonthecellsurfaceandthatitis Receptor endocytosis is a common internalized in a constitutive manner at a speed mechanism to regulate receptor function correspondingtothatofanagonist-induced β-arrestin−mediated endocytosis is a com- class A receptor (GPR183). Moreover, we show mon and well-described desensitization mech- that the internalization of GPR125 happens in a anism for class A and B1 receptors.37,48 Also, β-arrestin−independent, but TfR1 colocalizing/ β-arrestin−independent internalization, as clathrin-dependent manner. These findings are observed here for GPR125 (Fig. 4), has been important amendments to the current knowledge described before as not all receptors rely on of the biology of GPR125. No ligands have yet arrestins for their internalization. Clathrin- been described for GPR125, and it, therefore, still mediated endocytosis is the major pathway for remains an orphan, like most aGPCRs.46 More- uptake of molecules and is essentially regulated over, its cleavage status is not known and based by the GTPase dynamin.45 There is a growing on its atypical GPS-motif (SLS) and not the usual evidence that GPCRs use clathrin-mediated inter- (HLS/HLT), it is possibly not cleaved via an auto- nalization as an alternative route, independent of

Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences 9 published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Constitutive endocytosis of GPR125/ADGRA3 Spiess et al.

Figure 5. Constitutive endocytosis of GPR125 in parental HEK293 and β-arrestin-1 and β-arrestin-2 KO cells. (A) Cell surface localization of GPR125 before (green) and (B) after induction of internalization, (red) in parental HEK293 cells and (C and D) β-arrestin-1 and β-arrestin-2 KO cells. (E) Quantification of internalized GPR125 (red fluorescence signal) and remaining cell surface GPR125 (green fluorescence signal) in parental HEK293 and β-arrestin-1 and β-arrestin-2 KO cells. Error bars indicate SEM. and arrestin recruitement.48 For tor endocytosis, less is known about constitutive instance, this has been described for the class A internalization and how it regulates GPCR func- melanocortin-4 receptor (MC4R)49 and the two tion and biology,55 except for those cases where chemokine receptors, CXCR4 (a human CXC- it functions as a ligand scavenger (like for US2854 chemokine receptor)50 and US2851 (encoded and atypical chemokine receptors56)orwherecon- by the human cytomegalovirus, HCMV). For stitutive internalization (and recycling) ensures CXCR4, it has been suggested that the constitu- sufficient receptor expression during prolonged tive and agonist-induced receptor endocytosis are exposuretotheagonist(asforGPRC6A).57 The defined by distinct endocytic machineries: the constitutive endocytosis of GPR125 could be a con- constitutive internalization initiated by CXCR4 sequence of basal receptor activity, as described phosphorylation by C, leading to for the MC4R49 and since no G protein signaling dynamin-dependent internalization, whereas the has been described for GPR125, this remains to be ligand-induced internalization relies on arrestin determined in the future. Moreover, emerging evi- recruitment.50,52,53 For US28, the internalization dence suggests that GPCRs are capable of signal- can take place in the absence of arrestins, yet US28 ing intracellularly from endosomes, as shown for also recruits arrestins and is able to use them the 2 (V2R; class A) GLP-1 as an internalization route.51 Of particular note, (class B1).58,59 It is, therefore, possible that internal- US28 internalization is an intrinsic function of this ized GPR125 located in early endosomes could sig- receptor, as it scavenges chemokines as an immune nal intracellularly. Since it does not colocalize with escape mechanism for HCMV.54 the late endosome marker LAMP1 (Fig. 3K), it is We observed a relatively fast constitutive inter- likely that GPR125 gets recycled back to the cell nalization of GPR125 (Fig. 3E). In contrast to the surface as it has been described for the β2- comprehensive literature on ligand-mediated recep- adrenergic receptor60 and the incretin receptors.37

10 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Spiess et al. Constitutive endocytosis of GPR125/ADGRA3

