DOCSLIB.ORG

The Molecular Diversity of Luminal a Breast Tumors

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Molecular Diversity of Luminal a Breast Tumors The molecular diversity of Luminal A breast tumors Giovanni Ciriello Computational Biology, MSKCC TCGA Annual Symposium Washington DC, 2012 Breast'Cancer'Heterogeneity Breast Cancer Intrinsic Subtypes ' Breast Cancer ' Her2-negative Her2 - positive PAM50: Her2-enriched ER - negative PAM50: Basal ER-positive PAM50: Luminal B PAM50: Luminal A ' Breast'Cancer'Heterogeneity Breast Cancer Intrinsic Subtypes ' Breast Cancer ' Her2-negative Her2 - positive PAM50: Her2-enriched ER - negative ' PAM50: Basal ' ER-positive PAM50: Luminal B ' PAM50: Luminal A ' Breast'Cancer'Heterogeneity Breast Cancer Intrinsic Subtypes ' Breast Cancer ' Her2-negative Her2 - positive PAM50: Her2-enriched ER - negative PAM50: Basal ER-positive PAM50: Luminal B PAM50 (Perou et al., 2000) PAM50: Luminal A Luminal(Heterogeneity Integrated data from: TCGA 2012, Ellis et al. 2012, Banerji et al. 2012 Curtis et al. 2012 Russnes et al. 2010 ~ 1500 Luminal tumors Copy Number Alterations Somatic Mutations mRNA expression Luminal(Molecular(Heterogeneity PAM50 vs CNA-clusters (Curtis et al., TCGA) Integrated data from: TCGA 2012, Ellis et al. 2012, Basal Her2 LumA LumB Normal Banerji et al. 2012 IC10 Curtis et al. 2012 IC5 Russnes et al. 2010 IC3 IC1 IC4 IC8 ~ 1500 Luminal tumors Curtis datset IC7 IC9 IC6 IC2 Copy Number Alterations CNA1 Somatic Mutations CNA3 mRNA expression CNA2 CNA5 TCGA datset CNA4 p < 10- 4 10 - 4 < p < 0.05 Luminal(Molecular(Heterogeneity CNA-clusters Somatic Mutations (Curtis et al., TCGA) (TCGA, Ellis et al., Banerji et al) Integrated data from: TCGA 2012, Ellis et al. 2012, Basal Her2 LumA LumB Normal Banerji et al. 2012 IC10 Her2- Curtis et al. 2012 IC5 enriched Russnes et al. 2010 IC3 IC1 Basal-like IC4 IC8 ~ 1500 Luminal tumors Curtis datset IC7 Luminal B IC9 IC6 IC2 # of mutations Luminal A per sample Copy Number Alterations CNA1 # of SigGenes ( q<0.05) Somatic Mutations CNA3 0 20 40 60 80 mRNA expression CNA2 CNA5 TCGA datset CNA4 p < 10- 4 10 - 4 < p < 0.05 Luminal(A(Clinical(Heterogeneity • Luminal A tumors have heterogenous outcome METABRIC Dataset (Curtis et al.) 7 Haque et al., 2012 Days at death death at Days 0 2000 4000 6000 8000 Basal Her2 LumB LumA Luminal(Heterogeneity • Luminal A tumors have heterogenous outcome METABRIC Dataset (Curtis et al.) Haque et al., 2012 Days at death death at Days 0 2000 4000 6000 8000 Basal Her2 LumB LumA Luminal A is molecularly and clinically heterogeneous Can we link outcome variability to molecular diversity? Luminal(A(Heterogeneity Figure 1 A) B) Luminal A Breast Tumors (TCGA Dataset) 50% T: TCGA data * C: Curtis data 40% a 30% * 20% %Samples 1q/16q b * * 10% * c 0 T C T C T C T C T C d * IGP p-value < 0.001 Quiet C) Copy Number e Copy NumberOverall survival Alterations (Curtis Dataset) f Chr.8 identify five major subgroups associated g h High Copy Number % Surviving i Mixed Copy Number Quiet 20 40 60 80 100 1q/16q Chr.8-associated Mixed Overlall Log-rank p = 0.015 Copy Number High CNH Log-rank p = 0.001 0 0 50 100 150 Chromosomes Months Survival Luminal(A(Heterogeneity Figure 1 A) B) Luminal A Breast Tumors (TCGA Dataset) 50% T: TCGA data * C: Curtis data 40% a 30% * 20% %Samples 1q/16q b * * 10% * c 0 T C T C T C T C T C d * IGP p-value < 0.001 Quiet C) Copy Number e Overall survival (Curtis Dataset) f Chr.8 associated g h High Copy Number % Surviving i Mixed Copy Number Quiet 20 40 60 80 100 1q/16q Chr.8-associated Mixed Overlall Log-rank p = 0.015 Copy Number High CNH Log-rank p = 0.001 0 0 50 100 150 Chromosomes Months Survival Genomic(Instability(correlates( with(poor(prognosis A) B) CNH survival (Curtis et al.) CNH Survival (Russnes et al.) CNH Others % Surviving % Surviving CNH Others Log-rank p = 4.6E-05 Log-rank p = 0.003 0 20 40 60 80 100 0 20 40 60 80 100 0 2 4 6 8 10 12 14 , 0 2 4 6 8 10 12 14 , Years Survival , Years Survival , Genomic(Instability(correlates( with(poor(prognosis A) B) CNH survival (Curtis et al.) CNH Survival (Russnes et al.) CNH Others % Surviving % Surviving CNH Others Log-rank p = 4.6E-05 Log-rank p = 0.003 0 20 40 60 80 100 0 20 40 60 80 100 0 2 4 6 8 10 12 14 , 0 2 4 6 8 10 12 14 , Years Survival , Years Survival , What are the molecular features of these tumors? CNH$Molecular$Features A) 60% ** * Luminal A 50% ** Copy Number High 40% Other 30% ** ** p < 0.01 ** p < 0.05 20% * %Samples 10% 0% 5q 20q TP53 MYC (mut) (amp) (gain) (loss) PIK3CA(mut) B) C) Luminal A Samples AURKA 8q.24 PLK1 AURKA CDC25B CCNA2 AURKB CDK1 CCNA1 CDC25B/C BIRC5 PLK1 TP53BP1 POLH POLI CDK1 MLH3 Cyclin-A/B POLK Differentially Expressed Genes Differentially Copy Number High Low High Mitosis CNH$Molecular$Features A) 60% ** * Luminal A 50% ** Copy Number High 40% Other 30% ** ** p < 0.01 ** p < 0.05 20% * %Samples 10% 0% 5q 20q TP53 MYC (mut) (amp) (gain) (loss) PIK3CA(mut) B) C) Luminal A Samples AURKA 8q.24 PLK1 AURKA CDC25B CCNA2 AURKB CDK1 CCNA1 CDC25B/C BIRC5 PLK1 TP53BP1 POLH POLI CDK1 MLH3 Cyclin-A/B POLK Differentially Expressed Genes Differentially Copy Number High Low High Mitosis What characterizes the other Luminal A subtypes? Luminal(A(Somatic(Mutations A) CNA-Quiet 1q/16q Chr.8-associated CNH Mixed PIK3CA GATA3 AKT1 MAP3K1 TP53 Samples Somatic mutations Chr. 8 - associated B) Co-occurrent (p<0.05) Copy Number Loss D) Chr. 8 Chr.16 Mutually Exclusive (p<0.05) Copy Number Gain