Experience with Lentivirus-Mediated CD40 Gene Silencing in a Mouse Model of Graves’ Disease

285 Experience with lentivirus-mediated CD40 gene silencing in a mouse model of Graves’ disease

Feng Ye, Bingyin Shi, Xiaoyan Wu, Peng Hou, Lei Gao, Xiaodan Ma, Li Xu and Liping Wu Department of Endocrinology, First Afﬁliated Hospital of Xi’an Jiaotong University School of Medicine, Xi’an 710061, People’s Republic of China (Correspondence should be addressed to X Wu; Email: [email protected])

Abstract CD40 plays an important role in the pathogenesis of detected at the mRNA level by real-time PCR and protein Graves’ disease (GD). Inhibition of CD40 expression may level by ﬂow cytometry. The expression of CD40, CD80, be a promising treatment for GD. In this study, we used and CD86 was signiﬁcantly decreased in the CD40 siRNA an animal model to investigate whether lentivirus expressing group (P!0.05), while FOXP3 expression was increased siRNA for CD40 (LV-CD40-siRNA) could be useful for compared to the control siRNA group (PZ0.05). Mean T4 the therapy of GD. BALB/c mice were injected with PBS levels were decreased 14% in the CD40 siRNA group alone (PBS group), negative lentivirus (control siRNA compared to the control siRNA group. The rate of disease group), or LV-CD40-siRNA (CD40 siRNA group), 3 days induction was similar among the three groups injected with before being treated with adenovirus expressing human Ad-TSHR289. LV-CD40-siRNA is a useful tool to inhibit TSHR A subunit (Ad-TSHR289) three times at 3-week the expression of CD40 in vivo, but it cannot decrease the intervals to induce GD model. Sera thyroxine (T4) levels incidence of hyperthyroidism in a limited period of time. were assayed by RIA. The expression of CD40 was Journal of Endocrinology (2011) 208, 285–291

Introduction of target genes as described by Hill et al. (2003). It has been successfully used in animal models of various diseases and is In general population, the prevalence of Graves’ disease (GD) currently in clinical trials (de Fougerolles et al. 2007). is w0.5%, and is the underlying cause of 60–80% of However, the utility of gene silencing as a treatment for hyperthyroidism (Weetman 2000, Brent 2008). It is an hyperthyroidism has not yet been reported. organ-specific autoimmune disease in which thyroid-stimu- CD40 is a member of the TNF receptor superfamily. It is lating antibody stimulates the TSH receptor (TSHR) leading expressed by a wide variety of cell types, including B cells, to overproduction of thyroid hormones and diffuse hyper- dendritic cells (DCs), fibroblasts, endothelial cells, macro- plasia of the thyroid gland. The mechanisms for breakdown phages, and thyrocytes (Smith et al. 1999). The interaction of immune tolerance to the TSHR remain obscure as between CD40 and its cognate ligand CD40L (CD154) described in Saitoh et al. (2007). The present treatment provides a costimulatory signal that mediates T-cell matu- modalities include antithyroid drugs, radioactive iodine, and ration, B-cell proliferation, immunoglobulin production, thyroidectomy. Although these are useful, they have isotype class switching, and generation of memory cells and limitations and have remained essentially unchanged for provides an additional maturation signal to antigen presenting 50 years as described by Gilbert et al. (2006). These authors cells (APCs; Sempowski et al. 1998). Blocking the interaction showed reduced hyperthyroidism in mice with on-going between CD40 and CD154 is beneficial in animal models GD using decoy molecules of tumor necrosis factor (TNF) of autoimmune diseases (Durie et al. 1993, Gerritse et al. family ligand inhibitors to target B lymphocyte proliferation 1996, Carayanniotis et al. 1997). It is also reported that the or survival factors. These studies indicate the importance of CD40/CD154 interaction may represent an important investigating additional novel therapeutic approaches. mechanism in the regulation of the autoimmune humoral RNA interference is a posttranscriptional mechanism of response in GD (Mysliwiec et al. 2007). Thus, inhibition of gene silencing, in which 19–23 nucleotide double-stranded CD40 expression may be a promising treatment for GD. RNA duplexes promote specific endonucleolytic cleavage A previous study has shown that blocking CD40/CD154 of mRNA targets called small interfering RNA (siRNA) as interaction by adenovirus expressing CD40-Lg could reduce described in Raoul et al. (2005) and Suzuki et al. (2008). Gene the incidence of hyperthyroidism (Chen et al. 2006). silencing using siRNA is an extremely efficient, specific, However, the exact mechanism was not clarified and neither long-lasting, and simple method for blocking the expression was the mechanism for the inhibition of hyperthyroidism in