Arrestin recruitment and the following complexes. Uptake of transferrin by TfR1 defines downstream signaling cascade clathrin-dependent internalization.61 We show that Interaction of β-arrestins with activated GPCRs GPR125 gets internalized in a clathrin-dependent was initially considered to be the stop signal of manner, determined by its colocalization with the receptor activation and subsequent initiation of transferrin receptor in our confocal microscopy receptor endocytosis.61 Recruitment of arrestins to studies. It is still unclear how endocytosis and initiate endocytosis has been vastly documented Wnt signaling are intertwined, but it is known that for class A and B1 receptors and most GPCRs clathrin-dependent endocytosis promotes PCP.61 seem to get internalized in an arrestin-dependent GPR125 recruits a subset of PCP components manner.25 However, the role of arrestins solely into the membrane subdomains, which suggests as signaling stoppers and receptor endocytosis that GPR125 modulates the composition of the initiators has expanded to include the capac- Wnt/PCP membrane complexes.34 Therefore, ity to act as signaling molecules on their own, GPR125-induced clathrin-dependent endocytosis independently of G proteins.62 There have been could be important for the modulation of Wnt examples of arrestin-initiated signaling cascades, signaling and subsequently, PCP. Another receptor that is, induced by ERK1/2 MAP-kinases.63 Recent of the same subgroup III, GPR124 has also been results though showed for a broad panel of class A suggested to be a potential candidate for stabiliza- GPCRs that β-arrestins are nonessential for driving tion of ligand–receptor interactions and thereby ERK/MAPK signaling.64,65 The acknowledgement essential for Wnt-induced internalization.51 It will of G protein−independent signaling has fostered be of interest to investigate whether internalization another phenomenon among GPCRs, namely of GPR125 (and of its sibling GPR124) is directly biased signaling, describing pathway-dependent linked to the modulation of Wnt signaling. Our signaling.66 In class A receptors, it is most often study paves the way to a better understanding seen that endogenous ligands are unbiased with of aGPCR internalization and contributes to the similar potencies for G protein activation and knowledge about their biological function. β-arrestin recruitment, although exceptions exist, Acknowledgments such as CCR7.67 By contrast, in class B1 receptors (VIP/secretin receptors), there is a general bias We thank Frederik Vilhardt (University of Copen- toward higher potency for G protein signaling than hagen, Denmark) for kindly supplying the con- for arrestin recruitment.37 However, for aGPCRs, structsforTfR1andLAMP1fusedtoGFPand very little is known about their use of arrestins Asuka Inoue (Tohoku University, Japan) for supply- and here, signaling bias remains to be described. ing β-arrestin-1 and β-arrestin-2 KO cells. We fur- Some aGPCRs (BAI1/ADGRB1, BAI3/ADGRB3, ther thank Sussi Mørkeberg Kristoffersen for her GPR56/ADGRG1, and GPR64/ADGRG2) have technical support. This work was supported by the been shown to interact with β-arrestins.17,26,27,68 European Research Council: VIREX Grant agree- For BAI1, BAI3, and GPR56, only receptor interac- ment 682549, Call ERC-2105-CoG, and the Lund- tion with β-arrestin was detected,17,68 whereas the beck Foundation. interaction of β-arrestin-1 with GPR64/Gα /CFTR q Author contributions (an ion channel) was shown to initiate signaling.26 For GPR125, where only the modulation of Wnt K.S. designed the research study, conducted the signaling has been described as the sole signaling,35 experiments, analyzed the data, and wrote the we observed a suppression of β-arrestin recruit- manuscript. S.O.B and T.L.J. designed the research ment to the receptor when measured in real time; study, conducted the experiments, analyzed the the effect that was increased upon cotransfecting data, and revised the manuscript. K.R., W.A.L., with GRK2 and GRK6. K.J.M., V.D., J.K.H.R., M.S.K., and G.M.H con- tributed to the experimental work, analyzed the Is the endocytosis of GPR125 a part of its data, and revised the manuscript. M.M.R. designed biological function? the research study, analyzed the data, and wrote Receptor-mediated endocytosis enables cells to take the manuscript. All authors commented on and up molecular complexes, such as ligand−receptor approved the final manuscript.

Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences 11 published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Constitutive endocytosis of GPR125/ADGRA3 Spiess et al.

