DOCSLIB.ORG

Supplementary Table

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supplementary Table Supplementary Table 1 Genes up- and down- regulated in RMS (>1.5 fold and P-value < 0.001) 2851 genes up-regulated in rhabdomyosarcoma (>1.5 fold and P-value < 0.001) Accession # Sequence Name(s) P-value Fold Change AV168216 Zzz3,R75514,AA408566,AW556059,3110065C23Rik 1.88E-07 2.43009 BB379602 Zzef1,C85424,BC051585,MGC107545,mKIAA0399, 0.00009 2.30216 BB759260 Zyx,R75157,9530098H06Rik 3.93E-07 6.8602 BC013559 Zwint,Zwint-1,D10Ertd749e,2010007E07Rik,2600001N01Rik 4.02E-06 4.33115 BB420529 Zswim6,mKIAA1577,2900036G02Rik 1.28E-43 5.81057 BG072903 Zranb1,Gm1956,Trabid,D7Wsu87e,9330160G10Rik 0.00095 1.60955 NM_011769 Zim1 0.00009 3.83185 BB361162 Zic1,ZIC,ZNF201 1.83E-25 14.45411 NM_011764 Zfp90,NK10,Zfp64,Zfp83,KRAB17,mKIAA1954,6430515L01Rik 4.88E-07 3.30762 BM230481 Zfp82,mszf3,KRAB16,A030010D05 4.62E-10 3.57192 BC021921 Zfp709,HIT-40,BC021921,MGC28841 0.00019 1.85074 BB040500 Zfp647,Es492,6030449J21 7.06E-07 2.21975 NM_009564 Zfp64 0.00085 2.48661 AW548399 Zfp617,Zfps11-6 0.00091 2.17308 AV274175 Zfp608,MGC116601,4932417D18Rik 5.52E-07 2.78491 BE985246 Zfp59,Mfg2,Mfg-2 4.62E-06 1.6049 BM207314 Zfp568,C80731,Gm1691 0 4.817 BB150458 Zfp537,Tsh3,KIAA1474,mKIAA1474,A630038G13Rik 1.11E-09 4.39825 NM_013843 Zfp53,KRAZ1,zfas8,Zfp-53,Zfp118,D030067O06Rik 8.89E-06 2.04926 BM225280 Zfp52,Zfp76,KRAB11,Zfp-52,mszf24,mszf34,zfec29,mszf23-2 1.01E-07 2.90437 BG064695 Zfp482,ZID,ZBTB6,MGC41441,A830092L04Rik 0.0009 1.52711 BC023090 Zfp472,Krim1,KRIM-1,Krim-1A,Krim-1B 0.00018 1.82524 BB421061 Zfp451,COASTER,AI596398, 1.28E-06 3.17744 AK012846 Zfp444,FLJ00134,mFLJ00134,2810031J10Rik,6230401O10Rik 3.83E-07 2.73545 BM227942 Zfp422-rs1,AI842447,Krox-25-2,A430003O12Rik,C430039G02Rik 0.00076 1.80164 AW547438 Zfp407,Gm333,Gm334,Gm948,ZNF407,6430585N13Rik 4.33E-07 2.63122 NM_009554 Zfp37,Tzn,Zfp-37,AV042165 3.33E-07 3.48645 M58566 Zfp36l1,Brf1,ERF1,cMG1,Berg36,TIS11b, 2.95E-10 2.1344 BQ176698 Zfp369,NRIF2,B930030B22Rik,D230020H11Rik 7.51E-07 1.95403 AK014562 Zfp329,ZNF329,2810439M05Rik,4632409L22Rik 0.0001 2.37418 NM_018759 Zfp326,ZAN75,5730470H14Rik 0.00052 1.61594 BG075830 Zfp322a,RP23-9O13.9,9630054P07Rik 4.99E-12 1.53642 NM_013889 Zfp292,Zn-15,Zn-16 0.00032 1.64396 BE651907 Zfp286,BC027023,MGC39058,RP23-59B16.5 0.00003 5.01023 L36316 Zfp260,Ozrf1,Zfp63,AI480997 0.00073 1.80779 AV346442 Zfp26,Zfp70,mkr-3,KRAB15,Zfp-26,mszf14,mszf52 3.62E-16 1.70624 X98096 Zfp148,BERF-1,BFCOL1,ZBP-89,AI480666,AW045217 2.69E-08 1.8039 BB154236 Zfp142,BB154236,mKIAA0236,9330177B18Rik 1.37E-06 2.5965 AV263718 Zfp110,NRIF,Nrif1,N28112,2900024E01Rik 0.00082 1.53557 NM_009544 Zfp105,AW557864 1.22E-09 2.9553 NM_015753 Zfhx1b,SIP1,Zfx1b,Zfxh1b,mKIAA0569,9130203F04Rik 3.76E-20 3.88171 AV363000 Zfhx1a,BZP,ZEB,MEB1,Nil2,Tcf8,AREB6,Tcf18,Zfhep, 4.15E-08 2.86147 NM_133349 