DOCSLIB.ORG

Supporting Figure 8

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Supporting Figure 8 HUGO ID Name HUGO ID Name Nalm-6 TOM-1 Reh Karpas-422 DoHH-2 SU-DHL-5 Nama lwa DG-75 Ramos Raji BEL EHEB BONNA-12 L-428 DEL BCP-1 BC-3 BCBL-1 JSC-1 PEL -SY HBL-6 DS-1 RPMI-8226 NCI-H929 L-363 SK-MM-2 Nalm-6 TOM-1 Reh Karpas-422 DoHH-2 SU-DHL-5 Nama lwa DG-75 Ramos Raji BEL EHEB BONNA-12 L-428 DEL BCP-1 BC-3 BCBL-1 JSC-1 PEL -SY HBL-6 DS-1 RPMI-8226 NCI-H929 L-363 SK-MM-2 CDC5L Cdc5-related protein (PCDC5RP) RAD51 Replication protein A (E coli RecA homolog) HSU53209 transformer-2 alpha (htra-2 alpha) HMG2 High-mobility group (nonhistone chromosomal) protein 2 CDC10 similar to TR:G560623 G560623 HCDC10 SPS selenium donor protein (selD) NFYB CAAT-box DNA binding protein subunit B CES2 Carboxylestease 2 (liver) GTF2I Bruton's tyrosine kinase-associated protein NOE1 clone 23876 neuronal olfactomedin-related ER localized CCT4 stimulator of TAR RNA binding (SRB) ZNF22 HKR-T1 RY1 RY-1 putative nucleic acid binding protein FKBP5 54 kDa progesterone receptor-associated FKBP54 DVL2 dishevelled 2 (DVL2) FKBP5 54 kDa progesterone receptor-associated FKBP54 RPL13 60S RIBOSOMAL PROTEIN L13 CU L4 A Hs-cul-4A C14ORF3 Hydroxyacyl-Coenzyme A dehydrogenase, beta subuit CU L4 A Hs-cul-4A SM S spermine synthase CLCN6 putative chloride channel SF3A1 splicing factor SF3a120 FALZ fetal Alz-50-reactive clone 1 (FAC1) KNSL4 oriP binding protein (OBP-1) GTF2H3 General transcription factor IIH, polypeptide 3 TUBA1 alpha-tubulin TRIP hT RIP TUBA1 Alpha-tubulin (K00558) GM2A glucose transporter pseudogene TUBA1 Alpha-tubulin (K00558) RBBP6 RBQ-1 TUBA1 TUBULIN ALPHA-4 CHAIN DARS ASPARTYL-TRNA SYNTHETASE PR P8 PRP8 protein DR 1 Down-regulator of transcription 1, TBP-b RPA1 Replication protein A 70 KD subunit ZFP161 zinc finger 5 protein TUBB5 TUBULIN BETA-1 CHAIN MDM4 similar to SW:MDM2_human Q00987 MDM2 protein HNRPA2B1 Heterogeneous nuclear ribonucleoprotein A2/B1 SO S1 guanine nucleotide exchange factor (SOS1) SN RPF Sm prot ein F UBE3A Ubiquitin protein ligase E3A CKS2 CDC28 protein kinase 2 TIA1 NUCLEOLYSIN TIA-1 ? Small nuclear ribonucleoprotein polypeptide MEF2A MYOCYTE-SPECIFIC ENHANCER FACTOR 2, MEF2 XPO1 CRM1 protein EIF4A2 Eukaryotic translation initiation factor 4A (eIF-4A) isoform 2 ZNF161 DB1 DLG1 homolog of Drosophila discs large protein, isoform 2 FZ D8 similar to TR:G1151252 transmembrane receptor FLJ13910 Weakly similar to coded for by C. elegans DO C1 putative oral tumor suppressor protein (doc-1) KIAA0029 KIAA0029 CDK2 cdc2-related protein kinase RBBP4 RETINO BLASTOMA BINDING PROTEIN P48 APLP1 amyloid precursor-like protein 1 DDR1 Receptor protein-tyrosine kinase EDDR1 SN RPN Small nuclear ribonucleoprotein polypeptide N MADH4 homozygous deletion target in pancreatic carcinoma (DPC4) SNRPB2 Small nuclear ribonucleoprotein polypeptide B’’ HP1-BP74 Weakly similar to contactin associated protein PSMA6 PROTEASOME IOTA CHAIN FU S