Phylogenetic Analysis of the Haemagglutinin Gene of Canine

Guo et al. Virology Journal 2013, 10:109 http://www.virologyj.com/content/10/1/109

RESEARCH Open Access Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China Ling Guo1, Shao-lin Yang1, Cheng-dong Wang2, Rong Hou3, Shi-jie Chen4, Xiao-nong Yang5, Jie Liu1, Hai-bo Pan1, Zhong-xiang Hao1, Man-li Zhang1, San-jie Cao1 and Qi-gui Yan1,6*

Abstract Background: Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results: Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions: These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. Keywords: Canine distemper virus, Haemagglutinin (H) gene, Genotype, Phylogenetic analysis

Background of specialist traits and increased expression of generalist CD is caused by the canine distemper virus (CDV) which traits, thereby confirming its functional importance [10]. belongs to the Morbillivirus genus of the Paramyxoviridae The H gene has been used to investigate the genetic virus family. This virus infects a broad range of animals, relationships among the various strains [11-13]. On the such as Mustelidae (ferrets, minks, skunks, weasels, and basis of the full-length sequence of the H gene of CDV badgers), Procyonidae (raccoons), Ursidae (bears and strains identified globally, at least seven main geographic pandas), Viverridae (civets, genets, and linsangs), hyaenidae groups (genotypes) appear to circulate among the vari- (hyenas), and Felidae (lions and tigers) [1-7]. The gen- ous susceptible hosts, namely America-1, America-2, ome of CDV encodes the following genes: matrix (M), Asia-1 and Asia-2, Europe, Europe wildlife and Arctic fusion (F), hemagglutinin (H), nucleocapsid (N), poly- [14-17]. In addition, some CDV strains identified in Africa, merase (L), and phosphoprotein (P). The H gene protein Asia and Argentina [18-20] appear to diverge substantially is responsible for viral attachment to the cell host [8] and might represent separate geographic groups. and is the most variable protein described for all members N glycosylation has been shown to be important for of the genus Morbillivirus [9]. Experimental investigation the correct folding, transport, and function of other showed that changing one amino acid (Y549H) in the paramyxovirus fusion and attachment glycoproteins [21]. CDV-H protein of one dog strain can decreased expression There are significant molecular differences between the glycoproteins of wild-type and vaccine CDV strains. It has * Correspondence: [email protected] been hypothesized that reduced N glycosylation is an im- 1 ’ College of Veterinary Medicine, Sichuan Agricultural University, Ya an, China portant attenuating factor and that an increase in N glyco- 6Key laboratory of Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural University, Ya’an, China sylation may eventually result in vaccine failure [15,22]. Full list of author information is available at the end of the article

© 2013 Guo et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Guo et al. Virology Journal 2013, 10:109 Page 2 of 7 http://www.virologyj.com/content/10/1/109

Although the use of live attenuated vaccines has greatly helped to prevent CDV infections in susceptible animals, the dental abnormalities and enamel erosion that are found in many young and adult giant pandas [23,24] may be related to early infection with CDV [25,26]. Several episodes also have been reported in raccoon dogs [20]. So in this work we analyzed a total of 7 samples from raccoon dogs with clinical signs of canine distemper and 1 sample from giant panda which were submitted to our laboratories and the viruses were analyzed using a fragment of the H gene.

Results CDV detection by NP-based RT-PCR We analyzed a total number of 108 samples taken from raccoon dogs with suspect of CDV infection. CDV RNA was detected in 56 out of 108 (51.8%) blood samples, most of the raccoon dogs, between the age of 15–30 weeks. Negative samples were assayed twice to confirm the results. Forty-one of the 56 positive clinical specimens (73.2%) were obtained from raccoon dogs which had been vaccinated against CDV at least once. Twelve samples (21.4%) were obtained from unvaccinated raccoon dogs, and the vaccination status of the three remaining raccoon dogs was un- known. Forty-nine of the 56 positive animals (87.5%), showed symptoms typical of CDV, such as respiratory disease and neurological dysfunction, two raccoon dogs were asymptomatic, while no records were available for the other five raccoon dogs. The giant panda showed a mild fever (anal temperature 39.0°C).