Zfand2a,Airap,AA407930,AU016206 5.35E-08 2.97538 BB271151 Zdhhc24,Leng4,5730496N17Rik 0.00036 2.24875 BC019536 Zdhhc20,AI448102,5033406L14Rik,B230110O18Rik 2.16E-16 4.27936 AV361868 Zdhhc14,New1cp,MGC29194,B530001K09Rik 0.00012 2.25267 AK010382 Zdhhc13,HIP3RP,Hip14l,C530010M18,2410004E01Rik 1.44E-07 2.09971 AV140894 Zcchc3,2810406K24Rik 0.00087 2.45231 BB223737 Zcchc14,BDG29,AA792890,KIAA0579 3.32E-08 5.64842 AW556219 Zc3h7a,Zc3h7,HSPC055,Zc3hdc7,AI447294,AW556219, 0.00024 1.7232 BG922355 Zbtb36,B230208J24Rik 4.78E-18 7.6601 AV027921 Ywhaz,AI596267,AL022924,AU020854,1110013I11Rik 9.65E-06 3.67075 AV024540 Ywhaq,R74690,AA409740,AU021156,MGC118161 0.00035 1.97938 NM_018753 Ywhab,14-3-3 beta,1300003C17Rik 0.00013 2.04605 BC009080 Yipf1,C030002N13Rik 3.05E-06 1.9655 BG070675 Yap1,Yap,65kDa,YAP65,AI325207 0.00001 6.01672 NM_011917 Xrn2 4.91E-09 2.12406 BG064541 Xpo4,mKIAA1721,B430309A01Rik 0.00082 1.57655 BC005560 Xlr 0.00014 2.56382 AV051768 Xbp1,TREB5,XBP-1,TREB-5,D11Ertd39e 5.24E-11 1.82847 BC014727 Wwtr1,TAZ,C78399,2310058J06Rik,2610021I22Rik 7.93E-06 2.88043 AK004087 Wwp2,AIP2,AA690238,AW554328,1300010O06Rik 0.00018 5.91992 BE136550 Wtip 3.30E-18 3.38288 BM730566 Wsb2,Swip2,WSB-2,AA673511 3.25E-06 3.1205 BC019601 Wsb1,1110056B13Rik,2700038M07Rik 2.82E-13 3.61184 NM_030215 Wrnip1,WHIP,Wrnip,4833444L21Rik 2.24E-23 3.93178 NM_009525 Wnt5b,Wnt-5b,AW545702 7.53E-06 5.94733 BC018425 Wnt5a,Wnt-5a,8030457G12Rik 0 6.32702 BI692255 Wnk1,Prkwnk1,mKIAA0344,6430573H23Rik 3.82E-06 1.7165 NM_018865 Wisp1,Elm1,AW146261 3.27E-31 29.54223 BI251603 Wipi1,AW411817,MGC36416,D11Ertd498e,4930533H01Rik 9.62E-07 1.97502 BI658695 Whsc1l1,NSD3,AI528490,A530023P05 0.00089 3.36446 BQ177743 Whsc1,Whsc1l,AW555663,mKIAA1090 9.71E-06 3.51548 NM_134139 Wdr74,AA407588,5730436H21Rik 0.00062 1.57214 AK002371 Wdr57,Prp8bp,0610009C03Rik 0.00006 1.71756 AI415371 Wdr19,PWDMP,mKIAA1638,C330027H04Rik,D330023L08Rik 0.00005 2.71503 AW542545 Wdr1,D5Wsu185e 6.78E-06 2.19091 NM_024479 Wbscr27,MGC8159,AW492986,BC002286 0.00064 3.08605 BC007478 Wbp5,AL024233 4.04E-16 2.48701 NM_031877 Wasf1,Scar,WAVE,WAVE-1,AI195380,AI838537 0.00013 2.33276 BM240052 Vps41,Vam2,mVam2,AI317346 0.00049 1.57065 NM_030559 Vps16,MGC7352,1810074M16Rik 0.00018 1.78868 AK003237 Vkorc1,D7Wsu86e 0.00028 1.81507 M24849 Vim,MGC102095 7.03E-35 3.33062 BM119387 Vil2,p81,ezrin,R75297,AW146364,MGC107499,cytovillin 4.76E-08 3.1633 NM_009502 Vcl,AA571387,AI462105,AW545629,9430097D22 4.53E-07 1.6678 BB250384 Vcam1,CD106,Vcam-1 4.16E-08 4.4065 BB742957 Uty,Hydb,KIAA4057,mKIAA4057 0 36.36382 BB153362 Utrn,DRP,Dmdl,AA589569 0.00003 8.13706 AW107303 Usp9x,Fafl,Dffrx,FAF-X,AA407302,AA407699,AL022658, 8.09E-31 2.13824 AB045709 Usp8,Ubpy,AI574262,AW557536,mKIAA0055 0.00028 1.53355 BM233265 Usp3,AA409661,BC017156,MGC28886 0.00009 1.96204 AI427806 Usp22,AI427806,KIAA1063,MGC91200,mKIAA1063,9330200A01 0.00017 1.76249 AK006800 