Identification of bleomycin and radiation-induced pulmonary

fibrosis susceptibility genes in mice

Anne-Marie Lemay

Department of Human Genetics

McGill University, Montréal

February 4th, 2010

A thesis submitted to McGill University in partial fulfilment of

the requirements of the degree of Doctor of Philosophy

© Anne-Marie Lemay 2010

Comme il est profond, ce mystère de l’Invisible ! Nous ne pouvons le sonder avec nos sens misérables, avec nos yeux qui ne savent apercevoir ni le trop petit, ni le trop grand, ni le trop près, ni le trop loin, ni les habitants d’une étoile, ni les habitants d’une goutte d’eau…

Guy de Maupassant Le Horla

ii

Table of contents

Table of contents ...... iii Abstract...... vi Résumé ...... viii Acknowledgments...... x Abbreviations...... xii Original contributions to knowledge...... xiv Author contribution to research...... xv List of figures ...... 1 List of tables ...... 3 CHAPTER I ...... 4 Introduction...... 4 Pulmonary fibrosis ...... 6 Hypotheses on the development of pulmonary fibrosis...... 7 Familial pulmonary fibrosis...... 9 Animal models of pulmonary fibrosis...... 10 Route of administration...... 11 Bleomycin ...... 12 Mode of action...... 13 Thoracic irradiation ...... 15 Identification of susceptibility genes using mouse genetics...... 16 Strain dependant fibrosis responses to bleomycin and radiation treatments...... 16 Mouse crosses for QTL analysis...... 21 Confirmation of a QTL ...... 25 Reduction of the size of the QTL...... 27 Positional cloning in mice...... 30 Candidate genes evaluation ...... 32 Gene expression analysis ...... 32 Sequence variations in candidate genes ...... 35 Evaluation of candidate genes...... 35 Experimental demonstration of the gene effect on the phenotype ...... 36 Aims of this research project...... 37 CHAPTER 2...... 39 Bleomycin-induced pulmonary fibrosis susceptibility genes in AcB/BcA recombinant congenic mice...... 39 Abstract ...... 40

iii Introduction ...... 41 Materials and Methods ...... 43 Mice ...... 43 Bleomycin treatment...... 43 Histology and Fibrosis Scoring...... 44 QTL Analysis...... 45 Gene expression...... 46 Microarray data analysis...... 47 Quantitative real-time PCR...... 48 Sequence Comparison...... 51 Results...... 51 Fibrosis phenotype of A/J and B6 mice ...... 51 AcB/BcA fibrosis phenotype ...... 52 Mapping of pulmonary fibrosis susceptibility ...... 55 Candidate Gene Identification ...... 57 Gene Expression Studies...... 57 Sequence Variation...... 61 Discussion ...... 63 Chapter transition ...... 68 CHAPTER 3...... 69 Radiation-induced lung response of AcB/BcA recombinant congenic mice..... 69 Abstract ...... 70 Introduction ...... 71 Materials and Methods ...... 73 Mice ...... 73 Radiation treatment...... 74 Histology...... 74 Bronchoalveolar Lavage Fluid (BAL) Analysis ...... 75 Data analysis...... 76 Results...... 76 Parental Strain radiation-induced lung phenotype ...... 76 AcB/BcA radiation-induced lung phenotype...... 77 RC strains informative for the radiation-induced lung response...... 87 Discussion ...... 90 Chapter transition ...... 94 CHAPTER 4...... 95 Bleomycin-induced pulmonary fibrosis candidate gene analysis ...... 95 Abstract ...... 96 Introduction ...... 96 Methods:...... 100 Mice ...... 100 Bleomycin treatment...... 103 Histology and fibrosis scoring ...... 103 Quantitative trait locus identification...... 104 Recombinant congenic strains genotyping...... 104

iv Flow Cytometry ...... 105 Fine mapping of Blmpf1...... 105 C4b sequence variation...... 106 Real-Time PCR...... 106 Enzyme-linked immunosorbent assay...... 107 Immunohistochemistry ...... 107 Identification of candidate genes ...... 108 Results: ...... 108 Investigation of informative recombinant congenic strains ...... 108 Pulmonary fibrosis in chromosome substitution strains ...... 111 Quantitative trait locus identification...... 113 Location of the candidate regions ...... 115 Strain dependent increase in lung tissue NK cells ...... 116 Fibrosis Phenotype of Natural-killer cell deficient mice...... 116 Fibrosis Phenotype of β2-microglobulin knock-out mice...... 120 Fine mapping of Blmpf1...... 122 Candidate gene analysis...... 123 C4b polymorphisms...... 125 C4b pulmonary expression does not correlate with fibrosis development...... 133 Levels of C4 protein in circulation did not correlate with fibrosis development...... 136 Pulmonary deposition of C4 ...... 138 Mannose-binding lectin complement activation pathway is not involved in PF...... 140 Discussion ...... 142 CHAPTER 5...... 151 General discussion and conclusion...... 151 Appendix...... 177

v Abstract

Pulmonary fibrosis is a complex trait disease of cells and collagen deposition in the lung parenchyma with unknown genes influencing the susceptibility to the disease. Genetic study of pulmonary fibrosis could allow the identification of new susceptibility genes, which could lead to a better understanding of the disease.

Treatments with a chemotherapeutic agent called bleomycin or with thoracic irradiation are known to induce pulmonary fibrosis in human and mice. We made use of the known susceptibility to develop bleomycin and radiation-induced pulmonary fibrosis of C57Bl/6J mice and of the known resistance of A/J and

C3H/HeJ mice to identify susceptibility genes by evaluating several mouse crosses. In this thesis, we identified putative quantitative trait loci (QTL) on chromosome 1, 3, 5, 6, 9 and 12 for bleomycin-induced pulmonary fibrosis and markers associated with fibrosis development on chromosome 3 and 4 for radiation-induced pulmonary fibrosis in a panel of recombinant congenic (RC) strains derived from C57Bl/6J and A/J mice. Candidate genes for bleomycin- induced pulmonary fibrosis were then evaluated for chromosome 6 QTL and for the previously identified Blmpf1 QTL on chromosome 17. As several natural killer cells genes were located under the peak of chromosome 6 linkage region, natural killer deficient mice were treated with bleomycin and NK deficiency was found not to influence pulmonary fibrosis development. Several class I major histocompatibility complex (MHC) genes were located under the peak of Blmpf1 locus and the deficiency in MHC class I molecules of β2-microglobulin knock-out

vi mice did not result in an altered lung phenotype, so NK cells genes and MHC class I genes were excluded as bleomycin-induced pulmonary fibrosis candidates.

The size of Blmpf1 locus was then reduced to a 0.8 megabase region containing

45 genes by studying B6:A/J and MHC congenic mice. Complement component

4b (C4b) was a candidate gene in this new reduced region and was further investigated, but no significant correlation was identified between the sequence variants, pulmonary expression or serum levels of C4 and bleomycin-induced pulmonary fibrosis susceptibility. In conclusion, in this thesis we successfully identified new regions linked with bleomycin and radiation-induced pulmonary fibrosis, narrowed Blmpf1 QTL and reduced the number of possible candidate genes.

vii Résumé

La fibrose pulmonaire est une maladie causée par l’infiltration de cellules et de collagène dans le poumon. Ce trait complexe est influencé par des gènes inconnus et une étude génétique de la fibrose pulmonaire pourrait mener à l’identification de nouveaux gènes de susceptibilité, ce qui pourrait améliorer la compréhension de cette maladie. Les traitements de chimiothérapie avec de la bléomycine ou de radiothérapie peuvent entraîner le développement de fibrose pulmonaire chez l’homme et la souris. Par exemple, certaines souches de souris sont susceptibles au développement de la fibrose pulmonaire, telles que la lignée C57BL/6J, alors que les lignées A/J et C3H sont résistantes au développement de cette maladie.

Dans cette thèse, nous avons identifié plusieurs locus de caractères quantitatifs

(QTL) sur les chromosomes 1, 3, 5, 6, 9 et 12 dans le modèle murin de fibrose pulmonaire causée par la bléomycine ainsi que des marqueurs associés avec le développement de la fibrose pulmonaire causée par la radiation sur les chromosomes 3 et 4 en utilisant des lignées recombinantes congéniques dérivées des lignées de souris C57Bl/6J et A/J. Nous avons ensuite évalué les cellules

Natural killer (NK) et le complexe majeur d’histocompatibilité de class I comme candidats de la région de susceptibilité du chromosome 6 et de la région Blmpf1

(Bleomycin-induced pulmonary fibrosis 1) précédemment identifiée sur le chromosome 17, car ces deux QTLs ont été identifiés dans plusieurs modèles de fibrose pulmonaire, mais nos résultats indiquent que ces candidats ne seraient pas impliqués dans la fibrose pulmonaire causée par la bléomycine. Nous avons

viii ensuite réduit la taille du QTL Blmpf1 à l’aide d’un croisement C57Bl/6J:A/J et de souris congéniques. Le gène Complement component 4b (C4b) est situé dans cette région, mais nous n’avons pas identifié de corrélation entre la séquence génomique, l’expression de ce gène dans le poumon ou la quantité de C4 dans le sérum et le développement de la fibrose pulmonaire. En conclusion, dans cette thèse nous avons identifié de nouvelles régions chromosomiques reliées au développement de la fibrose pulmonaire suite aux traitements avec de la bléomycine ou suite à une irradiation thoracique, nous avons réduit la taille de

Blmpf1 et éliminé plusieurs gènes candidats.

ix Acknowledgments

First, I would like to thank my supervisor, Dr Christina Haston, for the opportunity she gave me to be a student in her laboratory. She always listened to my ideas and was very helpful and supportive. I am very grateful for the good time and great projects she let me have in her lab, it could not have been better.

I would also like to thank my mouse girls, Laura and Jessica, for weaning these hundreds of mice for me, which allowed me to leave the animal room a little.

Nic, Sean and Alexandra, my favourite bioinformaticians, also deserve my gratitude, as they helped me with some of the analysis that even I could not do with my giant Excel macros.

I am also grateful to everyone who contributed to my projects by treating or monitoring mice. Genevieve, Josée and several undergraduate students, I appreciated your help.

The atmosphere in the lab was really great and I cannot thank everyone enough who made this experience fantastic: Jessica, Juan, Geneviève, Josée, Alexandra,

Mélanie, François, Larissa, Mark, Pierre, Anguel and everyone else that I can’t list here. Thanks for telling awesome stories and for making me laugh.

x I would also like to thank le Fonds de la recherche en santé du Québec and

McGill University Health Center for their financial support and Dr Danielle Malo and Dr Silvia Vidal for their help.

Je veux aussi remercier mes parents, pour m’avoir soutenue sans m’avoir demandé quand j’allais terminer mon doctorat et Cédric pour avoir écouté et compris la génétique et pour avoir été patient quand je lui expliquais mes histoires de souris blanches et souris noires.

Finally, I would like to thank the mice as there would not be a single page in this thesis without their (involuntary) help.

xi Abbreviations

B6 C57BL/6J BAL Bronchoalveolar lavage BHT Butylated hydroxytoluene Blmpf Bleomycin-induced pulmonary fibrosis locus BSA Bovine serum albumin C3H C3Hf/Kam or C3H/HeJ C4b Complement component 4b cDNA Complementary DNA cM Centimorgan CR1 Complement receptor 1 CSS Chromosome substitution strains CXCR3 chemokine (C-X-C motif) receptor 3 ELISA Enzyme-linked immunosorbent assay ELMOD2 ELMO domain containing 2 EST Expressed sequence tags FACS Fluorescent activated cell sorter Fgf1 Fibroblast growth factor 1 Fgfr1 Fibroblast growth factor receptor 1 Fkbpl FK506-binding protein like GO Gene ontology Gy Gray H&E Hematoxylin and eosin IFNγ Interferon gamma IHC Immunohistochemistry IL Interleukin IPF Idiopathic pulmonary fibrosis K-O Knock-out LIMMA Linear models for microarray data

xii LOD Logarithm of odds LPS Lipopolysaccharide Mbl Mannose-binding lectin MHC Major histocompatibility complex NK Natural killer NKT Natural Killer T cell PBS Phosphate buffered saline PCR Polymerase chain reaction PF Pulmonary fibrosis PMN Polymorphonuclear cells QTL Quantitative trait loci Radpf Radiation-induced pulmonary fibrosis locus RCS Recombinant congenic strains RNA Ribonucleic acid RT-PCR Real-Time PCR Sca10 (Atxn10) Spinocerebellar ataxia 10 homolog (human) SCID Severe combined immunodeficiency SIFT Sorting intolerant from tolerant siRNA Small interfering RNA SNP Single nucleotide polymorphism Tg Transgenic TGF-β Transforming-growth factor beta TMB Tetramethylbenzene Th1 T helper type-1 Th2 T helper type-2 WT Wild-type

xiii Original contributions to knowledge

Chapter 2: Bleomycin-induced pulmonary fibrosis susceptibility genes in

AcB/BcA recombinant congenic mice

I identified new QTLs for bleomycin-induced pulmonary fibrosis, as well as

QTLs overlapping with our previous radiation studies. I also analyzed and confirmed the mRNA expression of A/J and B6 mice response to bleomycin by microarray and RT-PCR.

Chapter 3: Radiation-induced lung response of AcB/BcA recombinant congenic mice

I identified recombinant congenic strains that develop fibrosis following radiation treatment. I also identified potential QTL linked with fibrosis and alveolitis caused by thoracic irradiation. I also supported previous findings concerning the lung profiles of inflammatory cells in irradiated mice.

Chapter 4: Bleomycin-induced pulmonary fibrosis candidate gene analysis

I identified two chromosome substitution strains of mice that were resistant to bleomycin induced pulmonary fibrosis. I also narrowed the susceptible region located on chromosome 17. I excluded MHC class I and NK cells as possible disease candidates in this model. I identified and investigated C4b as a potential candidate. I also described the propensity to develop pulmonary fibrosis in 27 inbred strains, most of which were not previously known.

xiv Author contribution to research

Chapter 2: Bleomycin-induced pulmonary fibrosis susceptibility genes in

AcB/BcA recombinant congenic mice

I did the experiments, except for the bioinformatic analysis of the microarray study. Manuscript preparation was done by me and Dr Christina Haston.

Chapter 3: Radiation-induced lung response of AcB/BcA recombinant congenic mice

I did the experiments, except for the irradiation of several mice. Manuscript preparation was done by me and Dr Christina Haston.

Chapter 4: Bleomycin-induced pulmonary fibrosis candidate gene analysis

The beta-2-microglobulin mice were treated by Dr Francois Depault. The R/QTL analysis was done by Alexandra Paun. Every other experiment was planned and executed by me. Manuscript preparation was done by me and Dr Christina

Haston.

xv List of figures

Figure 1: Simplified molecular structure of bleomycin. 13

Figure 2: Lung phenotype of B6 and A/J mice 17

Figure 3: Flow diagram of fibrotic disease gene discovery 18

Figure 4: Identification of QTLs in mice 20

Figure 5: Recombinant congenic strains 23

Figure 6: Congenic mice and chromosome substitution strains 27

Figure 7: Reduction of the size of a linkage region 29

Figure 8: Principle of SNP association analysis 30

Figure 9: Positional cloning in mice 32

Figure 10: Strain distribution pattern of the bleomycin-induced pulmonary

fibrosis response of recombinant congenic mice. 55

Figure 11: Comparison of microarray gene expression data with Real-Time

PCR evaluation of selected genes. 60

Figure 12. Radiation-induced lung phenotype of inbred and recombinant

congenic AcB/BcA mice. 78

Figure 13. Radiation-induced lung inflammatory phenotype of inbred and

recombinant congenic AcB/BcA mice. 82

Figure 14. Correlations between lung response phenotypes in recombinant

congenic AcB/BcA mice. 85

Figure 15: Allele-dependant pulmonary fibrosis on chromosome 11 and 17

109

Figure 16: Bleomycin-induced pulmonary fibrosis phenotype of C57BL/6J,

A/J and chromosome substitution strains B6.6A and B6.17A. 112

1 Figure 17: Identification of loci for bleomycin-induced pulmonary fibrosis

and inflammation 115

Figure 18: Percentage of NK cells in the lungs of bleomycin-treated

C57BL/6J and A/J mice. 117

Figure 19: Pulmonary lymphocyte composition and bleomycin-induced

fibrosis phenotype of Ly49A transgenic and wild-type littermates. 119

Figure 20: Bleomycin-induced pulmonary fibrosis phenotype of β2

microglobulin knock-out mice and wild-type (C57BL/6J) controls. 122

Figure 21: Bleomycin-induced pulmonary fibrosis phenotype of inbred

strains 127

Figure 22: Single nucleotide polymorphism in exon 36 of C4b of a

susceptible and resistant strain 129

Figure 23: Relationship between allelic variation of inbred strains and

fibrosis development 131

Figure 24: Pulmonary expression of C4b does not correlate with

susceptibility to fibrosis 134

Figure 25: Differential expression of C4b over time relative to B6 control 135

Figure 26: Level of complement component 4 in serum. 138

Figure 27: C4 deposition in the lungs detected by IHC 140

Figure 28: Mannose-binding lectin deficiency does not influence fibrosis

development 142

2 List of tables

Table 1: Genes investigated with real-time PCR 50

Table 2: Putative linkage regions : effect of the genotype on bleomycin-

induced pulmonary fibrosis phenotype of RCS mice 56

Table 3: Significantly differently expressed genes in the lungs of bleomycin-

treated A/J mice relative to non treated A/J mice 59

Table 4: A/J:B6 differentially expressed genes of the linkage regions 62

Table 5: Effect of the genotype on radiation-induced lung disease phenotype

of BcA mice 88

Table 6: Effect of the genotype on bleomycin-induced pulmonary fibrosis in

(BcA84 x B6) F2 mice 110

Table 7: Genes located in the region identified with the MHC congenic mice

124

Table 8: Inbred strains C4b allelic variation of the 3 most correlated SNPs

132

3

CHAPTER I

Introduction

4 In this thesis, we used several genetic approaches in an attempt to identify regions of the genome or specific genes that would be involved in the development of pulmonary fibrosis. Even though this disease is not highly prevalent, it is a highly debilitating chronic disease for which no effective treatments exist. The identification of pulmonary fibrosis susceptibility genes could be used to discover a treatment or to pre-screen susceptible patients in the case of drug or radiation-induced pulmonary fibrosis. The understanding of the processes that lead to the development of pulmonary fibrosis could also potentially be applied to other fibrotic diseases, such as liver fibrosis, or to other diseases that are caused by inappropriate cellular proliferation, such as cancer.

Pulmonary fibrosis has been studied for several years, but numerous components of the disease are still unknown. In this thesis, genetic approaches were favoured, as they are un-biased hypothesis-generating experiments. Using hypothesis-generating experiments such as quantitative trait locus identification and microarray expression studies we could identify new genes or processes, which could then be investigated for their implication in pulmonary fibrosis development.

In order to use the genetic approaches, we chose an animal model of induced pulmonary fibrosis. A few inbred strains of mice were known to be susceptible to the development of pulmonary fibrosis when subjected to a chemotherapeutic agent called bleomycin, or to chest radiotherapy. In this thesis,

5 we made use of both inducing agents, as we could either dissect genes involved in radiation-induced pulmonary fibrosis or bleomycin-induced pulmonary fibrosis, or we could identify genes involved in pulmonary fibrosis pathology, regardless of the inducing treatment. This approach enabled the identification of regions of the mouse genome linked with the susceptibility to radiation and bleomycin- induced pulmonary fibrosis and the investigation of several bleomycin-induced pulmonary fibrosis candidate genes.

Pulmonary fibrosis

Lung diseases such as pulmonary fibrosis, emphysema and chronic obstructive lung disease are the fourth most prevalent cause of death in the United

States of America (1). Interstitial lung disease is a chronic and debilitating condition characterized by scarring of the lung which leads to shortness of breath and eventually respiratory failure (2). The prevalence of interstitial lung diseases was estimated to be 42.7 cases per 100 000 persons, and to be 227 per 100 000 persons greater than 75 year old in the United States (3). The diagnosis of an interstitial lung disease is typically followed by a mean survival of 3.2 years (4), with the greatest incidence of pulmonary fibrosis mortality in patients over 65 years of age (5).

The most common interstitial lung disease is idiopathic pulmonary fibrosis

(IPF). IPF patients constitute half of the cases of interstitial lung diseases (6) and

6 it is the most studied disease of this class. An interstitial lung disease is classified as “idiopathic” when the patient’s history does not show exposure to lung irritants that are known to cause pulmonary fibrosis. In idiopathic pulmonary fibrosis, the normal lung architecture is destroyed and this gives rise to honeycomb-shaped lungs with collagen deposition, fibroblasts and inflammatory cell infiltration (7).

The appearance of the IPF lung is usually heterogeneous, with regions of fibrosis and regions of normal lung tissue. As well as IPF, pulmonary fibrosis (PF) could develop following exposure to viruses such as Epstein-Barr (8), occupational exposures to dusts (9) and cancer treatments with bleomycin or radiotherapy (10).

Hypotheses on the development of pulmonary fibrosis

The mechanisms which result in the development of pulmonary fibrosis are still not well understood, but several lines of hypotheses coexist. It is possible that an imbalance between the deposition and the degradation of collagen and other matrix proteins could lead to a progressive accumulation of tissue in the alveoli (11). Some argue that inflammation is involved in the development of PF

(12,13), while others believe it is not required (14). Sime and O’Reilly (15) proposed that an immune reaction geared toward T helper type-1 (Th1) response would lead to the resolution of pulmonary fibrosis, while a Th2 immune response would maintain pulmonary fibrosis (PF) in the lungs. Transforming-growth factor

β (TGF-β) was also often associated with fibrosis development as this cytokine causes matrix deposition and myofibroblast differentiation (reviewed in (16)), which are characteristics of pulmonary fibrosis. Lastly, aberrant wound healing

7 due to an imbalance in the levels of apoptosis of lung epithelial and fibroblast cells was also suspected to be involved in the development of PF (17). Despite years of studies, a complete comprehension of pulmonary fibrosis etiology has not been achieved and it is necessary to further investigate this disease to better understand the pathogenic processes with the goal of preventing or curing pulmonary fibrosis.

Several pulmonary fibrosis treatments developed from the inflammation hypothesis were attempted, but none was found to be effective in humans.

Patients are usually treated with a combination of corticosteroids, such as

Prednisone, to reduce the inflammation and immunosuppressive drugs such as

Cyclophosphamide (18). This treatment does not resolve pulmonary fibrosis and only reduces the severity of the symptoms in 10 to 30 percent of patients (19).

New experimental treatments are being attempted in patients, based on the new hypotheses generated by animal studies such as inhibition of TGF-β induced collagen synthesis by Pirfenidone (20). The failure of several treatments aimed to disrupt processes believed to be involved in pulmonary fibrosis development (21) is still puzzling and could be explained by the fact that these processes might not be a requisite for disease development, or that the treatments were administered after irreversible lung changes. The identification of new candidate genes could potentially lead to the development of new treatment regimens that could improve the lives of the patients.

8 Familial pulmonary fibrosis

The development of pulmonary fibrosis is partially determined by genetic factors (22). For example, cases of idiopathic pulmonary fibrosis were observed in twins (23,24) and a familial form of pulmonary fibrosis was also identified in which several relatives are affected by this disease. This form of PF was thought to be inherited as an autosomal dominant with a variable penetrance or as a recessive trait (25). A few mutations were identified to be associated with the development of pulmonary fibrosis in families, such as surfactant protein A and B

(26,27), surfactant protein C (28) and telomerase genes (29) by comparing the relative frequency of mutations in these genes in IPF (or usual interstitial pneumonitis) patients and healthy controls. A correlation between certain major histocompatibility complex (MHC) haplotypes and idiopathic pulmonary fibrosis development was also identified in a case-control study (30). In Finland, a genome-wide scan of six families with familial IPF identified ELMO domain containing 2 (ELMOD2) as a candidate gene, a gene potentially involved in apoptosis and phagocytosis, to be implicated in the susceptibility to pulmonary fibrosis (31). The causative mutations of familial PF can provide hints into the pathological processes of this disease, but as most studies were relatively small, an animal model of the disease could increase our understanding of the disease process.

9 Animal models of pulmonary fibrosis

As there are limited data from human studies and due to the inherent influence of multiple environmental exposures, such as smoking or occupational exposure to agriculture or farming in the development of pulmonary fibrosis in humans (32), animal models are an appropriate method for the study of genetic factors linked to the susceptibility of pulmonary fibrosis. With the exception of a mutant mouse strain called Motheaten which survives for a few weeks after birth, shows several immunological defects and dies of pneumonitis and fibrosis

(33,34), there are no animals that naturally develop pulmonary fibrosis like humans do and the development of the disease is usually triggered by treatments with fibrosis causing agents. Studies in multiple animal species have been pursued to investigate pulmonary fibrosis (35), but the most commonly used animal models are rats (36) and mice (37), with the majority of studies on the latter.

The most commonly used pulmonary fibrosis causative agent is a chemotherapeutic agent called bleomycin, as described below. Several other experimental compounds are known to cause fibrosis-like depositions in the lungs, such as asbestos (38), fluorescein isothiocyanate (39) and silica (40). Other substances are known to cause pulmonary inflammation, such as ozone (41) and butylated hydroxytoluene (42). A few transgenic animals develop PF without inducing treatments. For example, overexpression of TGFβ in the lungs of rat leads to pulmonary fibrosis (43). Thoracic irradiation is also used to induce pulmonary fibrosis and inflammation, as will be discussed.

10

Ideally, an animal model of pulmonary fibrosis should resemble the human pathology to ascertain that the pathways revealed in the animals would reflect the human disease process. Most fibrosis inducing treatments in rats and mice show histological characteristics observed in humans, as indicated by the fibroblast proliferation and collagen deposition (44). Nevertheless, there are inherent differences between the animals and human. For example, the disease in humans is progressive and develops over a long period of time in middle-aged patients, while it develops over a few weeks in young animals. There are also some reports that pulmonary fibrosis resolves in animals after a few weeks post- treatment, which does not occur in human patients. This is especially seen in intratracheal instillation of bleomycin (45), while the use of a chronic infusion such as mini-osmotic pumps is characterized by a chronic phenotype resembling human PF (46), which is why it was used in this thesis. Overall, as with any models, the animal studies of pulmonary fibrosis have limitations, but are useful to develop an understanding of this disease, which can then be applied to humans.

Route of administration

The route of administration may influence the development of pulmonary diseases. Some irritants, such as cyclophosphamide, will result in pulmonary toxicity if delivered intratracheally, but not if injected intravenously (35). In the case of bleomycin, the most common route of administration consists of a single intratracheal injection. Following this treatment, mice develop pulmonary fibrosis

11 around day 14 to 21, with a potential resolution after 28 days. As human cases of

PF are usually not reversible, this is not a perfect model. In this research project, we instill a bleomycin solution subcutaneously over a week using mini-osmotic pumps implanted under the skin of the back of the mice. This type of administration was shown to result in a decreased mortality, an increase in the amount of collagen deposition and in a phenotype resembling more closely to the human pathology, including foci of subpleural fibrosis (46). Furthermore, the pulmonary disease does not resolve after six weeks, in contrast with intratracheal injections.

Bleomycin

Bleomycin is a glycopeptide antibiotic extracted from Streptomyces

Verticillus. It was first isolated by Umezawa et al. in 1966 (47). Bleomycin was shown to be effective in the treatments of squamous cell carcinomas, lymphomas and testicular cancers and is still used as a single chemotherapy treatment, or in combination with other drugs or radiotherapy.

12

Figure 1: Simplified molecular structure of bleomycin.

The bithiazole moiety intercalates in DNA while the pyrimidine and imidazole moieties bind oxygen and iron to produce reactive oxygen species (48).

Mode of action

Bleomycin injections or subcutaneous delivery such as given by the mini- osmotic pumps used in this thesis, result in a systemic distribution of the drug, with accumulation in the spleen, lung and skin of mice (49). Bleomycin is partly inactivated by bleomycin hydrolase, which is present in most tissues but shows very low levels in lung and skin (50) and this correlates with the accumulation of active bleomycin in these tissues (51) where pulmonary fibrosis and hair loss in some mice can be observed. Bleomycin molecules must bind metal ions such as iron or copper and oxygen molecules, which are readily available in the lungs, to be activated. Each molecule of activated bleomycin can then produce eight to ten

DNA breaks (52). Bleomycin activation also results into oxidative stress with the production of singlet oxygen (53).

13 One of the main effects of bleomycin is to damage DNA, which leads to the death of rapidly dividing cells or cells lacking DNA repair and proper cell cycle checkpoints such as cancer cells. Human mononuclear cells and fibroblasts are also especially susceptible to cell death. According to Hay and colleagues

(48), human lung pathology caused by bleomycin treatment includes type II epithelial proliferation, oedema and infiltration of mononuclear cells. Fibrous tissue of collagen type I and V accumulates in the alveoli, which leads to pulmonary obstruction (54).

According to the Food and Drug Administration, pulmonary toxicities occur in ten percent of the patients undergoing bleomycin treatment (55). One percent of the patients will then succumb to the resulting pulmonary fibrosis. This adverse effect is more pronounced in older patients or with larger doses of bleomycin. Patients undergoing concomitant radiotherapy have higher risks of developing PF, as radiotherapy is also known to cause this disease. Another common side-effect of bleomycin treatment is the development of skin toxicities

(rash, hyperpigmentation and hair loss, among others). As the susceptibility to the development of pulmonary fibrosis is unknown, the possibility of this complication limits the quantity of drug that can be administered to non- susceptible patients.

14 Thoracic irradiation

In this project, we also used thoracic irradiation to induce pulmonary fibrosis in mice. In humans, thoracic irradiation is mainly used to treat lung, esophageal and breast cancers. A complication of thorax radiotherapy is radiation pneumonitis, which occurs in thirteen to thirty-seven percents of patients and develops between six weeks and 6 months following the end of the treatment (56).

Radiation pneumonitis is characterised by fever, dyspnea and polymorphonuclear cell infiltration in the lung (57). Corticosteroids are usually used to treat radiation pneumonitis, and the disease can be reversed. In some cases, radiation pneumonitis progresses to radiation fibrosis. This disease presents with cellular infiltration of macrophages, fibroblasts, plasma cells and collagen deposition (58).

As for bleomycin-induced pulmonary fibrosis, radiation-induced PF is not reversible. The susceptibility to radiation fibrosis is similar to bleomycin susceptibility and increases with age, smoking and dose of treatment.

Radiotherapy uses ionizing radiation which produces hydroxyl radicals that will attack and break DNA molecules. This treatment kills cancer cells and damage surrounding cells in a way similar to bleomycin treatment, as both treatments cause oxidative stress and DNA damage. The radiation dose administered to animals or patients is measured in Gray (Gy), which is a measure of the absorbed dose as defined by the absorption of one joule per kilogram of tissue (59).

15

Identification of susceptibility genes using mouse genetics

Strain dependant fibrosis responses to bleomycin and radiation treatments

The susceptibility to bleomycin-induced pulmonary fibrosis has genetic determinants in human and mice. In previous studies (60), we found that A/J and

C3Hf/Kam (C3H) mice do not develop fibrosis (figure 2b), while C57Bl/6J (B6) mice show a fibrotic response following bleomycin treatment (figure 2a).

Following whole thorax irradiation, B6 mice develop fibrosing alveolitis

(61), which is a combination of lung inflammation and pulmonary fibrosis (figure

2c). The A/J and C3H strains do not develop PF and succumb of diffuse alveolitis, which is characterized by massive cellular infiltration and protein exudates in the lung (62), (figure 2d). These strains of mice will be used to investigate pulmonary fibrosis genetic susceptibility.

16

A B

C D

Figure 2: Lung phenotype of B6 and A/J mice a) 12.5x magnification of bleomycin-treated B6 mouse. b) 100x magnification of bleomycin-treated A/J mouse. c) and d) 100x magnification of the lung of irradiated B6 (c) and A/J (d) mice.

The aim of this project was to identify candidate genes involved in the susceptibility of bleomycin and radiation-induced pulmonary fibrosis. The approach used was quantitative trait locus analysis in mice and candidate genes evaluation as Burch and Schwartz suggested for the identification of fibrosis susceptibility genes (63) (figure 3), and these techniques were successfully used in several other studies such as the identification of Tbc1d1 as a gene underlying obesity and diabetes in mice (64). These candidate genes can then be investigated for their possible implication in the development of pulmonary fibrosis.

17

Figure 3: Flow diagram of fibrotic disease gene discovery

This diagram represents steps in the identification of genes involved in lung fibrotic diseases using QTL linkage to identify a candidate region and analysis of candidate genes in this region. Most steps will be discussed below. (modified from the chapter written by Burch and Schwartz in (63))

18

Quantitative trait loci (QTL) are regions of the genome that putatively contain genes implicated in the development of a disease. QTL mapping was developed in the end of the 1980s (65) as a method to identify genes responsible for complex trait diseases. In animal studies, QTL analysis requires the identification of two inbred strains that are different for the phenotype investigated. A cross is made between the two different inbred strains and the phenotype of the progeny is evaluated. This phenotype must be quantitatively measured, as indicated by the name of this analysis, as the extent of the response is correlated with the segments of the chromosome inherited from either parent

(66). Our hypothesis was that genes involved in the disease development would be polymorphic between susceptible mice and resistant mice. By studying different crosses of mice, the regions of the genome that every susceptible mouse strains have in common and that differ from the resistant strains of mice should contain susceptibility genes (figure 4). The mice that inherited the region from the high responder, or susceptible strain, at a locus involved in the development of the trait will show a phenotype similar to its parent. If the inherited chromosomal region is unrelated to the susceptibility to this trait, the progeny phenotype will not correlate with its parental phenotype.

19

Figure 4: Identification of QTLs in mice

Mice derived from a cross between resistant and susceptible mice are genotyped and the parental contributions of each mouse are determined (white or black boxes). The correlation between the phenotype and the genotype at each location is calculated as a logarithm of odds (LOD) score and is plotted on a graph. The region under the QTL peak is hypothesized to contain genes related to the susceptibility of the animal to the disease.

The susceptibility or resistance of different inbred strains could be due to one or several genes, which could lead to either new QTLs to investigate, or to supporting evidence for known QTLs. A few studies have identified linkage regions for bleomycin or radiation-induced pulmonary fibrosis. A cross of fibrosis susceptible B6 and fibrosis resistant C3H mice identified parts of chromosome 11 and 17 as potential QTLs involved in this disease (67). A cross between BALB

20 and DBA/2J mice identified QTLs on chromosome 6 and 13 (68). For radiation- induced pulmonary fibrosis, a cross of fibrosis susceptible B6 and fibrosis resistant C3H mice identified chromosome 1, 6, 17 and 18 as susceptibility loci

(62). Interestingly, the identification of susceptibility loci in other lung disease models often overlaps with bleomycin and radiation-induced PF (69). For example, a QTL analysis of ozone-induced lung inflammation in mice also resulted in the identification of loci on chromosome 11 and 17 (70). An analysis of macrophage phagocytic dysfunction following lung exposure to sulphate- associated particles also identified chromosome 11 and 17 as potential candidates

(71). This data indicates that common mechanisms may contribute to several lung diseases and that bleomycin-induced PF candidate genes could also be involved in the pathogenesis of other lung diseases.

Mouse crosses for QTL analysis

As discussed above, QTL analysis relies on the evaluation of the phenotype of a progeny derived from parents that showed a different response for that trait. In this thesis, we make use of the recombinant congenic strains (RCS) developed by Fortin et al. (72). The RCS were generated by crossing A/J and B6 parental mice, then by backcrossing the progeny to either B6 or A/J for two generations. The resulting progeny were then intercrossed and inbred for 18 to 30 generations to produce thirty-seven strains (figure 5a), twenty-two of which have

13% of A/J alleles on a B6 background (called BcA) and fifteen strains that have

13% of B6 alleles on an A/J background (called AcB) (figure 5b). These strains of

21 mice have the benefit of being fully genotyped so the inherited AJ and B6 regions

are known for each strain. The RC strains are then treated and phenotyped and the

correlation between the phenotype and the known genotypes are analysed using a

software developed for this purpose, such as MapManager (73) or R/qtl (74). This

set of strains was used to successfully identify QTL and disease genes in malaria

susceptibility (75), salmonella infections (76) and cocaine-induced locomotor

activation (77).

Recombinant congenic strains

+

C57BL/6J A/J

+ +

C57BL/6J F1 F1 A/J

BcA1 BcA2 AcB1 AcB2

BcA3 AcB3 22 BcA strains 87% B6, 13% A/J 14 AcB strains 87% A/J, 13% B6 A

22 B

Figure 5: Recombinant congenic strains

A) The parental strains are crossed and the progeny are sequentially

backcrossed and intercrossed for multiple generations, until the resulting strains

have homozygous alleles. B) Fifteen AcB strains are derived from B6 alleles on

a A/J background, while 22 BcA strains contain A/J alleles on a B6 background.

In this example, the fibrosis susceptible AcB3 is an informative strain that could

be used toward the identification of candidate genes as genes predisposing to

the development of pulmonary fibrosis are likely located in one of the B6 (pink)

regions. Adapted from (79).

23 The advantage of the RCS is that the location of susceptibility alleles is distributed in a small number of recombinant alleles. For example, the susceptibility genes of a particular fibrosis prone AcB strain would be located in approximately 13% of its genome where this strain inherited B6 alleles. This is an advantage over the traditional mouse crosses such as backcrosses (crossing the

F1 to the parent) and intercrosses (crossing the F1 together), in which 25-50% of the alleles are recombinant. Another advantage of RCS is that every allele is in a homozygous state, which simplifies the analysis of recessive risk loci.

Furthermore, each animal in a backcross or intercross has a unique genotype and is often sacrificed at the end of the experiment, while there are an unlimited number of mice for any RC strain, which allow for replicate experiment or breeding of an informative strain for further studies. A disadvantage to the use of recombinant strains is that a small finite number of strains exist, and the statistical power of a QTL analysis in 30-40 strains could be lower than in crosses that result in hundreds of phenotyped animals in the case of traditional intercrosses.

Typically, QTLs identified with mouse crosses result in large intervals that contain hundreds of genes. The identification of the gene responsible for the phenotype in this interval is a notoriously difficult task and only a few genes were definitively shown to be the quantitative trait gene underlying a QTL (80). The usual steps toward the identification of candidate genes by QTL mapping are the confirmation of the QTL effect on the phenotype, the reduction of the size of the

24 QTL, the identification of candidate genes and the experimental demonstration that this candidate gene is involved in the disease (81).

Confirmation of a QTL

As QTLs are identified by a statistical association between the observed phenotype and the genotype of the animals, falsely associated regions can occur.

To prevent the analysis of candidate genes in a region unrelated to the phenotype, the presence of a QTL on a chromosome is usually confirmed (81). Chromosome substitution strains (CSS) of mice can be used to confirm the presence of a QTL on one chromosome. Nadeau and colleagues developed twenty-one strains (one for each mouse chromosome) that each possess alleles of A/J mice on an entire chromosome while keeping B6 alleles on every other chromosomes (82) (figure

6). These strains of mice are now commercially available at the Jackson laboratories. CSS are particularly useful to dissect the influence of a single chromosome on the phenotype and to confirm the presence of a QTL on a chromosome in the event that the phenotype of the CSS mice differ from the phenotype of the background strain (83). Chromosome substitution strains were used to confirm the presence of QTLs on chromosome 8 in the identification of a candidate gene involved in lipopolysaccharide-induced inflammatory response

(84) and were used here to confirm the presence of bleomycin-induced QTLs on chromosome 6 and 17.

25 A second type of mice used to confirm the presence of a QTL on a chromosome is congenic mice (figure 6). They differ from chromosome substitution strains, as only a portion of a chromosome containing alleles from the donor mice was transferred via sequential backcrosses on the genome of another strain. If this region contains susceptibility genes the phenotype of the progeny would resemble that of the donor strain. The advantage of congenic strains is that the precise location of a QTL can be confirmed, while a whole chromosome is confirmed in CSS mice. Congenic lines are a tool frequently used toward the identification of candidate genes and were a step in the identification of the gene tbc1d1 in a high-fat diet-induced obesity mouse model (64) and in this study congenic mice were used to confirm the location of a QTL on chromosome 17.

Congenic strain

26 Chromosome substitution strain

Figure 6: Congenic mice and chromosome substitution strains

In congenic strains, a selected portion of the genome of a mouse strain (in white) is transferred on the genome of a second strain (in black). In chromosome substitution strains, each line contains all the alleles of an entire chromosome from a donor strain on another strain background. These strains are produced by selecting the progeny that contains the best combination of donor allele on the desired chromosome and sequentially backcrossing this progeny.

Reduction of the size of the QTL

Once a QTL is confirmed, the next step in QTL mapping is the reduction of the size of this QTL. As QTLs can be quite large (30-50 cM) (78) and may contain hundreds of genes, any technique aimed at reducing the size of the region

27 will result in a smaller number of potential genes to study. First, performing QTL mapping in a larger sample size or in multiple crosses can allow a reduction of the size of the QTL (85). An additional cross might show different recombination points and the overlap between both crosses could lead to a smaller region. In this study, we compared a new cross of bleomycin-treated B6:A/J with our previous

B6:C3H results (67). The data from different crosses can also be combined in a large QTL analysis as the increased statistical power of the analysis can lead to a smaller confidence interval around the QTL. By using this technique, Burgess-

Herbert et al. were able to reduce the size of a high-density lipoprotein cholesterol

QTL from 104 Mb to 26.3 Mb (85), as shown in figure 7.

Haplotype analysis can also be evaluated between the mouse strains to narrow down the region as described in (85), in which they further decreased the size of the QTL to 2.9 Mb, a region that contained 11 genes (figure 7). The principle of the haplotype analysis is that strains of mice may contain regions of their genome that are polymorphic or that are identical by descent. In these identical regions, both evaluated strains have indistinguishable alleles and it is believed that as non-polymorphic regions cannot explain the difference in phenotype between the strains, they can be excluded from the QTL. In this thesis, we were able to eliminate 6 genes in the region identified by major histocompatibility complex (MHC) congenic mice because they were identical by descent. This approach was also used by Fulton et al. to decrease the size of their

QTL nearly by half (84).

28

Figure 7: Reduction of the size of a linkage region

As shown in (85), the combination of multiple mouse crosses, haplotype analysis and haplotype association mapping can greatly narrow down the QTL to a small area and reduce the number of potential candidate genes. The grey blocks represent the QTL location on the chromosome, while the white blocks are excluded as they do not overlap with all the analyses. The size of the region and the number of potential candidate genes are indicated on the right.

A further analysis of haplotypes called single nucleotide polymorphism

(SNP) association analysis (also called haplotype association mapping or in silico mapping) can be performed to identify small regions of a QTL associated with the phenotype. The correlation between the allele at each individual SNP and the phenotype of each strain is assessed and significantly associated SNPs may be related to the development of the disease (figure 8). Recent advances allowed the identification of 8 million SNPs in 15 inbred strains of mice (86). These SNPs could either be in the causative genes, or be in the vicinity of these genes. As the density of SNPs can be very high, very fine mapping of the region of interest is

29 possible. SNP association may be used in a genome-wide analysis to identify new candidate genes, or in combination with QTL analysis, which was shown to reduce the number of false-positive loci (87). SNP association analysis can greatly reduce the number of candidate genes as Liu et al identified a 200 kb region significantly associated with lung cancer that contained a single gene, which was shown to be involved in cellular proliferation (88).

Figure 8: Principle of SNP association analysis

Resequencing data of inbred strains of mice led to the discovery of 8 million

SNPs that differed between the inbred strains evaluated. It is hypothesized that genes at the locations where resistant strains have an allele of a SNP that differs from susceptible strains could be involved in the phenotype development (top), while regions where no correlations are observed are unlikely to contain susceptibility genes (bottom).

Positional cloning in mice

Another method to narrow down the size of a QTL is through positional cloning. The main limitation to the use of chromosome substitution strains is that

30 it identifies an entire chromosome and does not directly lead to the study of candidate genes and the size of the region transferred in congenic mice can also be quite large. To decrease the number of candidates, it is possible to create a panel of strains derived from a congenic line or chromosome substitution strain by backcrossing and selecting the progeny for smaller donor regions in the locus of interest on this chromosome. By repeatedly crossing each line, a panel of subcongenic mice can be created. These mice can then be phenotyped and a correlation between the phenotype and genotype of this chromosome can identify small regions that contain the genes of interest (fig 9). This method was successfully applied by Dr Nathan et al. in the identification of a region correlating with onset of puberty in mice (89) and was used in this research project to identify regions of susceptibility to bleomycin-induced PF on mouse chromosome 17 in B6:C3H mice.

31

Figure 9: Positional cloning in mice

A particular congenic strain or chromosome substitution strain can be backcrossed to create subcongenic lines and the progeny can be phenotyped.

The regions that the susceptible progeny have in common should contain susceptibility genes.

Candidate genes evaluation

Gene expression analysis

The goal of the reduction of the size of a QTL is to identify a small number of genes that can be studied in greater detail. The reduction in size of the

QTLs can be more or less successful and several genes may still reside in this region. One approach to rapidly prioritize or eliminate candidate genes is to evaluate gene expression (80). Gene expression analysis assumes that the

32 quantitative trait gene is differentially expressed in the tissue studied, either due to differential regulation, or to a mutation that would lead to mRNA decay, for example. If the differential expression of a gene is translated into a different amount of proteins, it could lead to the phenotype observed.

Real-Time PCR (RT-PCR) is a method to evaluate the mRNA expression of particular genes. Qualitative or relative RT-PCR is a technique used to compare the abundance of a specific mRNA in a sample with a housekeeping gene, which should be expressed at a constant level in all the samples (90). In this thesis,

SYBR® green and Taqman ® technologies were used. In both cases, a fluorescent molecule is released or activated when the number of double-stranded DNA molecule increases during a polymerase chain reaction (PCR) amplification. By comparing the number of PCR cycles necessary for the detection of fluorescence, one can deduct the initial quantity of mRNA for a particular gene. Several QTL investigations use the absence of mRNA expression in the tissue of interest to eliminate candidate genes. Wang et al identified 32 of the 49 positional mouse lung adenomas candidate genes to be expressed in the lung tissues (91), hereby reducing the number of possible candidate genes. Then, differential expression of the genes between susceptible and resistant mice or between treated and untreated control animals may indicate interesting candidates for further studies. Among the

32 genes identified in the study by Wang et al. (91), 4 genes were differentially expressed between the strains evaluated and these genes were further investigated as possible candidates. On the other hand, although differential expression can

33 prioritize genes for further studies, DNA variants do not always lead to differential mRNA expression, as explained in (80). For example, in the mouse lung adenoma study by Wang et al., the gene shown to be involved in the phenotype by in vitro experiments did not display differential expression (91).

A second method to evaluate gene expression, especially when a large number of genes have to be evaluated is microarray chips. A microarray chip can be used for high-throughput analysis of the mRNA expression of genes (92). The microarray results can reduce the number of candidate genes in a chromosomal region identified by positional cloning when differential expression is a criterion.

Microarray studies can also contribute to the generation of new hypotheses and to potentially identify pathways or classes of genes that could be involved in the disease progression. Microarray chips consist of an assortment of thousands of oligo probes that recognize a large number of genes from an organism. In this research project, we used Affymetrix ® gene chips to evaluate the difference in mRNA expression in the lungs of different inbred strains following bleomycin treatment. The RNA isolated from the lungs was fluorescently labelled and bound to their corresponding probe on the chip by complementary base pair binding. The variable fluorescence intensities between the probes can be translated into differential RNA expression by a bioinformatic analysis. Microarray chips have been employed in other studies of bleomycin-induced pulmonary fibrosis (93,94) and were used in this research to identify candidate genes.

34 Sequence variations in candidate genes

Another complementary approach to the identification of the candidate gene is to identify differences in the DNA sequence of the strains under study.

DNA polymorphisms could cause a differential expression of the gene, or could result in a protein that may behave differently in the susceptible or resistant strain.

The sequence variations that commonly affect a protein can occur within an exon or intron, as well as in the untranslated region and may affect the sequence, stability or the splicing site of the mRNA (95). The presence of SNPs in genes can be used to prioritize candidate genes for further study as in (91) in which 5 of the

32 lung adenoma candidate genes displayed nonsynonymous DNA polymorphisms, one of which being shown to be involved in the susceptibility to lung adenomas development. The identification of DNA variants in a particular candidate gene can also explain functional difference such as the deletion identified in the gene tbc1d1 in mice resistant to high-fat diet-induced obesity

(64). In this thesis we used known SNPs to prioritize bleomycin-induced candidate genes for future studies and a candidate gene was sequenced to identify strain variations.

Evaluation of candidate genes

In this thesis, we prioritized genes for further study due their location in a

QTL, differential expression and/or sequence variation. Prior to the direct evaluation of the gene in transgenic or knock-out mice, we further characterized

35 the candidate genes with methods that were appropriate to their function. A functional difference between susceptible and resistant strains in a candidate gene supports the implication of this gene in the disease and these genes can then be tested in genetically modified animals. Such functional tests included flow cytometry (FACS) to measure the number of particular cell types in tissues, enzyme-linked immunosorbent assay (ELISA) to measure proteins in circulation or immunohistochemistry (IHC) to identify proteins localization and abundance in tissue sections. The techniques used may vary depending on the genes evaluated, but IHC is often used to characterize QTL candidate genes such as the increase in

Tob1 in mouse lung adenomas when compared to normal tissue (91). FACS is also often used in immunological evaluation of candidate genes such as the increase in surface expression of a QTL candidate gene on peritoneal macrophages of mice susceptible to LPS-induced mortality (84).

Experimental demonstration of the gene effect on the phenotype

The identification of a genetic variation in a candidate gene between susceptible and resistant animals could be due to natural variation and potentially not be related to the observed phenotype. To ascertain that the candidate gene is indeed involved in the phenotype, this candidate gene should be manipulated in vivo or in vitro (96). Several methods can be used to demonstrate that a gene is involved in the phenotype of interest and usually involve the study of genetically modified animals such as transgenic or knock-out animals, but several

36 combinations of studies could demonstrate that a gene is involved in a particular disease (81). Knock-out mice that lack the gene of interest can be investigated as in (84), in which Msr knock-out mice on the susceptible mouse background reduced the plasma level of LPS-induced IL-10 to the resistant strain level, indicating that this gene was indeed involved in the phenotype investigated.

Several other genetically modified animals could be evaluated such as transgenic animals that could overexpress the gene of interest, or animals treated with small interfering RNA (siRNA) to decrease the transcription of the protein investigated.

In this thesis, we investigated the implication of natural killer (NK) cells genes and major histocompatibility complex (MHC) proteins in bleomycin-induced pulmonary fibrosis by evaluating the phenotype of transgenic mice that specifically lacked NK cells and knock-out mice that were deficient in class I

MHC molecules.

Aims of this research project

The first aim of this research project was to identify regions of the genome linked to the development of bleomycin and radiation-induced pulmonary fibrosis. This aim is based on the hypothesis that fibrosis prone mice have susceptible alleles of genes involved in the disease, which would be different in resistant mice. The experiments used to address this aim and hypothesis were

QTL analysis of bleomycin and radiation-treated RCS mice, derived from fibrosis susceptible B6 mice and fibrosis resistant A/J mice.

37 The second aim of this project was to further investigate some of the identified QTLs, with the intention of confirming their location and allowing the identification of a small number of candidate genes. The hypothesis underlying the second aim was that a single genetic variation within an isolated QTL would be sufficient for the induction of pulmonary fibrosis. It was also hypothesized that the candidate genes would show polymorphisms between susceptible and resistant mice, either in their nucleotide sequence or in their gene expression. To investigate this second aim, crosses of informative RC strains and of B6xA/J mice, chromosome substitution strains and congenic strains of mice were evaluated. To prioritize candidate genes for further studies, mRNA expression of the candidate genes was evaluated by microarray chips and RT-PCR.

The third aim of this research project was to evaluate candidate genes for their implication in pulmonary fibrosis. It was hypothesized that natural killer cells and MHC class I molecules could be involved in the development of pulmonary fibrosis due to the location of these two candidates at the peaks of previously identified QTLs. Complement component 4b (C4b) was also evaluated as it was located in a reduced region identified in congenic mice. To answer the third aim, NK deficient and MHC class I deficient mice were evaluated and C4b was investigated by RT-PCR, sequencing, by ELISA and IHC in susceptible and resistant strains of mice.

38

CHAPTER 2

Bleomycin-induced pulmonary fibrosis

susceptibility genes in AcB/BcA recombinant

congenic mice

A.M. Lemay and C.K. Haston. Bleomycin-induced pulmonary fibrosis susceptibility genes in AcB/BcA recombinant congenic mice. Physiol Genomics

23, 54-61 (2005)

Used with permission

39 Abstract

The genetic basis of susceptibility to pulmonary fibrosis is largely unknown. Initially, in this study, loci regulating the response of bleomycin- induced pulmonary fibrosis were mapped using a set of recombinant congenic strains bred from pulmonary fibrosis-resistant A/J and susceptible C57BL/6J (B6) mice. Linkage was identified (LOD= 4.9) on chromosome 9 and other suggestive loci were detected. The putative loci include alleles from both the B6 and A/J strains as increasing the fibrosis response of the congenic mice. Gene expression analysis with microarrays revealed 3304 genes or expressed sequence tags to be differentially expressed (p < 0.01) in lung tissue between bleomycin treated B6 and A/J mice, and 246 of these genes map to the potential susceptibility loci.

Pulmonary genes differentially expressed between bleomycin treated B6 and A/J mice included those of heparin binding and extracellular matrix deposition pathways. A review of available genomic sequences revealed 809 (43% of total) genes in the linkage intervals to have variations predicted to alter the encoded proteins or their regulation, 68 (8.4%) of which were also differentially expressed.

Genomic approaches were combined to produce a set of candidate genes which may influence susceptibility to bleomycin-induced pulmonary fibrosis in the

A/J:B6 mouse model.

Keywords: Genetic Predisposition to Disease, Quantitative Trait Loci, Microarray

Analysis

40 Introduction

Pulmonary fibrosis is a genetically complex disease which can result from known exposures such as chemotherapy regimens involving bleomycin or can occur idiopathically (7,97). The pathology of excessive deposition of extracellular matrix in the lung interstitium can result in impaired lung function and, ultimately, respiratory failure. From clinical studies, it is suggested the development of pulmonary fibrosis has a genetic component (98,99), but the specific genes involved have not been identified.

Inbred strains of mice differ in their tendency to develop pulmonary fibrosis after bleomycin treatment and they have been used as the base of genetic investigations to define susceptibility genes. We have previously mapped 2 quantitative trait loci (QTL), named Blmpf1 (bleomycin-induced pulmonary fibrosis 1) and Blmpf2, of propensity to develop fibrosis after bleomycin exposure in F2 mice derived from progenitor strains C57BL/6J (B6) and C3Hf/KAM.

Barth, et al. (68), used the progenitor strains DBA/2 and BALB/c to map two loci of susceptibility to bleomycin-induced pulmonary fibrosis, which, as they differ from those we have mapped (67), indicates the utility of studies in distinct inbred strains of mice for uncovering susceptibility loci of complex traits.

In this study, we make use of the strain difference in bleomycin response between B6 (susceptible) and A/J (resistant) mice (100) and of available genomic resources to both map susceptibility to pulmonary fibrosis and to identify a set of

41 potential candidate genes for the trait. Investigations of the A/J strain were undertaken as our previously identified locus Blmpf1, which maps to the major histocompatibility complex (MHC), was defined in B6 (MHC haplotype H2b) and

C3Hf/KAM (H2k) mice, and as the haplotype of the A/J strain (H2a) is different, studies of this strain may reduce the number of MHC-derived fibrosis candidate genes.

To map susceptibility to pulmonary fibrosis we used a series of 36 recombinant congenic mouse strains (RCS) derived from the B6 and A/J progenitor strains (72,101). Fourteen of the strains (named AcB) contain a random 13.25% of B6 genes in the A/J strain background, and 22 strains have

13.25% A/J genes in the B6 background (BcA strains). Thus, with this resource, the B6 alleles involved in the susceptibility to pulmonary fibrosis are potentially divided among 14 strains of mice, enabling the assessment of the effect of discrete

B6 genomic regions on the phenotype. Such recombinant congenic strains have been used by others to map complex traits of malaria susceptibility and endotoxin-induced lung response among others (101,102,103).

In addition, amongst the mapped positional candidates a set of potential fibrosis susceptibility genes was isolated by identifying the subset of these genes which were differentially expressed between B6 and A/J mice in the bleomycin treated mouse lungs and for which there is a sequence variation between the two strains.

42 Materials and Methods

Mice

Mice of the C57BL/6J and A/J strains were purchased from the Jackson

Laboratory (Bar Harbor, USA) and mice of the AcB/BcA strains from Emerillon

Therapeutics Inc. (Montreal, Canada). The AcB and BcA series of recombinant congenic strains of mice (RCS) were generated and maintained at the Montreal

General Hospital Research Institute, according to a breeding scheme and a genotyping protocol previously described (72). Male and female mice of 8 to 14 weeks of age were used for the study. All mice were handled according to guidelines and regulations of the Canadian Council on Animal Care.

Bleomycin treatment

Lung damage was elicited by administering bleomycin through osmotic minipumps implanted subcutaneously, as described previously (67). A/J mice were typed for their fibrosis response at 3 (5 males, 6 females) or 6 weeks (6 males, 6 females) after treatment and 10 untreated control mice (5 males, 5 females) were sacrificed at the 6 week time point. Male mice received 100 units of bleomycin per kg of body weight (~2.5 units per mouse) and female mice received 125 units per kg. Male and female mice were treated in separate studies due to the higher drug dose required to produce fibrosis in female mice. An additional 11 A/J and 7 B6 mice were treated with a lower dose of bleomycin (80 unit/kg for males and 100 for females) and sacrificed after 3 weeks. 208

43 recombinant congenic mice (a minimum of 3 male and 3 female mice of each of

19 RC strains, a total of 3-5 male and female mice for 14 additional strains) received 80 units of bleomycin per kg for males and 100 units per kg for females, to assay the fibrosis response. A further 8 to 15 mice of each of the AcB65 and the BcA 70, 72, 78, 81, 84 and 85 strains were treated with the bleomycin lower dose protocol to substantiate their phenotypes. The AcB/BcA mice were sacrificed at three weeks after treatment. AcB52, AcB56 and BcA76 strains were not studied due to low availability of these strains.

Histology and Fibrosis Scoring

At autopsy, the lungs were removed and the single left lobe of each mouse was perfused with 10% neutral buffered formalin and submitted for histological processing. Lung sections were stained with Masson's trichrome to identify the sites of collagen deposition in the lung. The area of the fibrosing phenotype for each mouse was quantified with image analysis of histological sections as in our previous study (67). Specifically, the area of fibrosis in the left lung lobe was determined from a user drawn region surrounding the fibrosis (Spot Software) and compared to the area of the entire lobe to yield the percent of pulmonary fibrosis for individual mice. Two different users evaluated the percent fibrosis of the mice and the inter-user agreement was r2=0.87.

44 QTL Analysis

Genome scan analyses were performed by using MapManager QTX

(Version b20) (73). With this software the set of fibrotic phenotypes (defined as percent of the lung with fibrosis by histology) of the 33 RCS mice was compared to their known genotypes to identify the genetic loci influencing this trait in B6 versus A/J mice. Only the recombinant congenic strains with 3 or more phenotyped mice were included in the QTL analysis (this yielded 33 strains when both sexes were combined, 27 strains for the males only and 23 for the females only) In this analysis, the marker regression function was used to determine the likelihood ratio statistic for each of 616 markers on 20 chromosomes. For each marker the resultant likelihood ratio statistic was divided by 4.61 (2 x ln 10) to yield the LOD score. The thresholds for determining the significance of loci were based on Lander and Kruglyak (104) proposed linkage standards and on empirically derived limits. From Lander and Kruglyak we used the mouse backcross value (deemed closest to recombinant congenic mice) which is a suggestive linkage LOD score of 1.9 and a significant LOD score of 3.3. To empirically determine suggestive and significant threshold LOD scores, 10000 permutations of the phenotype on the genotype were carried out in our data set.

Using the data of 33 RCS strains, the LOD score suggestive of linkage was 1.8, for significant linkage was 3.8 and the LOD score indicative of highly significant linkage was 6.9.

45 Gene expression

Following sacrifice, the right lung of each mouse was immediately homogenized in 2 mL of Trizol reagent and placed in dry ice. The homogenates were stored at -85C until RNA isolation. Total RNA was extracted from A/J lung homogenates according to the manufacturer’s (Sigma) instructions. The RNA from the right lungs of four or five mice from each group, defined by sex and treatment, was pooled, as in (105) to minimize biological variation in gene expression within a group. One sample of pooled RNA for each group was processed through the RNAEasy column (Qiagen) and submitted for hybridization. The quality of the isolated RNA was assessed and confirmed both prior to and following pooling by using the Agilent Bioanalyzer (Agilent

Technologies, Palo Alto, California, USA). The experiment was performed with one chip per mouse group, represented by its pooled RNA. The gene expression profile of the following groups of A/J mice was measured at the 3 week time point: males 100 bleomycin units/kg, females 125 units/kg, males 80 units/kg, females 100 units/kg, male untreated control mice and female untreated control mice, at the 6 week time point: males 100 units/kg and females 125 units/kg.

Microarray hybridization was performed by the Affymetrix Gene Chip

Core facility at the McGill University and Genome Quebec Innovation Centre.

The probe synthesis, hybridization and washing protocols followed the standardized Affymetrix protocol as reported by Novak, et al. (106).

46 The chips were scanned with a GeneArray Scanner (Agilent Technologies,

Palo Alto, California, USA). The resultant gene expression profile was then viewed using Microarray Suite 5.0 (Affymetrix). MOE430A GeneChip arrays containing 22690 probe sets derived from sequence clusters contained in Build

107, June 2002 of UniGene, which represent 12422 functionally annotated genes and a set of expressed sequence tags, were used.

Microarray data analysis

Routines from Bioconductor version 1.4 (http://www.bioconductor.org/) within the R version 1.90 statistical language (107) were used for quality control, normalization and differential expression. In particular, the quality of the raw microarray data was assessed by inspecting similarities between the intensity distribution and RNA digestion plot for each array. Normalization was performed using the robust probe level model (108). Using mean log intensity versus average log intensity plots, we compared arrays to determine whether different time post- bleomycin exposure, bleomycin dose and/or gender of the animal influenced gene expression in A/J mice and we found no significant differences in expression levels, with the exception of the genes on the X and Y chromosomes. This lack of difference justified the pooling of data from these arrays to form two distinct groups: A/J control and A/J bleomycin. A list of significantly differentially expressed genes with p<0.01 was then generated intra-strain (control versus bleomycin exposure) with the detection of differential expression performed using the LIMMA package (109,110). The gene expression data of A/J mice were then

47 compared, using LIMMA analysis, to that reported for B6 mice in response to the same bleomycin treatment (111)

To further assess the lung gene expression profile of A/J mice in response to bleomycin, we used the LIMMA package to analyze the data from NCBI GEO entry GDS350. These data were generated from 4 Gladstone v2 mouse lung oligo arrays (n=16463 probes) hybridized with cDNA from each of 4 bleomycin-treated

A/J mice compared to the pooled RNA of control untreated A/J mice.

The detection of significantly over-represented Gene Ontology categories was performed using the GOStats package in bioconductor (112). This test of statistical significance considers the number of differentially expressed genes found in each category compared to the total number of genes in the category represented on the chip.

Quantitative real-time PCR

4-5 µg of total RNA from each of 4 mice of each treatment group was used in a reverse-transcription reaction to synthesize the first strand cDNA using oligo(dT)12-18 Primer and Superscript™ II RNase H– Reverse Transcriptase

(Invitrogen, Carlsbad, CA, USA), in a 20 µL total volume. The lung expression level of each of the genes in Table 1 was determined for bleomycin-treated mice

(100 units/kg for female and 80 units/kg for males at the 3 week time point) and control B6 and A/J mice. These 6 genes were selected to represent genes of

48 increased and decreased expression in response to bleomycin, as indicated by the arrays. For this analysis sequence-specific primer sets were designed using Primer

3 (113) or taken from Primerbank (114). Primers were selected to span large introns in order to amplify only cDNA, see Table 1.

For real time PCR, Qiagen SYBR Green and a LightCycler™ (Roche) were used. Each reaction contained 1 µl of cDNA template and 10 µl of

QuantiTect SYBR Green PCR Kit (Qiagen). The PCR variables were as follows:

95C for 15 seconds, 55C for 20 seconds, 72C for 20 seconds repeated for 50 cycles. Genomic DNA, no reverse transcribed RNA and no template controls were included in the runs. Relative gene expression data analysis was carried out with the standard curve method (115). The fluorescence data were expressed as normalized to a reference gene, Spinocerebellar ataxia 10 homolog (human)

Sca10, which was determined with the array data to be of invariant expression across treatment types.

Applied Biosystems Real-Time PCR system 7500 was used with the

Taqman gene expression assay to test fibroblast growth factor receptor 2 expression. In this assay each 25 µl reaction contained 1 µl of 1:10 diluted cDNA template, 12.5 µl of TaqMan Universal PCR Master Mix and 1.25 µl of Assays- on-Demand™ Gene Expression Assay Mix which contained forward and reverse primers and labeled probe. The default thermal cycling conditions for PCR were used as instructed by the manufacturer. Relative quantification values were

49 obtained by using the Applied Biosystems (Foster City, CA) software and the

Sca10 reference gene expression.

Table 1: Genes investigated with real-time PCR Gene name Primer sequence 5’-3’ Product length (bp) Cytochrome P450, family 4, subfamily b, Forward CTTTTTGGTCATGCCCTTGAGA 148 polypeptide 1 (Cyp4b1) Reverse CAGCTTTAGCATAGTCAGGCTC

NM_007823 Primer bank 6681123a2

Latent transforming growth factor beta binding Forward AACAGCACCAACCACTGTATC 159 protein 2 (Ltbp2) Reverse CCTGGCATTCTGAGGGTCAAA

NM_013589 Primer bank 7305243a1

Dipeptidase 1 (renal) (Dpep1) Forward TGTCAGCCACAGGACTGAAG 184

NM_007876 Reverse ATGATAGCCACTGCCTGGTC

Phosphatase and tensin homolog (Pten) Forward TGGATTCGACTTAGACTTGACCT 180

NM_008960 Primer bank 6679523a1 Reverse GCGGTGTCATAATGTCTCTCAG

Glyoxalase 1 (Glo1) Forward GATTTGGTCACATTGGGATTGC 110

NM_025374 Primer bank 31981282a1 Reverse TGATGACGGGAAAATGAAAGGA

Fibroblast growth factor receptor 2 (Fgfr2) Applied Biosystems Assay on Demand Exon NM_201601 ABI Mm00438941_m1 0 / Exon 1 junction

Spinocerebellar ataxia 10 homolog (human) Forward AAGCTAGTGGGTGAGGAGCA 155

(Sca10) NM_016843 Reverse AAGGAAGCCCTGGTTACGAT

50 Sequence Comparison

The markers flanking each of the identified putative loci were located in the Celera (Rockville, MD) mouse genome database (http://www.celera.com/,

CDS 13h release) and the number of genes (excluding pseudogenes) mapping to each region was determined. Using the DNA positions of the flanking markers, the Celera Mouse SNP reference database (v3.6) was queried for single nucleotide polymorphisms (SNPs) within each linkage region. These SNP data were then filtered to uncover the set of SNPs for which B6 and A/J mice have a different allele. These data were further filtered to exclude SNPs appearing in the intronic region or identified as synonymous, as has been used by others (95).

