Anti-SNX18 Polyclonal Antibody (CABT-B1766) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

Total Page：16

File Type：pdf, Size：1020Kb

Anti-SNX18 polyclonal antibody (CABT-B1766) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Specificity Expected to react with all spliced isoforms. Immunogen Recombinant protein corresponding to human SNX18. Isotype IgG Source/Host Rabbit Species Reactivity Canine, Human Purification Affinity Purfied Conjugate Unconjugated Applications WB, ICC, IP Molecular Weight ~73 kDa observed Format Liquid Concentration Please refer to lot specific datasheet. Size 100 μg Buffer PBS with 0.05% sodium azide. Preservative 0.05% Sodium Azide Storage Stable for 1 year at 2-8°C from date of receipt. BACKGROUND Introduction Sorting nexin-18 (UniProt Q96RF0; also known as SH3 and PX domain-containing protein 3B, Sorting nexin-associated Golgi protein 1) is encoded by the SNX18 (also known as SNAG1, SH3PX2, SH3PXD3B) gene (Gene ID 112574) in human. SNX18, SNX33, and SNX9 constitute a subfamily of sorting nexin (SNX) proteins characterized by a Bin–Amphiphysin–Rvs (BAR) domain that allows dimerization. It also contributes to modulation and shaping of membrane curvature. It also has a Src-homology 3 (SH3) domain that allows interaction with a wide range of proline-rich PXXP motif containing proteins. In addition to mediating endocytosis and intracellular 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved vesicle trafficking, SNX18, SNX33, and SNX9 are also essential for successful completion of the ingression and abscission stages of cytokinesis and for the delivery of a subset of vesicles to the intracellular bridge that connects the two nascent daughter cells during mitosis. GSK‐3 is reported to prevent FIP5-SNX18 interaction during metaphase and anaphase in Madin‐Darby canine kidney (MDCK) cells by catalyzing FIP5 Thr276 phosphorylation to ensure the fidelity and timing of FIP5‐endosome targeting to the AMIS during apical lumen formation. GENE INFORMATION Entrez Gene ID 112574 UniProt ID Q96RF0 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved.

Copy Link

Recommended publications

Pathway-Based Genome-Wide Association Analysis of Coronary Heart Disease Identifies Biologically Important Gene Sets
European Journal of Human Genetics (2012) 20, 1168–1173 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Pathway-based genome-wide association analysis of coronary heart disease identifies biologically important gene sets Lisa de las Fuentes1,4, Wei Yang2,4, Victor G Da´vila-Romań1 and C Charles Gu*,2,3 Genome-wide association (GWA) studies of complex diseases including coronary heart disease (CHD) challenge investigators attempting to identify relevant genetic variants among hundreds of thousands of markers being tested. A selection strategy based purely on statistical significance will result in many false negative findings after adjustment for multiple testing. Thus, an integrated analysis using information from the learned genetic pathways, molecular functions, and biological processes is desirable. In this study, we applied a customized method, variable set enrichment analysis (VSEA), to the Framingham Heart Study data (404 467 variants, n ¼ 6421) to evaluate enrichment of genetic association in 1395 gene sets for their contribution to CHD. We identified 25 gene sets with nominal Po0.01; at least four sets are previously known for their roles in CHD: vascular genesis (GO:0001570), fatty-acid biosynthetic process (GO:0006633), fatty-acid metabolic process (GO:0006631), and glycerolipid metabolic process (GO:0046486). Although the four gene sets include 170 genes, only three of the genes contain a variant ranked among the top 100 in single-variant association tests of the 404 467 variants tested. Significant enrichment for novel gene sets less known for their importance to CHD were also identified: Rac 1 cell-motility signaling pathway (h_rac1 Pathway, Po0.001) and sulfur amino-acid metabolic process (GO:0000096, Po0.001).
