DOCSLIB.ORG

FCHSD2 Regulates Cell Death and Cell Adhesion

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
FCHSD2 Regulates Cell Death and Cell Adhesion FCHSD2 regulates cell death and cell adhesion by Stephanie Louise Sue A thesis submitted in conformity with the requirements for the degree of Master of Science Department of Medical Biophysics University of Toronto © Copyright by Stephanie Louise Sue 2010 FCHSD2 regulates cell death and cell adhesion Stephanie Louise Sue Master of Science Department of Medical Biophysics University of Toronto 2010 Abstract FCH/CIP4 homology-Bin-Amphiphysin-Rvs (F-BAR) domain proteins are a subfamily of the Bin-Amphiphysin-Rvs (BAR) superfamily of proteins. They contain unique domains that bind and reshape the phospholipid bilayers of endosomal compartments during endocytosis. Using a functional assay for cell survival, we identified an F-BAR protein, FCH/CIP4 homology and double Src homology 3 domains 2 (FCHSD2), that confers drug resistance. Stable expression of shRNA against FCHSD2 in multiple cell types showed that loss of FCHSD2 sensitized cells to apoptosis by doxorubicin. Silencing of FCHSD2 also enhanced the ability of fibroblasts to grow colonies in culture. Mass spectrometry analysis of FCHSD2 protein complexes identified multiple interacting proteins that are involved in adhesion and endosome trafficking. We identified and confirmed a novel interaction between FCHSD2 and sorting nexin 18 (SNX18), a BAR domain protein that binds to endosomes. Our results suggest that FCHSD2 is involved in regulating cellular adhesion and cell death. ii Acknowledgements I owe many thanks to my colleagues who helped in my work and development as a scientist. They include: Enrico Arpaia, Thorsten Berger, Heiko Blaser, Dirk Brenner, Anne Brüstle, Gordon Duncan, Ying Ju Jang, Christiane Knobbe, Jennifer Liepa Silvester, David McIlwain, Elize Shirdel, Yuwen Su, Michael Tusche, and Drew Wakeham. I would also like to thank the Proteomics Facility at the Campbell Family Cancer Research Institute, especially to Theo Goh, for its expertise, which was instrumental to this project. Also, thanks to the Princess Margaret Hospital Flow Cytometry facility for their help and support, and to Irene Ng and Marissa Luchico. I would like to thank my supervisory committee, Dr. Vuk Stambolic and Dr. Mitsu Ikura, for their support, guidance, and encouragement. To my ʻhonoraryʼ committee member, Dr. Mark Minden, thank you for your support and collaboration on the project. Lastly, to my supervisor Dr. Tak Wah Mak, for bringing me into his science family and allowing me the freedom to find my place in it. I would not have been able to pursue this project without the unwavering love and encouragement of my friends and family. Your support means everything. Thank you. iii Table of Contents Chapter 1: Introduction#1 1. Programmed cell death#.....................................................................................1 1.1. Apoptosis#.................................................................................................1 1.2. Autophagy#................................................................................................3 1.3. Necrosis#...................................................................................................3 1.4. Mitotic catastrophe#...................................................................................4 2. Cancer#..............................................................................................................4 2.1. Leukemia#..................................................................................................5 2.1.1. Chronic lymphoblastic leukemia#.......................................................5 2.1.2. Acute lymphoblastic leukemia#..........................................................6 2.1.3. Chronic myeloid leukemia#................................................................6 2.1.4. Acute myeloid leukemia#....................................................................7 3. Endocytosis#......................................................................................................7 3.1. Endocytosis and endosomal recycling#.....................................................8 3.2. Biological functions of endosomal recycling#..........................................10 3.2.1. Growth factor signaling#...................................................................10 3.2.2. Cell adhesion and motility#..............................................................11 4. Studies of BAR superfamily proteins: insights into F-BAR protein structure and function#....................................................................................................12 4.1. Structure of BAR domains#.....................................................................12 4.2. F-BAR domain protein functions#............................................................14 5. FER/CIP4 homology and double Src homology domains 2 (FCHSD2)#..........16 5.1. Human FCHSD2#....................................................................................16 5.2. Drosophila FCHSD2/Nervous Wreck (Nwk)#..........................................17 6. Cyclical Packaging Rescue (CPR)#.................................................................18 7. Rationale of the project#...................................................................................19 8. Hypothesis#......................................................................................................20 Chapter 2: Materials and methods#21 1. Materials#.........................................................................................................21 