Usp20,Vdu2,AI467231,1700055M05Rik 7.51E-08 5.67967 AW539189 Usp12,Ubh1 0.00027 2.63202 AI117611 Usp11,MGC6649,KIAA4085,mKIAA4085,6230415D12Rik 1.10E-13 3.57519 BC018179 Usp1,MGC25559 4.70E-07 2.34283 NM_009477 Upp1,Up,Upp,UPase,UdRPase,AI325217 6.14E-36 11.01495 BB219662 Upk1b,UPIb,Upk1,Tspan20,AI413235 3.16E-27 20.3888 BM226250 Unc5c,rcm,Unc5h3,AI047720,6030473H24,B130051O18Rik 0.00037 6.51702 BG065285 Unc5b,Unc5h2,A630020F16,D10Bwg0792e,6330415E02Rik 7.58E-15 8.88249 BB464342 Unc45a,AW538196 0.00016 4.8632 BQ266387 Uhrf2,Nirf,AI426270,AW214556,2310065A22Rik,D130071B19Rik 0.00019 2.08508 NM_053184 Ugt2a1 0.00024 3.36764 NM_009466 Ugdh,Udpgdh 6.18E-06 2.39509 BM211361 Ugcgl1,AA589501,AI414429,AI448372,0910001L17Rik 1.15E-20 2.25635 AA591863 Ugcg,Ugcgl,C80537,Epcs21,GlcT-1,AU043821 2.62E-09 6.95918 NM_026435 Ufm1,AI132708,AI463323,1810045K17Rik 0.00012 2.30698 AW108044 Ucp2,Slc25a8 0.00046 1.83128 NM_030724 Uck2,UK,UMK,Umpk,TSA903,AA407809,AI481316 0.00006 4.12208 NM_011670 Uchl1,gad,C88048,PGP9.5,R75593,AW822034 8.56E-38 6.9241 BB253461 Ubxd2,KIAA0242,mKIAA0242,1300013G12Rik 1.12E-10 6.49582 BC016129 Ubtd1,BC016129,MGC28905 0.00008 4.05438 NM_013699 Ubp1,Cp2b,NF2d9,LBP-1a,LBP-1b 8.04E-07 1.90585 AK016093 Ube4b,UFD2,UFD2a,Ufd2p, 0.00043 4.89101 BB796558 Ube2w,6130401J04Rik 9.19E-40 2.88704 BF472749 Ube2j1,Ncube,Ubc6p,Ncube1,0710008M05Rik,1110030I22Rik 0.00001 1.80343 BM242612 Ube2i,UBC9,Ubce9,Mmubc9,Ubce2i,5830467E05Rik 6.64E-08 3.08933 BI438002 Ube1dc1,AW240750,5730525G14Rik 0.0002 1.78572 AI482041 Ubap2l,C77168,Nice-4, 0.00041 4.46128 BG963358 Uap1l1,5730445F03Rik 2.53E-07 2.50763 AW542140 U2af1-rs2,35kDa,C77286,5031411E02Rik,A230052C13Rik 0.00011 2.24527 NM_024187 U2af1,35kDa,2010107D16Rik 0.00041 1.5122 BC020139 Tyms,TS 0.00005 3.35804 AK004219 Txnl5,TRP14,D11Ertd672e,4831443O22Rik,RP23-207N15.4 0.00003 1.58279 NM_025299 Txnl4,Dim1,U5-15kD,U5-15kDa 0.00002 4.28416 NM_025334 Txndc12,ERp19,0610040B21Rik 5.38E-08 1.79225 NM_011660 Txn1,ADF,Txn,AW550880 4.79E-26 1.77416 BG070463 Txlna,Txln,AI425952,AW209241,MGC77972,MGC86145, 6.81E-07 6.66388 BC004850 Twsg1,Tsg,Twg,AW552143,D17Ertd403e,1810013J15Rik 3.81E-12 4.8169 NM_030254 Tusc3,N33,MGC6989,AU022242,BC003311 0.00019 1.90576 BB667130 Tulp4,Tusp,1110057P05Rik 1.70E-20 4.77645 BQ178976 Tubgcp2,1700022B05Rik 2.62E-06 3.82656 NM_026473 Tubb6,BB220206,2310057H16Rik 0 7.88058 NM_011655 Tubb5,AA408537,AI596182,M(beta)5,B130022C14Rik 6.79E-41 5.16786 AA986082 Tubb2b,2410129E14Rik 4.04E-14 8.24627 BC003475 Tubb2a,Tubb2,M(beta)2 2.68E-15 4.59273 NM_009448 Tuba6,M[a]6 0.00008 2.02814 NM_009446 Tuba3,M[a]3,AI528779,MGC107295 8.04E-32 22.61037 BC008117 Tuba2,MGC102558,MGC117866,MGC118411 1.11E-19 2.83886 NM_011653 Tuba1,Tuba-1,MGC102097,MGC102098,MGC102099 8.74E-11 2.8343 AK016145 Ttll5,R75373,AI428864,mKIAA0998,1700048H13Rik 2.19E-11 10.05176 BB764137 Ttll1,AV014541,6330444E16Rik 0.00001 3.52484 BC018513 