The CD28-Transmembrane Domain Mediates Chimeric Antigen Receptor

Home , CD28, CD80

bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

The CD28-transmembrane domain mediates chimeric antigen receptor

heterodimerization with CD28

Yannick D. Muller (1,2,3), Duy P. Nguyen (4), Leonardo M.R. Ferreira (1,2,5), Patrick Ho

(1,2,5), Caroline Raffin (2,5), Roxxana Beltran Valencia (1), Zion Congrave-Wilson (1),

Theodore Roth (2,6), Justin Eyquem (5), Frederic Van Gool (2,5), Alexander Marson (2,6,8),

James A. Wells (4,7), Jeffrey A. Bluestone (2,5), Qizhi Tang (1,2)

(1) Department of Surgery, University of California, San Francisco, California, USA

(2) Diabetes Center, University of California, San Francisco, CA, USA

(3) Division of Immunology and Allergy, Lausanne University Hospital, University of

Lausanne, Switzerland

(4) Department of Pharmaceutical Chemistry, University of California, San Francisco,

California, USA

(5) Sean N. Parker Autoimmune Research Laboratory, University of California, San

Francisco, California, USA

(6) Department of Medicine, University of California, San Francisco, California, USA

(7) Department of Cellular and Molecular Pharmacology, University of California, San

Francisco, California, USA

(8) Gladstone Institutes, San Francisco, California, USA

Running title: CD28-CAR heterodimerization

Correspondence to: [email protected], Department of Surgery, 505 Parnassus Ave. Box

0780. San Francisco. California. Phone: +1 (415) 476 1739. [email protected],

1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Division of Immunology and Allergy, Lausanne University Hospital, University of Lausanne,

Switzerland. Phone: +41(0)795569438.

Abbreviations:

Chimeric Antigen Receptor, CAR

Hinge domain, HD

Intracellular signaling domain, ICD

Single chain variable fragment, scFv

Transmembrane domain, TMD

2 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Graphical abstract

CD28-TM CD80 CD86 F F W W V V L L V V V V V V G G V V V V V V G G L H V V L H H L L L A A C C Y Y S S L L L L

V V 4-1BB 4-1BB

4-1BB 4-1BB T T 28 V V 28

A A 28 ! F F ! ! I I I I F F W W CD28 CD28 CAR CAR V V

Abstract

Anti-CD19 chimeric antigen receptor (CD19-CAR)-engineered T cells are approved

therapeutics for malignancies. The impact of the hinge (HD) and transmembrane (TMD)

domains between the extracellular antigen-targeting and the intracellular signaling modalities

of CARs has not been systemically studied. Here, a series of CD19-CARs differing only by

their HD (CD8/CD28/IgG4) and TMD (CD8/CD28) was generated. CARs containing a CD28-

TMD, but not a CD8-TMD, formed heterodimers with the endogenous CD28 in human T cells,

as shown by co-immunoprecipitation and CAR-dependent proliferation to anti-CD28

stimulation. This dimerization depended on polar amino-acids in the CD28-TMD. CD28-CAR

heterodimerization was more efficient in CARs containing a CD8-HD or CD28-HD as

compared to an IgG4-HD. CD28-CAR heterodimers did not respond to CD80 and CD86

stimulation but led to a significant reduction of CD28 cell-surface expression. These data unveil

a new property of the CD28-TMD and suggest that TMDs can modulate CAR T-cell activities

by engaging endogenous partners.

3 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Introduction

Chimeric antigen receptor (CAR)-engineered T cells are emerging as promising therapies for

otherwise untreatable diseases (1). The FDA has approved two anti-CD19 CAR (CD19-CAR)

T-cell products, tisagenlecleucel (CTL-019, KYMRIAH, Novartis Pharmaceuticals Corp.) and

axicabtagene ciloleucel (KTE-19, YESCARTA, Kite Pharma, Inc.), for the treatment of acute

lymphocytic leukemia and relapsed/refractory large B-cell lymphoma. A third CAR-T product,

Lisocabtagene Maraleucel (JCAR-17, LISO-CEL, Bristol-Myers Squibb), is currently under

review by the FDA for adults with relapsed/refractory large B-cell lymphoma. The success of

these CAR-T products can be attributed to their antigen specificity, all conferred by the single

chain variable fragment (scFv) of the anti-CD19 antibody clone FMC63, and their intracellular

signaling domains (ICD), 28� for KTE-19 and 4-1BB� for CTL-019 and JCAR-17. It is worth

noting that these products differ in their hinge domain (HD) and transmembrane domain

(TMD), CD28-HD/TMD for KTE-19, CD8-HD/TMD for CTL-019, and IgG4-HD/CD28-TMD

for JCAR-17 (2–4).

In earlier iterations of CAR designs, CD28- and CD8-TMDs were chosen because they are

considered to be inert when compared to the CD3z-derived TMD that mediated association of

the CAR with the endogenous T cell receptor (TCR)/CD3 complexes (5). Emerging evidence,

however, suggests potential contributions of the HD and TMD to the function of CAR-T

cells. The group of Dr. June first observed unexpectedly sustained proliferation after a single

in-vitro stimulation of CD28-HD/TMD but not CD8-HD/TMD-based-CAR T cells directed

against mesothelin (6). More recently, the group of Dr. Mackall demonstrated that replacing a

CD8-HD/TMD with a CD28-HD/TMD lowers the threshold for CAR activation to CD19 in an

ICD-independent fashion (7). These results corroborate the finding reported by the group of Dr.

4 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Kochenderfer showing that T cells with CD28-HD/TMD-containing CARs secrete higher

levels of interferon-ɣ upon CAR stimulation (8, 9). In a recent clinical trial, the Kochenderfer’s

group observed lower incidences of neurotoxicity with a new humanized CD19-CAR-T cell

product engineered with CD8-HD/TMD when compared to KTE-19 and attributed this

difference to the HD/TMD in the two CARs (10).

The mechanisms underlying the differences between CD8-HD/TMD and CD28-HD/TMD

domains remain to be defined (11). In the present work, we investigated the impact of CD28-

TMD on CD19-CARs in human T cells and made the surprising discovery that CD28-TMD

mediates a heterodimeric association of the CAR with the endogenous CD28 receptor.

Results and discussion

To investigate the role of CAR TMD, we first generated a panel of CD19-CARs differing only

by their HD (CD8, CD28 or IgG4) and TMD (CD8 versus CD28), all of which have been used

to engineer CAR T cells for clinical applications (Figure 1A, Supplementary Figure 1). Each

CAR was designed with a MYC tag on the N-terminus of the scFv and a mCherry reporter

(Figure 1A). We selected 4-1BB’s ICD to avoid potential interactions with the endogenous

CD28. Furthermore, we disrupted the TCR beta chain constant region (TRBC) locus using

CRISPR/Cas9 to prevent any potential confounding influence by the endogenous TCR (Figure

1B). The TRBC gene-disrupted human T cells retained cell surface expression of TCR/CD3

proteins for a few days after editing and could thus be activated with anti-CD3/CD28 beads.

Edited CD4+ T cells were transduced with various lentiviral CAR constructs by spinoculation

two days after activation. On day 9 after stimulation, 87-98% of the cells were CD3-negative,

demonstrating successful TCR deletion in the majority of the cells (Figure 1C). Comparable

transduction efficiencies were observed across the different CAR constructs, as assessed by

5 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

mCherry expression and all CAR T cells responded to CD19 re-stimulation (Supplementary

Figure 2A-C).

Re-stimulation of TCR-edited CAR-transduced T cells, containing a mixed population of

CD3+/- and CAR+/- cells, with anti-CD3/CD28 beads on day 9, resulted in the expansion of

CD3+ T cells that escaped TCR deletion (Figure 1D and E). Surprisingly, TCR-deficient, CD3-

CAR+ T cells with CARs containing a CD28-TMD, but not CD8-TMD, also proliferated.

Consequently, CAR+ T cells transduced with CARs containing a CD28-TMD, but not CD8-

TMD, were enriched at the end of the 5-day re-stimulation (Figure 1F). The lack of proliferation

of CD8-TMD-containing CAR T cells suggests that expansion was not a consequence of

bystander effects, such as IL-2 production by the CD3+CAR+ T cells in the same culture. To

determine if this is unique to CARs with 4-1BB-ICD, we repeated the experiment using CARs

with a CD28-ICD and observed a similar pattern of proliferation and enrichment of CD3-CAR+

T cells after anti-CD3/28 bead re-stimulation (Supplementary Figure 3A-D).

To verify that the endogenous CD28 receptor was required for proliferation in response to anti-

CD3/CD28 beads, both the CD28 and TRBC genes were deleted in T cells before activation

and lentiviral CAR transduction (Figure 2A). CD3-CAR+CD28+ T cells expressing CARs

containing a CD28-TMD, but not a CD8-TMD, proliferated in response to anti-CD3/28 beads.

Deletion of CD28 abrogated the ability of CD28-TMD-containing CAR T cells to proliferate

in response to anti-CD3/CD28 beads, demonstrating that CD28-mediated activation depends

on endogenous CD28 expression (Figure 2A).