Results

Fibrosis phenotype of A/J and B6 mice

To enable the use of AcB/BcA recombinant congenic mice in mapping susceptibility to bleomycin–induced pulmonary fibrosis, the response of the A/J strain to the drug (delivered by osmotic minipumps), relative to the known response of B6 mice (111) was determined. Male and female A/J mice were treated with 100 and 125 units of bleomycin per kg respectively and groups of mice of each sex were sacrificed 3 or 6 weeks later. The A/J phenotype of the percent of the lung with fibrosis, as assessed with histology, was similar at 3 weeks and 6 weeks (0.53% at 3 weeks and 0.49% at 6 weeks p = 0.41) and did not differ by sex (p=0.13, data not shown). The amount of fibrosis in A/J mice was

51 lower than that reported for the B6 strain for comparisons to both the male (B6 fibrosis = 11.5% ± 5.5 stdev. p= 4.4x10-6) and female mice (B6 fibrosis = 7.8% ±

3.9, p value=3.0x10-6), as reported in Haston et al. (111).

Due to the risk of lethality from acute toxicity in response to bleomycin, which is not related to the development of fibrosis, we assayed the lung phenotype of B6 and A/J mice 3 weeks after delivery of a lower dose of bleomycin (80 units per kg for males, 100 for females). As the strain difference in fibrosis phenotype of B6 and A/J mice was evident at this dose in both male, (B6

= 5.7%  1.1 stdev. v. A/J = 0.12%  0.18; p=1x10-7) and female mice (B6= 4.7%

 1.9 v. A/J = 0.48%  0.56; p= 4.7x10-4), this lower dose was used in the mapping study.

AcB/BcA fibrosis phenotype

The first step of our strategy for identifying the genes involved in the fibrosis susceptibility of B6 mice, relative to the A/J strain, was to determine their map position. To accomplish this we treated a minimum of 3 male and 3 female mice of 19 AcB/BcA strains and 3 to 5 mice of an additional 14 recombinant congenic strains (RCS) with bleomycin and sacrificed the mice 3 weeks later.

Percent fibrosis of the lung, by histology, was used to phenotype for susceptibility/resistance and the resultant strain distribution pattern of the RCS mice is shown in Figure 10. As shown in this figure, mice of the BcA strains were generally more sensitive to the development of fibrosis than those of the

52 AcB strains. Two BcA strains (BcA 78 and 81) were highly susceptible to the development of pulmonary fibrosis. These strains had an average of 10 and 15 percent fibrotic lung tissue, which is 1.8 and 2.7 times the B6 susceptible phenotype at this dose. In addition, BcA strains 68, 69, 73, 74, 84, 85 and 79

(females only) had significantly lower levels of fibrosis compared to B6 mice

(<1% fibrosis, all p < 8.6 x 10-3).

As expected from their A/J background, 9 of 12 AcB strains were of a fibrosis-resistant phenotype like the A/J, and the other 3 AcB strains showed intermediate susceptibility (percent fibrosis significantly higher than that of A/J mice and significantly lower than that of B6, all p<0.03) (see Figure 10).

53 54 Figure 10: Strain distribution pattern of the bleomycin-induced pulmonary fibrosis response of recombinant congenic mice.

Average percent fibrosis ( standard error), measured from histological lung sections of mice, three weeks after a dose of 80 units bleomycin/kg (males) or

100 units (females), is given. The number of phenotyped mice of each strain is indicated below the strain names. Six strains demonstrated a sex-specific response and the data are presented separately, indicated by “m” or “f”.

Mapping of pulmonary fibrosis susceptibility

Using percent fibrosis as a quantitative phenotypic trait and the genotypic data of all 33 phenotyped AcB and BcA strains combined, 2 linkage regions were detected through linear regression analysis with MapManager QTX software (73)

(see Table 2). The identified linkages (on chromosomes 3 and 6) have suggestive

LOD scores (104) and they are also suggestively linked to the phenotype according to the permutation test in MapManager QTX. When regression was performed using the dataset from male mice only (n=27 strains with 3 or more phenotyped male mice), suggestive regions on chromosomes 1, 5, 9 and 12 were detected in addition to the regions on chromosomes 3 and 6. No regions suggested to be linked to the fibrosis phenotype were evident with the data from the female mice (23 strains with 3 or more phenotyped male mice) alone. The difference in linkage results between the sexes is likely attributable to the lower number of phenotyped recombinant congenic female mice compared to males and to greater range of phenotype in male mice. At each of these putative loci the presence of

B6 alleles increased the fibrotic phenotype of RCS mice, as shown in Table 2.

55 Table 2: Putative linkage regions : effect of the genotype on bleomycin- induced pulmonary fibrosis phenotype of RCS mice

33 RCS strains % Fibrosis %Fibrosis Size Marker* LOD score A:A B6:B6 (Mb) Base pair position Dataset genotype† genotype†

D1Mit374 2.23 0.7 5.1 13.9 29912836-43772560 Fibrosis males

D3Mit335 2.26 1.5 5.4 29.8 28343624-57128175 Fibrosis males

D3Mit335 2.36 1.1 4.3 29.8 28343624-57128175 Fibrosis both‡

D5Mit31 1.97 0.6 4.7 9.4 129715761-139130948 Fibrosis males

D6Mit290 2.39 0.8 5.1 12.7 134038410-146754140 Fibrosis males

D6Mit290 2.3 0.8 4.1 12.7 134038410-146754140 Fibrosis both

D9Mit4 2.21 0.7 4.9 8.4 52287988- 60703711 Fibrosis males

D12Mit133 2.00 0.8 4.8 19.9 95212391-115071072 Fibrosis males

21 BcA strains % Fibrosis %Fibrosis Size Marker LOD score A:A B6:B6 (Mb) Base pair position Dataset genotype genotype

D9Mit236 3.34 15.1 3.0 11.8 80494716-92311831 Fibrosis both

D9Mit236 4.92 17.4 2.7 11.8 80494716-92311831brosis females BcAFi

D15Mit108 3.51 11.0 2.2 26.9 77236381-104138553brosis females BcAFi

D15Mit170 2.0 8.0 2.3 26.9 77236381-104138553 Fibrosis both BcA

D15Mit170 3.05 11.0 3.0 26.9 77236381-104138553Fibrosis males BcA

D18Mit183 3.45 9.9 2.5 33.1 36497577-69558597 Fibrosis both BcA

D18Mit183 3.51 10.4 2.2 33.1 36497577-69558597 Fibrosis females BcA

*=peak marker of the linkage interval, †=average fibrosis of mice that have

A:A or B:B genotype at this marker, ‡=Both includes males and females

56 When the 21 BcA strains were analyzed separately, QTL were identified on chromosomes 9, 15 and 18 (LOD scores between 2.0 and 4.9), see Table 2. At each of these putative loci the presence of A/J alleles increased the fibrotic phenotype of RCS mice, as shown in Table 2. This may indicate that A/J loci could combine with the B6 loci to increase the pulmonary fibrosis to a level exceeding the parental fibrosis levels. No loci were found through analysis of the

AcB strains separately, which is likely due to the smaller range of the phenotype in these strains. The percent of the phenotype explained by each of the loci was between 35 and 72 % based on regression analysis in MapManager QTX. As this was calculated from the differences between 2 homozygous populations, at each marker, the phenotypic variance results are of limited usefulness.

Candidate Gene Identification

To propose candidate fibrosis susceptibility genes, we isolated, from among the mapped positional candidates (identified by a composite of Ensembl and Celera), the subset of genes which were differentially expressed between B6 and A/J mice in the bleomycin treated lung, and for which there is a sequence variation between the strains.

Gene Expression Studies

It was hypothesized that the genes producing the difference in response to bleomycin between B6 and A/J mice would be differentially expressed in the lungs of these mice following the drug treatment. To identify such genes

57 expression studies were performed using Affymetrix GeneChip microarrays. The lung response of A/J mice to the drug was ascertained by comparing the gene expression profile of bleomycin treated mice to that untreated controls, and subsequently this dataset was compared to that of B6 mice (111) to identify strain differences in response.

The A/J response to bleomycin was measured with 6 arrays, each of which represents the response of a group of treated mice, as described in the materials and methods, compared to 2 arrays of gene expression in lung tissue from untreated mice. Nine genes were identified to be differentially expressed (fold  2 p<0.01, with a maximum fold change=5.8, p value=0.0003) between A/J control and A/J bleomycin treated, see Table 3. This limited change in gene expression reflects the minimal histological response of A/J mice to bleomycin which was consistent across the groups of A/J mice evaluated. In support of this finding, we analyzed the data taken from NCBI entry GEO GDS350 of the pulmonary response to bleomycin of A/J mice and we detected no differentially expressed genes for the bleomycin to control comparison (all genes p0.14). In contrast to the minimal bleomycin response of A/J mice, the B6 gene expression profile, as reported in Haston, et al. (111), has 1768 genes or expressed sequence tags measured to be differentially expressed between controls and bleomycin treated mice.

58 Table 3: Significantly differently expressed genes in the lungs of bleomycin- treated A/J mice relative to non treated A/J mice

Fold treated/ Symbol Name control P value UniGene ID Gpnmb glycoprotein (transmembrane) nmb 2.7 0.00035 Mm.23567 Cdkn1a cyclin-dependent kinase inhibitor 1A (P21) 3.1 0.00035 Mm.195663 Igh-4 immunoglobulin heavy chain 4 (serum IgG1) 4.7 0.00035 Mm.246497 S100a9 S100 calcium binding protein A9 (calgranulin B) 5.8 0.00035 Mm.2128 S100a8 S100 calcium binding protein A8 (calgranulin A) 5.5 0.00035 Mm.21567 Gp49b glycoprotein 49 B 2.3 0.00098 Mm.34408 Csf3r colony stimulating factor 3 receptor (granulocyte) 2.1 0.00098 Mm.271701 Ctsk cathepsin K 2.2 0.0040 Mm.3109 Spp1 secreted phosphoprotein 1 2.4 0.0040 Mm.288474

Next, we compared the gene expression profile of A/J mice to that of B6

mice to identify strain differences in lung gene expression for both untreated

control mice (2 B6 arrays compared to 2 A/J arrays) and in response to bleomycin

(5 B6 arrays compared to 6 A/J arrays). 357 genes were differentially expressed

(p<0.01) in the lungs of untreated A/J mice compared to B6 control mice, while

2555 genes and 749 expressed sequence tags were differentially expressed

between the strains following bleomycin treatment (p<0.01). A majority (90%) of

the genes of altered expression in the controls were also present in the treated

comparison and 55% of the differentially expressed genes were more highly

expressed in lungs of A/J mice. To assess the validity of the microarray data, six

genes were chosen from the list of B6:A/J differentially expressed genes and were

submitted for RT-PCR analysis. As shown in Figure 11, the expression levels

measured with RT-PCR were found to be similar to the microarray results.

59

Figure 11: Comparison of microarray gene expression data with Real-Time PCR evaluation of selected genes.

Fold change ( standard error) in lung expression of untreated control A/J mice relative to B6 (hatched bars) and for bleomycin-treated mice (solid bars).

The 3304 genes or expressed sequence tags identified to be differentially expressed in lung tissue between B6 and A/J bleomycin-treated mice are given in supplementary Table 1. To present the cellular processes represented in this set of genes GOStats from Bioconductor (112) was used to compare the gene ontology distribution of these genes with that of all probes present on the microarray chip.

By this analysis the genes differentially expressed in the lungs between bleomycin treated A/J and B6 mice are related to heparin binding (p=2.7 x 10-7), glutathione transferase activity (p=1.6 x 10-6) and extracellular matrix structural constituents

(p=1.3 x 10-4). The heparin binding category includes genes such as fibronectin 1,

60 tenascin XB, fibroblast growth factor 1 and thrombospondin 1. The glutathione transferase activity category includes glutathione-S-transferases and the extracellular matrix structural constituents were mainly procollagens and laminin.

The map positions of the genes measured to be differentially expressed in the lungs of bleomycin-treated B6 mice compared to A/J mice were reviewed to isolate genes located in the putative linkage regions. A total of 246 linkage interval genes were identified to be differentially expressed (p0.01) and the subset of 18 of these genes, with fold changes in expression 2, is shown in Table

4. These genes are considered to be expression and positional candidates for the genetic basis of bleomycin-induced pulmonary fibrosis in this model.

Sequence Variation

It was hypothesized that the gene (or the regulatory region of the gene) producing the difference in response to bleomycin between B6 and A/J mice would be polymorphic between these two strains. Thus, we documented the sequence variation between these strains for the putative linkage regions. These data were generated through use of the Celera Discovery System and Celera's associated databases. Among the 1899 genes located in the loci, 809 had B6:A/J polymorphisms in their coding sequences or untranslated regions. In the 809 genes containing single nucleotide polymorphisms (SNPs), 68 genes were also differentially expressed (p≤0.01) and are thus positional, expression and sequence based candidate genes for the B6 vs. A/J difference in susceptibility to bleomycin-

61 induced pulmonary fibrosis. Five of the linkage region genes with expression fold

change ≥2 have SNPs, see Table 4.

Table 4: A/J:B6 differentially expressed genes of the linkage regions 33 strains Chromosome 1 Sequence Symbol Name AJ/B6† P value UniGene ID Variation 1200011D03Rik RIKEN cDNA 1200011D03 gene 2.9 1.2 x 10-6 Mm.20108 Aox1 aldehyde oxidase 1 2.0 2.6 X 10-6 Mm.26787 Col3a1* procollagen, type III, alpha 1 0.38 7.6 X 10-7 Mm.249555 UTR 3‡ UTR 3 Col5a2 procollagen, type V, alpha 2 0.27 1.1 X 10-7 Mm.10299 Mis-sense

Chromosome 5 Cldn4 claudin 4 0.47 2.3 X 10-5 Mm.7339 Eln elastin 0.25 7.2 X 10-6 Mm.275320 serine (or cysteine) proteinase inhibitor, clade Serpine1 E, member 1 0.42 1.0 X 10-6 Mm.250422

Chromosome 6 UTR 3 Hebp1 heme binding protein 1 2.1 2.5x10-6 Mm.247996 Mis-sense

Chromosome 12 Ckb creatine kinase, brain 0.43 1.2 X 10-7 Mm.16831 Igh-1 immunoglobulin heavy chain 1 (serum IgG2a) 2.1 1.1 X 10-5 Mm.144308 Igh-4 immunoglobulin heavy chain 4 (serum IgG1) 4.4 1.3 X 10-7 Mm.246497 Igh-VJ558 immunoglobulin heavy chain (J558 family) 2.9 4.2 X 10-4 Mm.240437 Wars tryptophanyl-tRNA synthetase 0.31 1.33 X 10-9 Mm.38433

BcA strains Chromosome 18 Lox lysyl oxidase 0.27 3.20 X 10-6 Mm.172 UTR 3 Iigp1 interferon inducible GTPase I 0.47 3.83 X 10-5 Mm.261140

Chromosome 15 Itga5 integrin alpha 5 (fibronectin receptor alpha) 0.5 7.36 X 10-5 Mm.16234 Irak4 interleukin-1 receptor-associated kinase 4 0.47 7.19 X 10-8 Mm.279655 UTR 3 BC031593 cDNA sequence BC031593 4.8 1.68 X 10-9 Mm.162744

* The gene symbols in bold indicate a similar fold change in expression between untreated control A/J and B6 mice. † Fold change of bleomycin-treated A/J relative to bleomycin-treated B6 mice ‡UTR=Untranslated region

62 Discussion

A combination of mapping, gene expression and DNA sequence analysis was used to identify specific candidate genes of susceptibility to bleomycin- induced pulmonary fibrosis in an A/J:B6 mouse cross. The candidate genes are of extracellular matrix deposition and immune response pathways and may represent new players in the complex pathology of pulmonary fibrosis.

Using the osmotic minipump delivery method, we showed the mice of the

A/J strain to have a minimal fibrotic response to bleomycin, in contrast to the inflammation and fibrosis which develops in B6 mice (60,100). This mode of bleomycin delivery, developed by Harrison and Lazo (46), and used by us (67) was selected as it has been found to produce a fibrotic phenotype which more closely resembles idiopathic pulmonary fibrosis than the more commonly used experimental method of intratracheal drug delivery (116). The response of the A/J strain to the drug agrees with the findings of Rossi, et al. (100), in which bleomycin was delivered intraperitoneally to mice over four weeks, and fibrosis did not result but differs from the report of Chen, et al. (117) in which an intratracheal drug delivery system was used.

With the confirmed strain difference in bleomycin-induced fibrosis susceptibility, recombinant congenic mice were used to map nine loci of the phenotype. Two of the putative linkage regions, on chromosomes 6 and 18, overlap with previously defined QTL of susceptibility to radiation-induced

63 pulmonary fibrosis (62) and the locus on chromosome 6 may coincide with a QTL of bleomycin-induced pulmonary fibrosis which has been reported to be on this chromosome (68). The commonality of the loci supports their existence but as the present linkage regions were mapped in a limited number of recombinant congenic strains, confirmatory studies are required. If confirmed, the implication of the same linkage regions in susceptibility to both radiation-induced and bleomycin-induced pulmonary fibrosis may indicate that the phenotype causative genes underlying these loci are not specific to the damaging agent used, but are related to the development of fibrosis. In addition, the putative fibrosis linkage region indicated by the marker D3Mit335 overlaps a butylated hydroxytoluene

(BHT)-induced inflammation (lymphocytes) QTL (118) which may indicate this to be a common lung response locus. The linkage regions of bleomycin-induced pulmonary fibrosis susceptibility detected in a B6 x C3Hf/KAM cross did not meet the criterion for suggestive linkage with the present data set, the LOD score of Blmpf1 was 1.7 and Blmpf2 was 1.5.

Our second genomic approach for identifying fibrosis susceptibility genes was to measure the gene expression profile of A/J mouse lungs following drug treatment and to compare it to that documented for B6 mice. The B6 gene expression data, reported in Haston et al. (111) and used for comparison in the present investigation, agree with those reported in previous studies of this strain

(93,94) and include the representation of 41 bleomycin-induced differentially expressed B6 genes in a gene cluster (n=66 genes) defined by Kaminski et al. (93)

64 for fibrosis development. The A/J response to bleomycin, measured by pulmonary gene expression of phenotypically similar groups, also agreed with a separate report for this strain (NCBI GEO). The comparison of the gene expression profile of A/J and B6 mice revealed thousands of genes to be differentially expressed by strain, further indicating the complexity of the fibrosis phenotype.

By combining the genomics approaches of linkage and gene expression

(as in (95)) fibrosis-causative candidate genes for the B6:A/J model were proposed. The identified genes are considered candidates as the causal variation leading to the development of bleomycin-induced pulmonary fibrosis with the assumption that the fibrosis-causative gene is differentially expressed in the bleomycin treated lung. Differential expression is not a necessary condition for implication as causal variation but was used to rank the set of positional candidate genes to facilitate further investigation. From this analysis the possible pathways to fibrosis in the A/J:B6 model include differences in immune system mediators and in extracellular matrix homeostasis. Specifically, gene candidates from the linkage regions which showed an increase in expression in the lungs of A/J mice compared to B6 mice are involved in immune defence, such as the immunoglobulin heavy chains 1 & 4, and the J558 family while genes such as procollagen 3α1 and 5α2 and elastin, which are linked to the collagen deposition and turnover, were of relatively increased expression in the lungs of B6 mice.

Secondly, from the analysis of the 21 BcA strains we were able to detect loci where alleles from the resistant A/J strain increased the fibrotic phenotype of BcA

65 mice, which likely indicates an interaction among loci influences the development of fibrosis. As an example of such an interaction, fibroblast growth factor 1

(Fgf1), which maps to a locus where A/J alleles increase the phenotype, showed an increase in expression in the lungs of A/J mice relative to B6 and it could interact with fibroblast growth factor receptor 1 (Fgfr1) which was shown to be increased in B6 mice, to produce increased levels of pulmonary fibrosis in certain

BcA strains.

We also assessed the positional candidate genes for DNA sequence variation and, as with gene expression, the functional effect of any sequence variation would have to be confirmed but the existence of a coding or regulatory

SNP is potential supporting evidence for causal variation. The Celera database was used as the source of SNPs as it is the most complete documentation of the

A/J strain at present, although it may not be a comprehensive review of all B6:A/J sequence variation. With this analysis a finite set of sequence variation in the candidate genes of Table 4 was uncovered for further testing. Included in this list are the physiological candidate genes lysyl oxidase and interleukin-1 receptor- associated kinase 4. Lysyl oxidase is involved in the cross-linking of collagen and the persistent expression of the gene has been implicated in irreversible fibrosis in bronchiolitis obliterans (119), while interleukin 1 receptor expression has been shown to increase with the development of fibrosis in B6 mice (120).

66 In summary a combination of genomic approaches was used to identify candidate genes for susceptibility to bleomycin-induced pulmonary fibrosis in a

B6:A/J mouse cross. 33 recombinant congenic mouse strains were used to define

6 intervals, which range in size between 9.4 and 29.8 Mb, linked to the trait.

Three more putative loci were defined using 21 BcA strains only and these contain alleles where the A/J genotype increases the fibrosis phenotype. In addition, gene expression studies identified a set of differentially expressed genes mapping to these 9 intervals and a review of SNP data permitted the identification of parental strain gene sequence variations.

The phenotypic trait mapped, susceptibility to bleomycin-induced pulmonary fibrosis, is clinically significant as this lung response limits the dose of bleomycin which can be safely administered and as the induced injury may be a model for the more prevalent condition of idiopathic pulmonary fibrosis. The specific genetic variants reported, if confirmed to influence drug-induced pulmonary fibrosis, would provide insight on the development of this pathology.

Grants

This work was supported by funding from the Canadian Institutes of

Health Research and Fonds de la Recherche en Santé Québec.

67 Chapter transition

Presented in chapter 2, we have identified genetic loci involved in the development of bleomycin-induced pulmonary fibrosis in recombinant congenic

AcB/BcA mice. As the histological appearance of pulmonary fibrosis induced by bleomycin and radiation-induced shows similarities and as certain loci of the fibrotic response were common to radiation and bleomycin in B6xC3H mice, we decided to examine the susceptibility of the same strains of mice to radiation- induced pulmonary fibrosis. The aim of this experiment was to compare the responses of the same strains of mice under two different treatments to determine if a common set of genes would be involved in both responses. This comparison could also help to differentiate between the drug or radiation effects and the fibrogenesis process.

If the RCS strains have a disparate response to both treatments, this could allow the identification of new loci involved in the development of radiation- induced PF for future investigation.

68

CHAPTER 3

Radiation-induced lung response of AcB/BcA

recombinant congenic mice

A-M Lemay et CK. Haston, Radiation-induced lung response of AcB/BcA

recombinant congenic mice, Radiation Research, 170, 299–306 (2008)

Used with permission

69 Abstract

The genetic factors which influence the development of radiotherapy- induced lung disease are largely unknown. Herein we identified a strain difference in lung response to radiation wherein A/J mice developed alveolitis with increased levels of pulmonary mast cells and cells in bronchoalveolar lavage while the phenotype in C57BL/6J mice was fibrosis with fewer inflammatory cells. To identify genomic loci which may influence these phenotypes we assessed recombinant congenic (RC) mice derived from the A/J and C57BL/6J strains for their propensity to develop alveolitis or fibrosis with exposure to 18 Gy whole thorax irradiation. Mouse survival, lung histopathology and bronchoalveolar lavage cell types were recorded. Informative strains for each of mast cell influx, bronchoalveolar cell numbers, alveolitis and fibrosis were identified. In mice with the A/J strain background alveolitis severity correlated with increased mast cell numbers while in C57BL/6J background strain mice fibrosis was correlated with neutrophil% in lavage. The data in RC mice support the association of specific inflammatory cells with the development of radiation-induced lung disease and provide informative strains with which to dissect the genetic basis of these complex traits.

Keywords: fibrosis, alveolitis, mouse model, genetic susceptibility, radiotherapy

70 Introduction

Use of the common cancer treatment modality of thoracic cavity radiotherapy is limited by the development of alveolitis or fibrosing alveolitis in up to 30% of patients (121). This response to treatment is thought to be influenced, in part, by genetic factors (122,123) but the genetic basis of these complex traits has not been identified. The phenotype of fibrosing alveolitis

(fibrosis) occurs through pathways involving excess extracellular matrix deposition in tissue repair and alveolitis is an inflammatory response associated with alveolar airspace cell infiltration and with thickening of the alveolar walls

(124). This clinical radiation response phenotype is reflected in mice as similarities in tissue histology (99,121), lavage characteristics (125) and time course to presentation of disease (121) have been reported. In particular, inbred strains of mice, such as C3H and A/J, have been shown to develop alveolitis and others such as C57BL/6J (B6) to develop fibrosis, in response to thoracic irradiation (61).

Towards uncovering the genetic basis of pulmonary radiation response two cohorts of genetically mixed mice derived from the B6 and C3H strains have been studied. In the first investigation three loci of propensity to develop fibrosis after radiation, named Radpf1-3, were revealed (62) and in a separate study we mapped loci of susceptibility to radiation-induced alveolitis and fibrosis in backcross mice (126). In the latter work the genetic factors influencing each of these phenotypes were shown to be distinct and to interact to produce a response

71 of either alveolitis or fibrosing alveolitis in the lung, or to spare the mice the development of radiation-induced lung disease. Separate loci of the alveolitis response were mapped in 75% C3H backcross mice, from those in 75% B6 backcross mice, therefore it is inferred that different genetic combinations can lead to alveolitis in mice. For the elucidation of the genetic basis of a complex trait, such as alveolitis, the addition of data from a cross involving a third mouse strain is beneficial (78) as the data will either (a) overlap with previously defined linkage intervals which supports their existence and provides a tool for their investigation or (b) provide novel loci of genetic variation contributing to the trait.

To further investigate the complex phenotype of lung response to irradiation, herein we phenotyped mice of a panel of recombinant congenic (RC) strains. RC mouse strains, from the progenitor strains A/J and B6, contain, on average, a random 13% of B6 genes in the A/J strain background (named AcB), or 13% A/J genes in the B6 background (named BcA). With this resource the B6 alleles involved in the susceptibility to pulmonary fibrosis are potentially divided among strains of mice, enabling the assessment of the effect of discrete B6 genomic regions on the phenotype. An evaluation of the lung response phenotype in mice of an RC panel may also uncover specific informative strains which are

RC strains that differ in phenotype from their background strain. For example, a mouse strain that is 13% B6 genes in the A/J strain background, which is shown to develop significant fibrosis, (a B6 but not A/J trait), is presumed to carry fibrosis-susceptibility alleles within the 13% B6 portion of its genome. Since

72 these RC mice have been extensively genotyped, (625 informative markers, an average of one marker every 2.6 cM (72)); the B6 genomic portion of any strain is already known. Evaluations of recombinant mice have been used to uncover informative strains for asthma (127), to map loci of lung inflammation induced by butylated hydroxytoluene (118) and ozone (128) and to map genetic factors of bleomycin-induced pulmonary fibrosis (129). In this investigation we phenotyped a panel of RC mice, derived from B6 and A/J strains, to identify informative strains and potential genomic regions influencing susceptibility to radiation- induced pulmonary alveolitis and fibrosis in this cross.

Materials and Methods

Mice

Mice of the AcB/BcA strains were purchased from Emerillon Therapeutics

Inc. (Montreal, Canada) and mice of inbred (C57BL/6J, A/J) strains were purchased from the Jackson Laboratory (Bar Harbor, ME). All mice were housed in the animal facility of the Meakins-Christie Laboratories. The AcB and BcA series of RC mice were generated and maintained at the Montreal General

Hospital Research Institute, according to a breeding scheme and a genotyping protocol previously described (72). Male and female mice of 8 to 14 weeks of age were used for the study. 137 AcB/BcA RC mice from 27 strains were phenotyped. All mice were handled according to guidelines and regulations of the

Canadian Council on Animal Care.

73 Radiation treatment

Lung damage was elicited by whole thorax radiation exposure (18 Gy;

42.3 Gy/hr) using a Gamma cell Cesium-137 unit as previously described (130).

In prior studies (9, 16) we showed 18 Gy to induce respiratory distress in all B6 mice by 26 weeks post treatment and thus this radiation dose was chosen as likely to produce a lung response (alveolitis or fibrosis) in the RC mice. The 18 Gy dose to produce the effect is higher than that used in other investigations due to lower dose rate of the unit (131). During treatment, the rest of the body was shielded with 3 cm of lead, to reduce the beam strength to 3% in this area. The irradiated mice were sacrificed when moribund, or at 26 weeks after treatment. The mice were weighed weekly from six weeks after radiation and mice losing > 20% body weight, and exhibiting distress through ruffled fur, accelerated breathing and hunched posture, were sacrificed as in previous studies (126,130).

Histology

At necropsy, bronchoalveolar lavage was performed on 95 mice, by cannulating the trachea and retrieving cells from three 1-mL injections of phosphate buffered saline. The lungs were then removed and the single left lobe of each mouse was perfused with 10% neutral buffered formalin and submitted for histological processing. Lung sections were stained with Masson's Trichrome and the area of fibrosis in the left lung lobe was determined from a user drawn region surrounding the fibrosis (Image Pro Plus Software) compared to the area of the entire lobe to yield the percent of pulmonary fibrosis for individual mice

74 (126,129). To assess alveolitis, hematoxylin and eosin (H&E) stained left lung sections were evaluated through semi-quantitative histology (126). Alveolitis was scored subjectively on a scale of 0-6; 0 being no alveolitis, 1= one or two foci of alveolar inflammatory cells, 2= several foci of alveolar inflammatory cells with thicker alveolar walls, 3= more than half the lung with alveolar inflammatory cells with thicker alveolar walls; 4= these traits in more than 75% of the lung, 5= involvement of more than 90% of the lung and 6 being extreme alveolitis

(characterized by excessive thickening of the alveolar walls with cellular infiltrate and exudates present in the alveolar space of the entire lung section). Mast cell numbers were determined by counting the mast cells present in 10 fields of a lung histological section stained with Toluidine blue, at a 200x magnification. All scoring was completed by a user blinded to mouse strain and treatment.

Bronchoalveolar Lavage Fluid (BAL) Analysis

The BAL fluid was centrifuged (302g for 10 minutes @ 4ºC) and the supernatant was removed and stored at -85ºC. The cellular pellet was re- suspended in 0.25mL phosphate buffered saline (PBS). Inflammatory cell counts were performed (400x magnification) on cytocentrifuged cells (214.2g for three minutes), after staining with a hematoxylin-eosin kit (Hema-3 Stain Set by

Protocol). The amount of each cell type was determined in cells/mL by multiplying the total number of cells/mL in the BAL fluid (counted using a hematocytometer) by the percentage of macrophages, lymphocytes and neutrophils counted.

75 Data analysis

Differences in lung phenotype between groups of mice were assessed with

Student’s t-test. The phenotypes of mice of each BcA strain were compared to that of B6 mice and of AcB strains to A/J mice, for identification of informative strains (strains whose phenotype deviates from that of the 87% background strain) using the Mann-Whitney U test as in (127). Correlations among the lung response phenotypes were calculated using Microsoft Excel software and were assessed for significance using two-tailed paired Student’s t tests in the R statistical package.

Results

Parental Strain radiation-induced lung phenotype

To enable the assessment of existing B6 x A/J recombinant congenic mice for genetic contributions to alveolitis and fibrosis we initially phenotyped mice of the B6 and A/J strains for their responses to thoracic irradiation. As shown in

Figure 12 mice of each of the parental strains developed respiratory distress at the same time post treatment and histological phenotyping revealed the B6 response to be fibrosing alveolitis, as in previous studies (7,8,9,16) and the A/J response was alveolitis with significantly less fibrosis as in (7). Further phenotyping of the radiation-induced inflammatory response showed additional differences between the parental strains as the A/J response to thoracic irradiation included a mast cell influx which exceeded that of B6 mice (p=0.001) as shown in Figure 13A, and higher cell counts in lavage (p=0.04, Figure 13B). The inbred strains did not significantly differ (p>0.3) in cell types within the lavage, as illustrated in Figure

76 13C. To identify informative strains for each of these traits the radiation response of a panel of RC mice was determined.

AcB/BcA radiation-induced lung phenotype

The majority of the RC mice were sacrificed due to respiratory distress and had developed alveolitis in response to whole thoracic irradiation while mice of 8 strains lived to the end of the experiment, as shown in Figure 12. For most of the strains all mice within that strain were either euthanized when moribund or lived to the end of the experiment. An exception was strain AcB54 where 4/5 mice lived to the end of the experiment and one mouse was euthanized due to distress symptoms at 23.4 weeks. The alveolitis score of this mouse was 3 and lavage data was not obtained. In addition, for strain BcA76 3/4 mice lived to the end of the experiment and one mouse was euthanized due to distress symptoms at

20.7 weeks. The alveolitis score of this mouse was 2.5 and lavage data showed a cell count of 16 x104 cells/ mL. Strains AcB54 and BcA76 were classified as survivors. Mice of strain BcA77, in contrast, were in distress at the end of the experiment (181 ± 0.8 days) and were therefore classified as non survivors. For each of the BcA and AcB background groups mice euthanized in distress had higher alveolitis scores (p = 0.03 for BcA, p=0.001 for AcB) compared to mice sacrificed at the end of the experiment. Percent fibrosis of the lung, by histology, was used to phenotype for susceptibility/resistance to fibrosing alveolitis and as shown in Figure 12C, four strains of susceptible BcA mice were identified as each had a fibrosis score which was not different (p>0.76) from the B6 phenotype of

4.8%.

77

Figure 12. Radiation-induced lung phenotype of inbred and recombinant congenic AcB/BcA mice.

Mice of each strain were exposed to 18 Gy whole thorax irradiation and euthanized when moribund or at 26 weeks post treatment. (a) time post treatment to develop respiratory distress. Phenotypes are presented as the mean ± std. dev. and the number of mice per strain is indicated below the strain name. The AcB and BcA strains are organised by their propensity to develop lung disease or to survive until the end of the experiment. Parental strain phenotypes are presented at the right of the figure; * indicates significant difference between the inbred strains, p<0.05.

78

Figure 12b. Radiation-induced lung phenotype of inbred and recombinant congenic AcB/BcA mice. Alveolitis score derived from semi quantitative evaluation of histological sections

79

Figure 12c. Radiation-induced lung phenotype of inbred and recombinant congenic AcB/BcA mice. % fibrotic lung tissue in Trichrome stained histological sections. For strain BcA78 one of three mice developed fibrosis with a score of

24.8%.

80

Inflammatory cell type phenotyping revealed that the lungs of AcB mice, which were sacrificed due to the severity of their symptoms, contained more mast cells than those of mice euthanized at the end of the experiment (p=4.6 x 10-3), while in BcA mice the mast cell phenotype did non differ (p=0.18) between distressed and non distressed mice, which is consistent with the parental response phenotypes, and is shown in Figures 12 and 13A. The moribund AcB mice, further, developed a mast cell infiltration which exceeded that measured in moribund BcA mice (p=1.0 x 10-12, Fig. 13A) while the time to develop respiratory distress, average alveolitis score and differential cell types in lavage did not differ in moribund mice of AcB compared to BcA strains (see Figs12,

13B). Bronchoalveolar lavage cell numbers were significantly greater in moribund mice than in mice surviving to the end of the experiment (27.6 x104 vs.

5.7 x104 cells/mL, p=5.4 x10-5) and did not differ between moribund mice of the

AcB compared to BcA backgrounds, as shown in Figure 13B. The percentage of lavage neutrophils was higher in moribund mice than survivors, (p=0.036) for mice of the BcA strains which is shown in Fig. 13C, but the neutrophil counts were not different between these groups in AcB mice (p=0.76).

81

Figure 13. Radiation-induced lung inflammatory phenotype of inbred and recombinant congenic AcB/BcA mice.

Mice of each strain were exposed to 18 Gy whole thorax irradiation and euthanized when moribund or at 26 weeks post treatment. (a) mast cell count in

Toluidine blue stained left lung sections. Phenotypes are presented as the mean

± std. dev. and the number of mice per strain is indicated below the strain name.

Parental strain phenotypes are presented at the right of the figure; * indicates significant difference between the inbred strains, p<0.05.

82

Figure 13b. Radiation-induced lung inflammatory phenotype of inbred and recombinant congenic AcB/BcA mice. Cells per mL of lavage, number x 104

83

Figure 13c. Radiation-induced lung inflammatory phenotype of inbred and recombinant congenic AcB/BcA mice. % of each cell type measured in the bronchoalveolar lavage; Lymph = lymphocyte, PMN = polymorphonuclear cell, Mphages = macrophages.

To determine how each of the inflammatory measures (BAL cell differential and mast cell counts) is related to the development of each of alveolitis and fibrosis, correlation coefficients were calculated. As shown in

Figure 14, alveolitis was correlated with increased numbers of mast cells in AcB mice, and the amount of lung fibrosis increased with lavage neutrophils, in BcA mice.

84

Figure 14. Correlations between lung response phenotypes in recombinant congenic AcB/BcA mice.

Mice were exposed to 18 Gy whole thorax irradiation and euthanized when moribund or at 26 weeks post treatment. Alveolitis, fibrosing alveolitis and mast cell number were evaluated histologically and cellular influx was assessed by bronchoalveolar lavage cell typing. A) Correlations of alveolitis score to mast cell number for each of AcB and BcA mice.

85

Figure 14b. Correlations between lung response phenotypes in recombinant congenic AcB/BcA mice. Mice were exposed to 18 Gy whole thorax irradiation and euthanized when moribund or at 26 weeks post treatment. Alveolitis, fibrosing alveolitis and mast cell number were evaluated histologically and cellular influx was assessed by bronchoalveolar lavage cell typing. Correlations of fibrosis score to PMN (=neutrophil) % in lavage are given for each of AcB and

BcA mice.

86

RC strains informative for the radiation-induced lung response

To identify genomic regions of the alveolitis response in BcA mice we first isolated the genetic markers where the A/J donor region was inherited by at least three strains of mice succumbing to alveolitis or three strains of mice surviving to the end of the experiment (see Fig. 12). We selected the three strain criterion as a minimal number of strains to define a phenotype for statistical assessment at a particular genotype. Donor regions shared among three RC strains are expected to encompass 0.195% of the genome (=0.125^3; where 0.125 is the average donor fraction of any one RC strain). Of these markers, those where the alveolitis phenotype of mice with the B6:B6 genotype significantly differs from that of mice with the AJ:AJ genotype are listed in Table 5. As shown in the table two regions of the genome, on chromosomes 11 & 19, where A/J alleles increased the alveolitis response in BcA mice, were identified.

87 Table 5: Effect of the genotype on radiation-induced lung disease phenotype of BcA mice

Peak Marker Genotype Survival Alveolitis Fibrosis Mast cells PMN (% Total cell time Score (% of lung) cells in number (weeks) lavage) (lavage x105) D3Mit239- B6:B6 20.6 ± 5.9 3.8 ± 0.7 3.5 ± 2.8 13.9 ± 17.0 3.5 ± 1.9 6.3 ± 5.4 D3Mit21 AJ:AJ 23.3 ± 4.1 3.9 ± 0.3 0.6 ± 0.5 12.5 ± 8.4 2.5 ± 0.6 3.3 ± 1.7

p value*a 0.44 0.81 0.03 0.87 0.41 0.37 D4Mit110- B6:B6 21.5 ± 6.2 3.6 ± 1.0 3.3 ± 2.9 13.6 ± 17.5 3.2 ± 1.7 5.5 ± 5.1 D4Mit111 AJ:AJ 22.5 ± 3.6 3.7 ± 0.4 0.7 ± 0.5 9.8 ± 7.5 ND ND

p value*a 0.45 0. 62 0.03 0.61 ND ND D11Mit67 B6:B6 22.8± 4.8 3.1± 0.8 1.6 ± 2.4 7.6 ± 7.0 1.9± 1.3 3.5± 4.4 AJ:AJ 23.3± 1.8 4.3± 0.4 1.7 ± 1.4 23.5 ± 23.7 3.1± 2.4 3.3± 2.2 p value* 0.75 0.005 0.91 0.36 0.51 0.92 D19Mit10 B6:B6 22.7± 4.9 3.1± 0.8 1.3 ± 2.3 6.2 ± 5.6 1.5± 1.1 3.0± 1.2 AJ:AJ 23.3± 2.4 3.9± 0.5 2.7 ± 2.1 24.4 ± 18.3 4.0± 1.6 4.6± 1.1 p value* 0.75 0.06 0.28 0.14 0.10 0.37

*p value of the comparison of the phenotype of mice with the A.J/A.J genotype to

that of mice with the B6/B6 genotype at the indicated marker. Mice were treated

with 18 Gy whole thorax irradiation and euthanized due to presentation of distress

symptoms or at the end of the experiment (26 weeks). Lung disease phenotype,

presented as the mean ± Std. dev. was assessed by survival post treatment,

histological evidence of alveolitis, fibrosis & mast cells, and bronchoalveolar total

and differential cell counts. aCalculated using the dataset of mice in distress only.

ND indicates not determined as fewer than three strains with this genotype were

phenotyped.

88 Genomic regions of the fibrosis phenotype were revealed using the dataset of moribund BcA mice as mice not developing alveolitis were previously shown to not develop fibrosis (126). Two regions of the genome where at least three strains succumbing to alveolitis had inherited the donor region were identified and as shown in Table 5, mice with B6 alleles at these regions had increased fibrosis compared to mice with the A/J donor alleles.

Phenotypic assessment of the mice of the AcB strains revealed that 6 strains developed respiratory distress which through histological analysis was determined to be from a mast cell rich alveolitis with minimal fibrosis, and 3 lived to the end of the experiment. The strains surviving to the end of the experiment are informative strains for alveolitis and post irradiation mast cell influx as each phenotype was different from the A/J level (p<0.03). These informative strains do not, however, share any common B6-allele donor regions, thus the specific interval which could spare lung disease in these mice is unknown. In addition, none of the AcB strains is informative for fibrosis, as no strain developed a fibrosis response comparable to B6 level (see Fig. 12C). Finally, strains AcB51,

52, 55, and 65 had fewer cells in the lavage than did A/J mice and are thus informative for this phenotype indicating the B6 donor regions in each strain likely reduce the inflammatory response to thoracic irradiation.

89

Discussion

In this evaluation of pulmonary response we show the majority of recombinant congenic mice to succumb to alveolitis following whole thoracic irradiation while certain strains were identified to have the genetic combinations permitting survival to the end of the experiment. The radiotherapy associated complication of pulmonary fibrosis was presented by mice of four strains and thus was more rare than alveolitis as is the case clinically and was found in our study of mice of the B6 x C3H cross (126). Among the 27 strains evaluated, informative strains for each of alveolitis, with or without mast cells, and fibrosis were identified.

The isolation of specific RC strains that were spared a lethal response to high dose thoracic irradiation allowed us to identify genomic regions which may influence the development of alveolitis in mice. Of the two alveolitis loci listed in

Table 5, the region on chromosome 19 overlaps with a quantitative trait locus of alveolitis susceptibility mapped in a much larger B6xC3H mouse cross (126) which increases confidence in the results of the mapping data. In both of the radiation linkage studies the presence of B6 alleles on chromosome 19 decreases the alveolitis response in mice relative to A/J or C3H alleles. The putative chromosome 11 inflammatory locus overlaps with a region previously implicated in the lung inflammatory response to ozone (70).

90 Three strains of AcB mice were identified as informative for the phenotype of mast cell rich alveolitis as these mice did not succumb with this response which is presented by A/J mice and by the majority of the AcB mice phenotyped here. These data likely indicate the existence of mast cell -dependent and -independent paths to alveolitis, as surviving AcB mice had few mast cells compared to those developing alveolitis and as BcA strain mice succumbed to alveolitis without significant increases in mast cells. From the fact that there was no common B6 donor region inherited among the mice of the three informative

AcB strains, and that B6 mice develop respiratory distress, it is presumed that it is a set of genotypes comprising both B6 and A/J alleles that leads to sparing of lung disease. Further study in crosses derived from these informative strains could reveal these genetic combinations. Additional investigations would also reveal if the phenotype of informative strains can be attributed to the inheritance of donor regions or is due to a spontaneous mutation acquired during development of the

RC strains, which although less likely, has occurred (75,132).

Of the 27 RC strains tested significant fibrosis was measured in three and possibly a fourth, and only in mice of BcA strains. This result supports our previous finding where fibrosis only occurred in moribund mice presenting alveolitis in response to irradiation and inheriting specific fibrosis-promoting alleles (126). Specifically, the RC strains which were not in distress post irradiation (BcA70, 72, 76, 81, 87) each inherited B6 alleles at one or both of the putative fibrosis loci on chromosomes 3 & 4, and did not develop fibrosis. The

91 regions of chromosomes 3 & 4 are distinct from loci mapped for radiation- induced pulmonary fibrosis in previous studies (62,126) suggesting that the interaction of several loci contributes to the fibrosis trait. The effect of the inflammatory response of increases in lavage PMN with increased fibrosis is, however, consistent with the prior work. Also consistent is the radiation-induced increase in lavage neutrophils in moribund mice, measured in the mice of the BcA population, which showed an increase similar to the B6 response level, relative to surviving mice. The biological significance, if any, of the neutrophil influx to the development of fibrosis or alveolitis is not yet clear and requires additional investigation. The effect of B6 or A/J alleles at the fibrotic loci previously mapped could not be assessed here as there was no genetic variation among the

RC mice for these regions. This observation highlights the main limitation of this study, the number of RC strains available, thus the data from this panel of strains most importantly reveal the relationships among phenotypic characteristics influencing radiation-induced lung disease in B6 vs. A/J mice, and informative strains for further mapping studies with the focus on regions shared among mice with similar phenotypes.

Characterisation of the thoracic radiation response of this AcB/BcA strain panel permits a comparison to the bleomycin-induced lung phenotype, also mapped in these mice (129). Despite the histological similarity in the fibrosis which can develop after each of radiation and bleomycin, there is no correlation between these phenotypes in this panel of RC mice. For example, of the 5 BcA

92 strains living to the end of the experiment presented in Figure 12, 3 (BcA 72, 81,

87) were among the strains developing significant pulmonary fibrosis in response to bleomycin and 3 strains with fibrosis following chest irradiation (BcA 67, 80,

86) had less fibrosis than B6 mice after bleomycin treatment. Therefore although one genetic factor is likely common to the bleomycin and radiation lung response pathways (62) the data in RC mice support the conclusion that there are also distinct genetic factors regulating these responses.

In summary we have identified certain RC mice which develop alveolitis, fibrosis or are spared a lung disease in response to whole thorax irradiation. By evaluating genetically mixed mice we were able to identify strains that survive high dose thoracic radiotherapy. This trait was not presented by inbred strains evaluated to date (133), which makes these established RC lines an important resource for genetic studies. The existence of a specific alveolitis susceptibility locus was supported and given the complexity of the radiation response phenotypes the identified informative strains will be valuable tools with which to dissect their genetic bases.

93 Chapter transition

We irradiated the recombinant congenic strains to investigate the possible relationship between bleomycin and radiation-induced pulmonary fibrosis. The investigation of irradiated recombinant congenic strains allowed the identification of markers possibly linked with inflammation or fibrosis and allowed the identification of informative RC strains that developed radiation-induced pulmonary fibrosis, alveolitis or that survived to radiation treatment.

Our next aim was to evaluate the location of resistance and susceptibility alleles in two informative BcA recombinant congenic strains that were especially resistant and susceptible respectively to bleomycin-induced pulmonary fibrosis

(Chapter II) by crossing these informative strains to inbred strains to identify linkage regions associated with their extreme response to bleomycin treatment.

The second aim was to confirm the presence of previously identified QTL and to address this aim a new linkage study was performed in a F2 intercross and in chromosome substitution strains of mice. The third aim was to identify and test candidate genes. To answer this aim, we first investigated candidate genes located under the peaks of the QTL on chromosome 6 (Chapter II) and chromosome 17

(67), without further reduction of the linkage regions. Then, the narrowed region on chromosome 17 led to a shorter list of candidate genes to study and complement component 4 was then investigated as an additional candidate gene.

94

CHAPTER 4

Bleomycin-induced pulmonary fibrosis candidate

gene analysis

95 Abstract

Pulmonary fibrosis is a poorly understood chronic lung disease. To identify genes involved in this disease, we initially investigated the previously identified bleomycin-induced pulmonary fibrosis QTLs in a new B6:A/J intercross and in crosses of informative recombinant congenic strains and we confirmed the presence of susceptibility genes on chromosomes 6 and 17. We then investigated natural killer cells and MHC class I molecules as candidates for the bleomycin-induced pulmonary fibrosis quantitative trait loci on mouse chromosome 6 and 17. Mice deficient in natural killer cells or MHC class I molecules were shown to develop as much fibrosis following bleomycin treatment as did wild-type controls and thus the implication of both classes of genes in the disease was excluded. The size of the linkage interval on mouse chromosome 17 was then narrowed to a 0.8 Mb region by evaluating the phenotype of MHC congenic mice. Of the 45 genes located in this reduced region, complement component 4b was investigated as a positional candidate for bleomycin-induced pulmonary fibrosis and no correlation between the propensity to develop pulmonary fibrosis and pulmonary expression or serum levels of C4 was observed.

Introduction

Pulmonary fibrosis is a complex trait disease of inflammation and fibrosis with unknown genetic basis and to which no treatments have been shown to be effective. This chronic disease is characterized by a proliferation of fibroblasts

96 and by extracellular matrix deposition, which lead to a decrease in lung function

(134). This disease dramatically reduces the quality of life of the patients and is often lethal. Pulmonary fibrosis can occur idiopathically or can be the result of several insults. Treatments with bleomycin, an effective chemotherapeutic agent against multiple types of cancers, or with thoracic irradiation may lead to the development of pulmonary fibrosis or to other pulmonary toxicities (48,58). The identification of new pathways or genes involved in this disease would be critical for the development of a new therapeutic or preventive approach.

Inflammation usually occurs prior to the development of pulmonary fibrosis (7) and was hypothesized to be necessary to the disease progression, but the importance of inflammation in the disease pathology is now disputed

(13,135). Most inflammatory cell types have been investigated for their implication in the disease with occasional conflicting results. T cells were believed to be implicated in bleomycin-induced pulmonary fibrosis as antibody depletion of CD4+ and CD8+ cells abrogated the development of the disease in bleomycin-treated mice (136), but the presence of T cell dependant and independent pathways are possible, since this was contradicted by the fibrosis development of bleomycin-treated SCID mice as they lack T cells and B cells

(137,138). The exact mechanisms through which the pulmonary fibrosis phenotype develops remain unknown but the identification of genetic variations which can contribute to fibrosis initiation or progression promises to be informative.

97

The development of pulmonary fibrosis has been shown to be a heritable trait (99). Among the genes that have been shown to be linked to familial pulmonary fibrosis are surfactant protein C (28), telomerase mutations (29) and major histocompatibility complex haplotypes (30). As there are limitations to the availability of clinical data, a mouse model of bleomycin-induced pulmonary fibrosis is often used to investigate disease genes and pathways (139).

To identify genetic susceptibility involved in pulmonary fibrosis development, we evaluated crosses between well studied fibrosis susceptible

C57BL/6J (B6) inbred strain (140), and A/J and C3H strains of mice that develop minimal fibrosis following radiation or bleomycin treatment (60,61,141). We have previously used both bleomycin treatment and thoracic irradiation to induce pulmonary fibrosis in susceptible strains of mice to identify quantitative trait loci

(QTL) that potentially contained candidate genes for the development of this disease. Several QTLs were found to overlap on chromosome 6 and 17 in bleomycin and radiation-induced pulmonary fibrosis studies and these chromosomes may contain candidate genes to investigate. For example, we identified QTLs in B6xC3H irradiated mice on chromosomes 1, 6, 17 and 18 (62), on chromosome 11 and 17 in bleomycin-treated B6xC3H mice (67), on chromosomes 6 among several other suggestive QTLs in bleomycin-treated

B6xAJ recombinant congenic strains (129) and Barth et al. identified QTLs on chromosome 6 and 13 in bleomycin-treated BALB/c and DBA mice (68). The

98 combination of new linkage studies in B6:A/J mice, crosses of informative recombinant congenic strains and the location of previously identified QTL could allow the identification of QTLs that contain bleomycin-induced pulmonary fibrosis susceptibility genes and a candidate gene study may reveal causative genes.

The peaks of the linkage regions identified at the distal end of chromosome 6 were located in the vicinity of the natural killer (NK) complex of genes (142), and several genes in the natural killer complex were shown to be highly polymorphic between bleomycin-induced pulmonary fibrosis resistant and susceptible inbred strains (143). Furthermore, NK cytotoxic activity was shown to be low in pulmonary fibrosis resistant A/J and SJL mice and high in fibrosis susceptible B6 mice (144,145), hence we hypothesized that NK cells could be involved in the disease development. To our knowledge, the role of natural killer cells was not directly studied in the murine model of bleomycin-induced pulmonary fibrosis.

The region identified in chromosome 17 linkage analyses is located in the mouse MHC genomic region. It was previously shown that certain MHC haplotypes predicted for bleomycin-induced lung disease susceptibility, as mice of the H2b haplotype generally develop pulmonary fibrosis, while mice of the H2k haplotype are generally resistant (67,100). Bleomycin-treated H2-Ea deficient mice also show a decrease in mortality and pulmonary fibrosis development,

99 indicating that MHC class II genes could be involved in bleomycin-induced pulmonary fibrosis development (146). Polymorphisms in MHC class I genes could potentially lead to differences in targeting damaged cell for apoptosis (147), a pathway possibly involved in pulmonary fibrosis development (17).

In this study we initially assessed the prior pulmonary fibrosis linkage in a new F2 intercross between A/J and B6 mice, in crosses of informative recombinant congenic strains identified in Chapter II and in chromosome substitutions strains of mice which have A/J alleles on the entire length of chromosome 6 and 17 respectively (83). We next evaluated two groups of genes,

NK cells genes and MHC class I genes, as candidates for the QTLs located on chromosomes 6 and 17 by evaluating the phenotype of Ly49A hemizygous transgenic mice that are selectively deficient of NK cells (148) and β2- microglobulin knock-out mice, which lack functional MHC class I proteins (149).

We then refined the location of chromosome 17 locus with MHC congenic mice.

Finally, we evaluated a third candidate gene, the fourth component of the complement pathway (C4b), which is a gene of the MHC class III, as it was a gene located in the new refined locus.

Methods:

Mice Mice of the chromosome substitution strain C57BL/6J-Chr 6A/J/NaJ

(B6.6A), C57BL/6J-Chr 17A/J/NaJ (B6.17A), B6.129P2-B2mtm1Unc/J (β2M-/-),

129S1/SvImJ, A/J, AKR/J, BALB/cJ, BTBR T <+> tf/J, BUB/BnJ, C3H/HeJ,

100 C57Bl/6J, C57BLKS/J, C58, CBA/J, CE/J, DBA/2J, FVB/NJ, I/LnJ, KK/HlJ,

LG/J, LP/J, MA/My, NOD/ShiLtJ, NON/ShiLtJ, NZB/BlNJ, NZW/LacJ, PL/J,

SJL, SM/J and SWR strains were purchased from the Jackson laboratory (Bar

Harbor, USA) and maintained at the Meakins-Christie laboratory animal facility.

Male and female mice of 8 to 10 weeks of age were used for the study. All mice were handled according to guidelines and regulations of the Canadian Council on

Animal Care.

We obtained Ly49A transgenic mice (148) that were also knock-out for the LDLr gene (150) from Dr. Stewart Whitman of the University of Ottawa and the mice were backcrossed to B6 mice to eliminate the knock-out gene. The mice were genotyped for the presence of the Ly49A transgene using the primers 5’

CCTGAAGCATGCTATCTCACGA 3’ and 5’

GTTCCCGGGCTCTCCCACCCCAATCA 3’ (148). As in (148), hemizygous mice were used in this experiment. 5 transgenic mice and 3 wild type mice were sacrificed at the 2 week time point, 3 wild-type and 8 transgenic mice were sacrificed at the 6 week time point and 3 wild-type and 3 transgenic mice were left as untreated control mice.

β2 microglobulin knock-out mice (B6.129P2-B2mtm1Unc/J) were bred and maintained under specific pathogen free environment in the Meakins-Christie laboratory animal facility. 4 females and 8 males β2 microglobulin -/- mice were treated with bleomycin.

101

F1 mice from a cross of C57Bl/6J and A/J mice (called B6AF1/J) were purchased from the Jackson laboratory (Bar Harbor, USA). The mice were intercrossed and maintained at the Meakins-Christie laboratory animal facility.

Male and female mice of 8 weeks of age were used for the study.

Recombinant congenic strains BcA78 and BcA84 were obtained from

Emerillon Therapeutics Inc. (Montreal, Canada). The RC mice were generated at the Montreal General Hospital Research Institute, according to a breeding scheme and a genotyping protocol previously described (72). 27 mice of an F2 cross between BcA78 and C3H/HeJ strains of mice was generated and treated with bleomycin. The animals were genotyped with 73 microsatellite markers. 63 mice of a F2 cross between BcA84 and C57Bl/6J were treated with the bleomycin protocol. 14 microsatellite markers were used to determine the parental origin of the 8 loci derived from A/J mice in BcA84 mice.

B6.129S4-Mbl1tm1Kata Mbl2tm1Kata/J (Mbl null) mice were obtained from the Jackson laboratory (Bar Harbor, USA) and kept in a specific pathogen free environment at the Meakins-Christie laboratory animal facility. Mbl null mice lack both MBL-A (Mbl1) and MBL-C (Mbl2) genes (151). Four males were treated with bleomycin.

102

Bleomycin treatment

Lung damage was elicited by administering bleomycin through osmotic minipumps implanted subcutaneously, as described previously (67). Male mice received 100 U bleomycin/kg body wt (2.5 U/mouse), and female mice received

125 U/kg. Male and female mice were treated in separate studies due to the higher drug dose required to produce fibrosis in female mice. The mice were typed for their fibrosis response at 6 weeks after treatment or were sacrificed when moribund, as indicated by 20% weight loss, ruffled fur and lethargy.

Histology and fibrosis scoring

At autopsy, the lungs were removed, and the single left lobe of each mouse was perfused with 10% neutral buffered formalin and submitted for histological processing. Lung sections were stained with Masson’s trichrome to identify the sites of collagen deposition in the lung. The area of the fibrosing phenotype for each mouse was quantified with image analysis of histological sections as in our previous study (67). Specifically, the area of fibrosis in the left lung lobe was determined from a user-drawn region surrounding the fibrosis

(Image ProPlus) and compared with the area of the entire lobe to yield the percent pulmonary fibrosis for individual mice. To assess alveolitis, hematoxylin and eosin (H&E) stained left lung sections were evaluated through semi-quantitative histology (152). Pulmonary inflammation was scored subjectively on a scale of 0-

6; 0 being no inflammation and 6 being an extreme inflammatory response

103 (characterized by excessive thickening of the alveolar walls with cellular infiltrate and exudates present in the alveolar space of the entire lung section).

Quantitative trait locus identification

140 mice of a B6:AJ F2 cross were treated with bleomycin and 10 mice were left as untreated controls. The mice were genotyped with 78 microsatellite markers, with an average of 4 markers per chromosome. The R/QTL software was used to perform a single-QTL genome scan with a normal model (the residual phenotypic variation was assumed to follow a normal distribution) using the

Haley-Knott regression for the phenotype. The logarithm of odd (LOD) score of each marker was calculated by comparing the likelihood of the used model to that of the null model. The threshold of LOD=3.3 for the significance of loci was based on Lander and Kruglyak proposed linkage standard for a genome-wide analysis of a mouse intercross (104).

Recombinant congenic strains genotyping

Mice of the AcB60, BcA69, BcA70 and BcA73 strains were genotyped with microsatellite markers D6Mit368, D6Mit335 and D6Mit194 to define the recombination at the peak of the QTL on chromosome 6 in these strains. The genotype of these strains was identical at marker D6Mit290 and D6Mit194, hence the linkage region previously identified (129) was extended to this marker.

104 Flow Cytometry

Minced lungs were incubated at 37C for 90 minutes in the presence of

5mg of collagenase and DNase (Roche) in 5mL of phosphate buffered saline

(PBS) 1% bovine serum albumin (BSA). The tissue was then dissociated using a cell dissociation kit and the red blood cells were lysed. The resultant cells were washed in PBS 1%BSA and filtered through a 70μM cell strainer. The samples were stained with FITC-CD49b, FITC-CD8, APC-CD3, APC-CD19, PE-CD4

(Biolegend) and analyzed in a BD FACSCalibur. The appropriate isotype controls were used to assess for non-specific binding. The natural killer (NK) cells were identified as CD49b positive, CD3ε negative cells within the gated lymphocytic population. In the evaluation of NK cell number in lung tissue, 3 to 14 A/J and B6 male mice were sacrificed on day 0, 2, 7, 14 and 21 after initiation of bleomycin treatment and their lungs were removed. An additional 3 B6 male mice were sacrificed on day 42.

Fine mapping of Blmpf1

DNA from MHC congenic strains B10.A(2R)/SgSn, B10.A(5R)/SgSnJ and B10.A-H2

(4R)/SgDrEg was obtained from the Jackson laboratories (Bar

Harbor, USA) and the location of the donor region for each strain was identified using the H2-Ea genotyping marker (146) and sequencing of a SNP in the gene

Clic1.

105 C4b sequence variation

A nested PCR reaction was used to specifically amplify C4b. Phenol-

Chloroform DNA isolates from every inbred strain phenotyped were obtained from the Jackson laboratory. To distinguish C4b and its homologue C4a, the entire genomic sequence of C4b of each strain was amplified by PCR using the

Qiagen LongRange PCR kit with the primers

5’CAGTCGATGGCCTCATATTCAA 3’ and 5’GGAAATTTAGCGAGGTCAG

ACG 3’. The long-range PCR protocol was 93 for 3 minutes and 38 cycles of 93 for 15 seconds, 62 for 30 seconds and 68 for 15 minutes. The resulting PCR reaction was used as a template to amplify the other exons with a standard PCR cycling protocol. The gel-purified PCR products were sequenced by the McGill

University and Génome Québec Innovation Center.

Real-Time PCR

These experiments were completed as described previously (111,153).

Briefly, 4-5 µg of total RNA from the right mouse lung was reversely transcribed with oligo(dT)12-18Primer using Superscript™ II RNase H– Reverse

Transcriptase (Invitrogen, Carlsbad, CA, USA) to make cDNA. Quantitative real- time PCR assays were performed using the Applied Biosystems International

Prism 7500 Sequence Detection System and assays on demand. The C4b assay

Mm00437896_m1 and Atxn10 assay Mm00450332_m1 was used as a house- keeping gene. The ΔΔCt method was used to determine fold change and standard deviation between groups as described in (154).

106

Enzyme-linked immunosorbent assay

Blood was collected by cardiac puncture, allowed to clot for 30 minutes, centrifuged for serum collection and stored at -80 until used. Medisorp Nunc 96 well plates (Roskilde, Denmark) were coated overnight with rabbit polyclonal anti-human C4 antibody (Abcam, Cambridge, USA) in carbonate buffer. The plates were washed with PBS-Tween (MP biomedicals, Aurora, USA) and blocked in 5% non-fat dry milk in PBS. Mouse serum was serially diluted (1:20 initial dilution) and rat monoclonal anti mouse C4 (clone 16D2, dilution 1:2000,

Cell Sciences, Canton, USA) was added after washing. For the detection, goat anti-rat IgG HRP conjugated (dilution 1:4000, Cell Sciences, Canton, USA) and tetramethylbenzidine (TMB) (Sigma-Aldrich, St.Louis, USA) were used. As no pure recombinant protein was available, we report the optical density at 450nm, as in (155)

Immunohistochemistry

Two B6 and C3H mice were sacrificed 6 weeks following the beginning of the bleomycin treatment and the excised left lungs were embedded in Tissue-

Tek OCT (Sakura Finetek, Torrance, USA) and snap-frozen in liquid nitrogen.

5μm sections were air-dried and fixed in acetone for 1 minute. The lung slides were then rinsed in PBS and blocked in 10% goat serum in 1% BSA Tris buffer saline (TBS). Rat monoclonal anti mouse C4 (clone 16D2, dilution 1:50, Cell

Sciences, Canton, USA) and goat anti-rat IgG HRP (dilution 1:50, Cell Sciences,

107 Canton, USA) were used. Endogenous peroxidase activity was blocked with 0.3%

H2O2 followed by staining with DAB (Dako, Carpinteria, USA) and hematoxylin counterstaining. Liver sections were used as a positive control.

Identification of candidate genes

The list of genes located in the regions of interest was downloaded from the mouse genome informatics MGI (http://www.informatics.jax.org), NCBI 37th assembly

Results:

Investigation of informative recombinant congenic strains

In chapter II, the propensity of recombinant congenic strains to develop pulmonary fibrosis following bleomycin treatment was evaluated and two BcA strains of mice, BcA78 and BcA81, showed a level of fibrosis higher than B6 mice in male and female animals. As mutations resulting in an extreme phenotype were shown to occur in AcB55 and AcB61 (75), these two strains were deemed informative and mice of the BcA78 strain were used as a progenitor for a fully informative F2 cross (BcA78 x C3H/HeJ) that was treated with bleomycin in an attempt of potentially identify a mutation that could have occurred in the long process of RC strains development. Of the 27 treated mice, 11 were found dead and percent fibrosis was determined for 18 mice. As shown in figure 15, significant association between the genotype and fibrosis development was

108 identified on chromosome 11 at marker D11Mit320 (p=0.05) and a marker on chromosome 17, D17Mit221, showed a non-significant association with fibrosis development (p=0.07). These results are consistent with the previously identified bleomycin-induced loci on chromosome 11 and 17 in a B6:C3H cross (67) and did not support the presence of new mutations in this strain.

Figure 15: Allele-dependant pulmonary fibrosis on chromosome 11 and 17

The fibrosis susceptible BcA78 strain was crossed to fibrosis resistant C3H/HeJ mice and 18 animals of the progeny were phenotyped. A significant association between fibrosis development and the genotype at marker D11Mit320 was identified. Mice with B6 alleles (B6:B6) at this marker developed significantly more fibrosis than mice with C3H alleles (C3H:C3H). Marker D17Mit221 was not significantly significant, but a trend was observed at this marker.

BcA84 was an informative RC strain that did not develop pulmonary fibrosis despite being 93% B6-like. This RC strain contained A/J alleles in 4 of

109 the 6 bleomycin-induced PF QTL identified in Chapter II. To dissect which of these regions were involved in the resistance of this strain of mice, 63 mice of an

F2 cross (BcA84 x B6) were generated and treated with bleomycin to potentially reduce the number of contributing A/J alleles and candidate regions to investigate.

No significant association was identified for any of the inherited A/J loci, as the best associations were located on chromosome 3 (p=0.12), 9 (p=0.15) and chromosome 12 (0.19) (table 6). A combination of several A/J loci might be responsible for the absence of significant locus in a particular region. As neither crosses of informative strains led to the identification of a single region or mutation, we investigated the QTLs on chromosomes 6 and 17 as they were most likely involved in bleomycin-induced PF due to several overlaps of pulmonary fibrosis QTLs on these chromosomes.