Ttl,2410003M22Rik 2.05E-08 2.57546 BB106428 Ttc9,AI429215,AI853559,1700029M07Rik 0 10.59357 BC017523 Ttc8,BBS8,AV001447,0610012F22Rik 2.35E-07 2.62042 BM116591 Ttc3,TPRD,AA409221,D16Ium21,KIAA4119 0.00008 2.60245 BM238672 Ttc14,cI-44,AI662468,AU014779,AW561908, 1.48E-09 1.91907 AV332105 Tspyl5,6330530B20,E130308C19Rik 0.0006 2.31038 AK020159 Tspan9,AU018597,6720474K14Rik,9430079M16Rik 4.13E-07 3.07294 NM_019656 Tspan6,T245,Tm4sf,Tm4sf6,TSPAN-6,AI316786 2.41E-21 5.47364 NM_019571 Tspan5,NET-4,Tm4sf9,AU024142,2810455A09Rik,4930505M03Rik 0.00025 2.81191 NM_053082 Tspan4,NAG-2,Tm4sf7,Tspan-4,AI325509,AI746565 1.47E-07 3.15741 AU016382 Tsc22d1,TSC,Egr5,TSC-22,Tgfb1i4,AA589566,AW105905 0 2.97769 NM_133901 Trrap,AI481500 4.21E-06 1.66403 BB360644 Trps1,AI115454,AI447310,MGC46754,MGC107472,D15Ertd586e 1.39E-08 2.07727 BB377721 Trpm3,MLSN2,LTRPC3,AU018608,9330180E14, 2.68E-06 4.46255 NM_013838 Trpc6,Trrp6,mtrp6,AV025995,LLHWJM002,LLHWJM003 3.15E-12 8.89173 BB817939 Trpc1,Trrp1 5.72E-07 6.41965 BB309395 Trpa1,Anktm1 0 100 AF075434 Trp63,Ket,p63,Tp63,p73L,TAp63,p51/p63,AI462811,
Load more

Recommended publications
  • Anti-SNX18 Polyclonal Antibody (CABT-B1766) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-SNX18 polyclonal antibody (CABT-B1766) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Specificity Expected to react with all spliced isoforms. Immunogen Recombinant protein corresponding to human SNX18. Isotype IgG Source/Host Rabbit Species Reactivity Canine, Human Purification Affinity Purfied Conjugate Unconjugated Applications WB, ICC, IP Molecular Weight ~73 kDa observed Format Liquid Concentration Please refer to lot specific datasheet. Size 100 μg Buffer PBS with 0.05% sodium azide. Preservative 0.05% Sodium Azide Storage Stable for 1 year at 2-8°C from date of receipt. BACKGROUND Introduction Sorting nexin-18 (UniProt Q96RF0; also known as SH3 and PX domain-containing protein 3B, Sorting nexin-associated Golgi protein 1) is encoded by the SNX18 (also known as SNAG1, SH3PX2, SH3PXD3B) gene (Gene ID 112574) in human. SNX18, SNX33, and SNX9 constitute a subfamily of sorting nexin (SNX) proteins characterized by a Bin–Amphiphysin–Rvs (BAR) domain that allows dimerization. It also contributes to modulation and shaping of membrane curvature. It also has a Src-homology 3 (SH3) domain that allows interaction with a wide range of proline-rich PXXP motif containing proteins. In addition to mediating endocytosis and intracellular 45-1 Ramsey Road, Shirley, NY 11967, USA Email: info@creative-diagnostics.com Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved vesicle trafficking, SNX18, SNX33, and SNX9 are also essential for successful completion of the ingression and abscission stages of cytokinesis and for the delivery of a subset of vesicles to the intracellular bridge that connects the two nascent daughter cells during mitosis.