Mutated genes PIK3CA MAP3K1 GATA3 Samples CNA 1p12 1q21 1q32 6p23 6q27 7p12 9p21 11p13 11q14 10p13 10q23 12q15 13q12 14q13 14q24 16q12 16q23 17p12 17q12 17q21 19q12 19q13 20p13 3p25.1 4p16.3 4q13.3 6q14.2 8p21.3 8p11.22 8p11.21 11p15.5 11q13.2 17p11.2 21q11.2 8q24.21 10q22.3 12p13.3 13q14.2 15q26.3 16q24.2 20q13.2 Chromosomes 8p11 Somatic mutations Amplification MAP3K1 C) PIK3CA Mutations GATA3 Mutations E) 25 20 MAP3K1 mutations 15 Mutation Type 10 10 Missense Splice-site #mutations 5 5 In Frame Del. Nonsense 0 0 1q/16q Quiet Chr.8 CNH Mixed 1q/16q Quiet Chr.8 CNH Mixed #mutations Frame-shift PIK3CA Hotspots (E545K, H1047R/L) GATA3 Hotspots (e4-2 , P409fs) Other MAP3K1 mutated samples Luminal(A(Somatic(Mutations A) CNA-Quiet 1q/16q Chr.8-associated CNH Mixed PIK3CA GATA3 AKT1 MAP3K1 TP53 Samples Somatic mutations Chr. 8 - associated B) Co-occurrent (p<0.05) Copy Number Loss D) Chr. 8 Chr.16 Mutually Exclusive (p<0.05) Copy Number Gain Mutated genes PIK3CA MAP3K1 GATA3 Samples CNA 1p12 1q21 1q32 6p23 6q27 7p12 9p21 11p13 11q14 10p13 10q23 12q15 13q12 14q13 14q24 16q12 16q23 17p12 17q12 17q21 19q12 19q13 20p13 3p25.1 4p16.3 4q13.3 6q14.2 8p21.3 8p11.22 8p11.21 11p15.5 11q13.2 17p11.2 21q11.2 8q24.21 10q22.3 12p13.3 13q14.2 15q26.3 16q24.2 20q13.2 Chromosomes 8p11 Somatic mutations Amplification MAP3K1 C) PIK3CA Mutations GATA3 Mutations E) 25 20 MAP3K1 mutations 15 Mutation Type 10 10 Missense Splice-site #mutations 5 5 In Frame Del. Nonsense 0 0 1q/16q Quiet Chr.8 CNH Mixed 1q/16q Quiet Chr.8 CNH Mixed #mutations Frame-shift PIK3CA Hotspots (E545K, H1047R/L) GATA3 Hotspots (e4-2 , P409fs) Other MAP3K1 mutated samples Luminal(A(Somatic(Mutations A) CNA-Quiet 1q/16q Chr.8-associated CNH Mixed PIK3CA GATA3 AKT1 MAP3K1 TP53 Samples Somatic mutations Chr. 8 - associated B) Co-occurrent (p<0.05) Copy Number Loss D) Chr. 8 Chr.16 Mutually Exclusive (p<0.05) Copy Number Gain Mutated genes PIK3CA MAP3K1 GATA3 Samples CNA 1p12 1q21 1q32 6p23 6q27 7p12 9p21 11p13 11q14 10p13 10q23 12q15 13q12 14q13 14q24 16q12 16q23 17p12 17q12 17q21 19q12 19q13 20p13 3p25.1 4p16.3 4q13.3 6q14.2 8p21.3 8p11.22 8p11.21 11p15.5 11q13.2 17p11.2 21q11.2 8q24.21 10q22.3 12p13.3 13q14.2 15q26.3 16q24.2 20q13.2 Chromosomes 8p11 Somatic mutations Amplification MAP3K1 C) PIK3CA Mutations GATA3 Mutations E) 25 20 MAP3K1 mutations 15 Mutation Type 10 10 Missense Splice-site #mutations 5 5 In Frame Del. Nonsense 0 0 1q/16q Quiet Chr.8 CNH Mixed 1q/16q Quiet Chr.8 CNH Mixed #mutations Frame-shift PIK3CA Hotspots (E545K, H1047R/L) GATA3 Hotspots (e4-2 , P409fs) Other MAP3K1 mutated samples Which pathways are most de-regulated? MEMo:%Mutual%Exclusivity%Modules Mutations CNA User Defined Set ● Homdel Hetloss Diploid Genes connected by Gain C24 