Induces Antigen Presentation in B Cells Cell-Activating Factor of The

Home , APRIL (protein), CD40 (protein), CD43, CD80, CD86, Interferon

B Cell Maturation Antigen, the Receptor for a Proliferation-Inducing Ligand and B Cell-Activating Factor of the TNF Family, Induces Antigen Presentation in B Cells This information is current as of September 27, 2021. Min Yang, Hidenori Hase, Diana Legarda-Addison, Leena Varughese, Brian Seed and Adrian T. Ting J Immunol 2005; 175:2814-2824; ; doi: 10.4049/jimmunol.175.5.2814 http://www.jimmunol.org/content/175/5/2814 Downloaded from

References This article cites 54 articles, 36 of which you can access for free at:

http://www.jimmunol.org/content/175/5/2814.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 27, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2005 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

B Cell Maturation Antigen, the Receptor for a Proliferation-Inducing Ligand and B Cell-Activating Factor of the TNF Family, Induces Antigen Presentation in B Cells1

Min Yang,* Hidenori Hase,* Diana Legarda-Addison,* Leena Varughese,* Brian Seed,† and Adrian T. Ting2*

B cell maturation Ag (BCMA), a member of the TNFR superfamily expressed on B cells, binds to a proliferation-inducing ligand (APRIL) and B cell-activating factor of the TNF family (BAFF) but the specific B cell responses regulated by BCMA remain unclear. This study demonstrates that ligation of A20 B cells transfected with BCMA induces the expression of CD40, CD80/B7-1, CD86/B7-2, MHC class II, and CD54/ICAM-1, which subsequently enhances the presentation of OVA peptide Ag to DO11.10 T cells. BCMA expression in murine splenic B cells can be induced with IL-4 and IL-6, allowing subsequent treatment with APRIL Downloaded from or agonist anti-BCMA to similarly induce Ag presentation. A comparative analysis of hybrid receptors of TNFR2 fused to the cytoplasmic domains of APRIL/BAFF receptors found that only BCMA, but not transmembrane activator and calcium-modulator and cyclophilin ligand interactor or BAFF-R, is capable of activating Ag presentation. Although all three receptors can trigger NF-␬B signaling, only BCMA activates the JNK pathway conferring on BCMA the specific ability to activate this Ag presentation response. The Journal of Immunology, 2005, 175: 2814–2824. http://www.jimmunol.org/ embers of the TNF and TNFR superfamilies are crit- the development of lupus in these animals (9, 10). These obser- ical for the development and response of the immune vations in animal models have led to the suggestion that elevated system (1). Two recent additions to the TNF super- BAFF levels may play a role in human autoimmune disorders. M 3 family, B cell-activating factor (BAFF), also known as BLYS, Consistent with this hypothesis, patients with SLE were reported TALL-1, zTNF4, or THANK, and a proliferation-inducing ligand to have elevated levels of BAFF when compared with normal (APRIL), also known as TALL-2 or TRDL-1, have been shown to individuals (11, 12). have a role in regulating B cells (2). BAFF was initially cloned by In contrast to the well-characterized physiological role of BAFF, sequence homology to the TNF family and was shown to stimulate that of APRIL remains less clear. APRIL is the closest relative of B cell growth and Ig production in vitro (3, 4). BAFF was subse- BAFF in the TNF family, sharing 33% sequence identity, and was by guest on September 27, 2021 quently shown to be required for maintaining the survival of pe- initially reported to stimulate the proliferation of tumor cells (13). ripheral B cell as baffϪ/Ϫ mice lack follicular and marginal zone B Subsequent in vitro experiments demonstrated that APRIL could cells (5, 6). The B cell developmental blockade in the BAFF-de- also stimulate proliferation, Ig secretion, and class switching in B ficient animals appears to be in the T1 to T2 transition step during cells (14, 15). Two groups recently generated aprilϪ/Ϫ mice with the maturation of B cells and as a result, these animals have im- slightly different observations. One group reported that these mice paired humoral responses to both T cell-dependent and T cell- did not have any overt immune defects (16), whereas a second independent Ags. In contrast, transgenic overexpression of BAFF group observed defects in isotype class switching to IgA (17). The in mice resulted in elevated number of B cells and these animals reason for the discrepancy between the two reports is unclear at subsequently developed a systemic lupus erythematosus (SLE)- this point. Thus in contrast to BAFF, APRIL appears to have a role like autoimmune disorder (7–9). Furthermore, increased BAFF in the immune system that can be largely compensated by other ϫ levels were observed in the NZW BF1 mouse model of SLE as cytokines. In addition to effects in the immune system, there is a the disease progresses and antagonist soluble BAFF-R inhibited growing body of evidence that BAFF and APRIL are likely to be involved in lymphoid malignancies by conferring antiapoptotic signals to tumor cells (18–22). BAFF and APRIL can be produced *Immunobiology Center, Mount Sinai School of Medicine, New York, NY 10029; and †Department of Molecular Biology, Massachusetts General Hospital, Boston, MA by the tumor cells and thus can act in an autocrine manner, or they 02114 can be produced by accessory cells to act in a paracrine manner. Received for publication February 3, 2005. Accepted for publication June 10, 2005. Both BAFF and APRIL can bind to multiple receptors of the The costs of publication of this article were defrayed in part by the payment of page TNFR superfamily expressed on B cells. BAFF binds to BCMA, charges. This article must therefore be hereby marked advertisement in accordance transmembrane activator and calcium-modulator and cyclophilin with 18 U.S.C. Section 1734 solely to indicate this fact. ligand interactor (TACI), and BAFF-R, whereas APRIL binds only 1 This study was supported in part by an Extended Fellowship (to M.Y.) and by a to BCMA and TACI (2). The prosurvival effects of BAFF on B research grant (to A.T.T.) from the Systemic Lupus Erythematosus Foundation. cells is most likely mediated by BAFF-R in that the A/WySnJ 2 Address correspondence and reprint requests to Dr. Adrian T. Ting, Immunobiology mouse strain that has a loss-of-function mutation in BAFF-R lacks Center, Mount Sinai School of Medicine, Box 1630, One Gustave L. Levy Place, New Ϫ Ϫ York, NY 10029. E-mail address: [email protected] peripheral B cells, a phenotype that is most similar to baff / mice Ϫ/Ϫ 3 Abbreviations used in this paper: BAFF, B cell-activating factor of the TNF family; (23, 24). On the contrary, taci mice have elevated B cell num- BCMA, B cell maturation Ag; TACI, transmembrane activator and calcium-modu- bers (25, 26), and older taciϪ/Ϫ mice subsequently develop auto- lator and cyclophilin ligand interactor; SLE, systemic lupus erythematosus; APRIL, a proliferation-inducing ligand; HA, hemagglutinin; I-␬BSR, I-␬B super-repressor; immunity (27), suggesting that TACI may play a negative regula- IRES, internal ribosome entry site; JNKK, JNK kinase; MKK, MAPK kinase. tory role in B cells. To date, the function of BCMA has remained