Sequence and phylogenetic analysis of the H gene Amplification of fragments of the expected size was obtained with H gene and the sequences determined. After removing primer-derived sequences and some sequences with inconsistencies at the 5’ and 3’ ends, a 594 bp-long fragment of the H gene were obtained. The neighbor joining tree (Figure 1) generated using a 594 base pair (bp) long partial sequences of the H gene (amplified with primers “B”), evidenced geographic Figure 1 Phylogenetic relationships among 73 CDV isolates patterns (genotypes) resembling the patterns described based on the amino acid sequences of the H gene. Distance previously using the full-length H gene (Asia 1, Asia 2, values were calculated by the ClustalW program within the MEGA Europe, Arctic, America1 and America 2). In the phylo- 5.0 software package. The Neighbor-Joining algorithm was used to genetic tree (Figure 1) all the Chinese wild-type viruses generate the tree. Bootstrap values were calculated on 1000 (8/8) grouped together in one branch in the Asia-1 replicates. Only bootstrap values >75% were shown. Filled quadrate (■) indicates the 8 Chinese wild-type CDV strains genotype. In this genotype, other Chinese CDV strains analyzed in this study. identified from domestic dogs or other wildlife species after the 1990s were also included, along with some Japanese and Korean strains detected before 1998. The 8 (Table 1). The 4 strains (Sichuan 02–05) displayed high Asia-1 strains displayed identity to each other in the H identity to each other (97.4-99.8% nt and 98.4-99.8% aa). gene (91.5-99.8% nt and 94.4-99.8% aa), while identity to On the other hand, although strain Sichuan06 appeared the vaccine strains CDV3, Onderstepoort and Lederle to belong to the main Asia 1 clade, it is more distant was lower (85.4-89.2% nt and 84.4-88.3% at aa level) from the group (Figure 1). Guo et al. Virology Journal 2013, 10:109 Page 3 of 7 http://www.virologyj.com/content/10/1/109

Table 1 Homology of nucleotide and amino acid sequences of CDV H gene Sichuan01 Sichuan02 Sichuan03 Sichuan04 Sichuan05 Sichuan06 Sichuan07 Sichuan08 CDV3 Onderstepoot Lederle Nucleotides(%) Sichuan01 93.1 94.1 94.9 94.9 94.6 98.3 98.0 86.5 85.4 86.7 Sichuan02 94.4 98.5 98.3 98.3 96.6 94.9 94.9 89.1 87.7 89.2 Sichuan03 95.0 98.4 97.4 97.4 94.6 95.2 92.1 87.7 86.5 88.0 Sichuan04 95.0 99.4 99.7 99.8 97.3 97.5 91.7 88.0 86.5 88.2 Sichuan05 95.0 99.5 99.6 99.8 97.5 97.7 91.9 88.2 86.6 88.5 Sichuan06 95.5 98.9 99.4 99.5 99.4 95.9 91.5 88.0 86.5 88.2 Sichuan07 99.8 94.4 95.0 95.0 95.0 95.5 93.9 88.0 86.4 88.3 Sichuan08 99.7 94.5 95.3 95.0 95.0 95.5 99.5 88.4 87.2 88.6 CDV3 86.0 86.6 87.2 87.2 87.5 87.7 86.0 86.4 96.1 99.0 Onderstepoot 84.4 84.9 85.5 85.5 85.7 86.0 84.4 84.7 93.9 96.0 Lederle 86.6 87.2 87.7 87.7 87.9 88.3 86.6 86.8 97.2 93.9 Amino acids(%)