Q1756 ● Amp ● ● Mutated ● ● ● Normal ● ● ● ● ● ● network proximity ● ● ●● ● ● ● ●● ● ● ● ● ●● ● ●●●●● ● ● ● ● ● ● ● ●● ● ●● ● BRCA1 Cases Genes Altered Not Altered . G S G S G S Gene A 54% Module t t + 1 Gene B Gene C 8% 8.5% Genes Samples MCMC Switching Permutation Gene D - preserves #alterations per sample 30.5%t - preserves #alterations per gene Ciriello et al., Genome Res. 2012 Mutual Exclusivity Module www.cbio.mskcc.org/memo Luminal(A(Pathways((MEMo) A) 2 IGF1R ERBB2 4% 4% PTEN NF1 6% 3% PIK3CA KRAS 1% 49% PIK3R1 2% MAP3K1 AKT1 14% 4% PAK1 8% MAP2K3/6 MAP2K1/2 MAP2K4 11% JNK p38 ERK Survival Apoptosis Proliferation Activating interaction Inhibiting interaction Inactivating Activating Alterations+to+NCor/SMRT+components NCOR1 NCOR2 GPS2 ANKRD11 TBL1XR1 NCOR1 NCOR2 GPS2 ANKRD11 TBL1XR1 Fingerprint mRNA Heatmap CNA - Clusters 1q/16q Hom. Del Copy Number Quiet Chr.8-associated Somatic Low High mutation Copy Number High Mixed Alterations+to+NCor/SMRT+components NCOR1 NCOR2 GPS2 ANKRD11 TBL1XR1 NCOR1 NCOR2 GPS2 ANKRD11 TBL1XR1 Fingerprint mRNA Heatmap CNA - Clusters 1q/16q Hom.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling
    G C A T T A C G G C A T genes Review Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling Aoife A. Nolan 1, Nourhan K. Aboud 1, Walter Kolch 1,2,* and David Matallanas 1,* 1 Systems Biology Ireland, School of Medicine, University College Dublin, Belfield, Dublin 4, Ireland; [email protected] (A.A.N.); [email protected] (N.K.A.) 2 Conway Institute of Biomolecular & Biomedical Research, University College Dublin, Belfield, Dublin 4, Ireland * Correspondence: [email protected] (W.K.); [email protected] (D.M.) Abstract: Oncogenic RAS (Rat sarcoma) mutations drive more than half of human cancers, and RAS inhibition is the holy grail of oncology. Thirty years of relentless efforts and harsh disappointments have taught us about the intricacies of oncogenic RAS signalling that allow us to now get a pharma- cological grip on this elusive protein. The inhibition of effector pathways, such as the RAF-MEK-ERK pathway, has largely proven disappointing. Thus far, most of these efforts were aimed at blocking the activation of ERK. Here, we discuss RAF-dependent pathways that are regulated through RAF functions independent of catalytic activity and their potential role as targets to block oncogenic RAS signalling. We focus on the now well documented roles of RAF kinase-independent functions in apoptosis, cell cycle progression and cell migration. Keywords: RAF kinase-independent; RAS; MST2; ASK; PLK; RHO-α; apoptosis; cell cycle; cancer therapy Citation: Nolan, A.A.; Aboud, N.K.; Kolch, W.; Matallanas, D. Hidden Targets in RAF Signalling Pathways to Block Oncogenic RAS Signalling.