Table 6: Effect of the genotype on bleomycin-induced pulmonary fibrosis in (BcA84 x B6) F2 mice

AJ:AJ * B6:B6 * Marker % Fibrosis % Fibrosis p value D2Mit1 3.3 3.8 0.57 D3Mit62 2.7 3.2 0.53 D3Mit239 2.6 3.5 0.40 D3Mit65 2.2 3.7 0.12 D4Mit286 2.3 3.1 0.37 D4Mit288 2.3 3.6 0.26 D4Mit178 2.8 2.9 0.92 D6Mit59 2.5 2.2 0.72 D9Mit247 3.5 2.9 0.72 D9Mit191 1.7 3.1 0.15 D9Mit103 3.1 2.9 0.85 D10Mit198 3.7 2.6 0.26 D12Mit231 3.3 2.2 0.19 D16Mit152 2.8 3.7 0.61 * Average percent fibrosis of mice with AJ:AJ or B6:B6 alleles at each marker

110

Pulmonary fibrosis in chromosome substitution strains

We previously identified bleomycin-induced pulmonary fibrosis quantitative trait loci (QTL) on chromosome 6 in B6xA/J recombinant congenic mice (129) and on chromosome 17 in B6xC3H (67). These QTL were further investigated in mice of chromosome substitution strains (83), as the influence of a single chromosome can be isolated due to the presence of B6 alleles on every other chromosomes in these mice. To determine whether chromosome 6 or 17 loci contribute to the difference in susceptibility to bleomycin-induced pulmonary fibrosis between B6 and A/J mice we measured the lung phenotype of treated B6,

AJ and chromosome substitution mice. As shown in Figure 16 mice of the B6.6A and B6.17A chromosome substitution strains developed a level of fibrosis similar to that of AJ mice (p>0.06), and significantly less (p<0.0005) than the B6 level, but B6.6A developed small patches of subpleural fibrosis that were not observed in B6.17A chromosome substitution strain (p=0.008).

111

Figure 16: Bleomycin-induced pulmonary fibrosis phenotype of C57BL/6J,

A/J and chromosome substitution strains B6.6A and B6.17A.

Mice of each strain were exposed to 100 mg/kg (males) or 125 mg/kg (females) through an osmotic minipump and euthanized 6 weeks later. Images of left lung histological sections stained with Masson's trichrome magnification 100X. A) A/J

B) B6.6A C) B6.17A D) C57BL/6J with regions of subpleural pulmonary fibrosis

(arrow), as indicated by the blue collagen streaks E) untreated C57BL/6J control.

F) average fibrosis in left lung sections of bleomycin-treated mice ± SE; n= 6-11 per group; *significant difference between each strain and B6, p<0.0005. # significant difference between B6.6A and B6.17A (p<0.01)

112 Quantitative trait locus identification

As the loci identified in RCS mice were deemed “suggestive linkage”

(chapter II, (129)), and the QTL previously identified in bleomycin-treated B6 x

C3H intercross were a strain different from A/J (67) we attempted to replicate the linkage study in a new intercross between A/J and B6 mice. 140 mice from the F2 progeny were treated with bleomycin and genotyped using microsatellite markers.

As shown in figure 17, a significant logarithm of odds (LOD) score was identified on chromosome 17 between the centromere of the chromosome and marker

D17Mit193 with a peak at marker D17Mit16. The location of Blmpf1 was located between markers D17Mit175 and D17Mit148 (67), which overlaps the QTL identified in this study. At this location, mice had a significant difference in fibrosis development by genotype as mice with B6 alleles had an average fibrosis of 2.6% and mice with A/J genotype had 0.2% fibrosis (p=4.4x10-4). The presence of a locus significantly associated with pulmonary fibrosis development on chromosome 17 led to the investigation of candidate genes on this chromosome.

Although chromosome 6 linkage was not replicated in this cross, the significant reduction in pulmonary fibrosis in chromosome 6 substitution strain indicated that genes on this chromosome were involved in fibrosis development and candidate genes were also investigated on this chromosome.

113 LOD

114 Figure 17: Identification of loci for bleomycin-induced pulmonary fibrosis and inflammation

QTLs for bleomycin-induced pulmonary fibrosis (green lines) or inflammation

(purple lines). 140 mice of a B6xA/J F2 intercross were treated with bleomycin and sacrificed 6 weeks after the beginning of the treatment. The R/QTL software was used to perform a single-QTL genome scan with a normal model using the

Haley-Knott regression for the phenotype. The horizontal line represents the threshold for significant linkage as proposed in (104)

Location of the candidate regions

To refine the location of the bleomycin-induced pulmonary fibrosis QTL identified on chromosome 6 in B6xAJ recombinant congenic strains (129), the mice used in the previous study were further genotyped. The borders of the bleomycin QTL on chromosome 6 were defined to start between markers

D6Mit254 (125306664 bp in NCBI 37th assembly) and D6Mit194 (128115503 bp) and to finish at the distal end of the chromosome (148131280 bp), with a peak at the start of the QTL.

The location of Blmpf1 on chromosome 17 was previously determined to be between markers D17Mit175 (31979623 bp) and D17Mit148 (37470737 bp)

(67). Out of the 183 genes and 114 expressed sequence tags (ESTs) located in the chromosome 6 region, 49 genes were associated to the functions of NK cells while out of the 214 genes and 50 ESTs located in chromosome 17 locus, 38 were

MHC class I genes.

115 Strain dependent increase in lung tissue NK cells

From the candidate gene list, NK cells were hypothesized to be involved in bleomycin-induced pulmonary fibrosis as a significant number of NK cell genes were located at the peak of the QTL on chromosome 6. To assess whether natural killer cells are a component of the B6:A/J strain dependent lung response to bleomycin, shown in Figure 18, we initially measured the numbers of NK cells in the lungs of these mice following bleomycin treatment. In untreated mice the numbers of NK cells in the lung did not differ by strain (p=0.4) but, as shown in

Figure 18 the numbers of NK cells in the lungs of B6 mice following treatment were significantly greater than the levels in treated A/J mice 7 to 21 days post treatment (p<0.05).

Fibrosis Phenotype of Natural-killer cell deficient mice

We next evaluated the potential contribution of NK cells to the fibrosis phenotype in B6 mice by treating mice rendered NK cell deficient through the insertion of a Ly49A gene under the control of granzyme promoter (148) (Ly49A

Tg), and their wildtype littermates, with bleomycin. As shown in Figure 19A, by

FACS analysis, untreated Ly49A Tg mice had fewer NK cells in the lung than did their littermates, while numbers of T & B lymphocytes were not affected by the transgene insertion in agreement with Kim et al (148). To determine whether this depletion was altered by bleomycin administration NK cell and lymphocyte numbers in the lung were measured at 2 and 6 weeks post treatment and the specific NK cell deficiency was observed.

116 Despite the difference in numbers of NK cells, the fibrosis phenotype of the Ly49A transgenic mice did not differ from that of wildtype mice (p=0.3) as shown in Figure 19B & C. Based on semi quantitative scoring of histological sections, there was also no significant difference in lung inflammation between

Ly49A Tg and their wildtype littermate mice after bleomycin treatment (Figure

19D).

Figure 18: Percentage of NK cells in the lungs of bleomycin-treated

C57BL/6J and A/J mice.

Mice were treated with bleomycin by osmotic minipump or left untreated and were sacrificed at specific days post treatment. CD3-/CD49b+ cells of the dissociated lungs were identified by flow cytometry. Average percentage of NK cells (+ st.err), for n=3-14 mice per group; * p<0.05 vs. strain control level, # p<0.05 C57BL/6J vs. A/J

117

Untreated

2 weeks

6 weeks

118

Figure 19: Pulmonary lymphocyte composition and bleomycin-induced fibrosis phenotype of Ly49A transgenic and wild-type littermates.

Ly49A transgenic mice (in black) and wild-type littermate controls (in grey) were treated with bleomycin through a 7 day osmotic minipump, or left as untreated

(controls), and were sacrificed 2 or 6 weeks after the beginning of the treatment.

A) Cellular composition of the lungs in untreated controls (top panel), at 2 weeks

(middle panel) and 6 weeks (bottom panel) post treatment. The lungs of 3-8 mice per group were homogenized and stained with CD49b, CD3ε, CD4, CD8 and

CD19 and analyzed by flow cytometry. The percentage of each cell type (+st.err) was measured among the lymphocyte-gated events. B) Discrete patches of subpleural fibrosis are evident in both Ly49A transgenic mice and wild-type littermate controls (arrows), staining Masson’s trichrome, magnification 12.5X. C)

Average percent fibrotic tissue in the lungs (+st.err) of Ly49A transgenic and wild-type littermate mice and of untreated controls. Images of histological sections were analysed with ImagePro software. D) The average inflammation scores (+ st.err) of Ly49A transgenic and wild-type littermate mice and of untreated controls. Histological sections stained with hematoxylin and eosin were scored by an observer blinded to mouse genotype and treatment *significant difference between Ly49A Tg and wild type mice, p<0.05.

119 Fibrosis Phenotype of β2-microglobulin knock-out mice

As chromosome 17 genes, and specifically the MHC genomic region

(67,100), were also implicated in the susceptibility response of B6 mice to bleomycin-induced lung disease, we determined whether β2 microglobulin knock- out mice which have an MHC class I deficiency have an altered response to the drug. As shown in Figure 20 the phenotype of bleomycin-treated knockout mice did not differ from that of wild type control mice, indicating that a deficiency in

MHC class I alleles does not influence the fibrosis susceptibility of B6 mice.

120

121

Figure 20: Bleomycin-induced pulmonary fibrosis phenotype of β2 microglobulin knock-out mice and wild-type (C57BL/6J) controls.

12 mice per group were treated with bleomycin and sacrificed 6 weeks post treatment. A) Pulmonary fibrosis is evident in the lungs of each of β2 microglobulin knock-out mice and B6 mice, as shown in Masson's trichrome stained histological sections, magnification 12.5X. B) The average fibrosis

(+st.err) of each group based on image analysis of histological sections, is indicated. C) The average lung inflammatory scores (+ st.err) derived from semi quantitative assessment of histological sections stained with hematoxylin and eosin, are presented for each experimental group. No significant difference between the groups was observed.

Fine mapping of Blmpf1

Dr Haston created congenic lines that harboured different regions of C3H alleles in the Blmpf1 locus on a B6 background to refine the location of the chromosome 17 QTL and found a region associated with the development of bleomycin-induced pulmonary fibrosis between markers D17Mit175

(31979623bp) and D17Mit47 (36353801bp) (personal communication). I genotyped major histocompatibility complex (MHC) congenic mice known to be susceptible (B10.A-H2

(4R)/SgDrEg) or resistant (B10.A(2R)/SgSn and

B10.A(5R)/SgSnJ) to the development of bleomycin-induced pulmonary fibrosis

(146) with our markers to identify a minimal Blmpf1 region located between

D17Mit21 (34380179 bp) and the gene Clic1 (35195665 bp). This region was

122 further reduced by haplotype analysis as in (85) as the region between D17Mit21 and the gene H2-Ea (34479878bp) was identical by descent between susceptible

B10.A-H2

(4R)/SgDrEg and resistant B10.A(2R)/SgSn mice (156). Hence, this minimal Blmpf1 region was located between the gene H2-Ea (34479878 bp) and the gene Clic1 (35195665 bp).

Candidate gene analysis

The refined Blmpf1 region identified contained 45 genes which partially encompasses the MHC region on chromosome 17 and includes several complement genes and heat-shock proteins, as listed in Table 7. As complement 5 polymorphisms were shown to influence bleomycin-induced pulmonary fibrosis development (157) and complement component 4b (C4b) was differentially expressed in a microarray assay of bleomycin-induced (129) and radiation- induced pulmonary fibrosis (Paun A, Lemay A-M and CK Haston, (2009). Gene

Expression Profiling Distinguishes Radiation-Induced Fibrosing Alveolitis from

Alveolitis in Mice, Radiation Research, in press) we decided to investigate C4b and its gene product C4 as a candidate for bleomycin-induced pulmonary fibrosis.

123 Table 7: Genes located in the region identified with the MHC congenic mice

Gene Name Description Unigene ID AC087117.9-1 Predicted gene ENSMUSG00000073416 Mm.372314 Ager Advanced glycosylation end product-specific receptor Precursor Mm.3383 Agpat1 1-acyl-sn-glycerol-3-phosphate acyltransferase alpha Mm.8684 Atf6b Cyclic AMP-dependent transcription factor ATF-6 beta Mm.4068 Btn3a3 butyrophilin, subfamily 3, member A3 Mm.462686 Btnl1 Butyrophilin-like protein 1 Precursor Mm.440426 Btnl2 Butyrophilin-like protein 2 Mm.441007 Btnl5 butyrophilin-like 5 (Btnl5), non-coding RNA Mm.443402 Btnl6 butyrophilin-like 6 Mm.471592 Btnl7 butyrophilin-like 7 Mm.454976 C2 Complement C2 Precursor Mm.283217 C4a sex-limited protein C4b complement component 4B (Childo blood group) Mm.439678 Cfb Complement factor B Precursor Mm.653 Cyp21a1 Steroid 21-hydroxylase Mm.415861 D17H6S56E-3 Protein G7c Precursor Mm.56895 Dom3z Protein Dom3Z Mm.275309 Egfl8 EGF-like domain-containing protein 8 Precursor Mm.231343 Ehmt2 Histone-lysine N-methyltransferase, H3 lysine-9 specific 3 Mm.35345 Fkbpl FK506-binding protein-like Mm.10025 Gpsm3 G-protein-signaling modulator 3 Mm.26584 H2-Ea H-2 class II histocompatibility antigen, E-U alpha chain Fragment Mm.15680 Hspa1a Heat shock 70 kDa protein 1A Mm.6388 Hspa1b heat shock protein 1B Mm.372314 Hspa1l Heat shock 70 kDa protein 1L Mm.14287 Lsm2 U6 snRNA-associated Sm-like protein LSm2 Mm.415967 Msh5 MutS protein homolog 5 Mm.24192 Neu1 Sialidase-1 Precursor Mm.8856 Ng23 Protein G7d Mm.390966 Notch4 Neurogenic locus notch homolog protein 4 Precursor Mm.173813 Pbx2 Pre-B-cell leukemia transcription factor 2 Mm.390957 Ppt2 Lysosomal thioesterase PPT2 Precursor Mm.373627 Prrt1 Proline-rich transmembrane protein 1 Mm.390965 Rdbp Negative elongation factor E Mm.653 Rnf5 E3 ubiquitin-protein ligase RNF5 Mm.400900 Skiv2l superkiller viralicidic activity 2-like Mm.18845 Slc44a4 Choline transporter-like protein 4 Mm.183126 SNORD48 Small nucleolar RNA SNORD48 SNORD52 Small nucleolar RNA SNORD52 Stk19 Serine/threonine-protein kinase 19 Mm.454326 Tesb hypothetical protein LOC407788 Mm.73205 Tnxb tenascin XB Mm.290527 U6 U6 spliceosomal RNA Vars Valyl-tRNA synthetase Mm.28420 Zbtb12 zinc finger and BTB domain containing 12 Mm.161119

124

C4b polymorphisms

The C4b sequence is polymorphic between inbred strains of mice (158), hence we investigated the relationship between C4b sequence polymorphisms and propensity to develop pulmonary fibrosis in several inbred strains. 27 strains were subjected to the bleomycin protocol and 23 strains survived until the six week experimental time point. The AKR/J, I/LnJ, LG/J and CE/J strains were sacrificed due to severe weight loss between 2 and 4 weeks post treatment, possibly due to increase capillary permeability as the lungs of CE/J mice displayed large amounts of red blood cells in the parenchyma. As shown in figure 21, the FVB/NJ,

KK/HlJ, C57BL/6J and NZW/LacJ developed significant fibrosis, while 5 strains showed low levels of fibrosis and 14 strains did not develop pulmonary fibrosis.

125

% Fibrosis 10 12 14 16 18 0 2 4 6 8

CBA/J C58/J SWR NZB/BlNJ

SJL/J BALB/cByJ DBA/2J BUB/BnJ NOD/ShiLtJ MA/MyJ C3H/HeJ SM/J 129S1/SvImJ A/J C57BLKS/J LP/J BTBR T <+> tf/J PL/J NON/ShiLtJ KK/HlJ NZW/LacJ FVB/NJ C57BL/6J

126

Figure 21: Bleomycin-induced pulmonary fibrosis phenotype of inbred strains

Mice of each strain were exposed to 100 mg/kg (males) or 125 mg/kg (females) through an osmotic minipump and euthanized 6 weeks later. Average fibrosis in left lung sections of bleomycin-treated mice ± SE; n= 5-6 per group. Mice of the

AKR/J, CE/J, I/LnJ and LG/J strains did not survive to the end of the experiment and were sacrificed 2 to 4 weeks after the beginning of the treatment.

We initially sequenced exons 3 to 5, 8 to 14, 26 to 28, and 32 to 40 of C4b in 2 susceptible and resistant strains (B6, A/J, C3H and FVB) to evaluate the frequency of sequence variations and to identify haplotypes. The exons that displayed sequence variations between those 4 strains, exons 11 to 14 and 36 to

38, were then sequenced in every other bleomycin-treated inbred strain. Six SNPs were discovered and the propensity to develop pulmonary fibrosis versus the allelic variation of each identified SNP is indicated in figure 23. As shown in figure 23, no SNP reached statistical significance, but a trend was observed in three SNPs. The best correlation between fibrosis susceptibility and allelic variation is for a known intronic SNP between exon 11 and 12, followed by a novel non-synonymous mutation (A1548T) located in exon 36 of C4b (fig.22). A third known non-synonymous SNP (T603M) in exon 14 showed a non- synonymous SNP (rs13475137, T603M) that showed a trend with the fibrosis development of the strains evaluated (fig.23). The allelic variation for each sequenced inbred strain for these three SNPs are indicated in Table 8. Despite incomplete sequencing of C4b, due to the identification of C4b haplotypes, we

127 can assume that if any SNPs remain to be identified by sequencing, they would display a distribution similar to what we described. For example, 129S1/SvImJ,

BTBR T <+> tf/J, BUB/BnJ, FVB/NJ, KK/HlJ, LP/J, SM/J and SWR had B6-like allele at most SNPs evaluated, while A/J, AKR, BALB/cByJ, DBA/2J, I/LnJ,

LG/J, NZB/BlNJ, NZW/LacJ, PL/J and SJL/J showed the opposite allele at most

SNPs, but the presence of these haplotypes did not correlate with the propensity to develop pulmonary fibrosis (p=0.25, data not shown).

The effect of these three SNPs on the mRNA splicing, expression or protein functions are unknown. By using SIFT (Sorting intolerant from tolerant)

(159), an algorithm that predicts the effect of a SNP on a protein by identifying conserved residues in an amino acid sequence, we determined that amino acid substitution T603M was likely tolerated while A1548T was likely not tolerated, which could affect protein stability or function. T603M is located in complement

4 beta chain and A1548T is located in the gamma chain (160). No change in phosphorylation was predicted for either mutation by NetPhos (161). The SNP identified in the intron 11-12 was not located in the splicing site and it is not known if this SNP has an effect on the protein.

128

Figure 22: Single nucleotide polymorphism in exon 36 of C4b of a susceptible and resistant strain

Exon 36 was sequenced in every bleomycin-treated inbred strain. A novel non- synonymous SNP (A1548T) was identified in our sequencing results. The star indicates the mutated nucleotide. The polymorphic sequences of a fibrosis susceptible (C57Bl/6J) and a resistant strain (C3H/HeJ) are depicted.

129

130 Figure 23: Relationship between allelic variation of inbred strains and fibrosis development

6 SNPs differed between the inbred strains under investigation among the introns and exons sequenced. For each allele, the percent fibrosis of the inbred strains with that allele and the average of the group (horizontal bar) are indicated. The base pair position in C4b DNA sequence, the location of the SNP and the dbSNP identification (when available) are indicated on each panel. A Student’s t-test was performed between the percent fibrosis of the strains with either alleles and the resulting p value is indicated on each graph.

131

Table 8: Inbred strains C4b allelic variation of the 3 most correlated SNPs

Strain % Fibrosis rs29498459 Exon 36 rs13475137 AKR/J Do not survive G A C LG/J Do not survive T G C I/LN Do not survive ND* ND C CE/J Do not survive G A C CBA/J 0 G A C NZB/BlNJ 0 T G C SJL/J 0 ND G C C58/J 0 ND A C SWR 0 G G T BALB/cByJ 0.1 T G C DBA/2J 0.1 T G C BUB/BnJ 0.1 ND G T NOD/ShiLtJ 0.2 G A C MA/MyJ 0.2 ND A C C3H/HeJ 0.4 G A C SM/J 0.4 G G C 129S1/SvImJ 0.5 G G T A/J 0.6 T G C C57BLKS/J 0.8 T G C LP/J 1.2 G ND T BTBR T<+> tf/J 1.8 G G T PL/J 2.0 T G C NON/ShiLtJ 2.2 G A C KK/HlJ 3.5 G G T NZW/LacJ 5.4 G G C FVB/NJ 8.3 G G T C57BL/6J 11.9 G G T * ND=not determined

132

C4b pulmonary expression does not correlate with fibrosis development

Although most complement proteins are secreted by the liver, local complement protein synthesis can be increased following lung injury, such as induced by LPS instillation (162). The gene expression of C4b was evaluated by

RT-PCR in the lungs of 3 fibrosis susceptible and 3 fibrosis resistant strains 6 weeks after the beginning of the bleomycin treatment. As shown in figure 24a, no significant difference between bleomycin-treated and untreated control B6, C3H,

A/J, and KK mice was observed (p>0.06), but an increase in expression in FVB mice following bleomycin treatment was observed (p=0.01) The levels of C4b mRNA did not correlate with the propensity to develop pulmonary fibrosis in bleomycin-treated mice (fig 24b). As expected, the C3H strain expressed less C4b as it is a strain of the H2k MHC haplotype and strains of this haplotype are low

C4b producing strains due to a retroposons insert in the gene (163). C4b expression was also evaluated at several time points during the experiment in B6 and C3H mice and did not show variation over time (fig 25).

133

Figure 24: Pulmonary expression of C4b does not correlate with susceptibility to fibrosis

RNA was isolated from the lungs of 3 bleomycin-treated males of each strain.

The 3 left bars are fibrosis susceptible strains while the 3 right columns are fibrosis resistant strains. A) Average fold change of each bleomycin-treated strain relative to untreated control mice (+stdev). B) Average fold change of each bleomycin-treated strain relative bleomycin-treated B6 mice (+stdev). ND

134 indicates that control untreated 129/SvImJ mice were not evaluated. * Indicates a significant increase in expression following bleomycin treatment (p<0.05). No significant correlation between C4b expression and fibrosis susceptibility was observed.

Fold change 5

4

3 C57Bl/6J C3H/HeJ 2

1 * * * * * * 0 123456Days

Figure 25: Differential expression of C4b over time relative to B6 control

RNA was isolated from the lungs of 3 B6 and C3H bleomycin-treated males at the time points indicated. Average fold change of each time point in B6 and C3H relative to B6 untreated controls (+stdev). * indicates a significant difference between B6 and C3H C4b expression (p<0.05). No significant difference was identified over time in each strain.

135 Levels of C4 protein in circulation did not correlate with fibrosis development

The propensity to develop pulmonary fibrosis was not shown to correlate with local synthesis of complement component in a C4b pulmonary expression

RT-PCR experiment. As most complement proteins are synthesized by the liver and secreted in the blood, we investigated the possible relationship between the levels of C4 in circulation and fibrosis development with a sandwich enzyme- linked immunosorbent assay (ELISA) against C4 in the serum of 8 bleomycin treated strains and control untreated B6 mice. As shown in figure 26A, the amount of circulating C4 varied between the strains but did not correlate with the propensity to develop fibrosis (p=0.26, fig. 26B).

136

1.5

1.0

0.5 OD at 450 nm

0.0 B6 ctrl DBA NOD 129 BTBR KK NZW FVB B6 bleo %Fibrosis 000.20.51.83.5 5.4 8.3 11.9 A

20 R2=0.2 p=0.26

10 % Fibrosis

0 0.00 0.25 0.50 0.75 1.00 1.25 1.50 OD 450nm B

137 Figure 26: Level of complement component 4 in serum.

Sera from 3-5 bleomycin-treated mice and untreated B6 control mice was diluted

1:40 and incubated in an anti-C4 antibody coated plate. C4 was detected in a sandwich ELISA using horse radish peroxidase with TMB and the optical density

(OD) at 450 nm was measured. A) Average OD (+stdev) of each strain. The propensity of each strain to develop pulmonary fibrosis is indicated under the name of each strain. B) No significant correlation between relative quantities of

C4 in the serum of inbred strains and propensity to develop bleomycin-induced pulmonary fibrosis was observed in the strains evaluated.

Pulmonary deposition of C4

Although local pulmonary expression of C4b and circulating C4 levels did not correlate with pulmonary fibrosis development, the development of pulmonary fibrosis could be due to specific deposition of circulating C4 in the lungs of susceptible mice. To evaluate the complement component 4 protein level in the lungs of bleomycin-treated B6 and C3H mice immunohistochemistry (IHC) was performed. As shown in figure 27, staining was observed around a few cells and possibly in blood vessels in B6 mice and no staining was visible in C3H mice or in negative controls. No staining was observed in the fibrotic scar of B6 mice

(fig 27C). Strong staining was observed in liver section, a tissue that secretes C4

(fig 27E).

138

139 Figure 27: C4 deposition in the lungs detected by IHC

C4 protein was detected in the lungs of bleomycin-treated B6 and C3H mice with rat anti-C4 antibodies and horseradish peroxidase conjugated antibodies. A)

Staining was detected around a few unidentified cells and potentially blood vessel walls (enlargement) in bleomycin-treated B6 mice. No staining was observed in C3H lung sections (B), B6 fibrotic area (C), or negative controls (D).

E) Staining was observed in the liver, an organ known to secrete C4.

Representative sections of 2 separate experiments, 2 animals per group, magnification 400X

Mannose-binding lectin complement activation pathway is not involved in PF

The complement component 4 is involved in both the mannose binding lectin (Mbl) pathway and the classical pathway of complement cascade activation

(164). In the event that C4b would be involved in fibrosis development through the Mbl pathway, Mbl-null mice, which lack both MBL-A and C proteins as well as Mbl complement activation (151) would show an altered phenotype when compared to wild-type mice. As shown in figure 28, both Mbl-null mice and wild- type B6 mice developed similar levels of pulmonary fibrosis following exposure to bleomycin.

140 A

Percent Fibrosis

16

14

12

10

8

6

4

2

0 B Mbl null WT B6

141

Figure 28: Mannose-binding lectin deficiency does not influence fibrosis development

4 Mbl null mice were treated with bleomycin through a mini-osmotic pump. A)

Similar fibrotic areas are present in the lungs of Mbl-null mice and in wild-type B6 mice (arrows). B) Average percent fibrosis (+St.err) as determined by image analysis is indicated for both groups. No significant difference was observed between the groups (p=0.4). The wild-type B6 results were taken from figure 21.

Discussion

In this chapter, we pursued the identification of candidate genes in the

QTLs identified in bleomycin-treated recombinant congenic strains with three linkage studies and chromosome 6 and 17 substitution strains to confirm the presence of susceptibility genes on these chromosomes.

First, we followed up on informative recombinant congenic strains identified in the bleomycin-induced pulmonary fibrosis QTL study (Chapter II) by crossing them to inbred strains to potentially identify a mutation that could have occurred during the creation of the line as this was previously shown to be responsible for extreme phenotypes in malaria resistance (75) and response to

LPS (132) in recombinant strains. The analysis of a small genome-wide linkage study in BcA78 recombinant congenic mice did not reveal novel susceptibility regions. The increase in pulmonary fibrosis in this strain when compared to B6

142 mice could be possibly explained by the presence of A/J alleles on chromosome

18, shown to be a linkage region contributing to the susceptibility (and not resistance) of bleomycin-induced PF (Chapter II), which could combine with B6 alleles to increase PF levels above the B6 levels. In the evaluation of the phenotype of pulmonary-fibrosis resistant BcA84 mice, we did not identify an A/J locus solely responsible for the resistance of this strain to bleomycin-induced PF and it is likely that several loci protect these mice from pulmonary fibrosis. As no new mutation and no small loci were shown to be responsible for the extreme phenotyped of the informative recombinant congenic strains, we investigated the

QTLs located on chromosome 6 (Chapter II and (62)), and 17 (62,67), as several overlapping QTLs were identified on these chromosomes.

To prevent the pursuit of falsely associated QTLs, confirmation of a QTL in a second cross or in congenic mice is strongly suggested (81). Studies of chromosome substitution strains and of a F2 intercross between B6 and A/J mice were used to confirm the presence of QTLs on the investigated chromosomes.

This approach was also used in a recent study by Boyle and Gill (165), in which the combination of F2 intercross and chromosome substitution strains analysis was successfully used to confirm the location of QTL identified in AcB/BcA RC strains. Using this approach, we confirmed the presence of susceptibility genes on chromosome 17 and on chromosome 6 in CSS mice and candidates were evaluated on these two chromosomes.

143 Although reduction of the size of the linkage region is usually performed prior to the candidate gene analysis (81), physiological implication of the natural killer cells in the phenotype was sought in advance of studies to implicate a specific genetic variation in pulmonary fibrosis. Natural killer cells were hypothesized to be an important cell type in the development of pulmonary fibrosis as CXCR3 knock-out mice that also showed a reduction in the number of in NK cells in several tissues had an increase in interstitial fibrosis following bleomycin treatment (166) and NK cells are known to secrete interferon gamma

(IFNγ), which is hypothesized to be implicated in pulmonary fibrosis development (167). In a study by Miyazaki et al., bleomycin-treated perforin knock-out mice, the NK and T cell cytotoxic molecule, showed an attenuation in lung fibrosis and inflammation (168), but it is possible that this effect was due to cytotoxic T cells cytotoxic activity, and not NK cells. Investigation of NK cell genes as candidates for chromosome 6 linkage region revealed that NK cell deficiency did not affect bleomycin-induced pulmonary fibrosis phenotype. Mice that were rendered deficient in natural killer cells by the insertion of a Ly49A transgene developed fibrotic and inflammation levels similar to littermate controls. Although low levels of circulating NK cells could be observed, the NK cells of the transgenic animals were previously shown to have profound functional defects (148). This suggests that natural killer cells are not involved in the development of pulmonary fibrosis in this bleomycin-treated mouse model.

144 Secondly, we investigated MHC class I receptors as candidate genes for

Blmpf1 on chromosome 17. MHC class I receptors are located on every nucleated cell and present peptides to circulating T cells (147). They could have been involved in pulmonary fibrosis development as DNA damage, such as caused by bleomycin treatment, induce MHC class I protein expression (169) and MHC class I molecules could present oxidized intracellular proteins on the cell surface

(170) to target the damaged cells for apoptosis. MHC class I genes were also highly differentially expressed in the lungs of A/J and B6 mice (see supplementary Table 1). As the amount of fibrosis and inflammation in the lungs of MHC class I deficient mice was shown to be similar to wild-type B6 mice levels, MHC class I genes are likely not candidate genes for Blmpf1 and are probably not involved in the disease development.

In addition to the absence of functional MHC class I molecules, β2- microglobulin deficient mice lack CD4-CD8+ T cells (149), were shown to have markedly reduced number of NKT cells (171) and low NK cell activity (172). The low activity of NK cells in β2-microglobulin deficient mice supports the results we obtained in the Ly49A transgenic mice which did not have an abrogated response to bleomycin in the absence of NK cells. β2-microglobulin deficient mice have a reduction of NKT cells. Our findings are consistent with those of

Kimura et al (173) who showed that NKT cell-deficient (J 281–/–) mice had a similar survival rate, histopathological score and hydroxyproline content as wild- type B6 mice in response to bleomycin. Conversely, our results contradicts the

145 results of Kim et al. who showed CD1d deficient mice, which are also NKT deficient, do have an increase in pulmonary fibrosis severity (174). The difference between the experiments could be explained by the different treatments as the bleomycin doses and administration route greatly differ. The cumulative dose of bleomycin given to the mice in our experiment was 0.3mg/mouse on average, which is a dose closer to the study by Kimura et al. (0.5mg/mouse) (173), in which no difference in phenotype was observed between NKT deficient mice and

B6 mice, than to the study of Kim et al. (0.04-0.06mg/mouse) (174), in which

NKT deficiency worsened the phenotype. The use of three different mouse strains with NKT deficiency could also explain the conflicting results, as each mouse strains could have different pathways altered or compensating mechanisms in place.

To identify a short list of candidate genes for further studies, congenic mice may be used to identify a small region within the QTL (81). By combining linkage interval studies with B6:C3H congenic lines and MHC congenic strains, we identified a 0.8 Mb region containing 45 genes and ESTs. Of these 45, 4 were involved in the complement immunological pathway. In a microarray study of the radiation response of B6, C3H and A/J mice, we identified by pathway analysis the complement cascade and melanoma pathways to be differentially expressed post radiation specifically in the fibrotic B6 strain (Paun, Lemay and Haston, in press). Several lines of evidence suggest a role for the complement pathway in pulmonary fibrosis development, as polymorphisms in the complement receptor 1

146 (CR1) was associated with idiopathic pulmonary fibrosis in humans (175), depletion of serum complement inhibited collagen deposition in bleomycin- treated mice (176) and complement 5 deficient mice had an increase in inflammation and a decrease in fibrosis following bleomycin treatment (157). Of the four complement genes, C4b was specifically chosen for further investigation as it showed sequence variations in the mouse phenome database (177), but other complement genes, or genes in the region could be candidates for bleomycin- induced pulmonary fibrosis.

To confirm that a candidate gene is indeed the gene responsible for the phenotype observed, an assortment of several evidences should be provided, such as the presence of sequence variations in the coding or regulatory regions, in vitro studies and evaluation of genetically modified animals (81). Complement component 4 altered protein function caused by sequence variation could be involved in the difference in response to bleomycin-induced treatment as C4 participate in pathways believed to be important in pulmonary fibrosis development such as removal of apoptotic cells (178) or recruitment of inflammatory cells, and because complement activation by cobra venom factor is known to result in acute lung injury (179). The correlation between the SNPs identified in the sequence of C4b and pulmonary fibrosis development of the inbred strains of mice did not reach statistical significance, but a trend was observed for 3 SNPs. The absence of significant correlation could be an indication that C4 sequence variation is unrelated to pulmonary fibrosis development, or that

147 the complement pathway is involved in pulmonary fibrosis development in some of the inbred strains evaluated and not in others. One of the SNPs was a newly identified non-synonymous SNP that could have an effect on the protein, as predicted by SIFT (159), but this prediction remains to be tested and no correlation was identified between the SNPs and levels of C4 in serum in evaluated inbred strains. Lastly, most exons of C4b were sequenced, but it is possible that other causative SNPs remain to be identified.

Pathological variations in C4 between inbred strains of mice could potentially be observed in pulmonary expression, in circulating protein level or in

C4 protein deposition in the lungs. Pulmonary expression of C4b was not significantly altered by bleomycin treatment in the strains evaluated and we did not find a correlation between pulmonary expression and fibrosis susceptibility.

Levels of circulating C4 was also unchanged following treatment in B6 mice and the quantity of C4 in the evaluated strains did not correlate with fibrosis development. Furthermore, we did not observe complement 4 deposition in B6 fibrotic scar by IHC and only a small difference was identified in staining between bleomycin treated B6 mice and C3H mice.

To complete the evaluation of C4b as a quantitative trait gene for bleomycin-induced pulmonary fibrosis, the effect of the identified SNPs should be evaluated and to determine if C4b is involved in pulmonary fibrosis, C4 deficient mice will be treated with bleomycin and irradiated shortly (180). Alternatively,

148 the B6 C4b isoform will be cloned in an expression plasmid that will be injected into C3H mice. It is also possible that C4b would be a good candidate for radiation-induced pulmonary fibrosis as C4b was differentially expressed following radiation in B6 mice (Paun, Lemay and Haston, in press) and this remains to be tested.

In this chapter, we also described the response of 27 inbred strains to bleomycin treatment, most of which have not been previously described. 4 strains did not survive the treatment and large amounts of red blood cells were discovered in the pulmonary alveoli of sacrificed CE/J males, indicating pulmonary haemorrhage. We confirmed the susceptibility to fibrosis development of FVB mice (181) and identified KK/HlJ and NZW/LacJ as new fibrosis susceptible strains and these strains could be further investigated. Interestingly, closely genetically related strains of mice such as C57Bl/6J and C57BLKS/J displayed a divergent phenotype to bleomycin treatment. The C57BLKS/J inbred strain of mice differ from C57Bl/6J by approximately 29% of its genome and 20% of these alleles are of a DBA/2J origin (182), which is a bleomycin-resistant strain of mice in our model. The divergent phenotypes could be explained by the presence of DBA/2J alleles in known regions of bleomycin susceptibility on chromosome 6, 11 and 17 in the C57BLKS/J inbred strain.

Finally, in this chapter, we used genetically modified animals to exclude

NK cells and MHC class I genes as candidates for bleomycin-induced pulmonary

149 fibrosis. By using congenic mice, we also narrowed the region on chromosome 17 and this allowed the investigation of a candidate gene located in this small interval. The mRNA and protein investigation of C4b did not strongly support its implication in pulmonary fibrosis, but C4 deficient mice that will be treated shortly will determine if this gene has a role in pulmonary fibrosis.

The identification of candidate genes is critical, as it could allow pre- screening of patients undergoing chemotherapy and as a better understanding of the disease process could permit the development of treatments, which are lacking at the moment.

150

CHAPTER 5

General discussion and conclusion

151 In this thesis, we treated B6:A/J recombinant congenic strains with bleomycin and radiation in an attempt to identify quantitative trait loci that would contain susceptibility genes to pulmonary fibrosis development following both induction methods.

In Chapter II, we treated RCS mice with bleomycin to identify loci associated with pulmonary fibrosis susceptibility. The putative QTLs identified in chapter 2 did not replicate the previously identified Blmpf1 and 2 QTLs on chromosome 11 and 17 (67). As the frequency of recombinations in the RCS strains varies across the genome (72), only 3 BcA strains had A/J alleles in the region of interest on chromosome 17, hence although all three strains had displayed low fibrotic levels, the statistical power of three strains was too low to identify this QTL in the second chapter.

The use of the RCS has both advantages and limitations, for example we were able to treat a few individual mice for each strain to confirm the phenotype observed and we were able to cross two informative strains in the attempt to identify susceptibility or resistance genes in these strains, which would have been impossible with backcross or intercross studies as the informative animals would have been sacrificed. On the other hand, the total number of RC strains is relatively small and some strains are less available than others which resulted in a low statistical power as 33 and 27 strains were analysed in bleomycin and radiation-induced lung disease respectively.

152

The overlap on chromosome 17 between bleomycin and radiation induced pulmonary fibrosis and the fact that several inbred strains show a similar response to both treatments suggested that both induction methods shared pathways in the development of pulmonary fibrosis. RCS mice with identical genotypes treated with bleomycin and radiation did not show a similar lung response, hence although it is likely that some genomic regions are involved in both diseases, other loci are likely specific to the response of one or the other treatment. The genomic regions that both diseases share could contain genes and pathways also involved in other lung fibrotic disease such as idiopathic pulmonary fibrosis, for which no treatments are available. For these reasons chromosome 17 QTL was chosen for further investigation in chapter 4.

In Chapter III, we irradiated RC strains to identify QTLs associated with pulmonary fibrosis development. Several informative strains were identified for fibrosis susceptibility, resistance to alveolitis and survival to radiation treatment.

The informative strains could be crossed to a selected inbred strain to identify genes or regions of the genome that contain fibrosis, alveolitis or radiation survival candidate genes. This approach was successfully used by Cook et al

(132) to identify a gene involved in inflammatory response to LPS inhalation. As the number of phenotyped strains was small and the linkage identified was not very strong, the creation of a new AJ:B6 QTL mapping cross could improve the results and confidence in the identified loci. We could also irradiate mice of the

153 chromosome 3, 4, 11 and 19 substitution strains to confirm the presence of genes involved in fibrosis or alveolitis development following thoracic irradiation.

Alternatively, a panel consisting of mice of every chromosome strains could be irradiated to identify the chromosome responsible for the mast cell infiltration in

A/J mice, a trait linked with survival in AcB strains. The immune cells identified to correlate with alveolitis and fibrosis development could also be good physiological candidates to investigate. Mast cell deficient mice could be irradiated to evaluate if mast cells are involved in alveolitis development or neutrophil inhibitors could be administered to irradiated mice to evaluate if pulmonary fibrosis development is associated with the presence of neutrophils, as was suggested by the phenotype observed in the lungs of sick BcA mice.

The focus of this research project was turned toward bleomycin-induced pulmonary fibrosis candidate gene studies. In the fourth chapter, we first evaluated RC informative strains that were shown to be especially resistant and susceptible to bleomycin-induced pulmonary fibrosis development by crossing them to inbred strains of mice, as mutations affecting the phenotype were shown to occur in RC mice (75,132). The results of the crosses of both informative strains suggested that the increase susceptibility of BcA78 was possibly due to the presence of a greater number of susceptibility alleles in this strain than in B6 mice and that BcA84 mice were most likely resistant to pulmonary fibrosis due to a high number of A/J alleles at major bleomycin-induced PF QTLs. We then confirmed the presence of susceptibility genes on chromosomes 6 and 17 in

154 chromosome substitution strains and in a new F2 cross. We studied the potential contribution of NK cells and MHC class I genes to bleomycin-induced pulmonary fibrosis prior to the reduction of the size of the linkage regions. As there were a relatively high number of genes related to these cells and molecules under the peak of their respective QTLs, these candidates were hypothesized to have a role in fibrosis development. As the MHC haplotypes of the mice were previously shown to be associated with fibrosis susceptibility (67,100), our finding that MHC class I deficiency does not affect bleomycin-induced PF greatly reduced the number of candidate genes. NK cell deficiency did not affect the phenotype and as chromosome 6 QTL was only identified in irradiated mice and was a suggestive QTL in the bleomycin-treated RCS mice, we focused on chromosome

17 candidate genes instead.

The size of the chromosome 17 QTL was reduced to 0.8 Mb through several mouse crosses and among 45 genes C4b was identified as a candidate gene for further investigation. No significant correlation was identified between

C4b expression, sequence variations or protein levels and bleomycin-induced fibrosis development. C4 knock-out mice were recently treated with bleomycin and the results will help determine if this gene has as role in PF development. In the event that C4b is not involved in PF development, other interesting candidate genes could be investigated in the pathogenesis of bleomycin-induced PF. For example, bleomycin and radiation treatments lead to DNA damage and FK506 binding protein-like (Fkbpl) was shown to be involved in DNA repair following

155 low doses of radiation (183). Another candidate gene could be tenascin XB, an extracellular matrix protein involved in cell adhesion (184) as an increase in extracellular matrix is observed in pulmonary fibrosis pathology and this gene was part of the heparin binding gene ontology (GO) category identified in Chapter

II as being over-represented in the B6 and A/J microarray gene expression assay.

MHC class II genes could also be good candidates for Blmpf1, and H2-Ea was shown to be involved in the survival of the mice following bleomycin treatment

(146), but other genes of this class could be involved as this gene did not fully explain the phenotype, because H2-Ea transgenic mice still developed significant bleomycin-induced pulmonary fibrosis (146).

Although Blmpf1 is now smaller than 0.8 Mb, this region still contains a number of genes too large to allow the analysis of each individual gene. To further narrow down the number of genes in the Blmpf1 region, a new congenic mouse line is currently under development and this line is believed to have a recombination in this region which could lead to a reduction in the size of Blmpf1 and in a reduction of the number of candidate genes. A second method to narrow down the region could be to take advantage of knock-out mice as a congenic mouse model (185). As most knock-out mice were generated in fibrosis-resistant

129 strain of mice and backcrossed for several generations with B6 mice, the region surrounding the knock-out gene, or “congenic footprint” is often derived from the genome of the 129 strain (186). If the knock-out gene is unrelated to the phenotype, this mouse strain can be used to precisely determine the location of

156 resistance alleles (185). A knock-out mouse with 129 alleles that would partially overlap our linkage region could potentially narrow this linkage region and reduce the number of candidate genes to evaluate. Another method to rapidly identify candidate genes for further studies would be to analyse gene expression of congenic mice. Our microarray studies compared the expression of genes in different inbred strains of mice, which have hundreds of genes differentially expressed in untreated animals. The comparison of the expression of genes in congenic mice of the same background reduces the number of differentially expressed genes and could underline candidate genes for studies that are differentially expressed in strains of mice that only differ in the investigated locus.

Lastly, in the near future the whole genome sequences of 12 inbred strains of mice including A/J, C3H and B6 strains will be made publicly available by a group led by Dr David Adams (187). This will allow the comparison of the sequences of large regions of inbred strains for polymorphisms, deletions, insertions, which may accelerate the identification of candidate genes for further investigation.

I have described the response of 27 inbred strains of mice to bleomycin treatment, most of which were not previously known. The strain distribution pattern of these inbred strains will allow SNP association analysis to be performed and the correlation between SNPs and fibrosis development will facilitate the identification of new candidate genes to further study. The SNP density for 12 of the evaluated inbred strains of mice is high, but due to much lower density for the other inbred strains resequencing of these strains could increase the power of the

157 analysis. The same inbred strains were also irradiated and we will be able to compare the response of the inbred strains to both treatments.

In the chapter “Finding Fibrosis Genes, The Lung” of the book “Fibrosis

Research: Methods and Protocols” Burch and Schwartz described the steps for the identification of fibrosis susceptibility genes (63) (see figure 3 in Chapter I). The first step toward the identification of fibrosis susceptibility genes was to determine a phenotype in a model organism and for that purpose we identified variable fibrosis susceptibility in several inbred strains. The next step suggested by Burch and Schwartz was to identify candidate regions by positional mapping and we used QTL mapping to identify such regions in bleomycin and radiation- treated recombinant congenic strains. Then, they suggested reducing the size of the region by fine mapping and we used a combination of new F2 cross and congenic mice to narrow down our region. We analyzed gene expression by a microarray analysis and chose candidate genes based on the literature as they proposed and resequenced our candidate gene as recommended. Lastly, to formally prove the discovery of a gene involved in a fibrotic disease we evaluated the phenotype of mice deficient in the candidates investigated. We did not include

In silico mapping as they suggested, but this analysis will be part of a separate manuscript.

158 In conclusion, in this thesis I have determined the fibrotic phenotype of bleomycin-treated and irradiated recombinant congenic strains and proposed putative loci for both diseases. I have also shown that deficiency in NK cells,

MHC class I or Mbl did not affect bleomycin-induced pulmonary fibrosis development. These mice will be irradiated as well to determine if they are involved in radiation-induced pulmonary fibrosis. Further investigations will be necessary to identify bleomycin and/or radiation-induced pulmonary fibrosis susceptibility genes, but I assisted in the reduction of the size of the linkage region and in the number of candidates to be studied. Breeding of a new congenic line on chromosome 17 might also decrease the size of the QTL and other candidate genes from the list could be eliminated or investigated. To ascertain that the identified candidate gene is indeed responsible for the phenotype observed, genetically modified animals could be ultimately evaluated and a deficiency- complementation test can be performed, in which the wild-type allele is inserted in knock-out animal to demonstrate that the gene is responsible for the different phenotype (81).

The identification of new susceptibility genes for fibrosis development is critical, as pulmonary fibrosis is a debilitating disease for which no treatments were found to be effective and because the identification of new genes or pathways involved in this disease could lead to new therapeutic approaches that could be beneficial to many patients.

159

Reference List

1. Centers for disease control and prevention, Natl. Vital Stat. Rep. 55, (2007).

2. R.J. Panos, R.L. Mortenson, S.A. Niccoli, and T.E. King, Clinical deterioration in patients with idiopathic pulmonary fibrosis: Causes and assessment. The American Journal of Medicine 88, 396-404 (1990).

3. G. Raghu, D. Weycker, J. Edelsberg, W.Z. Bradford, and G. Oster, Incidence and prevalence of idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 174, 810-816 (2006).

4. W.W. Douglas, J.H. Ryu, and D.R. Schroeder, Idiopathic pulmonary fibrosis - Impact of oxygen and colchicine, prednisone, or no therapy on survival. Am. J. Respir. Crit. Care Med. 161, 1172-1178 (2000).

5. A.L. Olson, J.J. Swigris, D.C. Lezotte, J.M. Norris, C.G. Wilson, and K.K. Brown, Mortality from Pulmonary Fibrosis Increased in the United States from 1992 to 2003. Am. J. Respir. Crit. Care Med. 176, 277-284 (2007).

6. American Thoracic Society/European Respiratory Society International Multidisciplinary Consensus Classification of the Idiopathic Interstitial Pneumonias . This Joint Statement of the American Thoracic Society (ATS), and the European Respiratory Society (ERS) was adopted by the ATS Board of Directors, June 2001 and by The ERS Executive Committee, June 2001. Am. J. Respir. Crit. Care Med. 165, 277-304 (2002).

7. T.J. Gross and G.W. Hunninghake, Medical progress: Idiopathic pulmonary fibrosis. N. Engl. J. Med. 345, 517-525 (2001).

8. J.P. Stewart, J.J. Egan, A.J. Ross, B.G. Kelly, S.S. Lok, P.S. Hasleton, and A.A. Woodcock, The detection of Epstein-Barr virus DNA in lung tissue from patients with idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 159, 1336-1341 (1999).

9. K.B. Baumgartner, J.M. Samet, D.B. Coultas, C.A. Stidley, W.C. Hunt, T.V. Colby, J.A. Waldron, and Collaborating Center, Occupational and Environmental Risk Factors for Idiopathic Pulmonary Fibrosis: A Multicenter Case-Control Study. Am. J. Epidemiol. 152, 307-315 (2000).

10. E. Loyer, L. Fuller, H.I. Libshitz, and J.L. Palmer, Radiographic appearance of the chest following therapy for Hodgkin disease. Eur. J. Radiol. 35, 136-148 (2000).

160 11. C. Ramos, M. Montano, J. Garcia-Alvarez, V. Ruiz, B.D. Uhal, M. Selman, and A. Pardo, Fibroblasts from Idiopathic Pulmonary Fibrosis and Normal Lungs Differ in Growth Rate, Apoptosis, and Tissue Inhibitor of Metalloproteinases Expression. Am. J. Respir. Cell Mol. Biol. 24, 591-598 (2001).

12. R.M. Strieter, Inflammatory Mechanisms Are Not a Minor Component of the Pathogenesis of Idiopathic Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med. 165, 1206-1207 (2002).

13. B.D. Bringardner, C.P. Baran, T.D. Eubank, and C.B. Marsh, The role of inflammation in the pathogenesis of idiopathic pulmonary fibrosis. Antioxid Redox Signal 10, 287-301 (2008).

14. J. Gauldie, Inflammatory Mechanisms Are a Minor Component of the Pathogenesis of Idiopathic Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med. 165, 1205-1206 (2002).

15. P.J. Sime and K.M.A. O'Reilly, Fibrosis of the lung and other tissues: New concepts in pathogenesis and treatment. Clin. Immunol. 99, 308-319 (2001).

16. A. Leask and D.J. Abraham, TGF-beta signaling and the fibrotic response. FASEB J. 18, 816-827 (2004).

17. C.L. Fattman, Apoptosis in pulmonary fibrosis: Too much or not enough? Antioxid Redox Signal 10, 379-385 (2008).

18. Idiopathic Pulmonary Fibrosis: Diagnosis and Treatment . International Consensus Statement. Am. J. Respir. Crit. Care Med. 161, 646-664 (2000).

19. D.W. Mapel, J.M. Samet, and D.B. Coultas, Corticosteroids and the Treatment of Idiopathic Pulmonary Fibrosis: Past, Present, and Future. Chest 110, 1058-1067 (1996).

20. M.S. Selman, V.J. Thannickal, A. Pardo, D.A. Zisman, F.J. Martinez, and J.P. Lynch, Idiopathic pulmonary fibrosis - Pathogenesis and therapeutic approaches. Drugs 64, 405-430 (2004).

21. P. Rogliani, M. Mura, M. ssunta Porretta, and C. Saltini, Review: New perspectives in the treatment of idiopathic pulmonary fibrosis. Therapeutic Advances in Respiratory Disease 2, 75-93 (2008).

22. R.M. du Bois, Genetic factors in pulmonary fibrotic disorders. Seminars in Respiratory and Critical Care Medicine 27, 581-588 (2006).

161 23. S. Javaheri, D.H. Lederer, J.A. Pella, G.J. Mark, and B.W. Levine, Idiopathic pulmonary fibrosis in monozygotic twins. The importance of genetic predisposition. Chest 78, 591-594 (1980).

24. J.W. Peabody and E.W. HAYES, Idiopathic Pulmonary Fibrosis - Its Occurrence in Identical Twin Sisters. Dis. Chest 18, 330-344 (1950).

25. R.P. Marshall, A. Puddicombe, W.O.C. Cookson, and G.J. Laurent, Adult familial cryptogenic fibrosing alveolitis in the United Kingdom. Thorax 55, 143-146 (2000).

26. M. Selman, H.M. Lin, M. Montano, A.L. Jenkins, A. Estrada, Z.W. Lin, G.R. Wang, S.L. DiAngelo, X.X. Guo, T.M. Umstead et al. Surfactant protein A and B genetic variants predispose to idiopathic pulmonary fibrosis. Hum. Genet. 113, 542-550 (2003).

27. Y. Wang, P.J. Kuan, C. Xing, J.T. Cronkhite, F. Torres, R.L. Rosenblatt, J.M. Dimaio, L.N. Kinch, N.V. Grishin, and C.K. Garcia, Genetic Defects in Surfactant Protein A2 Are Associated with Pulmonary Fibrosis and Lung Cancer. Am. J. Hum. Genet. 84, 52-59 (2009).

28. A.Q. Thomas, K. Lane, J. Phillips, M. Prince, C. Markin, M. Speer, D.A. Schwartz, R. Gaddipati, A. Marney, J. Johnson et al. Heterozygosity for a surfactant protein C gene mutation associated with usual interstitial pneumonitis and cellular nonspecific interstitial pneumonitis in one kindred. Am. J. Respir. Crit. Care Med. 165, 1322-1328 (2002).

29. M.Y. Armanios, J.J.L. Chen, J.D. Cogan, J.K. Alder, R.G. Ingersoll, C. Markin, W.E. Lawson, M.Y. Xie, I. Vulto, J.A. Phillips et al. Telomerase mutations in families with idiopathic pulmonary fibrosis. N. Engl. J. Med. 356, 1317-1326 (2007).

30. R. Falfan-Valencia, A. Camarena, A. Juarez, C. Becerril, M. Montano, J. Cisneros, F. Mendoza, J. Granados, A. Pardo, and M. Selman, Major histocompatibility complex and alveolar epithelial apoptosis in idiopathic pulmonary fibrosis. Hum. Genet. 118, 235-244 (2005).

31. U. Hodgson, V. Pulkkinen, M. Dixon, M. Peyrard-Janvid, M. Rehn, P. Lahermo, V. Ollikainen, K. Salmenkivi, V. Kinnula, J. Kere et al. ELMOD2 is a candidate gene for familial idiopathic pulmonary fibrosis. Am. J. Hum. Genet. 79, 149-154 (2006).

32. V.S. Taskar and D.B. Coultas, Is Idiopathic Pulmonary Fibrosis an Environmental Disease? Proceedings of the American Thoracic Society 3, 293-298 (2006).

33. M.C. Green and L.D. Shultz, Motheaten, An Immunodeficient Mutant of Mouse .1. Genetics and Pathology. J. Hered. 66, 250-258 (1975).

162 34. G.A. Rossi, G.W. Hunninghake, O. Kawanami, V.J. Ferrans, C.T. Hansen, and R.G. Crystal, Motheaten Mice - An Animal-Model with An Inherited Form of Interstitial Lung-Disease. Am. Rev. Respir. Dis. 131, 150-158 (1985).

35. F.M. Muggia, A.C. Louie, and B.I. Sikic, Pulmonary Toxicity of Antitumor Agents. Cancer Treat. Rev. 10, 221-243 (1983).

36. M. Kolb, P.J. Margetts, D.C. Anthony, F. Pitossi, and J. Gauldie, Transient expression of IL-1 beta induces acute lung injury and chronic repair leading to pulmonary fibrosis. J. Clin. Invest. 107, 1529-1536 (2001).

37. C.L. Fattman, F. Gambelli, G. Hoyle, B.R. Pitt, and L.A. Ortiz, Epithelial expression of TIMP-1 does not alter sensitivity to bleomycin-induced lung injury in C57BL/6 mice. Am J Physiol Lung Cell Mol Physiol 294, L572- L581 (2008).

38. M. Myllarniemi, P. Lindholm, M.J. Ryynanen, C.R. Kliment, K. Salmenkivi, J. Keski-Oja, V.L. Kinnula, T.D. Oury, and K. Koli, Gremlin- mediated Decrease in Bone Morphogenetic Protein Signaling Promotes Pulmonary Fibrosis. Am. J. Respir. Crit. Care Med. 177, 321-329 (2008).

39. T.R. McMillan, B.B. Moore, J.B. Weinberg, K.M. Vannella, W.B. Fields, P.J. Christensen, L.F. van Dyk, and G.B. Toews, Exacerbation of Established Pulmonary Fibrosis in a Murine Model by Gammaherpesvirus. Am. J. Respir. Crit. Care Med. 200708-1184OC (2008).

40. C.T. Migliaccio, M.C. Buford, F. Jessop, and A. Holian, The IL- 4R{alpha} pathway in macrophages and its potential role in silica-induced pulmonary fibrosis. J. Leukoc. Biol. 83, 630-639 (2007).

41. A.S. Williams, R. Issa, S.Y. Leung, P. Nath, G.D. Ferguson, B.L. Bennett, I.M. Adcock, and K.F. Chung, Attenuation of ozone-induced airway inflammation and hyper-responsiveness by c-Jun NH2 terminal kinase inhibitor SP600125. J. Pharmacol. Exp. Ther. 322, 351-359 (2007).

42. A.C.K. Miller, L.D. Dwyer, C.E. Auerbach, F.B. Miley, D. Dinsdale, and A.M. Malkinson, Strain-Related Differences in the Pneumotoxic Effects of Chronically Administered Butylated Hydroxytoluene on Protein-Kinase-C and Calpain. Toxicology 90, 141-159 (1994).

43. P.J. Sime, Z. Xing, F.L. Graham, K.G. Csaky, and J. Gauldie, Adenovector-mediated gene transfer of active transforming growth factor- 1 induces prolonged severe fibrosis in rat lung. J. Clin. Invest. 100, 768- 776 (1997).

163 44. J. Gauldie and M. Kolb, Animal models of pulmonary fibrosis: how far from effective reality? Am J Physiol Lung Cell Mol Physiol 294, L151 (2008).

45. W.E. Lawson, V.V. Polosukhin, G.T. Stathopoulos, O. Zoia, W. Han, K.B. Lane, B. Li, E.F. Donnelly, G.E. Holburn, K.G. Lewis et al. Increased and prolonged pulmonary fibrosis in surfactant protein C-deficient mice following intratracheal bleomycin. Am. J. Pathol. 167, 1267-1277 (2005).

46. J.H. Harrison and J.S. Lazo, High-Dose Continuous Infusion of Bleomycin in Mice - A New Model for Drug-Induced Pulmonary Fibrosis. J. Pharmacol. Exp. Ther. 243, 1185-1194 (1987).

47. H. Umezawa, K. Maeda, T. Takeuchi, and Y. Okami, New Antibiotics Bleomycin A and B. J. Antibiot. (Tokyo). 19, 200 (1966).

48. J. Hay, S. Shahzeidi, and G. Laurent, Mechanisms of Bleomycin-Induced Lung Damage. Arch. Toxicol. 65, 81-94 (1991).

49. H. Umezawa, M. Ishizuka, S. Hori, H. Chimura, T. Takeuchi, and T. Komai, Distribution of 3H-Bleomycin in Mouse Tissue. J. Antibiot. (Tokyo). 21, 638 (1968).

50. A. Takeda, D. Higuchi, T. Yamamoto, Y. Nakamura, Y. Masuda, T. Hirabayashi, and K. Nakaya, Purification and characterization of bleomycin hydrolase, which represents a new family of cysteine proteases, from rat skin. J. Biochem. (Tokyo). 119, 29-36 (1996).

51. T. Ohnuma, J.F. Holland, H. Masuda, J.A. Waligund, and G.A. Goldberg, Microbiological Assay of Bleomycin - Inactivation, Tissue Distribution, and Clearance. Cancer 33, 1230-1238 (1974).

52. L.F. Povirk, Y.H. Han, and R.J. Steighner, Structure of Bleomycin- Induced Dna Double-Strand Breaks - Predominance of Blunt Ends and Single-Base 5' Extensions. Biochemistry (Mosc). 28, 5808-5814 (1989).

53. J.R. Kanofsky, Singlet Oxygen Production by Bleomycin - A Comparison with Heme-Containing Compounds. J. Biol. Chem. 261, 3546-3550 (1986).

54. J.A. Madri and H. Furthmayr, Collagen Polymorphism in the Lung - An Immunochemical Study of Pulmonary Fibrosis. Hum. Pathol. 11, 353-366 (1980).

55. Food and Drug Administration, Blenoxane. Accessed February 26, 2008 , (2008).

164 56. G. Rodrigues, M. Lock, D. D'Souza, E. Yu, and J. Van Dyk, Prediction of radiation pneumonitis by dose-volume histogram parameters in lung cancer--a systematic review. Radiother. Oncol. 71, 127-138 (2004).

57. R.A. Rosiello and W.W. Merrill, Radiation-Induced Lung Injury. Clin. Chest Med. 11, 65-71 (1990).

58. R.P. Abratt and G.W. Morgan, Lung toxicity following chest irradiation in patients with lung cancer. Lung Cancer 35, 103-109 (2002).

59. Canadian Center for Occupational Health and Safety, Quantities and Units of Ionizing Radiation. Accessed February 28, 2008 http://www.ccohs.ca/oshanswers/phys_agents/ionizing.html

60. C.K. Haston, C.I. Amos, T.M. King, and E.L. Travis, Inheritance of susceptibility to bleomycin-induced pulmonary fibrosis in the mouse. Cancer Res. 56, 2596-2601 (1996).

61. J. Sharplin and A.J. Franko, A Quantitative Histological Study of Strain- Dependent Differences in the Effects of Irradiation on Mouse Lung During the Early Phase. Radiat. Res. 119, 1-14 (1989).

62. C.K. Haston, X. Zhou, L. Gumbiner-Russo, R. Irani, R. Dejournett, X. Gu, M. Weil, C.I. Amos, and E.L. Travis, Universal and radiation-specific loci influence murine susceptibility to radiation-induced pulmonary fibrosis. Cancer Res. 62, 3782-3788 (2002).

63. L.H. Burch and D.A. Schwartz, Finding Fibrosis Genes, The Lung, chapter from the book Fibrosis Research: Methods and Protocols, Varga,J.; Brenner,D.A.; Phan,S.H., Humana Press, Totowa. 392p (2005).

64. A. Chadt, K. Leicht, A. Deshmukh, L.Q. Jiang, S. Scherneck, U. Bernhardt, T. Dreja, H. Vogel, K. Schmolz, R. Kluge et al. Tbc1d1 mutation in lean mouse strain confers leanness and protects from diet- induced obesity. Nat. Genet. 40, 1354-1359 (2008).

65. E.S. Lander and D. Botstein, Mapping Mendelian Factors Underlying Quantitative Traits Using Rflp Linkage Maps. Genetics 121, 185-199 (1989).

66. D.A. Roff, A centennial celebration for quantitative genetics. Evolution 61, 1017-1032 (2007).

67. C.K. Haston, M. Wang, R.E. Dejournett, X. Zhou, D. Ni, X. Gu, T.M. King, M.M. Weil, R.A. Newman, C.I. Amos et al. Bleomycin hydrolase and a genetic locus within the MHC affect risk for pulmonary fibrosis in mice. Hum. Mol. Genet. 11, 1855-1863 (2002).

165 68. R.K. Barth, L.A. Hanchett, and C.M. Baecher-Allan, Mapping susceptibility genes for the induction of pulmonary fibrosis in mice. Chest 121, 21S-21S (2002).

69. A.K. Bauer, A.M. Malkinson, and S.R. Kleeberger, Susceptibility to neoplastic and non-neoplastic pulmonary diseases in mice: genetic similarities. American Journal of Physiology-Lung Cellular and Molecular Physiology 287, L685-L703 (2004).

70. S.R. Kleeberger, R.C. Levitt, L.Y. Zhang, M. Longphre, L. Harkema, A. Jedlicka, S.M. Eleff, D. DiSilvestre, and K.J. Holroyd, Linkage analysis of susceptibility to ozone-induced lung inflammation in inbred mice. Nat. Genet. 17, 475-478 (1997).

71. Y. Ohtsuka, K.J. Brunson, A.E. Jedlicka, W. Mitzner, R.W. Clarke, L.Y. Zhang, S.M. Eleff, and S.R. Kleeberger, Genetic linkage analysis of susceptibility to particle exposure in mice. Am. J. Respir. Cell Mol. Biol. 22, 574-581 (2000).

72. A. Fortin, E. Diez, D. Rochefort, L. Laroche, D. Malo, G.A. Rouleau, P. Gros, and E. Skamene, Recombinant congenic strains derived from A/J and C57BL/6J: a tool for genetic dissection of complex traits. Genomics 74, 21-35 (2001).

73. K.F. Manly, R.H. Cudmore, and J.M. Meer, Map manager QTX, cross- platform software for genetic mapping. Mamm. Genome 12, 930-932 (2001).

74. K.W. Broman, H. Wu, S. Sen, and G.A. Churchill, R/qtl: QTL mapping in experimental crosses. Bioinformatics 19, 889-890 (2003).

75. G. Min-Oo, A. Fortin, M.F. Tam, A. Nantel, M.M. Stevenson, and P. Gros, Pyruvate kinase deficiency in mice protects against malaria. Nat. Genet. 35, 357-362 (2003).

76. M.F. Roy, N. Riendeau, J.C. Loredo-Osti, and D. Malo, Complexity in the host response to Salmonella Typhimurium infection in AcB and BcA recombinant congenic strains. Genes and Immunity 7, 655-666 (2006).

77. K.J. Gill and A.E. Boyle, Confirmation of quantitative trait loci for cocaine-induced activation in the AcB/BcA series of recombinant congenic strains. Pharmacogenetics 13, 329-338 (2003).

78. L.L. Peters, R.F. Robledo, C.J. Bult, G.A. Churchill, B.J. Paigen, and K.L. Svenson, The mouse as a model for human biology: a resource guide for complex trait analysis. Nat Rev Genet 8, 58-69 (2007).

166 79. P. Demant, Cancer susceptibility in the mouse: Genetics, biology and implications for human cancer. Nat Rev Genet 4, 721-734 (2003).

80. J. Flint, W. Valdar, S. Shifman, and R. Mott, Strategies for mapping and cloning quantitative trait genes in rodents. Nat Rev Genet 6, 271-286 (2005).

81. O. Abiola, J.M. Angel, P. Avner, A.A. Bachmanov, J.K. Belknap, B. Bennett, E.P. Blankenhorn, D.A. Blizard, V. Bolivar, G.A. Brockmann et al. The nature and identification of quantitative trait loci: a community's view. Nat Rev Genet 4, 911-916 (2003).

82. J.B. Singer, A.E. Hill, L. Burrage, K.R. Olszens, J.H. Song, M. Justice, W.E. O'Brien, D.V. Conti, J.S. Witte, E.S. Lander et al. Genetic dissection of complex traits with chromosome substitution strains of mice. Science 304, 445-448 (2004).

83. J.H. Nadeau, J.B. Singer, A. Matin, and E.S. Lander, Analysing complex genetic traits with chromosome substitution strains. Nat. Genet. 24, 221- 225 (2000).

84. W.B. Fulton, R.H. Reeves, M. Takeya, and A. De Maio, A quantitative trait loci analysis to map genes involved in lipopolysaccharide-induced inflammatory response: Identification of macrophage scavenger receptor 1 as a candidate gene. J. Immunol. 176, 3767-3773 (2006).