Analysis of the amino acid sequences of the H gene of responsible for relevant economic losses in Chinese fur in- wild-type CDV strains dustry [20]. In order to determine the frequency of this in- The inferred aa sequences of the partial H protein of fection, we analyzed the samples taken from raccoon dogs the 8 wild-type Chinese CDV strains and of vaccine with suspect of CDV infection. Our result revealed a rela- (America-1 genotype) strains were aligned. The giant tively high (51.8%) prevalence of CDV infection animals panda and raccoon dogs all were 549Y on the HA sampled with clinical signs consistent with CDV infection. protein from the current study (Table 2). Inspection of This indicated that CDV still represents a high risk to the the H protein alignment (Table 3) revealed that all the canine population in China. Furthermore, all samples were 7 Asia-1 strains possessed 9 potential N-linked glycosyla- tested twice and the results were reproducible. One pos- tion sites (N-X-S/T) at aa positions 19–21, 149–151, sible explanation for the 52 animals thought to be infected 309–311, 391–393,422–424, 456–458, 584–586, 587–589 with CDV were found negative by PCR screening is the and 603–605. In the H protein of strain Sichuan01, the ability of detecting low copy numbers of RNA. Another sites at positions 584–586 and 603–605 were disrupted. possible explanation for the negative is the presence of Taq The strain Onderstepoort had only four glycosylation polymerase inhibitors on blood samples, since it is known sites, while strains CDV3, Lederle and Convac displayed that blood material contains nucleases that degrades RNA, seven glycosylation sites. and substances, such as heparin and hemoglobin were found to inhibit the activity of Taq DNA polymerase [27]. Discussion The molecular analysis of the amplifications obtained Despite the vaccination procedures adopted in China in by the use of primer pair “B” helped to clarify the rela- the last decades, CDV is still a serious threat to breed- tionship of the China strains with other CDV strains ing raccoon dogs as well as to domestic dogs and it is reported in other parts of the world. The analysis has

Table 2 CDV isolates from China, organs from which they were isolated and their GenBank accession numbers Serial no Isolate Host Foster mode Vaccinated Organ source GenBank accession no. 549 1 Sichuan01 Raccoon dog Captivity Yes Blood JX406733 Y 2 Sichuan02 Raccoon dog Captivity Yes Blood JX406734 Y 3 Sichuan03 Raccoon dog Captivity Yes Blood JX406736 Y 4 Sichuan04 Raccoon dog Captivity Yes Blood JX406737 Y 5 Sichuan05 Raccoon dog Captivity Yes Blood JX406738 Y 6 Sichuan06 Raccoon dog Captivity Yes Blood JX406739 Y 7 Sichuan07 Raccoon dog Captivity Yes Blood JX406740 Y 8 Sichuan08 Giant Panda Captivity Yes Blood JX406735 Y Guo et al. Virology Journal 2013, 10:109 Page 4 of 7 http://www.virologyj.com/content/10/1/109

