Expression of Dendritic Cell Markers on Cultured Neutrophils and Its Modulation by Anti-Apoptotic and Pro-Apoptotic Compounds
Total Page：16
File Type：pdf, Size：1020Kb
EXPERIMENTAL and MOLECULAR MEDICINE, Vol. 39, No. 4, 439-449, August 2007 Expression of dendritic cell markers on cultured neutrophils and its modulation by anti-apoptotic and pro-apoptotic compounds Hae-Young Park1, Jun-O Jin1, production in the T cells co-cultured with anti-Fas Min-Gyu Song1, Joo-In Park1 Ab-treated neutrophils than with the LPS-treated and Jong-Young Kwak1,2 neutrophils. This suggests that apoptotic neutrophils express DC markers on their surface and the differ- 1Department of Biochemistry ential expression of DC markers might have a detri- School of Medicine mental effect on the immune reaction. Medical Research Center for Cancer Molecular Therapy Dong-A University Keywords: antigen-presenting cells; antigens, CD95; Busan 602-714, Korea apoptosis; dendritic cells; neutrophils 2Corresponding author: Tel, 82-51-240-2928; Fax, 82-51-241-6940; E-mail, [email protected] Introduction Accepted 3 May 2007 Neutrophils play an important role in the innate Abbreviations: DC, dendritic cell; PDTC, pyrroline dithiocarbamate; immune response by rapidly migrating into infla- PE, phycoerythrin; SEB, staphylococcal enterotoxin med tissues, releasing proteolytic enzymes, and producing reactive oxygen species (Burg and Pillinger, 2001). Neutrophils have also been impli- Abstract cated in modulating the adaptive immune respon- ses. The release of cytokines from neutrophils mo- Neutrophils are also known to acquire the character- dulates the T cell responses, such as chemotaxis istics of dendritic cells (DCs) under the appropriate and cytokine secretion (Taub et al., 1996). Mo- conditions. In this study, neutrophils were cultivated reover, it has been demonstrated that neutrophils can function as APCs and induce T cell prolifera- in vitro in the presence or absence of compounds mod- tion in a MHC-II restricted manner (Radsak et al., ulating their survival in an attempt to characterize the 2000). Human peripheral blood and inflammatory expression profile of the DC markers. Higher MHC-II, neutrophils express functional B7-1-like molecules, CD80, CD86, CD83, and CD40 expression levels were and the expression of these molecules is up- detected on the surface of the cultured neutrophils for regulated by the neutrophils of patients with chro- 24 h than on the freshly isolated cells. The annexin nic inflammatory disease or Wegener’s granulo- V-positive cells showed a higher expression level of matosis (Windhagen et al., 1999; Iking-Konert et the DC markers than the annexin V-negative cells. The al., 2001b, 2002). The in vitro generation of dendri- population of neutrophils double stained with annexin tic cell (DC)-like cells from immediate precursors of V and the DC markers increased after being incubated mature neutrophils (Oehler et al., 1998) or neutro- with agonistic anti-Fas Ab. LPS, the anti-apoptotic phils from the peripheral blood using cytokines has compound, decreased the CD86 and MHC-II ex- also been reported (Yamashiro et al., 2000; Iking- pression levels but 50-60% of the DC marker-positive Konert et al., 2001a). Neutrophils and immature cells were detected in the annexin V-positive cells. In DCs co-localize during pathogenic challenge (van Gisbergen et al., 2005). Therefore, it appears that contrast, CD80, CD86, CD83, and HLA-DR mRNA levels neutrophils are capable of up-regulating molecules increased in the GM-CSF-treated neutrophils but not to present an antigen against naive T cells or can in the anti-Fas Ab-treated neutrophils. T cell pro- differentiate into DCs through the appropriate liferation was inhibited by co-culturing them with an- stimuli. ti-Fas Ab- or LPS-treated neutrophils at a high neu- Mature neutrophils are terminally differentiated trophil:T cell ratio. However, the superantigen-medi- and short-lived cells, and their apoptosis is known ated T cell proliferation was increased by the LPS-treat- to be an important factor in resolving inflammation ed neutrophils but decreased by the anti-Fas Ab-treat- (Savill, 1997). The apoptotic rate of neutrophils is ed neutrophils. There was a lower level of interferon-γ dependent on the presence of pro- or anti-inflam- 440 Exp. Mol. Med. Vol. 39(4), 439-449, 2007 matory stimuli in the surrounding milieu (Ward et al., (Park et al., 2002). The donors were confirmed not 1999b). The spontaneous apoptosis of neutrophils to have taken any anti-inflammatory drugs for at can be enhanced by Fas stimulation (Watson et al., least three weeks before sampling. Informed con- 1997, 1999). Moreover, the onset of apoptosis by sent was obtained from all participants and the neutrophils in vitro is associated with the down- local institutional review board at Dong-A Uni- regulation of key pro-inflammatory functions, in- versity Hospital approved the study. The neutrop- cluding cell surface receptor expression (Whyte et hils were shown to be 98% pure by microscopy. al., 1993; Dransfield et al., 1994). Moreover, several The contaminating monocytes were depleted using genes encoding