    [Show full text]
  • 1 Tumor Suppressor PLK2 May Serve As a Biomarker in Triple-Negative Breast Cancer for Improved Response to PLK1 Therapeutics
    bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Tumor suppressor PLK2 may serve as a biomarker in triple-negative breast cancer for improved response to PLK1 therapeutics Yang Gao1, 2, 3, Elena B. Kabotyanski1, 2, Elizabeth Villegas7, Jonathan H. Shepherd8, Deanna Acosta1, 2, Clark Hamor1, 2, Tingting Sun2,4,5, Celina Montmeyor-Garcia9, Xiaping He8, Lacey E. Dobrolecki1, 2, 3, Thomas F. Westbrook2, 4, 5, Michael T. Lewis1, 2, 3, Susan G. Hilsenbeck2, 3, Xiang H.-F. Zhang1, 2, 3, 6, Charles M. Perou8 and Jeffrey M. Rosen1, 2 1Department of Molecular and Cellular Biology 2Dan L. Duncan Cancer Center 3Lester and Sue Smith Breast Center 4Department of Molecular and Human Genetics 5Verna & Marrs McLean Department of Biochemistry and Molecular Biology 6McNair Medical Institute Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030, USA 7University of Houston-Downtown, Houston, TX 77002, USA 8The University of North Carolina at Chapel Hill, Chapel Hill, NC 27599, USA 9 Canadian Blood Services, Toronto, ON M5G 2M1, Canada Correspondence to Jeffrey M. Rosen (Mail Stop: BCM130, Room: BCM-M638a, Baylor College of Medicine, 1 Baylor Plaza, Houston, TX 77030. Office: 713-798-6210. Fax: 713-898-8012. Email: [email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.16.448722; this version posted June 16, 2021.
    [Show full text]
  • Genome-Wide Association Study to Identify Genomic Regions And
    www.nature.com/scientificreports OPEN Genome‑wide association study to identify genomic regions and positional candidate genes associated with male fertility in beef cattle H. Sweett1, P. A. S. Fonseca1, A. Suárez‑Vega1, A. Livernois1,2, F. Miglior1 & A. Cánovas1* Fertility plays a key role in the success of calf production, but there is evidence that reproductive efciency in beef cattle has decreased during the past half‑century worldwide. Therefore, identifying animals with superior fertility could signifcantly impact cow‑calf production efciency. The objective of this research was to identify candidate regions afecting bull fertility in beef cattle and positional candidate genes annotated within these regions. A GWAS using a weighted single‑step genomic BLUP approach was performed on 265 crossbred beef bulls to identify markers associated with scrotal circumference (SC) and sperm motility (SM). Eight windows containing 32 positional candidate genes and fve windows containing 28 positional candidate genes explained more than 1% of the genetic variance for SC and SM, respectively. These windows were selected to perform gene annotation, QTL enrichment, and functional analyses. Functional candidate gene prioritization analysis revealed 14 prioritized candidate genes for SC of which MAP3K1 and VIP were previously found to play roles in male fertility. A diferent set of 14 prioritized genes were identifed for SM and fve were previously identifed as regulators of male fertility (SOD2, TCP1, PACRG, SPEF2, PRLR). Signifcant enrichment results were identifed for fertility and body conformation QTLs within the candidate windows. Gene ontology enrichment analysis including biological processes, molecular functions, and cellular components revealed signifcant GO terms associated with male fertility.