Journal of Endocrinology (2011) 208, 285–291 DOI: 10.1677/JOE-10-0224 0022–0795/11/0208–285 q 2011 Society for Endocrinology Printed in Great Britain Online version via http://www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/26/2021 09:16:46AM via free access 286 FYEand others . Using of CD40 gene silencing in GD

the Ad-TSHR289-induced GD animal model by the Thyroxine and TRAb measurements adenovirus vector. The effect of CD40 inhibition on GD Total serum thyroxine (T ) was measured with an RIA kit thus needs further investigation. Hence, in this study, we have 4 (Beijing Atom High Tech Co., Ltd, Beijing, China). The used lentivirus as a gene delivery vector to investigate whether normal range was deﬁned as meanG3 S.D. of the PBS-treated LV-CD40-siRNA-induced posttranscriptional CD40 gene silencing could reduce the incidence of hyperthyroidism mice. TRAb values were determined using human recombi- in Ad-TSHR289-induced GD animal model and the nant TSHR protein (a TRAb kit, BRAHMS Diagnostica possible mechanisms. GmbH, Berlin, Germany).

Histology Materials and Methods Thyroid tissues were removed and fixed in 4% formalin. Construction of TSHR adenoviruses Sections were examined at 3–5 mm intervals and were stained with hematoxylin and eosin. Analysis was performed using an Construction of Ad-TSHR289 was performed as previously Olympus Cue-2 image analysis system connected to an described (Chen et al. 2003, Saitoh & Nagayama 2006). Olympus compound microscope. Briefly, adenoviruses (Ad-TSHR289) were propagated in HEK293 cells and purified by ion-exchange column chromatography. The concentration of viral particles was Flow cytometry analysis determined by measuring the absorbance at 260 nm, and they To analyze surface expression of CD40, CD80, and CD86, were stored at K80 8C. 1!106 splenocytes were stained with PE, FITC, or APC- conjugated Ab or the appropriate isotype-controlled Ab Construction of LV-CD40-siRNA respectively, in a final volume of 100 ml for 60 min in dark The lentivector used in this study was designed to coexpress (eBioscience, San Diego, CA, USA), followed by washing green fluorescent protein (GFP). The sequence of the twice in 1 ml of cold flow cytometry wash buffer (PBS with siRNA-targeting murine CD40 was gaTGGTAAAGA- 1% BSA). The cells were then resuspended in 300 ml PBS, and GAGTCGCATC. Pairs of complementary oligonucleotides protein expression was analyzed using a FACScan apparatus containing these sequences were synthesized and cloned into (BD Biosciences, San Jose, CA, USA). To analyze FOXP3 ! 6 the PGCL-GFP Lentivector; 293T cells were cotransfected expression, 1 10 splenocytes were stained with anti-CD4- with plasmid pHelper1.0, pHelper2.0, and the PGCL-GFP PerCP-cy5.5 and anti-CD25-APC antibodies (eBioscience) Lentivector containing the shRNA sequences using Lipo- for 30 min and incubated with fixation/permeabilization fectamine 2000 (Invitrogen). Viral supernatants were solution. After 30 min incubation, cells were washed twice harvested after 48 h, and the titers were determined with with permeabilization buffer and incubated with anti- serial dilutions of concentrated lentivirus. FOXP3-PE for 30 min.