Supporting information 9. Jeong, S.-J., R. Luo, S. Li, et al. 2012. Characterization of G protein-coupled receptor 56 protein expression in the mouse Additional supporting information may be found in developing neocortex. J. Comp. Neurol. 520: 2930–2940. the online version of this article. 10. Luo, R. et al. 2011. G protein-coupled receptor 56 and col- β lagen III, a receptor–ligand pair, regulates cortical develop- Figure S1. -Arrestin recruitment by GPR125. (A) ment and lamination. Proc. Natl. Acad. Sci. USA 108: 12925– Real-time qPCR analysis of GPR125 in HEK293 12930. and GPR125 knockdown (KD) HEK293 cells rela- 11. Li, S. et al. 2008. GPR56 regulates pial basement membrane tive to the expression of the control gene, GAPDH. integrity and cortical lamination. J. Neurosci. 28: 5817–5826. (B) β-Arrestin-1 recruitment was determined by 12. Iguchi, T. et al. 2008. Orphan G protein-coupled receptor GPR56 regulates neural progenitor cell migration via a G performing BRET experiments in HEK293 GPR125 alpha 12/13 and Rho pathway. J. Biol. Chem. 283: 14469– KD cells, (C) after cotransfection with GRK2 and 14478. GRK6 as in the parental HEK293 cells. GLP-1 13. Silva, J.-P. et al. 2011. Latrophilin 1 and its endogenous receptor−mediated β-arrestin-1 recruitment in a ligand Lasso/-2 form a high-affinity transsynaptic ligand-dependent manner was included as a pos- receptor pair with signaling capabilities. Proc. Natl. Acad. Sci. USA 108: 12113–12118. itive control in HEK293 GPR125 KD cells. (D) 14. Little, K.D., M.E. Hemler & C.S. Stipp. 2004. Dynamic reg- β-Arrestin-2 recruitment to GPR125 using the ulation of a GPCR--G protein complex on intact PathHunter DiscoverX system. Error bars indi- cells: central role of CD81 in facilitating GPR56-Galpha q/11 cate SEM for at least three independent biological association. Mol. Biol. Cell 15: 2375–2387. replicates. ∗P < 0.05; ∗∗P < 0.01 using Student’s t- 15. Lelianova, V.G. et al. 1997. Alpha-latrotoxin receptor, lat- rophilin, is a novel member of the secretin family of test (E). G protein-coupled receptors. J. Biol. Chem. 272: 21504– Table S1. aGPCR genes and corresponding NCBI 21508. 16. Peeters, M.C. et al. 2015. The adhesion G protein-coupled accession numbers. receptor G2 (ADGRG2/GPR64) constitutively activates SRE κ Competing interests and NF B and is involved in cell adhesion and migration. Cell. Signal. 27: 2579–2588. Theauthorsdeclarenocompetinginterests. 17. Kishore, A., R.H. Purcell, Z. Nassiri-Toosi & R.A. Hall. 2016. Stalk-dependent and stalk-independent signaling by the adhesion G protein-coupled receptors GPR56 (ADGRG1) References and BAI1 (ADGRB1). J. Biol. Chem. 291: 3385–3394. 1. Hilger, D., M. Masureel & B.K. Kobilka. 2018. Structure and 18. Stephenson, J.R. et al. 2013. Brain-specific angiogenesis dynamics of GPCR signaling complexes. Nat. Struct. Mol. inhibitor-1 signaling, regulation, and enrichment in the Biol. 25: 4–12. postsynaptic density. J. Biol. Chem. 288: 22248–22256. 2. Petersen, S.C. et al. 2015. The adhesion GPCR GPR126 19. Araç, D. et al. 2012. Dissecting signaling and functions of has distinct, domain-dependent functions in Schwann cell adhesion G protein-coupled receptors. Ann. N.Y. Acad. Sci. development mediated by interaction with laminin-211. 1276: 1–25. 85: 755–769. 20. Gupte, J. et al. 2012. Signaling property study of adhesion 3. Hauser, A.S. et al. 2018. Pharmacogenomics of GPCR drug G-protein-coupled receptors. FEBS Lett. 586: 1214–1219. targets. Cell 172: 41–54.e19. 21. Demberg, L.M. et al. 2017. Activation of adhesion G protein- 4. Lin, H.-H. et al. 2004. Autocatalytic cleavage of the EMR2 coupled receptors: agonist specificity of Stachel sequence- receptor occurs at a conserved G protein-coupled receptor derived peptides. J. Biol. Chem. 292: 4383–4394. proteolytic site motif. J. Biol. Chem. 279: 31823–31832. 22. Bohnekamp, J. & T. Schöneberg. 2011. Cell adhesion recep- 5.Nieberler,M.,R.J.Kittel,A.G.Petrenko,et al. 2016. Con- tor GPR133 couples to Gs protein. J. Biol. Chem. 286: 41912– trol of adhesion GPCR function through proteolytic pro- 41916. cessing. In Adhesion G Protein-Coupled Receptors. Handbook 23. Liebscher, I. et al. 2015. A tethered agonist within the of Experimental Pharmacology.Vol.234. T. Langenhan & T. ectodomain activates the adhesion G protein-coupled recep- Schöneberg, Eds.: 83–109. Cham: Springer. tors GPR126 and GPR133. Cell Rep. 10: 1021. 6. Liebscher, I. et al. 2014. A tethered agonist within the 24. Schöneberg, T., I. Liebscher, R. Luo, et al. 2015. Tethered ectodomain activates the adhesion G protein-coupled recep- agonists: a new mechanism underlying adhesion G protein- tors GPR126 and GPR133. Cell Rep. 9: 2018–2026. coupled receptor activation. J. Recept. Signal Transduct. 35: 7. Stoveken, H.M., A.G. Hajduczok, L. Xu & G.G. Tall. 2015. 220–223. Adhesion G protein-coupled receptors are activated by 25. Pavlos, N.J. & P.A.Friedman. 2017. GPCR signaling and traf- exposure of a cryptic tethered agonist. Proc.Natl.Acad.Sci. ficking: the long and short of it. Trends Endocrinol. Metab. USA 112: 6194–6199. 28: 213–226. 8. Schwartz, T.W.,T.M. Frimurer, B. Holst, et al. 2006. Molecu- 26. Zhang, D.-L. et al. 2018. Gq activity- and β-arrestin- lar mechanism of 7TM receptor activation—a global toggle 1 scaffolding-mediated ADGRG2/CFTR coupling are switch model. Annu. Rev. Pharmacol. Toxicol. 46: 481–519. required for male fertility. elife 7: e33432.