fusion, derived from t(12;16) malignant liposarcoma GALNT1 UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase ? protein immuno-reactive with anti-PTH MRE11B MRE11 homologue hMre11 RPL15 ribosomal protein L10 SFRS2IP novel member of serine-arginine domain protein, SRrp129 ? STRESS-ACTIVATED PROTEIN KINASE JNK2 PIK3R1 P13-kinase associated p85 ? STRESS-ACTIVATED PROTEIN KINASE JNK2 PIK3R1 P13-kinase associated p85 NSEP1 dbpB-like protein TRIO TRIO SP3 Sp3 transcription factor CH D3 similar to TR:E149079 E149079 MI-2 PROTEIN HNRPU Heterogenous nuclear riboneucloprotein U ACAT2 T-COMPLEX PRO TEIN 1, ALPHA SUBUNIT TPP2 Tripeptidyl peptidase II IDI1 homolog of yeast IPP isomerase NUDT1 8-oxo-7,8-dihydroguanosine triphosphatase PRKCL2 lipid-activated, protein kinase PRK2 SLC20A1 leukemia virus receptor 1 (GLVR1) HMGCR 3- hydroxy-3-methylglutaryl-coenzyme A reductase SR P9 Signal recognition particle 9 kD protein CCNK cyclin K (CPR4) KIAA0159 KIAA0159 CCNK cyclin K (CPR4) KIAA1233 KIAA1233 protein GABPA GA-binding protein transcription factor, alpha subunit GMFB similar to gb:M86492 glia maturation factor beta YY1 YY1 transcription factor GMFB Glia maturation factor beta TCF17 HKL1 HSU15552 acidic 82 kDa protein CPSF6 HPBRII-4 ? EST HNRPK Heterogeneous nuclear ribonucleoprotein K SU RB7 RNA polymerase II holoenzyme component SRB7 UGCG ceramide glucosyltransferase IDE INSULIN-DEGRADING ENZ YME SLC16A1 Solute carrier family 16, member 3 HIF1A MOP1 NCK1 Non-catalytic region of tyrosine kinase CASP7 Mch3 isoform alpha (Mch3) ZNF43 Zinc finger protein 43 (HTF6) MAP3K7 TGF-beta activated kinase 1a ZNF273 Zinc finger protein 9 GNG10 G protein gamma-10 subunit OIP5 Opa-interacting protein OIP5 GALT Galactose-1-phosphate uridyl transferase REG1B regenerating protein I beta MRPL3 MRL3 mRNA for ribosomal protein L3 homologue ZNF198 ZNF198 zinc finger protein MRPL3 MRL3 mRNA for ribosomal protein L3 homologue KIF5B KINESIN HEAVY CHAIN MRPL3 MRL3 mRNA for ribosomal protein L3 homologue EZ H2 enhancer of zeste homolog 2 (EZH2) GMPS guanosine 5'-monophosphate synthase PPP2R5C Protein phosphatase 2A, regulatory subunit B' alpha-1 NUP153 nuclear pore complex protein hnup153 RBBP8 CtBP interacting protein CtIP (CtIP) GRIK3 Glutamate receptor, ionotropic, kainate KIAA0332 KIAA0332 MTR 5-methyltetrahydrofolate-homocysteine methyltransferase TOPBP1 KIAA0259 Topoisomerase II binding protein MAX MAX protein KIAA0419 KIAA0420 SNRNPA U1 snRNP-specific protein A RFC4 Replication factor C, 37-kD subunit SNRNPA U1 small nuclear ribonucleoprotien A RFC5 replication factor C, 36-kDa subunit CH AF1 B chromatin assembly factor-I p60 subunit RFC5 replication factor C (activator 1) 5 (36.5kD) ABCD4 peroxisomal membrane protein 69 (PMP69) BRCA1 Breast cancer 1, early onset KIAA0008 KIAA0008 MCM3 Minichromosome maintenance deficient (S. cerevisiae) 3 HNK-1ST HNK-1 sulfotransferase KIAA0105 KIAA0105 Wilms’ tumour 1-associating protein UBCH10 cyclin-selective