    [Show full text]
  • Genazzani-2003-Calcineurin And
    Edinburgh Research Explorer Calcineurin controls the expression of numerous genes in cerebellar granule cells Citation for published version: Kramer, D, Fresu, L, Ashby, DS, Freeman, TC & Genazzani, AA 2003, 'Calcineurin controls the expression of numerous genes in cerebellar granule cells', Molecular and Cellular Neuroscience, vol. 23, no. 2, pp. 325- 30. Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Molecular and Cellular Neuroscience Publisher Rights Statement: © 2003 Elsevier Science (USA) General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact openaccess@ed.ac.uk providing details, and we will remove access to the work immediately and investigate your claim. Download date: 28. Sep. 2021 Molecular and Cellular Neuroscience 23 (2003) 325–330 www.elsevier.com/locate/ymcne Calcineurin controls the expression of numerous genes in cerebellar granule cells Dana Kramer,a Luigia Fresu,b Dominique S. Ashby,a Tom C. Freeman,c and Armando A. Genazzania,* a Department of Pharmacology, Tennis Court Road, Cambridge, CB2 1PD, UK b Department of Pharmacology, Gynaecology and Obstetrics, University of Sassari, Italy c Microarray Group, MRC HGMP-RC, Wellcome Trust Genome Campus, Hinxton, CB10 1SB, UK Received 31 October 2002; revised 7 January 2003; accepted 20 January 2003 Abstract The Ca2ϩ/calmodulin-dependent phosphatase calcineurin plays a crucial role in gene expression in different cell types such as T-lymphocytes, cardiac myocytes, and smooth muscle cells.
    [Show full text]
  • Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
    BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron.
    [Show full text]
  • Silencing of Phosphoinositide-Specific
    ANTICANCER RESEARCH 34: 4069-4076 (2014) Silencing of Phosphoinositide-specific Phospholipase C ε Remodulates the Expression of the Phosphoinositide Signal Transduction Pathway in Human Osteosarcoma Cell Lines VINCENZA RITA LO VASCO1, MARTINA LEOPIZZI2, DANIELA STOPPOLONI3 and CARLO DELLA ROCCA2 Departments of 1Sense Organs , 2Medicine and Surgery Sciences and Biotechnologies and 3Biochemistry Sciences “A. Rossi Fanelli”, Sapienza University, Rome, Italy Abstract. Background: Ezrin, a member of the signal transduction pathway (5). The reduction of PIP2 ezrin–radixin–moesin family, is involved in the metastatic induces ezrin dissociation from the plasma membrane (6). spread of osteosarcoma. Ezrin binds phosphatydil inositol-4,5- The levels of PIP2 are regulated by the PI-specific bisphosphate (PIP2), a crucial molecule of the phospholipase C (PI-PLC) family (7), constituting thirteen phosphoinositide signal transduction pathway. PIP2 levels are enzymes divided into six sub-families on the basis of amino regulated by phosphoinositide-specific phospholipase C (PI- acid sequence, domain structure, mechanism of recruitment PLC) enzymes. PI-PLCε isoform, a well-characterized direct and tissue distribution (7-15). PI-PLCε, a direct effector of effector of rat sarcoma (RAS), is at a unique convergence RAS (14-15), might be the point of convergence for the point for the broad range of signaling pathways that promote broad range of signalling pathways that promote the RAS GTPase-mediated signalling. Materials and Methods. By RASGTPase-mediated signalling (16). using molecular biology methods and microscopic analyses, In previous studies, we suggested a relationship between we analyzed the expression of ezrin and PLC genes after PI-PLC expression and ezrin (17-18).