Table 3 Distribution status of N-glycosylation sites of H gene in different genetypes of CDV Genetype CDV isolate N-glycosylation sites in each sequence 19 149 309 391 421 456 584 587 603 Asia-1 Sichuan01 N N N N N N N N N Sichuan02 N N N N N N N N N Sichuan03 N N N N N N N N N Sichuan04 N N N N N N N N N Sichuan05 N N N N N N N N N Sichuan06 N N N N N N N N N Sichuan07 N N N N N N N N N Sichuan08 N N N N N N N N N Vaccines Onderstepoort N N - - N - - N - Convac N N - N N N - N N CDV3 N N - N N N - N N Lederle N N - N N N - N N Note:“N”: N-glycosylation Sites;“-”: negative. shown that the strains of giant panda and raccoon dogs in strains. Some studies believed that the variants from H this study are placed on one branches of the phylogenetic protein glycosylation played a crucial role in the anti- tree, were characterized as Asia-1 genotype. The H gene- genic differences and increase in N glycosylation may based neighbor-joining phylogenetic tree analysis using se- eventually result in vaccine failure [15,39]. So, we lected sequences retrieved from GenBank revealed conjectured that the giant panda and raccoon dogs geographic-related patterns of segregation. Our findings infected CDV maybe due to this reason in this time. are consistent with previous studies demonstrating the oc- Based on phylogenetic analyses of complete sequences currence of strains belonging to genetically distinct CDV data from CDV strains retrieved from domestic dog and lineages in Asia [20,28,29]. The Chinese Asia-1 strains non-dog species it was hypothesized that positive selec- displayed a high genetic conservation with other Asia-1 tion drives residues 530 and 549 of the HA gene, and CDVs, which detected from raccoon dogs or other carni- that the presence of specific residues at these positions vores in China over nearly two decades (Figure 1). The resulted in the emergence of CDV as a disease of novel strain Sichuan08 was obtained from a mild fever giant host species [31]. Recently, it has been suggested that panda in the Mar of 2012, and it showed the identity be- there no evidence that amino acid 530 was strongly af- tween Sichuan02-06 were 94.5-95.5%. Because there were fected by host species, while wild canids there was a few reports of giant panda clinical onset of CDV infection nearly significant trend towards a 549Y bias, non-canid up to now, so we couldn't determine whether or not the strains showed no significant bias towards either H or Y fever is the clinical manifestations of the giant panda. at site 549 [9]. In this study, We found that amino acid The observed diversity between the vaccine strains 549Y was conserved within CDV lineages, regardless of and recent wild-type CDVs may be accounted for by sev- host species. CDV transmission in wild carnivore and eral mechanisms, such as adaptation to new host species non-canids species may also most often occur between [30,31], antigenic escape [32-35] and/or genetic recom- individuals within a species, and will be influenced by a bination between wild-type strains [36], variously driving range of factors such as population size and ranging pat- the evolution of the virus. It has been described that terns [40,41]. changes in N-glycosylation of the H protein may affect neutralization by antibodies and replication in vitro Conclusions [15,37,38]. So, the connected aspartic amide N glycosyla- In conclusion, the results presented by this study from a tion site potentially is a spotlight in H proteins between relatively small number of samples obtained from two host vaccine and wild strains of CDV. Usually, there are four species conform to information obtained by other studies (Onderstepoort strain) or seven (CDV3, Lederle and in China, that information currently available on CDV Convac strain) potential sites in the vaccine strains. strains in China, including the results from the current However, seven or nine sites have been detected in all study, is insufficient to determine whether or not the Asia wild CDV strains, of which 309–311 N-connected amide 1 genotype is the predominant genotype in China. Analysis asparagine glycosylation sites are specific to CDV field of CDV strains from a variety of host species will provide a Guo et al. Virology Journal 2013, 10:109 Page 5 of 7 http://www.virologyj.com/content/10/1/109