Immunization and treatment Real-time PCR Thirty-two 6–8-week-old female BALB/c mice were Total RNA was isolated from the spleens using RNAfast200 purchased and housed in a specific pathogen-free facility at purification kit (Fastagen Biotech, Shanghai, China) according the Experimental Animal Center of the Fourth Military to the manufacturer’s protocol. The RNA was subsequently Medical University (Xi’an, P R China). Room temperature reverse transcribed using a RevertAid First Strand cDNA (23G1 8C), humidity (50G10%), and a 12 h light:12 h Synthesis kit (Fermentas, Vilnius, Lithuania). The primer darkness cycle were strictly controlled. Mice were randomly sequences were designed using Primer Express (Applied divided into four groups and provided with food pellets Biosystems, Foster City, CA, USA) (shown in Table 1). and water ad libitum. One group of mice was injected with Quantitative PCR assay was performed in triplicate for each 50 ml PBS as the PBS-treated mice and the other three groups sample in a final reaction mixture of 20 ml containing SYBR of mice were injected i.v. with PBS alone (PBS group), Premix Ex TaqTM II PCR Master Mix (TakaRa, Dalian, negative lentivirus (control siRNA group), or LV-CD40- China) and 0.25 mMofeachprimer.Afteraninitial siRNA (CD40 siRNA group) 3 days before being treated with denaturation step at 95 8C for 10 s, 40 cycles of 5 s at Ad-TSHR289, which was injected i.m. three times at 95 8C, 15 s at 55 8C, and 15 s at 72 8C were run on an IQ5 3-week interval to induce hyperthyroidism. Blood, spleen, Real-Time PCR Detection System (Bio-Rad). Mouse and thyroid tissues were obtained 4 weeks after the third b-actin mRNA was used for normalization to ensure equal immunization. All experiments were conducted in accor- amounts of starting RNA. The specificity of real-time dance with the principles and procedures outlined in the quantitative PCR for all these genes was confirmed by Guideline for the Care and Use of Laboratory Animals at running the PCR products on a 2% agarose gel to show single Xi’an Jiaotong University. specific bands at the expected sizes (data not shown).

Journal of Endocrinology (2011) 208, 285–291 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/26/2021 09:16:46AM via free access Using of CD40 gene silencing in GD . FYEand others 287

Table 1 Primer sequences used in this study for real-time quantitative RT-PCR analysis

Gene Forward Reverse Product size (bp)

CD40 GCCATCGTGGAGGTACTGTT CTGCGATGGTGTCTTTGCCT 110 CD80 GGCAAGGCAGCAATACCTTA CTCTTTGTGCTGCTGATTCG 94 CD86 TCTCCACGGAAACAGCATCT CTTACGGAAGCACCCATGAT 100 FOXP3 CTCGTCTGAAGGCAGAGTCA TGGCAGAGAGGTATTGAGGG 106 b-actin CCAGGCATTGCTGACAGG GCTGGAAGGTGGACAGTG 142

FOXP3, the forkhead family transcription factor. Statistical analysis siRNA group, although this difference was not statistically significant. We subsequently measured TRAb in all of the All comparisons between the groups were performed using mice and found that mice injected with Ad-TSHR289, no either Student’s t-test or ANOVA, and P values !0.05 were matter hyperthyroid or euthyroid, had significantly higher considered statistically significant. TRAb compared with the PBS-treated mice (Fig. 2B). Next, we investigated whether the hyperthyroid BALB/c mice as judged by T4 levels displayed histological changes. Unlike Results euthyroid or control mice, all the hyperthyroid BALB/c mice had diffuse goiters and hyperplastic follicles with cuboidal or Silencing CD40 in vivo using LV-CD40-siRNA columnar thyroid epithelial cells, but no lymphocytic During in vitro experiments, we observed that mature DCs infiltration as previously reported (Saitoh & Nagayama 2006). (mDCs) expressed high levels of CD40 and these were significantly decreased by LV-CD40-siRNA (data not Alterations of other costimulatory molecules by CD40 silencing shown). We subsequently investigated the ability of LV-CD40-siRNA to suppress CD40 expression of splenocytes DCs play an essential role in immune homeostasis. mDCs in vivo. Mice were killed 4 weeks after the third immunization act as potent APCs, stimulating T-cell activation, whereas with Ad-TSHR289. The silencing effects of LV-CD40-siRNA immature DCs (iDCs) characterized as low expression of were detected at the mRNA level by real-time PCR and costimulatory molecules (CD40, CD80, and CD86) induce protein level by flow cytometry as compared with negative lentivirus. As shown in Fig. 1, CD40 expression was A 1·6 significantly lower in the CD40 siRNA group than the control siRNA group (P!0.05), at both RNA and protein levels. 1·2