iv 1.1. Antibodies#..............................................................................................21 1.1.1. Unconjugated#.................................................................................21 1.1.2. Conjugated#.....................................................................................21 1.2. Chemical reagents#.................................................................................21 1.3. Media and buffers#..................................................................................25 1.4. Cell lines#................................................................................................27 1.5. Plasmids#................................................................................................27 1.6. Primers#...................................................................................................28 1.7. shRNA sequences against FCHSD2#.....................................................29 1.7.1. shRNA used in NIH 3T3 cells#.........................................................29 1.7.2. shRNA used in U937 cells#..............................................................29 1.8. Kits#.........................................................................................................29 2. Methods#..........................................................................................................30 2.1. Cloning#...................................................................................................30 2.1.1. FLAG-FCHSD2#..............................................................................30 2.1.2. FCHSD2-Myc#..................................................................................31 2.1.3. HIS-SNX18#.....................................................................................31 2.1.4. shRNA vectors used in NIH 3T3 cells#............................................31 2.2. Bacterial transformation#.........................................................................32 2.3. Cell culture#.............................................................................................32 2.3.1. Cell lines#.........................................................................................32 2.3.2. Drug response assay#.....................................................................32 2.3.3. Colony formation assay#..................................................................33 2.3.4. siRNA transfection#..........................................................................33 2.3.5. U937 differentiation#.........................................................................34 2.3.6. Electroporation#...............................................................................34 2.3.7. Retroviral infection of NIH 3T3 cells#...............................................34 2.3.7.1. Retroviral supernatant production#...........................................34 2.3.7.2. Infection of NIH 3T3 cells#........................................................35 2.3.8. Lentiviral infection of U937 cells#.....................................................35 2.3.8.1. Lentiviral supernatant production#............................................35 v 2.3.8.2. Infection of U937 cells#.............................................................36 2.4. Protein expression analysis#...................................................................36 2.4.1. Cell lysis#.........................................................................................36 2.4.2. Immunoblotting#...............................................................................37 2.5. Protein biochemistry#..............................................................................37 2.5.1. Immunoprecipitation for mass spectrometry analysis#....................37 2.5.2. FCHSD2 and SNX18 immunoprecipitation#.....................................38 2.6. qRT-PCR analysis of FCHSD2 expression#............................................39 2.7. Immunocytochemistry#............................................................................39
Load more

Recommended publications
  • Anti-SNX18 Polyclonal Antibody (CABT-B1766) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Anti-SNX18 polyclonal antibody (CABT-B1766) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Specificity Expected to react with all spliced isoforms. Immunogen Recombinant protein corresponding to human SNX18. Isotype IgG Source/Host Rabbit Species Reactivity Canine, Human Purification Affinity Purfied Conjugate Unconjugated Applications WB, ICC, IP Molecular Weight ~73 kDa observed Format Liquid Concentration Please refer to lot specific datasheet. Size 100 μg Buffer PBS with 0.05% sodium azide. Preservative 0.05% Sodium Azide Storage Stable for 1 year at 2-8°C from date of receipt. BACKGROUND Introduction Sorting nexin-18 (UniProt Q96RF0; also known as SH3 and PX domain-containing protein 3B, Sorting nexin-associated Golgi protein 1) is encoded by the SNX18 (also known as SNAG1, SH3PX2, SH3PXD3B) gene (Gene ID 112574) in human. SNX18, SNX33, and SNX9 constitute a subfamily of sorting nexin (SNX) proteins characterized by a Bin–Amphiphysin–Rvs (BAR) domain that allows dimerization. It also contributes to modulation and shaping of membrane curvature. It also has a Src-homology 3 (SH3) domain that allows interaction with a wide range of proline-rich PXXP motif containing proteins. In addition to mediating endocytosis and intracellular 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved vesicle trafficking, SNX18, SNX33, and SNX9 are also essential for successful completion of the ingression and abscission stages of cytokinesis and for the delivery of a subset of vesicles to the intracellular bridge that connects the two nascent daughter cells during mitosis.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Pathway-Based Genome-Wide Association Analysis of Coronary Heart Disease Identifies Biologically Important Gene Sets