[Show full text]
PROTEOMIC ANALYSIS of HUMAN URINARY EXOSOMES. Patricia
ABSTRACT Title of Document: PROTEOMIC ANALYSIS OF HUMAN URINARY EXOSOMES. Patricia Amalia Gonzales Mancilla, Ph.D., 2009 Directed By: Associate Professor Nam Sun Wang, Department of Chemical and Biomolecular Engineering Exosomes originate as the internal vesicles of multivesicular bodies (MVBs) in cells. These small vesicles (40-100 nm) have been shown to be secreted by most cell types throughout the body. In the kidney, urinary exosomes are released to the urine by fusion of the outer membrane of the MVBs with the apical plasma membrane of renal tubular epithelia. Exosomes contain apical membrane and cytosolic proteins and can be isolated using differential centrifugation. The analysis of urinary exosomes provides a non- invasive means of acquiring information about the physiological or pathophysiological state of renal cells. The overall objective of this research was to develop methods and knowledge infrastructure for urinary proteomics. We proposed to conduct a proteomic analysis of human urinary exosomes. The first objective was to profile the proteome of human urinary exosomes using liquid chromatography-tandem spectrometry (LC- MS/MS) and specialized software for identification of peptide sequences from fragmentation spectra. We unambiguously identified 1132 proteins. In addition, the phosphoproteome of human urinary exosomes was profiled using the neutral loss scanning acquisition mode of LC-MS/MS. The phosphoproteomic profiling identified 19 phosphorylation sites corresponding to 14 phosphoproteins. The second objective was to analyze urinary exosomes samples isolated from patients with genetic mutations. Polyclonal antibodies were generated to recognize epitopes on the gene products of these genetic mutations, NKCC2 and MRP4. The potential usefulness of urinary exosome analysis was demonstrated using the well-defined renal tubulopathy, Bartter syndrome type I and using the single nucleotide polymorphism in the ABCC4 gene.
[Show full text]
Predicting Clinical Response to Treatment with a Soluble Tnf-Antagonist Or Tnf, Or a Tnf Receptor Agonist
(19) TZZ _ __T (11) EP 2 192 197 A1 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.: 02.06.2010 Bulletin 2010/22 C12Q 1/68 (2006.01) (21) Application number: 08170119.5 (22) Date of filing: 27.11.2008 (84) Designated Contracting States: (72) Inventor: The designation of the inventor has not AT BE BG CH CY CZ DE DK EE ES FI FR GB GR yet been filed HR HU IE IS IT LI LT LU LV MC MT NL NO PL PT RO SE SI SK TR (74) Representative: Habets, Winand Designated Extension States: Life Science Patents AL BA MK RS PO Box 5096 6130 PB Sittard (NL) (71) Applicant: Vereniging voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek en Patiëntenzorg 1081 HV Amsterdam (NL) (54) Predicting clinical response to treatment with a soluble tnf-antagonist or tnf, or a tnf receptor agonist (57) The invention relates to methods for predicting a clinical response to a therapy with a soluble TNF antagonist, TNF or a TNF receptor agonist and a kit for use in said methods. EP 2 192 197 A1 Printed by Jouve, 75001 PARIS (FR) EP 2 192 197 A1 Description [0001] The invention relates to methods for predicting a clinical response to a treatment with a soluble TNF antagonist, with TNF or a TNF receptor agonist using expression levels of genes of the Type I INF pathway and a kit for use in said 5 methods. In another aspect, the invention relates to a method for evaluating a pharmacological effect of a treatment with a soluble TNF antagonist, TNF or a TNF receptor agonist.