85. S.L. Burgess-Herbert, A. Cox, S.W. Tsaih, and B. Paigen, Practical Applications of the Bioinformatics Toolbox for Narrowing Quantitative Trait Loci. Genetics 180, 2227-2235 (2008).

86. K.A. Frazer, E. Eskin, H.M. Kang, M.A. Bogue, D.A. Hinds, E.J. Beilharz, R.V. Gupta, J. Montgomery, M.M. Morenzoni, G.B. Nilsen et al. A sequence-based variation map of 8.27 million SNPs in inbred mouse strains. Nature 448, 1050-1053 (2007).

87. G. Manenti, A. Galvan, A. Pettinicchio, G. Trincucci, E. Spada, A. Zolin, S. Milani, A. Gonzalez-Neira, and T.A. Dragani, Mouse Genome-Wide Association Mapping Needs Linkage Analysis to Avoid False-Positive Loci. Plos Genetics 5, (2009).

88. P.Y. Liu, Y. Wang, H. Vikis, A. Maciag, D.L. Wang, Y. Lu, Y. Liu, and M. You, Candidate lung tumor susceptibility genes identified through whole-genome association analyses in inbred mice. Nat. Genet. 38, 888- 895 (2006).

89. B.M. Nathan, C.A. Hodges, P.J. Supelak, L.C. Burrage, J.H. Nadeau, and M.R. Palmert, A quantitative trait locus on chromosome 6 regulates the onset of puberty in mice. Endocrinology 147, 5132-5138 (2006).

167 90. M.W. Pfaffl, A new mathematical model for relative quantification in real- time RT-PCR. Nucleic Acids Res. 29, (2001).

91. M. Wang, Z.Q. Zhang, Z. Zhang, H. Vikis, Y. Yan, Y. Yan, Y. Wang, and M. You, Fine mapping and candidate gene analyses of Pulmonary adenoma resistance 1, a major genetic determinant of mouse lung adenoma resistance. Cancer Res. 67, 2508-2516 (2007).

92. D.J. Lockhart, H.L. Dong, M.C. Byrne, M.T. Follettie, M.V. Gallo, M.S. Chee, M. Mittmann, C.W. Wang, M. Kobayashi, H. Horton et al. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat. Biotechnol. 14, 1675-1680 (1996).

93. N. Kaminski, J.D. Allard, J.F. Pittet, F.G. Zuo, M.J.D. Griffiths, D. Morris, X.Z. Huang, D. Sheppard, and R.A. Heller, Global analysis of gene expression in pulmonary fibrosis reveals distinct programs regulating lung inflammation and fibrosis. Proc. Natl. Acad. Sci. U. S. A. 97, 1778- 1783 (2000).

94. S. Katsuma, K. Nishi, K. Tanigawara, H. Ikawa, S. Shiojima, K. Takagaki, Y. Kaminishi, Y. Suzuki, A. Hirasawa, T. Ohgi et al. Molecular monitoring of bleomycin-induced pulmonary fibrosis by cDNA microarray-based gene expression profiling. Biochem. Biophys. Res. Commun. 288, 747-751 (2001).

95. W.J. Lemon, C.H. Swinton, M. Wang, N. Berbari, Y. Wang, and M. You, Single nucleotide polymorphism (SNP) analysis of mouse pulmonary adenoma susceptibility loci 1-4 for identification of candidate genes. J. Med. Genet. 40, (2003).

96. S.R. Kleeberger and D.A. Schwartz, From quantitative trait locus to gene - A work in progress. Am. J. Respir. Crit. Care Med. 171, 804-805 (2005).

97. K. Kawai and H. Akaza, Bleomycin-induced pulmonary toxicity in chemotherapy for testicular cancer. Expert Opinion on Drug Safety 2, 587- 596 (2003).

98. P.B. Bitterman and R.G. Crystal, Is There A Fibrotic Gene. Chest 78, 549- 550 (1980).

99. R.P. Marshall, R.J. McAnulty, and G.J. Laurent, The pathogenesis of pulmonary fibrosis: Is there a fibrosis gene? Int J Biochem Cell Biol 29, 107-120 (1997).

100. G.A. Rossi, S. Szapiel, V.J. Ferrans, and R.G. Crystal, Susceptibility to Experimental Interstitial Lung-Disease Is Modified by Immune-Related and Non-Immune-Related Genes. Am. Rev. Respir. Dis. 135, 448-455 (1987).

168 101. A. Fortin, L.R. Cardon, M. Tam, E. Skamene, M.M. Stevenson, and P. Gros, Identification of a malaria new susceptibility locus (Char4) in recombinant congenic strains of mice. Proc. Natl. Acad. Sci. U. S. A. 98, 10793-10798 (2001).

102. G.T. Cicila, M.R. Garrett, S.J. Lee, J. Liu, H. Dene, and J.P. Rapp, High- resolution mapping of the blood pressure QTL on chromosome 7 using Dahl rat congenic strains. Genomics 72, 51-60 (2001).

103. D.N. Cook, S.B. Wang, Y.H. Wang, G.P. Howles, G.S. Whitehead, K.G. Berman, T.D. Church, B.C. Frank, R.M. Gaspard, Y. Yu et al. Genetic regulation of endotoxin-induced airway disease. Genomics 83, 961-969 (2004).

104. E. Lander and L. Kruglyak, Genetic Dissection of Complex Traits - Guidelines for Interpreting and Reporting Linkage Results. Nat. Genet. 11, 241-247 (1995).

105. S. Perkowski, J. Sun, S. Singhal, J. Santiago, G.D. Leikauf, and S.M. Albelda, Gene expression profiling of the early pulmonary response to hyperoxia in mice. Am. J. Respir. Cell Mol. Biol. 28, 682-696 (2003).

106. J.P. Novak, R. Sladek, and T.J. Hudson, Characterization of variability in large-scale gene expression data: Implications for study design. Genomics 79, 104-113 (2002).

107. R. Ihaka and R. Gentleman, R: A Language for Data Analysis and Graphics. Journal of Computational and Graphical Statistics 5, 299-314 (/9).

108. R.A. Irizarry, B.M. Bolstad, F. Collin, L.M. Cope, B. Hobbs, and T.P. Speed, Summaries of affymetrix GeneChip probe level data. Nucleic Acids Res. 31, (2003).

109. I. Lonnstedt and T. Speed, Replicated microarray data. Statistica Sinica 12, 31-46 (2002).

110. G.K. Smyth, Linear Models and Empirical Bayes Methods for Assessing Differential Expression in Microarray Experiments. Statistical Applications in Genetics and Molecular Biology 3, (2004).

111. C.K. Haston, T.G. Tomko, N. Godin, L. Kerckhoff, and M.T. Hallett, Murine candidate bleomycin induced pulmonary fibrosis susceptibility genes identified by gene expression and sequence analysis of linkage regions. J. Med. Genet. 42, 464-473 (2005).

112. R.C. Gentleman, V.J. Carey, D.M. Bates, B. Bolstad, M. Dettling, S. Dudoit, B. Ellis, L. Gautier, Y.C. Ge, J. Gentry et al. Bioconductor: open

169 software development for computational biology and bioinformatics. Genome Biology 5, R80 (2004).

113. S. Rozen and H. Skaletsky, Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365-386 (2000).

114. X.W. Wang and B. Seed, A PCR primer bank for quantitative gene expression analysis. Nucleic Acids Res. 31, (2003).

115. J. Winer, C.K.S. Jung, I. Shackel, and P.M. Williams, Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro. Anal. Biochem. 270, 41-49 (1999).

116. E.C. Gabazza, O. Taguchi, and Y. Adachi, Bleomycin-induced lung fibrosis: The authors should have used another method to induce pulmonary lesions resembling human idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 165, 845-846 (2002).

117. E.S. Chen, B.M. Greenlee, M. Wills-Karp, and D.R. Moller, Attenuation of lung inflammation and fibrosis in interferon-gamma-deficient mice after intratracheal bleomycin. Am. J. Respir. Cell Mol. Biol. 24, 545-555 (2001).

118. A.M. Malkinson, R.A. Radcliffe, and A.K. Bauer, Quantitative trait locus mapping of susceptibilities to butylated hydroxytoluene-induced lung tumor promotion and pulmonary inflammation in CXB mice. Carcinogenesis 23, 411-417 (2002).

119. N. Streichenberger, S. Peyrol, F. Philit, R. Loire, P. Sommer, and J.F. Cordier, Constrictive bronchiolitis obliterans - Characterisation of fibrogenesis and lysyl oxidase expression patterns. Virchows Archiv-An International Journal of Pathology 439, 78-84 (2001).

120. E. Cavarra, F. Carraro, S. Fineschi, A. Naldini, B. Bartalesi, A. Pucci, and G. Lungarella, Early response to bleomycin is characterized by different cytokine and cytokine receptor profiles in lungs. American Journal of Physiology-Lung Cellular and Molecular Physiology 287, L1186-L1192 (2004).

121. J.R. Carver, C.L. Shapiro, A. Ng, L. Jacobs, C. Schwartz, K.S. Virgo, K.L. Hagerty, M.R. Somerfield, and D.J. Vaughn, American Society of Clinical Oncology clinical evidence review on the ongoing care of adult cancer survivors: Cardiac and pulmonary late effects. Journal of Clinical Oncology 25, 3991-4008 (2007).

122. G. Giotopoulos, R.P. Symonds, K. Foweraker, M. Griffin, I. Peat, A. Osman, and M. Plumb, The late radiotherapy normal tissue injury

170 phenotypes of telangiectasia, fibrosis and atrophy in breast cancer patients have distinct genotype-dependent causes. British Journal of Cancer 96, 1001-1007 (2007).

123. S. Quarmby, H. Fakhoury, E. Levine, J. Barber, J. Wylie, A.H. Hajeer, C. West, A. Stewart, B. Magee, and S. Kumar, Association of transforming growth factor beta-1 single nucleotide polymorphisms with radiation- induced damage to normal tissues in breast cancer patients. International Journal of Radiation Biology 79, 137-143 (2003).

124. A. Burkhardt, Alveolitis and Collapse in the Pathogenesis of Pulmonary Fibrosis. American Review of Respiratory Disease 140, 513-524 (1989).

125. N. Takigawa, Y. Segawa, T. Saeki, M. Kataoka, M. Ida, D. Kishino, K. Fujiwara, S. Ohsumi, K. Eguchi, and S. Takashima, Bronchiolitis obliterans organizing pneumonia syndrome in breast-conserving therapy for early breast cancer: Radiation-induced lung toxicity. International Journal of Radiation Oncology Biology Physics 48, 751-755 (2000).

126. C.K. Haston, M. Begin, G. Dorion, and S.M. Cory, Distinct Loci Influence Radiation-Induced Alveolitis from Fibrosing Alveolitis in the Mouse. Cancer Res 67, 10796-10803 (2007).

127. B. Piavaux, P.V. Jeurink, P.C. Groot, G.A. Hofman, P. Demant, and A.J.M. Van Oosterhout, Mouse genetic model for antigen-induced airway manifestations of asthma. Genes and Immunity 8, 28-34 (2007).

128. D.R. Prows and M.L. Horner, Parental genetic contributions in the AXB and BXA recombinant inbred mouse strains. Mammalian Genome 13, 127-133 (2002).

129. A.M. Lemay and C.K. Haston, Bleomycin-induced pulmonary fibrosis susceptibility genes in AcB/BcA recombinant congenic mice. Physiol Genomics 23, 54-61 (2005).

130. T.J. O'Brien, S. Letuve, and C.K. Haston, Radiation-induced strain differences in mouse alveolar inflammatory cell apoptosis. Can. J. Physiol Pharmacol. 83, 117-122 (2005).

131. A. Safwat, O.S. Nielsen, S. ElBadawy, and J. Overgaard, Effect of radiation dose rate and cyclophosphamide on pulmonary toxicity after total body irradiation in a mouse model. International Journal of Radiation Oncology Biology Physics 34, 85-91 (1996).

132. D.N. Cook, G.S. Whitehead, L.H. Burch, K.G. Berman, Z. Kapadia, C. Wohlford-Lenane, and D.A. Schwartz, Spontaneous mutations in recombinant inbred mice: Mutant toll-like receptor 4 (Tlr4) in BXD29 mice. Genetics 172, 1751-1755 (2006).

171 133. J. Sharplin and A.J. Franko, A Quantitative Histological Study of Strain- Dependent Differences in the Effects of Irradiation on Mouse Lung During the Intermediate and Late Phases. Radiation Research 119, 15-31 (1989).

134. E. Crouch, Pathobiology of Pulmonary Fibrosis. Am. J. Physiol. 259, L159-L184 (1990).

135. M. Selman, T.E. King, and A. Pardo, Idiopathic pulmonary fibrosis: Prevailing and evolving hypotheses about its pathogenesis and implications for therapy. Ann. Intern. Med. 134, 136-151 (2001).

136. P.F. Piguet, M.A. Collart, G.E. Grau, Y. Kapanci, and P. Vassalli, Tumor Necrosis Factor Cachectin Plays A Key Role in Bleomycin-Induced Pneumonopathy and Fibrosis. J. Exp. Med. 170, 655-663 (1989).

137. M.H.V. Lake-Bullock, J. Zhu, H. Hao, D.A. Cohen, and A.M. Kaplan, T cell independence of bleomycin-induced pulmonary fibrosis. J. Leukoc. Biol. 65, 187-195 (1999).

138. J. Zhu, D.A. Cohen, S.N. Goud, and A.M. Kaplan, Contribution of T lymphocytes to the development of bleomycin-induced pulmonary fibrosis. Ann. N. Y. Acad. Sci. 796, 194-202 (1996).

139. F. Chua, J. Gauldie, and G.J. Laurent, Pulmonary Fibrosis: Searching for Model Answers. Am. J. Respir. Cell Mol. Biol. 33, 9-13 (2005).

140. B.B. Moore and C.M. Hogaboam, Murine models of pulmonary fibrosis. Am J Physiol Lung Cell Mol Physiol 294, L152-L160 (2008).

141. A.M. Lemay and C.K. Haston, Radiation-induced lung response of AcB/BcA recombinant congenic mice. Radiat. Res. 170, 299-306 (2008).

142. W.M. Yokoyama and B.F.M. Plougastel, Immune functions encoded by the natural killer gene complex. Nat Rev Immunol 3, 304-316 (2003).

143. M.F. Proteau, E. Rousselle, and A.P. Makrigiannis, Mapping of the BALB/c Ly49 cluster defines a minimal natural killer cell receptor gene repertoire. Genomics 84, 669-677 (2004).

144. S.G. Kaminsky, I. Nakamura, and G. Cudkowicz, Selective Defect of Natural-Killer and Killer Cell-Activity Against Lymphomas in Sjl Mice - Low Responsiveness to Interferon Inducers. J. Immunol. 130, 1980-1984 (1983).

145. A.L. Whyte and S.C. Miller, Strain differences in natural killer cell- mediated immunity among mice: A possible mechanism for the low natural killer cell activity of A/J mice. Immunobiology 199, 23-38 (1998).

172 146. M. Du, R.A. Irani, D.N. Stivers, S.J. Lee, and E.L. Travis, H2-Ea deficiency is a risk factor for bleomycin-induced lung fibrosis in mice. Cancer Res. 64, 6835-6839 (2004).

147. S. Skov, P. Klausen, and M.H. Claesson, Ligation of major histocompatability complex (MHC) class I molecules on human T cells induces cell death through PI-3 kinase-induced c-jun NH2-terminal kinase activity: A novel apoptotic pathway distinct from fas-induced apoptosis. J. Cell Biol. 139, 1523-1531 (1997).

148. S. Kim, K. Iizuka, H.L. Aguila, I.L. Weissman, and W.M. Yokoyama, In vivo natural killer cell activities revealed by natural killer cell-deficient mice. Proc. Natl. Acad. Sci. U. S. A. 97, 2731-2736 (2000).

149. M. Zijlstra, M. Bix, N.E. Simister, J.M. Loring, D.H. Raulet, and R. Jaenisch, Beta-2-Microglobulin Deficient Mice Lack Cd4-8+ Cytolytic T- Cells. Nature 344, 742-746 (1990).

150. S.C. Whitman, D.L. Rateri, S.J. Szilvassy, W. Yokoyama, and A. Daugherty, Depletion of natural killer cell function decreases atherosclerosis in low-density lipoprotein receptor null mice. Arterioscler Thromb Vasc Biol 24, 1049-1054 (2004).

151. L. Shi, K. Takahashi, J. Dundee, S. Shahroor-Karni, S. Thiel, J.C. Jensenius, F. Gad, M.R. Hamblin, K.N. Sastry, and R.A.B. Ezekowitz, Mannose-binding lectin-deficient mice are susceptible to infection with Staphylococcus aureus. J. Exp. Med. 199, 1379-1390 (2004).

152. C.K. Haston, S. Cory, L. Lafontaine, G. Dorion, and M.T. Hallett, Strain- dependent pulmonary gene expression profiles of a cystic fibrosis mouse model. Physiol. Genomics 25, 336-345 (2006).

153. C.K. Haston, S. Cory, L. Lafontaine, G. Dorion, and M.T. Hallett, Strain- dependent pulmonary gene expression profiles of a cystic fibrosis mouse model. Physiol. Genomics 25, 336-345 (2006).

154. K.J. Livak and T.D. Schmittgen, Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 25, 402-408 (2001).

155. N.K. Banda, K. Takahashi, A.K. Wood, V.M. Holers, and W.P. Arend, Pathogenic complement activation in collagen antibody-induced arthritis in mice requires amplification by the alternative pathway. J. Immunol. 179, 4101-4109 (2007).

156. Jackson Laboratory, MHC H2 Haplotypes. Section 12-Appendix 1 (2009). http://jaxmice.jax.org/literature/catalog/mhc_h2_haplotypes.pdf

173 157. E. Addis-Lieser, J. Kohl, and M.G. Chiaramonte, Opposing regulatory roles of complement factor 5 in the development of bleomycin-induced pulmonary fibrosis. J. Immunol. 175, 1894-1902 (2005).

158. C.A. Blanchong, E.K. Chung, K.L. Rupert, Y. Yang, Z.Y. Yang, B. Zhou, J.M. Moulds, and C.Y. Yu, Genetic, structural and functional diversities of human complement components C4A and C4B and their mouse homologues, Slp and C4. International Immunopharmacology 1, 365-392 (2001).

159. P.C. Ng and S. Henikoff, SIFT: predicting amino acid changes that affect protein function. Nucleic Acids Res. 31, 3812-3814 (2003).

160. D.R. Karp, K.L. Parker, D.C. Shreffler, and J.D. Capra, Characterization of the Murine C-4 Precursor (Pro-C4) - Evidence That the Carboxy- Terminal Subunit Is the C-4 Gamma-Chain. J. Immunol. 126, 2060-2061 (1981).

161. N. Blom, S. Gammeltoft, and S. Brunak, Sequence and structure-based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 294, 1351-1362 (1999).

162. M.S. Bolger, D.S. Ross, H.X. Jiang, M.M. Frank, A.J. Ghio, D.A. Schwartz, and J.R. Wright, Complement levels and activity in the normal and LPS-injured lung. American Journal of Physiology-Lung Cellular and Molecular Physiology 292, L748-L759 (2007).

163. S.N. Pattanakitsakul, J.H. Zheng, S. Natsuumesakai, M. Takahashi, and M. Nonaka, Aberrant Splicing Caused by the Insertion of the B2 Sequence Into An Intron of the Complement C4 Gene Is the Basis for Low C4 Production in H-2K Mice. J. Biol. Chem. 267, 7814-7820 (1992).

164. S.V. Petersen, S. Thiel, L. Jensen, T. Vorup-Jensen, C. Koch, and J.C. Jensenius, Control of the classical and the MBL pathway of complement activation. Mol. Immunol. 37, 803-811 (2000).

165. A. Boyle and K. Gill, Genetic analysis of the psychostimulant effects of nicotine in chromosome substitution strains and F2 crosses derived from A/J and C57BL/6J progenitors. Mamm. Genome 20, 34-42 (2009).

166. D.H. Jiang, J.R. Liang, J. Hodge, B. Lu, Z. Zhu, S. Yu, J. Fan, Y.F. Gao, Z.N. Yin, R. Homer et al. Regulation of pulmonary fibrosis by chemokine receptor CXCR3. J. Clin. Invest. 114, 291-299 (2004).

167. M.J. Segel, G. Izbicki, P.Y. Cohen, R. Or, T.G. Christensen, S.B. Wallach-Dayan, and R. Breuer, Role of interferon-{gamma} in the evolution of murine bleomycin lung fibrosis. Am J Physiol Lung Cell Mol Physiol 285, L1255-L1262 (2003).

174 168. H. Miyazaki, K. Kuwano, K. Yoshida, T. Maeyama, M. Yoshimi, M. Fujita, N. Hagimoto, R. Yoshida, and Y. Nakanishi, The perforin mediated apoptotic pathway in lung injury and fibrosis. J. Clin. Pathol. 57, 1292- 1298 (2004).

169. M.E. Lambert, Z.A. Ronai, I.B. Weinstein, and J.I. Garrels, Enhancement of Major Histocompatibility Class-I Protein-Synthesis by Dna Damage in Cultured Human-Fibroblasts and Keratinocytes. Mol. Cell. Biol. 9, 847- 850 (1989).

170. C.Y. Teoh and K.J.A. Davies, Potential roles of protein oxidation and the immunoproteasome in MHC class I antigen presentation: the 'PrOxI' hypothesis. Arch. Biochem. Biophys. 423, 88-96 (2004).

171. M.C. Coles and D.H. Raulet, Class-I Dependence of the Development of Cd4+Cd8-Nk1.1+ Thymocytes. J. Exp. Med. 180, 395-399 (1994).

172. N.S. Liao, M. Bix, M. Zijlstra, R. Jaenisch, and D. Raulet, Mhc Class-I Deficiency - Susceptibility to Natural-Killer (Nk) Cells and Impaired Nk Activity. Science 253, 199-202 (1991).

173. T. Kimura, Y. Ishii, Y. Morishima, A. Shibuya, K. Shibuya, M. Taniguchi, M. Mochizuki, A.E. Hegab, T. Sakamoto, A. Nomura et al. Treatment with alpha-galactosylceramide attenuates the development of bleomycin- induced pulmonary fibrosis. J. Immunol. 172, 5782-5789 (2004).

174. J.H. Kim, H.Y. Kim, S. Kim, J.H. Chung, W.S. Park, and D.H. Chung, Natural killer T (NKT) cells attenuate bleomycin-induced pulmonary fibrosis by producing interferon-gamma. Am. J. Pathol. 167, 1231-1241 (2005).

175. M. Zorzetto, L. Ferrarotti, R. Trisolini, L.L. Agli, R. Scabini, M. Novo, A. De Silvestri, M. Patelli, M. Martinetti, M. Cuccia et al. Complement receptor 1 gene polymorphisms are associated with idiopathic pulmonary fibrosis. Am. J. Respir. Crit. Care Med. 168, 330-334 (2003).

176. S.H. Phan and R.S. Thrall, Inhibition of Bleomycin-Induced Pulmonary Fibrosis by Cobra Venom Factor. Am. J. Pathol. 107, 25-28 (1982).

177. S.C. Grubb, T.P. Maddatu, C.J. Bult, and M.A. Bogue, Mouse Phenome Database. Nucleic Acids Res. 37, D720-D730 (2009).

178. L.A. Trouw, A.M. Blom, and P. Gasque, Role of complement and complement regulators in the removal of apoptotic cells. Mol. Immunol. 45, 1199-1207 (2008).

179. G.O. Till, K.J. Johnson, R. Kunkel, and P.A. Ward, Intravascular Activation of Complement and Acute Lung Injury - Dependency on

175 Neutrophils and Toxic Oxygen Metabolites. J. Clin. Invest. 69, 1126-1135 (1982).

180. M.B. Fischer, M.H. Ma, S. Goerg, X.N. Zhou, J.R. Xia, O. Finco, S.H. Han, G. Kelsoe, R.G. Howard, T.L. Rothstein et al. Regulation of the B cell response to T-dependent antigens by classical pathway complement. J. Immunol. 157, 549-556 (1996).

181. A.M. Tager, R.L. Kradin, P. LaCamera, S.D. Bercury, G.S.V. Campanella, C.P. Leary, V. Polosukhin, L.H. Zhao, H. Sakamoto, T.S. Blackwell et al. Inhibition of pulmonary fibrosis by the chemokine IP-10/CXCL10. American Journal of Respiratory Cell and Molecular Biology 31, 395-404 (2004).

182. R.C. Davis, E.E. Schadt, A.C.L. Cervino, M. Peterfy, and A.J. Lusis, Ultrafine mapping of SNPs from mouse strains C57BL/6J, DBA/2J, and C57BLKS/J for loci contributing to diabetes and atherosclerosis susceptibility. Diabetes 54, 1191-1199 (2005).

183. T. Robson, M.C. Joiner, G.D. Wilson, W. McCullough, M.E. Price, I. Logan, H. Jones, S.R. McKeown, and D.G. Hirst, A novel human stress response-related gene with a potential role in induced radioresistance. Radiat. Res. 152, 451-461 (1999).

184. F. Elefteriou, J.Y. Exposito, R. Garrone, and C. Lethias, Cell adhesion to tenascin-X - Mapping of cell adhesion sites and identification of integrin receptors. Eur. J. Biochem. 263, 840-848 (1999).

185. V.J. Bolivar, M.N. Cook, and L. Flaherty, Mapping of quantitative trait loci with knockout/congenic strains. Genome Res. 11, 1549-1552 (2001).

186. L.C. Schalkwyk, C. Fernandes, M.W. Nash, K. Kurrikoff, E. Vasar, and S. Koks, Interpretation of knockout experiments: the congenic footprint. Genes Brain and Behavior 6, 299-303 (2007).

187. Jackson Laboratory, JAX partners in international mouse sequencing project. Jax Notes Spring 2009, (2009) http://jaxmice.jax.org/ jaxnotes/513/513.pdf.

176 Appendix

Supplementary table 1

Symbol Name AJ/B6 P.Value UniGene ID H2-D1 histocompatibility 2, D region locus 1 67.18 1.27E-16 Mm.33263 H2-K histocompatibility 2, K region 36.25 1.85E-16 Mm.288170 1300006M19Rik RIKEN cDNA 1300006M19 gene 5.58 2.48E-13 Mm.18814 Rpgrip1 retinitis pigmentosa GTPase regulator interacting protein 1 0.16 2.63E-13 Mm.21662 Myh6 myosin, heavy polypeptide 6, cardiac muscle, alpha 5.35 3.78E-12 Mm.290003 A930025J12Rik RIKEN cDNA A930025J12 gene 4.14 1.25E-11 Mm.260712 Cap1 CAP, adenylate cyclase-associated protein 1 (yeast) 6.11 1.59E-11 Mm.8687 Runx1 runt related transcription factor 1 0.32 1.69E-11 Mm.162974 Bst1 bone marrow stromal cell antigen 1 0.24 1.69E-11 Mm.246332 Sfrp1 secreted frizzled-related sequence protein 1 0.15 1.69E-11 Mm.281691 H2-Q1 histocompatibility 2, Q region locus 1 3.39 2.96E-11 Mm.214762 Gbp1 guanylate nucleotide binding protein 1 7.06 3.88E-11 Mm.250 Glo1 glyoxalase 1 3.25 3.88E-11 Mm.261984 Pla2g1b phospholipase A2, group IB, pancreas 2.68 7.89E-11 Mm.20190 Adprtl3 ADP-ribosyltransferase (NAD+; poly (ADP-ribose polymerase)-like 3 0.39 8.75E-11 Mm.273659 3010033P07Rik RIKEN cDNA 3010033P07 gene 0.16 1.03E-10 Mm.13944 Ifi205 interferon activated gene 205 0.22 1.36E-10 Mm.255414 4833417L20Rik RIKEN cDNA 4833417L20 gene 0.26 1.70E-10 Mm.196382 --- Mus musculus transcribed sequences 0.30 1.98E-10 Mm.332738 Fmo1 flavin containing monooxygenase 1 2.69 2.62E-10 Mm.976 Stk25 serine/threonine kinase 25 (yeast) 0.27 3.04E-10 Mm.28761 Prdx2 peroxiredoxin 2 0.34 3.40E-10 Mm.270130 Alad aminolevulinate, delta-, dehydratase 3.86 3.69E-10 Mm.90076 Nptx1 neuronal pentraxin 1 3.48 4.25E-10 Mm.5142 Pigo phosphatidylinositol glycan, class O 0.43 1.21E-09 Mm.143738 Wars tryptophanyl-tRNA synthetase 0.31 1.33E-09 Mm.38433 C1qg complement component 1, q subcomponent, gamma polypeptide 0.18 1.33E-09 Mm.3453 Sc5d sterol-C5-desaturase (fungal ERG3, delta-5-desaturase) homolog (S. cerevisae) 0.41 1.55E-09 Mm.32700 BC031593 cDNA sequence BC031593 4.82 1.68E-09 Mm.162744 Cyp4b1 cytochrome P450, family 4, subfamily b, polypeptide 1 2.35 1.68E-09 Mm.1840 Thbs1 thrombospondin 1 0.17 1.71E-09 Mm.4159 Cftr cystic fibrosis transmembrane conductance regulator homolog 2.55 1.74E-09 Mm.15621 Col1a2 procollagen, type I, alpha 2 0.19 1.74E-09 Mm.277792 C1qb complement component 1, q subcomponent, beta polypeptide 0.16 2.29E-09 Mm.2570 Gas5 growth arrest specific 5 3.39 2.39E-09 Mm.270065 Mfap5 microfibrillar associated protein 5 0.34 2.41E-09 Mm.41931 2610104C07Rik RIKEN cDNA 2610104C07 gene 0.54 4.54E-09 Mm.289086 Fstl1 follistatin-like 1 0.31 5.22E-09 Mm.182434 Rgs18 regulator of G-protein signaling 18 2.55 5.66E-09 Mm.253927 Ifi202b interferon activated gene 202B 3.48 6.38E-09 Mm.218770 Col1a1 procollagen, type I, alpha 1 0.20 7.83E-09 Mm.277735 Temt thioether S-methyltransferase 2.36 9.11E-09 Mm.299 1300011C24Rik RIKEN cDNA 1300011C24 gene 0.30 1.02E-08 Mm.186 Slc15a2 solute carrier family 15 (H+/peptide transporter), member 2 0.50 1.13E-08 Mm.281804 Cryac crystallin, alpha C 0.53 1.14E-08 Mm.21549 C1qa complement component 1, q subcomponent, alpha polypeptide 0.24 1.17E-08 Mm.370 Cd84 CD84 antigen 0.41 1.18E-08 Mm.259115 1110033J19Rik RIKEN cDNA 1110033J19 gene 0.26 1.18E-08 Mm.3572 9130020G10Rik RIKEN cDNA 9130020G10 gene 1.85 1.26E-08 Mm.252312 Myo7a myosin VIIa 0.55 1.30E-08 Mm.1403 Ltbp2 latent transforming growth factor beta binding protein 2 0.41 1.47E-08 Mm.3900 Fgfr4 fibroblast growth factor receptor 4 2.10 1.51E-08 Mm.276715 BC022687 cDNA sequence BC022687 2.46 1.65E-08 Mm.186678 2810014D17Rik RIKEN cDNA 2810014D17 gene 0.55 2.34E-08 Mm.41622 2210418I02Rik RIKEN cDNA 2210418I02 gene 0.57 2.39E-08 Mm.73682 Thrsp thyroid hormone responsive SPOT14 homolog (Rattus) 1.98 2.47E-08 Mm.28585 Cxcl14 chemokine (C-X-C motif) ligand 14 0.14 2.47E-08 Mm.30211 Chi3l4 chitinase 3-like 4 0.29 2.58E-08 Mm.244998 1110001C20Rik RIKEN cDNA 1110001C20 gene 0.41 2.69E-08 Mm.218889 Igh-4 immunoglobulin heavy chain 4 (serum IgG1) 5.94 2.98E-08 Mm.246497 Rad51ap1 RAD51 associated protein 1 1.88 2.98E-08 Mm.204634

177 Atp1a2 ATPase, Na+/K+ transporting, alpha 2 polypeptide 1.86 2.98E-08 Mm.207432 Gstm1 glutathione S-transferase, mu 1 2.11 3.01E-08 Mm.2011 Mglap matrix gamma-carboxyglutamate (gla) protein 0.54 3.04E-08 Mm.243085 Itga6 integrin alpha 6 0.54 3.14E-08 Mm.225096 Krt1-23 keratin complex 1, acidic, gene 23 1.74 3.29E-08 Mm.279767 Abhd1 abhydrolase domain containing 1 1.95 3.44E-08 Mm.272414 1810029F08Rik RIKEN cDNA 1810029F08 gene 0.48 3.74E-08 Mm.22353 1110020P15Rik RIKEN cDNA 1110020P15 gene 0.51 4.41E-08 Mm.269736 Serpine2 serine (or cysteine) proteinase inhibitor, clade E, member 2 0.36 4.67E-08 Mm.3093 Cald1 caldesmon 1 0.33 4.67E-08 Mm.212567 Cyp2b20 cytochrome P450, family 2, subfamily b, polypeptide 20 2.30 5.41E-08 Mm.218749 Trim16 tripartite motif protein 16 0.54 5.41E-08 Mm.117087 Nnt nicotinamide nucleotide transhydrogenase 2.30 5.56E-08 Mm.195803 Slc35a5 solute carrier family 35, member A5 0.37 5.83E-08 Mm.264984 Bckdhb branched chain ketoacid dehydrogenase E1, beta polypeptide 1.78 6.00E-08 Mm.12819 Apoe apolipoprotein E 0.37 6.91E-08 Mm.259289 Col5a1 procollagen, type V, alpha 1 0.38 7.10E-08 Mm.7281 Irak4 interleukin-1 receptor-associated kinase 4 0.47 7.19E-08 Mm.279655 Cdh16 cadherin 16 1.87 7.25E-08 Mm.19423 0610006O14Rik RIKEN cDNA 0610006O14 gene 1.90 8.43E-08 Mm.30214 Tceb3 transcription elongation factor B (SIII), polypeptide 3 0.60 8.58E-08 Mm.27663 Ddr2 discoidin domain receptor family, member 2 0.46 8.58E-08 Mm.4999 Mbd1 methyl-CpG binding domain protein 1 0.45 8.58E-08 Mm.22522 1200006L06Rik RIKEN cDNA 1200006L06 gene 0.49 1.12E-07 Mm.21762 Eif4a1 eukaryotic translation initiation factor 4A1 0.50 1.13E-07 Mm.279821 Col5a2 procollagen, type V, alpha 2 0.27 1.13E-07 Mm.10299 Ubc ubiquitin C 0.63 1.17E-07 Mm.331 Gria1 glutamate receptor, ionotropic, AMPA1 (alpha 1) 2.00 1.18E-07 Mm.4920 Fmod fibromodulin 0.62 1.18E-07 Mm.287146 Ckb creatine kinase, brain 0.43 1.18E-07 Mm.16831 Reg3g regenerating islet-derived 3 gamma 0.33 1.21E-07 Mm.252385 Mmp3 matrix metalloproteinase 3 0.22 1.22E-07 Mm.4993 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 Adamts1 motif, 1 0.43 1.23E-07 Mm.1421 Chi3l3 chitinase 3-like 3 0.30 1.27E-07 Mm.4571 Wdfy1 WD40 and FYVE domain containing 1 2.28 1.38E-07 Mm.293273 C3ar1 complement component 3a receptor 1 0.33 1.38E-07 Mm.2408 Tnc tenascin C 0.18 1.38E-07 Mm.980 Zfp52 zinc finger protein 52 0.62 1.39E-07 Mm.296100 Grin2c glutamate receptor, ionotropic, NMDA2C (epsilon 3) 1.80 1.44E-07 Mm.39090 2810435D12Rik RIKEN cDNA 2810435D12 gene 1.63 1.45E-07 Mm.41506 Qpct glutaminyl-peptide cyclotransferase (glutaminyl cyclase) 0.52 1.45E-07 Mm.293870 Pcdha6 protocadherin alpha 6 2.45 1.48E-07 Mm.15528 1200003C23Rik RIKEN cDNA 1200003C23 gene 2.10 1.60E-07 Mm.280563 Ces3 carboxylesterase 3 1.65 1.65E-07 Mm.292803 Fcrl3 Fc receptor-like 3 0.51 1.65E-07 Mm.251254 Trem2b triggering receptor expressed on myeloid cells 2b 0.44 1.65E-07 Mm.261623 Slc7a10 solute carrier family 7 (cationic amino acid transporter, y+ system), member 10 2.89 1.68E-07 Mm.277439 2610001E17Rik RIKEN cDNA 2610001E17 gene 0.40 1.68E-07 Mm.181074 LOC230857 endothelin converting enzyme 1 1.71 1.83E-07 Mm.294384 Clca2 chloride channel calcium activated 2 0.25 1.86E-07 Mm.20897 Fbn1 fibrillin 1 0.40 1.88E-07 Mm.271644 Mafb v-maf musculoaponeurotic fibrosarcoma oncogene family, protein B (avian) 0.39 1.91E-07 Mm.298157 Ccl8 chemokine (C-C motif) ligand 8 0.28 1.91E-07 Mm.42029 Pnpt1 polyribonucleotide nucleotidyltransferase 1 1.70 1.96E-07 Mm.272938 Strm striamin 0.55 1.97E-07 Mm.253564 Itm2a integral membrane protein 2A 0.53 2.00E-07 Mm.193 2410011G03Rik RIKEN cDNA 2410011G03 gene 0.51 2.00E-07 Mm.27886 Ccr5 chemokine (C-C motif) receptor 5 0.55 2.09E-07 Mm.14302 Klf7 Kruppel-like factor 7 (ubiquitous) 0.34 2.12E-07 Mm.29466 Pgrmc1 progesterone receptor membrane component 1 1.67 2.22E-07 Mm.9052 Spred1 sprouty protein with EVH-1 domain 1, related sequence 0.58 2.22E-07 Mm.245890 Cox7a1 cytochrome c oxidase, subunit VIIa 1 2.08 2.38E-07 Mm.12907 Spp1 secreted phosphoprotein 1 0.34 2.50E-07 Mm.288474 Col4a1 procollagen, type IV, alpha 1 0.53 2.60E-07 Mm.738 Trim34 tripartite motif protein 34 0.31 2.64E-07 Mm.219657 Adcy9 adenylate cyclase 9 1.71 2.74E-07 Mm.4294 Pmscl1 polymyositis/scleroderma autoantigen 1 0.62 2.74E-07 Mm.116711 2310058J06Rik RIKEN cDNA 2310058J06 gene 0.40 2.81E-07 Mm.227202 Igf1 insulin-like growth factor 1 0.51 2.85E-07 Mm.268521 1810013B01Rik RIKEN cDNA 1810013B01 gene 1.52 2.86E-07 Mm.24806 Calb3 calbindin 3, (vitamin D-dependent calcium binding protein) 1.96 2.87E-07 Mm.6891 Dapk2 death-associated kinase 2 1.68 2.97E-07 Mm.41755 Gpt1 glutamic pyruvic transaminase 1, soluble 1.85 2.98E-07 Mm.30130

178 2010005A06Rik RIKEN cDNA 2010005A06 gene 1.84 3.04E-07 Mm.36560 Serpinh1 serine (or cysteine) proteinase inhibitor, clade H, member 1 0.37 3.11E-07 Mm.22708 Pttg1 pituitary tumor-transforming 1 0.52 3.26E-07 Mm.6856 Villp villin-like protein 0.65 3.46E-07 Mm.83817 Dll4 delta-like 4 (Drosophila) 1.95 3.53E-07 Mm.143719 Fbp2 fructose bisphosphatase 2 2.06 3.70E-07 Mm.289741 Sh3bgrl3 SH3 domain binding glutamic acid-rich protein-like 3 0.54 3.70E-07 Mm.22240 Zfp191 zinc finger protein 191 0.63 3.72E-07 Mm.153618 1300003P13Rik RIKEN cDNA 1300003P13 gene 0.63 3.72E-07 Mm.28654 Ifngr2 interferon gamma receptor 2 0.59 3.85E-07 Mm.249364 D4Wsu27e DNA segment, Chr 4, Wayne State University 27, expressed 0.66 3.91E-07 Mm.17917 Zfhx1b zinc finger homeobox 1b 0.33 4.08E-07 Mm.209368 3830408P04Rik RIKEN cDNA 3830408P04 gene 0.52 4.59E-07 Mm.12912 Fah fumarylacetoacetate hydrolase 1.78 4.73E-07 Mm.3798 Gsta2 glutathione S-transferase, alpha 2 (Yc2) 2.35 4.80E-07 Mm.197422 Hexb hexosaminidase B 0.51 4.82E-07 Mm.27816 Lepre1 leprecan 1 0.68 4.84E-07 Mm.27961 Tshb thyroid stimulating hormone, beta subunit 1.58 4.96E-07 Mm.110730 Bmp6 bone morphogenetic protein 6 2.00 5.00E-07 Mm.254978 5830400N10Rik RIKEN cDNA 5830400N10 gene 0.52 5.00E-07 Mm.240252 BC024760 cDNA sequence BC024760 1.58 5.01E-07 Mm.191491 Pon1 paraoxonase 1 2.39 5.03E-07 Mm.237657 BC004056 cDNA sequence BC004056 0.49 5.03E-07 Mm.279514 Sod1 superoxide dismutase 1, soluble 1.90 5.06E-07 Mm.5274 Gsto1 glutathione S-transferase omega 1 0.59 5.44E-07 Mm.282 2510048K03Rik RIKEN cDNA 2510048K03 gene 0.51 5.46E-07 Mm.263894 Gclc glutamate-cysteine ligase, catalytic subunit 0.44 5.72E-07 Mm.89888 Mapre1 microtubule-associated protein, RP/EB family, member 1 0.56 5.78E-07 Mm.143877 Pnp purine-nucleoside phosphorylase 0.56 5.79E-07 Mm.17932 Pten phosphatase and tensin homolog 0.46 5.79E-07 Mm.245395 Ltf lactotransferrin 0.39 5.79E-07 Mm.282359 4833421E05Rik RIKEN cDNA 4833421E05 gene 0.36 5.93E-07 Mm.297155 D11Wsu99e DNA segment, Chr 11, Wayne State University 99, expressed 0.48 6.02E-07 Mm.261620 Fgfr1 fibroblast growth factor receptor 1 0.60 6.05E-07 Mm.265716 Itgb5 integrin beta 5 0.60 6.37E-07 Mm.6424 Trim12 tripartite motif protein 12 0.56 6.48E-07 Mm.26466 Prkce protein kinase C, epsilon 1.73 6.56E-07 Mm.240216 Epb4.9 erythrocyte protein band 4.9 1.64 6.56E-07 Mm.210863 5430435G22Rik RIKEN cDNA 5430435G22 gene 0.58 6.56E-07 Mm.44508 BC027340 cDNA sequence BC027340 1.65 6.74E-07 Mm.257116 Ndr1 N-myc downstream regulated 1 0.70 6.80E-07 Mm.30837 Rod1 ROD1 regulator of differentiation 1 (S. pombe) 0.61 6.91E-07 Mm.158801 Mmp14 matrix metalloproteinase 14 (membrane-inserted) 0.38 7.07E-07 Mm.280175 Fbln2 fibulin 2 0.38 7.37E-07 Mm.249146 Mmp13 matrix metalloproteinase 13 0.63 7.59E-07 Mm.5022 Fcgr2b Fc receptor, IgG, low affinity IIb 0.36 7.59E-07 Mm.22119 2610042N09Rik RIKEN cDNA 2610042N09 gene 2.81 7.62E-07 Mm.248647 Col3a1 procollagen, type III, alpha 1 0.38 7.63E-07 Mm.249555 Bex2 brain expressed X-linked 2 2.25 7.75E-07 Mm.94160 Myl7 myosin, light polypeptide 7, regulatory 2.64 7.82E-07 Mm.46514 Ctsb cathepsin B 0.50 7.85E-07 Mm.236553 Dtr diphtheria toxin receptor 0.44 7.85E-07 Mm.289681 Sfn stratifin 0.38 7.93E-07 Mm.301269 Asah1 N-acylsphingosine amidohydrolase 1 0.63 8.21E-07 Mm.22547 2310020L09Rik RIKEN cDNA 2310020L09 gene 0.58 8.21E-07 Mm.29293 Rps6 ribosomal protein S6 0.52 8.32E-07 Mm.292504 Bmp4 bone morphogenetic protein 4 1.87 8.78E-07 Mm.6813 Cd164l1 CD164 sialomucin-like 1 0.62 9.08E-07 Mm.29597 Arg1 arginase 1, liver 0.08 9.08E-07 Mm.154144 Gpr97 G protein-coupled receptor 97 0.70 9.19E-07 Mm.27995 6030432N09Rik RIKEN cDNA 6030432N09 gene 1.53 9.25E-07 Mm.247039 Emr1 EGF-like module containing, mucin-like, hormone receptor-like sequence 1 0.58 9.37E-07 Mm.2254 Myoz2 myozenin 2 1.92 9.52E-07 Mm.141157 Slc2a9 solute carrier family 2 (facilitated glucose transporter), member 9 1.65 9.52E-07 Mm.17389 5630400A09Rik RIKEN cDNA 5630400A09 gene 0.57 9.52E-07 Mm.9210 Clu clusterin 0.49 9.52E-07 Mm.200608 Fn1 fibronectin 1 0.43 9.56E-07 Mm.193099 Timp1 tissue inhibitor of metalloproteinase 1 0.15 9.57E-07 Mm.8245 1500001L15Rik RIKEN cDNA 1500001L15 gene 0.51 9.68E-07 Mm.21214 Clca1 chloride channel calcium activated 1 0.26 9.78E-07 Mm.275745 2410018G23Rik RIKEN cDNA 2410018G23 gene 0.41 9.81E-07 Mm.28626 Edg7 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor 7 2.20 9.91E-07 Mm.155520 Crym crystallin, mu 1.59 1.02E-06 Mm.9114 Wnt5a wingless-related MMTV integration site 5A 0.56 1.02E-06 Mm.287544

179 Kdelr3 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3 0.48 1.02E-06 Mm.29644 Cri1 CREBBP/EP300 inhibitory protein 1 0.50 1.03E-06 Mm.44244 Serpine1 serine (or cysteine) proteinase inhibitor, clade E, member 1 0.42 1.03E-06 Mm.250422 1700020E22Rik RIKEN cDNA 1700020E22 gene 2.79 1.06E-06 Mm.293635 Ocln occludin 1.61 1.07E-06 Mm.4807 Bambi BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) 1.54 1.12E-06 Mm.284863 4921528E07Rik RIKEN cDNA 4921528E07 gene 0.57 1.12E-06 Mm.121918 Snx6 sorting nexin 6 0.51 1.12E-06 Mm.28240 Retnla resistin like alpha 0.32 1.17E-06 Mm.33772 1200011D03Rik RIKEN cDNA 1200011D03 gene 2.91 1.18E-06 Mm.20108 Fprl1 formyl peptide receptor-like 1 1.85 1.18E-06 Mm.3522 Fcgr1 Fc receptor, IgG, high affinity I 0.38 1.20E-06 Mm.150 Prickle1 prickle like 1 (Drosophila) 1.89 1.26E-06 Mm.293502 Lrrfip1 leucine rich repeat (in FLII) interacting protein 1 1.70 1.27E-06 Mm.45039 Plagl1 pleiomorphic adenoma gene-like 1 1.73 1.28E-06 Mm.287857 Cables1 Cdk5 and Abl enzyme substrate 1 1.60 1.28E-06 Mm.40717 Slc2a3 solute carrier family 2 (facilitated glucose transporter), member 3 1.63 1.30E-06 Mm.269857 Col4a2 procollagen, type IV, alpha 2 0.61 1.30E-06 Mm.181021 Supt16h suppressor of Ty 16 homolog (S. cerevisiae) 1.46 1.31E-06 Mm.286066 Otub1 OTU domain, ubiquitin aldehyde binding 1 0.45 1.31E-06 Mm.203921 E030025D05Rik RIKEN cDNA E030025D05 gene 1.90 1.35E-06 Mm.93759 Dp1l1 deleted in polyposis 1-like 1 1.60 1.35E-06 Mm.28147 4932416N17Rik RIKEN cDNA 4932416N17 gene 1.56 1.35E-06 Mm.159176 Fbxl12 F-box and leucine-rich repeat protein 12 1.43 1.35E-06 Mm.24608 Wisp1 WNT1 inducible signaling pathway protein 1 0.34 1.35E-06 Mm.10222 Ndr4 N-myc downstream regulated 4 0.67 1.36E-06 Mm.29846 2310021M12Rik RIKEN cDNA 2310021M12 gene 1.73 1.37E-06 Mm.142343 G0s2 G0/G1 switch gene 2 1.81 1.39E-06 Mm.3283 1200009O22Rik RIKEN cDNA 1200009O22 gene 1.67 1.39E-06 Mm.41187 Lpl lipoprotein lipase 0.60 1.39E-06 Mm.1514 2310047I15Rik RIKEN cDNA 2310047I15 gene 1.88 1.43E-06 Mm.236878 Nid1 nidogen 1 0.53 1.47E-06 Mm.4691 Gp2 glycoprotein 2 (zymogen granule membrane) 0.47 1.52E-06 Mm.46403 Socs3 suppressor of cytokine signaling 3 0.46 1.54E-06 Mm.3468 1110035L05Rik RIKEN cDNA 1110035L05 gene 0.54 1.59E-06 Mm.29140 Pumag interferon-gamma inducible gene, Puma-g 1.46 1.63E-06 Mm.77690 Nsf N-ethylmaleimide sensitive fusion protein 0.69 1.63E-06 Mm.69960 Osmr oncostatin M receptor 0.54 1.63E-06 Mm.10760 Ptp4a3 protein tyrosine phosphatase 4a3 1.41 1.66E-06 Mm.153891 Plekhb1 pleckstrin homology domain containing, family B (evectins) member 1 1.66 1.68E-06 Mm.26633 Ppp1r14a protein phosphatase 1, regulatory (inhibitor) subunit 14A 2.20 1.74E-06 Mm.2343 Sparcl1 SPARC-like 1 (mast9, hevin) 0.57 1.74E-06 Mm.29027 Cmkor1 chemokine orphan receptor 1 0.39 1.74E-06 Mm.6522 Bid BH3 interacting domain death agonist 0.57 1.75E-06 Mm.281317 Dpysl3 dihydropyrimidinase-like 3 0.56 1.79E-06 Mm.8180 Notch4 Notch gene homolog 4 (Drosophila) 1.85 1.81E-06 Mm.173813 Grtp1 GH regulated TBC protein 1 1.46 1.83E-06 Mm.34901 Nrip1 nuclear receptor interacting protein 1 0.44 1.83E-06 Mm.20895 Fscn1 fascin homolog 1, actin bundling protein (Strongylocentrotus) purpuratus) 0.27 1.92E-06 Mm.289707 Grb7 growth factor receptor bound protein 7 1.59 1.94E-06 Mm.276702 Dpep1 dipeptidase 1 (renal) 1.89 1.99E-06 Mm.20388 Ckmt2 creatine kinase, mitochondrial 2 1.74 2.03E-06 Mm.20240 Itgav integrin alpha V 0.56 2.03E-06 Mm.227 MGC29978 3-ketoacyl-CoA thiolase B 1.98 2.05E-06 Mm.224885 Stard10 START domain containing 10 1.50 2.05E-06 Mm.28896 AW552001 expressed sequence AW552001 1.67 2.13E-06 Mm.21175 Cldn8 claudin 8 1.79 2.15E-06 Mm.25836 Rtn2 reticulon 2 (Z-band associated protein) 1.56 2.15E-06 Mm.24142 A430103C15Rik RIKEN cDNA A430103C15 gene 0.37 2.16E-06 Mm.193094 Tfpi2 tissue factor pathway inhibitor 2 0.47 2.29E-06 Mm.25612 Gapd glyceraldehyde-3-phosphate dehydrogenase 0.69 2.31E-06 Mm.5289 Prdc protein related to DAN and cerberus 1.82 2.33E-06 Mm.25760 Wfs1 Wolfram syndrome 1 homolog (human) 0.69 2.35E-06 Mm.20916 Il13ra1 interleukin 13 receptor, alpha 1 0.64 2.38E-06 Mm.24208 2310040G17Rik RIKEN cDNA 2310040G17 gene 1.38 2.39E-06 Mm.268156 1110063G11Rik RIKEN cDNA 1110063G11 gene 1.76 2.46E-06 Mm.273785 Hebp1 heme binding protein 1 2.14 2.51E-06 Mm.247996 Asb13 ankyrin repeat and SOCS box-containing protein 13 1.50 2.51E-06 Mm.253061 Mpeg1 macrophage expressed gene 1 0.50 2.52E-06 Mm.3999 AI447904 expressed sequence AI447904 0.29 2.56E-06 Mm.447 Alas2 aminolevulinic acid synthase 2, erythroid 3.29 2.58E-06 Mm.140509 2410011K10Rik RIKEN cDNA 2410011K10 gene 1.44 2.58E-06 Mm.273285 Aox1 aldehyde oxidase 1 2.00 2.59E-06 Mm.26787 Ccnd2 cyclin D2 0.40 2.62E-06 Mm.294136

180 Mkrn1 makorin, ring finger protein, 1 1.77 2.66E-06 Mm.83241 Ctss cathepsin S 0.56 2.66E-06 Mm.3619 Madh6 MAD homolog 6 (Drosophila) 1.91 2.68E-06 Mm.27935 Bgn biglycan 0.73 2.68E-06 Mm.2608 Cspg4 chondroitin sulfate proteoglycan 4 0.67 2.73E-06 Mm.41329 Lox lysyl oxidase 0.29 2.75E-06 Mm.172 C230052I12Rik RIKEN cDNA C230052I12 gene 1.55 2.76E-06 Mm.206921 AU045326 expressed sequence AU045326 0.63 2.89E-06 Mm.25745 Aldh2 aldehyde dehydrogenase 2, mitochondrial 1.53 2.92E-06 Mm.284446 AA536743 expressed sequence AA536743 0.55 2.93E-06 Mm.243632 2410015B03Rik RIKEN cDNA 2410015B03 gene 1.49 2.94E-06 Mm.135188 2610311I19Rik RIKEN cDNA 2610311I19 gene 0.64 2.94E-06 Mm.270382 Ly86 lymphocyte antigen 86 0.44 2.94E-06 Mm.2639 Gstm2 glutathione S-transferase, mu 2 1.53 2.95E-06 Mm.272792 Hagh hydroxyacyl glutathione hydrolase 1.49 3.01E-06 Mm.44240 Nnmt nicotinamide N-methyltransferase 0.36 3.16E-06 Mm.8362 Chst1 carbohydrate (keratan sulfate Gal-6) sulfotransferase 1 1.53 3.17E-06 Mm.38021 Abcc3 ATP-binding cassette, sub-family C (CFTR/MRP), member 3 1.88 3.18E-06 Mm.23942 Spon1 spondin 1, (f-spondin) extracellular matrix protein 0.65 3.20E-06 Mm.121116 Gpaa1 GPI anchor attachment protein 1 2.03 3.25E-06 Mm.5903 Gig1 glucocorticoid induced gene 1 1.88 3.26E-06 Mm.212908 Tst thiosulfate sulfurtransferase, mitochondrial 1.66 3.30E-06 Mm.15312 Fgfr3 fibroblast growth factor receptor 3 1.66 3.30E-06 Mm.6904 Epb4.1l4a erythrocyte protein band 4.1-like 4a 1.69 3.36E-06 Mm.3465 Dbn1 drebrin 1 0.60 3.38E-06 Mm.19016 1200002M06Rik RIKEN cDNA 1200002M06 gene 1.41 3.42E-06 Mm.292503 Actg2 actin, gamma 2, smooth muscle, enteric 0.51 3.44E-06 Mm.292865 Ivd isovaleryl coenzyme A dehydrogenase 1.38 3.45E-06 Mm.6635 BC021381 cDNA sequence BC021381 1.56 3.46E-06 Mm.35661 Cxcl16 chemokine (C-X-C motif) ligand 16 0.69 3.47E-06 Mm.301293 Egr2 early growth response 2 0.52 3.48E-06 Mm.290421 0610009A07Rik RIKEN cDNA 0610009A07 gene 1.48 3.50E-06 Mm.24153 Cox8b cytochrome c oxidase, subunit VIIIb 1.72 3.55E-06 Mm.3841 Col15a1 procollagen, type XV 0.60 3.55E-06 Mm.233547 0610041E09Rik RIKEN cDNA 0610041E09 gene 0.53 3.55E-06 Mm.241387 Rpl17 ribosomal protein L17 0.55 3.56E-06 Mm.276337 Cxcl12 chemokine (C-X-C motif) ligand 12 0.43 3.60E-06 Mm.465 Ccl12 chemokine (C-C motif) ligand 12 0.28 3.60E-06 Mm.867 5730402K07Rik RIKEN cDNA 5730402K07 gene 1.46 3.62E-06 Mm.196153 AW049829 expressed sequence AW049829 1.43 3.62E-06 Mm.291433 Tor3a torsin family 3, member A 1.78 3.79E-06 Mm.206737 9130410M22Rik RIKEN cDNA 9130410M22 gene 1.60 3.79E-06 Mm.24670 D930024E11 hypothetical protein D930024E11 1.55 3.82E-06 Mm.258310 Gstz1 glutathione transferase zeta 1 (maleylacetoacetate isomerase) 1.41 3.86E-06 Mm.151475 5730445F03Rik RIKEN cDNA 5730445F03 gene 0.63 3.89E-06 Mm.33797 Pps putative phosphatase 1.67 3.94E-06 Mm.1458 Lass4 longevity assurance homolog 4 (S. cerevisiae) 1.53 3.94E-06 Mm.35511 Sparc secreted acidic cysteine rich glycoprotein 0.70 3.94E-06 Mm.291442 Ugcg UDP-glucose ceramide glucosyltransferase 0.63 3.94E-06 Mm.198803 Pik3r1 phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) 0.54 3.94E-06 Mm.3058 Apobec3 apolipoprotein B editing complex 3 0.44 3.94E-06 Mm.227489 Snrk SNF related kinase 1.70 4.06E-06 Mm.257989 Dmd dystrophin, muscular dystrophy 1.44 4.07E-06 Mm.275608 Cp ceruloplasmin 0.61 4.07E-06 Mm.13787 Siat8b sialyltransferase 8 (alpha-2, 8-sialyltransferase) B 1.63 4.14E-06 Mm.4954 Plunc palate, lung, and nasal epithelium carcinoma associated 0.44 4.22E-06 Mm.268852 H28 histocompatibility 28 1.43 4.24E-06 Mm.219544 Dab2 disabled homolog 2 (Drosophila) 0.54 4.25E-06 Mm.240830 Lysal1 lysosomal apyrase-like 1 0.63 4.27E-06 Mm.291443 Ppicap peptidylprolyl isomerase C-associated protein 0.58 4.30E-06 Mm.3152 2310016C08Rik RIKEN cDNA 2310016C08 gene 1.77 4.37E-06 Mm.45161 Hpgd hydroxyprostaglandin dehydrogenase 15 (NAD) 1.88 4.48E-06 Mm.18832 1810019C21Rik RIKEN cDNA 1810019C21 gene 0.68 4.58E-06 Mm.52356 Msh5 mutS homolog 5 (E. coli) 1.51 4.64E-06 Mm.24192 Cotl1 coactosin-like 1 (Dictyostelium) 0.58 4.66E-06 Mm.141741 BC004728 cDNA sequence BC004728 1.68 4.70E-06 Mm.26282 Slc12a5 solute carrier family 12, member 5 1.50 4.77E-06 Mm.252987 Dusp7 dual specificity phosphatase 7 1.49 4.80E-06 Mm.275584 Spry1 sprouty homolog 1 (Drosophila) 1.59 4.86E-06 Mm.86483 Chst2 carbohydrate sulfotransferase 2 1.56 5.06E-06 Mm.212446 Igfbp4 insulin-like growth factor binding protein 4 0.65 5.08E-06 Mm.233799 LOC234344 hypothetical protein LOC234344 0.56 5.29E-06 Mm.282378 Lgmn legumain 0.49 5.52E-06 Mm.17185 Uchl1 ubiquitin carboxy-terminal hydrolase L1 0.69 5.58E-06 Mm.113770

181 Efna1 ephrin A1 1.55 5.63E-06 Mm.15675 Lims2 LIM and senescent cell antigen like domains 2 1.52 5.65E-06 Mm.21402 BC018465 cDNA sequence BC018465 1.59 5.77E-06 Mm.167411 Usf1 upstream transcription factor 1 0.63 5.87E-06 Mm.8 Ptgs1 prostaglandin-endoperoxide synthase 1 0.58 5.90E-06 Mm.290010 Tmem8 transmembrane protein 8 (five membrane-spanning domains) 1.48 5.92E-06 Mm.143826 Prss8 protease, serine, 8 (prostasin) 1.58 5.96E-06 Mm.5875 Wdr1 WD repeat domain 1 0.71 5.96E-06 Mm.2654 Clic3 chloride intracellular channel 3 1.58 6.30E-06 Mm.44194 Soat1 sterol O-acyltransferase 1 0.36 6.32E-06 Mm.28099 Eln elastin 0.23 6.35E-06 Mm.275320 Trps1 trichorhinophalangeal syndrome I (human) 0.56 6.45E-06 Mm.30466 Hey1 hairy/enhancer-of-split related with YRPW motif 1 1.72 6.58E-06 Mm.29581 Csda cold shock domain protein A 0.67 6.58E-06 Mm.193526 Slc38a2 solute carrier family 38, member 2 0.64 6.58E-06 Mm.46754 Ccnl2 cyclin L2 1.46 6.63E-06 Mm.23492 Efnb2 ephrin B2 1.52 6.64E-06 Mm.209813 Pcyt1a phosphate cytidylyltransferase 1, choline, alpha isoform 0.54 6.65E-06 Mm.209300 S100a11 S100 calcium binding protein A11 (calizzarin) 0.73 6.72E-06 Mm.280038 Sycp3 synaptonemal complex protein 3 1.66 6.75E-06 Mm.297977 Tgfbi transforming growth factor, beta induced 0.46 6.75E-06 Mm.14455 Lyzs lysozyme 1.85 6.77E-06 Mm.45436 3110004L20Rik RIKEN cDNA 3110004L20 gene 1.59 6.79E-06 Mm.23932 2610528J11Rik RIKEN cDNA 2610528J11 gene 1.45 6.79E-06 Mm.34431 2210023G05Rik RIKEN cDNA 2210023G05 gene 1.61 6.80E-06 Mm.26580 Brp17 brain protein 17 1.66 6.84E-06 Mm.248635 Hba-a1 hemoglobin alpha, adult chain 1 1.83 6.89E-06 Mm.196110 Pdgfrb platelet derived growth factor receptor, beta polypeptide 0.59 6.89E-06 Mm.4146 sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-beta-galactosyl-1,3)-N-acetyl Siat7b galactosaminde alpha-2,6-sialyltransferase) B 1.46 6.90E-06 Mm.3947 Rgs9 regulator of G-protein signaling 9 1.41 6.96E-06 Mm.38548 A930018B01Rik RIKEN cDNA A930018B01 gene 1.38 7.01E-06 Mm.266328 BC026370 cDNA sequence BC026370 1.41 7.02E-06 Mm.157904 Ptp4a2 protein tyrosine phosphatase 4a2 0.61 7.02E-06 Mm.193688 2310061A22Rik RIKEN cDNA 2310061A22 gene 0.61 7.19E-06 Mm.3676 5930437N14 hypothetical protein 5930437N14 1.48 7.28E-06 Mm.45005 Cd97 CD97 antigen 1.70 7.36E-06 Mm.182255 Mfng manic fringe homolog (Drosophila) 1.43 7.36E-06 Mm.149235 9130417A21Rik RIKEN cDNA 9130417A21 gene 0.47 7.36E-06 Mm.24163 Gnb1 guanine nucleotide binding protein, beta 1 1.81 7.38E-06 Mm.2344 Taf1a TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A 1.37 7.43E-06 Mm.39081 Cabc1 chaperone, ABC1 activity of bc1 complex like (S. pombe) 1.69 7.48E-06 Mm.38330 Itga3 integrin alpha 3 0.72 7.54E-06 Mm.57035 Adam8 a disintegrin and metalloprotease domain 8 0.55 7.56E-06 Mm.15969 Bcar3 breast cancer anti-estrogen resistance 3 1.49 7.60E-06 Mm.45815 2210417C17Rik RIKEN cDNA 2210417C17 gene 0.66 7.60E-06 Mm.28013 P2ry6 pyrimidinergic receptor P2Y, G-protein coupled, 6 0.51 7.65E-06 Mm.235193 Wnt2 wingless-related MMTV integration site 2 1.75 7.70E-06 Mm.33653 Mox2 antigen identified by monoclonal antibody MRC OX-2 0.55 7.70E-06 Mm.245851 Cspg2 chondroitin sulfate proteoglycan 2 0.57 7.80E-06 Mm.158700 Clasp2 CLIP associating protein 2 1.56 7.83E-06 Mm.222272 Epha1 Eph receptor A1 1.55 7.86E-06 Mm.251772 Copz2 coatomer protein complex, subunit zeta 2 0.67 8.29E-06 Mm.22144 Dkk3 dickkopf homolog 3 (Xenopus laevis) 0.55 8.29E-06 Mm.55143 Fkbp10 FK506 binding protein 10 0.50 8.29E-06 Mm.3894 4732452J19Rik RIKEN cDNA 4732452J19 gene 1.40 8.30E-06 Mm.87252 Fxyd1 FXYD domain-containing ion transport regulator 1 1.57 8.44E-06 Mm.1491 Cbr2 carbonyl reductase 2 1.46 8.54E-06 Mm.21454 CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small Ctdspl phosphatase-like 1.46 8.62E-06 Mm.28747 Sh3md2 SH3 multiple domains 2 0.67 8.62E-06 Mm.27949 Cd86 CD86 antigen 0.74 8.65E-06 Mm.1452 2700063A19Rik RIKEN cDNA 2700063A19 gene 1.58 8.67E-06 Mm.291752 D6Ertd32e DNA segment, Chr 6, ERATO Doi 32, expressed 0.62 8.75E-06 Mm.220334 Erbb2ip Erbb2 interacting protein 1.73 8.79E-06 Mm.277354 Mapk12 mitogen-activated protein kinase 12 1.64 8.79E-06 Mm.38343 Abca3 ATP-binding cassette, sub-family A (ABC1), member 3 1.99 8.88E-06 Mm.239470 AI464131 expressed sequence AI464131 1.43 9.01E-06 Mm.27054 Emp2 epithelial membrane protein 2 1.39 9.06E-06 Mm.246009 Myl4 myosin, light polypeptide 4, alkali; atrial, embryonic 2.35 9.09E-06 Mm.247636 Klk6 kallikrein 6 1.58 9.10E-06 Mm.4486 Pip5k1a phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha 1.39 9.12E-06 Mm.1945 Msr2 macrophage scavenger receptor 2 0.51 9.28E-06 Mm.45173 Wdr26 WD repeat domain 26 0.50 9.45E-06 Mm.289082