more in-depth understanding of the global ecology of manufacturer’s instruction: 37°C for 15 min, 85°C for 5 sec, CDV, So, detect these more research on a broader range of using 7 μlofRNA,2μl 5 × PrimeScript buffer, 0.5 μlran- potential carnivore hosts is required. dom primer and 0.5 μl PrimeScript RT Enzyme. The CDV- positive samples were tested with primers “B” (Table 4), Materials and methods which amplifying a 613 bp fragment (corresponding to po- Viruses and clinical specimens sitions 8006–8619 of the Onderstepoort strain genome). Ethics statement The thermo-cycling condition were as follows: 5 min at The animal from which specimens were collected, was 94°C (initial denaturation), 30 cycles of 30 sec at 94°C, handled in accordance with animal protection law of the 30 sec at 51°C, 30 sec at 72°C, and a final extension of People’s Republic of China (a draft of an animal protec- 10 min at 72°C. tion law in China released on September 18, 2009). This study was approved by the National Institute of Animal Cloning and sequencing Health Animal Care and Use Committee at Sichuan PCR products of the correct size (613 bp in length) were Agricultural University (approval number 2010–020). amplified and cloned into the pMD 19-T vector (TaKaRa, From 2011 to 2012, 108 samples (whole blood) of rac- Dalian, China). For each CDV strain, 3–5 positive recom- coon dogs with suspect of CDV infection were sent to binant plasmids were sequenced in both directions using our laboratory for diagnostic confirmation and were primer M13 (Shanghai Invitrogen Biotechnology Com- identified only in 56 samples (51.8%) by using a RT- pany, Shanghai, China) and additional primers selected on PCR, which amplifies a 242 bp-long fragment of the nu- the basis of the obtained sequences. The accession num- cleoprotein (NP) gene with primers “A” ( Table 4). Out bers are shown in Table 2. of 56 samples, 7 could be included in this study based on the amount of the sample and the amount of RNA Amino acid analysis extracts available for additional analysis. The samples To investigate the differences between the Chinese wild- were submitted to our laboratory from 3 different pri- type CDV strains and the vaccine strains available in the vate fur farms within ya’an, Sichuan province. The or- market in China, the deduced amino acid (aa) sequences gans of the giant panda (whole blood) were submitted to of the H protein were aligned. Multiple sequence align- our laboratory by China Conservation and Research ment was carried out using the software package Center for the Giant Panda, Ya’an, China. Detailed infor- MegAlign (Lasergene7.0, DNAStar Inc., Madison, WI). mation on the origin and the accession numbers of the The aa present at sites 549 on the HA protein was deter- CDV-positive samples is shown in Table 2. mined for the eight strains from the current study. The potential N-linked glycosylation sites of the H protein Extraction of nucleic acids were determined using the software NetNGlyc1.0. Viral RNA was extracted from leucocytes obtained by washing with nuclease-free water. Briefly, 500 μlof Phylogenetic analysis nuclease-free water were added to 500 μl of whole blood The eight China CDV sequences were compared to those in a 1.5 microcentrifuge tube, and centrifuged 7 min at of 64 CDV strains that were obtained from various part of 5,000 g. A total of 500 μl of the supernatant was the world up until November 2010. The Accession num- discarded, then 500 μl of nuclease-free water were added, bers for these H gene nucleotide sequences were obtained repeating this step 3 times. Total RNA was extracted from the GenBank nucleotide database at the National W with TRI Reagent (Sigma , USA), following the manufac- Center for Biotechnology Information (NCBI). The nucleo- turer’s instructions. tide sequences were analyzed preliminary with cognate sequences available in GenBank using BLAST software RT-PCR (http://www.ncbi.nlm.nih.gov/). Multiple sequence align- ™ Reverse transcription was carried out by PrimeScript ment was made with ClustalW software [42] included in RT reagent Kit (TaKaRa, Dalian, China) according to the MEGA 5.0 software [43].

Table 4 Description of the primer pairs Primer pair Sequence 5’–3’ Target Sense Purpose Amplicon size (bp) A CGGAAATCAACGGACCTAAAT N + Diagnostic 242 TCCTTGAGCTTTCGACCCTT _ B TGGTTCACAAGATGGTATTC H + Phylogenetic 613 CAACACCAC TAAATTGGACT _ Guo et al. Virology Journal 2013, 10:109 Page 6 of 7 http://www.virologyj.com/content/10/1/109