[Show full text]
SNX18 (NM 001102575) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG219205 SNX18 (NM_001102575) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: SNX18 (NM_001102575) Human Tagged ORF Clone Tag: TurboGFP Symbol: SNX18 Synonyms: SH3PX2; SH3PXD3B; SNAG1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 SNX18 (NM_001102575) Human Tagged ORF Clone – RG219205 ORF Nucleotide >RG219205 representing NM_001102575 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGCTGCGCGCCCGGGCGCTGTACGACTTCAGGTCGGAGAACCCAGGAGAGATCTCGCTGCGAGAGC ACGAGGTGCTGAGCCTGTGCAGCGAGCAGGACATCGAGGGCTGGCTCGAGGGGGTCAACAGCCGCGGCGA CCGCGGCCTCTTCCCGGCCTCCTATGTGCAGGTGATCCGCGCCCCCGAGCCTGGCCCGGCGGGAGACGGC GGCCCGGGCGCCCCGGCCCGCTACGCCAATGTGCCCCCCGGGGGCTTCGAGCCCCTGCCTGTCGCGCCCC CCGCCTCCTTCAAGCCGCCGCCTGACGCCTTCCAGGCGCTGCTGCAGCCACAGCAGGCGCCGCCTCCGAG CACCTTCCAGCCGCCCGGCGCGGGCTTCCCGTACGGCGGGGGCGCCCTGCAGCCGTCGCCTCAGCAGCTC TACGGCGGCTACCAGGCCAGCCAAGGCAGCGATGATGACTGGGACGACGAGTGGGACGACAGCTCCACGG TGGCGGACGAGCCGGGCGCTCTGGGCAGCGGAGCATACCCGGACCTCGACGGCTCGTCTTCGGCGGGTGT GGGCGCAGCCGGCCGCTACCGCCTGTCCACGCGCTCCGACCTGTCCCTGGGTTCCCGCGGCGGCTCGGTC
[Show full text]
Supplementary Data
Supplementary Fig. 1 A B Responder_Xenograft_ Responder_Xenograft_ NON- NON- Lu7336, Vehicle vs Lu7466, Vehicle vs Responder_Xenograft_ Responder_Xenograft_ Sagopilone, Welch- Sagopilone, Welch- Lu7187, Vehicle vs Lu7406, Vehicle vs Test: 638 Test: 600 Sagopilone, Welch- Sagopilone, Welch- Test: 468 Test: 482 Responder_Xenograft_ NON- Lu7860, Vehicle vs Responder_Xenograft_ Sagopilone, Welch - Lu7558, Vehicle vs Test: 605 Sagopilone, Welch- Test: 333 Supplementary Fig. 2 Supplementary Fig. 3 Supplementary Figure S1. Venn diagrams comparing probe sets regulated by Sagopilone treatment (10mg/kg for 24h) between individual models (Welsh Test ellipse p-value<0.001 or 5-fold change). A Sagopilone responder models, B Sagopilone non-responder models. Supplementary Figure S2. Pathway analysis of genes regulated by Sagopilone treatment in responder xenograft models 24h after Sagopilone treatment by GeneGo Metacore; the most significant pathway map representing cell cycle/spindle assembly and chromosome separation is shown, genes upregulated by Sagopilone treatment are marked with red thermometers. Supplementary Figure S3. GeneGo Metacore pathway analysis of genes differentially expressed between Sagopilone Responder and Non-Responder models displaying –log(p-Values) of most significant pathway maps. Supplementary Tables Supplementary Table 1. Response and activity in 22 non-small-cell lung cancer (NSCLC) xenograft models after treatment with Sagopilone and other cytotoxic agents commonly used in the management of NSCLC Tumor Model Response type
[Show full text]
Identification of Bleomycin and Radiation-Induced Pulmonary Fibrosis Susceptibility Genes in Mice Anne-Marie Lemay Department Of
Identification of bleomycin and radiation-induced pulmonary fibrosis susceptibility genes in mice Anne-Marie Lemay Department of Human Genetics McGill University, Montréal February 4th, 2010 A thesis submitted to McGill University in partial fulfilment of the requirements of the degree of Doctor of Philosophy © Anne-Marie Lemay 2010 Comme il est profond, ce mystère de l’Invisible ! Nous ne pouvons le sonder avec nos sens misérables, avec nos yeux qui ne savent apercevoir ni le trop petit, ni le trop grand, ni le trop près, ni le trop loin, ni les habitants d’une étoile, ni les habitants d’une goutte d’eau… Guy de Maupassant Le Horla ii Table of contents Table of contents ................................................................................................... iii Abstract...................................................................................................................vi Résumé ................................................................................................................ viii Acknowledgments................................................................................................... x Abbreviations........................................................................................................ xii Original contributions to knowledge...................................................................xiv Author contribution to research...........................................................................xv List of figures ........................................................................................................