the most enigmatic of the three receptors. BCMA was initially mated sequencing (PE Applied Biosystems). All receptors were cloned into cloned as a translocation product from a human T cell lymphoma a previously described Moloney murine leukemia virus-based retroviral and its expression profile was shown to correlate with the matu- vector upstream of an internal ribosome entry site (IRES)-puromycin resistance cassette (34). The dominant negative JNK kinase (JNKK)2 or ration of B cells, with the highest level observed in plasma cell MAPK kinase (MKK)7 (JNKK2/MKK7) is a lysine to methionine substi- lines (28). Although both BAFF and APRIL can bind to BCMA, tution at residue 149 of human JNKK2, which has been previously de- APRIL binds with much higher affinity (29, 30) suggesting per- scribed to behave in a dominant negative manner (35). Mutagenesis was haps that the APRIL-BCMA interaction may be more physiolog- performed using the Quikchange site-directed mutagenesis kit (Stratagene) and verified by sequencing. The I-␬B super-repressor (I-␬BSR) with the ically relevant. However, the functional consequences of BCMA serine to alanine substitutions at residues 32 and 36 of I-␬B␣ was sub- ligation on B cells have remained unclear and the generation of cloned from a previously described plasmid pEAK8-I␬B␣ double negative Ϫ Ϫ bcma / mice has not provided further clues to this question. Ini- (36). The JNKK2 (K149M) mutant, I-␬BSR, and the GST irrelevant con- tial examination of the BCMA-deficient mice revealed no discern- trol were cloned into the retroviral vector upstream of an IRES-GFP cas- ible phenotype (5, 31) but a more recent analysis indicated that sette. Infection of A20 B cells with vesicular stomatitis virus G protein- pseudotyped retrovirus was conducted as described (34). All experiments BCMA has a role in maintaining the survival of long-lived plasma were conducted with bulk populations of puromycin-resistant or GFP-pos- cells (32). Whether BCMA can regulate other functions of B cells itive A20 cells to avoid clonal variability. has heretofore remained unknown. In this study, we report our cloning of BCMA using an expres- Cell culture sion cloning strategy designed to identify molecules that activate The murine A20 B cell line was obtained from ATCC and maintained in the NF-␬B signaling pathway. Our subsequent analysis of BCMA DMEM (Invitrogen Life Technologies) supplemented with 10% FBS (Hy- ␮ ␮ Clone Laboratories), 50 M 2-ME, 2 mM L-glutamine, and 15 g/ml gen- Downloaded from revealed a novel function for this receptor in triggering Ag pre- ␮ ␬ tamicin. Stable transfectants were kept in the presence of 1 g/ml puro- sentation in B cells that is dependent on NF- B and JNK signaling. mycin. 293EBNA and its derivatives were cultured in DMEM with 10% This ability to induce Ag presentation is specific to BCMA and bovine calf serum and 15 ␮g/ml gentamcin. The DO11.10 T cell hybrid- cannot be triggered by signals generated by either TACI or oma was a generous gift of Dr. J. Zhang (Kimmel Cancer Center, Phila- BAFF-R. delphia, PA) and was cultured in RPMI 1640 (Cellgro) supplemented with 10% FBS, 50 ␮M 2-ME, and penicillin-streptomycin. Mouse B cells were magnetically isolated from spleen using the B cell isolation kit purchased ϩ ϩ ϩ Materials and Methods from Miltenyi Biotec by depletion of CD43 , CD4 , and Ter-119 cells. http://www.jimmunol.org/ Expression cloning of NF-␬B-activating molecules The purity of the isolated B cells was ϳ98% B220-positive as analyzed by flow cytometry. Mouse spleens were obtained from 4- to 6-wk-old female The NF-␬B reporter cell line is a derivative of the EBV-encoded nuclear BALB/c mice purchased from Charles River Breeding Laboratories. The Ag 293EBNA cell line (Invitrogen Life Technologies) that was cotrans- mice were maintained in pathogen-free facilities in accordance with the fected with a NF-␬B-GFP reporter plasmid and an expression construct guidelines of the Institutional Animal Care and Use Committee of Mount encoding two antiapoptotic molecules CrmA and Bcl-xL. Stable selection Sinai School of Medicine. of the plasmids was achieved by resistance against hygromycin B, which was encoded on the antiapoptotic plasmid. The activated human T cell Reagents cDNA library in the Ef1␣ promoter-driven vector pEAK8 was obtained from Edge BioSystems. The library was divided into pools each of ϳ500 The OVA 323–339 peptide was synthesized by Peptides International. Mu- clones, cultured in Terrific broth (TB) media, and miniprep DNA generated rine IL-4, IL-6, APRIL, and human BAFF were purchased from Pepro- by guest on September 27, 2021 from the cultures using Qiagen. Reporter cells were seeded onto 24-well Tech. Abs used were from the following sources: TNFR2 (AB-226-PB) plates (75,000 cells/500 ␮l/well) and transfected the next day with 0.4 ␮g and BCMA (AF593 and MAB593; R&D Systems); I-␬B␣ mAb (Im- of the miniprep DNA using calcium phosphate. At 48 h after transfection, genex); HA mAb (clone 3F10; Roche Applied Science); phospho-JNK, plates were analyzed by fluorescent microscopy for GFP-positive wells. JNK, phospho-p38, p38, phospho-ERK, and ERK (Cell Signaling The initial TB cultures from the pools that gave rise to GFP-positive wells Technology). were titered and divided into subpools of ϳ50 clones. Transfections and GFP screens were repeated with the miniprep DNA from the subpool cul- Western blotting tures. Cultures from positive subpools were plated on Luria-Bertani agar Cells were gently lysed in ice-cold buffer containing 1% Nonidet P-40, 20 and subpools of five clones each screened in the same manner. In the last mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 30 mM NaF supplemented step, individual clones from the final GFP-positive subpools were tested with protease inhibitors. Protein concentrations in the extract were deter- and DNA sequencing conducted on the positive clones. mined using the bicinchoninic acid protein assay kit (Pierce) and equiva- Expression constructs lent amounts of protein were resolved on SDS-PAGE gels. Western blotting was performed using standard methodologies. Full-length murine BCMA and TACI were amplified by Pfu Turbo DNA polymerase (Stratagene) from IMAGE (clone nos. 1349977 and 3411532, Flow cytometry respectively; American Type Culture Collection (ATCC)). The murine ϫ 5 ␮ ⌬ A total of 5 10 A20 B cells were stained with 1 g of FITC-conjugated BCMA- C83 mutant was also generated by PCR amplification using the Ab in 100 ␮l of complete medium in the presence of Fc block in accor- full-length BCMA as the template and replacing codon 104 with a stop dance with manufacturer’s instructions (BD Pharmingen). Stained cells codon. All three receptors were cloned in-frame downstream of a CD5 were analyzed on a FACScan or FACSCalibur flow cytometer using the leader and hemagglutinin (HA) epitope. To generate chimeric receptors, CellQuest software (BD Biosciences). FITC- and biotin-conjugated anti- the extracellular and transmembrane domain of human TNFR2 (residues CD40, anti-CD80/B7-1, anti-CD86/B7-2, anti-MHC class II, anti-CD54/ 1–287) was amplified from a TNFR2 plasmid (33) and cloned in-frame to ICAM-1 Abs, and streptavidin-allophycocyanin were purchased from the intracellular domains of murine BCMA (residues 74–185), murine eBioscience. Allophycocyanin-conjugated goat anti-rat IgG was obtained TACI (residues 150–249), and murine BAFFR (residues 98–175) using from BD Pharmingen. standard PCR methodology. The primers used are: mBCMA, forward GGAATTCACGCGTAAGATGAACCCCGAGGCCCTG, reverse GG Real-time PCR analysis GATCCGCGGCCGCTTATCTAG-TGTGAGTTGGCTT; mTACI, forward GGAATTCACGCGTAGGCGTAGAGGAGAGCCACTA, reverse Primary B cells were treated as indicated and harvested for total RNA GGGATCCGCGGCCGCTCAAGTTGCCGGACGAGCGTC; and mBAFFR, isolation by using RNA STAT-60 (Iso-Tex). First-strand cDNA was syn- forward GGAATTCACGCGTAGGTGGCGTCAACAGCTCAGG, re- thesized by using ThermoScript RT-PCR System (Invitrogen Life Tech- verse GGGATCCGCGGCCGCCTATTGCTCTGGGCCAGCTGT. PCR nologies). The primers used for real-time PCR analysis of the APRIL/ products are flanked with Mlu1(5Ј end) and NotI(3Ј end) sites for sub- BAFF receptors are the same as those described earlier for cloning of their cloning downstream of human TNFR2. For the negative control, the in- intracellular domains. Primers for GAPDH controls are forward, CTCAT tracellular domain was replaced by an in-frame stop codon. The intracel- GACCACAGTCCATGCCATC and reverse, CTGCTTCACCACCTTCT lular domain of murine BAFF-R was amplified from IMAGE (clone no. TGAT-GTC. Quantitative real-time PCR was performed using the Light- 5547292; ATCC). All constructs were sequenced and verified by auto- Cycler instrument and FastStart DNA Master SYBR Green I kit according 2816 BCMA INDUCES Ag PRESENTATION

to manufacturer’s instructions (Roche). Data analysis was performed using the LightCycler Software version 3.5. EMSA A total of 5 ϫ 106 A20 B cells were stimulated with APRIL (100 ng/ml) or anti-human TNFR2 (10 ␮g/ml) for varying lengths of time. Nuclear extracts were prepared, and NF-␬B EMSA was performed as previously described (37). IL-2 secretion assays A total of 2 ϫ 105 A20 B cells in 0.4 ml were treated with APRIL (0–100 ng/ml) or BAFF (0–100 ng/ml) or anti-human TNFR2 (0–10 ␮g/ml) for 24 h. The next day, 1 ϫ 106 DO11.10 T cells in 0.1 ml were added to the B cells with varying concentrations of the OVA peptide for another 24 h. For primary B cells, 5 ϫ 106 B cells in 0.4 ml were stimulated with the different combinations of cytokines for 48 h before the addition of 1 ϫ 106 DO11.10 T cells and OVA peptide for another 24 h. Culture supernatants were harvested and assayed in triplicate using IL-2 ELISA kits (eBioscience). Results