    [Show full text]
  • Pathway-Based Genome-Wide Association Analysis of Coronary Heart Disease Identifies Biologically Important Gene Sets
    European Journal of Human Genetics (2012) 20, 1168–1173 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Pathway-based genome-wide association analysis of coronary heart disease identifies biologically important gene sets Lisa de las Fuentes1,4, Wei Yang2,4, Victor G Da´vila-Roma´n1 and C Charles Gu*,2,3 Genome-wide association (GWA) studies of complex diseases including coronary heart disease (CHD) challenge investigators attempting to identify relevant genetic variants among hundreds of thousands of markers being tested. A selection strategy based purely on statistical significance will result in many false negative findings after adjustment for multiple testing. Thus, an integrated analysis using information from the learned genetic pathways, molecular functions, and biological processes is desirable. In this study, we applied a customized method, variable set enrichment analysis (VSEA), to the Framingham Heart Study data (404 467 variants, n ¼ 6421) to evaluate enrichment of genetic association in 1395 gene sets for their contribution to CHD. We identified 25 gene sets with nominal Po0.01; at least four sets are previously known for their roles in CHD: vascular genesis (GO:0001570), fatty-acid biosynthetic process (GO:0006633), fatty-acid metabolic process (GO:0006631), and glycerolipid metabolic process (GO:0046486). Although the four gene sets include 170 genes, only three of the genes contain a variant ranked among the top 100 in single-variant association tests of the 404 467 variants tested. Significant enrichment for novel gene sets less known for their importance to CHD were also identified: Rac 1 cell-motility signaling pathway (h_rac1 Pathway, Po0.001) and sulfur amino-acid metabolic process (GO:0000096, Po0.001).
    [Show full text]
  • PROTEOMIC ANALYSIS of HUMAN URINARY EXOSOMES. Patricia
    ABSTRACT Title of Document: PROTEOMIC ANALYSIS OF HUMAN URINARY EXOSOMES. Patricia Amalia Gonzales Mancilla, Ph.D., 2009 Directed By: Associate Professor Nam Sun Wang, Department of Chemical and Biomolecular Engineering Exosomes originate as the internal vesicles of multivesicular bodies (MVBs) in cells. These small vesicles (40-100 nm) have been shown to be secreted by most cell types throughout the body. In the kidney, urinary exosomes are released to the urine by fusion of the outer membrane of the MVBs with the apical plasma membrane of renal tubular epithelia. Exosomes contain apical membrane and cytosolic proteins and can be isolated using differential centrifugation. The analysis of urinary exosomes provides a non- invasive means of acquiring information about the physiological or pathophysiological state of renal cells. The overall objective of this research was to develop methods and knowledge infrastructure for urinary proteomics. We proposed to conduct a proteomic analysis of human urinary exosomes. The first objective was to profile the proteome of human urinary exosomes using liquid chromatography-tandem spectrometry (LC- MS/MS) and specialized software for identification of peptide sequences from fragmentation spectra. We unambiguously identified 1132 proteins. In addition, the phosphoproteome of human urinary exosomes was profiled using the neutral loss scanning acquisition mode of LC-MS/MS. The phosphoproteomic profiling identified 19 phosphorylation sites corresponding to 14 phosphoproteins. The second objective was to analyze urinary exosomes samples isolated from patients with genetic mutations. Polyclonal antibodies were generated to recognize epitopes on the gene products of these genetic mutations, NKCC2 and MRP4. The potential usefulness of urinary exosome analysis was demonstrated using the well-defined renal tubulopathy, Bartter syndrome type I and using the single nucleotide polymorphism in the ABCC4 gene.