[Show full text]
Strand Breaks for P53 Exon 6 and 8 Among Different Time Course of Folate Depletion Or Repletion in the Rectosigmoid Mucosa
SUPPLEMENTAL FIGURE COLON p53 EXONIC STRAND BREAKS DURING FOLATE DEPLETION-REPLETION INTERVENTION Supplemental Figure Legend Strand breaks for p53 exon 6 and 8 among different time course of folate depletion or repletion in the rectosigmoid mucosa. The input of DNA was controlled by GAPDH. The data is shown as ΔCt after normalized to GAPDH. The higher ΔCt the more strand breaks. The P value is shown in the figure. SUPPLEMENT S1 Genes that were significantly UPREGULATED after folate intervention (by unadjusted paired t-test), list is sorted by P value Gene Symbol Nucleotide P VALUE Description OLFM4 NM_006418 0.0000 Homo sapiens differentially expressed in hematopoietic lineages (GW112) mRNA. FMR1NB NM_152578 0.0000 Homo sapiens hypothetical protein FLJ25736 (FLJ25736) mRNA. IFI6 NM_002038 0.0001 Homo sapiens interferon alpha-inducible protein (clone IFI-6-16) (G1P3) transcript variant 1 mRNA. Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15 GALNTL5 NM_145292 0.0001 (GALNT15) mRNA. STIM2 NM_020860 0.0001 Homo sapiens stromal interaction molecule 2 (STIM2) mRNA. ZNF645 NM_152577 0.0002 Homo sapiens hypothetical protein FLJ25735 (FLJ25735) mRNA. ATP12A NM_001676 0.0002 Homo sapiens ATPase H+/K+ transporting nongastric alpha polypeptide (ATP12A) mRNA. U1SNRNPBP NM_007020 0.0003 Homo sapiens U1-snRNP binding protein homolog (U1SNRNPBP) transcript variant 1 mRNA. RNF125 NM_017831 0.0004 Homo sapiens ring finger protein 125 (RNF125) mRNA. FMNL1 NM_005892 0.0004 Homo sapiens formin-like (FMNL) mRNA. ISG15 NM_005101 0.0005 Homo sapiens interferon alpha-inducible protein (clone IFI-15K) (G1P2) mRNA. SLC6A14 NM_007231 0.0005 Homo sapiens solute carrier family 6 (neurotransmitter transporter) member 14 (SLC6A14) mRNA.
[Show full text]
Article Microarray Analysis and Functional Genomics Identify Novel Components of Melanopsin Signaling
Current Biology 17, 1363–1372, August 21, 2007 ª2007 Elsevier Ltd All rights reserved DOI 10.1016/j.cub.2007.07.045 Article Microarray Analysis and Functional Genomics Identify Novel Components of Melanopsin Signaling Stuart N. Peirson,1,3 Henrik Oster,1,3 Sarah L. Jones,1 Introduction Michael Leitges,2 Mark W. Hankins,1 and Russell G. Foster1,* Mice lacking both rod and cone photoreceptors (rd/rd 1 Circadian and Visual Neuroscience Group cl) retain multiple nonvisual responses to light, including University of Oxford phase shifting of circadian behavior, acute suppression Wellcome Trust Centre for Human Genetics of pineal melatonin, and pupil constriction [1–3]. The Roosevelt Drive photoreceptors mediating these responses are a subset Oxford OX3 7BN of photosensitive retinal ganglion cells (pRGCs) that United Kingdom express melanopsin (OPN4) [4–7]. Unlike hyperpolariza- 2 The Biotechnology Centre of Oslo tion responses of the rods and cones of the outer retina, University of Oslo light triggers depolarization of pRGCs associated with P.O. Box 1125 marked changes in intracellular Ca2+ [6, 7]. Recent Blindern in vitro studies using cells transfected with melanopsin N-0317 Oslo provide compelling evidence that this protein is the Norway photopigment of the pRGCs [8–10]. The pRGC photo- transduction cascade is pertussis toxin insensitive, leading to the suggestion that melanopsin may utilize Summary an invertebrate-like signaling cascade [10, 11]. Further- more, pharmacological experiments suggest that mela- Background: Within the mammalian retina, there exists nopsin signals via a Gq-type G protein coupled to phos- a third photoreceptive system based upon a population pholipase C, resulting in TRP channel activation [9, 10, of melanopsin (Opn4) expressing photosensitive retinal 12].