CD40 expression did not differ significantly between the PBS 0·8 group and the control siRNA groups (Fig. 1). Our data thus * of CD40 mRNA showed the feasibility and efficacy of LV-CD40-siRNA on quantity Relative 0·4 downregulating the expression of CD40 in splenocytes in vivo. 0 Lenivirus did not influence the expression of CD40 in vivo. PBS LV LV-CD40-siRNA +TSHR289 +TSHR289 +TSHR289 B Thyroid function after virus immunizations 50 PBS+TSHR289 50 LV+TSHR289 50 LV-CD40-siRNA 40 31·9% 40 33·2% 40 +TSHR289 24·9% 30 30 30 Serum T4 levels were measured 4 weeks after the third 20 20 20 injection of Ad-TSHR289. Mice with serum T4 levels higher Counts 10 10 10 G S D M1 M1 M1 than mean 3 . . of PBS-treated mice were considered 0 0 0 hyperthyroid. In this study, compared with the PBS-treated 100 101 102 103 104 100 101 102 103 104 100 101 102 103 104 mice, 75% (6/8) of mice immunized with Ad-TSHR289 and CD40 PE treated with PBS (PBS group) became hyperthyroid. Sixty- Figure 1 LV-CD40-siRNA inhibits the expression of CD40 in vivo. three percent (5/8) of mice immunized with Ad-TSHR289 Three days prior to immunization with Ad-TSHR289, three groups and treated with negative lentivirus (control siRNA group) or of mice were treated with either PBS alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were obtained 4 weeks after the third LV-CD40-siRNA (CD40 siRNA group) became hyperthyr- immunization. Eight tissues in each group were studied. The error oid. Although there was no significant difference in the rate of bars represent standard error in each group. (A) CD40 expression disease induction among these three groups, mean T4 levels in was determined by real-time PCR in Ad-TSHR289 immunized the CD40 siRNA group were much lower than the other two mice. (B) CD40 expression was determined by flow cytometry and the mean count in each group is shown. Splenocytes were stained (Fig. 2A). Mean T4 levels were similar between the PBS group with PE-labeled anti-CD40 Ab and analyzed by flow cytometry. and the control siRNA group (Fig. 2A) and there was a 14% Details are described in section ‘Materials and Methods’. *P!0.05 decrease in the CD40 siRNA group compared to the control versus control siRNA group. www.endocrinology-journals.org Journal of Endocrinology (2011) 208, 285–291

Downloaded from Bioscientifica.com at 09/26/2021 09:16:46AM via free access 288 FYEand others . Using of CD40 gene silencing in GD

(Wing et al.2008), which play an important role in A 120 94·1 94·8 81·2 autoimmune diseases. It has been reported that a blockade 90 of the CD40/CD40L interaction actively generates Treg cells (Suzuki et al. 2009). We thus used our own mouse model to 60

levels (ng/ml) levels 40·5 explore the effect of CD40 siRNA on the expression of 4

30 FOXP3 in splenocytes in vivo using real-time PCR. As shown

Mean T in Fig. 4, the treatment of CD40 siRNA dramatically 0 increased FOXP3 gene expression compared with the control PBS PBS LV LV-CD40-siRNA +TSHR289 +TSHR289 +TSHR289 siRNA (PZ0.05) or PBS group (P!0.05). We also used ﬂow cytometry to determine whether treatment of CD40 siRNA B LV-CD40-siRNA+TSHR289 can increase the number of Treg cells in vivo. The proportion 1000 LV+TSHR289 PBS+TSHR289 of Treg cells in CD40 siRNA group were also increased 800 PBS compared with the other two groups although there were no signiﬁcant differences (data not shown). 600

400 TRAb (U/l)

200 Discussion

0 PBS treated The GD animal model, induced by immunization with mice Ad-TSHR289 immunized mice adenovirus expressing the TSHR, is the most widely used Figure 2 The effect of LV-CD40-siRNA on hyperthyroidism. model to study the pathogenesis and therapy of GD. In this (A) Mean serum T4 levels in each group. Mice were immunized with 1!109 particles Ad-TSHR289 per injection on three occasions study, six of eight BALB/c mice (75%) immunized with at 3-week intervals. Serum T4 levels were measured 4 weeks after the third injection. (B) Serum TRAb levels in BALB/c mice immunized A 1·5 with adenovirus expressing the TSHR extracellular A subunit G (Ad-TSHR289). The shaded area represents the mean 3 S.D. for 1·2 serum TRAB levels in mice immunized with PBS (PBS-treated mice). * 0·9 peripheral T-cell tolerance (Chorny et al. 2006). In vitro experiments showed that mDCs expressed high levels of 0·6 CD80 and CD86, and they were significantly decreased by of CD80 mRNA CD40 downregulation (data not shown). In this study, we quantity Relative 0·3 used an siRNA approach to explore the effect of CD40 0 downregulation on the expression of CD80 and CD86 in PBS LV LV-CD40-siRNA splenocytes in vivo. As shown in Fig. 3, the expressions of +TSHR289 +TSHR289 +TSHR289 CD80 and CD86 were significantly decreased in the CD40 B 1·5 siRNA group compared to the control siRNA group 1·2 (P!0.05). There was no significant difference in the expression of CD80 between the control siRNA group and 0·9 the PBS group (Fig. 3A). However, a significant difference was found in the expression of CD86 between the control 0·6 *

