Supplementary Table
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Anti-SNX18 Polyclonal Antibody (CABT-B1766) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
Anti-SNX18 polyclonal antibody (CABT-B1766) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Specificity Expected to react with all spliced isoforms. Immunogen Recombinant protein corresponding to human SNX18. Isotype IgG Source/Host Rabbit Species Reactivity Canine, Human Purification Affinity Purfied Conjugate Unconjugated Applications WB, ICC, IP Molecular Weight ~73 kDa observed Format Liquid Concentration Please refer to lot specific datasheet. Size 100 μg Buffer PBS with 0.05% sodium azide. Preservative 0.05% Sodium Azide Storage Stable for 1 year at 2-8°C from date of receipt. BACKGROUND Introduction Sorting nexin-18 (UniProt Q96RF0; also known as SH3 and PX domain-containing protein 3B, Sorting nexin-associated Golgi protein 1) is encoded by the SNX18 (also known as SNAG1, SH3PX2, SH3PXD3B) gene (Gene ID 112574) in human. SNX18, SNX33, and SNX9 constitute a subfamily of sorting nexin (SNX) proteins characterized by a Bin–Amphiphysin–Rvs (BAR) domain that allows dimerization. It also contributes to modulation and shaping of membrane curvature. It also has a Src-homology 3 (SH3) domain that allows interaction with a wide range of proline-rich PXXP motif containing proteins. In addition to mediating endocytosis and intracellular 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved vesicle trafficking, SNX18, SNX33, and SNX9 are also essential for successful completion of the ingression and abscission stages of cytokinesis and for the delivery of a subset of vesicles to the intracellular bridge that connects the two nascent daughter cells during mitosis. -
Genazzani-2003-Calcineurin And
Edinburgh Research Explorer Calcineurin controls the expression of numerous genes in cerebellar granule cells Citation for published version: Kramer, D, Fresu, L, Ashby, DS, Freeman, TC & Genazzani, AA 2003, 'Calcineurin controls the expression of numerous genes in cerebellar granule cells', Molecular and Cellular Neuroscience, vol. 23, no. 2, pp. 325- 30. Link: Link to publication record in Edinburgh Research Explorer Document Version: Publisher's PDF, also known as Version of record Published In: Molecular and Cellular Neuroscience Publisher Rights Statement: © 2003 Elsevier Science (USA) General rights Copyright for the publications made accessible via the Edinburgh Research Explorer is retained by the author(s) and / or other copyright owners and it is a condition of accessing these publications that users recognise and abide by the legal requirements associated with these rights. Take down policy The University of Edinburgh has made every reasonable effort to ensure that Edinburgh Research Explorer content complies with UK legislation. If you believe that the public display of this file breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 28. Sep. 2021 Molecular and Cellular Neuroscience 23 (2003) 325–330 www.elsevier.com/locate/ymcne Calcineurin controls the expression of numerous genes in cerebellar granule cells Dana Kramer,a Luigia Fresu,b Dominique S. Ashby,a Tom C. Freeman,c and Armando A. Genazzania,* a Department of Pharmacology, Tennis Court Road, Cambridge, CB2 1PD, UK b Department of Pharmacology, Gynaecology and Obstetrics, University of Sassari, Italy c Microarray Group, MRC HGMP-RC, Wellcome Trust Genome Campus, Hinxton, CB10 1SB, UK Received 31 October 2002; revised 7 January 2003; accepted 20 January 2003 Abstract The Ca2ϩ/calmodulin-dependent phosphatase calcineurin plays a crucial role in gene expression in different cell types such as T-lymphocytes, cardiac myocytes, and smooth muscle cells. -
Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron. -
Silencing of Phosphoinositide-Specific
ANTICANCER RESEARCH 34: 4069-4076 (2014) Silencing of Phosphoinositide-specific Phospholipase C ε Remodulates the Expression of the Phosphoinositide Signal Transduction Pathway in Human Osteosarcoma Cell Lines VINCENZA RITA LO VASCO1, MARTINA LEOPIZZI2, DANIELA STOPPOLONI3 and CARLO DELLA ROCCA2 Departments of 1Sense Organs , 2Medicine and Surgery Sciences and Biotechnologies and 3Biochemistry Sciences “A. Rossi Fanelli”, Sapienza University, Rome, Italy Abstract. Background: Ezrin, a member of the signal transduction pathway (5). The reduction of PIP2 ezrin–radixin–moesin family, is involved in the metastatic induces ezrin dissociation from the plasma membrane (6). spread of osteosarcoma. Ezrin binds phosphatydil inositol-4,5- The levels of PIP2 are regulated by the PI-specific bisphosphate (PIP2), a crucial molecule of the phospholipase C (PI-PLC) family (7), constituting thirteen phosphoinositide signal transduction pathway. PIP2 levels are enzymes divided into six sub-families on the basis of amino regulated by phosphoinositide-specific phospholipase C (PI- acid sequence, domain structure, mechanism of recruitment PLC) enzymes. PI-PLCε isoform, a well-characterized direct and tissue distribution (7-15). PI-PLCε, a direct effector of effector of rat sarcoma (RAS), is at a unique convergence RAS (14-15), might be the point of convergence for the point for the broad range of signaling pathways that promote broad range of signalling pathways that promote the RAS GTPase-mediated signalling. Materials and Methods. By RASGTPase-mediated signalling (16). using molecular biology methods and microscopic analyses, In previous studies, we suggested a relationship between we analyzed the expression of ezrin and PLC genes after PI-PLC expression and ezrin (17-18). -
Pathway-Based Genome-Wide Association Analysis of Coronary Heart Disease Identifies Biologically Important Gene Sets
European Journal of Human Genetics (2012) 20, 1168–1173 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Pathway-based genome-wide association analysis of coronary heart disease identifies biologically important gene sets Lisa de las Fuentes1,4, Wei Yang2,4, Victor G Da´vila-Roma´n1 and C Charles Gu*,2,3 Genome-wide association (GWA) studies of complex diseases including coronary heart disease (CHD) challenge investigators attempting to identify relevant genetic variants among hundreds of thousands of markers being tested. A selection strategy based purely on statistical significance will result in many false negative findings after adjustment for multiple testing. Thus, an integrated analysis using information from the learned genetic pathways, molecular functions, and biological processes is desirable. In this study, we applied a customized method, variable set enrichment analysis (VSEA), to the Framingham Heart Study data (404 467 variants, n ¼ 6421) to evaluate enrichment of genetic association in 1395 gene sets for their contribution to CHD. We identified 25 gene sets with nominal Po0.01; at least four sets are previously known for their roles in CHD: vascular genesis (GO:0001570), fatty-acid biosynthetic process (GO:0006633), fatty-acid metabolic process (GO:0006631), and glycerolipid metabolic process (GO:0046486). Although the four gene sets include 170 genes, only three of the genes contain a variant ranked among the top 100 in single-variant association tests of the 404 467 variants tested. Significant enrichment for novel gene sets less known for their importance to CHD were also identified: Rac 1 cell-motility signaling pathway (h_rac1 Pathway, Po0.001) and sulfur amino-acid metabolic process (GO:0000096, Po0.001). -