Sequences for comparison were obtained corresponded 10. Nikolin VM, Osterrieder K, von Messling V, Hofer H, Anderson D, Dubovi E, to nucleotide sequences of the H gene. Phylogenetic ana- Brunner E, East ML: Antagonistic pleiotropy and fitness trade-offs reveal specialist and generalist traits in strains of canine distemper virus. PLoS lysis of nucleotide were computed using the Kimura two One 2012, 7:e50955. parameter algorithm and the tree was constructed with the 11. Demeter Z, Lakatos B, Palade EA, Kozma T, Forgách P, Rusvai M: Genetic Neighbor Joining method with a 1000 bootstrap repeats diversity of Hungarian canine distemper virus strains. Vet Microbiol 2007, 122:258–269. using the MEGA 5.0 Software [43]. The measles virus 12. Haas L, Martens W, Greiser-Wilke I, Mamaev L, Butina T, Maack D, Barrett T: (MeV) (NC001498), phocine (seal) distemper virus (PDV) Analysis of the haemagglutinin gene of current wild-type canine (AF479274), peste-des- petits-ruminants virus (PPRV) distemper virus isolates from Germany. Virus Res 1997, 48:165–171. 13. Martella V, Cirone F, Elia G, Lorusso E, Decaro N, Campolo M, Desario C, (NC006383), hendra virus (HeV) (NC001906) and dolphin Lucente M, Bellacicco A, Blixenkrone-Møller M: Heterogeneity within the morbillivirus (DMV) (NC005283) were used as outgroup hemagglutinin genes of canine distemper virus (CDV) strains detected in in the neighbor joining trees. Italy. Vet Microbiol 2006, 116:301–309. 14. Bolt G, Jensen TD, Gottschalck E, Arctander P, Appel MJ, Buckland R, Blixenkrone-Moller M: Genetic diversity of the attachment (H) protein Competing interests gene of current field isolates of canine distemper virus. J Gen Virol 1997, The authors declare that they have no competing interests. 78:367–372. 15. Iwatsuki K, Miyashita N, Yoshida E, Gemma T, Shin YS, Mori T, Hirayama N, Authors’ contributions Kai C, Mikami T: Molecular and phylogenetic analyses of the Conceived and designed the experiments: LG QGY SJC. Performed the haemagglutinin (H) proteins of field isolates of canine distemper virus experiments: LG SLY ZXH JL HBP. Analyzed the data: LG SLY MLZ. from naturally infected dogs. J Gen Virol 1997, 78:373–380. Contributed reagents/materials /analysis tools: SJC CDW RH XNY . Wrote the 16. Martella V, Elia G, Lucente MS, Decaro N, Lorusso E, Banyai K, paper: LG SLY. All of the authors read and approved the final version of the Blixenkrone-Møller M, Lan NT, Yamaguchi R, Cirone F: Genotyping manuscript. canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks. Acknowledgments Vet Microbiol 2007, 122:32–42. This work was supported by Program for Changjiang Scholars and Innovative 17. Pardo ID, Johnson GC, Kleiboeker SB: Phylogenetic characterization of Research Team in University, China (IRT0848), Specific projects of public canine distemper viruses detected in naturally infected dogs in North welfare of the Ministry of Science and Technology of the P.R. China America. J Clin Microbiol 2005, 43:5009–5017. (200910188), Program of Science and Technology Department of Sichuan 18. Calderon MG, Remorini P, Periolo O, Iglesias M, Mattion N, La Torre J: Province (2010SZ0050), National Key Technology R&D Program Detection by RT-PCR and genetic characterization of canine distemper (2012BAC01B06) and the “973 project” of prophase special program virus from vaccinated and non-vaccinated dogs in Argentina. Vet (2012CB722207). Microbiol 2007, 125:341–349. 19. Woma TY, van Vuuren M, Bosman AM, Quan M, Oosthuizen M: Author details Phylogenetic analysis of the haemagglutinin gene of current wild-type 1College of Veterinary Medicine, Sichuan Agricultural University, Ya’an, China. canine distemper viruses from South Africa: lineage Africa. Vet Microbiol 2China Conservation and Research Center for the Giant Panda, Ya’an, China. 2010, 143:126–132. 3Chengdu Research Base for Giant Panda Breeding, Chengdu, China. 