To determine if CD3- T cells with a CD28-TMD-containing CAR can respond to anti-CD28

stimulation alone without influence from other cells in the culture, we FACS-purified CD3-

CAR+ cells before re-stimulation with plate-bound or soluble anti-CD28 antibodies (clone

6 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

CD28.2). For these experiments, we excluded CD28-HD containing CARs to avoid potential

interaction mediated by the CD28-HD. The results confirmed that CAR T cells engineered with

a CD28-TMD, but not a CD8-TMD, proliferated in response to anti-CD28 alone (Figure 2B).

The proliferative response induced by anti-CD28 alone in CD3-CAR+ T cells was similar in

CAR T cells with a 4-1BB or a CD28 costimulatory domain in their ICD (Supplementary Figure

4A). Moreover, anti-CD28 induced secretion of multiple cytokines by CD3-CAR+ T cells, but

not by CD3+CAR- or CD3-CAR- control cells (Supplementary Figure 4B). Collectively, these

results show that CD28-TMD containing CARs can be activated by anti-CD28 without antigen

recognition by the CAR or TCR. These results, together with recent reports of phosphorylation

of endogenous CD28 upon CAR stimulation (with a CD28-TMD domain), suggest interactions

between CD28 and CD28-TMD-containing CARs (12, 13).

To directly determine if CD28-TMD-containing CAR and CD28 physically interact, we

performed co-immunoprecipitation experiments. CD28-TMD-containing, but not CD8-TMD-

containing, CARs co-immunoprecipitated with endogenous CD28. Conversely, endogenous

CD28 co-immunoprecipitated with CD28-TMD-containing, but not CD8-TMD-containing,

CARs, demonstrating that the CD28-TMD of the CAR interacted with the endogenous CD28

receptor (Figure 2C). It is worth noting that CD8-HD/CD28-TMD CARs and CD28 co-

immunoprecipitated more efficiently when compared to the IgG4-HD-CD28-TMD construct,

which is consistent with the better proliferation observed with CD8-HD/CD28-TMD CAR

upon anti-CD28 stimulation (Figure 2B). We speculate that this difference may be due to the

very short IgG4-HD (Supplementary Figure 1) which may not be as flexible as other hinges,

leading to steric hindrance by the globular scFv domain (14). Alternatively, the membrane

proximity of the cysteine in the IgG4-HD may not readily form disulfide bonds with the cysteine

in the CD28 hinge of the endogenous CD28 receptor.

7 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Next, we generated a series of CD28-TMD CAR mutants to determine the molecular basis of

the CAR-CD28 interaction. We first mutated the two glycine G160L and G161L (M1) that may

function as part of a glycine-zipper motif, a process known to control TMD dimerization (15).

The second mutation replaced the C165 cysteine to alanine, as cysteine can form disulfide

bonds (M2). The third (M3) and fourth (M4) sets of mutations were made on amino acids

targeting either the two bulky hydrophobic tryptophans at the border of the TMD (W154L and

W179L) or the four amino-acid residues in the core of the TMD (C165L, Y166L, S167L, and

T171L), as cysteine could form a disulfide bond and others may hydrogen bond across the

interface (Figure 3A). All CARs with TMD-mutants were readily expressed on the cell surface

(Figure 3A). The various CD3-CAR+ cells with mutated CD28-TMD were examined for their

ability to proliferate to anti-CD28 stimulation. Based on the level of mCherry expression, CD3-

CAR+ cells were defined as low, intermediate, or high CAR expressors. CAR T cells with the

wild type CD28-TMD (CD28WT-TMD) proliferated to anti-CD3/CD28 stimulation regardless

of the level of CAR expression (Figure 3B-C). The CD28M4-TMD, but not the other TMD-

mutants, abrogated the proliferation of CD3-CARlow cells and significantly reduced

- int proliferation of CD3 CAR cells with either CD8-HD or IgG4-HD (Figure 3B-C).

Interestingly, CD3-CARhigh T cell proliferation was only weakly affected by M4 mutations. The

proliferation of CD3-CARhigh T cells was not observed under conditions when the cells were

not re-stimulated, demonstrating that activation was dependent on anti-CD28 stimulation, and

not a result of autonomous CAR tonic signaling (Figure 3C). It has been reported that CD28-

mediated co-stimulation can induce coalescence of membrane microdomains enriched for

signaling molecules resulting in enhanced T cell activation (16). Thus, cells expressing high

levels of CAR may become sufficiently activated to proliferate by CD28-induced membrane

compartmentalization.

8 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

To confirm that the CD28M4-TMD mutant disrupted the interaction between CD28 and the

CAR, we sorted CAR T-cells engineered either with a CD8-HD/CD28WT-TMD, or with CD8-

HD/CD28M4-TMD and re-challenged them with plate-bound anti-CD28 (Figure 3D). In this

assay, only CAR T cells with a CD28WT-TMD showed significant proliferation, as measured

by radiolabeled-thymidine incorporation. Importantly, co-immunoprecipitation of the

endogenous CD28 and CD28-TMD-containing CAR was abrogated by the M4-mutant,

demonstrating that the four amino acids in the core of the CD28-TMD are necessary for CAR-

CD28 heterodimerization (Figure 3E). Our finding is consistent with a recent report of the

existence of an evolutionarily conserved YxxxxT motif in the CD28TMD that mediates CD28

homodimerization (23). This study further demonstrates that this motif also mediates

heterodimerization between synthetic CAR and the endogenous CD28.

To determine if the natural ligands of CD28, CD80 and CD86, can activate CARs by engaging

CD28-CAR heterodimers, we stimulated CAR T cells with different HD and TMD with CD19-

deficient Raji cells that express high levels of CD80 and CD86 (Supplementary Figure 5A).

CD19null Raji induced CAR T cell activation, although less than that induced by the CD19+ Raji

cells (Supplementary Figure 5B, Figure 4A). This “off-target” activation was mostly seen in T

cells with high CAR expression (Figure 4A-B). Moreover, CAR T activation by CD19null Raji

was significantly reduced by CTLA-4 Ig, a high-affinity competitive inhibitor of CD28 by

binding to CD80 and CD86 (Figure 4A-B), demonstrating that the off-target activation of CAR

T cells is predominantly driven by the CD28 interaction with CD80 and CD86. CD28M4-TMD

did not markedly affect the off-target activation of the IgG4-HD CAR, likely because of the

WT weak heterodimerization between IgG4-HD/CD28 -TMD CAR and CD28 (Figure 2C).

Intriguingly, the CD28M4-TMD significantly potentiated off-target activation of CD8-HD

containing CAR T cells (Figure 4B). CD80 and CD86 are reported to engage CD28

9 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

homodimers (17) and our results suggest they are unable to recognize CD28 in CD28-CAR

heterodimers. This further suggests that the off-target CAR T cell activation by CD80/86 was

mediated by the endogenous CD28 homodimers, which may induce CAR clustering through

membrane compartmentalization and signaling especially in cells with high CAR expression

(Figure 3C).

A previous report has shown that the percentages of CD28+ CD19-CAR T cells engineered with

a CD28-TMD are significantly lower when compared to CD19-CAR T cells engineered with a

CD8-TMD. This correlated with a significantly lower number of CD28-TMD-containing CAR

T cells in the peripheral blood one month after infusion into patients, suggesting that the reduced

CD28 expression might have impaired CAR T cell persistence (10). We thus examined if CAR-

CD28 heterodimerization regulates CD28 expression. Since lentiviral transduction resulted in

a wide range of CAR expression levels that influenced on- and off-target T cell activation, we

expressed various CARs by knocking them into the TCR alpha constant (TRAC) gene locus

using homology-directed repair that provided more homogenous expression of the CAR (Figure

4C) (18). Knock-in efficiencies ranged between 17-72% across the various CAR constructs but

the levels of CAR expression were similar regardless of the differences in editing efficiency

(Supplementary Figure 6A). In addition, all CAR T cells proliferated comparably upon

stimulation with CD19+ NALM-6 target cells (Supplementary Figure 6B), demonstrating M4

mutations in the CD28-TMD did not impact on-target CAR activation. Six days after CAR

knock-in prior to exposing the cells to target cells, we observed a 26-51% reduction in CD28

staining on CAR T cells containing a CD28WT-TMD as compared to a CD28M4-TMD with

either a CD8-HD or CD28-HD (Figure 4D-E). This reduction was seen in both CD4 and CD8

T cells with CARs containing either 28� or 4-1BB� ICD. The downregulation of CD28 in CAR

WT T cells was only minimal with CAR T cells engineered with an IgG4-HD/CD28 -TMD,

10 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

echoing the earlier result of inefficient CAR-CD28 heterodimerization in the context of IgG4-

HD. However, the reduced staining is not likely due to the inability of the anti-CD28 antibody

to bind to CD28 in heterodimers since we could activate heterodimer-expressing CAR T cells

with anti-CD28 (Figures 2 and 3). Rather, reduced CD28 staining most likely reflected a loss

of cell surface expression of CD28 protein. CD28 downmodulation occurred days after CAR

engineering, without exposure to target antigen or CD28 ligands, suggesting that this might be

mediated at the level of protein synthesis and stability. A recent report showed that CD28 cell-

surface expression depended on the dimerization of the CD28 TMD (23). Thus, the reduction

of CD28 expression likely resulted from reduced homodimerization of endogenous CD28 due

to the recruitment of CD28 into CAR heterodimers. The finding of CAR CD28-TMD-

dependent downmodulation of CD28 may also explained our observation that CD80/86-

mediated off-target activation was less pronounced with the dimerization-competent CD28-

TMD CAR than with the dimerization-disabled CD28-TMDM4 CAR (Figure 4B).