PROTEOMIC ANALYSIS of HUMAN URINARY EXOSOMES. Patricia
ABSTRACT Title of Document: PROTEOMIC ANALYSIS OF HUMAN URINARY EXOSOMES. Patricia Amalia Gonzales Mancilla, Ph.D., 2009 Directed By: Associate Professor Nam Sun Wang, Department of Chemical and Biomolecular Engineering Exosomes originate as the internal vesicles of multivesicular bodies (MVBs) in cells. These small vesicles (40-100 nm) have been shown to be secreted by most cell types throughout the body. In the kidney, urinary exosomes are released to the urine by fusion of the outer membrane of the MVBs with the apical plasma membrane of renal tubular epithelia. Exosomes contain apical membrane and cytosolic proteins and can be isolated using differential centrifugation. The analysis of urinary exosomes provides a non- invasive means of acquiring information about the physiological or pathophysiological state of renal cells. The overall objective of this research was to develop methods and knowledge infrastructure for urinary proteomics. We proposed to conduct a proteomic analysis of human urinary exosomes. The first objective was to profile the proteome of human urinary exosomes using liquid chromatography-tandem spectrometry (LC- MS/MS) and specialized software for identification of peptide sequences from fragmentation spectra. We unambiguously identified 1132 proteins. In addition, the phosphoproteome of human urinary exosomes was profiled using the neutral loss scanning acquisition mode of LC-MS/MS. The phosphoproteomic profiling identified 19 phosphorylation sites corresponding to 14 phosphoproteins. The second objective was to analyze urinary exosomes samples isolated from patients with genetic mutations. Polyclonal antibodies were generated to recognize epitopes on the gene products of these genetic mutations, NKCC2 and MRP4. The potential usefulness of urinary exosome analysis was demonstrated using the well-defined renal tubulopathy, Bartter syndrome type I and using the single nucleotide polymorphism in the ABCC4 gene. -
Structure-Based Redesigning of Pentoxifylline Analogs Against
www.nature.com/scientificreports OPEN Structure‑based redesigning of pentoxifylline analogs against selective phosphodiesterases to modulate sperm functional competence for assisted reproductive technologies Mutyala Satish1,5, Sandhya Kumari2,5, Waghela Deeksha1, Suman Abhishek1, Kulhar Nitin1, Satish Kumar Adiga2, Padmaraj Hegde3, Jagadeesh Prasad Dasappa4, Guruprasad Kalthur2* & Eerappa Rajakumara1* Phosphodiesterase (PDE) inhibitors, such as pentoxifylline (PTX), are used as pharmacological agents to enhance sperm motility in assisted reproductive technology (ART), mainly to aid the selection of viable sperm in asthenozoospermic ejaculates and testicular spermatozoa, prior to intracytoplasmic sperm injection (ICSI). However, PTX is reported to induce premature acrosome reaction (AR) and, exert toxic efects on oocyte function and early embryo development. Additionally, in vitro binding studies as well as computational binding free energy (ΔGbind) suggest that PTX exhibits weak binding to sperm PDEs, indicating room for improvement. Aiming to reduce the adverse efects and to enhance the sperm motility, we designed and studied PTX analogues. Using structure‑guided in silico approach and by considering the physico‑chemical properties of the binding pocket of the PDEs, designed analogues of PTX. In silico assessments indicated that PTX analogues bind more tightly to PDEs and form stable complexes. Particularly, ex vivo evaluation of sperm treated with one of the PTX analogues (PTXm‑1), showed comparable benefcial efect at much lower concentration—slower -