[Show full text]
Immune Cells in Spleen and Mucosa + CD127 Neg Production of IL-17 and IL-22 by CD3 TLR5 Signaling Stimulates the Innate
Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021 neg is online at: average * The Journal of Immunology , 23 of which you can access for free at: 2010; 185:1177-1185; Prepublished online 21 Immune Cells in Spleen and Mucosa from submission to initial decision + 4 weeks from acceptance to publication TLR5 Signaling Stimulates the Innate Production of IL-17 and IL-22 by CD3 CD127 Laurye Van Maele, Christophe Carnoy, Delphine Cayet, Pascal Songhet, Laure Dumoutier, Isabel Ferrero, Laure Janot, François Erard, Julie Bertout, Hélène Leger, Florent Sebbane, Arndt Benecke, Jean-Christophe Renauld, Wolf-Dietrich Hardt, Bernhard Ryffel and Jean-Claude Sirard June 2010; doi: 10.4049/jimmunol.1000115 http://www.jimmunol.org/content/185/2/1177 J Immunol cites 51 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/185/2/1177.full#ref-list-1 http://www.jimmunol.org/content/suppl/2010/06/21/jimmunol.100011 5.DC1 This article Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2010 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606.
[Show full text]
Supplementary Data
SUPPLEMENTARY METHODS 1) Characterisation of OCCC cell line gene expression profiles using Prediction Analysis for Microarrays (PAM) The ovarian cancer dataset from Hendrix et al (25) was used to predict the phenotypes of the cell lines used in this study. Hendrix et al (25) analysed a series of 103 ovarian samples using the Affymetrix U133A array platform (GEO: GSE6008). This dataset comprises clear cell (n=8), endometrioid (n=37), mucinous (n=13) and serous epithelial (n=41) primary ovarian carcinomas and samples from 4 normal ovaries. To build the predictor, the Prediction Analysis of Microarrays (PAM) package in R environment was employed (http://rss.acs.unt.edu/Rdoc/library/pamr/html/00Index.html). When more than one probe described the expression of a given gene, we used the probe with the highest median absolute deviation across the samples. The dataset from Hendrix et al. (25) and the dataset of OCCC cell lines described in this manuscript were then overlaid on the basis of 11536 common unique HGNC gene symbols. Only the 99 primary ovarian cancers samples and the four normal ovary samples were used to build the predictor. Following leave one out cross-validation, a predictor based upon 126 genes was able to identify correctly the four distinct phenotypes of primary ovarian tumour samples with a misclassification rate of 18.3%. This predictor was subsequently applied to the expression data from the 12 OCCC cell lines to determine the likeliest phenotype of the OCCC cell lines compared to primary ovarian cancers. Posterior probabilities were estimated for each cell line in comparison to the following phenotypes: clear cell, endometrioid, mucinous and serous epithelial.