Identiﬁcation of BCMA as an NF-␬B-activating molecule by Downloaded from functional cloning As the NF-␬B signaling pathway controls numerous aspects of the immune system, we reasoned that an unbiased search for molecules that activate this signaling pathway would likely lead to the identiﬁcation of molecules that critically regulate biochemical sig-

naling events and downstream immunological responses. To do so, http://www.jimmunol.org/ we established an expression cloning approach that allowed us to rapidly identify molecules with such characteristics. This approach was based on the observation that high-level expression of receptors and pathway-specific signaling molecules is often sufficient to activate the NF-␬B pathway in a ligand-independent manner. We first generated a NF-␬B reporter cell line by stable transfection of 293EBNA cells with a construct consisting of multimerized NF-␬B promoter elements upstream of GFP, together with a plas- by guest on September 27, 2021 mid that expresses CrmA and Bcl-xL. The latter antiapoptotic genes served to avoid the loss of cDNAs that encode genes with direct proapoptotic effects themselves, or nonapoptotic cDNAs that are accompanied by cDNAs with proapoptotic effects. An activated human T cell cDNA expression was then screened by sib ␬ selection using the NF-␬B reporter cell line. The complexity of the FIGURE 1. Cloning of BCMA as a NF- B-activating molecule. A, Schematic of the sib selection process used to screen a cDNA expression cDNA library was first reduced by division into multiple pools of ␬ ϳ library for molecules that activate the NF- B signaling pathway. The red 500 cDNA clones per pool (Fig. 1A). DNA obtained from these ␬ ␬ circle denotes a cDNA that encodes a protein that can induce the NF- B pools were transfected into the NF- B reporter cells and examined pathway and the green stars denote GFP expression. The initial pool with by fluorescence microscopy for GFP-positive cells. Positive pools 500 cDNA clones that produces a positive GFP signal is sequentially di- were subdivided into ever-smaller size pools and the screening vided into ever smaller subpools that are rescreened until eventually a process repeated until eventually a single cDNA clone capable of single NF-␬B activating gene is cloned. B, The stages of the cloning pro- activating NF-␬B was isolated (Fig. 1A). A number of molecules cess that led to the eventual identification of BCMA are shown. The initial previously known to activate NF-␬B, as well as novel genes, were pool that produced a few GFP-positive cells is shown (top left). Further isolated in the screen. Among the former were several receptors division of the initial pool to subpools with the indicated pool size gave rise including BCMA, FAS, DR3, lymphotoxin ␤ receptor, and TLR4. to increasing GFP intensity. The different stages during the sib selection process that led to the cloning of BCMA were shown (Fig. 1B). The initial pool where BCMA was present at a frequency of 1/500 produced a fluores- and activating this receptor in various B cell models. Our initial cence pattern in which only a few cells were green. The intensity RT-PCR analysis of the murine A20 B cell line indicated that this of the fluorescent signal increased as the pool size decreased, re- cell line has no detectable expression of endogenous BCMA and flecting the increased frequency of the target cDNA. The cloning BAFFR, but TACI expression was detected (Fig. 2A). The lack of of BCMA as a NF-␬B-activating protein is consistent with previ- BAFF-R transcripts in our A20 cell line is a consistent finding and ous reports showing that BCMA induces the NF-␬B signaling is somewhat surprising because many other B cell lines have been pathway (38, 39). Nonetheless, the biological responses regulated shown to express BAFF-R (23). The fact that the RT-PCR analysis by BCMA have remained unclear and we therefore focused our conducted in the same experiment detected BAFF-R expression in subsequent analyses on the characterization of this receptor. the positive control splenic B cells but not in the A20 cell lines indicated that this observation is accurate and is not due to an BCMA induces Ag presentation in A20 B cells experimental error. We subsequently stably expressed full-length Because BCMA is expressed predominantly on B cells (28), we murine BCMA in A20 B cells using retroviruses. Bulk populations explored the function of BCMA by testing the effects of expressing of puromycin-resistant cells were used in all our experiments to The Journal of Immunology 2817

examining nuclear translocation of NF-␬B transcription factors using EMSA with a NF-␬B-binding probe previously described (Fig. 2D) (37). To obtain a better understanding of the role of BCMA, we examined the effects of APRIL stimulation on the expression of several immunologically relevant surface proteins on B cells by ﬂow cytometry. Overnight stimulation of BCMA-expressing cells with 100 ng/ml APRIL signiﬁcantly increased the expression of CD40, CD80/B7-1, CD86/B7-2, MHC class II, and CD54/ICAM-1 (Fig. 3A). This APRIL-mediated increase in expression was not observed in untransfected A20 cells (our unpublished observation) or in A20 cells expressing the signaling-defective BCMA-⌬C83 mutant (Fig. 3A). The surface molecules that were up-regulated are known to be critical for Ag presentation and we therefore hypoth- esized that this immunologically important process is regulated by BCMA in B cells. To test this hypothesis further, we investigated whether BCMA ligation has any effect on IL-2 production by T cells in the presence of Ag. A20 cells (H-2d haplotype) expressing

the different receptors were stimulated with APRIL for 24 h and Downloaded from then cocultured with DO11.10 T cell hybridomas in the presence of varying concentrations of the OVA 323–339 peptide. Culture supernatants were harvested after an additional 24 h and IL-2 lev- FIGURE 2. Expression of APRIL/BAFF receptors in B cells. A, Total els quantified by ELISA. APRIL stimulation of BCMA-expressing RNA isolated from untransfected A20 B cells or those stably transfected B cells dramatically induces IL-2 production by T cells that is ⌬ with full-length BCMA, TACI, and the BCMA- C83 mutant were sub- dose-dependent on Ag concentration (Fig. 3B). Little IL-2 produc- http://www.jimmunol.org/ jected to RT-PCR analysis. RNA isolated from purified splenic B cells was tion occurred if the BCMA-expressing cells were not stimulated included in the analysis. No BCMA signal is detected in cells transfected with APRIL. In contrast, APRIL stimulation of untransfected A20 with the BCMA-⌬C83 mutant because the PCR primers used detect the cells, or those expressing the BCMA-⌬C83 mutant, did not have intracellular domain of BCMA, which is absent in the mutant. B, Cyto- plasmic extracts from A20 cells transfected with the different receptors, any effect on IL-2 production by the T cells (Fig. 3B). This last which are HA-tagged, were resolved and probed with anti-HA mAb to observation is consistent with the fact that APRIL failed to induce indicate expression. In multiple transfections, only modest but equivalent the expression of Ag presenting molecules in those two cell lines expression of the full-length BCMA and TACI was achieved whereas the (Fig. 3A). The absence of any IL-2 production by the T cells when BCMA-⌬C83 mutant is more highly expressed. This effect is most likely cocultured with the untransfected A20 cells and similarly treated due to the fact that both BCMA and TACI can induce apoptosis when with APRIL also shows that APRIL itself does not have a direct by guest on September 27, 2021 highly overexpressed. C, A20 B cells stably expressing the indicated re- effect on IL-2 production by the T cells. Furthermore, direct treat- ceptors were left unstimulated or stimulated for 20, 40, and 60 min with ment of the DO11.10 T cells with APRIL also does not induce IL-2 APRIL (100 ng/ml). Cytoplasmic extracts were resolved and probed with secretion (our unpublished observation). mAb specific for I-␬B␣. Membrane was stripped and reprobed with anti- In addition to APRIL, BAFF also binds BCMA albeit at a lower ␤-actin mAb to ensure equivalent loading. D, A20 B cells expressing the indicated receptors were stimulated for 0, 30, 60, and 90 min with APRIL affinity (29, 30). Hence we examined whether BAFF has the same (100 ng/ml). Nuclear extracts were prepared and gel shift analysis was effect as APRIL. Stimulation of BCMA-expressing A20 cells with performed with a radiolabeled NF-␬B probe. BAFF also induced Ag presentation to T cells in a dose-dependent manner (Fig. 3C). A comparison of the dose responses to BAFF and APRIL revealed that APRIL is more potent at activating Ag avoid the effects of clonal variation. As controls, we also expressed presentation (Fig. 3C). On a molar basis, the effect of APRIL is a signaling-defective BCMA mutant with a truncation of the C- even greater as the molecular mass of APRIL (22 kD) is larger terminal 83 residues and a full-length murine TACI. All constructs than BAFF (17 kD). This observation is consistent with the re- were epitope-tagged with HA and Western blotting indicated that ported higher affinity of APRIL for BCMA (29, 30). The results these receptors are expressed, albeit full-length BCMA and TACI thus far demonstrate that BCMA ligation induces B cells to be- are expressed at lower levels than the signaling-defective BCMA- come more efficient APCs. ⌬C83 mutant (Fig. 2B). This difference in expression level is likely Aside from BCMA, both APRIL and BAFF can bind to TACI, due to the fact that high level expression of wild-type BCMA and another member of the TNFR superfamily expressed on B cells TACI leads to cell death (our unpublished observation) and is not (2). We therefore asked whether TACI ligation has any effect on tolerated by the cells. We also tested whether these receptors were Ag presentation by B cells. A20 cells stably transfected with either functional by stimulating with their ligand APRIL and examining the full-length BCMA or TACI were stimulated with 100 ng/ml the activation of the canonical NF-␬B pathway. APRIL (100 ng/ APRIL and cocultured with the DO11.10 T cells in the presence of ml) did not induce detectable I-␬B␣ degradation in untransfected varying concentrations of the OVA peptide (Fig. 3D). Although A20 B cells or in cells expressing the signaling defective BCMA- APRIL stimulation of the BCMA-expressing cells led to IL-2 pro- ⌬C83 mutant. In contrast, APRIL stimulation of cells expressing duction by the T cells, identical stimulation of the TACI-express- either full-length BCMA or TACI led to the time-dependent deg- ing cells did not result in IL-2 production. Likewise, APRIL stim- radation of I-␬B␣ followed by its re-expression (Fig. 2C), indicat- ulation of TACI-expressing cells also did not induce the surface ing that the two full-length APRIL receptors are functional. The expression of CD40, CD80, MHC class II and ICAM-1 (Fig. 3A). functionality of the full-length BCMA and TACI receptors were This differential effect is not due to differences in BCMA and further confirmed by examining I-␬B␣ phosphorylation using a TACI expression. Both receptors are equivalently expressed as as- phospho-I-␬B␣ mAb (our unpublished observation), as well as by sayed by anti-HA Western blotting and both can induce signaling 2818 BCMA INDUCES Ag PRESENTATION