    European Journal of Human Genetics (2012) 20, 1168–1173 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg ARTICLE Pathway-based genome-wide association analysis of coronary heart disease identifies biologically important gene sets Lisa de las Fuentes1,4, Wei Yang2,4, Victor G Da´vila-Roma´n1 and C Charles Gu*,2,3 Genome-wide association (GWA) studies of complex diseases including coronary heart disease (CHD) challenge investigators attempting to identify relevant genetic variants among hundreds of thousands of markers being tested. A selection strategy based purely on statistical significance will result in many false negative findings after adjustment for multiple testing. Thus, an integrated analysis using information from the learned genetic pathways, molecular functions, and biological processes is desirable. In this study, we applied a customized method, variable set enrichment analysis (VSEA), to the Framingham Heart Study data (404 467 variants, n ¼ 6421) to evaluate enrichment of genetic association in 1395 gene sets for their contribution to CHD. We identified 25 gene sets with nominal Po0.01; at least four sets are previously known for their roles in CHD: vascular genesis (GO:0001570), fatty-acid biosynthetic process (GO:0006633), fatty-acid metabolic process (GO:0006631), and glycerolipid metabolic process (GO:0046486). Although the four gene sets include 170 genes, only three of the genes contain a variant ranked among the top 100 in single-variant association tests of the 404 467 variants tested. Significant enrichment for novel gene sets less known for their importance to CHD were also identified: Rac 1 cell-motility signaling pathway (h_rac1 Pathway, Po0.001) and sulfur amino-acid metabolic process (GO:0000096, Po0.001).
    [Show full text]
  • RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases
    G C A T T A C G G C A T genes Review RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases Amber Willbanks, Shaun Wood and Jason X. Cheng * Department of Pathology, Hematopathology Section, University of Chicago, Chicago, IL 60637, USA; [email protected] (A.W.); [email protected] (S.W.) * Correspondence: [email protected] Abstract: Chromatin structure plays an essential role in eukaryotic gene expression and cell identity. Traditionally, DNA and histone modifications have been the focus of chromatin regulation; however, recent molecular and imaging studies have revealed an intimate connection between RNA epigenetics and chromatin structure. Accumulating evidence suggests that RNA serves as the interplay between chromatin and the transcription and splicing machineries within the cell. Additionally, epigenetic modifications of nascent RNAs fine-tune these interactions to regulate gene expression at the co- and post-transcriptional levels in normal cell development and human diseases. This review will provide an overview of recent advances in the emerging field of RNA epigenetics, specifically the role of RNA modifications and RNA modifying proteins in chromatin remodeling, transcription activation and RNA processing, as well as translational implications in human diseases. Keywords: 5’ cap (5’ cap); 7-methylguanosine (m7G); R-loops; N6-methyladenosine (m6A); RNA editing; A-to-I; C-to-U; 2’-O-methylation (Nm); 5-methylcytosine (m5C); NOL1/NOP2/sun domain Citation: Willbanks, A.; Wood, S.; (NSUN); MYC Cheng, J.X. RNA Epigenetics: Fine-Tuning Chromatin Plasticity and Transcriptional Regulation, and the Implications in Human Diseases. Genes 2021, 12, 627.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Proteomics Provides Insights Into the Inhibition of Chinese Hamster V79
    www.nature.com/scientificreports OPEN Proteomics provides insights into the inhibition of Chinese hamster V79 cell proliferation in the deep underground environment Jifeng Liu1,2, Tengfei Ma1,2, Mingzhong Gao3, Yilin Liu4, Jun Liu1, Shichao Wang2, Yike Xie2, Ling Wang2, Juan Cheng2, Shixi Liu1*, Jian Zou1,2*, Jiang Wu2, Weimin Li2 & Heping Xie2,3,5 As resources in the shallow depths of the earth exhausted, people will spend extended periods of time in the deep underground space. However, little is known about the deep underground environment afecting the health of organisms. Hence, we established both deep underground laboratory (DUGL) and above ground laboratory (AGL) to investigate the efect of environmental factors on organisms. Six environmental parameters were monitored in the DUGL and AGL. Growth curves were recorded and tandem mass tag (TMT) proteomics analysis were performed to explore the proliferative ability and diferentially abundant proteins (DAPs) in V79 cells (a cell line widely used in biological study in DUGLs) cultured in the DUGL and AGL. Parallel Reaction Monitoring was conducted to verify the TMT results. γ ray dose rate showed the most detectable diference between the two laboratories, whereby γ ray dose rate was signifcantly lower in the DUGL compared to the AGL. V79 cell proliferation was slower in the DUGL. Quantitative proteomics detected 980 DAPs (absolute fold change ≥ 1.2, p < 0.05) between V79 cells cultured in the DUGL and AGL. Of these, 576 proteins were up-regulated and 404 proteins were down-regulated in V79 cells cultured in the DUGL. KEGG pathway analysis revealed that seven pathways (e.g.