In conclusion, we have discovered that the CD28-TMD mediates CAR and CD28

heterodimerization via a core of up to four polar amino acids, of which the tyrosine (Y),

threonine (T), and serine (S) can form hydrogen bonds (19). In fact, the CAR-CD28

heterodimerization may be mediated by the YxxxxT motif in the CD28-TMD solely, as recently

demonstrated in the context of CD28 dimerization (23). Importantly, the efficiency of the

heterodimerization is modulated by the HD of the CAR. The CAR-CD28 heterodimer mediates

CAR T-cell activation after anti-CD28 stimulation independently of TCR and CAR cognate

antigens but did not respond to natural CD28 ligands, CD80 and CD86. Yet, CAR-CD28

heterodimerization is associated with reduced cell surface expression of CD28. Together, these

results demonstrate an active role of the TMD and the HD on CAR T cells. Future investigations

are needed to understand the contribution of the CAR-CD28 heterodimerization to CAR T cell

11 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

activation, survival, exhaustion, and CAR T-cell associated toxicities. Thus, our findings

suggest that CAR TMDs may modulate CAR T activities by association with their endogenous

partners. Optimization of CAR designs should incorporate consideration of TMD-mediated

receptor interactions.

Materials and methods

Human T cells isolation

Human T cells were obtained by purchasing whole blood units from STEMCELL technologies

(Vancouver, Canada). STEMCELL reported that these products are distributed using

Institutional Review Board (IRB)-approved consent forms and protocols. Peripheral blood

mononuclear cells were isolated by Ficoll density gradient centrifugation and T cells were

further enriched using the EasySep Human T Cell Isolation Kit (STEMCELL) per

manufacturer’s instructions. Enriched T cells were stained with antibodies against CD4, CD25,

and CD127 and CD4+CD127+CD25low conventional T cells were purified by fluorescence-

activated cell sorting (FACS). Alternatively, enriched T cells were directly edited and activated

with anti-CD3/CD28 beads and IL-2 (300 IU/mL, Prometheus laboratories, Nestle Health

Science, Lausanne Switzerland). Cells were either used fresh or cryopreserved in fetal calf

serum (FCS) with 10% DMSO and used later after thawing. When frozen cells were used, cells

were thawed and cultured overnight in 300 IU/mL recombinant human IL-2 before editing and

cell activation.

Genome editing using ribonucleoprotein complex

Ribonucleoprotein complexes were made by complexing CRISPR RNAs (crRNAs) and trans-

activating crRNAs (tracrRNA) chemically synthesized (Integrated DNA Technologies (IDT),

12 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Coralville, IA) with recombinant Cas9 protein (QB3 Macrolab, UC Berkley, CA) as previously

described (20). Guide RNA sequences used for gene editing were:

(1) T cell receptor beta chain constant region (TRBC): CCCACCAGCTCAGCTCCACG;

(2) CD19: CGAGGAACCTCTAGTGGTGA;

(3) CD28: TTCAGGTTTACTCAAAAACG.

Lyophilized RNAs were resuspended at 160µM in 10mM Tris-HCl with 150mM KCl and

stored in aliquots at -80oC. The day of electroporation, crRNA and tracrRNA aliquots were

thawed and mixed at a 1:1 volume and annealed for 30 minutes at 37°C. The 80 µM guide RNA

complex was mixed at 37°C with Cas9 NLS at a 2:1 gRNA to Cas9 molar ratio for another 15

minutes. The resulting ribonucleoprotein complex (RNP) was used for genome editing. To

delete TCR or CD28 genes, 1 x106 T cells were mixed with appropriate RNP and electroporated

using a Lonza 4D 96-well electroporation system (pulse code EH115). For generating CD19-

variants of Raji cells, parent Raji cells (ATCC® CCL-86™, Manassas, VA) were electroporated

(pulse code EH140) with ribonucleoprotein complex targeting CD19 and the CD19- negative

fraction was purified by FACS.

Activation and lentiviral transduction of CD4+ T cells

CD4+ T cells were electroporated prior to stimulation with anti-CD3/CD28 beads (Dynabeads

Human T-Activator CD3/CD28, Thermo Fisher Scientific (ThermoFisher), Waltham, MA).

Cells were cultured in RPMI supplemented with 10% FCS and 300 IU/mL of IL-2 for the first

two days after electroporation and reduced to 30 IU/mL of IL-2 for CD4 T cells and 100 IU/mL

for bulk T cells thereafter. Lentiviruses encoding CD19-I4-28-4-1BB�-T2A-EGFRt and CD19-

I4-28-28�-T2A-EGFRt were provided by Juno Therapeutics (Bristol-Myers Squibb, New York,

NY). Other lentiviral constructs, depicted in Figure 2A, were cloned into the pCDH-EF1-FHC

vector (Addgene plasmid #64874, Watertown, MA) as previously described (21). Briefly, genes

13 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

encoding CAR constructs were purchased as gblocks (IDT) (21, 22) and amplified by PCR and

cloned into the pCDH vector using Infusion cloning tools (Takara Bio, Kusatsu, Japan).

Sequences for all clones used in subsequent experiments were confirmed by sequencing. All

pLX302-based lentiviruses were produced and tittered by the viral core of UCSF. All

lentiviruses were aliquoted and stored at -80°C until use. Transduction was performed on day

2 after CD4+ T cell activation at a multiplicity of infection of 1 by spinoculation (1200 g, 30

minutes, 30°C) in medium supplemented with 10% FCS and 0.1 mg/mL of protamine.

Regarding AAV production, helper plasmid 30 µg of pDGM6 (a kind gift from YY Chen,

University of California, Los Angeles), 40 µg of pAAV helper, and 15 nmol PEI were utilized.

AAV6 vector production was carried out by iodixanol gradient purification. After

ultracentrifugation, the AAVs were extracted by puncture and further concentrated using 50

mL Amicon column (Millipore Sigma Burlington, MA) and directly titrated on primary human

T cells. Transduction was performed on day 2 after T cell activation.

In vitro activation of gene-edited CAR T cells

For some experiments, day-9 cells were re-stimulated without separating edited and transduced

cells. For proliferation assays, the cell mixtures were stained with 2.5 µM carboxyfluorescein

diacetate succinimidyl ester (CFDA SE, ThermoFisher, referred to as CFSE) before

restimulation with anti-CD3/CD28 beads. For some other experiments, day-9 cells were

separated by FACS to purify CD3+ and CD3- T cells with or without CAR. For assessing early

T cell activation, purified CAR T cells were stimulated with soluble anti-CD28 (clone CD28.2,

1 µg/mL, BD Pharmigen), parental CD19+ Raji cells, or CD19deficient Raji cells for 2 days. In

some cultures, CTLA-4 Ig (kindly provided by Dr. Vincenti, UCSF) was added at a

concentration of 13.5 µg/mL. For measurements of proliferation, purified cells were stimulated

with soluble anti-CD28 (clone CD28.2, 1 µg/mL, BD Pharmigen), plate-bound anti-CD28

14 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(clone CD28.2, 10 µg/mL), or soluble anti-CD3 (clone HIT3α 2 µg/mL. BD Pharmigen). After

48 hours, a portion of the supernatant was collected and analyzed for cytokine secretion using

multiplexed Luminex (Eve Technologies, Calgary, Canada). The cells were then pulsed with

0.5µCi of 3H thymidine and cultured for another 16-18 hrs before harvesting the cells to

determine the level of 3H thymidine incorporation using a scintillation counter.

Flow cytometry

The following antibodies were used for phenotyping and proliferation assays: anti-CD3-

PE/Cy7 (clone SK7, Biolegend, San Diego, CA), anti-CD4-PerCP (clone SK3, BD Pharmigen,

San Jose, CA), anti-CD4 A700 (clone RPA T4, Biolegend), anti-CD19 APC (clone HIB19, BD

Pharmigen), anti-CD25 APC (clone 2A3, BD Pharmigen), anti-CD71 FITC (clone CY1G4,

Biolegend), anti Myc FITC or APC (clone 9B11, Cell Signaling, Danvers, MA), anti-FMC19

idiotype APC (Juno therapeutics), anti-EGFRt PE (Juno therapeutics), anti-CD28 APC (clone

28.2, Biolegend), CD8 APC-Cy7 (clone SK1 Biolegend). DAPI (ThermoFisher, Waltham,

MA) was used to stain dead cells for exclusion during analysis. For in vitro mixed lymphocyte

reactions or CFSE in vivo analysis, Fc-block (Sigma-Aldrich, St. Louis, MO) was used (20

µg/mL) 5 minutes prior to surface staining. Flow cytometric analyses were performed on an

LSRII flow cytometer (BD Pharmigen). Fluorescence-activated cell sorting was performed on

FACSAria III (BD Pharmigen). All flow cytometry data were analyzed using Flowjo software

(Tree Star, Ashland, OR).