20. Zhao JJ, Yan XJ, Chai XL, Martella V, Luo GL, Zhang HL, Gao H, Liu YX, Bai X, 4Enery-exit Inspection and Quarantine of Sichuan Province, Chengdu, China. Zhang L, et al: Phylogenetic analysis of the haemagglutinin gene of 5Southwest University for Nationalities, Chengdu, China. 6Key laboratory of canine distemper virus strains detected from breeding foxes, raccoon Animal Disease and Human Health of Sichuan Province, Sichuan Agricultural dogs and minks in China. Vet Microbiol 2010, 140:34–42. University, Ya’an, China. 21. Hu A, Cattaneo R, Schwartz S, Norrby E: Role of N-linked oligosaccharide chains in the processing and antigenicity of measles virus haemagglutinin Received: 12 January 2013 Accepted: 1 April 2013 protein. J Gen Virol 1994, 75:1043–1052. Published: 8 April 2013 22. Sawatsky B, von Messling V: Canine distemper viruses expressing a hemagglutinin without N-glycans lose virulence but retain – References immunosuppression. J Virol 2010, 84:2753 2761. 1. Appel MJG, Yates RA, Foley GL, Bernstein JJ, Santinelli S, Spelman LH, Miller LD, 23. Janssen DL, Edwards MS, Sutherland-Smith M, Yu J, Li D, Zhong G, Wei R, Arp LH, Anderson M, Barr M: Canine distemper epizootic in lions, tigers, and Chenglin Z, Miller R, Phillips L: Significant medical issues and biological leopards in North America. J Vet Diagn Invest 1994, 6:277. reference values for giant pandas from the biomedical survey.InGiant 2. Deem SL, Spelman LH, Yates RA, Montali RJ: Canine distemper in terrestrial pandas: biology, veterinary medicine, and management. Cambridge, U.K: carnivores: a review. J Zoo Wildlife Med 2000, 31:441–451. Cambridge University Press; 2006:59–86. 3. Evermann J, Leathers C, Gorham J, McKeirnan A, Appel M: Pathogenesis of 24. Janssen DL, Morris P, Sutherland-Smith M, Greenberg M, Li D, Hu D, Mauroo N, two strains of lion (Panthera leo) morbillivirus in ferrets (Mustela Spelman L: Medical management of captive adult and geriatric giant pandas. putorius furo). Vet Pathol 2001, 38:311. In Giant pandas: biology, veterinary medicine, and management. Cambridge, U.K: 4. Pearson R, Gorham J: Canine distemper virus. Virus 1987, 1:371–373. Cambridge University Press; 2006:353–376. 5. Van De Bildt MWG, Kuiken T, Visee AM, Lema S, Fitzjohn TR, Osterhaus 25. Bittegeko S, Arnbjerg J, Nkya R, Tevik A: Multiple dental developmental ADME: Distemper outbreak and its effect on African wild dog abnormalities following canine distemper infection. J Am Anim Hosp conservation. Emerg Infect Dis 2002, 8:212. Assoc 1995, 31:42–45. 6. Appel MJ, Summers BA: Pathogenicity of morbilliviruses for terrestrial 26. Dubielzig RR, Higgins RJ, Krakowka S: Lesions of the enamel organ of carnivores. Book Pathogenicity of morbilliviruses for terrestrial carnivores 1995, developing dog teeth following experimental inoculation of gnotobiotic 4:187–191. puppies with canine distemper virus. Vet Pathol 1981, 18:684–689. 7. Haas L, Hofer H, East M, Wohlsein P, Liess B, Barrett T: Canine distemper 27. De Paula SO, Lopes da Fonseca BA: Optimizing dengue diagnosis by virus infection in Serengeti spotted hyenas. Vet Microbiol 1996, 48:147–152. RT-PCR in IgM-positive samples: comparison of whole blood, buffy-coat 8. Von Messling V, Zimmer G, Herrler G, Haas L, Cattaneo R: The and serum as clinical samples. J Virol Methods 2002, 102:113–117. hemagglutinin of canine distemper virus determines tropism and 28. Wang F, Yan X, Chai X, Zhang H, Zhao J, Wen Y, Wu W: Differentiation of cytopathogenicity. J Virol 2001, 75:6418–6427. canine distemper virus isolates in fur animals from various vaccine 9. Nikolin VM, Wibbelt G, Michler FU, Wolf P, East ML: Susceptibility of strains by reverse transcription-polymerase chain reaction-restriction carnivore hosts to strains of canine distemper virus from distinct genetic fragment length polymorphism according to phylogenetic relations in lineages. Vet Microbiol 2012, 156:45–53. china. J Virol 2011, 8:85. Guo et al. Virology Journal 2013, 10:109 Page 7 of 7 http://www.virologyj.com/content/10/1/109