siRNA group and the PBS group (Fig. 3B), suggesting that of CD86 mRNA Relative quantity Relative 0·3 lentivirus can affect the expression of some costimulatory molecules through certain unknown molecular mechanisms. 0 Moreover, we also analyzed the expression of CD80 and PBS LV LV-CD40-siRNA CD86 on the surface of splenocytes by ﬂow cytometry. Fewer +TSHR289 +TSHR289 +TSHR289 CD80 and CD86 positive cells were found in the CD40 Figure 3 The effect of LV-CD40-siRNA on the expression of other siRNA group compared with the other two groups, which costimulatory molecules. Three days prior to immunization with Ad-TSHR289, three groups of mice were treated with either PBS was consistent with the results of mRNA, although no alone, LV, or LV-CD40-siRNA respectively. Splenic tissues were signiﬁcant difference was noted (data not shown). obtained 4 weeks after the third immunization. Eight tissues in each group were studied. The error bars represent standard error in each group. Total RNA was extracted from splenic tissues and real-time Alteration of immune response by CD40 silencing PCR was performed to investigate the expression of CD80 (A) and CD86 (B) as described in section ‘Materials and Methods’. *P!0.05 ; T regulatory cells (Tregs) are essential for maintaining when compared to control siRNA group; P!0.05 when compared immunological self-tolerance and immune homeostasis to PBS group.

Journal of Endocrinology (2011) 208, 285–291 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/26/2021 09:16:46AM via free access Using of CD40 gene silencing in GD . FYEand others 289