FIGURE 3. BCMA induces Ag presentation in A20 B cells. A, A20 B cells stably transfected with either murine full-length BCMA, BCMA-⌬C83 signaling mutant or full-length TACI were left untreated (ﬁlled histogram) or treated with 100 ng/ml APRIL for 24 h (solid line histogram). The cells were stained with FITC-conjugated Abs against CD40, CD80/B7-1, CD86/B7-2, MHC class II, and CD54/ICAM-1, followed by ﬂow cytometry analysis. B, A total of 2 ϫ 105 untransfected A20, or BCMA- ⌬ and BCMA- C83-expressing A20 cells were left un- Downloaded from treated or stimulated with APRIL (100 ng/ml) for 24 h. A total of 1 ϫ 106 DO11.10 hybridoma T cells together with the OVA 323–339 peptide at the indicated concentrations were added for another 24 h before IL-2 ELISA were performed on the culture supernatants. C, A20 B cells expressing full-length BCMA were stimulated with increasing amount of APRIL or BAFF at the indicated http://www.jimmunol.org/ concentrations for 24 h. DO11.10 T cells were then added together with 80 ng/ml OVA peptide and IL-2 ELISA performed on the culture supernatants after an additional 24 h. D, A20 B cells expressing either full- length BCMA or TACI were treated with or without APRIL (100 ng/ml) overnight. Ag presentation to DO11.10 T cells was assayed as in B. by guest on September 27, 2021

when stimulated by ligand (Fig. 2). Hence, TACI does not have the using anti-BCMA mAb. Consistent with the PCR analysis, stim- same effect as BCMA on Ag presentation in B cells. ulation of splenic B cells with a combination of IL-4 and IL-6 resulted in increased surface expression of BCMA (Fig. 4B). In BCMA ligation induces Ag presentation in splenic B cells contrast to BCMA, parallel samples analyzed for TACI and We next examined whether BCMA ligation has any effect on Ag BAFF-R expression indicated that these two receptors remained presentation in primary B cells. The expression profile of BCMA, unchanged by these cytokines. TACI, and BAFF-R in resting B cells isolated by MACS beads To investigate whether BCMA expression on splenic B cells from BALB/c splenocytes was examined by PCR analysis. Little induced by IL-4 and IL-6 can lead to responsiveness to APRIL and BCMA expression was detectable in resting B cells, whereas both enhanced Ag presentation, the surface expression of costimulatory TACI and BAFF-R were detected (Fig. 2A). The lack of BCMA molecules treated with a combination of IL-4, IL-6, and APRIL expression in peripheral naive murine B cells observed in this was compared with cells treated with IL-4 and IL-6 only (Fig. 4C). study is similar to previous analyses in both mouse and human B Similar to that observed previously in the A20 cell line, APRIL cells (21, 40, 41). Because BCMA expression appeared to increase stimulation increased the expression of CD40, CD80, CD86, and as B cells differentiate to plasma cells (28), we evaluated the ef- MHC class II on splenic B cells. However, CD54 was not induced fects of B cell differentiation cytokines on BCMA expression by by APRIL in splenic B cells, indicating a minor difference between real-time PCR analysis. Treatment of splenic B cells with IL-6 splenic B cells and the A20 B cell line. To examine Ag presenta- alone had no effect on BCMA expression, whereas IL-4 alone tion to T cells, B cells stimulated with the various combinations of resulted in a modest increase in BCMA expression (Fig. 4A). How- IL-4, IL-6, and APRIL were incubated with DO11.10 T cells in the ever, IL-4 and IL-6 synergize to significantly induce BCMA ex- presence of OVA peptide. APRIL stimulation alone had very little pression. To confirm the results from the PCR analysis, we exam- effect on Ag presentation in splenic B cells (our unpublished ob- ined the expression of BCMA on splenic B cells by flow cytometry servation) most likely because BCMA expression in resting B cells The Journal of Immunology 2819

FIGURE 4. Stimulation of BCMA activates Ag presentation in splenic B cells. A, Purified splenic B cells were stimulated with various combinations of IL-4 (100 ng/ml) and IL-6 (100 ng/ ml) for 48 h. BCMA, TACI, BAFF-R, and GADPH expression were analyzed by real-time PCR using the LightCycler instrument. Relative fluorescence intensity of each receptor was normalized to that of GAPDH in the corresponding samples. B, Puri- fied B cells were left untreated or treated with a combination of IL-4 (100 ng/ml) and IL-6 (100 ng/ml) for 48 h. The cells were then stained with a mAb against murine BCMA (MAB593) followed by allophycocyanin-conjugated anti-rat IgG. C, Primary B cells were stimulated for 48 h with IL-4 and IL-6 in the absence Downloaded from (filled histogram) or presence (solid line histogram) of APRIL. The cells were stained with FITC-conjugated Abs against CD40, CD80, CD86, MHC class II, and CD54 followed by flow cytometry analysis. D, Splenic B http://www.jimmunol.org/ cells stimulated for 48 h with the indicated cytokines were cocultured with DO11.10 T cells in the presence of 0, 40, and 80 ng/ml OVA peptide for an additional 24 h. IL-2 concentrations in the culture supernatants were measured by ELISA. Experi- ment shown is representative of three p Ͻ 0.05 and ,ء) .that were conducted p Ͻ 0.01 by paired Student’s t by guest on September 27, 2021 ,ءء test). E, A20 B cells expressing either full-length BCMA or TACI were stimulated with increasing concentrations of polyclonal anti-BCMA (AF593) for 24 h, followed by cocul- ture with DO11.10 T cells and OVA peptide. F, Splenic B cells were left unstimulated or stimulated with IL-4 (100 ng/ml), IL-6 (100 ng/ml), and either APRIL (100 ng/ml) or polyclonal anti-BCMA (5 ␮g/ml) for 48 h. Ag presentation to T cells was analyzed as described in B.