12 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Spiess et al. Constitutive endocytosis of GPR125/ADGRA3

27. Southern, C. et al. 2013. Screening β-arrestin recruitment for 42. Benned-Jensen, T. et al. 2011. Ligand modulation of the the identification of natural ligands for orphan G-protein– Epstein–Barr virus-induced seven-transmembrane receptor coupled receptors. J. Biomol. Screen. 18: 599–609. EBI2. J. Biol. Chem. 286: 29292–29302. 28. Purcell, R.H., C. Toro, W.A. Gahl & R.A. Hall. 2017. 43. Daugvilaite, V. et al. 2017. Biased agonism and allosteric A disease-associated mutation in the adhesion GPCR modulation of G protein-coupled receptor 183 — a 7TM BAI2 (ADGRB2) increases receptor signaling activity. Hum. receptor also known as Epstein–Barr virus-induced gene 2. Mutat. 38: 1751–1760. Br. J. Pharmacol. 174: 2031–2042. 29. Gabe, M.B.N. et al. 2019. Enhanced agonist residence time, 44. Mayle, K.M., A.M. Le & D.T. Kamei. 2012. The intracellular internalization rate and signalling of the GIP receptor vari- trafficking pathway of transferrin. Biochim. Biophys. 1820: ant [E354Q] facilitate receptor desensitization and long- 264–281. term impairment of the GIP system. Basic Clin. Pharmacol. 45. van Dam, E.M. & W.Stoorvogel. 2002. Dynamin-dependent Toxicol. https://doi.org/10.1111/bcpt.13289. transferrin receptor recycling by endosome-derived 30. Reiter, E. & R.J. Lefkowitz. 2006. GRKs and β-arrestins: clathrin-coated vesicles. Mol. Biol. Cell 13: 169–182. roles in receptor silencing, trafficking and signaling. Trends 46. Langenhan, T. 2019. Adhesion G protein–coupled Endocrinol. Metab. 17: 159–165. receptors—candidate metabotropic mechanosensors 31. Hamann, J. et al. 2015. International Union of Basic and and novel drug targets. Basic Clin. Pharmacol. Toxicol. Clinical Pharmacology. XCIV. Adhesion G protein-coupled https://doi.org/10.1111/bcpt.13223. receptors. Pharmacol. Rev. 67: 338–367. 47. Vallon, M. & M. Essler. 2006. Proteolytically processed solu- 32. Waheeb, R. & M.-C. Hofmann. 2011. Human spermatogo- ble tumor endothelial marker (TEM) 5 mediates endothelial nial stem cells: a possible origin for spermatocytic semi- cell survival during angiogenesis by linking integrin αvβ3 to noma. Int. J. Androl. 34: e296–e305. glycosaminoglycans. J. Biol. Chem. 281: 34179–34188. 33. Pickering, C. et al. 2008. The Adhesion GPCR GPR125 is 48. Wolfe, B.L. & J. Trejo. 2007. Clathrin-dependent mecha- specifically expressed in the choroid plexus and is upregu- nisms of G protein-coupled receptor endocytosis. Traffic 8: lated following brain injury. BMC Neurosci. 9: 97. 462–470. 34. Li, X. et al. 2013. Gpr125 modulates Dishevelled distribution 49. Mohammad, S. et al. 2007. Constitutive traffic of and planar cell polarity signaling. Development 140: 3028– melanocortin-4 receptor in Neuro2A cells and immortal- 3039. ized hypothalamic . J. Biol. Chem. 282: 4963–4974. 