4 real-time PCR (a very sensitive technique) data demonstrated decreased amounts of CD80 and CD86 mRNA in splenic 3·5 tissue from mice pretreated with LV-CD40-siRNA compared 3 with PBS or control siRNA, however, no significant 2·5 differences were obtained by flow cytometry, indicating that 2 the protein levels may not have been significantly reduced 1·5 due to unknown complicated mechanisms in vivo. It is not sufficient to affect the occurrence of hyperthyroidism. Relative quantity Relative of FOXP3 mRNA of FOXP3 1 Thirdly, the lack of uniform effect of CD40 silencing 0·5 on the incidence of hyperthyroidism does not rule out the 0 PBS LV LV-CD40-siRNA possibility of a link between these two events. Fourth, it +TSHR289 +TSHR289 +TSHR289 remains to be investigated whether the effect of CD40 silencing on hyperthyroidism may be a long-term conse- Figure 4 Immune modulation by LV-CD40-siRNA in vivo. Three days prior to immunization with Ad-TSHR289, three groups of mice quence. Finally, the current results may be a result of the were treated with either PBS alone, LV, or LV-CD40-siRNA relatively small number of study animals. Further study with respectively. Splenic tissues were obtained at 4 weeks after the third more animals is thus needed. C C C immunization. Eight tissues in each group were studied. The error CD4 CD25 FOXP3 Treg cells develop in the thymus bars represent standard error in each group. Total RNA was and peripheral lymphatic or immune organs, and represent extracted from splenic tissues and real-time PCR was performed C using specific primers of FOXP3 as described in section ‘Materials 5–10% of the peripheral CD4 T-cell compartment (Sakaguchi ; and Methods’. P!0.05 when compared to PBS group. 2005, Saitoh & Nagayama 2006). These cells suppress the expression of CD80 and CD86, and hamper the proliferation of C effector CD4 T cells as well as the maturation of DCs (Saitoh & Ad-TSHR289 became hyperthyroid, which is consistent Nagayama 2006, Wing et al.2008). Recently, Treg cells with the previous study (Chen et al. 2004). have been demonstrated to efficiently influence autoimmune CD40/CD40L signaling plays an important role in disease (Cheng et al.2008). A previous study showed that humoral and cellular immunity. Deregulation of this signaling regulatory T cells play an important role in the mechanism pathway was found to be associated with human autoimmune involved in both susceptibility and severity of GD (Saitoh & and inflammatory diseases (Law & Grewal 2009). Some Nagayama 2006). In this study, we found that mRNA levels of success in treatment of various diseases has been achieved in FOXP3 were dramatically increased and the number of Treg animal models by inhibition of CD40 expression (Durie et al. cells was mildly increased in the mice treated with LV-CD40- 1993, Carayanniotis et al. 1997, Suzuki et al. 2009, Zheng et siRNA. We speculate that increased Treg cells partially dampen al. 2009). Lentiviral vectors have become a promising tool in the severity of hyperthyroidism in the CD40 siRNA group. gene therapy including transgenesis and functional knock- A previous study showed that coimmunization with a down due to highly efficient transduction, rare preexisting second adenovirus, regardless of the nature of its insert, immunity, and persistent expression (Dullaers et al. 2006, Park markedly reduced TSHR antibody level and the incidence of 2007). In this study, we successfully used LV-CD40-siRNA to hyperthyroidism induced by Ad-TSHR289 (Chen et al. inhibit the expression of CD40 in vivo both at RNA and 2006), which seriously limits the use of Ad vectors in such protein levels. This may be a new method for exploring the animal models of GD. In this study, our findings showed that feasibility of gene therapy by CD40 gene silencing. re-administration of lentivirus vectors to the GD model did CD40 over expression plays a role in the pathogenesis of not affect the incidence of hyperthyroidism. Recently, a GD through stimulation of T-cell maturation, activating B number of studies showed that Ad-specific effector and cells, and inhibiting thyrocyte apoptosis (Faure et al. 1997, Kie memory T cells can be quickly activated following Ad vector et al. 2001, Tomer et al. 2002, Jacobson & Tomer 2007). administration concomitant with production of proinflam- Inhibition of CD40 expression may be a prospective matory cytokines and chemokines, which may be responsible treatment for GD. In this study, we found that LV-CD40- for reduced therapeutic efficacies of this vector (Thacker et al. siRNA attenuated disease severity in a GD animal model, as 2009). However, lentivirus vectors are less likely to stimulate reflected by T4 level. systemic immune responses (Sinn et al. 2008), suggesting that The following reasons might explain the observations of lentivirus is a suitable vector to study the pathogenesis and this study. First, GD is an organ-specific autoimmune disease therapy of GD in animal model induced by Ad-TSHR289, and the main organ involved is the thyroid gland. Although although molecular mechanisms remain unclear. we have effectively used LV-CD40-siRNA to inhibit the In summary, we tried a novel immune blocker for CD40 expression in spleen, this does not mean that it had an preventing the occurrence of GD through lentivirus- appreciable effect on the thyroid. If we can directly inject mediated CD40 gene silencing in an animal model. We LV-CD40-siRNA into the thyroid locally, perhaps it will play demonstrated that LV-CD40-siRNA is a powerful tool for a greater role. Secondly, CD80 and CD86 are also required inhibiting the expression of CD40 in vivo, which can partially for effective activation of T lymphocytes. In this study, lighten the severity of GD in animal model, although it did www.endocrinology-journals.org Journal of Endocrinology (2011) 208, 285–291

Downloaded from Bioscientifica.com at 09/26/2021 09:16:46AM via free access 290 FYEand others . Using of CD40 gene silencing in GD