182 Kcnq1 potassium voltage-gated channel, subfamily Q, member 1 1.34 9.56E-06 Mm.5177 Nudt6 nudix (nucleoside diphosphate linked moiety X)-type motif 6 1.38 9.57E-06 Mm.30820 Wisp2 WNT1 inducible signaling pathway protein 2 0.64 9.63E-06 Mm.13828 Epn2 epsin 2 1.41 9.84E-06 Mm.139695 Adam15 a disintegrin and metalloproteinase domain 15 (metargidin) 0.75 1.01E-05 Mm.172610 MGC18837 hypothetical protein MGC18837 1.78 1.02E-05 Mm.253329 BC006662 cDNA sequence BC006662 0.66 1.02E-05 Mm.25240 Mxi1 Max interacting protein 1 1.36 1.03E-05 Mm.2154 Mark1 MAP/microtubule affinity-regulating kinase 1 0.69 1.03E-05 Mm.219860 Ddc dopa decarboxylase 1.39 1.04E-05 Mm.12906 Ccrl2 chemokine (C-C motif) receptor-like 2 1.39 1.04E-05 Mm.7336 Ube2v1 ubiquitin-conjugating enzyme E2 variant 1 0.70 1.04E-05 Mm.301425 Mga MAX gene associated 0.63 1.04E-05 Mm.257223 Ear1 eosinophil-associated ribonuclease 1 3.23 1.06E-05 Mm.86948 Igh-1 immunoglobulin heavy chain 1 (serum IgG2a) 2.13 1.06E-05 Mm.144308 Manba mannosidase, beta A, lysosomal 0.61 1.06E-05 Mm.280536 Car4 carbonic anhydrase 4 2.64 1.07E-05 Mm.1641 Itln intelectin 1.46 1.08E-05 Mm.247426 N28137 expressed sequence N28137 0.72 1.08E-05 Mm.34113 Gsta3 glutathione S-transferase, alpha 3 2.13 1.09E-05 Mm.14719 Eno3 enolase 3, beta muscle 1.59 1.09E-05 Mm.251322 Dab2ip disabled homolog 2 (Drosophila) interacting protein 1.38 1.09E-05 Mm.29629 5830417I10Rik RIKEN cDNA 5830417I10 gene 1.37 1.09E-05 Mm.126870 Wbp1 WW domain binding protein 1 1.38 1.10E-05 Mm.1109 Rin1 Ras and Rab interactor 1 0.68 1.11E-05 Mm.55192 Slc9a3r2 solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 2 1.73 1.12E-05 Mm.21587 Aldh6a1 aldehyde dehydrogenase family 6, subfamily A1 1.62 1.12E-05 Mm.247510 Mef2c myocyte enhancer factor 2C 0.63 1.12E-05 Mm.24001 D10Ertd438e DNA segment, Chr 10, ERATO Doi 438, expressed 0.60 1.13E-05 Mm.199964 A930009M04Rik RIKEN cDNA A930009M04 gene 0.45 1.13E-05 Mm.219675 Plat plasminogen activator, tissue 0.47 1.14E-05 Mm.154660 2400009B11Rik RIKEN cDNA 2400009B11 gene 1.39 1.16E-05 Mm.21202 Ptger4 prostaglandin E receptor 4 (subtype EP4) 0.51 1.20E-05 Mm.18509 C530046L02Rik RIKEN cDNA C530046L02 gene 0.73 1.21E-05 Mm.74587 Slc11a1 solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1 0.70 1.21E-05 Mm.2913 Tfdp1 transcription factor Dp 1 0.70 1.22E-05 Mm.925 Inpp5b inositol polyphosphate-5-phosphatase B 1.45 1.24E-05 Mm.296202 D530020C15Rik RIKEN cDNA D530020C15 gene 0.70 1.24E-05 Mm.34411 Dio2 deiodinase, iodothyronine, type II 0.70 1.25E-05 Mm.21389 Rgs5 regulator of G-protein signaling 5 0.51 1.25E-05 Mm.20954 Aldh1a1 aldehyde dehydrogenase family 1, subfamily A1 1.51 1.26E-05 Mm.4514 Elf5 E74-like factor 5 1.88 1.28E-05 Mm.20888 Vps33b vacuolar protein sorting 33B (yeast) 1.50 1.28E-05 Mm.37879 Cab140 calcium binding protein 140 1.41 1.28E-05 Mm.116721 Btg3 B-cell translocation gene 3 1.36 1.34E-05 Mm.2823 Mod1 malic enzyme, supernatant 0.70 1.35E-05 Mm.298213 Grn granulin 0.68 1.35E-05 Mm.238941 Aard alanine and arginine rich domain containing protein 1.62 1.36E-05 Mm.24204 Stard8 START domain containing 8 1.39 1.36E-05 Mm.236928 Acp5 acid phosphatase 5, tartrate resistant 0.54 1.38E-05 Mm.46354 Dhrs8 dehydrogenase/reductase (SDR family) member 8 1.44 1.39E-05 Mm.239333 Fgfr2 fibroblast growth factor receptor 2 1.62 1.41E-05 Mm.16340 Wbscr5 Williams-Beuren syndrome chromosome region 5 homolog (human) 0.72 1.42E-05 Mm.23955 Ppic peptidylprolyl isomerase C 0.67 1.45E-05 Mm.4587 Txnrd3 thioredoxin reductase 3 1.44 1.51E-05 Mm.229332 Aps adaptor protein with pleckstrin homology and src 0.72 1.51E-05 Mm.277333 E130304C20Rik RIKEN cDNA E130304C20 gene 0.53 1.51E-05 Mm.27740 Cpxm1 carboxypeptidase X 1 (M14 family) 0.49 1.51E-05 Mm.149442 Hadhsc L-3-hydroxyacyl-Coenzyme A dehydrogenase, short chain 1.52 1.52E-05 Mm.260164 2010004N24Rik RIKEN cDNA 2010004N24 gene 0.69 1.52E-05 Mm.280459 4930488L10Rik RIKEN cDNA 4930488L10 gene 1.39 1.53E-05 Mm.2962 Gsn gelsolin 1.39 1.55E-05 Mm.21109 Fbp1 fructose bisphosphatase 1 1.50 1.57E-05 Mm.246512 Gstm6 glutathione S-transferase, mu 6 1.42 1.59E-05 Mm.31041 Khdrbs3 KH domain containing, RNA binding, signal transduction associated 3 0.63 1.59E-05 Mm.17964 Fstl3 follistatin-like 3 0.63 1.59E-05 Mm.251710 Lif leukemia inhibitory factor 0.59 1.59E-05 Mm.4964 Pi4k2a phosphatidylinositol 4-kinase type 2 alpha 0.53 1.59E-05 Mm.117037 Fech ferrochelatase 1.93 1.61E-05 Mm.217130 Idb2 inhibitor of DNA binding 2 0.56 1.62E-05 Mm.34871 Gucy1b3 guanylate cyclase 1, soluble, beta 3 0.55 1.64E-05 Mm.9445 1810024J13Rik RIKEN cDNA 1810024J13 gene 0.73 1.67E-05 Mm.248331 2410043F08Rik RIKEN cDNA 2410043F08 gene 0.65 1.70E-05 Mm.286536 Ccl9 chemokine (C-C motif) ligand 9 0.46 1.70E-05 Mm.2271

183 Masp2 mannan-binding lectin serine protease 2 1.50 1.71E-05 Mm.22453 Nov nephroblastoma overexpressed gene 1.64 1.72E-05 Mm.5167 Echdc3 enoyl Coenzyme A hydratase domain containing 3 1.39 1.72E-05 Mm.38342 Axl AXL receptor tyrosine kinase 0.62 1.76E-05 Mm.4128 Cdc42ep4 CDC42 effector protein (Rho GTPase binding) 4 0.50 1.76E-05 Mm.293378 Dgka diacylglycerol kinase, alpha 1.37 1.78E-05 Mm.291235 A930001N09Rik RIKEN cDNA A930001N09 gene 1.61 1.80E-05 Mm.275414 Icam2 intercellular adhesion molecule 2 1.85 1.84E-05 Mm.394 Sdc4 syndecan 4 0.46 1.84E-05 Mm.3815 2700055K07Rik RIKEN cDNA 2700055K07 gene 1.99 1.85E-05 Mm.29358 Surf1 surfeit gene 1 1.47 1.86E-05 Mm.6874 Dpp7 dipeptidylpeptidase 7 1.75 1.88E-05 Mm.21440 Slc30a7 solute carrier family 30 (zinc transporter), member 7 0.72 1.90E-05 Mm.254626 Cltc clathrin, heavy polypeptide (Hc) 0.69 1.90E-05 Mm.254588 Lzp-s P lysozyme structural 1.33 1.96E-05 Mm.177539 Marcks myristoylated alanine rich protein kinase C substrate 0.40 1.97E-05 Mm.30059 Snca synuclein, alpha 3.16 1.99E-05 Mm.17484 Cttn cortactin 0.69 2.02E-05 Mm.205601 Mrpl16 mitochondrial ribosomal protein L16 1.39 2.05E-05 Mm.203928 Prss12 protease, serine, 12 neurotrypsin (motopsin) 1.33 2.05E-05 Mm.9431 Ran RAN, member RAS oncogene family 0.57 2.05E-05 Mm.7521 Anks1 ankyrin repeat and SAM domain containing 1 1.38 2.06E-05 Mm.32556 Timp2 tissue inhibitor of metalloproteinase 2 0.73 2.06E-05 Mm.206505 1200009K13Rik RIKEN cDNA 1200009K13 gene 0.64 2.06E-05 Mm.240490 9330161F08Rik RIKEN cDNA 9330161F08 gene 1.36 2.07E-05 Mm.258402 Lgals1 lectin, galactose binding, soluble 1 0.51 2.07E-05 Mm.43831 Eng endoglin 1.51 2.10E-05 Mm.277741 Invs inversin 1.29 2.12E-05 Mm.110147 5330440M15Rik RIKEN cDNA 5330440M15 gene 0.67 2.13E-05 Mm.41715 Scgb3a1 secretoglobin, family 3A, member 1 0.64 2.16E-05 Mm.22802 Fcer1g Fc receptor, IgE, high affinity I, gamma polypeptide 0.57 2.16E-05 Mm.22673 Copa coatomer protein complex subunit alpha 0.75 2.18E-05 Mm.30041 Ccndbp1 cyclin D-type binding-protein 1 1.60 2.23E-05 Mm.7838 Tes testis derived transcript 0.68 2.23E-05 Mm.279920 Laptm4b lysosomal-associated protein transmembrane 4B 1.38 2.27E-05 Mm.197518 Snag1 sorting nexin associated golgi protein 1 0.62 2.29E-05 Mm.33721 Xpa xeroderma pigmentosum, complementation group A 1.40 2.30E-05 Mm.247036 Sdf2l1 stromal cell-derived factor 2-like 1 0.61 2.32E-05 Mm.30222 Sell selectin, lymphocyte 1.58 2.34E-05 Mm.1461 Gstt2 glutathione S-transferase, theta 2 1.42 2.34E-05 Mm.24118 Fxyd6 FXYD domain-containing ion transport regulator 6 0.60 2.34E-05 Mm.208287 Cldn4 claudin 4 0.47 2.34E-05 Mm.7339 Lpin1 lipin 1 0.73 2.35E-05 Mm.153625 Eps8 epidermal growth factor receptor pathway substrate 8 0.65 2.35E-05 Mm.235346 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- Galnt1 acetylgalactosaminyltransferase 1 0.61 2.35E-05 Mm.30249 Msra methionine sulfoxide reductase A 1.31 2.39E-05 Mm.26713 Tnni3 troponin I, cardiac 1.85 2.43E-05 Mm.604 Vwf Von Willebrand factor homolog 0.65 2.43E-05 Mm.22339 Cyp27a1 cytochrome P450, family 27, subfamily a, polypeptide 1 1.46 2.46E-05 Mm.85083 Neo1 neogenin 1.47 2.47E-05 Mm.42249 Parg poly (ADP-ribose) glycohydrolase 0.73 2.48E-05 Mm.15962 Fxyd5 FXYD domain-containing ion transport regulator 5 0.69 2.48E-05 Mm.1870 Cat catalase 1.90 2.49E-05 Mm.4215 Acas2l acetyl-Coenzyme A synthetase 2 (AMP forming)-like 1.84 2.53E-05 Mm.7044 Centg2 centaurin, gamma 2 1.33 2.53E-05 Mm.138160 Irf5 interferon regulatory factor 5 0.69 2.53E-05 Mm.6479 2810453I06Rik RIKEN cDNA 2810453I06 gene 1.83 2.54E-05 Mm.290816 D14Wsu89e DNA segment, Chr 14, Wayne State University 89, expressed 1.53 2.54E-05 Mm.24477 Edil3 EGF-like repeats and discordin I-like domains 3 1.49 2.54E-05 Mm.255272 BC003296 cDNA sequence BC003296 1.47 2.54E-05 Mm.25300 Atp9a ATPase, class II, type 9A 1.39 2.54E-05 Mm.10288 Socs4 suppressor of cytokine signaling 4 0.76 2.54E-05 Mm.91920 Npn1 neoplastic progression 1 0.52 2.54E-05 Mm.29567 Spna1 spectrin alpha 1 1.64 2.58E-05 Mm.200611 Tm4sf2 transmembrane 4 superfamily member 2 1.55 2.58E-05 Mm.18590 Ndel1 nuclear distribution gene E-like homolog 1 (A. nidulans) 0.53 2.58E-05 Mm.31979 Syne2 synaptic nuclear envelope 2 1.82 2.59E-05 Mm.26652 4933402K05Rik RIKEN cDNA 4933402K05 gene 0.52 2.66E-05 Mm.259801 LOC209387 tripartite motif protein 30-like 0.49 2.66E-05 Mm.295781 Dscr1l1 Down syndrome critical region gene 1-like 1 2.06 2.70E-05 Mm.251242 Il18 interleukin 18 1.47 2.70E-05 Mm.1410 1110068E11Rik RIKEN cDNA 1110068E11 gene 1.35 2.70E-05 Mm.289680 Eif2s2 eukaryotic translation initiation factor 2, subunit 2 (beta) 0.75 2.71E-05 Mm.29859

184 Bcl3 B-cell leukemia/lymphoma 3 0.61 2.72E-05 Mm.1068 H2-T10 histocompatibility 2, T region locus 10 0.53 2.78E-05 Mm.87776 4930422J18Rik RIKEN cDNA 4930422J18 gene 0.54 2.81E-05 Mm.30 9530046H09Rik RIKEN cDNA 9530046H09 gene 1.51 2.82E-05 Mm.74362 Col13a1 procollagen, type XIII, alpha 1 1.61 2.83E-05 Mm.10805 Cd2 CD2 antigen 1.65 2.84E-05 Mm.22842 Prdm1 PR domain containing 1, with ZNF domain 1.52 2.84E-05 Mm.4800 Wif1 Wnt inhibitory factor 1 1.42 2.84E-05 Mm.32831 1110001E17Rik RIKEN cDNA 1110001E17 gene 1.41 2.84E-05 Mm.212927 Fgf18 fibroblast growth factor 18 1.34 2.84E-05 Mm.246671 Ssh3bp1 spectrin SH3 domain binding protein 1 0.67 2.85E-05 Mm.695 2210022F10Rik RIKEN cDNA 2210022F10 gene 1.51 2.87E-05 Mm.132226 BC026645 cDNA sequence BC026645 1.62 2.90E-05 Mm.153676 Nfatc3 nuclear factor of activated T-cells, cytoplasmic 3 0.60 2.91E-05 Mm.276000 9430059P22Rik RIKEN cDNA 9430059P22 gene 1.28 2.93E-05 Mm.275409 Npl N-acetylneuraminate pyruvate lyase 0.51 2.93E-05 Mm.24887 Dpp4 dipeptidylpeptidase 4 1.45 2.94E-05 Mm.1151 D14Ertd436e DNA segment, Chr 14, ERATO Doi 436, expressed 1.28 2.94E-05 Mm.287279 Synpo synaptopodin 0.68 2.96E-05 Mm.27313 Hal histidine ammonia lyase 2.95 3.05E-05 Mm.13000 Pla1a phospholipase A1 member A 0.35 3.05E-05 Mm.279805 Bnip3l BCL2/adenovirus E1B 19kDa-interacting protein 3-like 1.50 3.06E-05 Mm.29820 Ccrn4l CCR4 carbon catabolite repression 4-like (S. cerevisiae) 0.61 3.06E-05 Mm.86541 Hsd11b1 hydroxysteroid 11-beta dehydrogenase 1 1.47 3.10E-05 Mm.28328 1810060J02Rik RIKEN cDNA 1810060J02 gene 0.62 3.10E-05 Mm.209774 Litaf LPS-induced TN factor 0.56 3.10E-05 Mm.294753 Irs1 insulin receptor substrate 1 1.73 3.11E-05 Mm.4952 acetyl-Coenzyme A acyltransferase 2 (mitochondrial 3-oxoacyl-Coenzyme A Acaa2 thiolase) 1.49 3.11E-05 Mm.245724 ORF28 open reading frame 28 1.31 3.11E-05 Mm.101927 Kif3b kinesin family member 3B 0.71 3.11E-05 Mm.27973 1500001M02Rik RIKEN cDNA 1500001M02 gene 1.39 3.17E-05 Mm.261329 Cox6a2 cytochrome c oxidase, subunit VI a, polypeptide 2 1.43 3.19E-05 Mm.43824 Bag3 Bcl2-associated athanogene 3 0.72 3.21E-05 Mm.84073 Dctn6 dynactin 6 0.54 3.23E-05 Mm.90496 Rarb retinoic acid receptor, beta 1.48 3.25E-05 Mm.259318 Mgat2 mannoside acetylglucosaminyltransferase 2 0.67 3.27E-05 Mm.206642 Aoah acyloxyacyl hydrolase 0.67 3.30E-05 Mm.159294 Anxa8 annexin A8 0.63 3.32E-05 Mm.3267 0610039N19Rik RIKEN cDNA 0610039N19 gene 1.45 3.33E-05 Mm.146873 Ddb2 damage specific DNA binding protein 2 1.43 3.33E-05 Mm.260747 Cfh complement component factor h 0.62 3.33E-05 Mm.8655 Abca1 ATP-binding cassette, sub-family A (ABC1), member 1 0.60 3.33E-05 Mm.277376 1700029I01Rik RIKEN cDNA 1700029I01 gene 0.73 3.34E-05 Mm.299127 Qk quaking 0.49 3.34E-05 Mm.262294 Arpc1b actin related protein 2/3 complex, subunit 1B 0.52 3.35E-05 Mm.30010 Lpp LIM domain containing preferred translocation partner in lipoma 0.52 3.36E-05 Mm.209385 Cyp2a4 cytochrome P450, family 2, subfamily a, polypeptide 4 3.46 3.38E-05 Mm.22313 1300013J15Rik RIKEN cDNA 1300013J15 gene 1.41 3.41E-05 Mm.100741 2010106G01Rik RIKEN cDNA 2010106G01 gene 0.38 3.41E-05 Mm.269928 Tcf21 transcription factor 21 2.41 3.48E-05 Mm.16497 1110057K04Rik RIKEN cDNA 1110057K04 gene 1.48 3.48E-05 Mm.25608 Ube2r2 ubiquitin-conjugating enzyme E2R 2 0.72 3.51E-05 Mm.258805 Slc39a14 solute carrier family 39 (zinc transporter), member 14 0.45 3.51E-05 Mm.270647 Surf4 surfeit gene 4 0.71 3.53E-05 Mm.196863 Heyl hairy/enhancer-of-split related with YRPW motif-like 0.59 3.53E-05 Mm.103615 Fbxo9 f-box only protein 9 1.50 3.55E-05 Mm.28584 Hmgcs2 3-hydroxy-3-methylglutaryl-Coenzyme A synthase 2 1.36 3.55E-05 Mm.289131 BC002216 cDNA sequence BC002216 1.39 3.57E-05 Mm.25556 Slc7a4 solute carrier family 7 (cationic amino acid transporter, y+ system), member 4 1.39 3.57E-05 Mm.254617 D130005A03 hypothetical protein D130005A03 1.35 3.62E-05 Mm.260210 Scarb1 scavenger receptor class B, member 1 0.67 3.63E-05 Mm.282242 2410003M22Rik RIKEN cDNA 2410003M22 gene 1.26 3.65E-05 Mm.33909 Ager advanced glycosylation end product-specific receptor 1.37 3.66E-05 Mm.3383 4930524C15Rik RIKEN cDNA 4930524C15 gene 1.40 3.67E-05 Mm.116789 LOC217831 hypothetical protein LOC217831 1.48 3.68E-05 Mm.156217 Por P450 (cytochrome) oxidoreductase 1.46 3.68E-05 Mm.3863 3300001H21Rik RIKEN cDNA 3300001H21 gene 1.38 3.68E-05 Mm.220975 Irf6 interferon regulatory factor 6 1.37 3.68E-05 Mm.273695 Pparbp peroxisome proliferator activated receptor binding protein 0.50 3.72E-05 Mm.12926 Set SET translocation 0.60 3.74E-05 Mm.292650 Lbp lipopolysaccharide binding protein 0.71 3.75E-05 Mm.218846 Cyp4v3 cytochrome P450, family 4, subfamily v, polypeptide 3 1.45 3.77E-05 Mm.245297 5730402C02Rik RIKEN cDNA 5730402C02 gene 1.28 3.77E-05 Mm.252862

185 Dcbld1 discoidin, CUB and LCCL domain containing 1 1.35 3.80E-05 Mm.62982 Acta2 actin, alpha 2, smooth muscle, aorta 0.62 3.80E-05 Mm.213025 Adrb3 adrenergic receptor, beta 3 1.38 3.81E-05 Mm.278475 Pmp22 peripheral myelin protein 1.33 3.81E-05 Mm.1237 Nubp1 nucleotide binding protein 1 0.72 3.81E-05 Mm.248934 Klf15 Kruppel-like factor 15 1.80 3.82E-05 Mm.41389 Dcxr dicarbonyl L-xylulose reductase 1.45 3.83E-05 Mm.231091 Prcc papillary renal cell carcinoma (translocation-associated) 0.72 3.83E-05 Mm.35089 Mcfd2 multiple coagulation factor deficiency 2 0.71 3.83E-05 Mm.30251 AW111922 expressed sequence AW111922 0.47 3.83E-05 Mm.261140 Kdap kidney-derived aspartic protease-like protein 1.40 3.84E-05 Mm.9495 Tmod4 tropomodulin 4 1.33 3.95E-05 Mm.71935 Uap1 UDP-N-acetylglucosamine pyrophosphorylase 1 0.72 3.95E-05 Mm.27969 Arfrp1 ADP-ribosylation factor related protein 1 1.49 3.96E-05 Mm.87720 2210404N08Rik RIKEN cDNA 2210404N08 gene 2.14 3.97E-05 Mm.34874 Taz tafazzin 1.33 4.00E-05 Mm.268483 Becn1 beclin 1 (coiled-coil, myosin-like BCL2-interacting protein) 1.32 4.01E-05 Mm.178947 Prkcn protein kinase C, nu 0.68 4.03E-05 Mm.252776 Trim39 tripartite motif protein 39 1.38 4.07E-05 Mm.40624 5730408C10Rik RIKEN cDNA 5730408C10 gene 1.64 4.08E-05 Mm.267395 Tle2 transducin-like enhancer of split 2, homolog of Drosophila E(spl) 1.73 4.13E-05 Mm.38608 Rgs3 regulator of G-protein signaling 3 1.33 4.13E-05 Mm.286753 Ril reversion induced LIM gene 0.74 4.18E-05 Mm.21830 Hs6st1 heparan sulfate 6-O-sulfotransferase 1 0.71 4.18E-05 Mm.27195 1700127B04Rik RIKEN cDNA 1700127B04 gene 0.66 4.21E-05 Mm.218639 1110006I11Rik RIKEN cDNA 1110006I11 gene 1.42 4.25E-05 Mm.156346 Mapkbp1 mitogen activated protein kinase binding proten 1 1.38 4.25E-05 Mm.299387 Zrf2 zuotin related factor 2 0.65 4.28E-05 Mm.266312 2210402C18Rik RIKEN cDNA 2210402C18 gene 1.49 4.32E-05 Mm.19119 Gpnmb glycoprotein (transmembrane) nmb 0.58 4.32E-05 Mm.23567 Fjx1 four jointed box 1 (Drosophila) 1.48 4.40E-05 Mm.29730 Myo5a myosin Va 0.49 4.41E-05 Mm.200292 Calm1 calmodulin 1 0.70 4.43E-05 Mm.34246 Osbpl1a oxysterol binding protein-like 1A 1.33 4.44E-05 Mm.259470 Pink1 PTEN induced putative kinase 1 0.74 4.44E-05 Mm.18539 1300006C19Rik RIKEN cDNA 1300006C19 gene 0.73 4.44E-05 Mm.296158 2810024B22Rik RIKEN cDNA 2810024B22 gene 0.68 4.44E-05 Mm.273836 Hdac11 histone deacetylase 11 1.56 4.45E-05 Mm.206218 Cdc42 cell division cycle 42 homolog (S. cerevisiae) 0.70 4.48E-05 Mm.1022 Rnf149 ring finger protein 149 0.61 4.50E-05 Mm.28614 C130076O07Rik RIKEN cDNA C130076O07 gene 0.46 4.50E-05 Mm.208439 Dscr1 Down syndrome critical region homolog 1 (human) 0.53 4.53E-05 Mm.265744 Man2b1 mannosidase 2, alpha B1 0.74 4.55E-05 Mm.4219 Scoc short coiled-coil protein 0.61 4.55E-05 Mm.300476 Pycs pyrroline-5-carboxylate synthetase (glutamate gamma-semialdehyde synthetase) 0.76 4.56E-05 Mm.233117 Pdlim2 PDZ and LIM domain 2 1.33 4.57E-05 Mm.283968 Ctps cytidine 5'-triphosphate synthase 0.65 4.57E-05 Mm.1815 Aif1 allograft inflammatory factor 1 0.56 4.57E-05 Mm.10747 1810020C19Rik RIKEN cDNA 1810020C19 gene 0.50 4.57E-05 Mm.272498 Nek6 NIMA (never in mitosis gene a)-related expressed kinase 6 0.71 4.60E-05 Mm.143818 4930526B11Rik RIKEN cDNA 4930526B11 gene 1.64 4.62E-05 Mm.179267 Sfxn2 sideroflexin 2 1.33 4.67E-05 Mm.296837 Rpl27a ribosomal protein L27a 0.61 4.67E-05 Mm.296868 Nme3 expressed in non-metastatic cells 3 1.38 4.70E-05 Mm.27278 Col17a1 procollagen, type XVII, alpha 1 1.41 4.72E-05 Mm.1225 Asgr1 asialoglycoprotein receptor 1 1.40 4.72E-05 Mm.6559 Mcpt5 mast cell protease 5 1.35 4.72E-05 Mm.1252 2610019F03Rik RIKEN cDNA 2610019F03 gene 1.33 4.72E-05 Mm.5727 Rnf128 ring finger protein 128 0.53 4.72E-05 Mm.27764 Smpd2 sphingomyelin phosphodiesterase 2, neutral 1.28 4.73E-05 Mm.953 tumor necrosis factor receptor superfamily, member 14 (herpesvirus entry Tnfrsf14 mediator) 1.48 4.75E-05 Mm.215147 AA407809 expressed sequence AA407809 0.68 4.77E-05 Mm.280895 Abp1 amiloride binding protein 1 (amine oxidase, copper-containing) 0.60 4.78E-05 Mm.7190 Rabac1 Rab acceptor 1 (prenylated) 1.37 4.80E-05 Mm.273561 BC010552 cDNA sequence BC010552 1.58 4.81E-05 Mm.33062 F11r F11 receptor 1.32 4.83E-05 Mm.294882 D15Ertd81e DNA segment, Chr 15, ERATO Doi 81, expressed 1.28 4.83E-05 Mm.291716 4933412D19Rik RIKEN cDNA 4933412D19 gene 1.39 4.85E-05 Mm.46722 Osbpl2 oxysterol binding protein-like 2 1.42 4.88E-05 Mm.253578 9930024E13Rik RIKEN cDNA 9930024E13 gene 0.78 4.88E-05 Mm.294761 Cerk ceramide kinase 0.59 4.88E-05 Mm.222685 Scamp2 secretory carrier membrane protein 2 0.73 4.89E-05 Mm.295392 Scgf stem cell growth factor 0.71 4.89E-05 Mm.20428

186 Spg4 spastic paraplegia 4 homolog (human) 0.63 4.89E-05 Mm.19804 Klf5 Kruppel-like factor 5 1.43 4.90E-05 Mm.30262 D930010J01Rik RIKEN cDNA D930010J01 gene 1.38 4.90E-05 Mm.59139 Zfhx1a zinc finger homeobox 1a 1.42 4.95E-05 Mm.3929 0610027O18Rik RIKEN cDNA 0610027O18 gene 1.33 4.95E-05 Mm.195309 Scnn1b sodium channel, nonvoltage-gated 1 beta 1.40 4.96E-05 Mm.7709 Sms spermine synthase 1.34 4.96E-05 Mm.18652 Spint2 serine protease inhibitor, Kunitz type 2 1.34 4.98E-05 Mm.295230 Mecp2 methyl CpG binding protein 2 1.27 4.98E-05 Mm.131408 Rab17 RAB17, member RAS oncogene family 1.50 4.99E-05 Mm.279780 Camk2d calcium/calmodulin-dependent protein kinase II, delta 0.69 5.00E-05 Mm.255822 Fgfbp1 fibroblast growth factor binding protein 1 2.08 5.03E-05 Mm.46053 0610042E07Rik RIKEN cDNA 0610042E07 gene 0.73 5.05E-05 Mm.41385 Zfp36l1 zinc finger protein 36, C3H type-like 1 0.67 5.06E-05 Mm.18571 Entpd1 ectonucleoside triphosphate diphosphohydrolase 1 0.71 5.07E-05 Mm.2824 Rpl36 ribosomal protein L36 0.53 5.07E-05 Mm.21421 Nrgn neurogranin 1.71 5.09E-05 Mm.29857 Ptges prostaglandin E synthase 0.67 5.11E-05 Mm.28768 Pbx2 pre B-cell leukemia transcription factor 2 1.41 5.14E-05 Mm.7103 0610043B10Rik RIKEN cDNA 0610043B10 gene 1.32 5.14E-05 Mm.27114 4930548G07Rik RIKEN cDNA 4930548G07 gene 1.28 5.20E-05 Mm.152466 Cygb cytoglobin 0.60 5.20E-05 Mm.34598 Mal myelin and lymphocyte protein, T-cell differentiation protein 0.50 5.27E-05 Mm.39040 Cited2 Cbp/p300-interacting transactivator, with Glu/Asp-rich carboxy-terminal domain, 2 1.56 5.29E-05 Mm.272321 Tm4sf8 transmembrane 4 superfamily member 8 0.79 5.29E-05 Mm.28484 G630041M05Rik RIKEN cDNA G630041M05 gene 0.62 5.29E-05 Mm.245357 Ehf ets homologous factor 1.45 5.30E-05 Mm.10724 Slamf9 SLAM family member 9 0.71 5.30E-05 Mm.150050 Fli1 Friend leukemia integration 1 0.68 5.30E-05 Mm.258908 Atp2b2 ATPase, Ca++ transporting, plasma membrane 2 1.48 5.33E-05 Mm.149619 Tars threonyl-tRNA synthetase 0.67 5.45E-05 Mm.286061 Foxa1 forkhead box A1 1.48 5.46E-05 Mm.4578 Vapb vesicle-associated membrane protein, associated protein B and C 1.36 5.46E-05 Mm.260456 Mcpt4 mast cell protease 4 1.30 5.48E-05 Mm.22693 Phlda1 pleckstrin homology-like domain, family A, member 1 0.59 5.49E-05 Mm.3117 Slc37a2 solute carrier family 37 (glycerol-3-phosphate transporter), member 2 0.67 5.55E-05 Mm.103729 5430413I02Ri RIKEN cDNA 5430413I02 gene 0.61 5.60E-05 Mm.23776 Dnajc3 DnaJ (Hsp40) homolog, subfamily C, member 3 0.63 5.63E-05 Mm.12616 Cdkn1a cyclin-dependent kinase inhibitor 1A (P21) 0.61 5.63E-05 Mm.195663 Coro1c coronin, actin binding protein 1C 1.62 5.64E-05 Mm.200372 Madh1 MAD homolog 1 (Drosophila) 0.73 5.64E-05 Mm.223717 Pdgfc platelet-derived growth factor, C polypeptide 0.42 5.64E-05 Mm.40268 2410002K23Rik RIKEN cDNA 2410002K23 gene 1.35 5.71E-05 Mm.123366 Ccl19 chemokine (C-C motif) ligand 19 0.72 5.76E-05 Mm.299018 Zdhhc1 zinc finger, DHHC domain containing 1 1.36 5.77E-05 Mm.100917 splicing factor proline/glutamine rich (polypyrimidine tract binding protein Sfpq associated) 0.70 5.77E-05 Mm.277094 Csrp2 cysteine and glycine-rich protein 2 0.63 6.01E-05 Mm.2020 Tm4sf13 transmembrane 4 superfamily member 13 1.75 6.04E-05 Mm.254663 Tacstd1 tumor-associated calcium signal transducer 1 1.38 6.06E-05 Mm.4259 Ramp2 receptor (calcitonin) activity modifying protein 2 1.45 6.11E-05 Mm.260698 Ldh2 lactate dehydrogenase 2, B chain 1.40 6.15E-05 Mm.9745 Epb4.1l4b erythrocyte protein band 4.1-like 4b 1.51 6.20E-05 Mm.28217 Gng12 guanine nucleotide binding protein (G protein), gamma 12 0.75 6.20E-05 Mm.13080 Pnrc2 proline-rich nuclear receptor coactivator 2 0.63 6.20E-05 Mm.29159 AW548124 expressed sequence AW548124 1.32 6.21E-05 Mm.273209 Tek endothelial-specific receptor tyrosine kinase 1.53 6.23E-05 Mm.14313 Dysf dysferlin 0.70 6.24E-05 Mm.220982 BC020077 cDNA sequence BC020077 1.38 6.31E-05 Mm.291250 Zfp30 zinc finger protein 30 1.35 6.33E-05 Mm.292690 Murr1 U2af1-rs1 region 1 1.43 6.34E-05 Mm.29542 Ptp4a1 protein tyrosine phosphatase 4a1 0.69 6.37E-05 Mm.262000 1190005L05Rik RIKEN cDNA 1190005L05 gene 1.37 6.44E-05 Mm.25285 Nol5 nucleolar protein 5 0.61 6.47E-05 Mm.220367 Facl2 fatty acid Coenzyme A ligase, long chain 2 1.58 6.50E-05 Mm.210323 Hdgfrp3 hepatoma-derived growth factor, related protein 3 0.75 6.53E-05 Mm.28887 Ctsh cathepsin H 0.61 6.53E-05 Mm.2277 Lepr leptin receptor 1.98 6.60E-05 Mm.259282 Pygl liver glycogen phosphorylase 1.75 6.64E-05 Mm.256926 C130058N24Rik RIKEN cDNA C130058N24 gene 0.70 6.69E-05 Mm.44135 Kdelr2 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 2 0.72 6.72E-05 Mm.181880 Atp2a3 ATPase, Ca++ transporting, ubiquitous 1.57 6.78E-05 Mm.6306 Tekt2 tektin 2 1.39 6.81E-05 Mm.23895 Es22 esterase 22 1.38 6.81E-05 Mm.63490

187 Pik3r4 phosphatidylinositol 3 kinase, regulatory subunit, polypeptide 4, p150 0.71 6.81E-05 Mm.297473 2200003E03Rik RIKEN cDNA 2200003E03 gene 2.43 6.83E-05 Mm.46418 Dgat2 diacylglycerol O-acyltransferase 2 1.63 6.83E-05 Mm.180189 Arf4 ADP-ribosylation factor 4 0.72 6.83E-05 Mm.281836 2810052M02Rik RIKEN cDNA 2810052M02 gene 0.70 6.83E-05 Mm.29475 Psa puromycin-sensitive aminopeptidase 0.70 6.83E-05 Mm.29824 Sdfr2 stromal cell derived factor receptor 2 0.72 6.89E-05 Mm.66293 2410003K15Rik RIKEN cDNA 2410003K15 gene 1.38 6.92E-05 Mm.281018 Pxmp2 peroxisomal membrane protein 2 1.36 6.96E-05 Mm.21853 Loxl2 lysyl oxidase-like 2 0.62 6.98E-05 Mm.116714 D17H6S56E-5 DNA segment, Chr 17, human D6S56E 5 0.70 7.01E-05 Mm.22506 5830417C01Rik RIKEN cDNA 5830417C01 gene 0.61 7.06E-05 Mm.26611 Ezh1 enhancer of zeste homolog 1 (Drosophila) 1.31 7.09E-05 Mm.5027 1700001E16Rik RIKEN cDNA 1700001E16 gene 1.42 7.10E-05 Mm.229110 Rgs16 regulator of G-protein signaling 16 0.73 7.10E-05 Mm.181709 2410003B16Rik RIKEN cDNA 2410003B16 gene 0.70 7.10E-05 Mm.29933 Mx1 myxovirus (influenza virus) resistance 1 0.69 7.10E-05 Mm.227378 Cyp7b1 cytochrome P450, family 7, subfamily b, polypeptide 1 0.51 7.10E-05 Mm.278588 Tagln transgelin 0.57 7.11E-05 Mm.283283 Pstpip1 proline-serine-threonine phosphatase-interacting protein 1 0.66 7.15E-05 Mm.2534 Islr immunoglobulin superfamily containing leucine-rich repeat 0.73 7.17E-05 Mm.38426 Rap2b RAP2B, member of RAS oncogene family 0.57 7.19E-05 Mm.273288 Tubb2 tubulin, beta 2 0.46 7.19E-05 Mm.246377 2610103J23Rik RIKEN cDNA 2610103J23 gene 0.65 7.20E-05 Mm.288982 Hdlbp high density lipoprotein (HDL) binding protein 0.71 7.27E-05 Mm.30012 1300008B03Rik RIKEN cDNA 1300008B03 gene 0.56 7.35E-05 Mm.326175 Itga5 integrin alpha 5 (fibronectin receptor alpha) 0.50 7.36E-05 Mm.16234 Fbxw4 F-box and WD-40 domain protein 4 1.27 7.37E-05 Mm.254739 1110007F23Rik RIKEN cDNA 1110007F23 gene 2.01 7.55E-05 Mm.272278 Qscn6 quiescin Q6 0.68 7.59E-05 Mm.297925 8430419L09Rik RIKEN cDNA 8430419L09 gene 1.32 7.63E-05 Mm.34182 C1qtnf5 C1q and tumor necrosis factor related protein 5 0.75 7.70E-05 Mm.227110 Bace beta-site APP cleaving enzyme 1.27 7.72E-05 Mm.24044 2010110K24Rik RIKEN cDNA 2010110K24 gene 0.75 7.74E-05 Mm.218423 Vamp2 vesicle-associated membrane protein 2 1.34 7.84E-05 Mm.28643 Itgb1 integrin beta 1 (fibronectin receptor beta) 0.65 7.84E-05 Mm.263396 Pcdh7 protocadherin 7 0.54 7.84E-05 Mm.255488 Cnr2 cannabinoid receptor 2 (macrophage) 1.36 7.91E-05 Mm.297251 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 Adamts4 motif, 4 0.75 7.94E-05 Mm.23156 Gnmt glycine N-methyltransferase 1.46 8.01E-05 Mm.29395 Grhl2 grainyhead like 2 (Drosophila) 1.27 8.01E-05 Mm.244612 Tbx3 T-box 3 1.50 8.22E-05 Mm.261742 Pln phospholamban 1.49 8.22E-05 Mm.34145 Mpp5 membrane protein, palmitoylated 5 (MAGUK p55 subfamily member 5) 1.51 8.37E-05 Mm.30561 5730442K12Rik RIKEN cDNA 5730442K12 gene 1.38 8.40E-05 Mm.22758 Tnxb tenascin XB 1.98 8.51E-05 Mm.290527 2810432L12Rik RIKEN cDNA 2810432L12 gene 1.39 8.51E-05 Mm.24564 Dnajc5 DnaJ (Hsp40) homolog, subfamily C, member 5 0.79 8.51E-05 Mm.140761 2310046K10Rik RIKEN cDNA 2310046K10 gene 0.59 8.54E-05 Mm.68134 Arhc ras homolog gene family, member C 0.69 8.56E-05 Mm.262 Hbb-bh1 hemoglobin Z, beta-like embryonic chain 1.47 8.60E-05 Mm.196718 Ppfibp2 protein tyrosine phosphatase, receptor-type, F interacting protein, binding protein 2 1.35 8.60E-05 Mm.2817 AI597479 expressed sequence AI597479 1.31 8.60E-05 Mm.28817 Bmp1 bone morphogenetic protein 1 0.80 8.65E-05 Mm.27757 Ccnd1 cyclin D1 0.50 8.70E-05 Mm.273049 Meis1 myeloid ecotropic viral integration site 1 1.61 8.76E-05 Mm.260855 Gsta4 glutathione S-transferase, alpha 4 1.49 8.80E-05 Mm.2662 Trim11 tripartite motif protein 11 1.26 8.80E-05 Mm.248049 Tyrobp TYRO protein tyrosine kinase binding protein 0.64 8.80E-05 Mm.46301 Cdh11 cadherin 11 0.55 8.80E-05 Mm.1571 E430018J23Rik RIKEN cDNA E430018J23 gene 1.25 8.81E-05 Mm.219955 2610524G09Rik RIKEN cDNA 2610524G09 gene 0.77 8.82E-05 Mm.295464 Arhgap5 Rho GTPase activating protein 5 0.67 8.85E-05 Mm.35059 Aars alanyl-tRNA synthetase 0.68 8.91E-05 Mm.24174 Map3k4 mitogen activated protein kinase kinase kinase 4 1.35 8.93E-05 Mm.28587 Mfge8 milk fat globule-EGF factor 8 protein 0.69 8.94E-05 Mm.2759 Wtap Wilms' tumour 1-associating protein 0.76 8.98E-05 Mm.275521 Mcl1 myeloid cell leukemia sequence 1 0.74 8.98E-05 Mm.1639 Rex3 reduced expression 3 1.53 8.99E-05 Mm.314476 Mme membrane metallo endopeptidase 2.00 9.00E-05 Mm.296022 Lap3 leucine aminopeptidase 3 0.73 9.07E-05 Mm.286830 1810074D23Rik RIKEN cDNA 1810074D23 gene 0.79 9.16E-05 Mm.193089 Map3k7 mitogen activated protein kinase kinase kinase 7 0.64 9.17E-05 Mm.258589

188 Gbas glioblastoma amplified sequence 1.54 9.18E-05 Mm.12468 Gadd45g growth arrest and DNA-damage-inducible 45 gamma 0.46 9.20E-05 Mm.281298 AW550801 expressed sequence AW550801 1.31 9.32E-05 Mm.220843 4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog Nipsnap1 1 (C. elegans) 1.41 9.33E-05 Mm.293716 Prx periaxin 1.35 9.33E-05 Mm.10119 Stard3 START domain containing 3 1.30 9.33E-05 Mm.265546 Crat carnitine acetyltransferase 1.32 9.36E-05 Mm.20396 Krt1-18 keratin complex 1, acidic, gene 18 0.63 9.37E-05 Mm.22479 Dscr5 Down syndrome critical region homolog 5 (human) 1.38 9.43E-05 Mm.39490 Snx5 sorting nexin 5 0.60 9.43E-05 Mm.273379 Pigr polymeric immunoglobulin receptor 1.68 9.44E-05 Mm.276414 Ogn osteoglycin 1.89 9.47E-05 Mm.4258 Zfp467 zinc finger protein 467 1.39 9.47E-05 Mm.301341 Lmna lamin A 0.66 9.59E-05 Mm.243014 Trem3 triggering receptor expressed on myeloid cells 3 1.40 9.61E-05 Mm.117124 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta Ywhaz polypeptide 0.28 9.61E-05 Mm.260643 Sox18 SRY-box containing gene 18 1.72 9.73E-05 Mm.264904 Gla galactosidase, alpha 0.67 9.80E-05 Mm.1114 Sf3b1 splicing factor 3b, subunit 1 0.63 9.84E-05 Mm.279736 Csf3r colony stimulating factor 3 receptor (granulocyte) 1.56 9.92E-05 Mm.271701 Zmynd10 zinc finger, MYND domain containing 10 1.41 1.01E-04 Mm.28331 Ptpn12 protein tyrosine phosphatase, non-receptor type 12 0.66 1.01E-04 Mm.228533 Elmo3 engulfment and cell motility 3, ced-12 homolog (C. elegans) 1.49 1.02E-04 Mm.237966 Csf2 colony stimulating factor 2 (granulocyte-macrophage) 1.33 1.02E-04 Mm.4922 Unc84a unc-84 homolog A (C. elegans) 1.27 1.02E-04 Mm.210845 Apg5l autophagy 5-like (S. cerevisiae) 0.76 1.02E-04 Mm.22264 Mcam melanoma cell adhesion molecule 0.68 1.02E-04 Mm.275003 1110001M20Rik RIKEN cDNA 1110001M20 gene 1.39 1.03E-04 Mm.291192 9430015G10Rik RIKEN cDNA 9430015G10 gene 1.25 1.03E-04 Mm.68999 2310076K21Rik RIKEN cDNA 2310076K21 gene 0.60 1.03E-04 Mm.277533 Lman1 lectin, mannose-binding, 1 0.60 1.03E-04 Mm.290857 Ifit3 interferon-induced protein with tetratricopeptide repeats 3 0.56 1.03E-04 Mm.290825 Sphk1 sphingosine kinase 1 0.42 1.03E-04 Mm.20944 Gstt1 glutathione S-transferase, theta 1 1.69 1.05E-04 Mm.2746 1110001F24Rik RIKEN cDNA 1110001F24 gene 0.57 1.05E-04 Mm.275766 Svs3 seminal vesicle secretion 3 1.42 1.06E-04 Mm.260341 4930451A13Rik RIKEN cDNA 4930451A13 gene 1.38 1.06E-04 Mm.257819 Rtn4 reticulon 4 0.81 1.06E-04 Mm.192580 Cstb cystatin B 0.69 1.06E-04 Mm.6095 Akp2 alkaline phosphatase 2, liver 1.82 1.07E-04 Mm.288186 Gak cyclin G associated kinase 1.32 1.07E-04 Mm.27921 2010308M01Rik RIKEN cDNA 2010308M01 gene 1.30 1.07E-04 Mm.30511 Spats2 spermatogenesis associated, serine-rich 2 0.76 1.07E-04 Mm.276650 Hars histidyl-tRNA synthetase 0.70 1.07E-04 Mm.10528 5830426I05Rik RIKEN cDNA 5830426I05 gene 0.67 1.07E-04 Mm.21516 2400010D15Rik RIKEN cDNA 2400010D15 gene 0.63 1.07E-04 Mm.196596 5830413E08Rik RIKEN cDNA 5830413E08 gene 0.53 1.07E-04 Mm.21697 Kpnb3 karyopherin (importin) beta 3 0.69 1.08E-04 Mm.221452 Ppp1r14b protein phosphatase 1, regulatory (inhibitor) subunit 14B 0.67 1.08E-04 Mm.296842 3110020O18Rik RIKEN cDNA 3110020O18 gene 0.66 1.08E-04 Mm.117055 Fmo5 flavin containing monooxygenase 5 1.63 1.09E-04 Mm.281718 0610009K11Rik RIKEN cDNA 0610009K11 gene 0.70 1.09E-04 Mm.103413 Serping1 serine (or cysteine) proteinase inhibitor, clade G, member 1 0.70 1.09E-04 Mm.38888 2810002E22Rik RIKEN cDNA 2810002E22 gene 0.66 1.10E-04 Mm.211535 solute carrier family 25 (mitochondrial carrier; dicarboxylate transporter), member Slc25a10 10 1.31 1.11E-04 Mm.3991 1110033G01Rik RIKEN cDNA 1110033G01 gene 1.30 1.11E-04 Mm.35241 Selp selectin, platelet 0.69 1.11E-04 Mm.248316 Slc1a3 solute carrier family 1, member 3 1.30 1.13E-04 Mm.204834 1700017B05Rik RIKEN cDNA 1700017B05 gene 0.62 1.13E-04 Mm.22712 Arhu ras homolog gene family, member U 0.58 1.13E-04 Mm.168257 Spata13 spermatogenesis associated 13 1.48 1.14E-04 Mm.149776 Klra17 killer cell lectin-like receptor, subfamily A, member 17 1.31 1.14E-04 Mm.155514 05-Sep septin 5 0.64 1.14E-04 Mm.29976 Cnot7 CCR4-NOT transcription complex, subunit 7 1.82 1.15E-04 Mm.272551 Utrn utrophin 1.47 1.15E-04 Mm.253554 Krt2-8 keratin complex 2, basic, gene 8 1.32 1.15E-04 Mm.289759 St5 suppression of tumorigenicity 5 1.30 1.15E-04 Mm.252009 C030003J19Rik RIKEN cDNA C030003J19 gene 1.26 1.15E-04 Mm.266264 Hist1h1c histone 1, H1c 0.59 1.15E-04 Mm.193539 1500012D09Rik RIKEN cDNA 1500012D09 gene 1.37 1.16E-04 Mm.32870 Edem1 ER degradation enhancer, mannosidase alpha-like 1 0.77 1.16E-04 Mm.21596 2310001H13Rik RIKEN cDNA 2310001H13 gene 1.37 1.17E-04 Mm.248608

189 H2afz H2A histone family, member Z 0.49 1.17E-04 Mm.117541 0610038P07Rik RIKEN cDNA 0610038P07 gene 0.75 1.18E-04 Mm.232728 Erp29 endoplasmic reticulum protein 29 0.74 1.19E-04 Mm.154570 1700020C11Rik RIKEN cDNA 1700020C11 gene 1.37 1.20E-04 Mm.41719 4930418P06Rik RIKEN cDNA 4930418P06 gene 1.27 1.21E-04 Mm.226994 Eif4g2 eukaryotic translation initiation factor 4, gamma 2 0.67 1.21E-04 Mm.185453 Zdhhc14 zinc finger, DHHC domain containing 14 1.39 1.22E-04 Mm.268326 Npnt nephronectin 1.46 1.23E-04 Mm.279310 Rab32 RAB32, member RAS oncogene family 0.70 1.24E-04 Mm.31486 Cdkn1b cyclin-dependent kinase inhibitor 1B (P27) 1.49 1.25E-04 Mm.272101 Cyb5 cytochrome b-5 1.42 1.25E-04 Mm.31018 Frg1 FSHD region gene 1 1.40 1.25E-04 Mm.67 MrgA2 G protein-coupled receptor MrgA2 1.39 1.25E-04 Mm.119803 2510009N07Rik RIKEN cDNA 2510009N07 gene 1.37 1.25E-04 Mm.29087 G22p1 thyroid autoantigen 0.76 1.25E-04 Mm.288809 D8Ertd812e DNA segment, Chr 8, ERATO Doi 812, expressed 0.74 1.25E-04 Mm.275720 5730442A20Rik RIKEN cDNA 5730442A20 gene 0.64 1.25E-04 Mm.22421 Ppp1r14c protein phosphatase 1, regulatory (inhibitor) subunit 14c 1.94 1.26E-04 Mm.23009 Ech1 enoyl coenzyme A hydratase 1, peroxisomal 1.56 1.26E-04 Mm.2112 L1cam L1 cell adhesion molecule 1.30 1.26E-04 Mm.260568 1110067P07Rik RIKEN cDNA 1110067P07 gene 0.73 1.26E-04 Mm.272685 Gus beta-glucuronidase 0.60 1.27E-04 Mm.3317 Fzd8 frizzled homolog 8 (Drosophila) 1.32 1.29E-04 Mm.184289 1200010C09Rik RIKEN cDNA 1200010C09 gene 1.39 1.30E-04 Mm.149870 Tacc2 transforming, acidic coiled-coil containing protein 2 1.36 1.31E-04 Mm.86322 Gabarapl1 gamma-aminobutyric acid (GABA(A)) receptor-associated protein-like 1 1.34 1.31E-04 Mm.14638 D8Ertd531e DNA segment, Chr 8, ERATO Doi 531, expressed 0.71 1.31E-04 Mm.294871 Jam2 junction adhesion molecule 2 0.66 1.31E-04 Mm.41758 2210022N24Rik RIKEN cDNA 2210022N24 gene 1.36 1.32E-04 Mm.293565 Cln8 ceroid-lipofuscinosis, neuronal 8 1.29 1.32E-04 Mm.132532 9130422G05Rik RIKEN cDNA 9130422G05 gene 0.69 1.32E-04 Mm.252239 Bmx BMX non-receptor tyrosine kinase 1.50 1.35E-04 Mm.504 1700022C21Rik RIKEN cDNA 1700022C21 gene 1.32 1.35E-04 Mm.26684 Ccnh cyclin H 0.80 1.35E-04 Mm.18474 Serpina3n serine (or cysteine) proteinase inhibitor, clade A, member 3N 0.34 1.35E-04 Mm.22650 Nutf2 nuclear transport factor 2 0.72 1.36E-04 Mm.269188 Cox7a2 cytochrome c oxidase, subunit VIIa 2 0.71 1.39E-04 Mm.3819 Csnk2a1 casein kinase II, alpha 1 polypeptide 0.56 1.39E-04 Mm.23692 04-Sep septin 4 1.69 1.41E-04 Mm.2214 4932432K03Rik RIKEN cDNA 4932432K03 gene 1.36 1.42E-04 Mm.252040 Kdelr1 KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 1 0.73 1.42E-04 Mm.25045 2610024A01Rik RIKEN cDNA 2610024A01 gene 1.61 1.43E-04 Mm.281287 AL022610 expressed sequence AL022610 1.36 1.43E-04 Mm.27259 Faah fatty acid amide hydrolase 1.34 1.43E-04 Mm.256025 Plcb1 phospholipase C, beta 1 1.32 1.45E-04 Mm.42083 Me2 malic enzyme 2, NAD(+)-dependent, mitochondrial 0.82 1.45E-04 Mm.36817 Pfc properdin factor, complement 0.56 1.45E-04 Mm.3064 Lamp2 lysosomal membrane glycoprotein 2 0.53 1.45E-04 Mm.486 Clk4 CDC like kinase 4 1.69 1.47E-04 Mm.239354 2610036D13Rik RIKEN cDNA 2610036D13 gene 1.31 1.47E-04 Mm.29068 2810409H07Rik RIKEN cDNA 2810409H07 gene 0.72 1.47E-04 Mm.22661 Mt2 metallothionein 2 0.22 1.48E-04 Mm.147226 Impact imprinted and ancient 1.37 1.49E-04 Mm.213423 6030411F23Rik RIKEN cDNA 6030411F23 gene 0.78 1.49E-04 Mm.5356 Col18a1 procollagen, type XVIII, alpha 1 0.75 1.49E-04 Mm.4352 Gsr glutathione reductase 1 0.74 1.49E-04 Mm.283573 Bzw1 basic leucine zipper and W2 domains 1 0.74 1.49E-04 Mm.21848 Tgfb1i4 transforming growth factor beta 1 induced transcript 4 0.69 1.49E-04 Mm.20927 2310067E08Rik RIKEN cDNA 2310067E08 gene 0.59 1.49E-04 Mm.41423 Loxl1 lysyl oxidase-like 1 0.52 1.49E-04 Mm.250492 Siglec5 sialic acid binding Ig-like lectin 5 1.51 1.50E-04 Mm.290569 Nsdhl NAD(P) dependent steroid dehydrogenase-like 1.26 1.50E-04 Mm.38792 Sec63 SEC63-like (S. cerevisiae) 0.72 1.53E-04 Mm.214344 Cldn10 claudin 10 1.30 1.55E-04 Mm.104972 Gtpbp2 GTP binding protein 2 1.30 1.55E-04 Mm.22147 Notch1 Notch gene homolog 1 (Drosophila) 1.42 1.58E-04 Mm.290610 Des desmin 0.78 1.58E-04 Mm.6712 1110001A05Rik RIKEN cDNA 1110001A05 gene 0.62 1.58E-04 Mm.117709 Fancl Fanconi anemia, complementation group L 1.25 1.60E-04 Mm.18875 0610041L09Rik RIKEN cDNA 0610041L09 gene 1.22 1.60E-04 Mm.21501 4930534K13Rik RIKEN cDNA 4930534K13 gene 0.75 1.60E-04 Mm.259672 D7Rp2e DNA segment, Chr 7, Roswell Park 2 complex, expressed 0.71 1.60E-04 Mm.27194 2400004E04Rik RIKEN cDNA 2400004E04 gene 1.50 1.63E-04 Mm.7124 Kcnn4 potassium intermediate/small conductance calcium-activated channel, subfamily N, 0.72 1.63E-04 Mm.9911

190 member 4 Igsf7 immunoglobulin superfamily, member 7 0.71 1.63E-04 Mm.2699 Rab1 RAB1, member RAS oncogene family 0.79 1.64E-04 Mm.271944 Slc1a1 solute carrier family 1, member 1 1.34 1.65E-04 Mm.246670 1810008A14Rik RIKEN cDNA 1810008A14 gene 1.28 1.65E-04 Mm.28924 Aebp1 AE binding protein 1 0.76 1.65E-04 Mm.4665 Acat2 acetyl-Coenzyme A acetyltransferase 2 1.37 1.67E-04 Mm.196520 Pik3c2g phosphatidylinositol 3-kinase, C2 domain containing, gamma polypeptide 1.26 1.68E-04 Mm.10301 2400006A19Rik RIKEN cDNA 2400006A19 gene 0.62 1.68E-04 Mm.27591 Efemp2 epidermal growth factor-containing fibulin-like extracellular matrix protein 2 0.73 1.69E-04 Mm.276367 Apoc2 apolipoprotein C-II 0.53 1.69E-04 Mm.28394 Entpd5 ectonucleoside triphosphate diphosphohydrolase 5 1.32 1.71E-04 Mm.10211 C85658 expressed sequence C85658 1.27 1.71E-04 Mm.206631 Prrx1 paired related homeobox 1 0.79 1.71E-04 Mm.288642 Sgpl1 sphingosine phosphate lyase 1 0.72 1.71E-04 Mm.200373 Rusc1 RUN and SH3 domain containing 1 1.31 1.72E-04 Mm.27687 Mapk8ip3 mitogen-activated protein kinase 8 interacting protein 3 1.27 1.72E-04 Mm.43081 Bub3 budding uninhibited by benzimidazoles 3 homolog (S. cerevisiae) 0.76 1.72E-04 Mm.927 Nfkb2 nuclear factor of kappa light polypeptide gene enhancer in B-cells 2, p49/p100 0.76 1.73E-04 Mm.102365 9430020E02Rik RIKEN cDNA 9430020E02 gene 0.74 1.73E-04 Mm.23998 AW742319 expressed sequence AW742319 1.44 1.75E-04 Mm.21092 Eral1 Era (G-protein)-like 1 (E. coli) 1.24 1.75E-04 Mm.21096 1810009K13Rik RIKEN cDNA 1810009K13 gene 0.82 1.75E-04 Mm.263319 C80913 expressed sequence C80913 0.77 1.75E-04 Mm.23997 Ptx3 pentaxin related gene 0.63 1.75E-04 Mm.276776 Ell2 elongation factor RNA polymerase II 2 0.59 1.75E-04 Mm.21288 Slfn8 schlafen 8 0.51 1.75E-04 Mm.270253 Cpd carboxypeptidase D 0.51 1.75E-04 Mm.20910 Gorasp2 golgi reassembly stacking protein 2 0.79 1.76E-04 Mm.271950 Stx3 syntaxin 3 0.73 1.76E-04 Mm.272264 Col6a2 procollagen, type VI, alpha 2 0.70 1.76E-04 Mm.1949 Lama1 laminin, alpha 1 0.67 1.76E-04 Mm.243 Hdac5 histone deacetylase 5 1.34 1.78E-04 Mm.22665 Thtpa thiamine triphosphatase 1.30 1.78E-04 Mm.221061 Grasp GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein 1.32 1.79E-04 Mm.276573 Anp32e acidic (leucine-rich) nuclear phosphoprotein 32 family, member E 0.77 1.79E-04 Mm.218657 Kist kinase interacting with leukemia-associated gene (stathmin) 0.74 1.81E-04 Mm.209150 Orc6l origin recognition complex, subunit 6-like (S. cerevisiae) 0.73 1.81E-04 Mm.29709 Ldb3 LIM domain binding 3 1.35 1.83E-04 Mm.29733 Cyp2f2 cytochrome P450, family 2, subfamily f, polypeptide 2 1.63 1.84E-04 Mm.298104 Pscd3 pleckstrin homology, Sec7 and coiled-coil domains 3 1.40 1.86E-04 Mm.281003 Acacb acetyl-Coenzyme A carboxylase beta 1.33 1.86E-04 Mm.173067 Pcdhb3 protocadherin beta 3 1.30 1.86E-04 Mm.82308 Pld3 phospholipase D3 0.68 1.86E-04 Mm.6483 Hist1h2bc histone 1, H2bc 0.58 1.88E-04 Mm.261676 Kcnk2 potassium channel, subfamily K, member 2 1.49 1.91E-04 Mm.31570 Sfxn1 sideroflexin 1 0.74 1.91E-04 Mm.134191 0610040B21Rik RIKEN cDNA 0610040B21 gene 1.31 1.92E-04 Mm.159965 Arhj ras homolog gene family, member J 0.57 1.92E-04 Mm.27467 D930015E06Rik RIKEN cDNA D930015E06 gene 1.27 1.94E-04 Mm.28838 MGC6357 hypothetical protein MGC6357 0.76 1.94E-04 Mm.211654 2600013G09Rik RIKEN cDNA 2600013G09 gene 0.74 1.94E-04 Mm.30191 C77892 expressed sequence C77892 0.52 1.94E-04 Mm.174256 Btbd2 BTB (POZ) domain containing 2 1.33 1.95E-04 Mm.60720 Mmp2 matrix metalloproteinase 2 0.63 1.96E-04 Mm.29564 0710001O03Rik RIKEN cDNA 0710001O03 gene 1.32 1.98E-04 Mm.30158 Sfrs5 splicing factor, arginine/serine-rich 5 (SRp40, HRS) 1.34 1.99E-04 Mm.43331 Nthl1 nth (endonuclease III)-like 1 (E.coli) 1.26 1.99E-04 Mm.148315 2610510D13Rik RIKEN cDNA 2610510D13 gene 0.67 2.00E-04 Mm.332344 C820004H04Rik RIKEN cDNA C820004H04 gene 0.63 2.00E-04 Mm.297530 Itpr5 inositol 1,4,5-triphosphate receptor 5 1.35 2.01E-04 Mm.7800 Npr2 natriuretic peptide receptor 2 1.43 2.02E-04 Mm.103477 Cbx2 chromobox homolog 2 (Drosophila Pc class) 1.22 2.02E-04 Mm.14547 Arhg ras homolog gene family, member G 0.58 2.02E-04 Mm.259795 Rasgrf2 RAS protein-specific guanine nucleotide-releasing factor 2 1.26 2.03E-04 Mm.57233 Pccb propionyl Coenzyme A carboxylase, beta polypeptide 1.27 2.05E-04 Mm.21079 Rab3a RAB3A, member RAS oncogene family 1.38 2.07E-04 Mm.5083 Gnpnat1 glucosamine-phosphate N-acetyltransferase 1 0.70 2.07E-04 Mm.233534 Gjb3 gap junction membrane channel protein beta 3 0.68 2.08E-04 Mm.90003 Ddx6 DEAD (Asp-Glu-Ala-Asp) box polypeptide 6 0.54 2.08E-04 Mm.130899 C330016O16Rik RIKEN cDNA C330016O16 gene 1.39 2.09E-04 Mm.156227 1810036J22Rik RIKEN cDNA 1810036J22 gene 1.35 2.09E-04 Mm.259708 Nars asparaginyl-tRNA synthetase 0.78 2.11E-04 Mm.29192 Kdr kinase insert domain protein receptor 1.65 2.12E-04 Mm.285

191 Tmc4 transmembrane channel-like gene family 4 1.36 2.12E-04 Mm.195872 methylenetetrahydrofolate dehydrogenase (NAD+ dependent), Mthfd2 methenyltetrahydrofolate cyclohydrolase 0.67 2.12E-04 Mm.443 Egfl7 EGF-like domain 7 1.33 2.13E-04 Mm.268933 Adam9 a disintegrin and metalloproteinase domain 9 (meltrin gamma) 0.69 2.13E-04 Mm.28908 Oasl1 2'-5' oligoadenylate synthetase-like 1 0.69 2.13E-04 Mm.95479 Rnf4 ring finger protein 4 0.74 2.15E-04 Mm.113388 Sprr1a small proline-rich protein 1A 0.44 2.16E-04 Mm.625 AI256711 expressed sequence AI256711 1.30 2.17E-04 Mm.235813 Epb4.1l3 erythrocyte protein band 4.1-like 3 1.37 2.19E-04 Mm.131135 2310079P12Rik RIKEN cDNA 2310079P12 gene 1.35 2.20E-04 Mm.2947 2410004D18Rik RIKEN cDNA 2410004D18 gene 1.25 2.20E-04 Mm.272847 AA959742 expressed sequence AA959742 0.62 2.20E-04 Mm.269069 Prodh proline dehydrogenase 1.42 2.21E-04 Mm.28456 Slc37a3 solute carrier family 37 (glycerol-3-phosphate transporter), member 3 1.30 2.21E-04 Mm.277527 Stat3 signal transducer and activator of transcription 3 0.59 2.21E-04 Mm.249934 Frzb frizzled-related protein 0.74 2.22E-04 Mm.136022 Lphn1 latrophilin 1 1.28 2.27E-04 Mm.260733 S100a14 S100 calcium binding protein A14 0.53 2.27E-04 Mm.24006 Irf7 interferon regulatory factor 7 0.53 2.27E-04 Mm.3233 4833420K19Rik RIKEN cDNA 4833420K19 gene 0.76 2.29E-04 Mm.27293 2810468K05Rik RIKEN cDNA 2810468K05 gene 0.75 2.29E-04 Mm.274756 Samsn1 SAM domain, SH3 domain and nuclear localisation signals, 1 0.69 2.29E-04 Mm.131406 2810443J12Rik RIKEN cDNA 2810443J12 gene 0.63 2.29E-04 Mm.296844 Tacc3 transforming, acidic coiled-coil containing protein 3 0.78 2.31E-04 Mm.27836 Col8a1 procollagen, type VIII, alpha 1 0.73 2.31E-04 Mm.130388 Ppp2r4 protein phosphatase 2A, regulatory subunit B (PR 53) 0.78 2.32E-04 Mm.275393 Cyhr1 cysteine and histidine rich 1 1.27 2.33E-04 Mm.18561 Stard4 StAR-related lipid transfer (START) domain containing 4 1.46 2.35E-04 Mm.127058 Psme4 proteasome (prosome, macropain) activator subunit 4 0.71 2.35E-04 Mm.240066 AB041541 hypothetical protein, MNCb-1504 1.35 2.36E-04 Mm.103476 D7Ertd671e DNA segment, Chr 7, ERATO Doi 671, expressed 0.70 2.36E-04 Mm.29997 Cd22 CD22 antigen 1.37 2.37E-04 Mm.260994 1620401E04Rik RIKEN cDNA 1620401E04 gene 1.39 2.38E-04 Mm.30114 1110031I02Rik RIKEN cDNA 1110031I02 gene 1.27 2.38E-04 Mm.220890 Tnfsf12 tumor necrosis factor (ligand) superfamily, member 12 1.22 2.38E-04 Mm.8983 1500031M22Rik RIKEN cDNA 1500031M22 gene 0.74 2.38E-04 Mm.9563 Rpo2tc1 RNA polymerase II transcriptional coactivator 0.73 2.39E-04 Mm.41746 A230046K03Rik RIKEN cDNA A230046K03 gene 0.60 2.39E-04 Mm.278577 Taf7 TAF7 RNA polymerase II, TATA box binding protein (TBP)-associated factor 1.31 2.42E-04 Mm.236009 D10Ertd749e DNA segment, Chr 10, ERATO Doi 749, expressed 0.72 2.43E-04 Mm.62876 Enah enabled homolog (Drosophila) 0.64 2.43E-04 Mm.87759 Ctsl cathepsin L 0.63 2.43E-04 Mm.930 Edg2 endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 2 0.61 2.43E-04 Mm.4772 1110061L23Rik RIKEN cDNA 1110061L23 gene 1.30 2.45E-04 Mm.181689 Gpd1 glycerol-3-phosphate dehydrogenase 1 (soluble) 1.31 2.47E-04 Mm.252391 Nlgn2 neuroligin 2 0.78 2.47E-04 Mm.296744 D11Ertd498e DNA segment, Chr 11, ERATO Doi 498, expressed 0.74 2.47E-04 Mm.301257 6330514M23Rik RIKEN cDNA 6330514M23 gene 0.66 2.47E-04 Mm.3124 6330406P08Rik RIKEN cDNA 6330406P08 gene 0.76 2.49E-04 Mm.35817 Npr1 natriuretic peptide receptor 1 1.45 2.50E-04 Mm.4627 sialyltransferase 7 ((alpha-N-acetylneuraminyl 2,3-betagalactosyl-1,3)-N-acetyl Siat7d galactosaminide alpha-2,6-sialyltransferase) D 0.78 2.51E-04 Mm.27446 Fbxo17 F-box only protein 17 0.50 2.51E-04 Mm.9043 Rfxank regulatory factor X-associated ankyrin-containing protein 1.33 2.52E-04 Mm.298302 Pitpn phosphatidylinositol transfer protein 0.75 2.52E-04 Mm.238958 C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily Clecsf6 member 6 0.74 2.52E-04 Mm.47384 AW822216 expressed sequence AW822216 1.37 2.53E-04 Mm.236454 Esam1 endothelial cell-specific adhesion molecule 1.33 2.53E-04 Mm.41751 1810012H11Rik RIKEN cDNA 1810012H11 gene 1.28 2.55E-04 Mm.271931 B230379M23Rik RIKEN cDNA B230379M23 gene 1.25 2.55E-04 Mm.35108 Bat5 HLA-B associated transcript 5 0.76 2.56E-04 Mm.43745 Fabp1 fatty acid binding protein 1, liver 1.88 2.57E-04 Mm.22126 2310008M14Rik RIKEN cDNA 2310008M14 gene 1.29 2.57E-04 Mm.259467 Ckm creatine kinase, muscle 1.76 2.60E-04 Mm.2375 Csrp3 cysteine and glycine-rich protein 3 1.57 2.60E-04 Mm.17235 Rps27a ribosomal protein S27a 0.80 2.60E-04 Mm.180003 Abcb10 ATP-binding cassette, sub-family B (MDR/TAP), member 10 0.75 2.60E-04 Mm.274243 Bhlhb2 basic helix-loop-helix domain containing, class B2 0.71 2.60E-04 Mm.2436 Rab4a RAB4A, member RAS oncogene family 1.33 2.61E-04 Mm.9221 Tirap toll-interleukin 1 receptor (TIR) domain-containing adaptor protein 1.46 2.63E-04 Mm.23987 Snx10 sorting nexin 10 0.75 2.65E-04 Mm.294166 Idh3g isocitrate dehydrogenase 3 (NAD+), gamma 1.32 2.69E-04 Mm.14825 Gab1 growth factor receptor bound protein 2-associated protein 1 1.26 2.70E-04 Mm.277409