ubiquitin carrier protein M11S1 GPI-anchored protein p137 SAE1 activation of Sentrin/SUMO protein AOS1 ? Gu protein p137 GTF2F2 TRANSCRIPTION INITIATION FACTOR IIF, BETA SUBUNIT SN RPG Sm prot ein G PPP2CA Protein phosphatase 2, catalytic subunit, alpha isoform TNFSF11 TNF-related ligand TRANCE RANBP1 RAN binding protein 1 KPNB2 transportin (TRN) CD81 CD81 ANTIGEN DDX9 DEAD/H (Asp-Glu-Ala-Asp/His) box polypepide 9 CYB5 Cytochrome b-5 ? clone A9A2BR11 (CAC)n/(GTG)n repeat-containing DAXX similar to TR:O15141 O15141 DAXX CSE1L chromosome segregation gene homolog CAS KIAA0377 KIAA0377 SSRP1 High mobility group box APEX APEX nuclease (multifunctional DNA repair enzyme) DNASE1L1 MUSCLE-SPECIFIC DNASE I-LIKE PRECURSOR KIAA0670 Weakly similar to coded for by C. elegans ADE2H1 MULTIFUNCTIONAL PROTEIN ADE2 PABPN1 poly(A) binding protein II (PABP2) RNPS1 RNA-binding protein clone E5.1 E2-EPF ubiquitin carrier protein (E2-EPF) KIAA0097 KIAA0097 CBX1 heterochromatin protein p25 BCL7B B cell lymphoma protein 7B PPGB Protective protein for beta-galactosidase (galactosialidosis) SRPK1 serine kinase KPNB1 importin beta subunit CH C1 Chromosome condensation 1 BCAA HYPOTHETICAL MYELOID CELL LINE PROTEIN 7 NFYA Nuclear transcription factor Y, alpha BIRC1 neuronal apoptosis inhibitory protein U2AF1 SPLICING FACTOR U2AF 35 KD SUBUNIT SAH SA mRNA for SA gene product H2BFL H2B/l HSRTSBETArTS beta protein CHEK1 checkpoint kinase Chk1 (CHK1) HNRPF HnRNP F protein CDC6 similar to TR:G1163108 origin recognition protein PR KCH protein kinase C-L (PRKCL) MCM4 CDC21 HOMOLOG RBM3 putative RNA binding protein RNPL MCM5 CDC46 HOMOLOG NSMAF FAN protein NASP Nuclear autoantigenic sperm protein (histone-binding) PO LE DNA polymerase epsilon, catalytic polypetide PPP2CA Protein phosphatase 2, catalytic subunit, alpha isoform PO LE DNA POLYMERASE EPSILON, CATALYTIC SUBUNIT SERPINE2 Plasminogen activator inhibitor, type II PT B Polypyrimidine tract binding protein (hnRNP I) PCNA Proliferating cell nuclear antigen H2AFX HISTONE H2A.X TLOC1 translocation protein-1 CTBP1 CtBP HMG1 High-mobility group (nonhistone chromosomal) protein 1 CTBP1 CtBP LAP18 ST AT HMIN MGC2721 Laminin, beta 2 (laminin S) HMG17 non-histone chromosomal protein HMG-17 PYCS Pyrroline-5-carboxylate synthetase MGC12250 Prothymosin alpha TNRC11 OPA-containing protein FBRNP D10S102 HCFC1 HCF1 gene related SET SET PROTEIN TR aspartyl beta-hydroxylase SFRS10 putative splice factor transformer2-beta SNRP70 U1 snRNP 70K protein SFRS7 9G8 splicing factor TRAP150 thyroid hormone receptor-associated protein complex FU S Highly similar to TLS protein CUGBP1 RNA-binding protein CUG-BP/hNab50 (NAB50) NR4A3 mitogen induced nuclear orphan receptor ELAVL1 HuR RNA binding protein (HuR) SRP46 PRE-MRNA SPLICING FACTOR SF2, P33 SUBUNIT NAP1L4 nucleosome assembly protein 2 SFRS3 PRE-MRNA SPLICING FACTOR SRP20 HLALS class I histocompatibility antigen-like RBMX Heterogeneous nuclear ribonucleoprotein G SATB1 Special