is very low. Although IL-4 and IL-6 stimulation resulted in in- expressed on splenic B cells is indeed able to induce Ag presen- creased BCMA expression (Fig. 4A), this activity had only minor tation, we tested the effect of stimulating BCMA with agonist Abs. effects on IL-2 production by T cells in the absence of APRIL (Fig. Polyclonal goat Abs directed against murine BCMA were first 4D). However, upon addition of APRIL to IL-4 and IL-6, signif- tested for specificity and agonistic activity using BCMA- and icant enhancement of IL-2 production by T cells was observed at TACI-transfected A20 B cell lines. The BCMA Abs were able to two different Ag concentrations tested (Fig. 4D). Therefore under activate NF-␬B signaling in A20 cells expressing BCMA, but not conditions in which BCMA expression is induced, i.e., after IL-4 in cells expressing TACI (our unpublished observation). Similarly, and IL-6 treatment, APRIL is now able to stimulate B cells to these Abs were also able to stimulate A20 B cells expressing present Ag. BCMA, but not those expressing TACI, to present Ag to T cells The previous experiment strongly suggests that stimulation of (Fig. 4E). Thus, these polyclonal Abs are specific for BCMA and BCMA by APRIL induces splenic B cells to present Ag to T cells. function as agonist. Splenic B cells stimulated with IL-4 and IL-6 Because APRIL can bind to both BCMA and TACI, the possibility in the presence of either APRIL or anti-BCMA were cocultured remains that the effect of APRIL on Ag presentation is not medi- with DO11.10 T cells in the presence of OVA peptide and IL-2 ated through its interaction with BCMA but rather via binding to production assayed. Similar to the experiment shown in Fig. 4D,B TACI, even though the results from transfected A20 cells indicated cells stimulated with IL-4 and IL-6 did not present Ag to T cells, this effect to be unlikely. To formally demonstrate that BCMA whereas those stimulated with IL-4, IL-6, and APRIL induced T 2820 BCMA INDUCES Ag PRESENTATION cells to produce IL-2 (Fig. 4F). More importantly, anti-BCMA had main of BCMA, TACI, and BAFF-R are functional as cross-link- the same effect as APRIL and was able to activate Ag presentation ing with anti-TNFR2 led to the activation of the NF-␬B pathway by B cells in the presence of IL-4 and IL-6 (Fig. 4F). These ob- (see Fig. 6A), similar to that previously described for ectodysplasin servations demonstrate that specific ligation of BCMA on primary anhidrotic receptor chimeric receptors (10). B cells by agonist Abs activates Ag presentation by B cells. Thus, The four A20 cell lines expressing the different chimeric recep- BCMA ligation induces Ag presentation in both the A20 cell line tors were stimulated with anti-TNFR2 for 24 h and the surface and primary B cells. expression of CD40, CD80, CD86, MHC class II, and ICAM-1 was analyzed by flow cytometry (Fig. 5A). Similar to our earlier observation with full-length BCMA, cross-linking of the TNFR2- Differential effect of APRIL/BAFF receptors on Ag presentation BCMA chimeric receptor induced the expression of the Ag pre- The experiments shown earlier in Fig. 3 indicated that BCMA but sentation molecules. This effect of receptor cross-linking was not not TACI induces Ag presentation in B cells. To investigate this observed in A20 cells expressing the negative control TNFR2-EC, differential effect more thoroughly and to also examine the third TNFR2-TACI, or TNFR2-BAFFR chimeras (Fig. 5A). This obser- TNFR-related receptor BAFF-R, a chimeric receptor approach was vation suggests that only BCMA is capable of activating signals used. A20 B cells were stably transfected with chimeric receptors leading to Ag presentation in B cells. To test this further, we next consisting of the ectodomain of human TNFR2 fused to the intra- stimulated the different A20 cell lines with different amounts of cellular signaling domains of murine BCMA, TACI, and BAFF-R. anti-TNFR2 for 24 h, followed by the addition of DO11.10 T cells

As a negative control, the TNFR2 ectodomain was fused in frame and 80 ng/ml OVA peptide for another 24 h. In line with the Downloaded from to a stop codon. The chimeric receptor approach allowed us to observations in Fig. 5A, anti-TNFR2 cross-linking of the B cells normalize for receptor expression level and “ligand-receptor” in- expressing TNFR2-BCMA resulted in a dose-dependent produc- teraction as all the receptors can be stimulated by the same ligand, tion of IL-2 by the T cells (Fig. 5B). This receptor-dependent pre- i.e., agonist Abs speciﬁc for human TNFR2. Hence a fair compar- sentation of Ag to T cells was not observed in B cells expressing ison of the effects of triggering signaling from the three APRIL/ the negative control TNFR2-EC, or TNFR2-TACI or TNFR2-

BAFF receptors on downstream biological responses can be con- BAFFR. These chimeric receptor studies demonstrate that among http://www.jimmunol.org/ ducted. All receptors are equivalently expressed on A20 cells (our the three APRIL/BAFF receptors, only BCMA is capable of gen- unpublished observation) and those containing the intracellular do- erating the appropriate signals to trigger Ag presentation in B cells. by guest on September 27, 2021

FIGURE 5. The intracellular domain of BCMA, but not TACI or BAFF-R, transduces signals to activate Ag presentation. A, A20 B cells stably expressing chimeric negative control TNFR2-EC, and TNFR2-BCMA, TNFR2-TACI, or TNFR2-BAFFR were left unstimulated or stimulated with anti-human TNFR2 (5 ␮g/ml) for 24 h. Cells were then stained with FITC-conjugated Abs and analyzed as in Fig. 3A. B, The four A20 B cell lines (A) were stimulated with 0, 1.25, 2.5, 5.0, and 10 ␮g/ml anti-human TNFR2 for 24 h. Ag presentation to DO11.10 T cells was examined as described in Fig. 3B. The Journal of Immunology 2821

BCMA-mediated Ag presentation is NF-␬B and JNK-dependent Among the three chimeric BAFF/APRIL receptors, only cross- The specific ability of BCMA to trigger Ag presentation suggests linking of the TNFR2-BCMA receptor resulted in activation of the that the signaling pathways triggered by BCMA are likely to be JNK signaling pathway as evidenced by increased phosphorylation different from that of TACI and BAFF-R. Although cross-linking of JNK (Fig. 6B). In contrast to the differential effect on JNK of TNFR2-BCMA, TNFR2-TACI, and TNFR2-BAFFR all acti- signaling, all three chimeric BAFF/APRIL receptors weakly in- vated the canonical NF-␬B signaling pathway as assayed by I-␬B␣ duced the phosphorylation of p38 (Fig. 6B). ERK phosphorylation degradation and NF-␬B gel shift analysis (Fig. 6A), only the was induced by ligation of TNFR2-TACI but was not significantly TNFR2-BCMA chimera induced Ag presentation in B cells (Fig. induced by ligation of TNFR2-BCMA or TNFR2-BAFFR (Fig. 5). Therefore, activation of the NF-␬B pathway does not appear to 6B). Thus, the MAPK signaling pathway that correlated with be sufficient for Ag presentation and it is very likely that BCMA BCMA-mediated Ag presentation is the JNK signaling pathway. triggers an additional signaling pathway required for this response To confirm that the effect of the TNFR2-BCMA receptor on that is not shared with TACI or BAFF-R. To identify this BCMA- JNK signaling is also reflected in wild-type BCMA, A20 B cells specific signaling pathway, we examine the ability of the different expressing full-length BCMA were stimulated with APRIL for dif- TNFR2 chimeric receptors to activate MAPK signaling pathways. ferent lengths of time and analyzed by Western blotting with Abs Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 6. BCMA-mediated Ag presentation is NF-␬B- and JNK-dependent. A, A20 cells expressing the indicated chimeric receptors were left unstimulated or stimulated for 20, 40, and 60 min with anti-TNFR2 (10 ␮g/ml). Cytoplasmic extracts were probed with mAb specific for I-␬B␣. Membrane was subsequently stripped and reprobed with anti-␤-actin mAb to ensure equivalent loading. The indicated cell lines were stimulated with anti-human TNFR2 for 0, 30, 60, and 90 min (bottom panel). Gel shift analysis with a radiolabeled NF-␬B probe was then performed. B, Cells were stimulated as in A, and the blot sequentially probed with phospho-JNK and JNK Abs (upper double panels). Cell lysates were also sequentially blotted with phospho-p38 and total p38 Abs (middle double panels), or with phospho-ERK and total ERK Abs (lower double panels). C, A20 cells expressing the indicated receptors were stimulated with APRIL (100 ng/ml) for varying lengths of time, and JNK phosphorylation was analyzed as in B. D, A20 B cells stably expressing BCMA were transduced with retroviruses encoding irrelevant control protein, I-␬BSR, or JNKK2/MKK7 (K149M) mutant upstream of GFP in a bicistronic manner. Sorted GFP-positive cells were left unstimulated or stimulated with APRIL (100 ng/ml) for 24 h. Surface molecule expression was analyzed using biotin-conjugated Abs followed by streptavidin-allophycocyanin. E, BCMA-expressing cells transfected with control, I-␬BSR, or JNKK2KM were stimulated with the indicated concentrations of APRIL for 24 h. B cells were then cocultured with DO11.10 T cells in the presence of 80 ng/ml OVA peptide. IL-2 production by T cells was measured as described in Fig. 3B. 2822 BCMA INDUCES Ag PRESENTATION specific for phospho-JNK. Similar to the TNFR2 chimeric recep- identify novel molecules involved in the regulation of the NF-␬B tor, ligation of full-length BCMA also resulted in JNK activation pathway. Use of the NF-␬B-GFP reporter cell line greatly simpli- whereas analogous stimulation of untransfected A20 B cells, or fied the screening process allowing rapid identification of mole- cells expressing full-length TACI or BCMA-⌬C83 did not result in cules that activate NF-␬B. This approach provides an advantage JNK signaling (Fig. 6C). These observations are consistent with over similar strategies that required the use of enzymatic assays earlier studies showing that overexpression of BCMA in HEK 293 such as luciferase activity (47). Coupled with the use of a powerful cells induced JNK activation (38) and strongly suggests that the expression vector driven by the EF1␣ promoter, this enabled the ability to activate JNK signaling confers on BCMA the specific size of the initial pools to be in the range of 500-1000 cDNA per capability to induce Ag presentation. pool. A number of TNFR superfamily members were identified in The expression of CD40, CD80, CD86, MHC class II, and the screen conducted including BCMA, a receptor for APRIL and ICAM-1 are known to be regulated by NF-␬B (42–45). Further- BAFF. The two other known receptors for BAFF, TACI and more, multiple AP-1 enhancer sites are present in the promoter BAFFR, were not identified in the initial screen. It is possible that regions of CD40 and CD80 (46), suggesting that the JNK signaling the mRNAs encoding TACI and BAFFR may be present at a low pathway is also critical for this process. We therefore examined the frequency in the T cell library and to date, only a small fraction of requirement for NF-␬B and JNK signaling in BCMA-mediated Ag this library has been screened. It is likely that cDNA libraries presentation. The BCMA-expressing A20 cells were transduced generated from different cell types will give rise to a different array with retroviruses encoding either an irrelevant control protein or of NF-␬B-activating genes and one may be more likely to find the I-␬BSR mutant to inhibit NF-␬B signaling. Both coding se- clones encoding TACI and BAFF-R in a B cell library. Although quences are located upstream of an IRES-GFP cassette and trans- the focus to date has been on the NF-␬B pathway, the principles on Downloaded from duced cells that were GFP-positive were sorted by flow cytometry. which this expression cloning technology is based can be adapted Sorted cells were left untreated or treated with APRIL for 24 h to other signaling pathways in which pathway-specific reporters followed by staining with biotinylated Abs and streptavidin-allo- can be developed. phycocyanin. As shown in Fig. 6D, transfection of the I-␬BSR Although it is known that BCMA binds to APRIL and BAFF, its mutant but not the control protein inhibited APRIL-induced up- function has remained obscure. This present study has revealed a