192 D10Jhu81e DNA segment, Chr 10, Johns Hopkins University 81 expressed 1.25 2.70E-04 Mm.268691 2310008M10Rik RIKEN cDNA 2310008M10 gene 0.73 2.70E-04 Mm.279721 Tna tetranectin (plasminogen binding protein) 1.60 2.72E-04 Mm.34588 Clcn5 chloride channel 5 0.71 2.72E-04 Mm.254370 Prkcz protein kinase C, zeta 1.33 2.73E-04 Mm.28561 0610009O20Rik RIKEN cDNA 0610009O20 gene 1.28 2.78E-04 Mm.281086 2810413N20Rik RIKEN cDNA 2810413N20 gene 1.30 2.79E-04 Mm.292720 Rspondin thrombospondin type 1 domain containing gene 1.39 2.80E-04 Mm.42202 Myo1b myosin IB 1.44 2.82E-04 Mm.3390 Lasp1 LIM and SH3 protein 1 0.60 2.83E-04 Mm.271967 Dnase1 deoxyribonuclease I 1.23 2.87E-04 Mm.239992 2610020H15Rik RIKEN cDNA 2610020H15 gene 0.71 2.87E-04 Mm.281887 Lcn7 lipocalin 7 0.62 2.87E-04 Mm.15801 Wbp5 WW domain binding protein 5 0.74 2.88E-04 Mm.512 Nsep1 nuclease sensitive element binding protein 1 0.76 2.89E-04 Mm.200413 C76746 expressed sequence C76746 0.75 2.89E-04 Mm.202750 Cpsf5 cleavage and polyadenylation specific factor 5 0.73 2.89E-04 Mm.28961 4932441K18 CXORF15 1.42 2.90E-04 Mm.282872 2310007F12Rik RIKEN cDNA 2310007F12 gene 1.41 2.91E-04 Mm.8142 Edn3 endothelin 3 1.26 2.91E-04 Mm.9478 1110017O10Rik RIKEN cDNA 1110017O10 gene 1.94 2.94E-04 Mm.241098 Fgf1 fibroblast growth factor 1 1.77 2.94E-04 Mm.241282 Actr8 ARP8 actin-related protein 8 homolog (S. cerevisiae) 1.26 2.94E-04 Mm.215110 Hspa1a heat shock protein 1A 0.63 2.94E-04 Mm.275405 Zfp288 zinc finger protein 288 0.57 2.94E-04 Mm.211212 C030018L16Rik RIKEN cDNA C030018L16 gene 1.24 2.96E-04 Mm.288739 Camkk1 calcium/calmodulin-dependent protein kinase kinase 1, alpha 1.30 2.97E-04 Mm.9998 4933428I03Rik RIKEN cDNA 4933428I03 gene 0.69 2.97E-04 Mm.254605 BC025600 cDNA sequence BC025600 1.24 2.98E-04 Mm.41681 Map1lc3 microtubule-associated protein 1 light chain 3 1.22 3.03E-04 Mm.28357 Cd14 CD14 antigen 0.74 3.03E-04 Mm.3460 Syngr1 synaptogyrin 1 0.71 3.07E-04 Mm.230301 Serpina1b serine (or cysteine) proteinase inhibitor, clade A, member 1b 1.41 3.08E-04 Mm.275860 D430024K22Rik RIKEN cDNA D430024K22 gene 0.77 3.08E-04 Mm.34316 Birc1e baculoviral IAP repeat-containing 1e 0.71 3.10E-04 Mm.290476 Aldh7a1 aldehyde dehydrogenase family 7, member A1 1.25 3.11E-04 Mm.30250 Pbp phosphatidylethanolamine binding protein 1.24 3.11E-04 Mm.299003 Acvr1 activin A receptor, type 1 0.72 3.11E-04 Mm.689 Zbp1 Z-DNA binding protein 1 0.63 3.11E-04 Mm.116687 Sftpa surfactant associated protein A 1.55 3.12E-04 Mm.46062 Tas1r3 taste receptor, type 1, member 3 1.50 3.12E-04 Mm.3400 2900008M13Rik RIKEN cDNA 2900008M13 gene 0.75 3.12E-04 Mm.86933 Plu1 putative DNA/chromatin binding motif 1 0.74 3.12E-04 Mm.28995 Tpm1 tropomyosin 1, alpha 0.72 3.12E-04 Mm.121878 Bach1 BTB and CNC homology 1 0.54 3.12E-04 Mm.5183 2810036M19Rik RIKEN cDNA 2810036M19 gene 0.61 3.13E-04 Mm.34776 3110038K10Rik RIKEN cDNA 3110038K10 gene 1.24 3.14E-04 Mm.276114 1110019C08Rik RIKEN cDNA 1110019C08 gene 0.61 3.15E-04 Mm.29482 Sgk3 serum/glucocorticoid regulated kinase 3 0.76 3.17E-04 Mm.207784 Tap1 transporter 1, ATP-binding cassette, sub-family B (MDR/TAP) 0.65 3.18E-04 Mm.207996 MGC59076 hypothetical protein MGC59076 1.33 3.19E-04 Mm.37547 D5Wsu46e DNA segment, Chr 5, Wayne State University 46, expressed 1.27 3.21E-04 Mm.61193 Cd5l CD5 antigen-like 0.65 3.22E-04 Mm.6676 Trim30 tripartite motif protein 30 0.60 3.23E-04 Mm.295578 Ccl17 chemokine (C-C motif) ligand 17 0.63 3.24E-04 Mm.41988 Gfpt2 glutamine fructose-6-phosphate transaminase 2 0.65 3.26E-04 Mm.24402 Bmp2k BMP2 inducible kinase 0.60 3.26E-04 Mm.281490 Igh-VJ558 immunoglobulin heavy chain (J558 family) 2.77 3.28E-04 Mm.240437 Tdrd3 tudor domain containing 3 1.85 3.28E-04 Mm.250990 L259 L259 1.55 3.28E-04 Mm.89556 Wnt4 wingless-related MMTV integration site 4 0.71 3.30E-04 Mm.20355 Pon3 paraoxonase 3 1.53 3.32E-04 Mm.9122 Cktsf1b1 cysteine knot superfamily 1, BMP antagonist 1 0.75 3.32E-04 Mm.166318 Oxa1l oxidase assembly 1-like 1.25 3.33E-04 Mm.182340 Enpp1 ectonucleotide pyrophosphatase/phosphodiesterase 1 0.79 3.34E-04 Mm.27254 Pbx1 pre B-cell leukemia transcription factor 1 0.72 3.34E-04 Mm.43358 Slc22a1l solute carrier family 22 (organic cation transporter), member 1-like 1.26 3.37E-04 Mm.271740 1300017C10Rik RIKEN cDNA 1300017C10 gene 0.76 3.37E-04 Mm.29357 Tcf4 transcription factor 4 0.71 3.38E-04 Mm.4269 Zfp37 zinc finger protein 37 0.78 3.39E-04 Mm.5011 Srm spermidine synthase 0.71 3.39E-04 Mm.10 0910001A06Rik RIKEN cDNA 0910001A06 gene 0.69 3.39E-04 Mm.246108 Aqp5 aquaporin 5 1.36 3.40E-04 Mm.45580 Rga recombination activating gene 1 gene activation 1.33 3.40E-04 Mm.17958

193 Flna filamin, alpha 0.69 3.41E-04 Mm.295533 Myadm myeloid-associated differentiation marker 0.81 3.42E-04 Mm.29874 2310045A20Rik RIKEN cDNA 2310045A20 gene 0.79 3.42E-04 Mm.235020 Fxyd3 FXYD domain-containing ion transport regulator 3 0.77 3.43E-04 Mm.263847 Rpl31 ribosomal protein L31 0.71 3.43E-04 Mm.285021 Cyp51 cytochrome P450, 51 0.63 3.43E-04 Mm.140158 BC011426 cDNA sequence BC011426 1.21 3.44E-04 Mm.239669 Apbb3 amyloid beta (A4) precursor protein-binding, family B, member 3 1.28 3.45E-04 Mm.89673 Msr1 macrophage scavenger receptor 1 0.52 3.45E-04 Mm.239291 ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), Atp5g2 isoform 2 1.27 3.46E-04 Mm.301327 Capza2 capping protein (actin filament) muscle Z-line, alpha 2 0.74 3.46E-04 Mm.260626 D9Bwg0185e DNA segment, Chr 9, Brigham & Women's Genetics 0185 expressed 0.64 3.46E-04 Mm.193647 Slc20a1 solute carrier family 20, member 1 0.73 3.47E-04 Mm.272675 Eef1e1 eukaryotic translation elongation factor 1 epsilon 1 0.71 3.47E-04 Mm.36683 Map2k6 mitogen activated protein kinase kinase 6 1.25 3.48E-04 Mm.14487 Hn1 hematological and neurological expressed sequence 1 0.66 3.48E-04 Mm.1775 Actr3 ARP3 actin-related protein 3 homolog (yeast) 0.67 3.50E-04 Mm.183102 Myo6 myosin VI 1.41 3.51E-04 Mm.4040 Sh3d4 SH3 domain protein 4 1.30 3.51E-04 Mm.5068 AI504298 expressed sequence AI504298 1.38 3.52E-04 Mm.206250 9130017A15Rik RIKEN cDNA 9130017A15 gene 1.29 3.52E-04 Mm.246267 Map4k6 mitogen-activated protein kinase kinase kinase kinase 6 1.24 3.52E-04 Mm.42967 Socs5 suppressor of cytokine signaling 5 0.76 3.52E-04 Mm.126885 Vegfa vascular endothelial growth factor A 1.36 3.55E-04 Mm.31540 B230114J08Rik RIKEN cDNA B230114J08 gene 1.32 3.56E-04 Mm.290341 Aldh1a7 aldehyde dehydrogenase family 1, subfamily A7 1.39 3.57E-04 Mm.14609 2410174K12Rik RIKEN cDNA 2410174K12 gene 1.26 3.57E-04 Mm.18972 3830421F13Rik RIKEN cDNA 3830421F13 gene 0.69 3.63E-04 Mm.253042 Mrpl3 mitochondrial ribosomal protein L3 0.71 3.65E-04 Mm.29746 Mcpt8 mast cell protease 8 1.37 3.68E-04 Mm.41979 Smc6l1 SMC6 structural maintenance of chromosomes 6-like 1 (yeast) 1.27 3.69E-04 Mm.173953 F830020C16Rik RIKEN cDNA F830020C16 gene 1.56 3.70E-04 Mm.844 Suclg1 succinate-CoA ligase, GDP-forming, alpha subunit 1.29 3.70E-04 Mm.29845 Prkacb protein kinase, cAMP dependent, catalytic, beta 0.78 3.70E-04 Mm.16766 Nme2 expressed in non-metastatic cells 2, protein 0.71 3.70E-04 Mm.298224 9130017L10Rik RIKEN cDNA 9130017L10 gene 0.66 3.70E-04 Mm.283495 S100a9 S100 calcium binding protein A9 (calgranulin B) 2.23 3.71E-04 Mm.2128 Hif1a hypoxia inducible factor 1, alpha subunit 0.66 3.73E-04 Mm.3879 Ngb neuroglobin 1.23 3.74E-04 Mm.41395 Dnaja4 DnaJ (Hsp40) homolog, subfamily A, member 4 1.48 3.75E-04 Mm.52319 Slc6a4 solute carrier family 6 (neurotransmitter transporter, serotonin), member 4 1.44 3.76E-04 Mm.3907 Rab25 RAB25, member RAS oncogene family 1.23 3.76E-04 Mm.26994 S100a4 S100 calcium binding protein A4 0.47 3.76E-04 Mm.3925 Csrp1 cysteine and glycine-rich protein 1 0.65 3.78E-04 Mm.196484 Mup1 major urinary protein 1 0.61 3.78E-04 Mm.237772 4933436C10Rik RIKEN cDNA 4933436C10 gene 0.80 3.80E-04 Mm.24397 Mrps9 mitochondrial ribosomal protein S9 1.32 3.83E-04 Mm.252982 3732409C05Rik RIKEN cDNA 3732409C05 gene 0.59 3.86E-04 Mm.206919 1810057C19Rik RIKEN cDNA 1810057C19 gene 1.78 3.87E-04 Mm.212428 1810017G16Rik RIKEN cDNA 1810017G16 gene 1.56 3.87E-04 Mm.38746 2310020H20Rik RIKEN cDNA 2310020H20 gene 1.23 3.87E-04 Mm.29497 Calu calumenin 0.71 3.88E-04 Mm.253494 Slc23a2 solute carrier family 23 (nucleobase transporters), member 2 1.37 3.89E-04 Mm.102014 Arl6ip6 ADP-ribosylation factor-like 6 interacting protein 6 1.30 3.90E-04 Mm.37623 Klhl10 kelch-like 10 (Drosophila) 1.25 3.90E-04 Mm.34168 Agtrl1 angiotensin receptor-like 1 1.61 3.95E-04 Mm.29368 Ap1s1 adaptor protein complex AP-1, sigma 1 0.80 3.95E-04 Mm.833 3110065C23Rik RIKEN cDNA 3110065C23 gene 0.80 3.95E-04 Mm.234757 Tbxas1 thromboxane A synthase 1, platelet 0.78 3.95E-04 Mm.4054 BC012871 cDNA sequence BC012871 1.34 3.96E-04 Mm.100282 H13 histocompatibility 13 0.75 3.96E-04 Mm.277327 AA409541 expressed sequence AA409541 0.60 3.96E-04 Mm.290530 Ifit1 interferon-induced protein with tetratricopeptide repeats 1 0.48 3.96E-04 Mm.6718 MGC18894 hypothetical protein MGC18894 1.63 3.97E-04 Mm.29110 2410003P15Rik RIKEN cDNA 2410003P15 gene 1.23 3.97E-04 Mm.158827 Rdx radixin 0.58 3.98E-04 Mm.245746 D6Ertd349e DNA segment, Chr 6, ERATO Doi 349, expressed 1.28 3.99E-04 Mm.196943 9430059D04Rik RIKEN cDNA 9430059D04 gene 1.39 4.00E-04 Mm.273418 3010027G13Rik RIKEN cDNA 3010027G13 gene 1.33 4.00E-04 Mm.44226 Mrpl45 mitochondrial ribosomal protein L45 0.76 4.04E-04 Mm.249520 2810423E13Rik RIKEN cDNA 2810423E13 gene 1.30 4.07E-04 Mm.130610 Tor1b torsin family 1, member B 0.68 4.11E-04 Mm.249164 H2-Ke6 H2-K region expressed gene 6 1.30 4.12E-04 Mm.275452

194 Fzd1 frizzled homolog 1 (Drosophila) 0.70 4.13E-04 Mm.246003 Apbb1 amyloid beta (A4) precursor protein-binding, family B, member 1 1.33 4.15E-04 Mm.38469 2210021J22Rik RIKEN cDNA 2210021J22 gene 1.23 4.15E-04 Mm.33706 1810020E01Rik RIKEN cDNA 1810020E01 gene 0.76 4.15E-04 Mm.28963 9030425C21Rik RIKEN cDNA 9030425C21 gene 1.24 4.18E-04 Mm.171334 Sort1 sortilin 1 1.36 4.19E-04 Mm.157119 Cte1 cytosolic acyl-CoA thioesterase 1 1.79 4.21E-04 Mm.1978 Gpam glycerol-3-phosphate acyltransferase, mitochondrial 1.38 4.21E-04 Mm.210196 Cldn7 claudin 7 1.36 4.21E-04 Mm.281896 Mesdc1 mesoderm development candidate 1 1.29 4.21E-04 Mm.272998 R75183 expressed sequence R75183 0.66 4.21E-04 Mm.295397 Ihpk1 inositol hexaphosphate kinase 1 1.28 4.23E-04 Mm.276155 D7Ertd458e DNA segment, Chr 7, ERATO Doi 458, expressed 0.73 4.23E-04 Mm.227506 Sgce sarcoglycan, epsilon 1.31 4.24E-04 Mm.8739 Gltscr2 glioma tumor suppressor candidate region gene 2 1.25 4.24E-04 Mm.277634 Col16a1 procollagen, type XVI, alpha 1 0.82 4.24E-04 Mm.41860 B430218L07Rik RIKEN cDNA B430218L07 gene 0.78 4.24E-04 Mm.151962 Folr2 folate receptor 2 (fetal) 0.58 4.24E-04 Mm.2724 1810073M23Rik RIKEN cDNA 1810073M23 gene 0.80 4.26E-04 Mm.246440 2810004N23Rik RIKEN cDNA 2810004N23 gene 0.72 4.26E-04 Mm.24141 Zfp91 zinc finger protein 91 0.66 4.26E-04 Mm.290924 Pfdn1 prefoldin 1 0.63 4.26E-04 Mm.327008 Hes1 hairy and enhancer of split 1 (Drosophila) 1.37 4.27E-04 Mm.287081 Actb actin, beta, cytoplasmic 0.75 4.28E-04 Mm.133292 Tpm2 tropomyosin 2, beta 0.71 4.30E-04 Mm.646 Add3 adducin 3 (gamma) 1.42 4.31E-04 Mm.44106 Ralbp1 ralA binding protein 1 1.33 4.31E-04 Mm.17009 2610524G07Rik RIKEN cDNA 2610524G07 gene 0.82 4.32E-04 Mm.222823 D7Bwg0421e DNA segment, Chr 7, Brigham & Women's Genetics 0421 expressed 0.75 4.33E-04 Mm.290880 A830007P12Rik RIKEN cDNA A830007P12 gene 1.42 4.34E-04 Mm.119747 Mef2a myocyte enhancer factor 2A 0.66 4.34E-04 Mm.250681 Bcap31 B-cell receptor-associated protein 31 1.25 4.35E-04 Mm.17 Ugt1a1 UDP-glucuronosyltransferase 1 family, member 1 1.31 4.38E-04 Mm.268456 Crlf1 cytokine receptor-like factor 1 0.76 4.38E-04 Mm.116700 Ctgf connective tissue growth factor 0.62 4.39E-04 Mm.1810 Nrbf2 nuclear receptor binding factor 2 0.77 4.40E-04 Mm.136223 Gba2 glucosidase beta 2 1.34 4.41E-04 Mm.229444 Phka1 phosphorylase kinase alpha 1 1.21 4.41E-04 Mm.212889 Abca8a ATP-binding cassette, sub-family A (ABC1), member 8a 1.42 4.43E-04 Mm.298496 Cdkn2c cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) 1.36 4.43E-04 Mm.1912 Enpp4 ectonucleotide pyrophosphatase/phosphodiesterase 4 1.33 4.43E-04 Mm.290707 Cpa3 carboxypeptidase A3, mast cell 1.28 4.43E-04 Mm.1135 Cml1 camello-like 1 1.22 4.44E-04 Mm.13036 Gas7 growth arrest specific 7 0.80 4.45E-04 Mm.40338 Slbp stem-loop binding protein 1.35 4.48E-04 Mm.4172 1110020C07Rik RIKEN cDNA 1110020C07 gene 0.68 4.48E-04 Mm.103072 Tex261 testis expressed gene 261 0.67 4.48E-04 Mm.28371 A230103N10Rik RIKEN cDNA A230103N10 gene 0.70 4.49E-04 Mm.247113 Rora RAR-related orphan receptor alpha 1.31 4.51E-04 Mm.271788 Slc22a5 solute carrier family 22 (organic cation transporter), member 5 1.23 4.53E-04 Mm.42253 Numb numb gene homolog (Drosophila) 1.31 4.54E-04 Mm.4390 1110020D10Rik RIKEN cDNA 1110020D10 gene 0.78 4.55E-04 Mm.253335 Rnf141 ring finger protein 141 1.33 4.57E-04 Mm.268926 01-Sep septin 1 1.32 4.57E-04 Mm.18 Ddx3x DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 3, X-linked 0.67 4.58E-04 Mm.18459 Sfrp2 secreted frizzled-related sequence protein 2 0.60 4.58E-04 Mm.19155 Tcn2 transcobalamin 2 1.35 4.60E-04 Mm.20948 Nit1 nitrilase 1 1.22 4.60E-04 Mm.12915 Cpsf4 cleavage and polyadenylation specific factor 4 1.23 4.61E-04 Mm.196884 6720463E02Rik RIKEN cDNA 6720463E02 gene 0.77 4.61E-04 Mm.246436 D030053O22Rik RIKEN cDNA D030053O22 gene 1.26 4.64E-04 Mm.256018 Gmppb GDP-mannose pyrophosphorylase B 0.80 4.64E-04 Mm.22554 Gmpr guanosine monophosphate reductase 1.32 4.70E-04 Mm.290802 Rbpsuh recombining binding protein suppressor of hairless (Drosophila) 0.81 4.70E-04 Mm.209292 Snx2 sorting nexin 2 0.78 4.72E-04 Mm.252171 Vamp5 vesicle-associated membrane protein 5 1.36 4.73E-04 Mm.42184 Vtn vitronectin 1.38 4.74E-04 Mm.3667 E030024M05Rik RIKEN cDNA E030024M05 gene 1.33 4.76E-04 Mm.5675 BC006909 cDNA sequence BC006909 1.27 4.76E-04 Mm.44183 E2f6 E2F transcription factor 6 1.24 4.76E-04 Mm.23296 B430214A04Rik RIKEN cDNA B430214A04 gene 1.30 4.77E-04 Mm.27707 Hgfac hepatocyte growth factor activator 1.25 4.77E-04 Mm.27369 2310014H01Rik RIKEN cDNA 2310014H01 gene 0.82 4.78E-04 Mm.218511 Rgs19 regulator of G-protein signaling 19 0.76 4.83E-04 Mm.274366

195 Acvr2b activin receptor IIB 1.31 4.84E-04 Mm.8940 A630065K24Rik RIKEN cDNA A630065K24 gene 0.67 4.84E-04 Mm.39723 Rab10 RAB10, member RAS oncogene family 0.60 4.85E-04 Mm.74596 Hps3 Hermansky-Pudlak syndrome 3 homolog (human) 1.25 4.87E-04 Mm.291533 Ppp1cc protein phosphatase 1, catalytic subunit, gamma isoform 0.80 4.87E-04 Mm.280784 Thbs2 thrombospondin 2 0.73 4.87E-04 Mm.26688 Obox1 oocyte specific homeobox 1 1.32 4.88E-04 Mm.269992 Cappa1 capping protein alpha 1 0.62 4.89E-04 Mm.19142 BC008155 cDNA sequence BC008155 1.32 4.91E-04 Mm.26783 BC019943 cDNA sequence BC019943 1.31 4.91E-04 Mm.174615 Krt2-6g keratin complex 2, basic, gene 6g 1.28 4.92E-04 Mm.247382 Gpr105 G protein-coupled receptor 105 0.72 4.97E-04 Mm.239569 Park2 parkin 1.27 4.98E-04 Mm.42046 Procr protein C receptor, endothelial 0.70 4.99E-04 Mm.3243 0610007L05Rik RIKEN cDNA 0610007L05 gene 1.49 5.01E-04 Mm.28231 Ets2 E26 avian leukemia oncogene 2, 3' domain 1.34 5.01E-04 Mm.290207 Fiz1 Flt3 interacting zinc finger protein 1 1.20 5.01E-04 Mm.38911 Zfpm2 zinc finger protein, multitype 2 0.75 5.01E-04 Mm.39496 Plaa phospholipase A2, activating protein 0.81 5.02E-04 Mm.22724 Zfp261 zinc finger protein 261 1.21 5.06E-04 Mm.23458 Crnkl1 Crn, crooked neck-like 1 (Drosophila) 1.27 5.07E-04 Mm.248755 Tm7sf2 transmembrane 7 superfamily member 2 1.36 5.09E-04 Mm.301370 Np15 nuclear protein 15.6 1.33 5.09E-04 Mm.30084 2810406K24Rik RIKEN cDNA 2810406K24 gene 1.26 5.12E-04 Mm.18589 D4Ertd765e DNA segment, Chr 4, ERATO Doi 765, expressed 1.27 5.16E-04 Mm.270783 Ikbkg inhibitor of kappaB kinase gamma 1.28 5.17E-04 Mm.12967 Grb10 growth factor receptor bound protein 10 0.69 5.17E-04 Mm.273117 Ace2 angiotensin I converting enzyme (peptidyl-dipeptidase A) 2 1.36 5.19E-04 Mm.13451 Eif5 eukaryotic translation initiation factor 5 0.74 5.20E-04 Mm.271222 Col6a3 procollagen, type VI, alpha 3 0.59 5.20E-04 Mm.7562 Cdadc1 cytidine and dCMP deaminase domain containing 1 1.29 5.22E-04 Mm.2046 Tlr2 toll-like receptor 2 0.75 5.24E-04 Mm.87596 Igj immunoglobulin joining chain 3.12 5.25E-04 Mm.1192 Sec1 secretory blood group 1 1.34 5.26E-04 Mm.56914 Smo smoothened homolog (Drosophila) 1.28 5.26E-04 Mm.29279 1500031N24Rik RIKEN cDNA 1500031N24 gene 1.19 5.26E-04 Mm.294295 Phxr5 per-hexamer repeat gene 5 1.85 5.27E-04 Mm.40447 Oaz2 ornithine decarboxylase antizyme 2 1.30 5.27E-04 Mm.116749 Col6a1 procollagen, type VI, alpha 1 0.68 5.29E-04 Mm.2509 Fst follistatin 0.40 5.30E-04 Mm.4913 Spic Spi-C transcription factor (Spi-1/PU.1 related) 1.21 5.34E-04 Mm.21642 Havcr2 hepatitis A virus cellular receptor 2 0.78 5.34E-04 Mm.72168 2610102K23Rik RIKEN cDNA 2610102K23 gene 0.72 5.34E-04 Mm.294783 Madh4 MAD homolog 4 (Drosophila) 0.75 5.35E-04 Mm.100399 Siat10 sialyltransferase 10 (alpha-2,3-sialyltransferase VI) 1.33 5.39E-04 Mm.212742 Slc12a2 solute carrier family 12, member 2 1.35 5.42E-04 Mm.228433 Tm4sf11 transmembrane 4 superfamily member 11 1.33 5.46E-04 Mm.281557 methylenetetrahydrofolate dehydrogenase (NADP+ dependent), Mthfd1 methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthase 1.38 5.47E-04 Mm.29584 Edg6 endothelial differentiation, G-protein-coupled receptor 6 1.25 5.47E-04 Mm.33065 Clk2 CDC-like kinase 2 1.24 5.47E-04 Mm.288098 Cugbp2 CUG triplet repeat,RNA binding protein 2 0.70 5.47E-04 Mm.147091 Prpf8 pre-mRNA processing factor 8 1.24 5.48E-04 Mm.3757 Cda cytidine deaminase 0.73 5.50E-04 Mm.46182 Prkca protein kinase C, alpha 0.77 5.54E-04 Mm.234258 Syncrip synaptotagmin binding, cytoplasmic RNA interacting protein 0.62 5.54E-04 Mm.260545 Ly75 lymphocyte antigen 75 1.22 5.55E-04 Mm.2074 Tie1 tyrosine kinase receptor 1 1.71 5.56E-04 Mm.4345 Rgs6 regulator of G-protein signaling 6 1.28 5.59E-04 Mm.153013 6530401D17Rik RIKEN cDNA 6530401D17 gene 1.43 5.60E-04 Mm.27579 2600002E23Rik RIKEN cDNA 2600002E23 gene 1.28 5.60E-04 Mm.20818 Zfp185 zinc finger protein 185 1.21 5.64E-04 Mm.1161 Tcap titin-cap 1.69 5.66E-04 Mm.10762 8430420C20Rik RIKEN cDNA 8430420C20 gene 0.81 5.68E-04 Mm.257952 Ripk3 receptor-interacting serine-threonine kinase 3 0.72 5.70E-04 Mm.46612 AI747096 expressed sequence AI747096 0.69 5.70E-04 Mm.236067 Ltk leukocyte tyrosine kinase 1.25 5.71E-04 Mm.1740 Ecm1 extracellular matrix protein 1 0.58 5.71E-04 Mm.3433 Pvrl3 poliovirus receptor-related 3 1.31 5.72E-04 Mm.135989 AW060207 expressed sequence AW060207 1.22 5.72E-04 Mm.159681 Acp1 acid phosphatase 1, soluble 0.79 5.72E-04 Mm.171337 Cab39 calcium binding protein 39 0.73 5.73E-04 Mm.26135 Casp3 caspase 3, apoptosis related cysteine protease 0.68 5.73E-04 Mm.34405 Plce1 phospholipase C, epsilon 1 1.46 5.75E-04 Mm.34031

196 Tbl1x transducin (beta)-like 1 X-linked 0.69 5.75E-04 Mm.258476 Pde7a phosphodiesterase 7A 0.62 5.77E-04 Mm.244900 2310076E16Rik RIKEN cDNA 2310076E16 gene 1.34 5.81E-04 Mm.33857 Scamp5 secretory carrier membrane protein 5 0.77 5.84E-04 Mm.102278 Cldn2 claudin 2 0.65 5.84E-04 Mm.117068 Cd207 CD 207 antigen 1.39 5.87E-04 Mm.136079 Mto1 mitochondrial translation optimization 1 homolog (S. cerevisiae) 1.25 5.87E-04 Mm.291779 9430083G14Rik RIKEN cDNA 9430083G14 gene 1.22 5.87E-04 Mm.161014 Dad1 defender against cell death 1 0.70 5.87E-04 Mm.2547 Acas2 acetyl-Coenzyme A synthetase 2 (ADP forming) 1.28 5.88E-04 Mm.255026 Pafah2 platelet-activating factor acetylhydrolase 2 1.23 5.92E-04 Mm.22116 Luzp1 leucine zipper protein 1 0.79 5.93E-04 Mm.92659 Dhx40 DEAH (Asp-Glu-Ala-His) box polypeptide 40 0.75 5.93E-04 Mm.260627 5330417C22Rik RIKEN cDNA 5330417C22 gene 1.53 5.96E-04 Mm.259442 1200003O06Rik RIKEN cDNA 1200003O06 gene 0.78 5.98E-04 Mm.271975 Cul3 cullin 3 0.75 5.99E-04 Mm.12665 Ltbp4 latent transforming growth factor beta binding protein 4 1.68 6.00E-04 Mm.272251 Oplah 5-oxoprolinase (ATP-hydrolysing) 1.38 6.00E-04 Mm.301388 Ngp neutrophilic granule protein 2.28 6.02E-04 Mm.236225 1500001H12Rik RIKEN cDNA 1500001H12 gene 1.39 6.02E-04 Mm.87027 H2-Ea histocompatibility 2, class II antigen E alpha 1.37 6.02E-04 Mm.15680 Il4ra interleukin 4 receptor, alpha 0.69 6.02E-04 Mm.233802 Tnfrsf7 tumor necrosis factor receptor superfamily, member 7 1.24 6.05E-04 Mm.121 Ccr1 chemokine (C-C motif) receptor 1 0.57 6.07E-04 Mm.274927 Sfrs4 splicing factor, arginine/serine-rich 4 (SRp75) 1.23 6.09E-04 Mm.2478 2610030H06Rik RIKEN cDNA 2610030H06 gene 0.75 6.09E-04 Mm.41102 Slc35a1 solute carrier family 35 (CMP-sialic acid transporter), member 1 1.38 6.10E-04 Mm.281885 Picalm phosphatidylinositol binding clathrin assembly protein 0.75 6.10E-04 Mm.235175 1700088E04Rik RIKEN cDNA 1700088E04 gene 1.28 6.11E-04 Mm.288195 D16Ertd480e DNA segment, Chr 16, ERATO Doi 480, expressed 1.22 6.11E-04 Mm.24035 Clic4 chloride intracellular channel 4 (mitochondrial) 0.79 6.12E-04 Mm.257765 Sdc2 syndecan 2 0.78 6.14E-04 Mm.234266 Mapk6 mitogen-activated protein kinase 6 0.73 6.16E-04 Mm.18856 Psmd8 proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 0.74 6.22E-04 Mm.273152 Il21r interleukin 21 receptor 0.79 6.25E-04 Mm.155643 1300013G12Rik RIKEN cDNA 1300013G12 gene 0.76 6.25E-04 Mm.293321 5830446M03Rik RIKEN cDNA 5830446M03 gene 1.21 6.29E-04 Mm.28916 Slc12a6 solute carrier family 12, member 6 1.29 6.30E-04 Mm.261614 Tbx6 T-box 6 1.28 6.30E-04 Mm.727 Gdi3 guanosine diphosphate (GDP) dissociation inhibitor 3 0.78 6.30E-04 Mm.153226 Abcf1 ATP-binding cassette, sub-family F (GCN20), member 1 0.74 6.30E-04 Mm.268334 Gpc4 glypican 4 0.69 6.31E-04 Mm.1528 Nfil3 nuclear factor, interleukin 3, regulated 0.56 6.31E-04 Mm.136604 Amacr alpha-methylacyl-CoA racemase 1.30 6.33E-04 Mm.2787 Arf2 ADP-ribosylation factor 2 0.77 6.33E-04 Mm.5061 Inpp5e inositol polyphosphate-5-phosphatase E 1.26 6.35E-04 Mm.301290 Ppp1r1a protein phosphatase 1, regulatory (inhibitor) subunit 1A 1.23 6.36E-04 Mm.143788 Zfp238 zinc finger protein 238 0.76 6.37E-04 Mm.27962 Znrf2 zinc finger/RING finger 2 0.71 6.38E-04 Mm.286149 Sostdc1 sclerostin domain containing 1 1.28 6.41E-04 Mm.43375 Eif4g1 eukaryotic translation initiation factor 4, gamma 1 0.63 6.44E-04 Mm.260256 Stard13 serologically defined colon cancer antigen 13 1.33 6.46E-04 Mm.270916 Pacrg Park2 co-regulated 1.27 6.46E-04 Mm.18889 Ak1 adenylate kinase 1 0.74 6.46E-04 Mm.29189 C1qtnf1 C1q and tumor necrosis factor related protein 1 0.66 6.46E-04 Mm.23845 2700016D05Rik RIKEN cDNA 2700016D05 gene 1.21 6.47E-04 Mm.267810 Tpbpb trophoblast specific protein beta 1.37 6.48E-04 Mm.297920 Olfm1 olfactomedin 1 0.67 6.48E-04 Mm.43278 1110008K06Rik RIKEN cDNA 1110008K06 gene 0.73 6.49E-04 Mm.20488 Mte1 mitochondrial acyl-CoA thioesterase 1 1.64 6.53E-04 Mm.296235 Bbs2 Bardet-Biedl syndrome 2 homolog (human) 1.28 6.53E-04 Mm.292107 Gnaz guanine nucleotide binding protein, alpha z subunit 1.26 6.59E-04 Mm.32595 Hyal2 hyaluronidase 2 1.26 6.59E-04 Mm.4834 AL024210 expressed sequence AL024210 1.22 6.59E-04 Mm.247782 Psen2 presenilin 2 0.78 6.59E-04 Mm.288572 Cd79b CD79B antigen 1.78 6.61E-04 Mm.2987 Zic3 zinc finger protein of the cerebellum 3 1.24 6.62E-04 Mm.255890 Prg4 proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein) 0.59 6.68E-04 Mm.212696 Hpn hepsin 1.28 6.70E-04 Mm.19182 Hspa4 heat shock protein 4 0.73 6.70E-04 Mm.239865 BC026439 cDNA sequence BC026439 1.24 6.74E-04 Mm.26555 Ulk1 Unc-51 like kinase 1 (C. elegans) 1.25 6.75E-04 Mm.271898 Hist1h4i histone 1, H4i 1.43 6.77E-04 Mm.14775 1700009P13Rik RIKEN cDNA 1700009P13 gene 1.29 6.77E-04 Mm.296565

197 A930040G15Rik RIKEN cDNA A930040G15 gene 1.21 6.77E-04 Mm.107646 Crtl1 cartilage link protein 1 1.19 6.77E-04 Mm.266790 Cmah cytidine monophospho-N-acetylneuraminic acid hydroxylase 0.62 6.77E-04 Mm.8396 2310030G06Rik RIKEN cDNA 2310030G06 gene 1.28 6.78E-04 Mm.273375 5730593F17Rik RIKEN cDNA 5730593F17 gene 1.29 6.79E-04 Mm.262113 Pfn2 profilin 2 0.68 6.79E-04 Mm.271744 Erbb3 v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) 1.31 6.80E-04 Mm.29023 Bckdha branched chain ketoacid dehydrogenase E1, alpha polypeptide 1.30 6.81E-04 Mm.25848 Morf4l2 mortality factor 4 like 2 0.72 6.81E-04 Mm.27218 Pdcd6ip programmed cell death 6 interacting protein 0.82 6.82E-04 Mm.29816 D12Wsu95e DNA segment, Chr 12, Wayne State University 95, expressed 0.63 6.85E-04 Mm.23808 2410003L07Rik RIKEN cDNA 2410003L07 gene 1.33 6.88E-04 Mm.159024 1110018M03Rik RIKEN cDNA 1110018M03 gene 1.44 6.92E-04 Mm.291809 2810011M08Rik RIKEN cDNA 2810011M08 gene 1.25 6.96E-04 Mm.239675 Lrp1 low density lipoprotein receptor-related protein 1 0.76 6.97E-04 Mm.271854 Cdc42ep3 CDC42 effector protein (Rho GTPase binding) 3 1.34 6.99E-04 Mm.275926 Foxa2 forkhead box A2 1.23 6.99E-04 Mm.938 E4f1 E4F transcription factor 1 1.22 7.00E-04 Mm.163132 Sgk serum/glucocorticoid regulated kinase 0.74 7.01E-04 Mm.28405 Dcn decorin 0.58 7.01E-04 Mm.56769 2900037I21Rik RIKEN cDNA 2900037I21 gene 0.68 7.02E-04 Mm.282751 Tgm1 transglutaminase 1, K polypeptide 0.74 7.03E-04 Mm.41964 Rac3 RAS-related C3 botulinum substrate 3 1.42 7.04E-04 Mm.27318 Tex11 testis expressed gene 11 1.35 7.05E-04 Mm.134024 Rps6ka2 ribosomal protein S6 kinase, polypeptide 2 1.24 7.05E-04 Mm.268383 Zfp101 zinc finger protein 101 1.31 7.07E-04 Mm.4417 Npdc1 neural proliferation, differentiation and control gene 1 0.79 7.07E-04 Mm.1131 Cd24a CD24a antigen 0.61 7.08E-04 Mm.6417 Pard6g par-6 partitioning defective 6 homolog gamma (C. elegans) 1.22 7.09E-04 Mm.24678 Etohi6 ethanol induced 6 0.72 7.14E-04 Mm.30133 4933425C05Rik RIKEN cDNA 4933425C05 gene 1.30 7.15E-04 Mm.87449 4930511A21Rik RIKEN cDNA 4930511A21 gene 0.81 7.15E-04 Mm.12848 Dcamkl1 double cortin and calcium/calmodulin-dependent protein kinase-like 1 0.79 7.15E-04 Mm.258673 Pgam2 phosphoglycerate mutase 2 1.32 7.18E-04 Mm.219627 Hoxa7 homeo box A7 1.26 7.18E-04 Mm.294826 Abtb1 ankyrin repeat and BTB (POZ) domain containing 1 1.23 7.18E-04 Mm.166858 Cxcl10 chemokine (C-X-C motif) ligand 10 0.43 7.18E-04 Mm.877 3110009E18Rik RIKEN cDNA 3110009E18 gene 1.23 7.19E-04 Mm.271602 Pcdhb17 protocadherin beta 17 0.81 7.19E-04 Mm.87553 Pla2g7 phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma) 0.64 7.21E-04 Mm.9277 Rasgrp2 RAS, guanyl releasing protein 2 1.28 7.24E-04 Mm.77017 Ppm1b protein phosphatase 1B, magnesium dependent, beta isoform 1.27 7.25E-04 Mm.249695 Gabbr1 gamma-aminobutyric acid (GABA-B) receptor, 1 1.27 7.27E-04 Mm.245164 2010317E03Rik RIKEN cDNA 2010317E03 gene 0.64 7.27E-04 Mm.250567 Arpc4 actin related protein 2/3 complex, subunit 4 0.76 7.28E-04 Mm.289306 Eif4g3 eukaryotic translation initiation factor 4 gamma, 3 0.81 7.29E-04 Mm.268903 Slc6a2 solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 0.71 7.30E-04 Mm.57040 Eltd1 EGF, latrophilin seven transmembrane domain containing 1 0.80 7.33E-04 Mm.27242 AI464239 expressed sequence AI464239 1.39 7.35E-04 Mm.258105 9130221H12Rik RIKEN cDNA 9130221H12 gene 1.23 7.39E-04 Mm.294664 Ccl2 chemokine (C-C motif) ligand 2 0.49 7.40E-04 Mm.290320 Atox1 ATX1 (antioxidant protein 1) homolog 1 (yeast) 0.76 7.48E-04 Mm.217759 asparagine-linked glycosylation 12 homolog (yeast, alpha-1,6- Alg12 mannosyltransferase) 1.24 7.50E-04 Mm.41512 Ces1 carboxylesterase 1 1.68 7.51E-04 Mm.22720 Ncr1 natural cytotoxicity triggering receptor 1 1.25 7.52E-04 Mm.41980 Eno1 enolase 1, alpha non-neuron 0.73 7.52E-04 Mm.70666 Gpc3 glypican 3 0.60 7.52E-04 Mm.22515 Ifi203 interferon activated gene 203 0.62 7.54E-04 Mm.277332 1810045K06Rik RIKEN cDNA 1810045K06 gene 1.25 7.57E-04 Mm.22306 Kpna3 karyopherin (importin) alpha 3 0.73 7.61E-04 Mm.25548 Map3k11 mitogen activated protein kinase kinase kinase 11 1.30 7.63E-04 Mm.185026 Kctd2 potassium channel tetramerisation domain containing 2 1.34 7.68E-04 Mm.276299 Nxf1 nuclear RNA export factor 1 homolog (S. cerevisiae) 1.34 7.70E-04 Mm.7271 Itgb6 integrin beta 6 0.46 7.71E-04 Mm.98193 Zfp62 KRAB-zinc finger protein 62 1.25 7.74E-04 Mm.295906 Rgs4 regulator of G-protein signaling 4 0.77 7.75E-04 Mm.54164 1110032E23Rik RIKEN cDNA 1110032E23 gene 0.72 7.77E-04 Mm.273274 Igk-V8 immunoglobulin kappa chain variable 8 (V8) 1.34 7.79E-04 Mm.244362 9030624L02Rik RIKEN cDNA 9030624L02 gene 1.24 7.79E-04 Mm.218630 sema domain, immunoglobulin domain (Ig), short basic domain, secreted, Sema3b (semaphorin) 3B 1.22 7.79E-04 Mm.4083 Swi/SNF related matrix associated, actin dependent regulator of chromatin, Smarcal1 subfamily a-like 1 1.31 7.82E-04 Mm.274232 Unc5c unc-5 homolog C (C. elegans) 1.25 7.82E-04 Mm.190874

198 Ube2l3 ubiquitin-conjugating enzyme E2L 3 0.77 7.83E-04 Mm.299954 2310006I24Rik RIKEN cDNA 2310006I24 gene 1.30 7.87E-04 Mm.29200 Rbp4 retinol binding protein 4, plasma 1.66 7.89E-04 Mm.2605 D8Ertd354e DNA segment, Chr 8, ERATO Doi 354, expressed 0.73 7.90E-04 Mm.28326 Myct1 myc target 1 1.25 7.91E-04 Mm.33762 Gne glucosamine 1.21 7.91E-04 Mm.256718 1110001I14Rik RIKEN cDNA 1110001I14 gene 1.21 7.91E-04 Mm.24126 Oxr1 oxidation resistance 1 0.76 7.91E-04 Mm.254267 Mt1 metallothionein 1 0.36 7.91E-04 Mm.192991 Net1 neuroepithelial cell transforming gene 1 1.50 7.92E-04 Mm.22261 Pigm phosphatidylinositol glycan, class M 0.82 8.01E-04 Mm.26612 Ly108 lymphocyte antigen 108 1.34 8.05E-04 Mm.245727 Gata2 GATA binding protein 2 1.31 8.10E-04 Mm.272747 Icsbp1 interferon consensus sequence binding protein 1 0.67 8.15E-04 Mm.249937 Klra3 killer cell lectin-like receptor, subfamily A, member 3 1.42 8.17E-04 Mm.298156 Ddx21 DEAD (Asp-Glu-Ala-Asp) box polypeptide 21 0.75 8.24E-04 Mm.25264 Arrb2 arrestin, beta 2 0.73 8.24E-04 Mm.203747 9430077D24Rik RIKEN cDNA 9430077D24 gene 0.74 8.25E-04 Mm.265125 Nakap95 neighbor of A-kinase anchoring protein 95 1.25 8.28E-04 Mm.9590 Atp7a ATPase, Cu++ transporting, alpha polypeptide 0.67 8.28E-04 Mm.254297 Hmgn3 high mobility group nucleosomal binding domain 3 0.75 8.29E-04 Mm.33848 Phf1 PHD finger protein 1 1.34 8.32E-04 Mm.18643 BC002236 cDNA sequence BC002236 0.81 8.32E-04 Mm.259200 0610011I04Rik RIKEN cDNA 0610011I04 gene 0.77 8.32E-04 Mm.27061 4921528G01Rik RIKEN cDNA 4921528G01 gene 1.22 8.36E-04 Mm.28376 Scarb2 scavenger receptor class B, member 2 0.77 8.36E-04 Mm.259568 D16Ertd472e DNA segment, Chr 16, ERATO Doi 472, expressed 0.81 8.37E-04 Mm.37332 Cd68 CD68 antigen 0.71 8.37E-04 Mm.15819 Tce4 T-complex expressed gene 4 1.22 8.40E-04 Mm.277304 Snx16 sorting nexin 16 0.82 8.40E-04 Mm.288429 Ms4a6c membrane-spanning 4-domains, subfamily A, member 6C 0.77 8.42E-04 Mm.87745 Cyp2s1 cytochrome P450, family 2, subfamily s, polypeptide 1 1.40 8.43E-04 Mm.275188 Sln sarcolipin 1.71 8.45E-04 Mm.29132 Man2c1 mannosidase, alpha, class 2C, member 1 1.22 8.45E-04 Mm.30110 proteosome (prosome, macropain) subunit, beta type 9 (large multifunctional Psmb9 protease 2) 1.67 8.50E-04 Mm.16251 Ppp1r2 protein phosphatase 1, regulatory (inhibitor) subunit 2 0.82 8.50E-04 Mm.291593 Xdh xanthine dehydrogenase 0.58 8.51E-04 Mm.11223 Vegfc vascular endothelial growth factor C 0.72 8.52E-04 Mm.1402 Fzd4 frizzled homolog 4 (Drosophila) 0.69 8.55E-04 Mm.86755 Mmp9 matrix metalloproteinase 9 1.51 8.60E-04 Mm.4406 3110031O14Rik RIKEN cDNA 3110031O14 gene 1.39 8.61E-04 Mm.301321 Cdx1 caudal type homeo box 1 1.31 8.62E-04 Mm.144448 Rad23b RAD23b homolog (S. cerevisiae) 0.64 8.63E-04 Mm.196846 E430023H19Rik RIKEN cDNA E430023H19 gene 0.67 8.64E-04 Mm.38229 Tmod3 tropomodulin 3 0.65 8.65E-04 Mm.157642 2610510B01Rik RIKEN cDNA 2610510B01 gene 1.45 8.67E-04 Mm.23230 Ppap2b phosphatidic acid phosphatase type 2B 1.28 8.67E-04 Mm.27363 Efnb1 ephrin B1 1.28 8.67E-04 Mm.3374 2310010I22Rik RIKEN cDNA 2310010I22 gene 0.83 8.67E-04 Mm.294478 Trim10 tripartite motif protein 10 1.48 8.71E-04 Mm.20159 E130307H12Rik RIKEN cDNA E130307H12 gene 1.30 8.71E-04 Mm.28604 B230113M03Rik RIKEN cDNA B230113M03 gene 1.29 8.71E-04 Mm.243950 1200015A22Rik RIKEN cDNA 1200015A22 gene 0.81 8.71E-04 Mm.38801 Ltbp1 latent transforming growth factor beta binding protein 1 0.60 8.71E-04 Mm.269747 Usmg4 upregulated during skeletal muscle growth 4 1.28 8.73E-04 Mm.27881 solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), Slc25a4 member 4 0.68 8.73E-04 Mm.16228 Timp3 tissue inhibitor of metalloproteinase 3 1.39 8.75E-04 Mm.132958 Fyco1 FYVE and coiled-coil domain containing 1 1.36 8.75E-04 Mm.252941 Pias3 protein inhibitor of activated STAT 3 1.28 8.75E-04 Mm.246731 Col5a3 procollagen, type V, alpha 3 0.73 8.75E-04 Mm.30477 Trf transferrin 0.73 8.75E-04 Mm.37214 Sardh sarcosine dehydrogenase 0.82 8.77E-04 Mm.278467 Prg proteoglycan, secretory granule 0.78 8.80E-04 Mm.22194 Lrba LPS-responsive beige-like anchor 1.24 8.82E-04 Mm.239927 Tpt1h tRNA splicing 2' phosphotransferase 1 homolog (S. cerevisiae) 0.66 8.82E-04 Mm.246408 Maged1 melanoma antigen, family D, 1 0.72 8.84E-04 Mm.27578 2410081M15Rik RIKEN cDNA 2410081M15 gene 1.31 8.92E-04 Mm.32997 Rab6ip1 Rab6 interacting protein 1 1.30 8.92E-04 Mm.290754 sema domain, immunoglobulin domain (Ig), TM domain, and short cytoplasmic Sema4f domain 1.30 8.94E-04 Mm.270543 Tcf3 transcription factor 3 0.76 8.94E-04 Mm.286449 Fabp3 fatty acid binding protein 3, muscle and heart 1.51 8.96E-04 Mm.22220 Tmem7 transmembrane protein 7 1.35 8.96E-04 Mm.215259

199 Gstm3 glutathione S-transferase, mu 3 1.25 9.02E-04 Mm.37199 Ucp1 uncoupling protein 1, mitochondrial 1.54 9.03E-04 Mm.4177 Sh3bp2 SH3-domain binding protein 2 0.77 9.03E-04 Mm.5012 Nup50 nucleoporin 50 0.74 9.03E-04 Mm.28379 Bach2 BTB and CNC homology 2 0.60 9.03E-04 Mm.252215 Upk3b uroplakin 3B 1.47 9.12E-04 Mm.3089 Rhag Rhesus blood group-associated A glycoprotein 1.26 9.12E-04 Mm.12961 C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily Clecsf5 member 5 0.70 9.13E-04 Mm.103765 4930550L21Rik RIKEN cDNA 4930550L21 gene 1.31 9.15E-04 Mm.78738 Cd19 CD19 antigen 1.30 9.15E-04 Mm.4360 AI551766 expressed sequence AI551766 1.18 9.16E-04 Mm.202715 Il6 interleukin 6 0.60 9.16E-04 Mm.1019 Cx3cl1 chemokine (C-X3-C motif) ligand 1 1.25 9.18E-04 Mm.292711 4432417N03Rik RIKEN cDNA 4432417N03 gene 1.23 9.18E-04 Mm.4206 BC023126 cDNA sequence BC023126 1.25 9.19E-04 Mm.38019 Ian1 immune associated nucleotide 1 1.71 9.21E-04 Mm.262146 Ggps1 geranylgeranyl diphosphate synthase 1 0.75 9.25E-04 Mm.148039 9030408N13Rik RIKEN cDNA 9030408N13 gene 0.75 9.27E-04 Mm.31056 Wig1 wild-type p53-induced gene 1 0.74 9.29E-04 Mm.35705 Ilk integrin linked kinase 1.29 9.35E-04 Mm.274846 6330407G11Rik RIKEN cDNA 6330407G11 gene 0.78 9.35E-04 Mm.27903 BC022145 cDNA sequence BC022145 0.78 9.36E-04 Mm.280559 Galc galactosylceramidase 0.77 9.41E-04 Mm.5120 D5Ertd33e DNA segment, Chr 5, ERATO Doi 33, expressed 1.32 9.43E-04 Mm.290142 Gcat glycine C-acetyltransferase (2-amino-3-ketobutyrate-coenzyme A ligase) 1.30 9.43E-04 Mm.237085 Cebpd CCAAT/enhancer binding protein (C/EBP), delta 0.67 9.45E-04 Mm.272602 Gpc1 glypican 1 0.70 9.47E-04 Mm.24193 Stmn2 stathmin-like 2 1.53 9.52E-04 Mm.29580 Ephx1 epoxide hydrolase 1, microsomal 1.48 9.52E-04 Mm.9075 Ptpns1 protein tyrosine phosphatase, non-receptor type substrate 1 0.77 9.53E-04 Mm.1682 Prps1 phosphoribosyl pyrophosphate synthetase 1 1.23 9.54E-04 Mm.287178 Itpka inositol 1,4,5-trisphosphate 3-kinase A 1.23 9.60E-04 Mm.65337 1110007L15Rik RIKEN cDNA 1110007L15 gene 1.23 9.63E-04 Mm.270137 Ms4a11 membrane-spanning 4-domains, subfamily A, member 11 0.54 9.63E-04 Mm.271843 AV249152 expressed sequence AV249152 1.21 9.64E-04 Mm.138090 A830073O21Rik RIKEN cDNA A830073O21 gene 1.38 9.72E-04 Mm.222728 D0H4S114 DNA segment, human D4S114 0.61 9.72E-04 Mm.128733 2310046K01Rik RIKEN cDNA 2310046K01 gene 1.26 9.74E-04 Mm.258262 Tcf2 transcription factor 2 1.23 9.74E-04 Mm.7226 C-type (calcium dependent, carbohydrate recognition domain) lectin, superfamily Clecsf10 member 10 0.52 9.74E-04 Mm.271782 4832415H08Rik RIKEN cDNA 4832415H08 gene 0.80 9.76E-04 Mm.287131 Ces2 carboxylesterase 2 1.19 9.83E-04 Mm.28191 2010300G19Rik RIKEN cDNA 2010300G19 gene 0.74 9.83E-04 Mm.24229 2410008M22Rik RIKEN cDNA 2410008M22 gene 1.33 9.84E-04 Mm.41449 Skp1a S-phase kinase-associated protein 1A 0.61 9.90E-04 Mm.42944 Snx9 sorting nexin 9 0.74 9.97E-04 Mm.89515 Gpm6a glycoprotein m6a 1.50 0.001 Mm.241700 Clstn1 calsyntenin 1 1.33 0.001 Mm.38993 Card10 caspase recruitment domain family, member 10 1.30 0.001 Mm.17629 Crk v-crk sarcoma virus CT10 oncogene homolog (avian) 1.19 0.001 Mm.280125 Ssr2 signal sequence receptor, beta 0.74 0.001 Mm.7091 Pkm2 pyruvate kinase, muscle 0.73 0.001 Mm.151203 Cks1 CDC28 protein kinase 1 0.60 0.001 Mm.3049 2810485I05Rik RIKEN cDNA 2810485I05 gene 1.19 0.001 Mm.246174 3110038L01Rik RIKEN cDNA 3110038L01 gene 1.51 0.001 Mm.29429 Rgl2 ral guanine nucleotide dissociation stimulator,-like 2 1.30 0.001 Mm.43777 Shkbp1 Sh3kbp1 binding protein 1 0.82 0.001 Mm.21297 Klf4 Kruppel-like factor 4 (gut) 0.71 0.001 Mm.4325 Ddx32 DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32 0.80 0.001 Mm.199223 Lamc2 laminin, gamma 2 0.80 0.001 Mm.4717 Cldn5 claudin 5 1.44 0.001 Mm.22768 Pscdbp pleckstrin homology, Sec7 and coiled-coil domains, binding protein 1.42 0.001 Mm.273905 Elavl2 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1.24 0.001 Mm.3823 Furin furin (paired basic amino acid cleaving enzyme) 0.80 0.001 Mm.243921 Loxl3 lysyl oxidase-like 3 0.80 0.001 Mm.296090 Sh3d1B SH3 domain protein 1B 1.31 0.001 Mm.139128 Gjb1 gap junction membrane channel protein beta 1 1.24 0.001 Mm.21198 Sap18 Sin3-associated polypeptide 18 1.23 0.001 Mm.290178 Purb purine rich element binding protein B 0.82 0.001 Mm.296150 9830126M18 hypothetical protein 9830126M18 0.77 0.001 Mm.266485 Arl6ip5 ADP-ribosylation factor-like 6 interacting protein 5 0.74 0.001 Mm.291014 Tnfrsf12a tumor necrosis factor receptor superfamily, member 12a 0.63 0.001 Mm.28518

200 Mapt microtubule-associated protein tau 1.70 0.001 Mm.1287 Tgif TG interacting factor 0.83 0.001 Mm.101034 Cct2 chaperonin subunit 2 (beta) 0.75 0.001 Mm.247788 Kitl kit ligand 1.38 0.001 Mm.45124 Sdf4 stromal cell derived factor 4 1.33 0.001 Mm.293517 1110003B01Rik RIKEN cDNA 1110003B01 gene 0.61 0.001 Mm.275648 2310014B11Rik RIKEN cDNA 2310014B11 gene 1.32 0.001 Mm.275266 Vamp4 vesicle-associated membrane protein 4 1.30 0.001 Mm.10699 1300004C11Rik RIKEN cDNA 1300004C11 gene 1.25 0.001 Mm.271923 Spry4 sprouty homolog 4 (Drosophila) 0.75 0.001 Mm.42038 Cct3 chaperonin subunit 3 (gamma) 0.74 0.001 Mm.256034 Rbpms RNA binding protein gene with multiple splicing 1.31 0.001 Mm.12436 C030022K24Rik RIKEN cDNA C030022K24 gene 1.26 0.001 Mm.159924 Ctsd cathepsin D 0.79 0.001 Mm.231395 Ifit2 interferon-induced protein with tetratricopeptide repeats 2 0.62 0.001 Mm.2036 Itgam integrin alpha M 0.59 0.001 Mm.262106 LOC214424 hypothetical protein LOC214424 1.23 0.001 Mm.31129 Ulk2 Unc-51 like kinase 2 (C. elegans) 1.22 0.001 Mm.162025 Rps6ka3 ribosomal protein S6 kinase polypeptide 3 0.76 0.001 Mm.24436 Myc myelocytomatosis oncogene 0.64 0.001 Mm.2444 Irf4 interferon regulatory factor 4 1.32 0.001 Mm.4677 2510049I19Rik RIKEN cDNA 2510049I19 gene 1.32 0.001 Mm.28327 Chrnb1 cholinergic receptor, nicotinic, beta polypeptide 1 (muscle) 1.23 0.001 Mm.86425 Prnp prion protein 0.80 0.001 Mm.648 D1Bwg1363e DNA segment, Chr 1, Brigham & Women's Genetics 1363 expressed 0.79 0.001 Mm.260577 Mtf2 metal response element binding transcription factor 2 0.79 0.001 Mm.10563 Waspip Wiskott-Aldrich syndrome protein interacting protein 0.78 0.001 Mm.223504 Rrbp1 ribosome binding protein 1 0.76 0.001 Mm.13705 MGC68300 Unknown (protein for MGC:68300) 1.23 0.001 Mm.299760 A030007L17Rik RIKEN cDNA A030007L17 gene 0.78 0.001 Mm.294708 Plek pleckstrin 0.72 0.001 Mm.98232 Fgl2 fibrinogen-like protein 2 0.67 0.001 Mm.292100 Slc1a7 solute carrier family 1, member 7 1.25 0.001 Mm.1056 1700021P10Rik RIKEN cDNA 1700021P10 gene 1.20 0.001 Mm.1116 Cyp2j9 cytochrome P450, family 2, subfamily j, polypeptide 9 1.20 0.001 Mm.87271 C630028C02Rik RIKEN cDNA C630028C02 gene 1.19 0.001 Mm.200200 Ppp2r5c protein phosphatase 2, regulatory subunit B (B56), gamma isoform 0.79 0.001 Mm.240396 Zfp106 zinc finger protein 106 0.77 0.001 Mm.27653 D11Ertd530e DNA segment, Chr 11, ERATO Doi 530, expressed 0.74 0.001 Mm.21964 Hbp1 high mobility group box transcription factor 1 1.23 0.001 Mm.87639 Nek7 NIMA (never in mitosis gene a)-related expressed kinase 7 0.76 0.001 Mm.283734 Glrx1 glutaredoxin 1 (thioltransferase) 0.68 0.001 Mm.25844 H2-Bf histocompatibility 2, complement component factor B 0.64 0.001 Mm.653 Psat1 phosphoserine aminotransferase 1 0.59 0.001 Mm.289936 Igk-V1 immunoglobulin kappa chain variable 1 (V1) 2.46 0.001 Mm.246499 Dscr6 Down syndrome critical region homolog 6 (human) 1.41 0.001 Mm.42604 Slc1a4 solute carrier family 1 (glutamate/neutral amino acid transporter), member 4 1.35 0.001 Mm.6379 Serpina1a serine (or cysteine) proteinase inhibitor, clade A, member 1a 1.31 0.001 Mm.259233 Tmlhe trimethyllysine hydroxylase, epsilon 1.29 0.001 Mm.311888 2310007F21Rik RIKEN cDNA 2310007F21 gene 1.20 0.001 Mm.34338 Actg actin, gamma, cytoplasmic 0.80 0.001 Mm.196173 Col7a1 procollagen, type VII, alpha 1 0.79 0.001 Mm.6200 Lgals9 lectin, galactose binding, soluble 9 0.71 0.001 Mm.18087 Bpgm 2,3-bisphosphoglycerate mutase 1.56 0.001 Mm.282863 sema domain, transmembrane domain (TM), and cytoplasmic domain, Sema6a (semaphorin) 6A 1.35 0.001 Mm.40909 Tada3l transcriptional adaptor 3 (NGG1 homolog, yeast)-like 1.25 0.001 Mm.286609 Crtap cartilage associated protein 0.76 0.001 Mm.20904 Gna13 guanine nucleotide binding protein, alpha 13 0.67 0.001 Mm.193925 Laptm5 lysosomal-associated protein transmembrane 5 0.60 0.001 Mm.271868 Cln3 ceroid lipofuscinosis, neuronal 3, juvenile (Batten, Spielmeyer-Vogt disease) 1.22 0.001 Mm.268930 a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 Adamts8 motif, 8 1.21 0.001 Mm.100582 BC018371 cDNA sequence BC018371 1.28 0.001 Mm.295854 2200002N01Rik RIKEN cDNA 2200002N01 gene 1.27 0.001 Mm.97 BC014685 cDNA sequence BC014685 1.20 0.001 Mm.170023 Igf2r insulin-like growth factor 2 receptor 0.72 0.001 Mm.213226 Ereg epiregulin 0.38 0.001 Mm.4791 Pa2g4 proliferation-associated 2G4 0.77 0.001 Mm.4742 AI597013 expressed sequence AI597013 1.26 0.001 Mm.258930 Tfb1m transcription factor B1, mitochondrial 1.22 0.001 Mm.226554 Gnao guanine nucleotide binding protein, alpha o 1.20 0.001 Mm.251445 Ehhadh enoyl-Coenzyme A, hydratase/3-hydroxyacyl Coenzyme A dehydrogenase 1.19 0.001 Mm.28100 9130022A11Rik RIKEN cDNA 9130022A11 gene 0.71 0.001 Mm.23834