[Show full text]
Supplementary Table 1
Supplemental Table 1. List of known genes affected by radiation as detected by microarray analysis of polysome-bound RNA and total cellular RNA. U87 cell were irradiated with 7 Gy and collected for microarray analyses 6h later. Polysome-bound RNA UniGene # Gene Description Fold Change (log 2) Hs.429294 ABCA1 ATP-binding cassette, sub-family A (ABC1), member 1 1.5829 Hs.471277 ACADL Acyl-Coenzyme A dehydrogenase, long chain 1.2587 Hs.471461 ACSL3 Acyl-CoA synthetase long-chain family member 3 1.2404 Hs.268785 ACSL4 Acyl-CoA synthetase long-chain family member 4 1.5611 Hs.14945 ACSL6 Acyl-CoA synthetase long-chain family member 6 1.5067 Hs.393201 ACTR2 ARP2 actin-related protein 2 homolog (yeast) 1.4219 Hs.433512 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 1.2404 Hs.150402 ACVR1 activin A receptor, type I=Ser/Thr protein kinase receptor R1 1.2864 Hs.438918 ACVR1B Activin A receptor, type IB 1.0827 Hs.127930 ADAM18 A disintegrin and metalloproteinase domain 18 1.0261 Hs.370287 ADAM23 A disintegrin and metalloproteinase domain 23 1.226 Hs.2442 ADAM9 A disintegrin and metalloproteinase domain 9 (meltrin gamma) 1.6771 Hs.151435 ADAMTS3 A disintegrin-like and metalloprotease (reprolysin type) with 1.3683 thrombospondin type 1 motif, 3 Hs.498313 ADSS Adenylosuccinate synthase 1.1344 Hs.515053 AES Amino-terminal enhancer of split 1.518 Hs.75823 AF1Q ALL1-fused gene from chromosome 1q 1.879 Hs.904 AGL Amylo-1, 6-glucosidase, 4-alpha-glucanotransferase (glycogen 1.2491 debranching enzyme, glycogen storage disease type III) Hs.530009 AGR2 Anterior
[Show full text]
(12) Patent Application Publication (10) Pub. No.: US 2013/0237454 A1 Schutzer (43) Pub
US 2013 0237454A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2013/0237454 A1 Schutzer (43) Pub. Date: Sep. 12, 2013 (54) DIAGNOSTIC MARKERS FOR Publication Classification NEUROPSYCHATRC DISEASE (51) Int. Cl. (76) Inventor: Steven E. Schutzer, Water Mill, NY GOIN33/68 (2006.01) (US) (52) U.S. Cl. CPC .................................. G0IN33/6896 (2013.01) (21) Appl. No.: 13/697,417 USPC ............................................................ SO6/12 (22) PCT Filed: May 12, 2011 (57) ABSTRACT Biomarkers for the diagnosis of neuropsychiatric diseases are (86). PCT No.: PCT/US11?0O843 presented herein. In particular embodiments, biomarkers are S371 (c)(1), identified that are useful for diagnosing multiple Sclerosis, (2), (4) Date: May 23, 2013 chronic fatigue syndrome, or Neurologic Lyme disease. Also encompassed is a method for diagnosing a patient with a Related U.S. Application Data neuropsychiatric disease. Such as multiple Sclerosis, chronic AV fatigue syndrome, or Neurologic Lyme disease, by analyzing (60) Provisional application No. 61/395,354, filed on May biological samples isolated from the patient or the patient as 12, 2010. a whole to assess levels of the biomarkers described herein. -N- 1895 72% 63 735 8% 92% Patent Application Publication Sep. 12, 2013 US 2013/0237454 A1 Figure l US 2013/0237454 A1 Sep. 12, 2013 DAGNOSTIC MARKERS FOR tiple Sclerosis is more common in women than men and NEUROPSYCHATRC DISEASE generally begins between ages 20 and 40, but can develop at any age. Multiple Sclerosis is generally viewed as an autoim FIELD OF THE INVENTION mune syndrome directed against unidentified central nervous 0001. The present invention relates to identifying biologic tissue antigens.
[Show full text]