    [Show full text]
  • Identification of PIM1 Substrates Reveals a Role for NDRG1
    ARTICLE https://doi.org/10.1038/s42003-020-01528-6 OPEN Identification of PIM1 substrates reveals a role for NDRG1 phosphorylation in prostate cancer cellular migration and invasion Russell J. Ledet1,2,3,5, Sophie E. Ruff1,2,3,5, Yu Wang1,2, Shruti Nayak4, Jeffrey A. Schneider1,2,3, ✉ ✉ 1234567890():,; Beatrix Ueberheide1,4, Susan K. Logan1,2 & Michael J. Garabedian 2,3 PIM1 is a serine/threonine kinase that promotes and maintains prostate tumorigenesis. While PIM1 protein levels are elevated in prostate cancer relative to local disease, the mechanisms by which PIM1 contributes to oncogenesis have not been fully elucidated. Here, we performed a direct, unbiased chemical genetic screen to identify PIM1 substrates in prostate cancer cells. The PIM1 substrates we identified were involved in a variety of oncogenic processes, and included N-Myc Downstream-Regulated Gene 1 (NDRG1), which has reported roles in sup- pressing cancer cell invasion and metastasis. NDRG1 is phosphorylated by PIM1 at serine 330 (pS330), and the level of NDRG1 pS330 is associated higher grade prostate tumors. We have shown that PIM1 phosphorylation of NDRG1 at S330 reduced its stability, nuclear localization, and interaction with AR, resulting in enhanced cell migration and invasion. 1 Departments of Biochemistry and Molecular Pharmacology, New York University School of Medicine, New York, NY 10016, USA. 2 Department of Urology, New York University School of Medicine, New York, NY 10016, USA. 3 Department of Microbiology, New York University School of Medicine, New York, NY 10016, USA. 4 Proteomics Laboratory, New York University School of Medicine, New York, NY 10016, USA.
    [Show full text]
  • Inhibition of Polo-Like Kinase 1 During the DNA Damage Response Is Mediated Through Loss of Aurora a Recruitment by Bora
    OPEN Oncogene (2017) 36, 1840–1848 www.nature.com/onc ORIGINAL ARTICLE Inhibition of Polo-like kinase 1 during the DNA damage response is mediated through loss of Aurora A recruitment by Bora W Bruinsma1,2,4,5, M Aprelia1,2,5, I García-Santisteban1,3, J Kool2,YJXu2 and RH Medema1,2 When cells in G2 phase are challenged with DNA damage, several key mitotic regulators such as Cdk1/Cyclin B, Aurora A and Plk1 are inhibited to prevent entry into mitosis. Here we have studied how inhibition of Plk1 is established after DNA damage. Using a Förster resonance energy transfer (FRET)-based biosensor for Plk1 activity, we show that inhibition of Plk1 after DNA damage occurs with relatively slow kinetics and is entirely dependent on loss of Plk1-T210 phosphorylation. As T210 is phosphorylated by the kinase Aurora A in conjunction with its co-factor Bora, we investigated how they are affected by DNA damage. Interestingly, we find that the interaction between Bora and Plk1 remains intact during the early phases of the DNA damage response (DDR), whereas Plk1 activity is already inhibited at this stage. Expression of an Aurora A mutant that is refractory to inhibition by the DDR failed to prevent inhibition of Plk1 and loss of T210 phosphorylation, suggesting that inhibition of Plk1 may be established by perturbing recruitment of Aurora A by Bora. Indeed, expression of a fusion in which Aurora A was directly coupled to Bora prevented DNA damage-induced inhibition of Plk1 activity, as well as inhibition of T210 phosphorylation. Taken together, these data demonstrate that DNA damage affects the function of Aurora A at multiple levels: both by direct inhibition of Aurora A activity, as well as by perturbing the interaction with its co-activator Bora.