    [Show full text]
  • Structure-Based Redesigning of Pentoxifylline Analogs Against
    www.nature.com/scientificreports OPEN Structure‑based redesigning of pentoxifylline analogs against selective phosphodiesterases to modulate sperm functional competence for assisted reproductive technologies Mutyala Satish1,5, Sandhya Kumari2,5, Waghela Deeksha1, Suman Abhishek1, Kulhar Nitin1, Satish Kumar Adiga2, Padmaraj Hegde3, Jagadeesh Prasad Dasappa4, Guruprasad Kalthur2* & Eerappa Rajakumara1* Phosphodiesterase (PDE) inhibitors, such as pentoxifylline (PTX), are used as pharmacological agents to enhance sperm motility in assisted reproductive technology (ART), mainly to aid the selection of viable sperm in asthenozoospermic ejaculates and testicular spermatozoa, prior to intracytoplasmic sperm injection (ICSI). However, PTX is reported to induce premature acrosome reaction (AR) and, exert toxic efects on oocyte function and early embryo development. Additionally, in vitro binding studies as well as computational binding free energy (ΔGbind) suggest that PTX exhibits weak binding to sperm PDEs, indicating room for improvement. Aiming to reduce the adverse efects and to enhance the sperm motility, we designed and studied PTX analogues. Using structure‑guided in silico approach and by considering the physico‑chemical properties of the binding pocket of the PDEs, designed analogues of PTX. In silico assessments indicated that PTX analogues bind more tightly to PDEs and form stable complexes. Particularly, ex vivo evaluation of sperm treated with one of the PTX analogues (PTXm‑1), showed comparable benefcial efect at much lower concentration—slower
    [Show full text]
  • Phosphodiesterase 1B Knock-Out Mice Exhibit Exaggerated Locomotor Hyperactivity and DARPP-32 Phosphorylation in Response to Dopa
    The Journal of Neuroscience, June 15, 2002, 22(12):5188–5197 Phosphodiesterase 1B Knock-Out Mice Exhibit Exaggerated Locomotor Hyperactivity and DARPP-32 Phosphorylation in Response to Dopamine Agonists and Display Impaired Spatial Learning Tracy M. Reed,1,3 David R. Repaske,2* Gretchen L. Snyder,4 Paul Greengard,4 and Charles V. Vorhees1* Divisions of 1Developmental Biology and 2Endocrinology, Children’s Hospital Research Foundation, Cincinnati, Ohio 45229, 3Department of Biology, College of Mount St. Joseph, Cincinnati, Ohio 45233, and 4Laboratory of Molecular and Cellular Neuroscience, Rockefeller University, New York, New York 10021 Using homologous recombination, we generated mice lack- maze spatial-learning deficits. These results indicate that en- ing phosphodiesterase-mediated (PDE1B) cyclic nucleotide- hancement of cyclic nucleotide signaling by inactivation of hydrolyzing activity. PDE1B Ϫ/Ϫ mice showed exaggerated PDE1B-mediated cyclic nucleotide hydrolysis plays a signifi- hyperactivity after acute D-methamphetamine administra- cant role in dopaminergic function through the DARPP-32 and tion. Striatal slices from PDE1B Ϫ/Ϫ mice exhibited increased related transduction pathways. levels of phospho-Thr 34 DARPP-32 and phospho-Ser 845 Key words: phosphodiesterases; DARPP-32; dopamine- GluR1 after dopamine D1 receptor agonist or forskolin stimu- stimulated locomotor activity; spatial learning and memory; lation. PDE1B Ϫ/Ϫ and PDE1B ϩ/Ϫ mice demonstrated Morris Morris water maze; methamphetamine; SKF81297; forskolin Calcium/calmodulin-dependent phosphodiesterases (CaM- (CaMKII) and calcineurin and have the potential to activate PDEs) are members of one of 11 families of PDEs (Soderling et CaM-PDEs. Dopamine D1 or D2 receptor activation leads to al., 1999;Yuasa et al., 2001) and comprise the only family that acts adenylyl cyclase activation or inhibition, respectively (Traficante ϩ as a potential point of interaction between the Ca 2 and cyclic et al., 1976; Monsma et al., 1990; Cunningham and Kelley, 1993; nucleotide signaling pathways.