regulation of CD40, CD80, CD86, MHC class II, and ICAM-1. novel function for BCMA in activating Ag presentation in B cells. http://www.jimmunol.org/ These B cell lines were also stimulated with varying concentra- Ligation of BCMA resulted in the up-regulation of surface mole- tions of APRIL for 24 h before coculturing with DO11.10 T cells cules critical for Ag presentation such as CD40, CD80, CD86, in the presence of 80 ng/ml OVA peptide. Culture supernatants MHC class II, and ICAM-1/CD54. This process is dependent on were subsequently harvested for IL-2 ELISA. Consistent with the the NF-␬B signaling pathway triggered by BCMA. One of the effect on the surface molecules, the I-␬BSR also inhibited the abil- most intriguing aspects of this study is the observation that among ity of APRIL to induce BCMA-expressing B cells to present Ag to the three APRIL/BAFF receptors, only BCMA is capable of gen- T cells (Fig. 6E). These observations demonstrate that BCMA- erating signals that lead to Ag presentation. This finding is despite induced Ag presentation in B cells is dependent on the NF-␬B the observation that the intracellular domains of BCMA, TACI, signaling pathway. and BAFFR are all capable of activating the canonical NF-␬B by guest on September 27, 2021 To examine whether BCMA-induced JNK signaling has a role pathway. Therefore, there must exist significant differences in sig- in Ag presentation in B cells, the effect of blocking JNK activation naling pathways triggered by the three receptors, which then ac- using a dominant negative JNKK2/MKK7 was tested using the count for the different biological responses elicited. Because mem- strategy described earlier for the I-␬BSR mutant. BCMA-express- bers of the TNFR superfamily including BCMA are known to ing A20 cells were infected with retroviruses encoding a kinase activate MAPK signaling pathways (38), a comparison of the three inactive JNKK2 (K149M) mutant upstream of an IRES-GFP cas- APRIL/BAFF receptors in their ability to activate MAPK signal- sette and infected cells were sorted based on GFP expression. Ex- ing was conducted. The JNK signaling pathway was found to be pression of the JNKK2KM dominant negative effectively inhibited specifically activated by BCMA but not by TACI or BAFF-R, APRIL-induced expression of CD40, CD80, CD86, and ICAM-1 suggesting that the ability to trigger the JNK pathway confers on in the BCMA-expressing B cells (Fig. 6D) indicating that the JNK BCMA the specificity to activate Ag presentation. Indeed, block- signaling pathway is critical for the induction of these surface mol- ade of the JNK pathway inhibited BCMA-mediated Ag presenta- ecules. The induction of MHC class II expression did not appear to tion indicating that this pathway is critical for this biological re- be significantly affected by the blockade of the JNK pathway. The sponse. Both the NF-␬B and JNK signaling pathways are thus blockade of BCMA-mediated up-regulation of CD40, CD80, essential for BCMA to induce Ag presentation in B cells. CD86, and ICAM-1 by the JNKK2KM dominant negative also The effect of BCMA ligation on Ag presentation was also ob- inhibited the ability of BCMA to induce B cells to present Ag to served in primary B cells. Resting murine splenic B cells do not T cells (Fig. 6E). These observations strongly suggest that the JNK appear to express significant level of BCMA. Upon stimulation signaling pathway is critical for Ag presentation induced by with IL-4 and IL-6, BCMA expression on B cells is up-regulated BCMA in B cells and is the likely explanation for the specific rendering these cells responsive to APRIL and subsequently to capability of BCMA, but not TACI or BAFF-R, to trigger this APRIL-mediated Ag presentation to T cells. We attribute this ef- response. fect of APRIL to its activation of BCMA based on several observations. First, because APRIL does not bind BAFF-R (23), this Discussion effect is not mediated by BAFF-R. Second, APRIL stimulation The study on BCMA reported here initiated from efforts to identify alone has little effect on Ag presentation by resting B cells even signaling molecules that activate the NF-␬B pathway using an ex- though TACI is expressed on resting B cells. Third, APRIL was pression cloning strategy. This strategy based on the high-level only able to elicit a response when B cells were also stimulated expression of signaling molecules to autonomously activate the with cytokines (i.e., IL-4 and IL-6) that induce BCMA expression. NF-␬B pathway led to the identification of both uncharacterized Fourth, APRIL stimulation of TACI-transfected A20 B cells had NF-␬B-activating molecules, as well as those previously known to no effect whereas it had an effect in BCMA-transfected cells. Fifth, do so. The latter observation validated the use of this strategy to agonistic Abs against BCMA were able to induce primary B cells The Journal of Immunology 2823 to present Ag to T cells. Taken together, these results show that Acknowledgments ligation of BCMA on B cells leads to enhanced Ag presentation We thank Lloyd Mayer for the OVA 323–339 peptide, Tom Moran and and indirectly to T cell activation. A previous report showed that Sergio Lira for providing mice, and Jianke Zhang for the DO11.10 T cell in vivo administration of APRIL resulted in T cell activation, most hybridoma. likely as a result of direct APRIL binding to TACI expressed on T cells (14). It is also possible that APRIL could activate T cells Disclosures The authors have no financial conflict of interest. indirectly through BCMA-mediated induction of stimulatory molecules on B cells. The observation that primary B cells that are References stimulated by cytokines to express BCMA can present Ag to T 1. Locksley, R. M., N. Killeen, and M. J. Lenardo. 2001. The TNF and TNF re- cells in response to APRIL raises the question whether cells that ceptor superfamilies: integrating mammalian biology. Cell 104: 487–501. 2. Mackay, F., P. Schneider, P. Rennert, and J. Browning. 2003. BAFF AND constitutively express BCMA, such as plasma cells and transitional APRIL: a tutorial on B cell survival. Annu. Rev. Immunol. 21: 231–264. T1 B cells (28, 32, 41), are able to do so in response to APRIL. 3. Moore, P. A., O. Belvedere, A. Orr, K. Pieri, D. W. LaFleur, P. Feng, D. Soppet, M. Charters, R. Gentz, D. Parmelee, et al. 1999. BLyS: member of the tumor Furthermore, it is not known whether all B cells can respond to necrosis factor family and B lymphocyte stimulator. Science 285: 260–263. APRIL in this manner or whether certain subsets of B cells such as 4. Schneider, P., F. MacKay, V. Steiner, K. Hofmann, J. L. Bodmer, N. Holler, marginal zone or B1 cells may respond differently. These ques- C. Ambrose, P. Lawton, S. Bixler, H. Acha-Orbea, et al. 1999. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J. Exp. Med. tions will be the subject of future studies. 189: 1747–1756. The functional characterization of BCMA adds this receptor to 5. Schiemann, B., J. L. Gommerman, K. Vora, T. G. Cachero, S. Shulga-Morskaya, M. Dobles, E. Frew, and M. L. Scott. 2001. An essential role for BAFF in the the list of signals that are known to induce Ag presentation in B normal development of B cells through a BCMA-independent pathway. Science Downloaded from cells, including TLRs and CD40. Because CD40 and BCMA are 293: 2111–2114. 6. Gross, J. A., S. R. Dillon, S. Mudri, J. Johnston, A. Littau, R. Roque, M. Rixon, both members of the TNFR superfamily, it is likely that the two O. Schou, K. P. Foley, H. Haugen, et al. 2001. TACI-Ig neutralizes molecules receptors share similar mechanisms to activate Ag presentation. critical for B cell development and autoimmune disease: impaired B cell maturation in mice lacking BLyS. Immunity 15: 289–302. For instance, both receptors interact with TNFR-associated factor 7. Mackay, F., S. A. Woodcock, P. Lawton, C. Ambrose, M. Baetscher, adapters and can activate the NF-␬B and JNK signaling pathway P. Schneider, J. Tschopp, and J. L. Browning. 1999. Mice transgenic for BAFF develop lymphocytic disorders along with autoimmune manifestations. J. Exp. (38, 39, 48–52). Future studies will be aimed at dissecting the http://www.jimmunol.org/ Med. 190: 1697–1710. proximal signaling mechanism that is used specifically by BCMA 8. Khare, S. D., I. Sarosi, X. Z. Xia, S. McCabe, K. Miner, I. Solovyev, N. Hawkins, and that may be shared with CD40 but not with TACI or BAFFR M. Kelley, D. Chang, G. Van, et al. 2000. Severe B cell hyperplasia and autoimmune disease in TALL-1 transgenic mice. Proc. Natl. Acad. Sci. USA 97: to activate Ag presentation. It is noteworthy that BCMA ligation 3370–3375. also increases the expression of CD40. Because CD40 ligation also 9. Gross, J. A., J. Johnston, S. Mudri, R. Enselman, S. R. Dillon, K. Madden, W. Xu, J. Parrish-Novak, D. Foster, C. Lofton-Day, et al. 2000. TACI and BCMA activates NF-␬B and JNK signaling, which in turn can induce are receptors for a TNF homologue implicated in B-cell autoimmune disease. CD80, CD86, MHC class II, and ICAM-1 expression, BCMA and Nature 404: 995–999. 10. Kayagaki, N., M. Yan, D. Seshasayee, H. Wang, W. Lee, D. M. French, CD40 may synergize to increase Ag presentation to T cells. Both I. S. Grewal, A. G. Cochran, N. C. Gordon, J. Yin, et al. 2002. BAFF/BLyS