not decrease the incidence of hyperthyroidism in a limited de Fougerolles A, Vornlocher HP, Maraganore J & Lieberman J 2007 period of time. It might be a potential future clinical Interfering with disease: a progress report on siRNA-based therapeutics. Nature Reviews. Drug Discovery 6 443–453. (doi:10.1038/nrd2310) adjunctive therapy in the prevention and intervention of Gerritse K, Laman JD, Noelle RJ, Aruffo A, Ledbetter JA, Boersma WJ & hyperthyroidism. Claassen E 1996 CD40–CD40 ligand interactions in experimental allergic encephalomyelitis and multiple sclerosis. PNAS 93 2499–2504. (doi:10. 1073/pnas.93.6.2499) Declaration of interest Gilbert JA, Kalled SL, Moorhead J, Hess DM, Rennert P, Li Z, Khan MZ & Banga JP 2006 Treatment of autoimmune hyperthyroidism in a murine The authors declare that there is no conflict of interest that could be perceived model of Graves’ disease with tumor necrosis factor-family ligand inhibitors as prejudicing the impartiality of the research reported. suggests a key role for B cell activating factor in disease pathology. Endocrinology 147 4561–4568. (doi:10.1210/en.2006-0507) Hill JA, Ichim TE, Kusznieruk KP, Li M, Huang X, Yan X, Zhong R, Funding Cairns E, Bell DA & Min WP 2003 Immune modulation by silencing IL-12 production in dendritic cells using small interfering RNA. Journal of Immunology 171 691–696. This work was supported by the National Natural Science Foundation of Jacobson EM & Tomer Y 2007 The CD40, CTLA-4, thyroglobulin, TSH China (30500250.) and the Fundamental Research Funds for the Central receptor, and PTPN22 gene quintet and its contribution to thyroid Universities. autoimmunity: back to the future. Journal of Autoimmunity 28 85–98. (doi:10.1016/j.jaut.2007.02.006) Kie JH, Cho MS & Yang WI 2001 Expression of CD40 and apoptosis Acknowledgements related molecules in autoimmune thyroid diseases. Yonsei Medical Journal 42 488–496. We thank Drs Basil Rapoport, Sandra M McLachlan, and Chunrong Chen Law CL & Grewal IS 2009 Therapeutic interventions targeting CD40L (University of California, Los Angeles, CA, USA) for providing us the plasmid (CD154) and CD40: the opportunities and challenges. Advances in expressing human TSHR289 (psv2-neo-ECE). Experimental Medicine and Biology 647 8–36. (doi:10.1007/978-0-387- 89520-8_2) Mysliwiec J, Oklota M, Nikolajuk A, Waligorski D & Gorska M 2007 Serum CD40/CD40L system in Graves’ disease and Hashimoto’s thyroiditis related to soluble Fas, FasL and humoral markers of autoimmune response. References Immunological Investigations 36 247–257. (doi:10.1080/0882013060 1069715) Brent GA 2008 Clinical practice. Graves’ disease. New England Park F 2007 Lentiviral vectors: are they the future of animal transgenesis? Journal of Medicine 358 2594–2605. (doi:10.1056/NEJMcp0801880) Physiological Genomics 31 159–173. (doi:10.1152/physiolgenomics.00069. Carayanniotis G, Masters SR & Noelle RJ 1997 Suppression of murine 2007) thyroiditis via blockade of the CD40–CD40L interaction. Immunology 90 Raoul C, Abbas-Terki T, Bensadoun J-C, Guillot S, Haase G, Szulc J, 421–426. (doi:10.1111/j.1365-2567.1997.00421.x) Henderson CE & Aebischer P 2005 Lentiviral-mediated silencing of Chen CR, Pichurin P, Nagayama Y, Latrofa F, Rapoport B & McLachlan SM SOD1 through RNA interference retards disease onset and progression 2003 The thyrotropin receptor autoantigen in Graves disease is the culprit in a mouse model of ALS. Nature Medicine 11 423–428. (doi:10.1038/ as well as the victim. Journal of Clinical Investigation 111 1897–1904. nm1207) (doi:10.1172/JCI17069) Saitoh O & Nagayama Y 2006 Regulation of Graves’ hyperthyroidism with Chen CR, Pichurin P, Chazenbalk GD, Aliesky H, Nagayama Y, McLachlan naturally occurring CD4(C)CD25(C) regulatory T cells in a mouse SM & Rapoport B 2004 Low-dose immunization with adenovirus model. Endocrinology 147 2417–2422. (doi:10.1210/en.2005-1024) C C expressing the thyroid-stimulating hormone receptor A-subunit deviates Saitoh O, Abiru N, Nakahara M & Nagayama Y 2007 CD8 CD122 T cells, the antibody response toward that of autoantibodies in human Graves’ a newly identified regulatory T subset, negatively regulate Graves’ disease. Endocrinology 145 228–233. (doi:10.1210/en.2003-1134) hyperthyroidism in a murine model. Endocrinology 148 6040–6046. (doi:10. Chen CR, Aliesky HA, Guo J, Rapoport B & McLachlan SM 2006 Blockade 1210/en.2007-0300) C C of costimulation between T cells and antigen-presenting cells: an approach Sakaguchi S 2005 Naturally arising Foxp3-expressing CD25 CD4 to suppress murine Graves’ disease induced using thyrotropin receptor- regulatory T cells in immunological tolerance to self and non-self. Nature expressing adenovirus. Thyroid 16 427–434. (doi:10.1089/thy.2006.16.427) Immunology 6 345–352. (doi:10.1038/ni1178) Cheng X, YuX, Ding YJ, Fu QQ, Xie JJ, Tang TT,YaoR, Chen Y & Liao YH Sempowski GD, Rozenblit J, Smith TJ & Phipps RP 1998 Human orbital 2008 The Th17/Treg imbalance in patients with acute coronary syndrome. fibroblasts are activated through CD40 to induce proinflammatory cytokine Clinical Immunology 127 89–97. (doi:10.1016/j.clim.2008.01.009) production. American Journal of Physiology 274 C707–C714. Chorny A, Gonzalez RE & Delgado M 2006 Regulation of dendritic cell Sinn PL, Arias AC, Brogden KA & McCray PB Jr 2008 Lentivirus vector can differentiation by vasoactive intestinal peptide: therapeutic applications on be readministered to nasal epithelia without blocking immune responses. autoimmunity and transplantation. Annals of the New York Academy of Sciences Journal of Virology 82 10684–10692. (doi:10.1128/JVI.00227-08) 1088 187–194. (doi:10.1196/annals.1366.004) Smith TJ, Sciaky D, Phipps RP & Jennings TA 1999 CD40 expression in Dullaers M, Van Meirvenne S, Heirman C, Straetman L, Bonehill A, Aerts JL, human thyroid tissue: evidence for involvement of multiple cell types in Thielemans K & Breckpot K 2006 Induction of effective therapeutic autoimmune and neoplastic diseases. Thyroid 9 749–755. (doi:10.1089/thy. antitumor immunity by direct in vivo administration of lentiviral vectors. 1999.9.749) Gene Therapy 13 630–640. (doi:10.1038/sj.gt.3302697) Suzuki M, Zheng X, Zhang X, Li M, Vladau C, Ichim TE, Sun H, Min LR, Durie FH, Fava RA, Foy TM, Aruffo A, Ledbetter JA & Noelle RJ 1993 Garcia B & Min W-P 2008 Novel vaccination for allergy through gene Prevention of collagen-induced arthritis with an antibody to gp39, the silencing of CD40 using small interfering RNA. Journal of Immunology 180 ligand for CD40. Science 261 1328–1330. (doi:10.1126/science.7689748) 8461–8469. Faure GC, Bensoussan LD, Bene MC, Aubert V & Leclere J 1997 Suzuki M, Zheng X, Zhang X, Ichim TE, Sun H, Kubo N, Beduhn M, Coexpression of CD40 and class II antigen HLA-DR in Graves’ disease Shunnar A, Garcia B & Min WP 2009 Inhibition of allergic responses by thyroid epithelial cells. Clinical Immunology and Immunopathology 84 CD40 gene silencing. Allergy 64 387–397. (doi:10.1111/j.1398-9995.2008. 212–215. (doi:10.1006/clin.1997.4391) 01839.x)