Phosphodiesterase 1B Knock-Out Mice Exhibit Exaggerated Locomotor Hyperactivity and DARPP-32 Phosphorylation in Response to Dopa
The Journal of Neuroscience, June 15, 2002, 22(12):5188–5197 Phosphodiesterase 1B Knock-Out Mice Exhibit Exaggerated Locomotor Hyperactivity and DARPP-32 Phosphorylation in Response to Dopamine Agonists and Display Impaired Spatial Learning Tracy M. Reed,1,3 David R. Repaske,2* Gretchen L. Snyder,4 Paul Greengard,4 and Charles V. Vorhees1* Divisions of 1Developmental Biology and 2Endocrinology, Children’s Hospital Research Foundation, Cincinnati, Ohio 45229, 3Department of Biology, College of Mount St. Joseph, Cincinnati, Ohio 45233, and 4Laboratory of Molecular and Cellular Neuroscience, Rockefeller University, New York, New York 10021 Using homologous recombination, we generated mice lack- maze spatial-learning deficits. These results indicate that en- ing phosphodiesterase-mediated (PDE1B) cyclic nucleotide- hancement of cyclic nucleotide signaling by inactivation of hydrolyzing activity. PDE1B Ϫ/Ϫ mice showed exaggerated PDE1B-mediated cyclic nucleotide hydrolysis plays a signifi- hyperactivity after acute D-methamphetamine administra- cant role in dopaminergic function through the DARPP-32 and tion. Striatal slices from PDE1B Ϫ/Ϫ mice exhibited increased related transduction pathways. levels of phospho-Thr 34 DARPP-32 and phospho-Ser 845 Key words: phosphodiesterases; DARPP-32; dopamine- GluR1 after dopamine D1 receptor agonist or forskolin stimu- stimulated locomotor activity; spatial learning and memory; lation. PDE1B Ϫ/Ϫ and PDE1B ϩ/Ϫ mice demonstrated Morris Morris water maze; methamphetamine; SKF81297; forskolin Calcium/calmodulin-dependent phosphodiesterases (CaM- (CaMKII) and calcineurin and have the potential to activate PDEs) are members of one of 11 families of PDEs (Soderling et CaM-PDEs. Dopamine D1 or D2 receptor activation leads to al., 1999;Yuasa et al., 2001) and comprise the only family that acts adenylyl cyclase activation or inhibition, respectively (Traficante ϩ as a potential point of interaction between the Ca 2 and cyclic et al., 1976; Monsma et al., 1990; Cunningham and Kelley, 1993; nucleotide signaling pathways. -
Targets and Mechanisms Validated Trials on the Horizon Targets And
TargetsTargets and and Mechanisms Mechanisms Validated Validated TrialsTrials on on the the Horizon Horizon Research Investors Report 2011 TABLE OF CONTENTS Huntington’s Disease Research in 2011: Targets and Mechanisms Validated; Trials on the Horizon FINDING AND VALIDATING TARGETS 4 DRP1 4 Ku705 5 A CLOSER LOOK AT THE HD PROTEIN 6 HR Protein aggregates visualized 6 Form of the HD protein associated with neurodegeneration identified 7 DISCOVERING/DEVELOPING NEW DRUGS AND UNDERSTANDING THEIR MECHANISMS 10 Dantrolene appears to be neuroprotective 10 Melatonin delays onset and prolongs survival in the R6/2 Mouse 11 KMO Inhibitor developed 12 New Caspase Inhibitors identified and Optimized 14 Quinazoline derivative looks promising 15 Phosphodiesterase-10 inhibitors 16 Novel benzoxazine compounds may be neuroprotective 18 Dimethylfumarate is helpful to the YAC128 Mouse 18 IPSC Consortium creates stem cell lines 19 FINDING AND VALIDATING BIOMARKERS 21 H2AFY 21 Protein Aggregates 22 TRACK-HD 22 UNDERSTANDING THE DISEASE COURSE AND IMPROVING CLINICAL MEASURES 25 Progression of HD and MRI imaging 25 Enroll-HD 25 POTENTIAL TREATMENTS MOVING CLOSE TO CLINICAL TRIALS 27 RNAi Primate Study 27 ASOs can be made allele specific 27 Mesenchymal stem cells with BDNF 28 CLINICAL TRIALS 30 Lessons from Dimebon 30 Neurosearch -- Huntexil (ACR-16) 31 Prana Biotech Copper Chelator 31 Siena Biotech Sirt1 Inhibitor 32 THE OTHER MEMBERS OF THE RESEARCH TEAM - THE PARTICIPANTS 33 FINAL THOUGHTS 35 HD DRUG DEVELOPMENT PIPELINE CHART 36 HDSA COALITION FOR THE CURE 37 HDSA CENTERS OF EXCELLENCE 38 Cover Photo: Polarizing optical microscopy image of huntingtin peptide aggregates stained with Congo Red. Courtesy of Dr. -