Immunoprecipitation

FACS-purified CD3-CAR+ or CD3-CAR- CD4+ T cells (8 x 106 each) were lysed in Pierce™

IP Lysis Buffer (ThermoFisher) supplemented with Complete Protease Inhibitor Cocktail

(Roche, Basel, Switzerland) for 30 minutes using a vertical rotator. Cell lysis was completed

15 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

by briefly sonicating cells using a Q500 sonicator (QSonica, Newtown, CT). PierceTM anti-c-

Myc magnetic beads (clone 9E10, ThermoFisher) were used for immunoprecipitation of the

CAR. Alternatively, rabbit anti-human CD28 (clone D2Z4E, Cell Signaling) followed by anti-

rabbit IgG PierceTM protein A/G magnetic beads (Thermo Fisher) were used for CD28

immunoprecipitation of the cell lysate according to the manufacturer’s instructions.

Western blot

Equal masses of protein lysate or equal volumes of immunoprecipitation eluents were loaded

into NuPAGE 4-12% Bis-Tris gels (ThermoFisher). After electrophoresis, proteins were

transferred onto PVDF membranes (ThermoFisher) using an iBlot 2 Dry Blotting system. After

blocking with Tris-buffered saline with 0.1% Tween-20 and 5% bovine serum albumin

(TBSTB), membranes were stained with primary and secondary antibodies diluted in TBSTB.

The following antibodies were used: mouse anti-Myc (clone 9B11, Cell Signaling), rabbit anti-

CD28 (clone D2Z4E, Cell Signaling), HRP-conjugated anti-mouse IgG (Cell Signaling) and

HRP-conjugated anti-rabbit IgG (Cell Signaling).

Authors contributions: Conceptualization: YDM, QT; Formal analysis: YDM; Funding

acquisition: QT; Investigation: YDM, DPN, LMRF, CR, ZCW, RBV; Methodology: YDM

DPN, TR, PH, JE; Analysis: YDM, DPN; Resources: QT, JAB, AM, JAW. Supervision: QT,

JAB. Writing-original draft: YDM, QT. Writing-review & editing: YDM, QT, DPN, LMRF,

CR, AM, JE, TR, FVG, ZCW, RBV, JAW, JAB.

Acknowledgment: YDM is supported by the Swiss National Science Foundation (Advanced

Postdoctoral Mobility Grant no. P300PB_174500). LMRF is the Jeffrey G. Klein Family

Diabetes Fellow. QT and JAB acknowledge research grants from the NIDDK (UC4 DK116264

16 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

and P30 DK063720). DN was supported on a Damon Runyon Fellowship (DRG-2204-14).

JAW thanks support from R35GM122451 and the Harry and Dianna Hind Professorship. A.M.

holds a Career Award for Medical Scientists from the Burroughs Wellcome Fund, is an

investigator at the Chan–Zuckerberg Biohub, a member of the Parker Institute for Cancer

Immunotherapy (PICI) and is a recipient of The Cancer Research Institute (CRI) Lloyd J. Old

STAR grant. The Marson lab has received funds from the Innovative Genomics Institute (IGI)

and the Parker Institute for Cancer Immunotherapy (PICI). We acknowledge Juno therapeutics

for providing I4-28-EGFRt viruses (with a 4-1BB or CD28 co-stimulatory domain).

Conflict of interest: JAB and QT are co-founders of Sonoma Biotherapeutics. AM and TR are

co-founders of Arsenal Biosciences. AM is also a co-founder of Spotlight Therapeutics. JAB

and AM have served as advisors to Juno Therapeutics. AM was a member of the scientific

advisory board at PACT Pharma and was an advisor to Trizell. QT, JAB, and AM have received

sponsored research support from Juno Therapeutics. AM has received research support from

Epinomics, Sanofi, GlaxoSmithKline, and gifts from Gilead and Anthem. JAW is co-Founder

of Soteria Biotherapeutics developing small molecule switchable biologics, on the SAB of

Spotlight, and recipient of sponsored research from Bristol Myers Squibb. JE is an advisor for

Mnemo Thérapeutics and Cytovia and received research support from Cytovia. The authors

declare no other relevant conflict of interest.

17 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

References

1. June, C. H., and M. Sadelain. 2018. Chimeric Antigen Receptor Therapy. N Engl J Med 379: 64-73. 2. Schuster, S. J., M. R. Bishop, C. S. Tam, E. K. Waller, P. Borchmann, J. P. McGuirk, U. Jäger, S. Jaglowski, C. Andreadis, J. R. Westin, I. Fleury, V. Bachanova, S. R. Foley, P. J. Ho, S. Mielke, J. M. Magenau, H. Holte, S. Pantano, L. B. Pacaud, R. Awasthi, J. Chu, Ö. Anak, G. Salles, R. T. Maziarz, and I. JULIET. 2019. Tisagenlecleucel in Adult Relapsed or Refractory Diffuse Large B-Cell Lymphoma. N Engl J Med 380: 45-56. 3. Gardner, R. A., O. Finney, C. Annesley, H. Brakke, C. Summers, K. Leger, M. Bleakley, C. Brown, S. Mgebroff, K. S. Kelly-Spratt, V. Hoglund, C. Lindgren, A. P. Oron, D. Li, S. R. Riddell, J. R. Park, and M. C. Jensen. 2017. Intent-to-treat leukemia remission by CD19 CAR T cells of defined formulation and dose in children and young adults. Blood 129: 3322-3331. 4. Locke, F. L., A. Ghobadi, C. A. Jacobson, D. B. Miklos, L. J. Lekakis, O. O. Oluwole, Y. Lin, I. Braunschweig, B. T. Hill, J. M. Timmerman, A. Deol, P. M. Reagan, P. Stiff, I. W. Flinn, U. Farooq, A. Goy, P. A. McSweeney, J. Munoz, T. Siddiqi, J. C. Chavez, A. F. Herrera, N. L. Bartlett, J. S. Wiezorek, L. Navale, A. Xue, Y. Jiang, A. Bot, J. M. Rossi, J. J. Kim, W. Y. Go, and S. S. Neelapu. 2019. Long-term safety and activity of axicabtagene ciloleucel in refractory large B-cell lymphoma (ZUMA-1): a single-arm, multicentre, phase 1-2 trial. Lancet Oncol 20: 31-42. 5. Bridgeman, J. S., R. E. Hawkins, S. Bagley, M. Blaylock, M. Holland, and D. E. Gilham. 2010. The optimal antigen response of chimeric antigen receptors harboring the CD3zeta transmembrane domain is dependent upon incorporation of the receptor into the endogenous TCR/CD3 complex. J Immunol 184: 6938-6949. 6. Frigault, M. J., J. Lee, M. C. Basil, C. Carpenito, S. Motohashi, J. Scholler, O. U. Kawalekar, S. Guedan, S. E. McGettigan, A. D. Posey, S. Ang, L. J. Cooper, J. M. Platt, F. B. Johnson, C. M. Paulos, Y. Zhao, M. Kalos, M. C. Milone, and C. H. June. 2015. Identification of chimeric antigen receptors that mediate constitutive or inducible proliferation of T cells. Cancer Immunol Res 3: 356-367. 7. Majzner, R. G., S. P. Rietberg, E. Sotillo, R. Dong, V. T. Vachharajani, L. Labanieh, J. H. Myklebust, M. Kadapakkam, E. W. Weber, A. M. Tousley, R. M. Richards, S. Heitzeneder, S. M. Nguyen, V. Wiebking, J. Theruvath, R. C. Lynn, P. Xu, A. R. Dunn, R. D. Vale, and C. L. Mackall. 2020. Tuning the Antigen Density Requirement for CAR T Cell Activity. Cancer Discov 8. Alabanza, L., M. Pegues, C. Geldres, V. Shi, J. J. W. Wiltzius, S. A. Sievers, S. Yang, and J. N. Kochenderfer. 2017. Function of Novel Anti-CD19 Chimeric Antigen Receptors with Human Variable Regions Is Affected by Hinge and Transmembrane Domains. Mol Ther 25: 2452-2465. 9. Kochenderfer, J. N., M. E. Dudley, S. H. Kassim, R. P. Somerville, R. O. Carpenter, M. Stetler-Stevenson, J. C. Yang, G. Q. Phan, M. S. Hughes, R. M. Sherry, M. Raffeld, S. Feldman, L. Lu, Y. F. Li, L. T. Ngo, A. Goy, T. Feldman, D. E. Spaner, M. L. Wang, C. C. Chen, S. M. Kranick, A. Nath, D. A. Nathan, K. E. Morton, M. A. Toomey, and S. A. Rosenberg. 2015. Chemotherapy-refractory diffuse large B-cell lymphoma and indolent B-cell malignancies can be effectively treated with autologous T cells expressing an anti-CD19 chimeric antigen receptor. J Clin Oncol 33: 540-549. 10. Brudno, J. N., N. Lam, D. Vanasse, Y. W. Shen, J. J. Rose, J. Rossi, A. Xue, A. Bot, N. Scholler, L. Mikkilineni, M. Roschewski, R. Dean, R. Cachau, P. Youkharibache, R. Patel, B. Hansen, D. F. Stroncek, S. A. Rosenberg, R. E. Gress, and J. N. Kochenderfer.