29. Tan B, Wen Y-J, Wang F-X, Zhang S-Q, Wang X-D, Hu J-X, Shi X-C, Yang B-C, Chen L-Z, Cheng S-P: Pathogenesis and phylogenetic analyses of canine distemper virus strain ZJ7 isolate from domestic dogs in China. J Virol 2011, 8:520. 30. Domingo E, Holland JJ: RNA virus mutations and fitness for survival. Annu Rev Microbiol 1997, 51:151–178. 31. McCarthy AJ, Shaw MA, Goodman SJ: Pathogen evolution and disease emergence in carnivores. Proc Biol Sci 2007, 274:3165–3174. 32. Iwatsuki K, Tokiyoshi S, Hirayama N, Nakamura K, Ohashi K, Wakasa C, Mikami T, Kai C: Antigenic differences in the H proteins of canine distemper viruses. Vet Microbiol 2000, 71:281–286. 33. Lan NT, Yamaguchi R, Furuya Y, Inomata A, Ngamkala S, Naganobu K, Kai K, Mochizuki M, Kobayashi Y, Uchida K, Tateyama S: Pathogenesis and phylogenetic analyses of canine distemper virus strain 007Lm, a new isolate in dogs. Vet Microbiol 2005, 110:197–207. 34. Lan NT, Yamaguchi R, Inomata A, Furuya Y, Uchida K, Sugano S, Tateyama S: Comparative analyses of canine distemper viral isolates from clinical cases of canine distemper in vaccinated dogs. Vet Microbiol 2006, 115:32–42. 35. Martella V, Elia G, Lucente MS, Decaro N, Lorusso E, Banyai K, Blixenkrone-Moller M, Lan NT, Yamaguchi R, Cirone F, et al: Genotyping canine distemper virus (CDV) by a hemi-nested multiplex PCR provides a rapid approach for investigation of CDV outbreaks. Vet Microbiol 2007, 122:32–42. 36. Han GZ, Liu XP, Li SS: Cross-species recombination in the haemagglutinin gene of canine distemper virus. Virus Res 2008, 136:198–201. 37. Harder TC, Kenter M, Vos H, Siebelink K, Huisman W, van Amerongen G, Orvell C, Barrett T, Appel MJ, Osterhaus AD: Canine distemper virus from diseased large felids: biological properties and phylogenetic relationships. J Gen Virol 1996, 77:397–405. 38. Lan NT, Yamaguchi R, Kawabata A, Uchida K, Sugano S, Tateyama S: Comparison of molecular and growth properties for two different canine distemper virus clusters, Asia 1 and 2, in Japan. J Vet Med Sci 2007, 69:739–744. 39. Zhao J, Yan X, Wu W: Genetic variations and cellular receptors of Canine distemper virus–a review. Acta Microbiol Sin 2008, 48:986. 40. Guiserix M, Bahi-Jaber N, Fouchet D, Sauvage F, Pontier D: The canine distemper epidemic in Serengeti: are lions victims of a new highly virulent canine distemper virus strain, or is pathogen circulation stochasticity to blame? J R Soc Interface 2007, 4:1127–1134. 41. Begon M, Townsend CR, Harper JL: Ecology: From Individuals to Ecosystems. Oxford, UK: Blackwell; 2006. 42. Thompson JD, Higgins DG, Gibson TJ: CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994, 22:4673–4680. 43. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S: MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011, 28:2731–2739.

doi:10.1186/1743-422X-10-109 Cite this article as: Guo et al.: Phylogenetic analysis of the haemagglutinin gene of canine distemper virus strains detected from giant panda and raccoon dogs in China. Virology Journal 2013 10:109.

Submit your next manuscript to BioMed Central and take full advantage of:

• Convenient online submission • Thorough peer review • No space constraints or color ﬁgure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution

Submit your manuscript at www.biomedcentral.com/submit