201 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, Ywhae epsilon polypeptide 0.68 0.001 Mm.234700 Atbf1 AT motif binding factor 1 1.31 0.001 Mm.196564 Spna2 spectrin alpha 2 1.28 0.001 Mm.295950 4733401H18Rik RIKEN cDNA 4733401H18 gene 1.24 0.001 Mm.29471 LOC268670 hypothetical protein LOC268670 1.23 0.001 Mm.56274 Ap3s1 adaptor-related protein complex 3, sigma 1 subunit 0.80 0.001 Mm.27171 Yy1 YY1 transcription factor 0.73 0.001 Mm.3868 Kctd12 potassium channel tetramerisation domain containing 12 0.66 0.001 Mm.246466 Git2 G protein-coupled receptor kinase-interactor 2 1.22 0.001 Mm.195632 0610025L06Rik RIKEN cDNA 0610025L06 gene 1.21 0.001 Mm.21687 E030025C11Rik RIKEN cDNA E030025C11 gene 0.77 0.001 Mm.44142 Sh3glb1 SH3-domain GRB2-like B1 (endophilin) 0.80 0.001 Mm.182692 Inpp5d inositol polyphosphate-5-phosphatase D 0.78 0.001 Mm.15105 Mlp MARCKS-like protein 0.72 0.001 Mm.2769 Gp49b glycoprotein 49 B 0.69 0.001 Mm.34408 0610013D04Rik RIKEN cDNA 0610013D04 gene 1.37 0.001 Mm.196330 4933439F18Rik RIKEN cDNA 4933439F18 gene 1.31 0.001 Mm.287548 Rbm6 RNA binding motif protein 6 1.24 0.001 Mm.139926 Bicc1 bicaudal C homolog 1 (Drosophila) 0.72 0.001 Mm.286834 Madh5 MAD homolog 5 (Drosophila) 0.68 0.001 Mm.272920 Dmtf1 cyclin D binding myb-like transcription factor 1 1.38 0.001 Mm.235906 Sdcbp syndecan binding protein 0.78 0.001 Mm.247473 Whsc2 Wolf-Hirschhorn syndrome candidate 2 (human) 0.76 0.001 Mm.71361 Evi2a ecotropic viral integration site 2a 0.67 0.001 Mm.164948 Chk choline kinase 1.34 0.001 Mm.225505 Alg1 asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) 1.24 0.001 Mm.34581 6330406I15Rik RIKEN cDNA 6330406I15 gene 0.48 0.001 Mm.63262 Cebpa CCAAT/enhancer binding protein (C/EBP), alpha 1.27 0.001 Mm.34537 Bpnt1 bisphosphate 3'-nucleotidase 1 0.78 0.001 Mm.227549 Rpl39 ribosomal protein L39 0.79 0.001 Mm.30478 Leftb left-right determination, factor B 0.78 0.001 Mm.1120 5830416A07Rik RIKEN cDNA 5830416A07 gene 0.76 0.001 Mm.241489 Unc93b unc-93 homolog B (C. elegans) 0.72 0.001 Mm.262094 8430423A01Rik RIKEN cDNA 8430423A01 gene 0.70 0.001 Mm.246869 Slc15a3 solute carrier family 15, member 3 0.69 0.001 Mm.218870 Imap38 immunity-associated protein 1.37 0.001 Mm.197478 A030009H04Rik RIKEN cDNA A030009H04 gene 1.21 0.001 Mm.5324 1500032M01Rik RIKEN cDNA 1500032M01 gene 1.18 0.001 Mm.29628 5730453H04Rik RIKEN cDNA 5730453H04 gene 0.73 0.001 Mm.203911 Ch25h cholesterol 25-hydroxylase 0.51 0.001 Mm.30824 Pdlim3 PDZ and LIM domain 3 1.24 0.001 Mm.282900 C630032K07Rik RIKEN cDNA C630032K07 gene 1.23 0.001 Mm.140060 Trim26 tripartite motif protein 26 1.21 0.001 Mm.291343 2310003F16Rik RIKEN cDNA 2310003F16 gene 1.18 0.001 Mm.24220 Idb4 inhibitor of DNA binding 4 1.53 0.001 Mm.283273 Guca2 guanylate cyclase activator 2 (guanylin 2, intestinal, heatstable) 1.34 0.001 Mm.2614 Kif1b kinesin family member 1B 1.23 0.001 Mm.83684 C730036D15Rik RIKEN cDNA C730036D15 gene 1.22 0.001 Mm.35071 Tcf7l2 transcription factor 7-like 2, T-cell specific, HMG-box 0.75 0.001 Mm.139815 Pcolce2 procollagen C-endopeptidase enhancer 2 2.03 0.001 Mm.46016 Cyp2d22 cytochrome P450, family 2, subfamily d, polypeptide 22 1.46 0.001 Mm.157435 Steap six transmembrane epithelial antigen of the prostate 0.83 0.001 Mm.85429 Eif3s10 eukaryotic translation initiation factor 3, subunit 10 (theta) 0.74 0.001 Mm.259617 Pim1 proviral integration site 1 0.66 0.001 Mm.269678 Fin15 fibroblast growth factor inducible 15 0.64 0.001 Mm.3421 Mmp15 matrix metalloproteinase 15 1.70 0.001 Mm.217116 3110006P09Rik RIKEN cDNA 3110006P09 gene 1.34 0.001 Mm.138332 Lpin2 lipin 2 1.26 0.001 Mm.227924 Cav caveolin, caveolae protein 1.25 0.001 Mm.28278 Epor erythropoietin receptor 1.21 0.001 Mm.2653 Nans N-acetylneuraminic acid synthase (sialic acid synthase) 0.82 0.001 Mm.249349 Hk1 hexokinase 1 0.81 0.001 Mm.196605 Axot axotrophin 0.67 0.001 Mm.260635 Psap prosaposin 0.63 0.001 Mm.277498 Oas1g 2'-5' oligoadenylate synthetase 1G 0.60 0.001 Mm.260702 Map3k6 mitogen-activated protein kinase kinase kinase 6 0.59 0.001 Mm.36640 Hip1r huntingtin interacting protein 1 related 1.19 0.001 Mm.149954 Guk1 guanylate kinase 1 1.37 0.001 Mm.3624 2610102M01Rik RIKEN cDNA 2610102M01 gene 1.34 0.001 Mm.21485 Arvcf armadillo repeat gene deleted in velo-cardio-facial syndrome 1.26 0.001 Mm.293599 Tuba8 tubulin, alpha 8 1.26 0.001 Mm.32884 BC021614 cDNA sequence BC021614 1.24 0.001 Mm.26996 AF119384 cDNA sequence AF119384 1.23 0.001 Mm.289274

202 9130022B02Rik RIKEN cDNA 9130022B02 gene 1.18 0.001 Mm.29856 A130022J15Rik RIKEN cDNA A130022J15 gene 0.82 0.001 Mm.251789 3110043O21Rik RIKEN cDNA 3110043O21 gene 0.79 0.001 Mm.491 DXImx38e DNA segment, Chr X, Immunex 38, expressed 1.35 0.001 Mm.28850 8030499H02Rik RIKEN cDNA 8030499H02 gene 0.80 0.001 Mm.202966 Anxa5 annexin A5 0.79 0.001 Mm.1620 Maff v-maf musculoaponeurotic fibrosarcoma oncogene family, protein F (avian) 0.67 0.001 Mm.86646 1110036E10Rik RIKEN cDNA 1110036E10 gene 0.58 0.001 Mm.287982 Slc4a4 solute carrier family 4 (anion exchanger), member 4 1.24 0.001 Mm.41044 1810045K07Rik RIKEN cDNA 1810045K07 gene 0.81 0.001 Mm.290353 Cdc25a cell division cycle 25 homolog A (S. cerevisiae) 0.80 0.001 Mm.279371 Leprotl1 leptin receptor overlapping transcript-like 1 0.78 0.001 Mm.34212 2610319K07Rik RIKEN cDNA 2610319K07 gene 0.77 0.001 Mm.279158 A730011F23Rik RIKEN cDNA A730011F23 gene 0.84 0.001 Mm.213243 AI428795 expressed sequence AI428795 0.78 0.001 Mm.200557 Pirb paired-Ig-like receptor B 0.72 0.001 Mm.3189 Pcnp PEST-containing nuclear protein 0.79 0.001 Mm.254130 Cd53 CD53 antigen 0.74 0.001 Mm.2692 Nr1d1 nuclear receptor subfamily 1, group D, member 1 1.88 0.001 Mm.193097 Fibp fibroblast growth factor (acidic) intracellular binding protein 1.24 0.001 Mm.272425 Rdgb2 retinal degeneration B2 homolog (Drosophila) 1.23 0.001 Mm.239214 Agtrap angiotensin II, type I receptor-associated protein 0.82 0.001 Mm.262174 Ube2d3 ubiquitin-conjugating enzyme E2D 3 (UBC4/5 homolog, yeast) 0.80 0.001 Mm.240184 Cdv3 carnitine deficiency-associated gene expressed in ventricle 3 0.73 0.001 Mm.167827 Plvap plasmalemma vesicle associated protein 1.52 0.001 Mm.34112 Slc30a2 solute carrier family 30 (zinc transporter), member 2 1.29 0.001 Mm.17586 Pcdh15 protocadherin 15 1.27 0.001 Mm.157917 1700019N19Rik RIKEN cDNA 1700019N19 gene 1.25 0.001 Mm.27027 Il1r1 interleukin 1 receptor, type I 0.79 0.001 Mm.896 Rab14 RAB14, member RAS oncogene family 0.62 0.001 Mm.29302 A330075D07 hypothetical protein A330075D07 1.90 0.001 Mm.276440 Hdgf hepatoma-derived growth factor 0.82 0.001 Mm.292208 F3 coagulation factor III 0.56 0.001 Mm.273188 Cxcl13 chemokine (C-X-C motif) ligand 13 0.34 0.001 Mm.10116 3110049J23Rik RIKEN cDNA 3110049J23 gene 1.21 0.001 Mm.24795 Apex1 apurinic/apyrimidinic endonuclease 1 0.82 0.001 Mm.203 Bspry B-box and SPRY domain containing 1.27 0.001 Mm.29808 Ppp2r5a protein phosphatase 2, regulatory subunit B (B56), alpha isoform 1.27 0.001 Mm.205569 Stxbp6 syntaxin binding protein 6 (amisyn) 1.25 0.001 Mm.285400 Sgne1 secretory granule neuroendocrine protein 1, 7B2 protein 1.26 0.001 Mm.4836 Pclo piccolo (presynaptic cytomatrix protein) 1.20 0.001 Mm.279903 Map3k1 mitogen activated protein kinase kinase kinase 1 0.83 0.001 Mm.15918 Sdccag33 serologically defined colon cancer antigen 33 0.79 0.001 Mm.102136 Desrt developmentally and sexually retarded with transient immune abnormalities 0.68 0.001 Mm.270346 Tnfsf10 tumor necrosis factor (ligand) superfamily, member 10 1.53 0.001 Mm.1062 Fn5 FN5 protein 1.28 0.001 Mm.86572 Ext1 exostoses (multiple) 1 0.80 0.001 Mm.1424 Trfr transferrin receptor 1.46 0.002 Mm.28683 Thsd1 thrombospondin, type I, domain 1 1.23 0.002 Mm.32067 Kctd5 potassium channel tetramerisation domain containing 5 0.79 0.002 Mm.28171 Nfix nuclear factor I/X 1.23 0.002 Mm.9394 Six4 sine oculis-related homeobox 4 homolog (Drosophila) 1.32 0.002 Mm.249575 Akap8 A kinase (PRKA) anchor protein 8 1.23 0.002 Mm.27351 BC013667 cDNA sequence BC013667 0.74 0.002 Mm.220901 Ceacam10 CEA-related cell adhesion molecule 10 1.21 0.002 Mm.30300 2600011L02Rik RIKEN cDNA 2600011L02 gene 1.16 0.002 Mm.218698 Syne1 synaptic nuclear envelope 1 1.24 0.002 Mm.301694 Rab12 RAB12, member RAS oncogene family 1.20 0.002 Mm.248313 Ssb Sjogren syndrome antigen B 0.75 0.002 Mm.10508 Clk CDC-like kinase 1.49 0.002 Mm.1761 Ripk1 receptor (TNFRSF)-interacting serine-threonine kinase 1 0.81 0.002 Mm.298305 Gps2 G protein pathway suppressor 2 1.27 0.002 Mm.18026 BC023181 cDNA sequence BC023181 1.23 0.002 Mm.276001 Slc37a1 solute carrier family 37 (glycerol-3-phosphate transporter), member 1 1.19 0.002 Mm.204968 Cckar cholecystokinin A receptor 1.48 0.002 Mm.3521 Bk brain and kidney protein 1.21 0.002 Mm.156558 protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting Ppfia4 protein (liprin), alpha 4 0.78 0.002 Mm.295105 Enc1 ectodermal-neural cortex 1 0.65 0.002 Mm.241073 Cdc25b cell division cycle 25 homolog B (S. cerevisiae) 1.42 0.002 Mm.38444 Blvra biliverdin reductase A 0.80 0.002 Mm.22028 Tardbp TAR DNA binding protein 0.75 0.002 Mm.24083 Tgfbr1 transforming growth factor, beta receptor I 0.72 0.002 Mm.197552 Tncc troponin C, cardiac/slow skeletal 1.47 0.002 Mm.712

203 Sqrdl sulfide quinone reductase-like (yeast) 1.22 0.002 Mm.28986 D930043C02Rik RIKEN cDNA D930043C02 gene 1.19 0.002 Mm.256991 2410005C22Rik RIKEN cDNA 2410005C22 gene 0.82 0.002 Mm.274158 BC018472 cDNA sequence BC018472 0.80 0.002 Mm.272127 Atf4 activating transcription factor 4 0.73 0.002 Mm.641 Nin ninein 1.26 0.002 Mm.244047 LOC218805 hypothetical protein LOC218805 1.21 0.002 Mm.206990 Tcfec transcription factor EC 0.76 0.002 Mm.36217 2900024C23Rik RIKEN cDNA 2900024C23 gene 0.73 0.002 Mm.277897 Pdgfra platelet derived growth factor receptor, alpha polypeptide 0.64 0.002 Mm.221403 BC025872 cDNA sequence BC025872 1.42 0.002 Mm.265552 Ghitm growth hormone inducible transmembrane protein 1.18 0.002 Mm.182912 Aldh3a1 aldehyde dehydrogenase family 3, subfamily A1 1.64 0.002 Mm.4257 Mmrp19 monocyte macrophage 19 1.23 0.002 Mm.24772 Nte neuropathy target esterase 1.18 0.002 Mm.23085 A030003E17Rik RIKEN cDNA A030003E17 gene 0.81 0.002 Mm.260943 Tfpi tissue factor pathway inhibitor 0.79 0.002 Mm.124316 C87860 expressed sequence C87860 0.78 0.002 Mm.21062 9930118K05Rik RIKEN cDNA 9930118K05 gene 1.19 0.002 Mm.207636 1500034J01Rik RIKEN cDNA 1500034J01 gene 0.81 0.002 Mm.300109 Cdgap Cdc42 GTPase-activating protein 1.56 0.002 Mm.268397 Klf1 Kruppel-like factor 1 (erythroid) 1.32 0.002 Mm.296944 Irf2bp1 interferon regulatory factor 2 binding protein 1 1.20 0.002 Mm.274237 Esrrb estrogen related receptor, beta 1.19 0.002 Mm.235550 Crim1 cysteine-rich motor neuron 1 0.55 0.002 Mm.19271 Osgep O-sialoglycoprotein endopeptidase 1.31 0.002 Mm.29642 Tnnt1 troponin T1, skeletal, slow 1.28 0.002 Mm.258670 5730449L18Rik RIKEN cDNA 5730449L18 gene 1.27 0.002 Mm.21065 BC003494 cDNA sequence BC003494 0.81 0.002 Mm.203556 Rnf41 ring finger protein 41 0.80 0.002 Mm.294120 1110055L24Rik RIKEN cDNA 1110055L24 gene 0.73 0.002 Mm.227281 Hspb1 heat shock protein 1 0.70 0.002 Mm.13849 Ggt1 gamma-glutamyltransferase 1 1.26 0.002 Mm.4559 Cipp channel-interacting PDZ domain protein 1.25 0.002 Mm.268359 AI643885 expressed sequence AI643885 0.69 0.002 Mm.46749 Nr2f2 nuclear receptor subfamily 2, group F, member 2 0.67 0.002 Mm.270109 Hoxc6 homeo box C6 1.30 0.002 Mm.4444 Jak2 Janus kinase 2 0.84 0.002 Mm.275839 4933433D23Rik RIKEN cDNA 4933433D23 gene 0.76 0.002 Mm.46067 Gmfb glia maturation factor, beta 0.65 0.002 Mm.87312 Ssr1 signal sequence receptor, alpha 1.27 0.002 Mm.138725 4933402O15Rik RIKEN cDNA 4933402O15 gene 1.57 0.002 Mm.23787 Myst3 MYST histone acetyltransferase (monocytic leukemia) 3 1.28 0.002 Mm.182776 1300010K09Rik RIKEN cDNA 1300010K09 gene 1.23 0.002 Mm.178115 Nedd1 neural precursor cell expressed, developmentally down-regulated gene 1 0.85 0.002 Mm.2998 2610511O17Rik RIKEN cDNA 2610511O17 gene 0.82 0.002 Mm.209503 2010011I20Rik RIKEN cDNA 2010011I20 gene 0.80 0.002 Mm.30013 AA792890 expressed sequence AA792890 0.70 0.002 Mm.103202 Jag1 jagged 1 0.65 0.002 Mm.22398 1500001L20Rik RIKEN cDNA 1500001L20 gene 1.36 0.002 Mm.28891 homocysteine-inducible, endoplasmic reticulum stress-inducible, ubiquitin-like Herpud1 domain member 1 1.34 0.002 Mm.29151 AI195350 expressed sequence AI195350 0.80 0.002 Mm.273197 Ly78 lymphocyte antigen 78 0.76 0.002 Mm.3300 Kif5b kinesin family member 5B 0.68 0.002 Mm.223744 Acp2 acid phosphatase 2, lysosomal 0.81 0.002 Mm.45570 Txn1 thioredoxin 1 1.24 0.002 Mm.260618 Tparl TPA regulated locus 0.85 0.002 Mm.790 Gpr54 G protein-coupled receptor 54 1.21 0.002 Mm.191035 Muc5b mucin 5, subtype B, tracheobronchial 0.65 0.002 Mm.200752 Tpm3 tropomyosin 3, gamma 1.24 0.002 Mm.240839 D10Bur2e DNA segment, Chr 10, Burmeister 2, expressed 1.23 0.002 Mm.71560 V1rc6 vomeronasal 1 receptor, C6 1.19 0.002 Mm.298068 Cyr61 cysteine rich protein 61 0.46 0.002 Mm.1231 X83328 EST X83328 1.35 0.002 Mm.291901 AI450757 expressed sequence AI450757 1.23 0.002 Mm.33908 Itpa inosine triphosphatase (nucleoside triphosphate pyrophosphatase) 0.84 0.002 Mm.21399 G1p2 interferon, alpha-inducible protein 0.55 0.002 Mm.4950 Camp cathelicidin antimicrobial peptide 1.94 0.002 Mm.3834 Zfp39 zinc finger protein 39 1.18 0.002 Mm.127646 B4galt6 UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 0.79 0.002 Mm.290717 BC037006 cDNA sequence BC037006 1.28 0.002 Mm.31267 Slco6c1 solute carrier organic anion transporter family, member 6c1 1.20 0.002 Mm.60362 Tef thyrotroph embryonic factor 1.68 0.002 Mm.270278

204 3010019O03Rik RIKEN cDNA 3010019O03 gene 0.79 0.002 Mm.206782 D10Ucla1 DNA segment, Chr 10, University of California at Los Angeles 1 0.63 0.002 Mm.240150 Ccl7 chemokine (C-C motif) ligand 7 0.59 0.002 Mm.16091 Smpx small muscle protein, X-linked 1.53 0.002 Mm.140340 4430402O11Rik RIKEN cDNA 4430402O11 gene 1.26 0.002 Mm.291832 4732429D16Rik RIKEN cDNA 4732429D16 gene 0.81 0.002 Mm.294107 6720485C15Rik RIKEN cDNA 6720485C15 gene 0.78 0.002 Mm.277449 Cops5 COP9 (constitutive photomorphogenic) homolog, subunit 5 (Arabidopsis thaliana) 0.76 0.002 Mm.242459 Bdkrb1 bradykinin receptor, beta 1 0.69 0.002 Mm.298087 Pgd phosphogluconate dehydrogenase 0.69 0.002 Mm.252080 Dnahc8 dynein, axonemal, heavy chain 8 1.27 0.002 Mm.247950 Pcm1 pericentriolar material 1 1.25 0.002 Mm.117896 Slc7a9 solute carrier family 7 (cationic amino acid transporter, y+ system), member 9 1.22 0.002 Mm.45874 Acad8 acyl-Coenzyme A dehydrogenase family, member 8 1.19 0.002 Mm.289244 Rpl22 ribosomal protein L22 1.33 0.002 Mm.191936 Krt1-12 keratin complex 1, acidic, gene 12 1.31 0.002 Mm.268993 0610039C21Rik RIKEN cDNA 0610039C21 gene 1.25 0.002 Mm.29998 Spink4 serine protease inhibitor, Kazal type 4 1.23 0.002 Mm.25246 3930401E15Rik RIKEN cDNA 3930401E15 gene 0.79 0.002 Mm.296043 Glb1 galactosidase, beta 1 0.78 0.002 Mm.290516 Tslpr thymic stromal-derived lymphopoietin, receptor 0.77 0.002 Mm.35771 Cdo1 cysteine dioxygenase 1, cytosolic 1.48 0.002 Mm.241056 Aldh3a2 aldehyde dehydrogenase family 3, subfamily A2 1.31 0.002 Mm.145091 Mrg1 myeloid ecotropic viral integration site-related gene 1 0.85 0.002 Mm.247566 6720484B16 hypothetical protein 6720484B16 0.82 0.002 Mm.260557 Cox5a cytochrome c oxidase, subunit Va 0.72 0.002 Mm.273403 A430106J12Rik RIKEN cDNA A430106J12 gene 0.66 0.002 Mm.259827 Ctsz cathepsin Z 0.65 0.002 Mm.271709 Cradd CASP2 and RIPK1 domain containing adaptor with death domain 1.20 0.002 Mm.17493 Il1a interleukin 1 alpha 1.20 0.002 Mm.15534 Cbfa2t1h CBFA2T1 identified gene homolog (human) 1.17 0.002 Mm.4909 2700097O09Rik RIKEN cDNA 2700097O09 gene 1.23 0.002 Mm.59041 A430081P20Rik RIKEN cDNA A430081P20 gene 1.23 0.002 Mm.3741 BC004012 cDNA sequence BC004012 1.22 0.002 Mm.28347 Ubap1 ubiquitin-associated protein 1 0.81 0.002 Mm.289795 Tnrc6 trinucleotide repeat containing 6 0.71 0.002 Mm.102305 Prdx3 peroxiredoxin 3 0.77 0.002 Mm.29821 Bace2 beta-site APP-cleaving enzyme 2 1.26 0.002 Mm.97885 Dpysl5 dihydropyrimidinase-like 5 1.25 0.002 Mm.27732 V1rb4 vomeronasal 1 receptor, B4 1.20 0.002 Mm.298059 Tlr4 toll-like receptor 4 0.82 0.002 Mm.38049 Hnrpab heterogeneous nuclear ribonucleoprotein A/B 0.77 0.002 Mm.280842 Mdk midkine 0.70 0.002 Mm.57181 Prps2 phosphoribosyl pyrophosphate synthetase 2 1.26 0.002 Mm.272955 Paip2 polyadenylate-binding protein-interacting protein 2 1.38 0.002 Mm.126534 Ifnab interferon alpha family, gene B 1.27 0.002 Mm.302572 Mor2 malate dehydrogenase, soluble 1.25 0.002 Mm.212703 Tmc6 transmembrane channel-like gene family 6 1.20 0.002 Mm.268910 Emb embigin 1.19 0.002 Mm.274926 1810029B16Rik RIKEN cDNA 1810029B16 gene 0.78 0.002 Mm.294985 Slc6a6 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 0.69 0.002 Mm.247352 4632413K17Rik RIKEN cDNA 4632413K17 gene 0.66 0.002 Mm.295246 Noxo1 NADPH oxidase organizer 1 1.32 0.002 Mm.269293 BC016235 cDNA sequence BC016235 1.24 0.002 Mm.213213 2310001A20Rik RIKEN cDNA 2310001A20 gene 1.24 0.002 Mm.26599 Kcnk5 potassium channel, subfamily K, member 5 1.21 0.002 Mm.68998 Hspa5 heat shock 70kD protein 5 (glucose-regulated protein) 0.68 0.002 Mm.918 Tnfsf13 tumor necrosis factor (ligand) superfamily, member 13 1.34 0.002 Mm.105328 Cryz crystallin, zeta 1.30 0.002 Mm.235152 Nek9 NIMA (never in mitosis gene a)-related expressed kinase 9 1.26 0.002 Mm.29071 Dpp8 dipeptidylpeptidase 8 1.26 0.002 Mm.202749 Krtap16-9 keratin associated protein 16-9 1.22 0.002 Mm.196822 1810020H02Rik RIKEN cDNA 1810020H02 gene 1.16 0.002 Mm.271985 Cxadr coxsackievirus and adenovirus receptor 0.73 0.002 Mm.66222 6330503C17Rik RIKEN cDNA 6330503C17 gene 0.82 0.002 Mm.27512 Kcnj8 potassium inwardly-rectifying channel, subfamily J, member 8 0.78 0.002 Mm.1482 Rec8L1 REC8-like 1 (yeast) 0.80 0.002 Mm.23149 C030006K11Rik RIKEN cDNA C030006K11 gene 1.32 0.002 Mm.291713 Harsl histidyl-tRNA synthetase-like 1.29 0.002 Mm.282700 Lhb luteinizing hormone beta 1.23 0.002 Mm.57061 Slc38a1 solute carrier family 38, member 1 0.82 0.002 Mm.103568 Chd4 chromodomain helicase DNA binding protein 4 0.79 0.002 Mm.183257 Emp3 epithelial membrane protein 3 0.78 0.002 Mm.20829 Hsd17b7 hydroxysteroid (17-beta) dehydrogenase 7 0.77 0.002 Mm.12882

205 Usp29 ubiquitin specific protease 29 1.16 0.002 Mm.40752 Ms4a8a membrane-spanning 4-domains, subfamily A, member 8A 0.74 0.002 Mm.248501 Lmod2 leiomodin 2 (cardiac) 1.25 0.002 Mm.250540 Abl1 v-abl Abelson murine leukemia oncogene 1 1.20 0.002 Mm.1318 Akr1b8 aldo-keto reductase family 1, member B8 0.75 0.002 Mm.5378 Calm3 calmodulin 3 0.74 0.002 Mm.288630 Amd1 S-adenosylmethionine decarboxylase 1 0.55 0.002 Mm.296726 Hspa9a heat shock protein, A 0.77 0.002 Mm.209419 Crsp2 cofactor required for Sp1 transcriptional activation subunit 2 1.26 0.002 Mm.245566 Ing4 inhibitor of growth family, member 4 1.25 0.002 Mm.262547 5730403B10Rik RIKEN cDNA 5730403B10 gene 1.19 0.002 Mm.272866 Acly ATP citrate lyase 1.32 0.002 Mm.282039 Pou2af1 POU domain, class 2, associating factor 1 1.73 0.002 Mm.897 Fcer1a Fc receptor, IgE, high affinity I, alpha polypeptide 1.27 0.002 Mm.5266 4930524H12Rik RIKEN cDNA 4930524H12 gene 0.81 0.002 Mm.29830 4833415N24Rik RIKEN cDNA 4833415N24 gene 0.80 0.002 Mm.251639 Havcr1 hepatitis A virus cellular receptor 1 1.20 0.002 Mm.17771 Serpinb8 serine (or cysteine) proteinase inhibitor, clade B, member 8 0.85 0.002 Mm.83909 S100a10 S100 calcium binding protein A10 (calpactin) 0.75 0.002 Mm.69081 Osbpl5 oxysterol binding protein-like 5 1.28 0.002 Mm.21199 D030056L22 hypothetical protein D030056L22 1.26 0.002 Mm.28101 A930017E24Rik RIKEN cDNA A930017E24 gene 1.20 0.002 Mm.258142 Auh AU RNA binding protein/enoyl-coenzyme A hydratase 1.20 0.002 Mm.252034 Mtac2d1 membrane targeting (tandem) C2 domain containing 1 0.84 0.002 Mm.275939 Rab28 RAB28, member RAS oncogene family 1.26 0.002 Mm.41555 Cops7a COP9 (constitutive photomorphogenic) homolog, subunit 7a (Arabidopsis thaliana) 1.20 0.002 Mm.1444 Asb6 ankyrin repeat and SOCS box-containing protein 6 1.19 0.002 Mm.27656 Shyc selective hybridizing clone 0.83 0.002 Mm.37249 1110018L13Rik RIKEN cDNA 1110018L13 gene 1.33 0.002 Mm.29989 Bnipl BCL2/adenovirus E1B 19kD interacting protein like 1.23 0.002 Mm.276596 AI591476 expressed sequence AI591476 1.20 0.002 Mm.50424 Zfp294 zinc finger protein 294 0.72 0.002 Mm.249005 Col4a6 procollagen, type IV, alpha 6 0.79 0.002 Mm.155586 Vim vimentin 0.64 0.002 Mm.268000 3-monooxgenase/tryptophan 5-monooxgenase activation protein, gamma Ywhag polypeptide 0.83 0.002 Mm.284984 Capg capping protein (actin filament), gelsolin-like 0.73 0.002 Mm.18626 Apln apelin 1.38 0.002 Mm.29262 Ndufs7 NADH dehydrogenase (ubiquinone) Fe-S protein 7 1.28 0.002 Mm.28712 Bri3 brain protein I3 1.25 0.002 Mm.38011 Sec14l2 SEC14-like 2 (S. cerevisiae) 1.18 0.002 Mm.253922 Galns galactosamine (N-acetyl)-6-sulfate sulfatase 0.80 0.002 Mm.34702 Itsn intersectin (SH3 domain protein 1A) 0.78 0.002 Mm.40546 Tm4sf9 transmembrane 4 superfamily member 9 0.76 0.002 Mm.31927 4732486I23Rik RIKEN cDNA 4732486I23 gene 0.73 0.002 Mm.34850 Acadvl acyl-Coenzyme A dehydrogenase, very long chain 1.28 0.002 Mm.18630 2210013K02Rik RIKEN cDNA 2210013K02 gene 1.23 0.002 Mm.11112 Eps15-rs epidermal growth factor receptor pathway substrate 15, related sequence 1.21 0.002 Mm.207270 7420700H20Rik RIKEN cDNA 7420700H20 gene 1.30 0.002 Mm.7381 holocarboxylase synthetase (biotin- [propriony-Coenzyme A-carboxylase (ATP- Hlcs hydrolysing)] ligase) 1.20 0.002 Mm.30921 Vnn1 vanin 1 0.60 0.002 Mm.27154 Pltp phospholipid transfer protein 1.48 0.002 Mm.6105 Rnf25 ring finger protein 25 1.34 0.002 Mm.280920 2410005O16Rik RIKEN cDNA 2410005O16 gene 1.29 0.002 Mm.257603 Padi4 peptidyl arginine deiminase, type IV 1.23 0.002 Mm.250358 Iqgap1 IQ motif containing GTPase activating protein 1 1.23 0.002 Mm.207619 Etfb electron transferring flavoprotein, beta polypeptide 1.26 0.002 Mm.30200 Rab11a RAB11a, member RAS oncogene family 0.80 0.002 Mm.1387 1810049H13Rik RIKEN cDNA 1810049H13 gene 1.21 0.002 Mm.45063 Mgll monoglyceride lipase 1.32 0.002 Mm.272197 0610030G03Rik RIKEN cDNA 0610030G03 gene 1.25 0.002 Mm.28122 Slc35b1 solute carrier family 35, member B1 0.85 0.002 Mm.289716 1300002F13Rik RIKEN cDNA 1300002F13 gene 0.78 0.002 Mm.249333 Ap3m2 adaptor-related protein complex 3, mu 2 subunit 1.34 0.002 Mm.10647 Rnf44 ring finger protein 44 1.23 0.002 Mm.25366 Arhq ras homolog gene family, member Q 0.82 0.002 Mm.826 Birc1b baculoviral IAP repeat-containing 1b 0.78 0.002 Mm.89961 Tomm20 translocase of outer mitochondrial membrane 20 homolog (yeast) 0.75 0.002 Mm.291471 Hs6st2 heparan sulfate 6-O-sulfotransferase 2 1.21 0.002 Mm.252561 1810061I13Rik RIKEN cDNA 1810061I13 gene 1.69 0.002 Mm.30700 Gdi1 guanosine diphosphate (GDP) dissociation inhibitor 1 1.32 0.002 Mm.205830 Dnmt2 DNA methyltransferase 2 1.24 0.002 Mm.6979 Kcnd2 potassium voltage-gated channel, Shal-related family, member 2 1.19 0.002 Mm.132309

206 AI481750 expressed sequence AI481750 1.31 0.002 Mm.22524 Trip4 thyroid hormone receptor interactor 4 1.22 0.002 Mm.208379 D10Ertd516e DNA segment, Chr 10, ERATO Doi 516, expressed 0.82 0.002 Mm.203965 Hspcb heat shock protein 1, beta 0.66 0.002 Mm.2180 Ednra endothelin receptor type A 0.68 0.002 Mm.251204 Vasp vasodilator-stimulated phosphoprotein 0.81 0.002 Mm.9684 Csnk1a1 casein kinase 1, alpha 1 0.76 0.002 Mm.26908 Rwdd3 RWD domain containing 3 1.21 0.002 Mm.263163 2700063N13Rik RIKEN cDNA 2700063N13 gene 0.76 0.002 Mm.38244 D17Wsu92e DNA segment, Chr 17, Wayne State University 92, expressed 1.34 0.002 Mm.196577 Prkcl protein kinase C, lambda 1.24 0.002 Mm.291554 Inhbb inhibin beta-B 0.75 0.002 Mm.3092 2610207I16Rik RIKEN cDNA 2610207I16 gene 1.21 0.002 Mm.272905 2500002E12Rik RIKEN cDNA 2500002E12 gene 0.84 0.002 Mm.101764 Creb1 cAMP responsive element binding protein 1 1.46 0.002 Mm.1376 1110014L17Rik RIKEN cDNA 1110014L17 gene 0.83 0.002 Mm.254495 Tpp2 tripeptidyl peptidase II 0.81 0.002 Mm.234139 Fkbp7 FK506 binding protein 7 0.74 0.002 Mm.24720 Dguok deoxyguanosine kinase 1.32 0.002 Mm.42234 1190005L06Rik RIKEN cDNA 1190005L06 gene 1.21 0.002 Mm.259223 Kcnj14 potassium inwardly-rectifying channel, subfamily J, member 14 1.20 0.002 Mm.68170 Trnt1 tRNA nucleotidyl transferase, CCA-adding, 1 0.80 0.002 Mm.196332 Mlc1 megalencephalic leukoencephalopathy with subcortical cysts 1 homolog (human) 1.42 0.002 Mm.32780 Luc7l2 LUC7-like 2 (S. cerevisiae) 1.20 0.002 Mm.170182 Evc Ellis van Creveld gene homolog (human) 1.19 0.002 Mm.23592 Arl2bp ADP-ribosylation factor-like 2 binding protein 1.24 0.002 Mm.279977 Es10 esterase 10 0.72 0.002 Mm.38055 Anapc5 anaphase-promoting complex subunit 5 1.23 0.002 Mm.45312 Eva epithelial V-like antigen 1.26 0.002 Mm.33240 AW549877 expressed sequence AW549877 1.25 0.002 Mm.21299 2410170E21Rik RIKEN cDNA 2410170E21 gene 1.23 0.002 Mm.280573 BC017158 cDNA sequence BC017158 1.21 0.002 Mm.220880 A630007B06Rik RIKEN cDNA A630007B06 gene 1.16 0.002 Mm.131555 Ubc-rs2 ubiquitin C, related sequence 2 0.85 0.002 Mm.295670 2600013N14Rik RIKEN cDNA 2600013N14 gene 0.80 0.002 Mm.35492 BC002230 cDNA sequence BC002230 1.25 0.002 Mm.224076 Gtl3 gene trap locus 3 1.31 0.002 Mm.2080 Mapk3 mitogen activated protein kinase 3 1.21 0.002 Mm.8385 Camkk2 calcium/calmodulin-dependent protein kinase kinase 2, beta 0.78 0.002 Mm.289237 Ms4a4d membrane-spanning 4-domains, subfamily A, member 4D 0.72 0.002 Mm.2072 Rpe ribulose-5-phosphate-3-epimerase 0.70 0.002 Mm.240912 Slco1c1 solute carrier organic anion transporter family, member 1c1 1.22 0.002 Mm.284495 Eef1b2 eukaryotic translation elongation factor 1 beta 2 0.78 0.002 Mm.2718 1810010A06Rik RIKEN cDNA 1810010A06 gene 1.31 0.002 Mm.7884 Bcl2l2 Bcl2-like 2 1.29 0.002 Mm.6967 Ninj1 ninjurin 1 0.73 0.002 Mm.18503 BC003236 cDNA sequence BC003236 0.66 0.002 Mm.200327 Nfe2l3 nuclear factor, erythroid derived 2, like 3 1.20 0.003 Mm.42138 2610209M04Rik RIKEN cDNA 2610209M04 gene 1.19 0.003 Mm.182650 Ttll1 tubulin tyrosine ligase-like 1 1.27 0.003 Mm.235007 AW494914 expressed sequence AW494914 1.25 0.003 Mm.297521 2700079K05Rik RIKEN cDNA 2700079K05 gene 0.83 0.003 Mm.27695 Trim46 tripartite motif protein 46 1.25 0.003 Mm.276035 Xpnpep2 X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound 1.22 0.003 Mm.129279 4732435N03Rik RIKEN cDNA 4732435N03 gene 0.82 0.003 Mm.116889 Lmcd1 LIM and cysteine-rich domains 1 0.67 0.003 Mm.234441 Orm1 orosomucoid 1 0.61 0.003 Mm.4777 Fnta farnesyltransferase, CAAX box, alpha 1.25 0.003 Mm.3496 2810446G01Rik RIKEN cDNA 2810446G01 gene 1.25 0.003 Mm.11337 1700019L03Rik RIKEN cDNA 1700019L03 gene 1.18 0.003 Mm.275709 1110014P06Rik RIKEN cDNA 1110014P06 gene 1.16 0.003 Mm.294441 Anxa7 annexin A7 0.83 0.003 Mm.20794 Ncoa6ip nuclear receptor coactivator 6 interacting protein 0.76 0.003 Mm.171323 Cyp2j13 cytochrome P450, family 2, subfamily j, polypeptide 13 1.20 0.003 Mm.268175 4930438M06Rik RIKEN cDNA 4930438M06 gene 1.16 0.003 Mm.31808 Edn1 endothelin 1 0.75 0.003 Mm.14543 Lst1 leukocyte specific transcript 1 1.50 0.003 Mm.19379 1600025H15Rik RIKEN cDNA 1600025H15 gene 1.29 0.003 Mm.276829 Adhfe1 alcohol dehydrogenase, iron containing, 1 1.29 0.003 Mm.28514 Slc25a28 solute carrier family 25, member 28 1.21 0.003 Mm.23827 Thra thyroid hormone receptor alpha 1.20 0.003 Mm.265917 Ptpn4 protein tyrosine phosphatase, non-receptor type 4 1.17 0.003 Mm.252737 Slc4a7 solute carrier family 4, sodium bicarbonate cotransporter, member 7 0.78 0.003 Mm.258893 Gpcr25 G-protein coupled receptor 25 0.81 0.003 Mm.2840

207 Dnajb10 DnaJ (Hsp40) homolog, subfamily B, member 10 1.28 0.003 Mm.248776 myeloid/lymphoid or mixed lineage-leukemia translocation to 10 homolog Mllt10 (Drosophila) 1.26 0.003 Mm.209175 Gng5 guanine nucleotide binding protein (G protein), gamma 5 subunit 1.15 0.003 Mm.301725 1500005K14Rik RIKEN cDNA 1500005K14 gene 0.76 0.003 Mm.34131 Bicd2 bicaudal D homolog 2 (Drosophila) 0.70 0.003 Mm.197387 1110019N10Rik RIKEN cDNA 1110019N10 gene 1.32 0.003 Mm.279 2610509I15Rik RIKEN cDNA 2610509I15 gene 1.23 0.003 Mm.218525 2900026G05Rik RIKEN cDNA 2900026G05 gene 1.20 0.003 Mm.248237 Cpxm2 carboxypeptidase X 2 (M14 family) 0.85 0.003 Mm.10233 Sec23ip Sec23 interacting protein 0.85 0.003 Mm.21163 Gna12 guanine nucleotide binding protein, alpha 12 0.84 0.003 Mm.305785 Sh3kbp1 SH3-domain kinase binding protein 1 0.77 0.003 Mm.167131 2610015J01Rik RIKEN cDNA 2610015J01 gene 0.76 0.003 Mm.30521 4930568P13Rik RIKEN cDNA 4930568P13 gene 0.74 0.003 Mm.30805 Man1a mannosidase 1, alpha 0.74 0.003 Mm.243941 Rps13 ribosomal protein S13 0.67 0.003 Mm.14798 9330177P20Rik RIKEN cDNA 9330177P20 gene 1.17 0.003 Mm.276096 Rps2 ribosomal protein S2 0.86 0.003 Mm.1129 Kcne4 potassium voltage-gated channel, Isk-related subfamily, gene 4 0.75 0.003 Mm.24386 Ptpla protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a 0.73 0.003 Mm.241205 Serpinb6b serine (or cysteine) proteinase inhibitor, clade B, member 6b 0.66 0.003 Mm.36526 Asgr2 asialoglycoprotein receptor 2 1.29 0.003 Mm.1357 Ovgp1 oviductal glycoprotein 1 1.26 0.003 Mm.5110 Ndfip1 Nedd4 family interacting protein 1 0.80 0.003 Mm.102496 Ftl1 ferritin light chain 1 0.79 0.003 Mm.30357 Siglecl1 SIGLEC-like 1 1.19 0.003 Mm.157702 Dst dystonin 1.38 0.003 Mm.25326 2310014B08Rik RIKEN cDNA 2310014B08 gene 1.28 0.003 Mm.37817 2810002D19Rik RIKEN cDNA 2810002D19 gene 0.81 0.003 Mm.48149 Myef2 myelin basic protein expression factor 2, repressor 0.78 0.003 Mm.18535 Chl1 close homolog of L1 0.63 0.003 Mm.251288 Cpn1 carboxypeptidase N, polypeptide 1 1.25 0.003 Mm.206774 1810030N24Rik RIKEN cDNA 1810030N24 gene 0.80 0.003 Mm.28071 1110035O14Rik RIKEN cDNA 1110035O14 gene 0.70 0.003 Mm.12950 1110027L01Rik RIKEN cDNA 1110027L01 gene 1.26 0.003 Mm.34088 Fxyd4 FXYD domain-containing ion transport regulator 4 0.84 0.003 Mm.250392 2700091N06Rik RIKEN cDNA 2700091N06 gene 1.17 0.003 Mm.291163 Gng11 guanine nucleotide binding protein (G protein), gamma 11 1.27 0.003 Mm.25547 1810059G22Rik RIKEN cDNA 1810059G22 gene 1.20 0.003 Mm.45155 Ampd2 adenosine monophosphate deaminase 2 (isoform L) 0.80 0.003 Mm.274335 2810025M15Rik RIKEN cDNA 2810025M15 gene 1.26 0.003 Mm.286863 0610039K22Rik RIKEN cDNA 0610039K22 gene 1.20 0.003 Mm.288183 Xpr1 xenotropic and polytropic retrovirus receptor 1 1.22 0.003 Mm.89968 Gabrr2 gamma-aminobutyric acid (GABA-C) receptor, subunit rho 2 1.20 0.003 Mm.6227 Tbc1d1 TBC1 domain family, member 1 0.78 0.003 Mm.286353 9030409G11Rik RIKEN cDNA 9030409G11 gene 0.77 0.003 Mm.281393 E430036I04Rik RIKEN cDNA E430036I04 gene 0.74 0.003 Mm.173515 Ceacam2 CEA-related cell adhesion molecule 2 1.26 0.003 Mm.308919 4930570C03Rik RIKEN cDNA 4930570C03 gene 1.29 0.003 Mm.28955 Ebfaz early B-cell factor associated zinc finger protein 0.84 0.003 Mm.23452 Reck reversion-inducing-cysteine-rich protein with kazal motifs 1.29 0.003 Mm.20862 Srr serine racemase 1.21 0.003 Mm.284605 1200008O12Rik RIKEN cDNA 1200008O12 gene 1.17 0.003 Mm.9916 2500002K03Rik RIKEN cDNA 2500002K03 gene 0.80 0.003 Mm.29181 D11Ertd603e DNA segment, Chr 11, ERATO Doi 603, expressed 0.77 0.003 Mm.276504 Aqp9 aquaporin 9 1.26 0.003 Mm.22477 4931432E15Rik RIKEN cDNA 4931432E15 gene 1.27 0.003 Mm.158524 Camk2g calcium/calmodulin -dependent protein kinase II gamma 1.22 0.003 Mm.235182 V1rb3 vomeronasal 1 receptor, B3 1.23 0.003 Mm.306505 1110008J03Rik RIKEN cDNA 1110008J03 gene 1.20 0.003 Mm.9654 1810063P04Rik RIKEN cDNA 1810063P04 gene 1.18 0.003 Mm.275878 D030041N15Rik RIKEN cDNA D030041N15 gene 0.50 0.003 Mm.4618 Zan zonadhesin 1.26 0.003 Mm.7984 Gfer growth factor, erv1 (S. cerevisiae)-like (augmenter of liver regeneration) 0.77 0.003 Mm.28124 Srrm1 serine/arginine repetitive matrix 1 0.86 0.003 Mm.1963 Nedd9 neural precursor cell expressed, developmentally down-regulated gene 9 0.78 0.003 Mm.8315 1110056N09Rik RIKEN cDNA 1110056N09 gene 0.77 0.003 Mm.238034 1700020H15 hypothetical protein 1700020H15 1.17 0.003 Mm.56997 Plod1 procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1 0.83 0.003 Mm.37371 Zfp99 zinc finger protein 99 1.25 0.003 Mm.26782 Atp6v1d ATPase, H+ transporting, V1 subunit D 0.77 0.003 Mm.30206 Sipa1 signal-induced proliferation associated gene 1 1.29 0.003 Mm.3072 BC022133 cDNA sequence BC022133 1.26 0.003 Mm.27361

208 Alox12 arachidonate 12-lipoxygenase 1.21 0.003 Mm.12286 1110018O08Rik RIKEN cDNA 1110018O08 gene 1.18 0.003 Mm.29432 Dr1 down-regulator of transcription 1 0.79 0.003 Mm.292108 H2-M3 histocompatibility 2, M region locus 3 1.25 0.003 Mm.14437 Kcnip2 Kv channel-interacting protein 2 1.21 0.003 Mm.213204 1810054D07Rik RIKEN cDNA 1810054D07 gene 0.81 0.003 Mm.5540 Srp9 signal recognition particle 9 0.76 0.003 Mm.273196 0610009H04Rik RIKEN cDNA 0610009H04 gene 0.60 0.003 Mm.272687 Serf2 small EDRK-rich factor 2 1.21 0.003 Mm.330720 Zfp68 Zinc finger protein 68 1.28 0.003 Mm.27575 Mrc1 mannose receptor, C type 1 0.66 0.003 Mm.2019 Ncl nucleolin 0.65 0.003 Mm.154378 1700011I11Rik RIKEN cDNA 1700011I11 gene 1.28 0.003 Mm.33150 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, Smarcc1 subfamily c, member 1 0.78 0.003 Mm.85410 Nptx2 neuronal pentraxin 2 1.28 0.003 Mm.10099 Pfkfb1 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 1 1.19 0.003 Mm.249131 Sytl4 synaptotagmin-like 4 1.20 0.003 Mm.38674 Elk4 ELK4, member of ETS oncogene family 1.28 0.003 Mm.254233 4631434O19Rik RIKEN cDNA 4631434O19 gene 1.21 0.003 Mm.40321 4732418C07Rik RIKEN cDNA 4732418C07 gene 0.73 0.003 Mm.283565 Arhgef3 Rho guanine nucleotide exchange factor (GEF) 3 1.33 0.003 Mm.207446 Palmd palmdelphin 1.34 0.003 Mm.253736 3010026O09Rik RIKEN cDNA 3010026O09 gene 1.19 0.003 Mm.227464 Rdh12 retinol dehydrogenase 12 1.26 0.003 Mm.274373 Peg3 paternally expressed 3 0.57 0.003 Mm.7952 0610033L19Rik RIKEN cDNA 0610033L19 gene 1.21 0.003 Mm.276429 Gpr43 G protein-coupled receptor 43 1.19 0.003 Mm.97338 A430091O22Rik RIKEN cDNA A430091O22 gene 0.81 0.003 Mm.185636 1810045K17Rik RIKEN cDNA 1810045K17 gene 0.81 0.003 Mm.28917 6330415F13Rik RIKEN cDNA 6330415F13 gene 1.24 0.003 Mm.27469 4632428N05Rik RIKEN cDNA 4632428N05 gene 0.80 0.003 Mm.31863 Hsd17b12 hydroxysteroid (17-beta) dehydrogenase 12 0.79 0.003 Mm.22505 0610005A07Rik RIKEN cDNA 0610005A07 gene 1.25 0.003 Mm.29640 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- Galnt3 acetylgalactosaminyltransferase 3 0.84 0.003 Mm.38441 Cd151 CD151 antigen 1.27 0.003 Mm.30246 2900027G03Rik RIKEN cDNA 2900027G03 gene 1.23 0.003 Mm.301367 Smr2 submaxillary gland androgen regulated protein 2 1.29 0.003 Mm.1397 Sbno1 sno, strawberry notch homolog 1 (Drosophila) 1.26 0.003 Mm.23879 Flt1 FMS-like tyrosine kinase 1 1.24 0.003 Mm.241483 Mov10l1 Moloney leukemia virus 10-like 1 1.22 0.003 Mm.268981 Lbx2h lady bird-like homeobox 2 homolog (Drosophila) 1.17 0.003 Mm.20359 Sec61a1 Sec61 alpha 1 subunit (S. cerevisiae) 0.78 0.003 Mm.28375 Csf1r colony stimulating factor 1 receptor 0.78 0.003 Mm.22574 H2-Ab1 histocompatibility 2, class II antigen A, beta 1 0.47 0.003 Mm.254067 Igfbp3 insulin-like growth factor binding protein 3 2.30 0.003 Mm.29254 2310068O22Rik RIKEN cDNA 2310068O22 gene 1.35 0.003 Mm.20079 Etv3 ets variant gene 3 0.80 0.003 Mm.219460 Styx phosphoserine/threonine/tyrosine interaction protein 0.79 0.003 Mm.202561 Eif2c2 eukaryotic translation initiation factor 2C, 2 0.68 0.003 Mm.274482 Gad1 glutamic acid decarboxylase 1 1.23 0.003 Mm.272120 Apob48r apolipoprotein B48 receptor 0.85 0.003 Mm.170665 Anapc11 anaphase promoting complex subunit 11 homolog (yeast) 1.31 0.003 Mm.21645 Laptm4a lysosomal-associated protein transmembrane 4A 1.33 0.003 Mm.30071 Unc119 unc-119 homolog (C. elegans) 1.26 0.003 Mm.284811 Slc28a3 solute carrier family 28 (sodium-coupled nucleoside transporter), member 3 1.21 0.003 Mm.18188 Gtpbp5 GTP binding protein 5 1.21 0.003 Mm.219658 Il1f9 interleukin 1 family, member 9 1.21 0.003 Mm.249379 2700038L12Rik RIKEN cDNA 2700038L12 gene 1.17 0.003 Mm.245683 Popdc2 popeye domain containing 2 1.16 0.003 Mm.286858 Mnt max binding protein 1.22 0.003 Mm.3759 Gosr1 golgi SNAP receptor complex member 1 0.79 0.003 Mm.20931 Prkg1 protein kinase, cGMP-dependent, type I 0.64 0.003 Mm.45826 Prdx6 peroxiredoxin 6 1.25 0.003 Mm.186185 Pon2 paraoxonase 2 1.20 0.003 Mm.126984 Zfp330 zinc finger protein 330 0.84 0.003 Mm.269248 Obrgrp leptin receptor gene-related protein 0.78 0.003 Mm.4756 2810036K01Rik RIKEN cDNA 2810036K01 gene 1.17 0.003 Mm.100617 Shank3 SH3/ankyrin domain gene 3 1.34 0.003 Mm.235121 Ugalt2 UDP-galactose translocator 2 0.79 0.003 Mm.4593 Slpi secretory leukocyte protease inhibitor 1.36 0.003 Mm.35215 0610006F02Rik RIKEN cDNA 0610006F02 gene 1.19 0.003 Mm.19281 1500015O10Rik RIKEN cDNA 1500015O10 gene 0.81 0.003 Mm.274301

209 Znhit1 zinc finger, HIT domain containing 1 0.73 0.003 Mm.273147 Bcl2l11 BCL2-like 11 (apoptosis facilitator) 0.73 0.003 Mm.141083 Rtkn rhotekin 1.19 0.003 Mm.4139 Cyp4f13 cytochrome P450, family 4, subfamily f, polypeptide 13 1.21 0.003 Mm.254838 Otor otoraplin 1.25 0.003 Mm.157751 Ceacam11 CEA-related cell adhesion molecule 11 1.23 0.003 Mm.36666 Abcd1 ATP-binding cassette, sub-family D (ALD), member 1 1.18 0.003 Mm.365 Relb avian reticuloendotheliosis viral (v-rel) oncogene related B 0.83 0.003 Mm.1741 3300001G02Rik RIKEN cDNA 3300001G02 gene 1.27 0.003 Mm.29952 Ppp5c protein phosphatase 5, catalytic subunit 1.18 0.003 Mm.3294 2010003I19Rik RIKEN cDNA 2010003I19 gene 1.22 0.003 Mm.292739 D630043A20Rik RIKEN cDNA D630043A20 gene 1.20 0.003 Mm.21365 Arhgap4 Rho GTPase activating protein 4 1.18 0.003 Mm.246654 Cntn1 contactin 1 1.23 0.003 Mm.4911 Icosl icos ligand 1.21 0.003 Mm.276377 2310061K06Rik RIKEN cDNA 2310061K06 gene 1.20 0.003 Mm.272139 Rad9 RAD9 homolog (S. pombe) 1.16 0.003 Mm.193035 Lactb2 lactamase, beta 2 1.21 0.003 Mm.89572 Gstp2 glutathione S-transferase, pi 2 1.20 0.003 Mm.426 MGC37245 hypothetical protein MGC37245 1.17 0.003 Mm.268448 6720480F16Rik RIKEN cDNA 6720480F16 gene 0.80 0.003 Mm.294908 Traf1 Tnf receptor-associated factor 1 1.38 0.003 Mm.239514 Htr1f 5-hydroxytryptamine (serotonin) receptor 1F 1.27 0.003 Mm.5040 Hoxb5 homeo box B5 1.25 0.003 Mm.207 Abhd6 abhydrolase domain containing 6 1.16 0.003 Mm.181473 Plekhh1 pleckstrin homology domain containing, family H (with MyTH4 domain) member 1 1.24 0.003 Mm.268317 Jundm2 Jun dimerization protein 2 1.28 0.003 Mm.103560 Nfkbil1 nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1 1.21 0.003 Mm.100226 Gle1l GLE1 RNA export mediator-like (yeast 1.19 0.003 Mm.275121 Xbp1 X-box binding protein 1 0.80 0.003 Mm.22718 Gdf10 growth differentiation factor 10 1.37 0.003 Mm.40323 Slc40a1 solute carrier family 40 (iron-regulated transporter), member 1 1.28 0.003 Mm.28756 Icam4 intercellular adhesion molecule 4, Landsteiner-Wiener blood group 1.18 0.003 Mm.30220 Rshl1 radial spokehead-like 1 1.26 0.003 Mm.84435 Muc20 mucin 20 1.16 0.003 Mm.153301 Arl6ip1 ADP-ribosylation factor-like 6 interacting protein 1 1.32 0.004 Mm.29924 Pdhb pyruvate dehydrogenase (lipoamide) beta 1.20 0.004 Mm.289348 C230080I20Rik RIKEN cDNA C230080I20 gene 0.79 0.004 Mm.32497 Inhba inhibin beta-A 0.79 0.004 Mm.8042 Tmem5 transmembrane protein 5 0.82 0.004 Mm.236764 1700040I03Rik RIKEN cDNA 1700040I03 gene 1.20 0.004 Mm.28037 Cldn3 claudin 3 1.18 0.004 Mm.271763 Enpp2 ectonucleotide pyrophosphatase/phosphodiesterase 2 0.81 0.004 Mm.250256 4833420I20Rik RIKEN cDNA 4833420I20 gene 0.77 0.004 Mm.122366 Xkh McLeod syndrome gene homolog 1.21 0.004 Mm.296997 Strap serine/threonine kinase receptor associated protein 0.77 0.004 Mm.22584 Clta clathrin, light polypeptide (Lca) 0.83 0.004 Mm.198817 1600029D21Rik RIKEN cDNA 1600029D21 gene 1.55 0.004 Mm.29959 Top3b topoisomerase (DNA) III beta 1.26 0.004 Mm.20915 1700094D03Rik RIKEN cDNA 1700094D03 gene 1.36 0.004 Mm.279955 4921526G09Rik RIKEN cDNA 4921526G09 gene 1.24 0.004 Mm.24995 Pacsin3 protein kinase C and casein kinase substrate in neurons 3 1.16 0.004 Mm.288732 Slc2a1 solute carrier family 2 (facilitated glucose transporter), member 1 0.76 0.004 Mm.21002 1190002H23Rik RIKEN cDNA 1190002H23 gene 0.64 0.004 Mm.29811 BB219290 expressed sequence BB219290 1.21 0.004 Mm.1850 Muc10 mucin 10, submandibular gland salivary mucin 1.17 0.004 Mm.200411 Rab3d RAB3D, member RAS oncogene family 1.15 0.004 Mm.260157 D930018N21Rik RIKEN cDNA D930018N21 gene 1.34 0.004 Mm.24621 Slc16a11 solute carrier family 16 (monocarboxylic acid transporters), member 11 1.26 0.004 Mm.289238 B430212I04Rik RIKEN cDNA B430212I04 gene 1.28 0.004 Mm.219001 Epha3 Eph receptor A3 0.76 0.004 Mm.1977 1810004I06Rik RIKEN cDNA 1810004I06 gene 0.79 0.004 Mm.1893 Brd4 bromodomain containing 4 0.72 0.004 Mm.253518 A730019I05Rik RIKEN cDNA A730019I05 gene 1.22 0.004 Mm.16972 1500010B24Rik RIKEN cDNA 1500010B24 gene 0.76 0.004 Mm.294623 Kcns1 K+ voltage-gated channel, subfamily S, 1 1.24 0.004 Mm.6217 Rps25 ribosomal protein S25 0.79 0.004 Mm.292027 Trabid TRAF-binding protein 0.73 0.004 Mm.246240 4833439L19Rik RIKEN cDNA 4833439L19 gene 1.26 0.004 Mm.24593 Bteb1 basic transcription element binding protein 1 1.21 0.004 Mm.291595 1810015H18Rik RIKEN cDNA 1810015H18 gene 0.84 0.004 Mm.175989 Glg1 golgi apparatus protein 1 0.82 0.004 Mm.276271 Cd2ap CD2-associated protein 0.80 0.004 Mm.218637 Mtpn myotrophin 0.71 0.004 Mm.289942

210 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta Ywhab polypeptide 1.19 0.004 Mm.34319 Anxa4 annexin A4 0.82 0.004 Mm.259702 Rcn2 reticulocalbin 2 0.76 0.004 Mm.1782 Pde1a phosphodiesterase 1A, calmodulin-dependent 0.84 0.004 Mm.40678 Lfng lunatic fringe gene homolog (Drosophila) 1.19 0.004 Mm.12834 2810484M10Rik RIKEN cDNA 2810484M10 gene 1.22 0.004 Mm.177724 Gata3 GATA binding protein 3 1.20 0.004 Mm.606 Hnmt histamine N-methyltransferase 1.36 0.004 Mm.33120 Tgfbr2 transforming growth factor, beta receptor II 0.80 0.004 Mm.172346 Spag7 sperm associated antigen 7 1.33 0.004 Mm.21569 Il6st interleukin 6 signal transducer 0.80 0.004 Mm.4364 Deaf1 deformed epidermal autoregulatory factor 1 (Drosophila) 1.22 0.004 Mm.28392 5330414D10Rik RIKEN cDNA 5330414D10 gene 1.44 0.004 Mm.271986 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- Galnt11 acetylgalactosaminyltransferase 11 1.27 0.004 Mm.246718 2010315L10Rik RIKEN cDNA 2010315L10 gene 1.27 0.004 Mm.41890 Csnd casein delta 1.22 0.004 Mm.153308 Fhl1 four and a half LIM domains 1 1.20 0.004 Mm.3126 1110004C05Rik RIKEN cDNA 1110004C05 gene 0.84 0.004 Mm.141021 Srfcp SRF co-factor protein (cardiac and smooth muscle) 0.80 0.004 Mm.32257 Pthr1 parathyroid hormone receptor 1 0.80 0.004 Mm.248293 BC023037 cDNA sequence BC023037 1.21 0.004 Mm.218233 3010001K23Rik RIKEN cDNA 3010001K23 gene 1.17 0.004 Mm.258324 Ly96 lymphocyte antigen 96 0.83 0.004 Mm.116844 Rassf1 Ras association (RalGDS/AF-6) domain family 1 1.25 0.004 Mm.12091 Wdr6 WD repeat domain 6 1.24 0.004 Mm.248951 Ednrb endothelin receptor type B 1.35 0.004 Mm.229532 Ddt D-dopachrome tautomerase 1.19 0.004 Mm.5731 E2f1 E2F transcription factor 1 1.17 0.004 Mm.18036 C130038N16Rik RIKEN cDNA C130038N16 gene 0.84 0.004 Mm.196269 Man2a1 mannosidase 2, alpha 1 0.76 0.004 Mm.2433 2810407E01Rik RIKEN cDNA 2810407E01 gene 1.23 0.004 Mm.64911 Ppp1r16b protein phosphatase 1, regulatory (inhibitor) subunit 16B 1.37 0.004 Mm.150540 Mtap7 microtubule-associated protein 7 1.24 0.004 Mm.20928 2310047M15Rik RIKEN cDNA 2310047M15 gene 1.20 0.004 Mm.24788 Apeg1 aortic preferentially expressed gene 1 0.85 0.004 Mm.275397 Ctse cathepsin E 1.38 0.004 Mm.230249 Rab6ip2 Rab6 interacting protein 2 1.17 0.004 Mm.297116 1110007F12Rik RIKEN cDNA 1110007F12 gene 1.44 0.004 Mm.248440 B230342M21Rik RIKEN cDNA B230342M21 gene 1.24 0.004 Mm.279932 Polg polymerase (DNA directed), gamma 1.20 0.004 Mm.3616 Rem2 rad and gem related GTP binding protein 2 1.19 0.004 Mm.274727 Has3 hyaluronan synthase 3 1.30 0.004 Mm.56986 Mmp11 matrix metalloproteinase 11 1.28 0.004 Mm.4561 Dact1 dapper homolog 1, antagonist of beta-catenin (xenopus) 1.17 0.004 Mm.46662 Rps8 ribosomal protein S8 0.79 0.004 Mm.260904 Rrs1 RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) 0.72 0.004 Mm.29061 Triobp TRIO and F-actin binding protein 1.24 0.004 Mm.123714 Cgref1 cell growth regulator with EF hand domain 1 0.84 0.004 Mm.45127 Il15ra interleukin 15 receptor, alpha chain 1.18 0.004 Mm.200196 Cbll1 Casitas B-lineage lymphoma-like 1 0.74 0.004 Mm.273270 1700001N19Rik RIKEN cDNA 1700001N19 gene 1.19 0.004 Mm.327788 Syp synaptophysin 1.42 0.004 Mm.223674 6330412F12Rik RIKEN cDNA 6330412F12 gene 1.35 0.004 Mm.5856 Pigf phosphatidylinositol glycan, class F 1.25 0.004 Mm.219685 Hsf1 heat shock factor 1 1.24 0.004 Mm.184019 Pafah1b3 platelet-activating factor acetylhydrolase, isoform 1b, alpha1 subunit 1.24 0.004 Mm.597 Vps16 vacuolar protein sorting 16 (yeast) 1.23 0.004 Mm.276092 Cideb cell death-inducing DNA fragmentation factor, alpha subunit-like effector B 1.16 0.004 Mm.10737 1500016H10Rik RIKEN cDNA 1500016H10 gene 0.79 0.004 Mm.218533 2610318G08Rik RIKEN cDNA 2610318G08 gene 0.77 0.004 Mm.257762 5730427N09Rik RIKEN cDNA 5730427N09 gene 0.77 0.004 Mm.328904 Gpiap1 GPI-anchored membrane protein 1 0.74 0.004 Mm.254134 2310061N23Rik RIKEN cDNA 2310061N23 gene 0.55 0.004 Mm.271275 Tnfrsf6 tumor necrosis factor receptor superfamily, member 6 0.84 0.004 Mm.1626 Fgg fibrinogen, gamma polypeptide 0.77 0.004 Mm.16422 5430411K16Rik RIKEN cDNA 5430411K16 gene 0.75 0.004 Mm.22315 Brd8 bromodomain containing 8 1.18 0.004 Mm.45602 Mic2l1 MIC2 (monoclonal Imperial Cancer Research Fund 2)-like 1 1.18 0.004 Mm.283879 Ptpn1 protein tyrosine phosphatase, non-receptor type 1 0.78 0.004 Mm.277916 Tk2 thymidine kinase 2, mitochondrial 1.16 0.004 Mm.183110 2810406C15Rik RIKEN cDNA 2810406C15 gene 0.76 0.004 Mm.257590 Enpep glutamyl aminopeptidase 1.84 0.004 Mm.1193