18 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

2020. Safety and feasibility of anti-CD19 CAR T cells with fully human binding domains in patients with B-cell lymphoma. Nat Med 26: 270-280. 11. Fink, A., N. Sal-Man, D. Gerber, and Y. Shai. 2012. Transmembrane domains interactions within the membrane milieu: principles, advances and challenges. Biochim Biophys Acta 1818: 974-983. 12. Salter, A. I., R. G. Ivey, J. J. Kennedy, V. Voillet, A. Rajan, E. J. Alderman, U. J. Voytovich, C. Lin, D. Sommermeyer, L. Liu, J. R. Whiteaker, R. Gottardo, A. G. Paulovich, and S. R. Riddell. 2018. Phosphoproteomic analysis of chimeric antigen receptor signaling reveals kinetic and quantitative differences that affect cell function. Sci Signal 11: 13. Ramello, M. C., I. Benzaïd, B. M. Kuenzi, M. Lienlaf-Moreno, W. M. Kandell, D. N. Santiago, M. Pabón-Saldaña, L. Darville, B. Fang, U. Rix, S. Yoder, A. Berglund, J. M. Koomen, E. B. Haura, and D. Abate-Daga. 2019. An immunoproteomic approach to characterize the CAR interactome and signalosome. Sci Signal 12: 14. Aalberse, R. C., and J. Schuurman. 2002. IgG4 breaking the rules. Immunology 105: 9- 19. 15. Khadria, A. S., B. K. Mueller, J. A. Stefely, C. H. Tan, D. J. Pagliarini, and A. Senes. 2014. A Gly-zipper motif mediates homodimerization of the transmembrane domain of the mitochondrial kinase ADCK3. J Am Chem Soc 136: 14068-14077. 16. Khan, A. A., C. Bose, L. S. Yam, M. J. Soloski, and F. Rupp. 2001. Physiological regulation of the immunological synapse by agrin. Science 292: 1681-1686. 17. Lazar-Molnar, E., S. C. Almo, and S. G. Nathenson. 2006. The interchain disulfide linkage is not a prerequisite but enhances CD28 costimulatory function. Cell Immunol 244: 125-129. 18. Eyquem, J., J. Mansilla-Soto, T. Giavridis, S. J. van der Stegen, M. Hamieh, K. M. Cunanan, A. Odak, M. Gönen, and M. Sadelain. 2017. Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection. Nature 543: 113-117. 19. Hildebrand, P. W., S. Günther, A. Goede, L. Forrest, C. Frömmel, and R. Preissner. 2008. Hydrogen-bonding and packing features of membrane proteins: functional implications. Biophys J 94: 1945-1953. 20. Roth, T. L., C. Puig-Saus, R. Yu, E. Shifrut, J. Carnevale, P. J. Li, J. Hiatt, J. Saco, P. Krystofinski, H. Li, V. Tobin, D. N. Nguyen, M. R. Lee, A. L. Putnam, A. L. Ferris, J. W. Chen, J. N. Schickel, L. Pellerin, D. Carmody, G. Alkorta-Aranburu, D. Del Gaudio, H. Matsumoto, M. Morell, Y. Mao, M. Cho, R. M. Quadros, C. B. Gurumurthy, B. Smith, M. Haugwitz, S. H. Hughes, J. S. Weissman, K. Schumann, J. H. Esensten, A. P. May, A. Ashworth, G. M. Kupfer, S. A. W. Greeley, R. Bacchetta, E. Meffre, M. G. Roncarolo, N. Romberg, K. C. Herold, A. Ribas, M. D. Leonetti, and A. Marson. 2018. Reprogramming human T cell function and specificity with non-viral genome targeting. Nature 559: 405-409. 21. Hill, Z. B., A. J. Martinko, D. P. Nguyen, and J. A. Wells. 2018. Human antibody-based chemically induced dimerizers for cell therapeutic applications. Nat Chem Biol 14: 112- 117. 22. Rodgers, D. T., M. Mazagova, E. N. Hampton, Y. Cao, N. S. Ramadoss, I. R. Hardy, A. Schulman, J. Du, F. Wang, O. Singer, J. Ma, V. Nunez, J. Shen, A. K. Woods, T. M. Wright, P. G. Schultz, C. H. Kim, and T. S. Young. 2016. Switch-mediated activation and retargeting of CAR-T cells for B-cell malignancies. Proc Natl Acad Sci U S A 113: E459-68. 23. Leddon Scott A., Fettis Margaret M., Abramo Kristin, Kelly Ryan, Oleksyn David, Miller. The CD28 Transmembrane Domain Contains an Essential Dimerization Motif 2020. Frontiers in Immunology in press.

19 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

FiguresFigur e 1

A B +

gRNA Cas9 crRNA tracrRNA (TRBC) Activation (anti CD3/CD28 beads)

EF1α EF1α EF1α EF1α EF1α Nucleofection D2 Myc Myc Myc Myc Myc

FMC63 FMC63 FMC63 FMC63 FMC63 scFv CD4+ T cells C TRBC HD IgG4 CD8 CD8 CD28 IgG4 200 No guide Guide RNA: TRBC None TMD CD8 CD8 CD28 CD28 CD28 150 TRBC Iso 100 200 4-1BB 4-1BB 4-1BB 4-1BB 4-1BB No guide 100 ICD D9 150 ! ! ! ! ! D6 50 50 100 P2A P2A P2A P2A P2A D4 Expansion fold (D0-D9)

D2 % CD3+( D9) 0 50 mCherry mCherry mCherry mCherry mCherry D0 Expansion fold (D0-D9) 0 0 αCD3

D CD8 transmembrane CD28 transmembrane

CD3 I4-HD CD8-HD CD8-HD CD28-HD I4-HD CD3 CAR

+ + mCherry + - - + - - CFSE

*** *** *** E TCR-CAR+F IGG4CD8 CD3TCR-CAR+-CAR+ 1.2 *** *** *** TCR+CAR- TCR+CAR-+ - 100 100 CD8CD8 CD3 CARTCR+CAR+ Legend *** HD TMD 1.21.0 CD3TCR+CAR++CAR+ CD8CD28 80 IGG4CD8I4 8 *** 80Legend 1.0 CD8CD8IgG4cd28 0.8 100 Legend 8 8 + 60 60 CD28CD28 0.8 CD8CD288 28 0.6 80 Legend IgG4cd28I4 28 % CD3 40 40 0.60.4 % Cherry Legend 60 28CD28CD2828 0.40.2 20 20

Normalized CFSE MFI ratio 40 0.2 % Cherry 0.0 0 0 Normalized CFSE MFI ratio I4 D9 D14 0.0HD 8 8 28 I4 20 D9 D14 TMD 8 8 28 28 28 0 Figure 1. Anti-CD28 stimulation of CD19-CAR T cells is D9TMDD14 dependent. (A) Designs of five chimeric antigen receptors (CAR) against CD19 bearing a 4-1BB costimulatory domain and differing by their hinge and transmembrane domain. (B) FACS sorted CD4+CD127+CD25low T cells were electroporated with a CRISPR-Cas9 ribonucleoprotein complex (RNP) targeting the constant region of the TCR β chain gene (TRBC), followed by stimulation with anti-CD3/CD28 beads (1:1 ratio). (C) Representative results of flow cytometric analysis of CD3 expression over time of cells electroporated with or without RNP. Percentages of residual CD3+ population and fold-expansion after 9 days of culture of CD4+ T cells electroporated with or without RNPs targeting TRBC are shown. Results from 4 independent experiments. (D) A representative example of CFSE dilution of a mixed population of CD3+/-CAR+/- T re-stimulated with anti-CD3/28 beads. (E) Normalized CFSE MFI ratio for CD3-mCherry+, CD3+mCherry- and CD3+mCherry+ cells was calculated by dividing CFSE MFI of these populations with the MFI of the CD3-mCherry- cells in the same culture. Two- way ANOVA was used for statistical analysis (bold line set as reference). (F) Percentages of CD3+ and mCherry+ cells before and 5 days after re-stimulation of edited T cells with anti- CD3/CD28 beads. Unpaired t-test was performed comparing CD8-TMD and CD28-TMD- containing CARs on D14. For E and F, results shown are a summary of 2 independent experiments using T cells from 5 unrelated donors for each construct. *** p<0.001

20 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 2 CD28- A H TM CD28+ CD28 positive CD28 negative

NS IgG4/8I4 8

CD3 NS CD8/88 8

mCherry CD8/288 28 *** **

CD28/2828 28 *** ** SSC -A *** * IgG4/28I4 28 CD28 1000 10000 100000 CFSE MFI B C - Whole cell lysate Myc IP - αCD28 soluble (1µg/ml) αCD28αCD28 soluble plate-bound (1µg/ml) (10µg/ml) 72kb αCD28 plate-bound (10µg/ml) 50000 *** *** *** 55kb 50000 *** *** *** CD28 40000 C D 2 8 (D Z 4 E) α 40000

W B 36kb 30000 Whole cell lysate 30000 CD28 IP CPM 20000 1 ) CAR 20000 95kb 10000 72kb Myc (9 B1

10000 α 0 55kb W B 0

I4 HD - 8 8 HD - 8 8 I4 - 8 8 I4 TMD - 8 28 28 TMD - 8 28 28 - 8 28 28

Figure 2: CD28-TMD-containing CARs interact with CD28 (A) A mixture of CFSE-labeled CD4+ T cells with or without CD3, CD28, and CAR expression. CFSE MFI of 5 independent donors in 2 independent experiments is reported. One-way ANOVA was used for statistical analysis. (B) Proliferation of purified CD3-CAR+ CD4+ T cells in response to plate-bound or soluble anti-CD28 stimulation. Results are representative of 3 independent experiments. Two-way ANOVA was used for statistical analysis. (C) CD28 or the Myc-tag of CD3-CAR+ T cells were immunoprecipitated. Western blot analysis of the input (5% of the whole cell lysate) as well as of the precipitated was performed using anti-CD28 (clone D2Z4E) and anti-Myc (clone 9B11). Results are representative of 2-3 independent experiments for each condition. ** p<0.01***, p<0.001 Counts per minute (CPM). Not Statistically Significant (NS).