AT-rich sequence binding protein TUBB5 beta-tubulin gene (5-beta) with ten Alu RBM10 DXS8237E HMMR Hyaluronan-mediated motility receptor (RHAMM) HNRPA1 Heterogeneous nuclear ribonucleoprotein A1 NDUFV2 NADH dehydrogenase (ubiquinone) flavoprotein 2 (24kD) DDX17 DEAD-box protein p72 (P72) CDC2 Cell division cycle 2, G1 to S and G2 to M ? EST unknown origin and sequence SO X3 SOX-3 PROTEIN NMT1 GLYCYLPEPTIDE N-TETRADECANOYLTRANSFERASE MAD2L1 mitotic feedback control protein Madp2 homolog HRMT1L2 suppressor for yeast mutant CCNA2 75-kD autoantigen (PM-Sc1) HIP2 huntingtin interacting protein (HIP2) CA150 putative transcription factor CA150 NCL NUCLEOLIN KIAA0101 KIAA0101 PT MA Prothymosin alpha LBR Lamin B receptor HNRPA0 heterogeneous ribonucleoprotein A0 CCNB1 Cyclin B1 ST IP1
Load more

Recommended publications
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • 2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
    REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins .............................................................................................................
    [Show full text]
  • Chicken CCDC152 Shares an NFYB-Regulated Bidirectional Promoter with a Growth Hormone Receptor Antisense Transcript and Inhibits Cells Proliferation and Migration
    www.impactjournals.com/oncotarget/ Oncotarget, 2017, Vol. 8, (No. 48), pp: 84039-84053 Research Paper Chicken CCDC152 shares an NFYB-regulated bidirectional promoter with a growth hormone receptor antisense transcript and inhibits cells proliferation and migration Shudai Lin1, Wei Luo1, Mingya Jiang1, Wen Luo1, Bahareldin Ali Abdalla1, Qinghua Nie1, Li Zhang2 and Xiquan Zhang1 1Guangdong Provincial Key Lab of Agro-Animal Genomics and Molecular Breeding and Key Lab of Chicken Genetics, Breeding and Reproduction, Ministry of Agriculture, College of Animal Science of South China Agricultural University, Guangzhou 510642, P.R. China 2Agricultural College, Guangdong Ocean University, Zhanjiang 524088, P.R. China Correspondence to: Xiquan Zhang, email: [email protected] Li Zhang, email: [email protected] Keywords: bidirectional promoter, GHR antisense transcript, coiled-coil domain containing 152, NFYB, cell cycle Received: December 15, 2016 Accepted: September 04, 2017 Published: September 20, 2017 Copyright: Lin et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License 3.0 (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT The chicken coiled-coil domain-containing protein 152 (CCDC152) recently has been identified as a novel one implicated in cell cycle regulation, cellular proliferation and migration by us. Here we demonstrate that CCDC152 is oriented in a head-to- head configuration with the antisense transcript of growth hormone receptor (GHR) gene. Through serial luciferase reporter assays, we firstly identified a minimal 102 bp intergenic region as a core bidirectional promoter to drive basal transcription in divergent orientations.