Transcriptome-Wide Profiling of Cerebral Cavernous Malformations
www.nature.com/scientificreports OPEN Transcriptome-wide Profling of Cerebral Cavernous Malformations Patients Reveal Important Long noncoding RNA molecular signatures Santhilal Subhash 2,8, Norman Kalmbach3, Florian Wegner4, Susanne Petri4, Torsten Glomb5, Oliver Dittrich-Breiholz5, Caiquan Huang1, Kiran Kumar Bali6, Wolfram S. Kunz7, Amir Samii1, Helmut Bertalanfy1, Chandrasekhar Kanduri2* & Souvik Kar1,8* Cerebral cavernous malformations (CCMs) are low-fow vascular malformations in the brain associated with recurrent hemorrhage and seizures. The current treatment of CCMs relies solely on surgical intervention. Henceforth, alternative non-invasive therapies are urgently needed to help prevent subsequent hemorrhagic episodes. Long non-coding RNAs (lncRNAs) belong to the class of non-coding RNAs and are known to regulate gene transcription and involved in chromatin remodeling via various mechanism. Despite accumulating evidence demonstrating the role of lncRNAs in cerebrovascular disorders, their identifcation in CCMs pathology remains unknown. The objective of the current study was to identify lncRNAs associated with CCMs pathogenesis using patient cohorts having 10 CCM patients and 4 controls from brain. Executing next generation sequencing, we performed whole transcriptome sequencing (RNA-seq) analysis and identifed 1,967 lncRNAs and 4,928 protein coding genes (PCGs) to be diferentially expressed in CCMs patients. Among these, we selected top 6 diferentially expressed lncRNAs each having signifcant correlative expression with more than 100 diferentially expressed PCGs. The diferential expression status of the top lncRNAs, SMIM25 and LBX2-AS1 in CCMs was further confrmed by qRT-PCR analysis. Additionally, gene set enrichment analysis of correlated PCGs revealed critical pathways related to vascular signaling and important biological processes relevant to CCMs pathophysiology. -
Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses
bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name phospholipase C, delta 3 Gene Symbol PLCD3 Organism Human Gene Summary This gene encodes a member of the phospholipase C family which catalyze the hydrolysis of phosphatidylinositol 45-bisphosphate to generate the second messengers diacylglycerol and inositol 145-trisphosphate (IP3). Diacylglycerol and IP3 mediate a variety of cellular responses to extracellular stimuli by inducing protein kinase C and increasing cytosolic Ca(2+) concentrations. This enzyme localizes to the plasma membrane and requires calcium for activation. Its activity is inhibited by spermine sphingosine and several phospholipids. Gene Aliases MGC71172 RefSeq Accession No. NC_000017.10, NT_010783.15 UniGene ID Hs.380094 Ensembl Gene ID ENSG00000161714 Entrez Gene ID 113026 Assay Information Unique Assay ID qHsaCED0002601 Assay Type SYBR® Green Detected Coding Transcript(s) ENST00000539433, ENST00000322765 Amplicon Context Sequence TGTTGAGCACGTAGTCAGTCTCCTGCCGGGCACAGTCTGCGGGCACCCCATGG ATCTCAATGCGCACCAGGGGGTCCACAATGGAGTGTGGCTTCTCGGCATTCAGC TTGGGCAGCTGCTGTGC Amplicon Length (bp) 94 Chromosome Location 17:43190493-43190616 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 1 cDNA Cq 21.75 cDNA Tm (Celsius) 86.5 Page 1/5 PrimePCR™Assay Validation Report gDNA Cq 23.62 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 2/5 PrimePCR™Assay Validation Report PLCD3, Human Amplification Plot Amplification of cDNA generated from