    [Show full text]
  • Kinase Profiling Book
    Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28
    [Show full text]
  • Modulation of NF-Κb Signalling by Microbial Pathogens
    REVIEWS Modulation of NF‑κB signalling by microbial pathogens Masmudur M. Rahman and Grant McFadden Abstract | The nuclear factor-κB (NF‑κB) family of transcription factors plays a central part in the host response to infection by microbial pathogens, by orchestrating the innate and acquired host immune responses. The NF‑κB proteins are activated by diverse signalling pathways that originate from many different cellular receptors and sensors. Many successful pathogens have acquired sophisticated mechanisms to regulate the NF‑κB signalling pathways by deploying subversive proteins or hijacking the host signalling molecules. Here, we describe the mechanisms by which viruses and bacteria micromanage the host NF‑κB signalling circuitry to favour the continued survival of the pathogen. The nuclear factor-κB (NF-κB) family of transcription Signalling targets upstream of NF‑κB factors regulates the expression of hundreds of genes that NF-κB proteins are tightly regulated in both the cyto- are associated with diverse cellular processes, such as pro- plasm and the nucleus6. Under normal physiological liferation, differentiation and death, as well as innate and conditions, NF‑κB complexes remain inactive in the adaptive immune responses. The mammalian NF‑κB cytoplasm through a direct interaction with proteins proteins are members of the Rel domain-containing pro- of the inhibitor of NF-κB (IκB) family, including IκBα, tein family: RELA (also known as p65), RELB, c‑REL, IκBβ and IκBε (also known as NF-κBIα, NF-κBIβ and the NF-κB p105 subunit (also known as NF‑κB1; which NF-κBIε, respectively); IκB proteins mask the nuclear is cleaved into the p50 subunit) and the NF-κB p100 localization domains in the NF‑κB complex, thus subunit (also known as NF‑κB2; which is cleaved into retaining the transcription complex in the cytoplasm.
    [Show full text]
  • Comparing Signaling Networks Between Normal and Transformed Hepatocytes Using Discrete Logical Models
    Published OnlineFirst July 8, 2011; DOI: 10.1158/0008-5472.CAN-10-4453 Cancer Integrated Systems and Technologies: Mathematical Oncology Research Comparing Signaling Networks between Normal and Transformed Hepatocytes Using Discrete Logical Models Julio Saez-Rodriguez1,2, Leonidas G. Alexopoulos1,2, MingSheng Zhang1, Melody K. Morris2, Douglas A. Lauffenburger2, and Peter K. Sorger1,2 Abstract Substantial effort in recent years has been devoted to constructing and analyzing large-scale gene and protein networks on the basis of "omic" data and literature mining. These interaction graphs provide valuable insight into the topologies of complex biological networks but are rarely context specific and cannot be used to predict the responses of cell signaling proteins to specific ligands or drugs. Conversely, traditional approaches to analyzing cell signaling are narrow in scope and cannot easily make use of network-level data. Here, we combine network analysis and functional experimentation by using a hybrid approach in which graphs are converted into simple mathematical models that can be trained against biochemical data. Specifically, we created Boolean logic models of immediate-early signaling in liver cells by training a literature-based prior knowledge network against biochemical data obtained from primary human hepatocytes and 4 hepatocellular carcinoma cell lines exposed to combinations of cytokines and small-molecule kinase inhibitors. Distinct families of models were recovered for each cell type, and these families clustered topologically into normal and diseased sets. Cancer Res; 71(16); 5400–11. Ó2011 AACR. Introduction Major Findings The availability of high-throughput interaction data has led Clustering arises from systematic differences in signaling to the creation of methods for summarizing and exploring logic in three regions of the network.