21 Page 1

FlowJo, LLC

Figure 3

CD28-TMD A I4-HD FWVLVVVGGVLACYSLLVTVAFIIFWV WT CD8-HD

FWVLVVVLLVLACYSLLVTVAFIIFWV M1 WT M1 M2 M3 M4 WT M4

FWVLVVVGGVLAAYSLLVTVAFIIFWV M2

FLVLVVVGGVLACYSLLVTVAFIIFLV M3 Myc

FWVLVVVGGVLALLLLLVLVAFIIFWV M4 Cherry

B CD8-HD I4-HD WT M4 WT M4 CD3

mCherry CD3/CD28

CD3-CARhigh α CD3-CARint CD3-CARlow CARneg -

CFSE Whole cell lysate Myc IP C CD3-CARhigh D E CD3-CARint - - *** *** 1.4 CD3-CARlow αCD28αCD28 plate-bound plate-bound (10ug/ml) (10µg/ml) 72kb *** *** 20000 1.2 55kb CD28 C D 2 8 (D Z 4 E) α ) - 1.0 *** 15000 W B 36kb CAR - 0.8 Whole cell lysate CD28 IP

CPM 10000 0.6 ** 1 ) * CAR 95kb

MFI ratio (/CD3 0.4 72kb 5000 Myc (9 B1 0.2 α 55kb W B March 5, 20200.0 0 FlowJo v.10.6.1 HD 8 8 8 8 8 I4 I4 HD 8 8 - HD 8 8 - 8 8 - TMD WT M1 M2 M3 M4 WT M4 TMD WT M4 - TMD WT M4 - WT M4 -

Figure 3: The dimerization of the CD28-TMD depends on a core of four amino acids (A) Diagram representing the amino acid sequence of the wild type and four mutants of the CD28-TMD. A representative example of MYC and mCherry expression for each mutant is shown. (B) A representative example of CFSE dilution of a mixed population of CD3+/-CAR+/- T cells re-stimulated with anti-CD3/CD28 beads. (C) Normalized CFSE MFI ratio for CD3- CARlow/int/high was calculated by dividing the MFI of each of these population with the MFI of CD3-mCherry- cells within the same culture. A summary of results using T cells from 4 unrelated donors in 2 independent experiments is shown. (D) Proliferation of purified CD3- CAR+ T cells in response to plate-bound anti-CD28 stimulation. Results represent the mean of 3 independent experiments. (E) CD28 or the Myc-tag of CD3-CAR+ T cells were immunoprecipitated. Western blot analysis of the input (5% of the whole cell lysate) as well as of the precipitated was performed using anti-CD28 (clone D2Z4E) and anti-Myc (clone 9B11). Results are representative of 2 independent experiments for each condition. Two-way ANOVA were used for statistical analysis. * p<0.05, ** p<0.01***, p<0.001

22 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.18.296913; this version posted September 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 4

CTLA-4 Ig A B I4-HD CD8 WT-CD28 CD8-HD CD8 WT-CD28 CTLA-4 Ig - + WT CD28CD8WT WT-TMD-CD28CD28CD8M4 M4-CD-TMD 28 CD28CD8 WT-TMD-CD28CD28CD8M4 M4-CD-TMD 28 I4 WT-CD28 CD8 WT-CD28 100 CD8 M4-CD28 100 CD8 M4-CD28 I WT-CD28 + CTLA-4 CD8 WT-CD28 *** *** 4 I M4-CD28 *** Raji CD8 M4-CD28 80 80 4 *** alone I4 M4-CD28 + CTLA-4 Legend 60 60

Specimen_001_Tube_042_042.fcsSpecimen_001_Tube_042_042.fcs Specimen_001_Tube_030_030.fcsSpecimen_001_Tube_030_030.fcs Specimen_001_Tube_054_054.fcsSpecimen_001_Tube_054_054.fcs Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_006_006.fcs Specimen_001_Tube_018_018.fcsSpecimen_001_Tube_018_018.fcs cd3 negcd3 neg cd3 negcd3 neg cd3 negcd3 neg cd3 negcd3 neg cd3 negcd3 neg 3570 17093 9613 13808 9543 40 *** *** 3570 17093 9613 null 13808 40 9543 ** Page 1 *** % CD25+ CD71+ % CD25+ CD71+ 20 20 * mCherry Raji 19 CD71 FlowJo, LLC 0 0 low int high Specimen_001_Tube_042_042.fcsSpecimen_001_Tube_042_042.fcs Specimen_001_Tube_030_030.fcsSpecimen_001_Tube_030_030.fcs Specimen_001_Tube_054_054.fcsSpecimen_001_Tube_054_054.fcs Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_006_006.fcs Specimen_001_Tube_018_018.fcsSpecimen_001_Tube_018_018.fcs low int high Page 1 cd3cd3 neg neg cd3cd3 neg neg cd3cd3 neg neg cd3cd3 neg neg cd3cd3 neg neg 35703570 1709317093 96139613 1380813808 95439543 C Page 1 HD TMD FlowJo, LLC ICD WT 5 + 5 5 5 5 5 CD28 CD28 10 10 10 10 10 10 Page 1 CD28! 4 4 4 4 4 4 FlowJo, LLC 10 10 10 10 Cas9 10 HA- 10 HA- T2A MYC CD19 M4 PolyA crRNA tracrRNA gRNA TRAC CD8 CD28 TRAC 3 3 3 3 3 3 (TRAC)10 10 10 10 10 10 4-1BB! 0 FlowJo, LLC0 0 0 0 0 IgG4 CD8 5 5 5 5 5 5 10 10 10 10 10 10 3 3 3 3 3 3 -10 -10 -10 -10 -10 -10

3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 AA10 V10 10 4 0 10 10 10 4 0 10 10 10 4 4 4 4 10 10 10 10 10 10 KO 5 5 5 5 Specimen_001_Tube_001_001.fcs 5 5 Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcsUnedited TRAC Edited 10 10 10 Specimen_001_Tube_001_001.fcs 10 10 Specimen_001_Tube_002_002.fcs 10 Specimen_001_Tube_003_003.fcs cd4 cd8 cd4 cd8 cd4 cd8 23942 14824 25306 14514 3 26420 3 14835 3 3 Page 1 3 3 10 10 10 10 Page 1 10 10

4 4 4 4 4 4 10 10 10 10 10 10 Nucleofection 0 0 0 0 0 0 5 5 5 5 5 5 5 5 5 5 5 5 1010 1010 1010 1010 1010 3 1010 3 3 3 3 3 -10 -10 -10 -10 -10 -10 3 3 3 3 3 3 10 10 10 10 10 10 Page 1

MYC Page 1 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 4 4 4 4 4 4 4 4 4 4 4 4 0 0 100 10 100 10 100FlowJo,10FlowJo, LLCLLC100 10 1010 1010 Specimen_001_Tube_001_001.fcs Specimen_001_Tube_001_001.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcs Specimen_001_Tube_003_003.fcs cd8 cd8 cd8 3 3 3 3 3 3 cd4 cd4 cd4 -10 -10 -10 -10 -10 -10 14824 14514 14835 23942 25306 26420 3 3 3 3 3 3 3 3 3 3 3 3 3 4 5 3 4 5 1010 3 4 5 1010 3 4 5 1010 3 4 5 1010 3 4 5 1010 1010 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10

FlowJo, LLC 0 0 0 0 0 0 0 0 0 0FlowJo, LLCCD30 0 Specimen_001_Tube_001_001.fcs Specimen_001_Tube_001_001.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcs Specimen_001_Tube_003_003.fcs 5 5 5 5 5 5 cd4 cd8 cd4 cd8 cd4 cd8 10 10 10 10 10 10 14824 3 3 3 3 14514 3 3 3 3 14835 3 3 3 3 23942 -10-10 25306 -10-10 -10-10 26420 -10-10 -10-10 -10-10