APRIL and BAFF are up-regulated in activated T cells (53) and receptor 3 binds the B cell survival factor BAFF ligand through a discrete surface by guest on September 27, 2021 loop and promotes processing of NF-␬B2. Immunity 17: 515–524. thus during B cell-T cell interactions, APRIL or BAFF can syn- 11. Zhang, J., V. Roschke, K. P. Baker, Z. Wang, G. S. Alarcoń, B. J. Fessler, ergize with CD40L to enhance Ag presentation by B cells. In ad- H. Bastian, R. P. Kimberly, and T. Zhou. 2001. Cutting edge: a role for B lymphocyte stimulator in systemic lupus erythematosus. J. Immunol. 166: 6–10. dition, APRIL and BAFF expression can be induced on B cells 12. Cheema, G. S., V. Roschke, D. M. Hilbert, and W. Stohl. 2001. Elevated serum following CD40 stimulation (18), raising the possibility that CD40 B lymphocyte stimulator levels in patients with systemic immune-based rheu- may also provide a feed-forward effect to BCMA further enhanc- matic diseases. Arthritis Rheum. 44: 1313–1319. 13. Hahne, M., T. Kataoka, M. Schroter, K. Hofmann, M. Irmler, J. L. Bodmer, ing Ag presentation. Because both BCMA and CD40 can induce P. Schneider, T. Bornand, N. Holler, L. E. French, et al. 1998. APRIL, a new Ag presentation, this function of BCMA is likely to be dispensable ligand of the tumor necrosis factor family, stimulates tumor cell growth. J. Exp. Med. 188: 1185–1190. in B cells and can be compensated for by CD40. This function may 14. Yu, G., T. Boone, J. Delaney, D. Hawkins, M. Kelley, M. Ramakrishnan, partly explain why the bcmaϪ/Ϫ mice displayed no overt defect in S. McCabe, W. Qiu, M. Kornuc, X.-Z. Xia, et al. 2000. APRIL and TALL-1 and receptors BCMA and TACI: system for regulating humoral immunity. Nat. Im- immune responses (5, 31). Another reason why this Ag presenta- munol. 1: 252–256. tion function of BCMA is dispensable in the context of the organ- 15. Litinskiy, M. B., B. Nardelli, D. M. Hilbert, B. He, A. Schaffer, P. Casali, and A. Cerutti. 2002. DCs induce CD40-independent immunoglobulin class switch- ism is the redundancy provided by the other APCs, i.e., dendritic ing through BLyS and APRIL. Nat. Immunol. 3: 822–829. cells and macrophages. 16. Varfolomeev, E., F. Kischkel, F. Martin, D. Seshasayee, H. Wang, D. Lawrence, C. Olsson, L. Tom, S. Erickson, D. French, et al. 2004. APRIL-deficient mice The discovery that BCMA can induce Ag presentation may have have normal immune system development. Mol. Cell Biol. 24: 997–1006. wider clinical implications for APRIL and BAFF. The present 17. Castigli, E., S. Scott, F. Dedeoglu, P. Bryce, H. Jabara, A. K. Bhan, study suggests that APRIL and BAFF could potentially be used as E. Mizoguchi, and R. S. Geha. 2004. Impaired IgA class switching in APRIL- deficient mice. Proc. Natl. Acad. Sci. USA 101: 3903–3908. an adjuvant to activate BCMA to increase the immunogenicity of 18. He, B., A. Chadburn, E. Jou, E. J. Schattner, D. M. Knowles, and A. Cerutti. vaccines, perhaps by enhancing the humoral response. In a similar 2004. Lymphoma B cells evade apoptosis through the TNF family members BAFF/BLyS and APRIL. J. Immunol. 172: 3268–3279. vein, BCMA may play a role in the pathogenesis of autoimmune 19. Moreaux, J., E. Legouffe, E. Jourdan, P. Quittet, T. Reme, C. Lugagne, P. Moine, disorders such as SLE, in which elevated levels of BAFF have J. F. Rossi, B. Klein, and K. Tarte. 2004. BAFF and APRIL protect myeloma cells from apoptosis induced by interleukin 6 deprivation and dexamethasone. been reported (11, 12). One mechanism by which elevated BAFF Blood 103: 3148–3157. can contribute to the development of autoimmunity is believed to 20. Kern, C., J. F. Cornuel, C. Billard, R. Tang, D. Rouillard, V. Stenou, T. Defrance, be due to BAFF-R-mediated prolonged survival of autoreactive B F. Ajchenbaum-Cymbalista, P. Y. Simonin, S. Feldblum, and J. P. Kolb. 2004. Involvement of BAFF and APRIL in the resistance to apoptosis of B-CLL cells (10, 54). The observation that BCMA can trigger Ag presen- through an autocrine pathway. Blood 103: 679–688. tation suggests the additional possibility that elevated BAFF lev- 21. Novak, A. J., J. R. Darce, B. K. Arendt, B. Harder, K. Henderson, W. Kindsvogel, J. A. Gross, P. R. Greipp, and D. F. Jelinek. 2004. Expression of BCMA, TACI, els, through the activation of BCMA on B cells with autoreactive and BAFF-R in multiple myeloma: a mechanism for growth and survival. Blood specificities, may enhance the presentation of self-Ags to autore- 103: 689–694. 22. Novak, A. J., R. J. Bram, N. E. Kay, and D. F. Jelinek. 2002. Aberrant expression active T cells. This enhancement is likely to contribute to the of B-lymphocyte stimulator by B chronic lymphocytic leukemia cells: a mech- breakdown of tolerance to self-Ags. anism for survival. Blood 100: 2973–2979. 2824 BCMA INDUCES Ag PRESENTATION