    [Show full text]
  • Targets and Mechanisms Validated Trials on the Horizon Targets And
    TargetsTargets and and Mechanisms Mechanisms Validated Validated TrialsTrials on on the the Horizon Horizon Research Investors Report 2011 TABLE OF CONTENTS Huntington’s Disease Research in 2011: Targets and Mechanisms Validated; Trials on the Horizon FINDING AND VALIDATING TARGETS 4 DRP1 4 Ku705 5 A CLOSER LOOK AT THE HD PROTEIN 6 HR Protein aggregates visualized 6 Form of the HD protein associated with neurodegeneration identified 7 DISCOVERING/DEVELOPING NEW DRUGS AND UNDERSTANDING THEIR MECHANISMS 10 Dantrolene appears to be neuroprotective 10 Melatonin delays onset and prolongs survival in the R6/2 Mouse 11 KMO Inhibitor developed 12 New Caspase Inhibitors identified and Optimized 14 Quinazoline derivative looks promising 15 Phosphodiesterase-10 inhibitors 16 Novel benzoxazine compounds may be neuroprotective 18 Dimethylfumarate is helpful to the YAC128 Mouse 18 IPSC Consortium creates stem cell lines 19 FINDING AND VALIDATING BIOMARKERS 21 H2AFY 21 Protein Aggregates 22 TRACK-HD 22 UNDERSTANDING THE DISEASE COURSE AND IMPROVING CLINICAL MEASURES 25 Progression of HD and MRI imaging 25 Enroll-HD 25 POTENTIAL TREATMENTS MOVING CLOSE TO CLINICAL TRIALS 27 RNAi Primate Study 27 ASOs can be made allele specific 27 Mesenchymal stem cells with BDNF 28 CLINICAL TRIALS 30 Lessons from Dimebon 30 Neurosearch -- Huntexil (ACR-16) 31 Prana Biotech Copper Chelator 31 Siena Biotech Sirt1 Inhibitor 32 THE OTHER MEMBERS OF THE RESEARCH TEAM - THE PARTICIPANTS 33 FINAL THOUGHTS 35 HD DRUG DEVELOPMENT PIPELINE CHART 36 HDSA COALITION FOR THE CURE 37 HDSA CENTERS OF EXCELLENCE 38 Cover Photo: Polarizing optical microscopy image of huntingtin peptide aggregates stained with Congo Red. Courtesy of Dr.
    [Show full text]
  • Transcriptome-Wide Profiling of Cerebral Cavernous Malformations
    www.nature.com/scientificreports OPEN Transcriptome-wide Profling of Cerebral Cavernous Malformations Patients Reveal Important Long noncoding RNA molecular signatures Santhilal Subhash 2,8, Norman Kalmbach3, Florian Wegner4, Susanne Petri4, Torsten Glomb5, Oliver Dittrich-Breiholz5, Caiquan Huang1, Kiran Kumar Bali6, Wolfram S. Kunz7, Amir Samii1, Helmut Bertalanfy1, Chandrasekhar Kanduri2* & Souvik Kar1,8* Cerebral cavernous malformations (CCMs) are low-fow vascular malformations in the brain associated with recurrent hemorrhage and seizures. The current treatment of CCMs relies solely on surgical intervention. Henceforth, alternative non-invasive therapies are urgently needed to help prevent subsequent hemorrhagic episodes. Long non-coding RNAs (lncRNAs) belong to the class of non-coding RNAs and are known to regulate gene transcription and involved in chromatin remodeling via various mechanism. Despite accumulating evidence demonstrating the role of lncRNAs in cerebrovascular disorders, their identifcation in CCMs pathology remains unknown. The objective of the current study was to identify lncRNAs associated with CCMs pathogenesis using patient cohorts having 10 CCM patients and 4 controls from brain. Executing next generation sequencing, we performed whole transcriptome sequencing (RNA-seq) analysis and identifed 1,967 lncRNAs and 4,928 protein coding genes (PCGs) to be diferentially expressed in CCMs patients. Among these, we selected top 6 diferentially expressed lncRNAs each having signifcant correlative expression with more than 100 diferentially expressed PCGs. The diferential expression status of the top lncRNAs, SMIM25 and LBX2-AS1 in CCMs was further confrmed by qRT-PCR analysis. Additionally, gene set enrichment analysis of correlated PCGs revealed critical pathways related to vascular signaling and important biological processes relevant to CCMs pathophysiology.
    [Show full text]
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad channu.vastrad@gmail.com Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name phospholipase C, delta 3 Gene Symbol PLCD3 Organism Human Gene Summary This gene encodes a member of the phospholipase C family which catalyze the hydrolysis of phosphatidylinositol 45-bisphosphate to generate the second messengers diacylglycerol and inositol 145-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine sphingosine and several phospholipids. Gene Aliases MGC71172 RefSeq Accession No. NC_000017.10, NT_010783.15 UniGene ID Hs.380094 Ensembl Gene ID ENSG00000161714 Entrez Gene ID 113026 Assay Information Unique Assay ID qHsaCED0002601 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000539433, ENST00000322765 Amplicon Context Sequence TGTTGAGCACGTAGTCAGTCTCCTGCCGGGCACAGTCTGCGGGCACCCCATGG ATCTCAATGCGCACCAGGGGGTCCACAATGGAGTGTGGCTTCTCGGCATTCAGC TTGGGCAGCTGCTGTGC Amplicon Length (bp) 94 Chromosome Location 17:43190493-43190616 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 1 cDNA Cq 21.75 cDNA Tm (Celsius) 86.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 23.62 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report PLCD3, Human Amplification Plot Amplification of cDNA generated from
    [Show full text]