proteins involved in antigen presen- anti-CD14 Ab-coated magnetic beads (Milteny tation are up-regulated during the initial stages of Biotec Inc., Auburn, CA). The detection of CD14+ neutrophil apoptosis (Kobayashi et al., 2003). It has cells in the separated neutrophils was ＜ 0.1% in been shown that MHC-II is synthesized by neutro- flow cytometry analysis using FITC-conjugated anti- phils after being stimulated with anti-apoptotic cyto- CD14 Ab. The isolated neutrophils (1 × 105/100 µl) kines, such as IFN-γ or GM-CSF (Fanger et al., were maintained in RPMI 1640 medium supple- 1997; Radsak et al., 2000). In contrast, Mycobac- mented with 5% FBS, 1% glutamine, 100 U/ml terium tuberculosis infection of neutrophils has been penicillin, and 100 µg/ml streptomycin in 96-well shown to induce CD83 expression on the cells at 3 flat bottomed plates at 37oC in a humidified h after infection, the time at which early apoptosis atmosphere containing 5% CO2. was observed, suggesting that neutrophils dif- ferentiate into DC-like cells as they start to undergo apoptosis (Aleman et al., 2005). Therefore, the Morphological assessment of neutrophil apoptosis modulation of cell survival can affect the expression The neutrophils incubated in the presence or of the DC markers on neutrophils. This study absence of anti-Fas Ab, or various agents were investigated whether or not pro- or anti-apoptotic spun down on a glass slide using a cytospin stimuli can modulate the expression of DC markers (Shandon, Pittsburgh, PA). The cells were fixed on neutrophils. with methanol and stained with the Giemsa stai- ning solution. Typical apoptotic cells were readily identified by the nuclear condensation and cytopla- Materials and Methods smic vacuoles. Reagents Flow cytometric analysis Histopaque, propidium iodide (PI), LPS, pyrroline The level of phosphatidylserine exposure was deter- dithiocarbamate (PDTC), staphylococcal entero- mined by measuring the extent of annexin V-FITC toxin B (SEB), and brefeldin A were purchased binding using an apoptosis detection kit (Onco- from Sigma (St. Louis, MO). The Giemsa staining gene Research Product). The cells (1 × 106) were solution was purchased from Fluka (Bushes, first harvested and washed with PBS. The cells Switzerland). The dextran was obtained from were incubated with IgG of the same isotype at Amersham Pharmacia Biotech (Uppsala, Sweden). 4oC for 1 h to block nonspecific staining or Fc The GM-CSF was acquired from R&D Systems receptor-mediated binding of Ab. They were then Inc. (Minneapolis, MN). The RPMI-1640 medium labeled with FITC- or PE-conjugated Abs, in- was supplied by Gibco-BRL (Rockville, MD). The cubated on ice for 30 min and washed with an RT-PCR kit was obtained from Promega (Madison, isotonic PBS buffer supplemented with 0.5% BSA. WI). The FITC or phycoerythrin (PE)-conjugated The cells (1 × 104) were subsequently analyzed by anti-CD80, CD83, CD86, CD40, MHC-II, HLA-DR, flow cytometry (Beckton Dickinson, Franklin Lakes, CD16, CD32, CD3 and isotype control Abs (IgG1, NJ) (Park et al., 2005). Isotype-matched irrelevant IgG2a) were purchased from BD Pharmingen Ab was used as a control for nonspecific staining (Flanklin lakes, NJ). The anti-caspase-3 Ab was and fluorescence parameters were gated using acquired from Santa Cruz Biotech (Santa Cruz, stained cells with FITC- or PE-conjugated isotype CA). Ab. Cell culture RT-PCR analysis The peripheral blood neutrophils were isolated The total RNA from CD14-CD66b+ cells (1 × 106) from healthy young donors using a method invol- was isolated and lysed with TRIZOL reagents (Invi- ving dextran sedimentation and differential centri- fugation through a Ficoll-Hypaque density gradient trogen). Each 50 µl PCR reaction mixture contained Expression of dendritic cell markers on neutrophils 441 1.5 U DNA polymerase, 200 µM dNTP, 50 pmol of Statistical analysis the oligonucleotide primers. The reaction was am- The results are presented as a mean ± SD. A plified in a DNA thermal cycler for 30 cycles using o o Student’s t-test was used to compare the means of the following PCR program: 95 C 1 min, 55 C 1 ＜ o the unpaired samples. A P value 0.05 was con- min, 72 C 30 s. Two specific primers were used; β- sidered significant. actin, ATGGATGATGATATCGCCGCG (sense), T- CTCCATGTCGTCCCAGTTG (antisense), (249 bp); CD80, TTGGATTGTCATCAGCCCTGC (sense), AT- Results TTTCTTCTCCTTTTGCCAGTAG (antisense) (318 bp); CD83, GCCATGTCGCGCGGCCTCCAGCTT Detection of DC markers on neutrophils in culture (sense), GGACAATCTCCGCTCTGTATTTC (anti- condition sense), (440 bp); CD86, AGGACAAGGGCTTG- TATCAA (sense), ATTGCTCGTAACATCAGGGA The expression levels of the co-stimulatory mole- (antisense), (330 bp); HLA-DR, CGGATCCTTCG- cules (CD80 and CD86), CD40, CD83, and MHC-II TGTCCCCAC (sense), CTCCCCAACCCCGTAGT- by the cultured neutrophils were analyzed using TGTGTCTGCA (antisense), (270 bp). immunofluorescent flow cytometry. As shown in Figure 1A, the number of cells stained positively to each marker increased when the neutrophils were Western blot analysis cultured for 24 h in a simple medium containing + + The cell extracts from the freshly isolated or cul- 5% FBS.