    [Show full text]
  • HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201834 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPH1 Synonyms: hnRNPH; HNRPH; HNRPH1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone – RC201834 ORF Nucleotide >RC201834 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
    [Show full text]
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Snapshot: the Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J
    192 Cell SnapShot: The Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J. Blencowe 133 Banting and Best Department of Medical Research, University of Toronto, Toronto, ON M5S 3E1, Canada Expression in mouse , April4, 2008©2008Elsevier Inc. Low High Name Other Names Protein Domains Binding Sites Target Genes/Mouse Phenotypes/Disease Associations Amy Ceb Hip Hyp OB Eye SC BM Bo Ht SM Epd Kd Liv Lu Pan Pla Pro Sto Spl Thy Thd Te Ut Ov E6.5 E8.5 E10.5 SRp20 Sfrs3, X16 RRM, RS GCUCCUCUUC SRp20, CT/CGRP; −/− early embryonic lethal E3.5 9G8 Sfrs7 RRM, RS, C2HC Znf (GAC)n Tau, GnRH, 9G8 ASF/SF2 Sfrs1 RRM, RS RGAAGAAC HipK3, CaMKIIδ, HIV RNAs; −/− embryonic lethal, cond. KO cardiomyopathy SC35 Sfrs2 RRM, RS UGCUGUU AChE; −/− embryonic lethal, cond. KO deficient T-cell maturation, cardiomyopathy; LS SRp30c Sfrs9 RRM, RS CUGGAUU Glucocorticoid receptor SRp38 Fusip1, Nssr RRM, RS ACAAAGACAA CREB, type II and type XI collagens SRp40 Sfrs5, HRS RRM, RS AGGAGAAGGGA HipK3, PKCβ-II, Fibronectin SRp55 Sfrs6 RRM, RS GGCAGCACCUG cTnT, CD44 DOI 10.1016/j.cell.2008.03.010 SRp75 Sfrs4 RRM, RS GAAGGA FN1, E1A, CD45; overexpression enhances chondrogenic differentiation Tra2α Tra2a RRM, RS GAAARGARR GnRH; overexpression promotes RA-induced neural differentiation SR and SR-Related Proteins Tra2β Sfrs10 RRM, RS (GAA)n HipK3, SMN, Tau SRm160 Srrm1 RS, PWI AUGAAGAGGA CD44 SWAP Sfrs8 RS, SWAP ND SWAP, CD45, Tau; possible asthma susceptibility gene hnRNP A1 Hnrnpa1 RRM, RGG UAGGGA/U HipK3, SMN2, c-H-ras; rheumatoid arthritis, systemic lupus
    [Show full text]
  • (P -Value<0.05, Fold Change≥1.4), 4 Vs. 0 Gy Irradiation
    Table S1: Significant differentially expressed genes (P -Value<0.05, Fold Change≥1.4), 4 vs. 0 Gy irradiation Genbank Fold Change P -Value Gene Symbol Description Accession Q9F8M7_CARHY (Q9F8M7) DTDP-glucose 4,6-dehydratase (Fragment), partial (9%) 6.70 0.017399678 THC2699065 [THC2719287] 5.53 0.003379195 BC013657 BC013657 Homo sapiens cDNA clone IMAGE:4152983, partial cds. [BC013657] 5.10 0.024641735 THC2750781 Ciliary dynein heavy chain 5 (Axonemal beta dynein heavy chain 5) (HL1). 4.07 0.04353262 DNAH5 [Source:Uniprot/SWISSPROT;Acc:Q8TE73] [ENST00000382416] 3.81 0.002855909 NM_145263 SPATA18 Homo sapiens spermatogenesis associated 18 homolog (rat) (SPATA18), mRNA [NM_145263] AA418814 zw01a02.s1 Soares_NhHMPu_S1 Homo sapiens cDNA clone IMAGE:767978 3', 3.69 0.03203913 AA418814 AA418814 mRNA sequence [AA418814] AL356953 leucine-rich repeat-containing G protein-coupled receptor 6 {Homo sapiens} (exp=0; 3.63 0.0277936 THC2705989 wgp=1; cg=0), partial (4%) [THC2752981] AA484677 ne64a07.s1 NCI_CGAP_Alv1 Homo sapiens cDNA clone IMAGE:909012, mRNA 3.63 0.027098073 AA484677 AA484677 sequence [AA484677] oe06h09.s1 NCI_CGAP_Ov2 Homo sapiens cDNA clone IMAGE:1385153, mRNA sequence 3.48 0.04468495 AA837799 AA837799 [AA837799] Homo sapiens hypothetical protein LOC340109, mRNA (cDNA clone IMAGE:5578073), partial 3.27 0.031178378 