211 Nab1 Ngfi-A binding protein 1 0.83 0.004 Mm.25903 Map2k5 mitogen activated protein kinase kinase 5 1.20 0.004 Mm.192651 Tcp10b t-complex protein 10b 1.18 0.004 Mm.212785 Tnf tumor necrosis factor 1.16 0.004 Mm.1293 3010020C06 hypothetical protein 3010020C06 1.49 0.004 Mm.249594 Slc6a9 solute carrier family 6 (neurotransmitter transporter, glycine), member 9 1.27 0.004 Mm.244549 Six5 sine oculis-related homeobox 5 homolog (Drosophila) 1.21 0.004 Mm.3410 Mttp microsomal triglyceride transfer protein 1.20 0.004 Mm.2941 Ahcyl1 S-adenosylhomocysteine hydrolase-like 1 1.19 0.004 Mm.220328 1500010J02Rik RIKEN cDNA 1500010J02 gene 1.18 0.004 Mm.285785 Kptn kaptin 1.17 0.004 Mm.41101 Dnajc8 DnaJ (Hsp40) homolog, subfamily C, member 8 1.15 0.004 Mm.29685 C81234 expressed sequence C81234 1.45 0.004 Mm.6055 Olfr73 olfactory receptor 73 1.26 0.004 Mm.196680 Scgb3a2 secretoglobin, family 3A, member 2 1.16 0.004 Mm.210437 Flot1 flotillin 1 0.83 0.004 Mm.2931 S100a6 S100 calcium binding protein A6 (calcyclin) 0.71 0.004 Mm.100144 6330580J24Rik RIKEN cDNA 6330580J24 gene 1.30 0.004 Mm.193395 Diap3 diaphanous homolog 3 (Drosophila) 0.86 0.004 Mm.28068 Cd1d2 CD1d2 antigen 1.18 0.004 Mm.157907 Gprin1 G protein-regulated inducer of neurite outgrowth 1 1.27 0.004 Mm.41812 Hmbs hydroxymethylbilane synthase 0.84 0.004 Mm.247676 Nupl1 nucleoporin like 1 0.78 0.004 Mm.258051 Rab5c RAB5C, member RAS oncogene family 0.66 0.004 Mm.29829 Jmj jumonji 1.25 0.004 Mm.25059 2010001C09Rik RIKEN cDNA 2010001C09 gene 1.22 0.004 Mm.35718 Stx8 syntaxin 8 1.16 0.004 Mm.3973 Lman2 lectin, mannose-binding 2 0.82 0.004 Mm.38868 Il18bp interleukin 18 binding protein 0.76 0.004 Mm.45579 Zfp161 zinc finger protein 161 1.26 0.004 Mm.29434 2810438M17Rik RIKEN cDNA 2810438M17 gene 1.23 0.004 Mm.127014 1-acylglycerol-3-phosphate O-acyltransferase 1 (lysophosphatidic acid Agpat1 acyltransferase, alpha) 0.81 0.004 Mm.8684 3110038B19Rik RIKEN cDNA 3110038B19 gene 0.76 0.004 Mm.29889 Tbce tubulin-specific chaperone e 1.18 0.004 Mm.260209 2410003A14Rik RIKEN cDNA 2410003A14 gene 1.29 0.004 Mm.21714 Pcca propionyl-Coenzyme A carboxylase, alpha polypeptide 1.26 0.004 Mm.23876 Rdh13 retinol dehydrogenase 13 (all-trans and 9-cis) 1.19 0.004 Mm.1627 2310016N05Rik RIKEN cDNA 2310016N05 gene 0.67 0.004 Mm.200383 Ing1 inhibitor of growth family, member 1 1.19 0.004 Mm.25709 Mds1 myelodysplasia syndrome 1 homolog (human) 1.26 0.004 Mm.42023 0610037P05Rik RIKEN cDNA 0610037P05 gene 1.16 0.004 Mm.290826 1110061A19Rik RIKEN cDNA 1110061A19 gene 0.79 0.004 Mm.28121 1110049F12Rik RIKEN cDNA 1110049F12 gene 1.22 0.004 Mm.29131 4930579C15Rik RIKEN cDNA 4930579C15 gene 1.17 0.004 Mm.25097 Scd2 stearoyl-Coenzyme A desaturase 2 0.71 0.004 Mm.193096 Pla2g6 phospholipase A2, group VI 1.20 0.004 Mm.155620 Eef1a2 eukaryotic translation elongation factor 1 alpha 2 1.19 0.004 Mm.212612 2600009E05Rik RIKEN cDNA 2600009E05 gene 1.27 0.004 Mm.188669 Kcnh2 potassium voltage-gated channel, subfamily H (eag-related), member 2 1.22 0.004 Mm.6539 Pcdhb12 protocadherin beta 12 1.21 0.004 Mm.196701 1110015E18Rik RIKEN cDNA 1110015E18 gene 1.21 0.004 Mm.27844 Vav3 vav 3 oncogene 1.17 0.004 Mm.282257 6330581L23Rik RIKEN cDNA 6330581L23 gene 0.79 0.004 Mm.224766 Pafah1b2 platelet-activating factor acetylhydrolase, isoform 1b, alpha2 subunit 0.80 0.004 Mm.200859 Fkbp5 FK506 binding protein 5 0.48 0.004 Mm.276405 Gmnn geminin 1.27 0.004 Mm.12239 Apg10l autophagy 10-like (S. cerevisiae) 1.20 0.004 Mm.111702 Tep1 telomerase associated protein 1 0.82 0.004 Mm.152812 Dicer1 Dicer1, Dcr-1 homolog (Drosophila) 1.23 0.004 Mm.21135 MGC30332 hypothetical protein MGC30332 1.19 0.004 Mm.297149 2610014F08Rik RIKEN cDNA 2610014F08 gene 1.19 0.004 Mm.288734 6330406L22Rik RIKEN cDNA 6330406L22 gene 1.20 0.004 Mm.243954 2310009E04Rik RIKEN cDNA 2310009E04 gene 0.84 0.004 Mm.276098 Rad52 RAD52 homolog (S. cerevisiae) 1.23 0.005 Mm.149 Ubtf upstream binding transcription factor, RNA polymerase I 1.18 0.005 Mm.2845 Ppap2a phosphatidic acid phosphatase 2a 0.77 0.005 Mm.276039 2810417H13Rik RIKEN cDNA 2810417H13 gene 0.72 0.005 Mm.269025 Ing1l inhibitor of growth family, member 1-like 1.22 0.005 Mm.272313 Bub1b budding uninhibited by benzimidazoles 1 homolog, beta (S. cerevisiae) 0.83 0.005 Mm.29133 Ddx25 DEAD (Asp-Glu-Ala-Asp) box polypeptide 25 1.19 0.005 Mm.291723 Gstk1 glutathione S-transferase kappa 1 1.29 0.005 Mm.267014 Strc stereocilin 1.22 0.005 Mm.261637 Sec61a2 Sec61, alpha subunit 2 (S. cerevisiae) 1.16 0.005 Mm.21435

212 Nmnat NMN adenylyltransferase; nicotinamide mononucleotide adenylyl transferase 1.13 0.005 Mm.76062 Sirt3 sirtuin 3 (silent mating type information regulation 2, homolog) 3 (S. cerevisiae) 1.20 0.005 Mm.244216 Preb prolactin regulatory element binding 1.14 0.005 Mm.15928 Calml4 calmodulin-like 4 1.42 0.005 Mm.28623 Gcl germ cell-less homolog (Drosophila) 1.19 0.005 Mm.74594 1300019H17Rik RIKEN cDNA 1300019H17 gene 1.19 0.005 Mm.272468 2310004L02Rik RIKEN cDNA 2310004L02 gene 1.19 0.005 Mm.285170 Nr2f1 nuclear receptor subfamily 2, group F, member 1 0.85 0.005 Mm.14297 Rhpn2 rhophilin, Rho GTPase binding protein 2 1.16 0.005 Mm.286600 Hoxb1 homeo box B1 1.28 0.005 Mm.890 Ccr3 chemokine (C-C) receptor 3 1.19 0.005 Mm.57050 Crsp9 cofactor required for Sp1 transcriptional activation, subunit 9, 33kDa 0.81 0.005 Mm.24159 D7Wsu180e DNA segment, Chr 7, Wayne State University 180, expressed 1.20 0.005 Mm.27853 2410042D21Rik RIKEN cDNA 2410042D21 gene 0.82 0.005 Mm.46449 AI646725 expressed sequence AI646725 1.25 0.005 Mm.31345 Gspt2 G1 to phase transition 2 1.23 0.005 Mm.20826 Ypel1 yippee-like 1 (Drosophila) 1.20 0.005 Mm.237941 1810015P03Rik RIKEN cDNA 1810015P03 gene 1.19 0.005 Mm.23032 Atp6v0c ATPase, H+ transporting, V0 subunit C 0.84 0.005 Mm.30155 Tgfb1 transforming growth factor, beta 1 0.78 0.005 Mm.9154 Hrg histidine-rich glycoprotein 0.81 0.005 Mm.2160 1810018L05Rik RIKEN cDNA 1810018L05 gene 0.79 0.005 Mm.28236 Casp12 caspase 12 0.79 0.005 Mm.42163 Kcnh1 potassium voltage-gated channel, subfamily H (eag-related), member 1 0.81 0.005 Mm.4489 Tff2 trefoil factor 2 (spasmolytic protein 1) 0.76 0.005 Mm.1825 Thap11 THAP domain containing 11 1.22 0.005 Mm.286598 Gtf2i general transcription factor II I 1.28 0.005 Mm.293003 Sbds Shwachman-Bodian-Diamond syndrome homolog (human) 1.17 0.005 Mm.280484 1110017C15Rik RIKEN cDNA 1110017C15 gene 0.76 0.005 Mm.28053 Rbms2 RNA binding motif, single stranded interacting protein 2 1.19 0.005 Mm.42247 Sdccag33l serologically defined colon cancer antigen 33 like 1.18 0.005 Mm.276510 Dffb DNA fragmentation factor, beta subunit 1.16 0.005 Mm.86386 Rab20 RAB20, member RAS oncogene family 0.71 0.005 Mm.234262 Cacna2d1 calcium channel, voltage-dependent, alpha2/delta subunit 1 0.84 0.005 Mm.30841 5730536A07Rik RIKEN cDNA 5730536A07 gene 0.74 0.005 Mm.27107 Tacr3 tachykinin receptor 3 1.22 0.005 Mm.103810 Kifc2 kinesin family member C2 1.23 0.005 Mm.247752 Nup210 nucleoporin 210 1.39 0.005 Mm.28162 Thbs3 thrombospondin 3 1.70 0.005 Mm.2114 Slfn2 schlafen 2 0.71 0.005 Mm.278689 Tde1 tumor differentially expressed 1 0.86 0.005 Mm.4962 Rap2c RAP2C, member of RAS oncogene family 0.83 0.005 Mm.43152 6330407G04Rik RIKEN cDNA 6330407G04 gene 1.25 0.005 Mm.159637 Zfp207 zinc finger protein 207 1.18 0.005 Mm.102253 V3R4 pheromone receptor V3R4 1.20 0.005 Mm.261621 Sprr1b small proline-rich protein 1B 1.31 0.005 Mm.140151 Zfp42 zinc finger protein 42 1.14 0.005 Mm.285848 Lgals3 lectin, galactose binding, soluble 3 0.78 0.005 Mm.248615 1500035H01Rik RIKEN cDNA 1500035H01 gene 1.16 0.005 Mm.278597 Hars2 histidyl tRNA synthetase 2 1.15 0.005 Mm.28109 1810009N02Rik RIKEN cDNA 1810009N02 gene 1.14 0.005 Mm.31229 Statip1 signal transducer and activator of transcription interacting protein 1 1.22 0.005 Mm.25298 Nphp1 nephronophthisis 1 (juvenile) homolog (human) 0.82 0.005 Mm.210766 1110001N06Rik RIKEN cDNA 1110001N06 gene 1.14 0.005 Mm.277705 Birc5 baculoviral IAP repeat-containing 5 0.67 0.005 Mm.8552 E030006K04Rik RIKEN cDNA E030006K04 gene 1.34 0.005 Mm.247642 2310007D03Rik RIKEN cDNA 2310007D03 gene 0.83 0.005 Mm.256107 Oas3 2'-5' oligoadenylate synthetase 3 0.78 0.005 Mm.204887 Sh2d3c SH2 domain containing 3C 1.24 0.005 Mm.9593 AI854876 expressed sequence AI854876 1.16 0.005 Mm.266301 2610208E05Rik RIKEN cDNA 2610208E05 gene 1.27 0.005 Mm.1182 Nr1h2 nuclear receptor subfamily 1, group H, member 2 1.18 0.005 Mm.968 Nssr neural-salient serine/arginine-rich 1.28 0.005 Mm.10229 Arf6 ADP-ribosylation factor 6 1.18 0.005 Mm.318195 Cnnm3 cyclin M3 1.17 0.005 Mm.256323 Capzb capping protein (actin filament) muscle Z-line, beta 0.86 0.005 Mm.2945 B130024L21Rik RIKEN cDNA B130024L21 gene 0.84 0.005 Mm.1960 E030041M21Rik RIKEN cDNA E030041M21 gene 0.82 0.005 Mm.268922 Rgs11 regulator of G-protein signaling 11 1.30 0.005 Mm.109840 Ndufs1 NADH dehydrogenase (ubiquinone) Fe-S protein 1 1.20 0.005 Mm.290791 Ccna2 cyclin A2 0.75 0.005 Mm.4189 BC033609 cDNA sequence BC033609 0.77 0.005 Mm.3224 Junb Jun-B oncogene 0.70 0.005 Mm.1167 AI836256 expressed sequence AI836256 1.27 0.005 Mm.24115

213 Tnfrsf11b tumor necrosis factor receptor superfamily, member 11b (osteoprotegerin) 0.87 0.005 Mm.15383 Hoxa13 homeo box A13 1.19 0.005 Mm.298143 9930104E21Rik RIKEN cDNA 9930104E21 gene 0.84 0.005 Mm.154275 Car11 carbonic anhydrase 11 1.20 0.005 Mm.298093 Pcnxl3 pecanex-like 3 (Drosophila) 1.18 0.005 Mm.28338 Ppat phosphoribosyl pyrophosphate amidotransferase 1.17 0.005 Mm.202337 Gsk3b glycogen synthase kinase 3 beta 0.71 0.005 Mm.200770 AW123240 expressed sequence AW123240 1.23 0.005 Mm.146001 Chst7 carbohydrate (N-acetylglucosamino) sulfotransferase 7 1.22 0.005 Mm.44827 Dci dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenyme A isomerase) 1.22 0.005 Mm.291743 Cugbp1 CUG triplet repeat, RNA binding protein 1 0.84 0.005 Mm.29495 Stx18 syntaxin 18 0.82 0.005 Mm.18959 AF013969 expressed sequence AF013969 1.22 0.005 Mm.158726 Cct6b chaperonin subunit 6b (zeta) 1.25 0.005 Mm.4126 Pdxk pyridoxal (pyridoxine, vitamin B6) kinase 1.28 0.005 Mm.260578 Wnt3a wingless-related MMTV integration site 3A 1.21 0.005 Mm.1367 D730049H07Rik RIKEN cDNA D730049H07 gene 0.80 0.005 Mm.218582 Gjb6 gap junction membrane channel protein beta 6 1.33 0.005 Mm.25652 D6Wsu176e DNA segment, Chr 6, Wayne State University 176, expressed 0.85 0.005 Mm.258484 Crb3 crumbs homolog 3 (Drosophila) 1.23 0.005 Mm.260076 6330500D04Rik RIKEN cDNA 6330500D04 gene 1.27 0.005 Mm.217261 6030404E16Rik RIKEN cDNA 6030404E16 gene 1.18 0.005 Mm.38312 Scmh1 sex comb on midleg homolog 1 1.17 0.005 Mm.208924 Spg20 spastic paraplegia 20, spartin (Troyer syndrome) homolog (human) 0.81 0.005 Mm.235523 Tmeff2 transmembrane protein with EGF-like and two follistatin-like domains 2 1.21 0.005 Mm.23304 4930522D07Rik RIKEN cDNA 4930522D07 gene 1.14 0.005 Mm.55982 Golph3 golgi phosphoprotein 3 0.87 0.005 Mm.250936 Zfp313 zinc finger protein 313 1.29 0.005 Mm.22225 Sh3bp4 SH3-domain binding protein 4 1.19 0.005 Mm.170983 Zfp339 zinc finger protein 339 1.19 0.005 Mm.252750 Stac src homology three (SH3) and cysteine rich domain 1.16 0.005 Mm.1414 Casp4 caspase 4, apoptosis-related cysteine protease 0.83 0.005 Mm.1569 Ogg1 8-oxoguanine DNA-glycosylase 1 1.23 0.005 Mm.43612 1810003N24Rik RIKEN cDNA 1810003N24 gene 0.74 0.005 Mm.27831 2610511E03Rik RIKEN cDNA 2610511E03 gene 1.22 0.005 Mm.210048 4930449E07Rik RIKEN cDNA 4930449E07 gene 0.83 0.005 Mm.133570 Pum1 pumilio 1 (Drosophila) 0.64 0.005 Mm.34701 2410007P03Rik RIKEN cDNA 2410007P03 gene 1.24 0.005 Mm.221900 Kcne2 potassium voltage-gated channel, Isk-related subfamily, gene 2 1.48 0.005 Mm.156736 AI842353 expressed sequence AI842353 1.19 0.005 Mm.24417 Hebp2 heme binding protein 2 1.18 0.005 Mm.35551 Gna11 guanine nucleotide binding protein, alpha 11 1.35 0.005 Mm.260925 Zdhhc3 zinc finger, DHHC domain containing 3 1.30 0.005 Mm.28300 DXImx46e DNA segment, Chr X, Immunex 46, expressed 1.17 0.005 Mm.142827 Zfp2 zinc finger protein 2 1.17 0.005 Mm.259230 Slc26a3 solute carrier family 26, member 3 1.17 0.005 Mm.283281 2310067G05Rik RIKEN cDNA 2310067G05 gene 1.38 0.005 Mm.301312 A030005L19Rik RIKEN cDNA A030005L19 gene 1.30 0.005 Mm.160024 2610034N03Rik RIKEN cDNA 2610034N03 gene 0.82 0.005 Mm.182574 Mpp6 membrane protein, palmitoylated 6 (MAGUK p55 subfamily member 6) 0.68 0.005 Mm.41288 E130307D12 hypothetical protein E130307D12 1.22 0.005 Mm.255066 Slc4a1 solute carrier family 4 (anion exchanger), member 1 1.66 0.005 Mm.7248 Pte1 peroxisomal acyl-CoA thioesterase 1 1.17 0.005 Mm.277878 Myh9 myosin heavy chain IX 0.58 0.005 Mm.29677 Eraf erythroid associated factor 1.61 0.005 Mm.218857 Uba52 ubiquitin A-52 residue ribosomal protein fusion product 1 1.21 0.005 Mm.43005 Mgst1 microsomal glutathione S-transferase 1 1.20 0.005 Mm.14796 Siat9 sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase) 1.19 0.005 Mm.38248 D4Bwg1540e DNA segment, Chr 4, Brigham & Women's Genetics 1540 expressed 1.18 0.005 Mm.141307 Oas2 2'-5' oligoadenylate synthetase 2 0.80 0.005 Mm.260926 0610041O14Rik RIKEN cDNA 0610041O14 gene 1.20 0.005 Mm.23739 C5r1 complement component 5, receptor 1 0.76 0.005 Mm.137488 Rdh10 retinol dehydrogenase 10 (all-trans) 1.26 0.005 Mm.274376 AW049765 expressed sequence AW049765 1.19 0.005 Mm.204991 Lass5 longevity assurance homolog 5 (S. cerevisiae) 1.15 0.005 Mm.9550 Psmc5 protease (prosome, macropain) 26S subunit, ATPase 5 0.83 0.005 Mm.272919 Vcam1 vascular cell adhesion molecule 1 0.67 0.005 Mm.76649 2610318K02Rik RIKEN cDNA 2610318K02 gene 1.19 0.006 Mm.220942 Hmgcr 3-hydroxy-3-methylglutaryl-Coenzyme A reductase 0.78 0.006 Mm.260207 Hmg20a high mobility group 20A 1.32 0.006 Mm.150856 9430079M16Rik RIKEN cDNA 9430079M16 gene 1.24 0.006 Mm.21814 Uros uroporphyrinogen III synthase 1.20 0.006 Mm.3160 A030002D08Rik RIKEN cDNA A030002D08 gene 1.19 0.006 Mm.40502 Dag1 dystroglycan 1 0.81 0.006 Mm.7524

214 Pcdhb8 protocadherin beta 8 1.25 0.006 Mm.196696 Car8 carbonic anhydrase 8 1.30 0.006 Mm.119320 Stx5a syntaxin 5A 1.16 0.006 Mm.153061 D15Wsu75e DNA segment, Chr 15, Wayne State University 75, expressed 0.84 0.006 Mm.213261 Csf1 colony stimulating factor 1 (macrophage) 0.80 0.006 Mm.795 Idh3b isocitrate dehydrogenase 3 (NAD+) beta 1.24 0.006 Mm.29590 4930586I02Rik RIKEN cDNA 4930586I02 gene 1.20 0.006 Mm.127378 Kpna1 karyopherin (importin) alpha 1 0.84 0.006 Mm.6952 Osbpl9 oxysterol binding protein-like 9 0.79 0.006 Mm.92314 Shfdg1 split hand/foot deleted gene 1 0.72 0.006 Mm.2469 Dia1 diaphorase 1 (NADH) 1.18 0.006 Mm.157635 4632412E09Rik RIKEN cDNA 4632412E09 gene 1.17 0.006 Mm.272976 Rock2 Rho-associated coiled-coil forming kinase 2 0.87 0.006 Mm.276024 Scn1b sodium channel, voltage-gated, type I, beta polypeptide 1.21 0.006 Mm.1418 UDP-N-acetyl-alpha-D-galactosamine: polypeptide N- Galnt7 acetylgalactosaminyltransferase 7 0.79 0.006 Mm.62886 Arih1 ariadne ubiquitin-conjugating enzyme E2 binding protein homolog 1 (Drosophila) 0.70 0.006 Mm.170965 Gja1 gap junction membrane channel protein alpha 1 0.67 0.006 Mm.4504 4930511I11Rik RIKEN cDNA 4930511I11 gene 1.22 0.006 Mm.46170 Rxrb retinoid X receptor beta 1.16 0.006 Mm.1243 Polr2e polymerase (RNA) II (DNA directed) polypeptide E 1.19 0.006 Mm.18579 Tce1 T-complex expressed gene 1 0.82 0.006 Mm.274794 AW610627 expressed sequence AW610627 0.78 0.006 Mm.27140 Dyrk3 dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 3 1.20 0.006 Mm.39299 Ppp2r2a protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), alpha isoform 0.83 0.006 Mm.28618 Spop speckle-type POZ protein 0.81 0.006 Mm.285454 2810047M21Rik RIKEN cDNA 2810047M21 gene 0.84 0.006 Mm.178424 E430001P04Rik RIKEN cDNA E430001P04 gene 0.80 0.006 Mm.250561 S100a8 S100 calcium binding protein A8 (calgranulin A) 1.74 0.006 Mm.21567 Pfn1 profilin 1 0.84 0.006 Mm.261818 C630004H02Rik RIKEN cDNA C630004H02 gene 1.16 0.006 Mm.205707 2810431N21Rik RIKEN cDNA 2810431N21 gene 1.17 0.006 Mm.275159 2610529I12Rik RIKEN cDNA 2610529I12 gene 1.14 0.006 Mm.29054 BC002059 cDNA sequence BC002059 1.17 0.006 Mm.255974 Cyp4f15 cytochrome P450, family 4, subfamily f, polypeptide 15 1.16 0.006 Mm.26539 Lims1 LIM and senescent cell antigen-like domains 1 0.75 0.006 Mm.57734 Eif1a eukaryotic translation initiation factor 1A 0.74 0.006 Mm.262037 Pip prolactin induced protein 1.19 0.006 Mm.214755 Cyp2d26 cytochrome P450, family 2, subfamily d, polypeptide 26 1.18 0.006 Mm.29064 Rab3c RAB3C, member RAS oncogene family 1.19 0.006 Mm.151600 Sec14l4 SEC14-like 4 (S. cerevisiae) 1.39 0.006 Mm.27333 Csf2rb2 colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage) 0.74 0.006 Mm.1940 Chi3l1 chitinase 3-like 1 2.14 0.006 Mm.38274 Cd209a CD209a antigen 1.36 0.006 Mm.32510 3732413I11Rik RIKEN cDNA 3732413I11 gene 1.28 0.006 Mm.156771 1200008A18Rik RIKEN cDNA 1200008A18 gene 1.23 0.006 Mm.27697 4833432B22Rik RIKEN cDNA 4833432B22 gene 1.22 0.006 Mm.24627 Tulp1 tubby like protein 1 1.22 0.006 Mm.42102 Foxd1 forkhead box D1 1.16 0.006 Mm.27015 Melk maternal embryonic leucine zipper kinase 0.83 0.006 Mm.268668 Tbx5 T-box 5 0.78 0.006 Mm.103636 Clca3 chloride channel calcium activated 3 0.23 0.006 Mm.33483 Ear11 eosinophil-associated ribonuclease 11 1.30 0.006 Mm.153688 C1qbp complement component 1, q subcomponent binding protein 0.80 0.006 Mm.30049 Arbp acidic ribosomal phosphoprotein P0 0.85 0.006 Mm.298083 Col10a1 procollagen, type X, alpha 1 1.24 0.006 Mm.212657 Rbmx RNA binding motif protein, X chromosome 1.20 0.006 Mm.28275 C330008I15Rik RIKEN cDNA C330008I15 gene 1.19 0.006 Mm.167232 Reg4 regenerating islet-derived family, member 4 1.17 0.006 Mm.46306 phosphoribosylaminoimidazole carboxylase, Paics phosphoribosylaminoribosylaminoimidazole, succinocarboxamide synthetase 0.79 0.006 Mm.182931 C030019F02Rik RIKEN cDNA C030019F02 gene 1.24 0.006 Mm.40361 Synj2 synaptojanin 2 1.14 0.006 Mm.236068 Mina myc induced nuclear antigen 0.79 0.006 Mm.255635 Serpinb1b serine (or cysteine) proteinase inhibitor, clade B, member 1b 1.16 0.006 Mm.92685 Sgcb sarcoglycan, beta (dystrophin-associated glycoprotein) 0.85 0.006 Mm.89310 1700001F22Rik RIKEN cDNA 1700001F22 gene 1.16 0.006 Mm.20314 Tnfaip2 tumor necrosis factor, alpha-induced protein 2 0.70 0.006 Mm.255332 Bat1a HLA-B-associated transcript 1A 1.24 0.006 Mm.126043 2610304G08Rik RIKEN cDNA 2610304G08 gene 1.22 0.006 Mm.290810 Gart phosphoribosylglycinamide formyltransferase 1.17 0.006 Mm.4505 Kdt1 kidney cell line derived transcript 1 0.83 0.006 Mm.1314 Mak male germ cell-associated kinase 1.17 0.006 Mm.8149 Uqcrc2 RIKubiquinol cytochrome c reductase core protein 2 1.19 0.006 Mm.988

215 D5Ertd689e DNA segment, Chr 5, ERATO Doi 689, expressed 1.16 0.006 Mm.249474 Fbxl8 F-box and leucine-rich repeat protein 8 1.15 0.006 Mm.33061 Sel1h Sel1 (suppressor of lin-12) 1 homolog (C. elegans) 0.77 0.006 Mm.250605 Tgoln1 trans-golgi network protein 0.52 0.006 Mm.246563 1110018J18Rik RIKEN cDNA 1110018J18 gene 1.33 0.006 Mm.227240 Dmrt2 doublesex and mab-3 related transcription factor 2 1.21 0.006 Mm.275572 Aplp2 amyloid beta (A4) precursor-like protein 2 1.14 0.006 Mm.19133 Cdh17 cadherin 17 1.27 0.006 Mm.33402 2900057C04Rik RIKEN cDNA 2900057C04 gene 1.20 0.006 Mm.297660 Epb4.2 erythrocyte protein band 4.2 1.20 0.006 Mm.240051 Syt1 synaptotagmin 1 1.19 0.006 Mm.289702 Htr2c 5-hydroxytryptamine (serotonin) receptor 2C 1.17 0.006 Mm.378 2610016C12Rik RIKEN cDNA 2610016C12 gene 0.81 0.006 Mm.41775 Srd5a2l steroid 5 alpha-reductase 2-like 0.79 0.006 Mm.289446 Ccnb1 cyclin B1 0.75 0.006 Mm.307595 Refbp1 RNA and export factor binding protein 1 0.68 0.006 Mm.1886 Extl1 exostoses (multiple)-like 1 1.21 0.006 Mm.30978 Lcn2 lipocalin 2 0.55 0.006 Mm.9537 4931426K16Rik RIKEN cDNA 4931426K16 gene 1.17 0.006 Mm.41454 Sfxn4 sideroflexin 4 1.20 0.006 Mm.48179 Akr1c13 aldo-keto reductase family 1, member C13 0.81 0.006 Mm.27447 1110036C17Rik RIKEN cDNA 1110036C17 gene 1.29 0.006 Mm.175661 2510010F15Rik RIKEN cDNA 2510010F15 gene 0.82 0.006 Mm.183368 AW049671 expressed sequence AW049671 1.27 0.006 Mm.22831 Chkl choline kinase-like 1.23 0.006 Mm.10124 Usp14 ubiquitin specific protease 14 0.82 0.006 Mm.182319 Ldh1 lactate dehydrogenase 1, A chain 0.82 0.006 Mm.29324 Actn2 actinin alpha 2 1.30 0.006 Mm.195067 Aspa aspartoacylase (aminoacylase) 2 1.23 0.006 Mm.293574 Entpd6 ectonucleoside triphosphate diphosphohydrolase 6 1.15 0.006 Mm.275524 Srp14 signal recognition particle 14 0.85 0.006 Mm.850 AA591032 expressed sequence AA591032 0.84 0.006 Mm.86564 2810439F02Rik RIKEN cDNA 2810439F02 gene 0.77 0.006 Mm.52526 Pcmt1 protein-L-isoaspartate (D-aspartate) O-methyltransferase 1 0.74 0.006 Mm.258431 Hip2 huntingtin interacting protein 2 0.84 0.006 Mm.263318 1110014H17Rik RIKEN cDNA 1110014H17 gene 1.23 0.006 Mm.200971 2610019F01Rik RIKEN cDNA 2610019F01 gene 1.14 0.006 Mm.56581 4933407C03Rik RIKEN cDNA 4933407C03 gene 0.83 0.006 Mm.233181 Grcc10 gene rich cluster, C10 gene 1.28 0.006 Mm.22195 Rnf5 ring finger protein 5 1.18 0.006 Mm.274542 Tlr5 toll-like receptor 5 1.16 0.006 Mm.116894 2810480G15Rik Riken cDNA 2810480G15 gene 0.83 0.006 Mm.40802 A230035L05Rik RIKEN cDNA A230035L05 gene 0.73 0.006 Mm.67073 Mb myoglobin 1.56 0.006 Mm.201606 Mpp4 membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4) 1.22 0.006 Mm.101838 Cckbr cholecystokinin B receptor 1.21 0.006 Mm.44513 Gtf3c1 general transcription factor III C 1 1.25 0.006 Mm.29630 Epb7.2 erythrocyte protein band 7.2 0.72 0.006 Mm.295284 Tsn translin 0.81 0.006 Mm.14644 Tktl1 transketolase-like 1 1.16 0.006 Mm.25057 Mmab methylmalonic aciduria (cobalamin deficiency) type B homolog (human) 1.19 0.006 Mm.105182 Rgnef Rho-guanine nucleotide exchange factor 1.28 0.006 Mm.252718 Resp18 regulated endocrine-specific protein 18 1.25 0.006 Mm.4032 1810004D07Rik RIKEN cDNA 1810004D07 gene 1.25 0.006 Mm.2000 AI450540 expressed sequence AI450540 0.82 0.006 Mm.245340 Igfbp2 insulin-like growth factor binding protein 2 1.42 0.006 Mm.141936 Amph amphiphysin 1.28 0.006 Mm.101650 4933425F03Rik RIKEN cDNA 4933425F03 gene 1.25 0.006 Mm.83840 BC004636 cDNA sequence BC004636 1.22 0.006 Mm.282641 G6pc-rs glucose-6-phosphatase, catalytic, related sequence 1.19 0.006 Mm.140768 Coil coilin 1.17 0.006 Mm.268004 Mtcp1 mature T-cell proliferation 1 1.16 0.006 Mm.16366 Mmd monocyte to macrophage differentiation-associated 0.85 0.006 Mm.277518 3200002M19Rik RIKEN cDNA 3200002M19 gene 0.82 0.006 Mm.284491 MGC25972 similar to cytochrome P450, 4a10 1.28 0.006 Mm.276106 Hnrpc heterogeneous nuclear ribonucleoprotein C 1.26 0.006 Mm.274690 E130012A19Rik RIKEN cDNA E130012A19 gene 1.25 0.006 Mm.24506 Mkrn2 makorin, ring finger protein, 2 1.19 0.006 Mm.177966 Prtn3 proteinase 3 1.20 0.006 Mm.2364 D2Bwg0891e DNA segment, Chr 2, Brigham & Women's Genetics 0891 expressed 1.20 0.006 Mm.195525 Tnk1 tyrosine kinase, non-receptor, 1 1.16 0.006 Mm.275935 Ppgb protective protein for beta-galactosidase 0.78 0.006 Mm.7046 BC019794 cDNA sequence BC019794 1.24 0.006 Mm.51437 Dctn4 dynactin 4 1.18 0.006 Mm.256520

216 Zfp352 zinc finger protein 352 1.15 0.006 Mm.214642 2610029K21Rik RIKEN cDNA 2610029K21 gene 0.84 0.006 Mm.46029 Mat2a methionine adenosyltransferase II, alpha 0.79 0.006 Mm.29815 BC032204 cDNA sequence BC032204 0.73 0.006 Mm.157591 Adm adrenomedullin 0.55 0.006 Mm.1408 1200014M14Rik RIKEN cDNA 1200014M14 gene 1.24 0.006 Mm.86472 C87436 expressed sequence C87436 1.16 0.006 Mm.290632 Abcb4 ATP-binding cassette, sub-family B (MDR/TAP), member 4 1.18 0.007 Mm.14172 Cyp1a1 cytochrome P450, family 1, subfamily a, polypeptide 1 1.33 0.007 Mm.14089 Cbr1 carbonyl reductase 1 1.20 0.007 Mm.26940 4933415F23Rik RIKEN cDNA 4933415F23 gene 1.20 0.007 Mm.46142 1110025I09Rik RIKEN cDNA 1110025I09 gene 1.17 0.007 Mm.35127 S3-12 plasma membrane associated protein, S3-12 1.17 0.007 Mm.12966 Fxyd2 FXYD domain-containing ion transport regulator 2 1.16 0.007 Mm.22742 Cd79a CD79A antigen (immunoglobulin-associated alpha) 1.52 0.007 Mm.1355 hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl- Hadhb Coenzyme A hydratase (trifunctional protein), beta subunit 1.20 0.007 Mm.291463 6330407P03Rik RIKEN cDNA 6330407P03 gene 1.19 0.007 Mm.259170 Appbp2 amyloid beta precursor protein (cytoplasmic tail) binding protein 2 0.82 0.007 Mm.271997 Sca10 spinocerebellar ataxia 10 homolog (human) 1.16 0.007 Mm.248906 Eif5a eukaryotic translation initiation factor 5A 0.83 0.007 Mm.196607 Rex2 reduced expression 2 1.17 0.007 Mm.303599 Ets1 E26 avian leukemia oncogene 1, 5' domain 1.39 0.007 Mm.292415 Slco2a1 solute carrier organic anion transporter family, member 2a1 0.79 0.007 Mm.207106 Mapk10 mitogen activated protein kinase 10 1.17 0.007 Mm.299388 1110013G13Rik RIKEN cDNA 1110013G13 gene 1.19 0.007 Mm.210305 Lmyc1 lung carcinoma myc related oncogene 1 1.17 0.007 Mm.1055 Hic1 hypermethylated in cancer 1 0.85 0.007 Mm.57250 Gtl6 gene trap locus 6 0.77 0.007 Mm.209265 1810007E14Rik RIKEN cDNA 1810007E14 gene 0.77 0.007 Mm.36777 2610301I15Rik RIKEN cDNA 2610301I15 gene 0.88 0.007 Mm.289248 Aip aryl-hydrocarbon receptor-interacting protein 1.22 0.007 Mm.10433 2400001E08Rik RIKEN cDNA 2400001E08 gene 0.84 0.007 Mm.30003 Zfp119 zinc finger protein 119 1.16 0.007 Mm.296953 Trpm7 transient receptor potential cation channel, subfamily M, member 7 0.80 0.007 Mm.244705 Kif2c kinesin family member 2C 0.86 0.007 Mm.247651 5430405G24Rik RIKEN cDNA 5430405G24 gene 0.85 0.007 Mm.260282 Ndufab1 NADH dehydrogenase (ubiquinone) 1, alpha/beta subcomplex, 1 0.80 0.007 Mm.3014 Pamci peptidylglycine alpha-amidating monooxygenase COOH-terminal interactor 1.21 0.007 Mm.282672 2310038H17Rik RIKEN cDNA 2310038H17 gene 1.19 0.007 Mm.46394 Abcc6 ATP-binding cassette, sub-family C (CFTR/MRP), member 6 1.22 0.007 Mm.63514 Atp6v1g1 ATPase, H+ transporting, V1 subunit G isoform 1 0.79 0.007 Mm.29868 2410030A14Rik RIKEN cDNA 2410030A14 gene 1.20 0.007 Mm.289669 1700019G17Rik RIKEN cDNA 1700019G17 gene 1.14 0.007 Mm.24454 1110020B03Rik RIKEN cDNA 1110020B03 gene 1.24 0.007 Mm.253151 Tpcn2 two pore segment channel 2 0.79 0.007 Mm.102235 Ros1 Ros1 proto-oncogene 1.20 0.007 Mm.4155 Cd209c CD209c antigen 1.21 0.007 Mm.215729 Tnfsf5 tumor necrosis factor (ligand) superfamily, member 5 1.17 0.007 Mm.4861 D19Bwg1357e DNA segment, Chr 19, Brigham & Women's Genetics 1357 expressed 0.83 0.007 Mm.261027 Bing4 BING4 protein 1.16 0.007 Mm.2437 Zfp64 zinc finger protein 64 1.16 0.007 Mm.2095 Klrc1 killer cell lectin-like receptor subfamily C, member 1 1.15 0.007 Mm.56899 Rpl13a ribosomal protein L13a 0.72 0.007 Mm.180458 Prss25 protease, serine, 25 1.22 0.007 Mm.21880 AW125391 expressed sequence AW125391 1.17 0.007 Mm.271296 2310067B10Rik RIKEN cDNA 2310067B10 gene 1.15 0.007 Mm.23168 Mrp63 mitochondrial ribosomal protein 63 1.14 0.007 Mm.30173 Spn sialophorin 1.20 0.007 Mm.87180 Eda ectodysplasin-A 1.17 0.007 Mm.6258 Baiap1 BAI1-associated protein 1 1.15 0.007 Mm.285284 Klk9 kallikrein 9 1.17 0.007 Mm.5193 0610042I15Rik RIKEN cDNA 0610042I15 gene 0.86 0.007 Mm.294821 Hpcal1 hippocalcin-like 1 1.15 0.007 Mm.20937 hr hairless 1.26 0.007 Mm.7598 2700084A09Rik RIKEN cDNA 2700084A09 gene 1.19 0.007 Mm.274120 Rfx2 regulatory factor X, 2 (influences HLA class II expression) 1.17 0.007 Mm.102 Nfia nuclear factor I/A 0.80 0.007 Mm.227856 2410003C09Rik RIKEN cDNA 2410003C09 gene 0.76 0.007 Mm.251199 Tm4sf1 transmembrane 4 superfamily member 1 1.24 0.007 Mm.856 2810452K22Rik RIKEN cDNA 2810452K22 gene 1.23 0.007 Mm.287157 Ap2a2 adaptor protein complex AP-2, alpha 2 subunit 0.77 0.007 Mm.253090 Cybb cytochrome b-245, beta polypeptide 0.57 0.007 Mm.200362 Glcci1 glucocorticoid induced transcript 1 1.25 0.007 Mm.27320

217 Insrr insulin receptor-related receptor 1.19 0.007 Mm.42041 Tnip1 TNFAIP3 interacting protein 1 1.15 0.007 Mm.259671 Gba glucosidase, beta; acid 0.81 0.007 Mm.5031 Cbx3 chromobox homolog 3 (Drosophila HP1 gamma) 1.17 0.007 Mm.280968 Ptrf polymerase I and transcript release factor 2.25 0.007 Mm.8009 Alox5ap arachidonate 5-lipoxygenase activating protein 0.79 0.007 Mm.19844 Pja2 praja 2, RING-H2 motif containing 0.82 0.007 Mm.41711 D10Wsu93e DNA segment, Chr 10, Wayne State University 93, expressed 1.26 0.007 Mm.27443 Cma2 chymase 2, mast cell 1.13 0.007 Mm.87865 D1Bwg0491e DNA segment, Chr 1, Brigham & Women's Genetics 0491 expressed 0.82 0.007 Mm.186943 Gspt1 G1 to phase transition 1 0.74 0.007 Mm.20925 Alb1 albumin 1 1.20 0.007 Mm.16773 Mc7 brain cDNA 7 1.19 0.007 Mm.103583 Catsper2 cation channel, sperm associated 2 1.19 0.007 Mm.271895 Srpk2 serine/arginine-rich protein specific kinase 2 0.80 0.007 Mm.8709 Dnmt3a DNA methyltransferase 3A 0.78 0.007 Mm.5001 Eea1 early endosome antigen 1 0.85 0.007 Mm.210035 Kif2a kinesin family member 2A 0.84 0.007 Mm.246666 MGC39058 hypothetical protein MGC39058 1.19 0.007 Mm.168530 Prlpb prolactin-like protein B 1.17 0.007 Mm.7512 V1rb9 vomeronasal 1 receptor, B9 1.21 0.007 Mm.298062 Pdpk1 3-phosphoinositide dependent protein kinase-1 0.81 0.007 Mm.10504 Tnfsf9 tumor necrosis factor (ligand) superfamily, member 9 0.77 0.007 Mm.41171 Btc betacellulin, epidermal growth factor family member 1.21 0.007 Mm.2024 A830006N08 hypothetical protein A830006N08 1.12 0.007 Mm.145208 4732466D17Rik RIKEN cDNA 4732466D17 gene 1.27 0.007 Mm.23844 1700060H10Rik RIKEN cDNA 1700060H10 gene 1.26 0.007 Mm.245111 Ela2 elastase 2 1.18 0.007 Mm.21925 D3Ertd330e DNA segment, Chr 3, ERATO Doi 330, expressed 0.78 0.007 Mm.278922 1110063F24Rik RIKEN cDNA 1110063F24 gene 1.17 0.007 Mm.17918 2900026H06Rik RIKEN cDNA 2900026H06 gene 1.14 0.007 Mm.259912 Copg coatomer protein complex, subunit gamma 0.86 0.007 Mm.295612 Psme3 proteaseome (prosome, macropain) 28 subunit, 3 1.15 0.007 Mm.288477 Gm2a GM2 ganglioside activator protein 0.70 0.007 Mm.287807 1500004O14Rik RIKEN cDNA 1500004O14 gene 1.17 0.007 Mm.291792 D3Ucla1 DNA segment, Chr 3, University of California at Los Angeles 1 0.78 0.007 Mm.29702 B430110G05Rik RIKEN cDNA B430110G05 gene 1.17 0.007 Mm.288417 2310036D22Rik RIKEN cDNA 2310036D22 gene 0.77 0.007 Mm.27742 Haao 3-hydroxyanthranilate 3,4-dioxygenase 1.21 0.008 Mm.30100 Nr1i3 nuclear receptor subfamily 1, group I, member 3 1.20 0.008 Mm.3077 Pmm1 phosphomannomutase 1 0.82 0.008 Mm.18939 2600014M03Rik RIKEN cDNA 2600014M03 gene 0.82 0.008 Mm.254988 Tegt testis enhanced gene transcript 1.19 0.008 Mm.102104 1200015A19Rik RIKEN cDNA 1200015A19 gene 1.20 0.008 Mm.288737 Fcna ficolin A 0.62 0.008 Mm.10510 Pdap1 PDGFA associated protein 1 0.61 0.008 Mm.188851 Arl4 ADP-ribosylation factor-like 4 1.24 0.008 Mm.12723 Cbs cystathionine beta-synthase 1.17 0.008 Mm.206417 Mylip myosin regulatory light chain interacting protein 0.82 0.008 Mm.212855 Son Son cell proliferation protein 1.25 0.008 Mm.46401 Vcp valosin containing protein 1.22 0.008 Mm.262053 0610012D09Rik RIKEN cDNA 0610012D09 gene 0.77 0.008 Mm.29122 Pgf placental growth factor 0.77 0.008 Mm.4809 Usp21 ubiquitin specific protease 21 1.26 0.008 Mm.287370 BC027231 cDNA sequence BC027231 0.84 0.008 Mm.34520 Nfkbib nuclear factor of kappa light chain gene enhancer in B-cells inhibitor, beta 0.79 0.008 Mm.364 Fgd6 FYVE, RhoGEF and PH domain containing 6 1.18 0.008 Mm.269596 2810405I11Rik RIKEN cDNA 2810405I11 gene 0.77 0.008 Mm.73777 Pald paladin 1.22 0.008 Mm.269699 E430007K15Rik RIKEN cDNA E430007K15 gene 0.80 0.008 Mm.273990 Mapk8ip2 mitogen-activated protein kinase 8 interacting protein 2 1.24 0.008 Mm.257154 2210023K21Rik RIKEN cDNA 2210023K21 gene 0.82 0.008 Mm.28890 Tiam1 T-cell lymphoma invasion and metastasis 1 0.76 0.008 Mm.124100 Asb11 ankyrin repeat and SOCS box-containing protein 11 1.21 0.008 Mm.33225 Vamp1 vesicle-associated membrane protein 1 1.18 0.008 Mm.32321 BC017607 cDNA sequence BC017607 1.16 0.008 Mm.27567 Gcst galactosylceramide sulfotransferase 1.20 0.008 Mm.103414 2410030J07Rik RIKEN cDNA 2410030J07 gene 0.83 0.008 Mm.26542 1200008D14Rik RIKEN cDNA 1200008D14 gene 1.28 0.008 Mm.2252 Myo1c myosin IC 1.21 0.008 Mm.234502 Usp11 ubiquitin specific protease 11 1.17 0.008 Mm.34489 2810441O16Rik RIKEN cDNA 2810441O16 gene 0.83 0.008 Mm.288565 Eya4 eyes absent 4 homolog (Drosophila) 1.16 0.008 Mm.186161 Prdx5 peroxiredoxin 5 0.78 0.008 Mm.279782

218 Rims2 regulating synaptic membrane exocytosis 2 1.16 0.008 Mm.125521 Np95 nuclear protein 95 0.82 0.008 Mm.42196 Cth cystathionase (cystathionine gamma-lyase) 1.24 0.008 Mm.28301 Dusp3 dual specificity phosphatase 3 (vaccinia virus phosphatase VH1-related) 1.18 0.008 Mm.196295 Bcr breakpoint cluster region homolog 0.85 0.008 Mm.182202 Slc22a3 solute carrier family 22 (organic cation transporter), member 3 1.23 0.008 Mm.99252 Aqp8 aquaporin 8 1.19 0.008 Mm.273175 5830462I21Rik RIKEN cDNA 5830462I21 gene 1.19 0.008 Mm.256368 8430432M10Rik RIKEN cDNA 8430432M10 gene 1.17 0.008 Mm.273594 Fer1l3 fer-1-like 3, myoferlin (C. elegans) 0.81 0.008 Mm.34674 Pls3 plastin 3 (T-isoform) 0.78 0.008 Mm.28777 2210023F24Rik RIKEN cDNA 2210023F24 gene 1.16 0.008 Mm.5510 Ap2s1 adaptor-related protein complex 2, sigma 1 subunit 0.75 0.008 Mm.27272 Guca1b guanylate cyclase activator 1B 1.19 0.008 Mm.59151 Slc13a3 solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3 0.84 0.008 Mm.250738 4932416A11Rik RIKEN cDNA 4932416A11 gene 0.81 0.008 Mm.26515 Car2 carbonic anhydrase 2 1.21 0.008 Mm.1186 Wdr23 WD repeat domain 23 1.20 0.008 Mm.127974 Areg amphiregulin 0.70 0.008 Mm.8039 Macf1 microtubule-actin crosslinking factor 1 1.40 0.008 Mm.3350 Wnt7b wingless-related MMTV integration site 7B 0.79 0.008 Mm.4092 Tbca tubulin cofactor a 0.71 0.008 Mm.290290 Ptprm protein tyrosine phosphatase, receptor type, M 1.32 0.008 Mm.243935 Ndufa4 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 4 1.24 0.008 Mm.41926 4122402O22Rik RIKEN cDNA 4122402O22 gene 1.21 0.008 Mm.34659 Ndufb8 NADH dehydrogenase (ubiquinone) 1 beta subcomplex 8 0.82 0.008 Mm.2060 Gch GTP cyclohydrolase 1 0.80 0.008 Mm.10651 Klk5 kallikrein 5 1.37 0.008 Mm.30375 F2 coagulation factor II 1.26 0.008 Mm.89048 Cyba cytochrome b-245, alpha polypeptide 0.82 0.008 Mm.271671 Ifna2 interferon alpha family, gene 2 1.24 0.008 Mm.14091 Stau1 staufen (RNA binding protein) homolog 1 (Drosophila) 1.17 0.008 Mm.73276 Lamb1-1 laminin B1 subunit 1 0.74 0.008 Mm.172674 AI159731 expressed sequence AI159731 1.30 0.008 Mm.26630 Astn2 astrotactin 2 1.17 0.008 Mm.116695 Ltbr lymphotoxin B receptor 0.81 0.008 Mm.3122 D330025I23Rik RIKEN cDNA D330025I23 gene 1.26 0.008 Mm.270598 Dvl2 dishevelled 2, dsh homolog (Drosophila) 1.18 0.008 Mm.5114 D330037A14Rik RIKEN cDNA D330037A14 gene 1.15 0.008 Mm.28639 Stag1 stromal antigen 1 0.85 0.008 Mm.42135 4933402K10Rik RIKEN cDNA 4933402K10 gene 1.24 0.008 Mm.282074 Cyp24a1 cytochrome P450, family 24, subfamily a, polypeptide 1 1.22 0.008 Mm.6575 Hmgb1 high mobility group box 1 0.81 0.008 Mm.16421 Gnas GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus 1.23 0.008 Mm.125770 Plcb3 phospholipase C, beta 3 1.18 0.008 Mm.273204 Maged2 melanoma antigen, family D, 2 0.83 0.008 Mm.252035 BC011290 cDNA sequence BC011290 1.30 0.008 Mm.40713 Angrp angiogenin related protein 1.19 0.008 Mm.323305 Mtap methylthioadenosine phosphorylase 0.85 0.008 Mm.28500 Rnf144 ring finger protein 144 1.27 0.008 Mm.214932 Lamc1 laminin, gamma 1 0.80 0.008 Mm.1249 D3Jfr1 DNA segment, Chr 3, MJeffers 1 0.84 0.008 Mm.277713 4632415L05Rik RIKEN cDNA 4632415L05 gene 1.21 0.008 Mm.37735 Psma5 proteasome (prosome, macropain) subunit, alpha type 5 0.86 0.008 Mm.208883 1200011I18Rik RIKEN cDNA 1200011I18 gene 1.15 0.008 Mm.260767 Mynn myoneurin 1.19 0.008 Mm.200378 Nol3 nucleolar protein 3 (apoptosis repressor with CARD domain) 1.16 0.008 Mm.204876 Cfi complement component factor i 0.80 0.008 Mm.117180 1190017O12Rik RIKEN cDNA 1190017O12 gene 1.28 0.008 Mm.21698 1300012G16Rik RIKEN cDNA 1300012G16 gene 0.86 0.008 Mm.100065 4930470D19Rik RIKEN cDNA 4930470D19 gene 0.80 0.008 Mm.250425 Eif4el3 eukaryotic translation initiation factor 4E like 3 0.68 0.008 Mm.227183 1700023O11Rik RIKEN cDNA 1700023O11 gene 0.81 0.008 Mm.246683 Dub2 deubiquitinating enzyme 2 1.22 0.008 Mm.311201 2900092E17Rik RIKEN cDNA 2900092E17 gene 1.23 0.008 Mm.181894 1500011D06Rik RIKEN cDNA 1500011D06 gene 1.20 0.008 Mm.76911 Il6ra interleukin 6 receptor, alpha 0.80 0.008 Mm.2856 Emr4 EGF-like module containing, mucin-like, hormone receptor-like sequence 4 1.43 0.008 Mm.210497 Sh2bp1 SH2 domain binding protein 1 (tetratricopeptide repeat containing) 0.79 0.008 Mm.255858 Slc25a11 solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11 1.19 0.008 Mm.296082 D10Ucla2 DNA segment, Chr 10, University of California at Los Angeles 2 1.16 0.008 Mm.30121 Eps15 epidermal growth factor receptor pathway substrate 15 1.16 0.008 Mm.22627 XPMC2H Xenopus prevents mitotic catastrophe 2 homolog 0.75 0.008 Mm.271690 Atp2a2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 1.25 0.009 Mm.227583

219 Kcnq5 potassium voltage-gated channel, subfamily Q, member 5 1.17 0.009 Mm.39371 2810410P22Rik RIKEN cDNA 2810410P22 gene 0.64 0.009 Mm.280257 2310032D16Rik RIKEN cDNA 2310032D16 gene 1.29 0.009 Mm.211211 Klk26 kallikrein 26 1.22 0.009 Mm.103708 Canx calnexin 0.79 0.009 Mm.248827 Mcoln3 mucolipin 3 0.75 0.009 Mm.114683 Myom2 myomesin 2 1.25 0.009 Mm.272115 2010008E23Rik RIKEN cDNA 2010008E23 gene 1.13 0.009 Mm.101274 B3galt6 UDP-Gal:betaGal beta 1,3-galactosyltransferase, polypeptide 6 0.87 0.009 Mm.257678 9530020D24Rik RIKEN cDNA 9530020D24 gene 1.18 0.009 Mm.158705 Ncf1 neutrophil cytosolic factor 1 0.75 0.009 Mm.4149 Pdk2 pyruvate dehydrogenase kinase, isoenzyme 2 1.18 0.009 Mm.29768 BC022150 cDNA sequence BC022150 1.20 0.009 Mm.215148 Bmpr1b bone morphogenetic protein receptor, type 1B 1.17 0.009 Mm.39089 Gpr143 G protein-coupled receptor 143 1.19 0.009 Mm.5157 Olig3 oligodendrocyte transcription factor 3 1.23 0.009 Mm.156946 Usp20 ubiquitin specific protease 20 1.18 0.009 Mm.209761 2610510L01Rik RIKEN cDNA 2610510L01 gene 1.15 0.009 Mm.271056 Cav3 caveolin 3 0.87 0.009 Mm.3924 Gpr35 G protein-coupled receptor 35 0.81 0.009 Mm.152780 1810023F06Rik RIKEN cDNA 1810023F06 gene 0.85 0.009 Mm.96998 1500005G05Rik RIKEN cDNA 1500005G05 gene 1.27 0.009 Mm.280230 0610007H10Rik RIKEN cDNA 0610007H10 gene 1.13 0.009 Mm.28452 Ctnnbl1 catenin, beta like 1 1.24 0.009 Mm.132973 Bdh 3-hydroxybutyrate dehydrogenase (heart, mitochondrial) 1.17 0.009 Mm.293470 Traf6 Tnf receptor-associated factor 6 0.84 0.009 Mm.168648 5330434F23Rik RIKEN cDNA 5330434F23 gene 1.20 0.009 Mm.194127 Wdr13 WD repeat domain 13 1.19 0.009 Mm.284162 Pex6 peroxisomal biogenesis factor 6 1.25 0.009 Mm.256118 Rnf38 ring finger protein 38 1.22 0.009 Mm.262859 1700041K21Rik RIKEN cDNA 1700041K21 gene 1.18 0.009 Mm.81035 Irx1 Iroquois related homeobox 1 (Drosophila) 1.30 0.009 Mm.332901 Ipf1 insulin promoter factor 1, homeodomain transcription factor 1.21 0.009 Mm.4949 Slc39a3 solute carrier family 39 (zinc transporter), member 3 1.16 0.009 Mm.5353 5630401J11Rik RIKEN cDNA 5630401J11 gene 0.87 0.009 Mm.297570 Ier5 immediate early response 5 0.86 0.009 Mm.12246 Pip5k2c phosphatidylinositol-4-phosphate 5-kinase, type II, gamma 1.20 0.009 Mm.22682 Cxcr4 chemokine (C-X-C motif) receptor 4 1.40 0.009 Mm.1401 1700023M09Rik RIKEN cDNA 1700023M09 gene 1.17 0.009 Mm.41511 Dap death-associated protein 0.86 0.009 Mm.222867 Polr2a polymerase (RNA) II (DNA directed) polypeptide A 1.24 0.009 Mm.16533 Odf1 outer dense fiber of sperm tails 1 1.23 0.009 Mm.252830 Decr1 2,4-dienoyl CoA reductase 1, mitochondrial 1.31 0.009 Mm.24395 8430437G11Rik RIKEN cDNA 8430437G11 gene 0.84 0.009 Mm.254845 Anxa1 annexin A1 0.83 0.009 Mm.248360 Stxbp1 syntaxin binding protein 1 1.25 0.009 Mm.278865 4921520G13Rik RIKEN cDNA 4921520G13 gene 1.20 0.009 Mm.158125 A630038E17Rik RIKEN cDNA A630038E17 gene 1.15 0.009 Mm.227512 Mad4 Max dimerization protein 4 0.83 0.009 Mm.132901 Vps28 vacuolar protein sorting 28 (yeast) 1.21 0.009 Mm.265946 Tpcn1 two pore channel 1 1.20 0.009 Mm.114054 Ubl5 ubiquitin-like 5 1.21 0.009 Mm.287987 D2Ertd97e DNA segment, Chr 2, ERATO Doi 97, expressed 1.15 0.009 Mm.245948 Pom121 nuclear pore membrane protein 121 1.17 0.009 Mm.28399 Gcn5l2 GCN5 general control of amino acid synthesis-like 2 (yeast) 0.86 0.009 Mm.218837 U46068 cDNA sequence U46068 0.63 0.009 Mm.3783 Vpreb3 pre-B lymphocyte gene 3 1.25 0.009 Mm.955 Cdc2l2 cell division cycle 2 homolog (S. pombe)-like 2 1.18 0.009 Mm.267410 Map3k7ip2 mitogen-activated protein kinase kinase kinase 7 interacting protein 2 0.87 0.009 Mm.193041 D13Wsu123e DNA segment, Chr 13, Wayne State University 123, expressed 0.83 0.009 Mm.260009 Mybph myosin binding protein H 1.14 0.009 Mm.269621 AA589584 expressed sequence AA589584 1.15 0.009 Mm.296885 Cast calpastatin 0.82 0.009 Mm.29163 Pabpn1 poly(A) binding protein, nuclear 1 1.37 0.009 Mm.7723 Fcer2a Fc receptor, IgE, low affinity II, alpha polypeptide 1.24 0.009 Mm.1233 Rpl44 ribosomal protein L44 1.14 0.009 Mm.14838 Tlr6 toll-like receptor 6 1.19 0.009 Mm.42146 Eif3s6 eukaryotic translation initiation factor 3, subunit 6 0.85 0.009 Mm.289992 Pla2g2d phospholipase A2, group IID 1.22 0.009 Mm.71913 Cfl1 cofilin 1, non-muscle 0.84 0.009 Mm.4024 Pou6f1 POU domain, class 6, transcription factor 1 1.18 0.009 Mm.28825 3110017O03Rik RIKEN cDNA 3110017O03 gene 0.85 0.009 Mm.41779 Sgpp1 sphingosine-1-phosphate phosphatase 1 0.80 0.009 Mm.280199 Nr1i2 nuclear receptor subfamily 1, group I, member 2 1.22 0.009 Mm.8509

220 BC021611 cDNA sequence BC021611 1.18 0.009 Mm.24338 4632408A20Rik RIKEN cDNA 4632408A20 gene 1.23 0.009 Mm.49245 Ndufa10 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex 10 0.82 0.009 Mm.248778 Prkcm protein kinase C, mu 1.18 0.009 Mm.282880 Hesx1 homeo box gene expressed in ES cells 1.17 0.009 Mm.4802 1110018N15Rik RIKEN cDNA 1110018N15 gene 1.15 0.009 Mm.39001 Nos3 nitric oxide synthase 3, endothelial cell 0.80 0.009 Mm.258415 Eppk1 epiplakin 1 0.85 0.009 Mm.259929 Col14a1 procollagen, type XIV, alpha 1 1.19 0.009 Mm.148962 Arfgap1 ADP-ribosylation factor GTPase activating protein 1 0.80 0.009 Mm.286543 1110001A16Rik RIKEN cDNA 1110001A16 gene 0.79 0.009 Mm.166319 1110037D04Rik RIKEN cDNA 1110037D04 gene 1.19 0.009 Mm.29364 2610529H08Rik RIKEN cDNA 2610529H08 gene 0.83 0.009 Mm.258985 Gpr37 G protein-coupled receptor 37 0.80 0.009 Mm.20465 Psmd13 proteasome (prosome, macropain) 26S subunit, non-ATPase, 13 0.80 0.009 Mm.29760 3110050F08Rik RIKEN cDNA 3110050F08 gene 0.78 0.009 Mm.20164 UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)- Galgt1 galactosylglucosylceramide-beta-1, 4-N-acetylgalactosaminyltransferase 1.21 0.009 Mm.1853 Extl3 exostoses (multiple)-like 3 0.87 0.009 Mm.103748 Lias lipoic acid synthetase 0.85 0.009 Mm.195776 Dbp D site albumin promoter binding protein 2.50 0.009 Mm.3459 2310047C17Rik RIKEN cDNA 2310047C17 gene 1.19 0.009 Mm.35669 Poll polymerase (DNA directed), lambda 1.17 0.009 Mm.46509 Rabggta Rab geranylgeranyl transferase, a subunit 1.16 0.009 Mm.87216 Ttyh1 tweety homolog 1 (Drosophila) 1.15 0.009 Mm.29729 2300002G02Rik RIKEN cDNA 2300002G02 gene 1.15 0.009 Mm.197829 AB041662 hypothetical protein, MNCb-4193 1.19 0.009 Mm.263169 Cidea cell death-inducing DNA fragmentation factor, alpha subunit-like effector A 1.32 0.009 Mm.449 Tbx1 T-box 1 1.22 0.009 Mm.295194 Trp53 transformation related protein 53 0.85 0.009 Mm.222 1110001J03Rik RIKEN cDNA 1110001J03 gene 1.28 0.009 Mm.158971 2610510E10Rik RIKEN cDNA 2610510E10 gene 1.19 0.009 Mm.276328 Amotl2 angiomotin like 2 1.18 0.009 Mm.21145 Zfpm1 zinc finger protein, multitype 1 0.87 0.009 Mm.3105 Gtf3a general transcription factor III A 0.81 0.009 Mm.29105 Tnfrsf11a tumor necrosis factor receptor superfamily, member 11a 0.79 0.009 Mm.6251 Apaf1 apoptotic protease activating factor 1 0.76 0.009 Mm.220289 Phf5a PHD finger protein 5A 0.82 0.009 Mm.271715 Cbl Casitas B-lineage lymphoma 0.70 0.009 Mm.266871 Rbpsuhl recombining binding protein suppressor of hairless-like (Drosophila) 1.35 0.010 Mm.42177 BC021513 cDNA sequence BC021513 1.14 0.010 Mm.24606 Cops2 COP9 (constitutive photomorphogenic) homolog, subunit 2 (Arabidopsis thaliana) 0.83 0.010 Mm.3596 Skil SKI-like 0.79 0.010 Mm.15406 Trex1 three prime repair exonuclease 1 0.78 0.010 Mm.262117 Cml2 camello-like 2 1.16 0.010 Mm.24251 0610016J10Rik RIKEN cDNA 0610016J10 gene 0.78 0.010 Mm.253185 Ak2 adenylate kinase 2 0.86 0.010 Mm.29460 Cpsf2 cleavage and polyadenylation specific factor 2 0.85 0.010 Mm.716 Refbp2 RNA and export factor binding protein 2 0.57 0.010 Mm.10364 Col4a3bp collagen, type IV, alpha 3 (Goodpasture antigen) binding protein 0.74 0.010 Mm.24125 0610012A05Rik RIKEN cDNA 0610012A05 gene 1.32 0.010 Mm.300419 Jam4 junction adhesion molecule 4 1.21 0.010 Mm.46368 Fgd4 FYVE, RhoGEF and PH domain containing 4 1.15 0.010 Mm.256131 6330578E17Rik RIKEN cDNA 6330578E17 gene 0.80 0.010 Mm.123263 Ard1 N-acetyltransferase ARD1 homolog (S. cerevisiae) 1.25 0.010 Mm.5934 Lyst lysosomal trafficking regulator 1.18 0.010 Mm.124392 0610027F08Rik RIKEN cDNA 0610027F08 gene 0.87 0.010 Mm.287981 Oprs1 opioid receptor, sigma 1 0.82 0.010 Mm.22745 Egr1 early growth response 1 0.46 0.010 Mm.181959 Satb2 special AT-rich sequence binding protein 2 1.19 0.010 Mm.145599 Lancl1 LanC (bacterial lantibiotic synthetase component C)-like 1.16 0.010 Mm.20522 LOC114601 tangerin 0.81 0.010 Mm.210447 2210409B01Rik RIKEN cDNA 2210409B01 gene 1.19 0.010 Mm.183126 Tgm2 transglutaminase 2, C polypeptide 0.76 0.010 Mm.18843 0610037L13Rik RIKEN cDNA 0610037L13 gene 1.17 0.010 Mm.274853 Zfp346 zinc finger protein 346 1.24 0.010 Mm.22795 Sult1a2 sulfotransferase family 1A, phenol-preferring, member 2 1.30 0.010 Mm.10108 4930447C24Rik RIKEN cDNA 4930447C24 gene 1.24 0.010 Mm.179144 Cecr6 cat eye syndrome chromosome region, candidate 6 homolog (human) 1.23 0.010 Mm.23088 Azi1 5-azacytidine induced gene 1 1.18 0.010 Mm.2556 2810021O14Rik RIKEN cDNA 2810021O14 gene 0.80 0.010 Mm.256185 Cct6a chaperonin subunit 6a (zeta) 0.76 0.010 Mm.153159 Btk Bruton agammaglobulinemia tyrosine kinase 1.19 0.010 Mm.4475 D630002G06 hypothetical protein D630002G06 1.15 0.010 Mm.77037

221 Theg testicular haploid expressed gene 1.20 0.010 Mm.89197 Rabep1 rabaptin, RAB GTPase binding effector protein 1 1.18 0.010 Mm.7087 Aicda activation-induced cytidine deaminase 1.18 0.010 Mm.32398 Sdpr serum deprivation response 1.46 0.010 Mm.255909 1700112N14Rik RIKEN cDNA 1700112N14 gene 1.15 0.010 Mm.192840 Pcsk7 proprotein convertase subtilisin/kexin type 7 1.15 0.010 Mm.3255 Ehd3 EH-domain containing 3 0.83 0.010 Mm.18526 AW050020 expressed sequence AW050020 0.82 0.010 Mm.262056 Cks2 CDC28 protein kinase regulatory subunit 2 0.66 0.010 Mm.222228 Cadps2 Ca2+-dependent activator protein for secretion 2 1.29 0.010 Mm.259632 Gtpbp1 GTP binding protein 1 1.14 0.010 Mm.19080 Slc35c2 solute carrier family 35, member C2 0.87 0.010 Mm.21184 Papola poly (A) polymerase alpha 0.79 0.010 Mm.255877 1110033A15Rik RIKEN cDNA 1110033A15 gene 1.22 0.010 Mm.200885 Psmd14 proteasome (prosome, macropain) 26S subunit, non-ATPase, 14 0.81 0.010 Mm.218198 Thrap6 thyroid hormone receptor associated protein 6 1.20 0.010 Mm.195562 Zfp386 zinc finger protein 386 (Kruppel-like) 1.20 0.010 Mm.254997 4930430A15Rik RIKEN cDNA 4930430A15 gene 1.16 0.010 Mm.84331 1110011D13Rik RIKEN cDNA 1110011D13 gene 1.16 0.010 Mm.44195 Hgd homogentisate 1, 2-dioxygenase 1.16 0.010 Mm.157442 AI853514 expressed sequence AI853514 1.15 0.010 Mm.137746 Hbb-y hemoglobin Y, beta-like embryonic chain 1.12 0.010 Mm.35830 Actr1b ARP1 actin-related protein 1 homolog B (yeast) 0.80 0.010 Mm.28521 Pla2g4a phospholipase A2, group IVA (cytosolic, calcium-dependent) 0.78 0.010 Mm.4186 BC003322 cDNA sequence BC003322 0.74 0.010 Mm.259969

222