Journal of Endocrinology (2011) 208, 285–291 www.endocrinology-journals.org

Downloaded from Bioscientifica.com at 09/26/2021 09:16:46AM via free access Using of CD40 gene silencing in GD . FYEand others 291

Thacker EE, Timares L & Matthews QL 2009 Strategies to overcome host Zheng X, Vladau C, Zhang X, Suzuki M, Ichim TE, Zhang Z-X, Li M, immunity to adenovirus vectors in vaccine development. Expert Review of Carrier E, Garcia B & Jevnikar AM 2009 A novel in vivo siRNA delivery Vaccines 8 761–777. (doi:10.1586/erv.09.29) system speciﬁcally targeting dendritic cells and silencing CD40 genes for Tomer Y, Concepcion E & Greenberg DA 2002 A C/T single-nucleotide immunomodulation. Blood 113 2646–2654. (doi:10.1182/blood-2008-04- polymorphism in the region of the CD40 gene is associated with Graves’ 151191) disease. Thyroid 12 1129–1135. (doi:10.1089/105072502321085234) Weetman AP 2000 Graves’ disease. New England Journal of Medicine 343 1236–1248. (doi:10.1056/NEJM200010263431707) Received in ﬁnal form 25 November 2010 Wing K, Onishi Y, Prieto-Martin P, Yamaguchi T, Miyara M, Fehervari Z, Nomura T & Sakaguchi S 2008 CTLA-4 control over Foxp3(C) Accepted 8 December 2010 regulatory T cell function. Science 322 271–275. (doi:10.1126/science. Made available online as an Accepted Preprint 1160062) 8 December 2010

www.endocrinology-journals.org Journal of Endocrinology (2011) 208, 285–291

Downloaded from Bioscientifica.com at 09/26/2021 09:16:46AM via free access