    [Show full text]
  • Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201834 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPH1 Synonyms: hnRNPH; HNRPH; HNRPH1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone – RC201834 ORF Nucleotide >RC201834 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Snapshot: the Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J
    192 Cell SnapShot: The Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J. Blencowe 133 Banting and Best Department of Medical Research, University of Toronto, Toronto, ON M5S 3E1, Canada Expression in mouse , April4, 2008©2008Elsevier Inc. Low High Name Other Names Protein Domains Binding Sites Target Genes/Mouse Phenotypes/Disease Associations Amy Ceb Hip Hyp OB Eye SC BM Bo Ht SM Epd Kd Liv Lu Pan Pla Pro Sto Spl Thy Thd Te Ut Ov E6.5 E8.5 E10.5 SRp20 Sfrs3, X16 RRM, RS GCUCCUCUUC SRp20, CT/CGRP; −/− early embryonic lethal E3.5 9G8 Sfrs7 RRM, RS, C2HC Znf (GAC)n Tau, GnRH, 9G8 ASF/SF2 Sfrs1 RRM, RS RGAAGAAC HipK3, CaMKIIδ, HIV RNAs; −/− embryonic lethal, cond. KO cardiomyopathy SC35 Sfrs2 RRM, RS UGCUGUU AChE; −/− embryonic lethal, cond. KO deficient T-cell maturation, cardiomyopathy; LS SRp30c Sfrs9 RRM, RS CUGGAUU Glucocorticoid receptor SRp38 Fusip1, Nssr RRM, RS ACAAAGACAA CREB, type II and type XI collagens SRp40 Sfrs5, HRS RRM, RS AGGAGAAGGGA HipK3, PKCβ-II, Fibronectin SRp55 Sfrs6 RRM, RS GGCAGCACCUG cTnT, CD44 DOI 10.1016/j.cell.2008.03.010 SRp75 Sfrs4 RRM, RS GAAGGA FN1, E1A, CD45; overexpression enhances chondrogenic differentiation Tra2α Tra2a RRM, RS GAAARGARR GnRH; overexpression promotes RA-induced neural differentiation SR and SR-Related Proteins Tra2β Sfrs10 RRM, RS (GAA)n HipK3, SMN, Tau SRm160 Srrm1 RS, PWI AUGAAGAGGA CD44 SWAP Sfrs8 RS, SWAP ND SWAP, CD45, Tau; possible asthma susceptibility gene hnRNP A1 Hnrnpa1 RRM, RGG UAGGGA/U HipK3, SMN2, c-H-ras; rheumatoid arthritis, systemic lupus
    [Show full text]
  • NFYB Polyclonal Antibody - Classic
    TECHNICAL DATASHEET NFYB polyclonal antibody - Classic Other names: NF-YB, HAP3, CBF-A, CBF-B Cat. No. C15410241 Specificity: Human, mouse: positive Type: Polyclonal ChIP-grade, ChIP-seq grade Other species: not tested Source: Rabbit Purity: Affinity purified polyclonal antibody in PBS containing 1% BSA, 20% glycerol and 0.01% thimerosal. Lot #: 40436 Storage: Store at -20°C; for long storage, store at -80°C. Size: 25 µl/100 µl Avoid multiple freeze-thaw cycles. Concentration: 1 µg/µl Precautions: This product is for research use only. Not for use in diagnostic or therapeutic procedures. Description: Polyclonal antibody raised in rabbit against NFYB (Nuclear transcription factor-Y, subunit B), using a recombinant protein. Applications Suggested dilution* Results ChIP* 2 µg per ChIP Fig 1, 2 Western blotting 1:500 - 1:3,000 Fig 3 Immunoprecipitation 2.5 µg per IP Fig 4 Immunofluorescence 1:100 - 1:1,000 Fig 5 * Please note that the optimal antibody amount per IP should be determined by the end-user. We recommend testing 1-5 µg per IP. Target description NFYB (UniProt/Swiss-Prot entry P25208) is one of the 3 subunits of the ubiquitous transcription factor NFY. All three subunits A, B and C are required to form a NFY-DNA complex. There is a connection between mutant p53 gain of function, NF-Y transactivation and DNA damage. 1 Results Figure 1. ChIP results obtained with the Diagenode antibody directed against NFYB ChIP assays were performed using HeLa cells, the Diagenode antibody against NFYB (Cat. No. C15410241) and optimized primer sets for qPCR.