35. Wu, Y. et al. 2018. Elevated G-protein receptor 125 50. Signoret, N. et al. 1998. Differential regulation of CXCR4 (GPR125) expression predicts good outcomes in colorectal and CCR5 endocytosis. J. Cell Sci. 111: 2819–2830. cancer and inhibits wnt/β-catenin signaling pathway. Med. 51. Fraile-Ramos, A., T.A. Kohout, M. Waldhoer & M. Marsh. Sci. Monit. 24: 6608–6616. 2003. Endocytosis of the viral chemokine receptor US28 36. Fu, J.-F. et al. 2013. Involvement of Gpr125 in the does not require beta-arrestins but is dependent on the myeloid sarcoma formation induced by cooperating clathrin-mediated pathway. Traffic 4: 243–253. MLL/AF10(OM-LZ) and oncogenic KRAS in a mouse 52. Orsini, M.J., J.L. Parent, S.J. Mundell, et al. 1999. Trafficking bone marrow transplantation model. Int. J. Cancer 133: of the HIV coreceptor CXCR4. Role of arrestins and identifi- 1792–1802. cation of residues in the c-terminal tail that mediate receptor 37. Gabe, M.B.N. et al. 2018. Human GIP(3-30)NH 2 inhibits G internalization. J. Biol. Chem. 274: 31076–31086. protein-dependent as well as G protein-independent signal- 53. Cheng, Z.J. et al. 2000. Beta-arrestin differentially regu- ing and is selective for the GIP receptor with high-affinity lates the chemokine receptor CXCR4-mediated signaling binding to primate but not rodent GIP receptors. Biochem. and receptor internalization, and this implicates multiple Pharmacol. 150: 97–107. interaction sites between beta-arrestin and CXCR4. J. Biol. 38. Hjortø, G.M., K. Kiilerich-Pedersen, D. Selmeczi, et al. 2013. Chem. 275: 2479–2485. Human cytomegalovirus chemokine receptor US28 induces 54. Kledal, T.N.,M.M. Rosenkilde & T.W.Schwartz. 1998. Selec- migration of cells on a CX3CL1-presenting surface. J. Gen. tive recognition of the membrane-bound CX3C chemokine, Virol. 94: 1111–1120. fractalkine, by the human cytomegalovirus-encoded broad- 39. Donthamsetti, P., J.R. Quejada, J.A. Javitch, et al. 2015. spectrum receptor US28. FEBS Lett. 441: 209–214. Using bioluminescence resonance energy transfer (BRET) to 55. Scarselli, M. & J.G. Donaldson. 2009. Constitutive internal- characterize agonist-induced arrestin recruitment to mod- ization of G protein-coupled receptors and G proteins via ified and unmodified G protein-coupled receptors. Curr. clathrin-independent endocytosis. J. Biol. Chem. 284: 3577– Protoc. Pharmacol. 70. https://doi.org/10.1002/0471141755. 3585. ph0214s70. 56. Graham, G.J., M. Locati, A. Mantovani, et al. 2012. The bio- 40. Shimizu, Y., R. Koyama & T. Kawamoto. 2017. Rho kinase- chemistry and biology of the atypical chemokine receptors. dependent desensitization of GPR39; a unique mechanism Immunol. Lett. 145: 30–38. of GPCR downregulation. Biochem. Pharmacol. 140: 105– 57. Jacobsen, S.E. et al. 2017. The GPRC6A receptor displays 114. constitutive internalization and sorting to the slow recycling 41. Rosenkilde, M.M. et al. 2006. Molecular pharmacologi- pathway. J. Biol. Chem. 292: 6910–6926. cal phenotyping of EBI2. An orphan seven-transmembrane 58. Bünemann, M. & M.M. Hosey. 1999. G-protein coupled receptor with constitutive activity. J. Biol. Chem. 281: 13199– receptor kinases as modulators of G-protein signalling. 13208. J. Physiol. 517: 5–23.

Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences 13 published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences Constitutive endocytosis of GPR125/ADGRA3 Spiess et al.

59. Irannejad, R. et al. 2013. Conformational biosensors reveal 64. Alvarez-Curto, E. et al. 2016. Targeted elimination of G pro- GPCR signalling from endosomes. Nature 495: 534– teins and arrestins defines their specific contributions to 538. both intensity and duration of G protein-coupled receptor 60. Seachrist, J.L. & S.S. Ferguson. 2003. Regulation of G signaling. J. Biol. Chem. 291: 27147–27159. protein-coupled receptor endocytosis and trafficking by Rab 65. Grundmann, M. et al. 2018. Lack of beta-arrestin signaling GTPases. Life Sci. 74: 225–235. in the absence of active G proteins. Nat. Commun. 9: 341. 61. Thomsen, A.R.B. et al. 2016. GPCR-G protein-β-arrestin 66. Steen, A., O. Larsen, S. Thiele & M.M. Rosenkilde. 2014. super-complex mediates sustained G protein signaling. Cell Biased and g protein-independent signaling of chemokine 166: 907–919. receptors. Front. Immunol. 5: 277. 62. Cahill, T.J. et al. 2017. Distinct conformations of GPCR– 67. Jørgensen, A.S., M.M. Rosenkilde & G.M. Hjortø. 2018. β-arrestin complexes mediate desensitization, signaling, Biased signaling of G protein-coupled receptors – from and endocytosis. Proc.Natl.Acad.Sci.USA114: 2562– a chemokine receptor CCR7 perspective. Gen. Comp. 2567. Endocrinol. 258: 4–14. 63. Luttrell, L.M. & R.J. Lefkowitz. 2002. The role of β-arrestins 68. Hamoud, N. et al. 2018. Spatiotemporal regulation of the in the termination and transduction of G-protein-coupled GPCR activity of BAI3 by C1qL4 and Stabilin-2 controls receptor signals. J. Cell Sci. 115(Pt 3): 455–465. myoblast fusion. Nat. Commun. 9: 4470.

14 Ann. N.Y. Acad. Sci. xxxx (2019) 1–14 © 2019 The Authors. Annals of the New York Academy of Sciences published by Wiley Periodicals, Inc. on behalf of New York Academy of Sciences