3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 4 0 10 10 10 4 0 10 10 10 4 4 4 4 CD28! 10 4-1BB 10 10 10 10 10 5 5 5 5 Specimen_001_Tube_004_004.fcsSpecimen_001_Tube_001_001.fcs 5 5 5 5 Specimen_001_Tube_005_005.fcsSpecimen_001_Tube_002_002.fcs 5 ! 5 Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_003_003.fcs 5 5 10 10 10 Specimen_001_Tube_004_004.fcsSpecimen_001_Tube_001_001.fcs 10 10105 Specimen_001_Tube_005_005.fcsSpecimen_001_Tube_002_002.fcs 10105 105 Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_003_003.fcs 105 105 105 D cd8cd8 10 10 cd8cd8 10 10 cd8cd8 10 10 cd4cd4 cd4cd4 cd4cd4 14824 14514 14835 2411823942 14047 2410825306 14251 3 2392126420 3 15403 3 3 3 3 10 10 10 10 10 10 Page 1

4 4 4 CD28-HD4 4 4 CD8-HD4 4 4 4 4 4 104 104 104 I4104-HD 104 104 TMD 10 10 10 10 10 10 CD8-HD 10 10 10 10 10 10 0 0 0 0 0 0

5 5 5 5 5 5 5 5 5 5 55 55 5 5 5 5 10 10 10105 10105 10105 10105 10510 3 10510 3 10 3 10 3 10 3 10 3 10 10 10 10 10-10 10-10 -10 -10 -10 -10 CD4 CD8 3 CD4 3 CD8 3 CD4 3 CD8 3 CD4 3 CD8 3 3 3 3 103 103 103 103 103 103 10 10 10 10 10 10 10 10 10 10 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 4 4 4 4 4 4 4 4 4 4 44 44 4 4 4 4 10 10 10104 10104 101040 101040 104010 104010 010 010 10 10 0 0 100 100 100 100 100 100 0 0

FlowJo, LLC WT Specimen_001_Tube_004_004.fcs Specimen_001_Tube_004_004.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcs Specimen_001_Tube_006_006.fcs cd8 cd8 cd8 3 3 3 3 3 3 3 3 3 cd4 3 3 cd4 3 cd4 -10 -10 -10 -10 -10-103 -10-103 -103 -103 -103 -103 -10 -10 -10 24118 -10 14047 -10 24108 -10 14251 23921 15403 3 3 33 3 33 3 33 3 33 3 3 33 3 33 3 3 3 3 10 10 101010 101010 101010 3 4 5 101010 3 4 5 101010 3 4 5 101010 3 4 5 10 3 4 5 10 3 4 5 10 10 3 4 5 3 4 5 3 4 5 3 4 5 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10

0 0 00 0 00 0 00 0 00 0 0 00 0 00 0 0 0 0 Specimen_001_Tube_001_001.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcs CD28 Specimen_001_Tube_004_004.fcs Specimen_001_Tube_004_004.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_001_001.fcs Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_001_001.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcs Specimen_001_Tube_003_003.fcs Specimen_001_Tube_001_001.fcs cd8 5 Specimen_001_Tube_002_002.fcs 5 cd8 5 Specimen_001_Tube_003_003.fcs 5 cd8 5 5 cd4 cd8 cd4 cd8 cd4cd4 cd8 10 cd4 10 cd8 10 cd4 10 cd8 10 10 3 3 3 3 3 cd4 3 14824 cd4 14514 cd4 14835 -10 -10 14047 -103 3 -103 3 14251 -103 3 23942 -103 3 15403 3 33 25306 3 33 3 26420 3 3 3 24118 -10-10 24108 -10-10 -10-10 2392123942 -10-10 14824 -10-10-10 25306 -10-10-10 14514 -10 26420 -10 14835 -10 -10

3 4 5 3 4 5 3 3 4 4 5 5 3 3 4 4 5 5 3 3 4 4 5 5 3 3 4 4 5 5 33 44 55 33 44 55 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 0 10103 10104 10105 0 0 10103 10104 10105 0 0 10103 10104 10105 0 0 10103 10104 10105 00 10310 10410 10510 00 10310 10410 10510 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 4 0 10 10 10 4 0 10 10 10 4 4 4 4 10 10 10 10 10 10

Specimen_001_Tube_001_001.fcs Specimen_001_Tube_007_007.fcsSpecimen_001_Tube_002_002.fcsSpecimen_001_Tube_004_004.fcs 5 5 Specimen_001_Tube_008_008.fcsSpecimen_001_Tube_003_003.fcsSpecimen_001_Tube_005_005.fcs 5 5 Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_006_006.fcsSpecimen_001_Tube_001_001.fcs 5 5 Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcs 5 Specimen_001_Tube_001_001.fcs 5 5 Specimen_001_Tube_007_007.fcsSpecimen_001_Tube_002_002.fcsSpecimen_001_Tube_004_004.fcs 5 105 Specimen_001_Tube_008_008.fcsSpecimen_001_Tube_003_003.fcsSpecimen_001_Tube_005_005.fcs 105 105 Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_006_006.fcsSpecimen_001_Tube_001_001.fcs 105 105 5 Specimen_001_Tube_002_002.fcs 105 5 5 Specimen_001_Tube_003_003.fcs 5 5 5 10 10 cd8 10 10 cd8cd8 10 10 cd8cd8 10 10 cd8cd8 10 10 10 10 cd8 10 10 cd8 10 10 cd4 cd4cd4cd4 cd8 cd4cd4cd4 cd8 cd4cd4cd4 cd8 cd4 cd4 14824 CD4 CD81451414047 CD4 CD81483514251 CD4 CD81540314824 CD4 CD814514 14835 23942 2530624118 13858 2642024108 14000 3 2392123942 3 14383 3 25306 3 3 26420 3 27381 26384 10 21154 10 10 10 10 10

4 4 4 4 4 4 4 4 4 4 104 104 104 104 104 4 104 4 4 4 4 4 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 0 0 0 0 0 0 M4

5 5 5 5 5 5 5 5 5 5 55 55 5 5 5 5 10 10 10105 10105 10105 10105 1010 3 1010 3 10 3 10 3 10 3 10 3 10 10 10 10 -10 -10 -10 -10 -10 -10 3 3 3 3 3 3 3 3 3 3 103 103 103 103 103 3 103 3 3 3 3 3 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 4 4 4 4 4 4 4 4 4 4 44 44 4 4 4 4 10 10 10104 10104 101040 101040 10010 10010 010 010 10 10 0 0 100 100 100 100 0 0 0 0 0 0 0 0 0 0 CD28 Specimen_001_Tube_007_007.fcs Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_009_009.fcs Specimen_001_Tube_009_009.fcs cd8 cd8 cd8 3 3 3 3 3 3 3 3 3 cd4 3 3 cd4 3 cd4 -10 -10 -10 -10 -10-103 -10-103 -103 -103 -103 3 -103 3 3 3 3 3 -10 -10 -10 27381 -10 13858 -10 -10 26384 -10 -10 14000 -10 21154 -10 14383 -10 -10 3 3 33 3 33 3 33 3 33 3 33 33 3 3 3 3 10 10 101010 101010 101010 3 4 5 101010 3 4 5 1010 3 4 5 1010 3 4 5 10 3 4 5 10 3 4 5 10 10 3 4 5 3 4 5 3 4 5 3 4 5 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 103 3 104 4 105 5 0 103 3 104 4 105 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 0 10 10 10 10 10 10 0 0 10 10 10 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10

0 0 00 0 00 0 00 0 00 0 00 00 0 0 0 0 Specimen_001_Tube_004_004.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcs Specimen_001_Tube_007_007.fcs Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_004_004.fcs Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_004_004.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcs Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_001_001.fcs Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcs Specimen_001_Tube_004_004.fcs cd8 5 Specimen_001_Tube_005_005.fcs 5 cd8 5 Specimen_001_Tube_006_006.fcsSpecimen_001_Tube_001_001.fcs 5 cd8 Specimen_001_Tube_002_002.fcs Specimen_001_Tube_003_003.fcs cd4 cd8 cd4 cd8 cd4cd4 cd8 10 cd4 10 cd8 10 cd4 10 cd8cd8 cd8 cd8 3 3 3 3 3 cd4 3 14047 cd4 14251 cd4cd4 15403 cd4 cd4 -10 -10 13858 -103 3 -103 3 14000 -103 3 24118 -103 3 14383 33 24108 33 3 23921 3 14824 3 3 14514 14835 27381 E -10-10 26384 -10-10 -10-10 2115424118 -10-10 14047 CD4 -10-10 24108 -10-10 14251 -10 23921CD423942 -10 15403CD8 -10 25306 -10 26420 ) 1.5