BC039509 LOC643401 cds. [BC039509] Homo sapiens Fas (TNF receptor superfamily, member 6) (FAS), transcript variant 1, mRNA 3.24 0.022156298 NM_000043 FAS [NM_000043] 3.20 0.021043295 A_32_P125056 BF803942 CM2-CI0135-021100-477-g08 CI0135 Homo sapiens cDNA, mRNA sequence 3.04 0.043389246 BF803942 BF803942 [BF803942] 3.03 0.002430239 NM_015920 RPS27L Homo sapiens ribosomal protein S27-like (RPS27L), mRNA [NM_015920] Homo sapiens tumor necrosis factor receptor superfamily, member 10c, decoy without an 2.98 0.021202829 NM_003841 TNFRSF10C intracellular domain (TNFRSF10C), mRNA [NM_003841] 2.97 0.03243901 AB002384 C6orf32 Homo sapiens mRNA for KIAA0386 gene, partial cds.
    [Show full text]
  • F-BAR Domain Only Protein 1 (FCHO1) Deficiency Is a Novel Cause of Combined Immune Deficiency in Human Subjects
    Letter to the Editor F-BAR domain only protein 1 (FCHO1) P5 was homozygous for the c.2711G>A mutation, which was deficiency is a novel cause of com- predicted to disrupt the intron 2 donor splice site and the correct bined immune deficiency in human FCHO1 amino acid sequence after Trp9 (Fig 1, B). No samples subjects were available to test the consequences of this mutation at the cDNA level. We performed quantitative PCR analysis of FCHO1 and To the Editor: FCHO2 expression in control CD41 and CD81 T cells, CD191 Clathrin-mediated endocytosis (CME) is the major endocytic B cells, CD561 natural killer cells, fibroblasts, and the K562 pathway by which eukaryotic cells internalize cell-surface cargo erythroleukemic cell line and observed differential expression. proteins and extracellular molecules, thereby enabling a broad FCHO1 was predominantly expressed in lymphoid cells, whereas range of biological processes, including cell signaling, nutrient FCHO2 was more abundantly expressed in fibroblasts and and growth factor uptake, and cell fate and differentiation.1 K562 cells (see Fig E3 in this article’s Online Repository at F-BAR domain only proteins 1 and 2 (FCHO1/FCHO2) are www.jacionline.org). involved in the maturation of clathrin-coated pit formation.2 To clarify the mechanisms underlying the T-cell lymphopenia Through the N-terminal F-BAR domain, they bind to observed in the patients, we first analyzed T-cell activation and phosphatidylinositol 4,5-biphosphate on the inner side of the proliferation in PBMCs from healthy control subjects and P2, the cell membrane, inducing and stabilizing membrane curvature.3 only patient from whom pre-HSCT PBMCs were available.
    [Show full text]
  • Phylogenetic Analysis of the Haemagglutinin Gene of Canine
    Guo et al. Virology Journal 2013, 10:109 http://www.virologyj.com/content/10/1/109 RESEARCH Open Access Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China Ling Guo1, Shao-lin Yang1, Cheng-dong Wang2, Rong Hou3, Shi-jie Chen4, Xiao-nong Yang5, Jie Liu1, Hai-bo Pan1, Zhong-xiang Hao1, Man-li Zhang1, San-jie Cao1 and Qi-gui Yan1,6* Abstract Background: Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results: Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions: These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. Keywords: Canine distemper virus, Haemagglutinin (H) gene, Genotype, Phylogenetic analysis Background of specialist traits and increased expression of generalist CD is caused by the canine distemper virus (CDV) which traits, thereby confirming its functional importance [10].
    [Show full text]