    [Show full text]
  • Evolutionary Fate of Retroposed Gene Copies in the Human Genome
    Evolutionary fate of retroposed gene copies in the human genome Nicolas Vinckenbosch*, Isabelle Dupanloup*†, and Henrik Kaessmann*‡ *Center for Integrative Genomics, University of Lausanne, Ge´nopode, 1015 Lausanne, Switzerland; and †Computational and Molecular Population Genetics Laboratory, Zoological Institute, University of Bern, 3012 Bern, Switzerland Communicated by Wen-Hsiung Li, University of Chicago, Chicago, IL, December 30, 2005 (received for review December 14, 2005) Given that retroposed copies of genes are presumed to lack the and rodent genomes (7–12). In addition, three recent studies regulatory elements required for their expression, retroposition using EST data (13, 14) and tiling-microarray data from chro- has long been considered a mechanism without functional rele- mosome 22 (15) indicated that retrocopy transcription may be vance. However, through an in silico assay for transcriptional widespread, although these surveys were limited, and potential activity, we identify here >1,000 transcribed retrocopies in the functional implications were not addressed. human genome, of which at least Ϸ120 have evolved into bona To further explore the functional significance of retroposition fide genes. Among these, Ϸ50 retrogenes have evolved functions in the human genome, we systematically screened for signatures in testes, more than half of which were recruited as functional of selection related to retrocopy transcription. Our results autosomal counterparts of X-linked genes during spermatogene- suggest that retrocopy transcription is not rare and that the sis. Generally, retrogenes emerge ‘‘out of the testis,’’ because they pattern of transcription of human retrocopies has been pro- are often initially transcribed in testis and later evolve stronger and foundly shaped by natural selection, acting both for and against sometimes more diverse spatial expression patterns.
    [Show full text]
  • What Your Genome Doesn't Tell
    UC San Diego UC San Diego Electronic Theses and Dissertations Title Multi-layered epigenetic control of T cell fate decisions Permalink https://escholarship.org/uc/item/8rs7c7b3 Author Yu, Bingfei Publication Date 2018 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA SAN DIEGO Multi-layered epigenetic control of T cell fate decisions A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biology by Bingfei Yu Committee in charge: Professor Ananda Goldrath, Chair Professor John Chang Professor Stephen Hedrick Professor Cornelis Murre Professor Wei Wang 2018 Copyright Bingfei Yu, 2018 All rights reserved. The dissertation of Bingfei Yu is approved, and it is ac- ceptable in quality and form for publication on microfilm and electronically: Chair University of California San Diego 2018 iii DEDICATION To my parents who have been giving me countless love, trust and support to make me who I am. iv EPIGRAPH Stay hungary. Stay foolish. | Steve Jobs quoted from the back cover of the 1974 edition of the Whole Earth Catalog v TABLE OF CONTENTS Signature Page.................................. iii Dedication..................................... iv Epigraph.....................................v Table of Contents................................. vi List of Figures.................................. ix Acknowledgements................................x Vita........................................ xii Abstract of
    [Show full text]
  • Association of Cnvs with Methylation Variation
    www.nature.com/npjgenmed ARTICLE OPEN Association of CNVs with methylation variation Xinghua Shi1,8, Saranya Radhakrishnan2, Jia Wen1, Jin Yun Chen2, Junjie Chen1,8, Brianna Ashlyn Lam1, Ryan E. Mills 3, ✉ ✉ Barbara E. Stranger4, Charles Lee5,6,7 and Sunita R. Setlur 2 Germline copy number variants (CNVs) and single-nucleotide polymorphisms (SNPs) form the basis of inter-individual genetic variation. Although the phenotypic effects of SNPs have been extensively investigated, the effects of CNVs is relatively less understood. To better characterize mechanisms by which CNVs affect cellular phenotype, we tested their association with variable CpG methylation in a genome-wide manner. Using paired CNV and methylation data from the 1000 genomes and HapMap projects, we identified genome-wide associations by methylation quantitative trait locus (mQTL) analysis. We found individual CNVs being associated with methylation of multiple CpGs and vice versa. CNV-associated methylation changes were correlated with gene expression. CNV-mQTLs were enriched for regulatory regions, transcription factor-binding sites (TFBSs), and were involved in long- range physical interactions with associated CpGs. Some CNV-mQTLs were associated with methylation of imprinted genes. Several CNV-mQTLs and/or associated genes were among those previously reported by genome-wide association studies (GWASs). We demonstrate that germline CNVs in the genome are associated with CpG methylation. Our findings suggest that structural variation together with methylation may affect cellular phenotype. npj Genomic Medicine (2020) 5:41 ; https://doi.org/10.1038/s41525-020-00145-w 1234567890():,; INTRODUCTION influence transcript regulation is DNA methylation, which involves The extent of genetic variation that exists in the human addition of a methyl group to cytosine residues within a CpG population is continually being characterized in efforts to identify dinucleotide.
    [Show full text]