3 4 5 3 4 5 - 3 2.04 5 3 4 5 3 4 5 3 4 5 3 3 4 4 5 5 3 3 4 4 5 5 3 3 4 4 5 5 3 3 4 4 5 5 33 44 55 33 44 55 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 00 0 101010 101010 101010 00 0 101010 101010 101010 00 0 101010 101010 101010 00 0CD4101010 101010 101010 00 1010 1010 1010 00 1010 1010 1010 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 4 4 4 4 CD8 10 10 10 10 Specimen_001_Tube_004_004.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcs 5 Specimen_001_Tube_004_004.fcs 5 5 Specimen_001_Tube_005_005.fcs 5 Specimen_001_Tube_010_010.fcsSpecimen_001_Tube_007_007.fcs 5 Specimen_001_Tube_006_006.fcs 5 Specimen_001_Tube_011_011.fcsSpecimen_001_Tube_008_008.fcs 5 5 Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_004_004.fcs 5 5 Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcs 10 10 10 Specimen_001_Tube_010_010.fcsSpecimen_001_Tube_007_007.fcs 10 105 Specimen_001_Tube_011_011.fcsSpecimen_001_Tube_008_008.fcs 105 CD8 105 Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_004_004.fcs 105 105 5 Specimen_001_Tube_005_005.fcs 105 5 5 Specimen_001_Tube_006_006.fcs 5 5 5 cd8 cd8cd8 10 10 cd8cd8 10 10 cd8cd8 10 10 10 10 cd8 10 10 cd8 10 10 cd4 cd4cd4cd4 *** cd8 *** *** cd4cd4cd4 cd8 cd4cd4 cd4 cd4 14047 1425113858 1540314000 1438314047 14251 15403 24118 2410827381 16226 2392126384 15026 3 2115424118 3 3 24108 3 23921 27152/Myc 22421 10 10 10 10 CD8

+ 4 4 4 4 4 4 4 4 4 4 104 104 104 104 104 4 104 4 4 4 4 4 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 1.5 0 0 0 0

5 5 5 5 1.0 5 5 5 5 5 5 5 5 5 5 5 5 10 10 1010 1010 1010 1010 10 3 10 3 10 3 10 3 10 10 -10 -10 -10 -10 3 3 3 3 3 3 3 3 3 3 103 103 103 103 103 3 103 3 3 3 3 3 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 10 10 1010 1010 10100 10100 010 010 010 010 10 10 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 Specimen_001_Tube_010_010.fcs Specimen_001_Tube_010_010.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_011_011.fcs 1.0 cd8 cd8 3 3 3 3 3 3 3 cd4 3 3 cd4 3 -10 -10 -10 -10 -103 -103 -103 -103 -103 3 -103 3 3 3 3 3 -10 -10 -10 27152 -10 16226 -10 -10 22421 -10 -10 15026 -10 -10 -10 -10 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 10 10 1010 1010 1010 3 4 5 1010 3 4 5 10 3 4 5 10 3 4 5 10 3 4 5 10 3 4 5 10 10 3 4 5 3 4 5 3 4 5 3 4 5 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 0 103 3 104 4 105 5 0 103 3 104 4 105 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 0 10 10 10 10 10 10 0 0 10 10 10 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10

0 0 0 0 0.5 0 0 0 0 0 0 0 0 0 0 0 0 Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_009_009.fcs Specimen_001_Tube_010_010.fcs Specimen_001_Tube_010_010.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_007_007.fcs Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_009_009.fcs Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_004_004.fcs Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcs Specimen_001_Tube_007_007.fcs cd8 Specimen_001_Tube_008_008.fcs cd8 Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_004_004.fcs cd8 Specimen_001_Tube_005_005.fcs Specimen_001_Tube_006_006.fcs cd4 cd8 cd4 cd8 cd4 cd8 cd4 cd8 cd4 cd8cd8 cd8 cd8 3 3 3 3 3 cd4 3 13858 cd4 14000 cd4cd4 14383 cd4 cd4 -10 -10 16226 -10 3 -10 3 15026 -10 3 27381 -10 3 3 26384 3 3 21154 3 14047 3 3 14251 15403 27152 -10 22421 0.5 -10 -10 27381 -10 13858 -10 26384 -10 14000 -10 2115424118 -10 14383 -10 24108 -10 23921 3 4 5 3 4 5 3 3 4 4 5 5 3 3 4 4 5 5 3 3 4 4 5 5 3 3 4 4 5 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 0 1010 1010 1010 0 0 1010 1010 1010 0 0 1010 1010 1010 0 0 1010 1010 1010 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 MYC MFI ratio (/M4) CD28 Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcsSpecimen_001_Tube_010_010.fcs 5 5 Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_011_011.fcs 5 5 Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_009_009.fcs Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcsSpecimen_001_Tube_010_010.fcs 105 Specimen_001_Tube_009_009.fcsSpecimen_001_Tube_011_011.fcs 105 105 Specimen_001_Tube_007_007.fcs 105 5 Specimen_001_Tube_008_008.fcs 5 5 Specimen_001_Tube_009_009.fcs 5 5 5 cd8 cd8 10 10 cd8 10 10 10 10 10 10 10 10 cd4 cd4cd4 cd8 cd4cd4 cd8 cd4 cd8 cd4 cd8 cd4 cd8 13858 14000 14383 27381 2638427152 16226 2115422421 15026 27381 13858 26384 14000 21154 14383 CD28 MFI ratio (Myc 0.0 4 4 4 4 0.0 10 10 10 10 4 4 4 4 4 4 4 4 4 4 10 10 10 10 10 10 10 10 10 10

5 5 5 28 285 8 8 I4 I4 5 5 5 5 10 10 10 HD 10 8 8 8 10 10 10 10 3 3 3 3 MYC 103 103 103 103 3 3 3 3 3 3 10 10 10 10 10 10 10 10 10 10

4 4 4 4 4 4 4 4 10 10 10 10 0 0 010 010 10 10 TMD 28 M4 28 M4 28 M40 28 M4 8 0 0 0 0 0 0 0 0 0 3 3 3 3 -103 -103 -103 -103 3 3 3 3 3 3 -10 -10 -10 -10 -10 -10 -10 -10 -10 -10 3 3 3 3 3 3 3 3 10 10 10 10 3 4 5 3 4 5 10 3 4 5 10 3 4 5 10 10 0 103 104 105 0 103 104 105 0 103 104 105 0 103 104 105 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10 0 0 0 0 0 0 0 0 Specimen_001_Tube_010_010.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_010_010.fcs Specimen_001_Tube_010_010.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_009_009.fcs Specimen_001_Tube_010_010.fcs cd8 Specimen_001_Tube_011_011.fcs cd8 Specimen_001_Tube_007_007.fcs Specimen_001_Tube_008_008.fcs Specimen_001_Tube_009_009.fcs cd4 cd8 cd4 cd8 cd8 cd8 cd8 3 3 3 3 cd4 16226 cd4 15026 cd4 cd4 cd4 -10 -10 -10 -10 27152 3 22421 3 3 3 13858 14000 14383 27152 16226 -10 22421 -10 15026 -10 27381 -10 26384 21154

3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 Figure10 10 0 4:10 CAR10 10 -CD280 10 10 heterodimers10 are B7-unresponsive0 10 10 10 0 but10 reduce10 10 0 CD2810 10 10 expression.0 10 10 10

Specimen_001_Tube_010_010.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_010_010.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_010_010.fcs Specimen_001_Tube_011_011.fcs Specimen_001_Tube_010_010.fcs 5 Specimen_001_Tube_011_011.fcs 5 5 5 cd8 cd8 10 10 10 10 cd4 cd4 cd4 cd8 cd4 cd8 16226 15026 27152 (A) JuneRepresentative22421 3, 2020 example showing CD71 upregulation27152 FlowJo16226 v.10.6.1 in CAR22421 T cells containing15026 an IgG4-

4 4 4 4 HD/CD28-TMD co-cultured for 48h with irradiated (4000Rad)10 CD19-wild10 type or10 deficient 10 3 3 3 3 10 10 10 10 Raji cells with or without CTLA-4 Ig. (B) CD25+CD71+ T 0 cells were0 analyzed0 in low, 0 3 3 3 3 June 3, 2020 -10 -10 -10 FlowJo-10 v.10.6.1 3 4 5 3 4 5 3 4 5 3 4 5 0 10 10 10 0 10 10 10 0 10 10 10 0 10 10 10

intermediate (int) or high mCherry-expressing CAR-T cells using theSpecimen_001_Tube_010_010.fcs gating Specimen_001_Tube_010_010.fcsstrategy describedSpecimen_001_Tube_011_011.fcs Specimen_001_Tube_011_011.fcs cd4 cd8 cd4 cd8 June 3, 2020 FlowJo v.10.6.1 27152 16226 22421 15026 in Supplementary Figure 5. Data were pooled from 4 independent experiments using T cells fromJune 4- 3,5 2020 unrelated donors. (C) Editing strategyFlowJo and v.10.6.1homology-directed repair-mediated integration into the TRAC locus of various CD19 CARs using an AAV-6 transduction protocol. (D) Myc and CD28 expression in a representative example analyzed 6 days after editing and beads removal. (E) CD28JuneJune MFI 3,3, 20202020 ratio was calculated by dividing CD28FlowJoFlowJo MFI v.10.6.1 v.10.6.1of Myc+ cells by - June 3, 2020 Myc cells in the same culture.FlowJo Pooled v.10.6.1 dataJune from3, 2020 3-4 independent experiments acrossFlowJo 5 v.10.6.1 unrelated donors are shown. Each dot represents one independent editing condition. Two-way ANOVA was used for statistical analysis. *p<0.05, *** p<0.001.

June 3, 2020 FlowJo v.10.6.1 23