23. Thompson, J. S., S. A. Bixler, F. Qian, K. Vora, M. L. Scott, T. G. Cachero, and TRAF3 and activates NF-␬B, Elk-1, c-Jun N-terminal kinase, and p38 mi- C. Hession, P. Schneider, I. D. Sizing, C. Mullen, et al. 2001. BAFF-R, a newly togen-activated protein kinase. J. Immunol. 165: 1322–1330. identified TNF receptor that specifically interacts with BAFF. Science 293: 39. Shu, H. B., and H. Johnson. 2000. B cell maturation protein is a receptor for the 2108–2111. tumor necrosis factor family member TALL-1. Proc. Natl. Acad. Sci. USA 97: 24. Yan, M., J. R. Brady, B. Chan, W. P. Lee, B. Hsu, S. Harless, M. Cancro, 9156–9161. I. S. Grewal, and V. M. Dixit. 2001. Identification of a novel receptor for B 40. Ng, L. G., A. P. Sutherland, R. Newton, F. Qian, T. G. Cachero, M. L. Scott, lymphocyte stimulator that is mutated in a mouse strain with severe B cell de- J. S. Thompson, J. Wheway, T. Chtanova, J. Groom, et al. 2004. B cell-activating ficiency. Curr. Biol. 11: 1547–1552. factor belonging to the TNF family (BAFF)-R is the principal BAFF receptor 25. Yan, M., H. Wang, B. Chan, M. Roose-Girma, S. Erickson, T. Baker, D. Tumas, facilitating BAFF costimulation of circulating T and B cells. J. Immunol. 173: I. S. Grewal, and V. M. Dixit. 2001. Activation and accumulation of B cells in 807–817. TACI-deficient mice. Nat. Immunol. 2: 638–643. 41. Hsu, B. L., S. M. Harless, R. C. Lindsley, D. M. Hilbert, and M. P. Cancro. 2002. 26. von Bulow, G., J. M. van Deursen, and R. J. Bram. 2001. Regulation of the Cutting edge: BLyS enables survival of transitional and mature B cells through T-independent humoral response by TACI. Immunity 14: 573–582. distinct mediators. J. Immunol. 168: 5993–5996. 27. Seshasayee, D., P. Valdez, M. Yan, V. M. Dixit, D. Tumas, and I. S. Grewal. 42. Tone, M., Y. Tone, J. M. Babik, C. Y. Lin, and H. Waldmann. 2002. The role of 2003. Loss of TACI causes fatal lymphoproliferation and autoimmunity, estab- Sp1 and NF-␬B in regulating CD40 gene expression. J. Biol. Chem. 277: lishing TACI as an inhibitory BLyS receptor. Immunity 18: 279–288. 8890–8897. 28. Laabi, Y., M. P. Gras, F. Carbonnel, J. C. Brouet, R. Berger, C. J. Larsen, and 43. Hsing, Y., B. S. Hostager, and G. A. Bishop. 1997. Characterization of CD40 A. Tsapis. 1992. A new gene, BCM, on chromosome 16 is fused to the interleukin signaling determinants regulating nuclear factor-␬B activation in B lymphocytes. 2 gene by a t(4;16)(q26;p13) translocation in a malignant T cell lymphoma. J. Immunol. 159: 4898–4906. EMBO J. 11: 3897–3904. 44. Zhao, J., G. J. Freeman, G. S. Gray, L. M. Nadler, and L. H. Glimcher. 1996. A 29. Schneider, P., H. Takatsuka, A. Wilson, F. Mackay, A. Tardivel, S. Lens, cell type-specific enhancer in the human B7.1 gene regulated by NF-␬B. J. Exp. T. G. Cachero, D. Finke, F. Beermann, and J. Tschopp. 2001. Maturation of Med. 183: 777–789. marginal zone and follicular B cells requires B cell activating factor of the tumor 45. Blanar, M. A., L. C. Burkly, and R. A. Flavell. 1989. NF-␬B binds within a necrosis factor family and is independent of B cell maturation antigen. J. Exp. region required for B-cell-specific expression of major histocompatibility com- Med. 194: 1691–1697. plex class II gene E␣d. Mol. Cell Biol. 9: 844–846. 30. Patel, D. R., H. J. Wallweber, J. Yin, S. K. Shriver, S. A. Marsters, N. C. Gordon, 46. Hoebe, K., and B. Beutler. 2004. LPS, dsRNA and the interferon bridge to adap- Downloaded from M. A. Starovasnik, and R. F. Kelley. 2004. Engineering an APRIL-specific B cell tive immune responses: Trif, Tram, and other TIR adaptor proteins. maturation antigen. J. Biol. Chem. 279: 16727–16735. J. Endotoxin Res. 10: 130–136. 31. Xu, S., and K. P. Lam. 2001. B-cell maturation protein, which binds the tumor 47. Pomerantz, J. L., E. M. Denny, and D. Baltimore. 2002. CARD11 mediates necrosis factor family members BAFF and APRIL, is dispensable for humoral factor-specific activation of NF-␬B by the T cell receptor complex. EMBO J. 21: immune responses. Mol. Cell Biol. 21: 4067–4074. 5184–5194. 32. O’Connor, B. P., V. S. Raman, L. D. Erickson, W. J. Cook, L. K. Weaver, 48. Rothe, M., V. Sarma, V. M. Dixit, and D. V. Goeddel. 1995. TRAF2-mediated C. Ahonen, L. L. Lin, G. T. Mantchev, R. J. Bram, and R. J. Noelle. 2004. BCMA activation of NF-␬B by TNF receptor 2 and CD40. Science 269: 1424–1427.

is essential for the survival of long-lived bone marrow plasma cells. J. Exp. Med. 49. Cheng, G., A. M. Cleary, Z. S. Ye, D. I. Hong, S. Lederman, and D. Baltimore. http://www.jimmunol.org/ 199: 91–98. 1995. Involvement of CRAF1, a relative of TRAF, in CD40 signaling. Science 33. Smith, C. A., T. Davis, D. Anderson, L. Solam, M. P. Beckmann, R. Jerzy, 267: 1494–1498. S. K. Dower, D. Cosman, and R. G. Goodwin. 1990. A receptor for tumor ne- 50. Hostager, B. S., I. M. Catlett, and G. A. Bishop. 2000. Recruitment of CD40 and crosis factor deﬁnes an unusual family of cellular and viral proteins. Science 248: tumor necrosis factor receptor-associated factors 2 and 3 to membrane microdo- 1019–1023. mains during CD40 signaling. J. Biol. Chem. 275: 15392–15398. 34. He, K. L., and A. T. Ting. 2002. A20 inhibits tumor necrosis factor (TNF) ␣-in- 51. Sakata, N., H. R. Patel, N. Terada, A. Aruffo, G. L. Johnson, and E. W. Gelfand. duced apoptosis by disrupting recruitment of TRADD and RIP to the TNF re- 1995. Selective activation of c-Jun kinase mitogen-activated protein kinase by ceptor 1 complex in Jurkat T cells. Mol. Cell Biol. 22: 6034–6045. CD40 on human B cells. J. Biol. Chem. 270: 30823–30828. 35. Tang, G., Y. Minemoto, B. Dibling, N. H. Purcell, Z. Li, M. Karin, and A. Lin. 52. Li, Y. Y., M. Baccam, S. B. Waters, J. E. Pessin, G. A. Bishop, and 2001. Inhibition of JNK activation through NF-␬B target genes. Nature 414: G. A. Koretzky. 1996. CD40 ligation results in protein kinase C-independent 313–317. activation of ERK and JNK in resting murine splenic B cells. J. Immunol. 157:

36. Goodkin, M. L., A. T. Ting, and J. A. Blaho. 2003. NF-␬B is required for apo- 1440–1447. by guest on September 27, 2021 ptosis prevention during herpes simplex virus type 1 infection. J. Virol. 77: 53. Stein, J. V., M. Lopez-Fraga, F. A. Elustondo, C. E. Carvalho-Pinto, 7261–7280. D. Rodriguez, R. Gomez-Caro, J. De Jong, C. Martinez-A, J. P. Medema, and 37. He, K. L., and A. T. Ting. 2003. Essential role for IKK␥/NEMO in TCR-induced M. Hahne. 2002. APRIL modulates B and T cell immunity. J. Clin. Invest. 109: IL-2 expression in Jurkat T cells. Eur. J. Immunol. 33: 1917–1924. 1587–1598. 38. Hatzoglou, A., J. Roussel, M. F. Bourgeade, E. Rogier, C. Madry, J. Inoue, 54. Lesley, R., Y. Xu, S. L. Kalled, D. M. Hess, S. R. Schwab, H. B. Shu, and O. Devergne, and A. Tsapis. 2000. TNF receptor family member BCMA (B cell J. G. Cyster. 2004. Reduced competitiveness of autoantigen-engaged B cells due maturation) associates with TNF receptor-associated factor (TRAF) 1, TRAF2, to increased dependence on BAFF. Immunity 20: 441–453.