    [Show full text]
  • Combined Inhibition of MEK and Plk1 Has Synergistic Anti-Tumor Activity in NRAS Mutant Melanoma
    Combined inhibition of MEK and Plk1 has synergistic anti-tumor activity in NRAS mutant melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Posch, C., B. Cholewa, I. Vujic, M. Sanlorenzo, J. Ma, S. Kim, S. Kleffel, et al. 2015. “Combined inhibition of MEK and Plk1 has synergistic anti-tumor activity in NRAS mutant melanoma.” The Journal of investigative dermatology 135 (10): 2475-2483. doi:10.1038/jid.2015.198. http://dx.doi.org/10.1038/jid.2015.198. Published Version doi:10.1038/jid.2015.198 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:26860102 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA HHS Public Access Author manuscript Author Manuscript Author ManuscriptJ Invest Author ManuscriptDermatol. Author Author Manuscript manuscript; available in PMC 2016 April 01. Published in final edited form as: J Invest Dermatol. 2015 October ; 135(10): 2475–2483. doi:10.1038/jid.2015.198. Combined inhibition of MEK and Plk1 has synergistic anti-tumor activity in NRAS mutant melanoma C Posch#1,2,3,*, BD Cholewa#4, I Vujic1,3, M Sanlorenzo1,5, J Ma1, ST Kim1, S Kleffel2, T Schatton2, K Rappersberger3, R Gutteridge4, N Ahmad4, and S Ortiz/Urda1 1 University of California San Francisco, Department of Dermatology, Mt. Zion Cancer Research
    [Show full text]
  • MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course
    8516 Vol. 10, 8516–8520, December 15, 2004 Clinical Cancer Research MAP2K4/MKK4 Expression in Pancreatic Cancer: Genetic Validation of Immunohistochemistry and Relationship to Disease Course Wei Xin,1 Ki J. Yun,4 Francesca Ricci,2 ing patterns were also evaluated among unresectable pri- Marianna Zahurak,3 Wanglong Qiu,4 mary and metastatic cancer tissues from autopsy specimens, Gloria H. Su,4 Charles J. Yeo,5,6 indicating intact Mkk4 immunolabeling in 88.8% of the unresectable primary carcinomas as compared with 63.3% Ralph H. Hruban,4,5 Scott E. Kern,4,5 and 4,5 of distant metastases (P < 0.001). Our data indicate that the Christine A. Iacobuzio-Donahue loss of Mkk4 protein expression in pancreatic carcinomas 1 Department of Pathology, The University of Michigan Medical may be more frequent than suggested by the rates of genetic Center, Ann Arbor, Michigan; 2Department of Pathology, University La Sapienza, Rome, Italy; and the Departments of 3Biostatistics, inactivation alone and that MKK4 loss may contribute to 4Pathology, 5Oncology, and 6Surgery, The Johns Hopkins University disease progression. The correlation of MKK4 genetic status Hospital, Baltimore, Maryland with immunolabeling patterns validate this approach for the evaluation of MKK4 status in routine histologic sections and ABSTRACT may provide useful information regarding patient prognosis. MKK4 (MAP2K4/SEK1) is a member of the mitogen- activated protein kinase family, originally identified as a INTRODUCTION kinase involved in the stress-activated protein kinase path- The mitogen-activated protein (MAP) kinase cascades are way by directly phosphorylating c-Jun NH -terminal kinase. 2 multifunctional signaling pathways that are evolutionally well MKK4 genetic inactivation has been observed in a subset of conserved in all of the eukaryotic cells.
    [Show full text]
  • Rnai Screen Identifies a Synthetic Lethal Interaction Between PIM1 Overexpression and PLK1 Inhibition
    Published OnlineFirst April 25, 2014; DOI: 10.1158/1078-0432.CCR-13-3116 Clinical Cancer Cancer Therapy: Preclinical Research RNAi Screen Identifies a Synthetic Lethal Interaction between PIM1 Overexpression and PLK1 Inhibition Riet van der Meer1, Ha Yong Song2, Seong-Hoon Park2, Sarki A. Abdulkadir1, and Meejeon Roh2 Abstract Purpose: To identify genes whose depletion is detrimental to Pim1-overexpressing prostate cancer cells and to validate this finding in vitro and in vivo. Experimental Design: RNAi screening was used to identify genes whose depletion is detrimental to Pim1-overexpressing cells. Our finding was validated using shRNA or PLK1-specific inhibitor BI 2536. Xenograft studies were performed using both PLK1-knockdown cells and BI 2536 to investigate the effects of PLK1 inhibition on tumorigenesis in Pim1-overexpressing cells. Finally, PLK1 and PIM1 expression patterns in human prostate tumors were examined by immunohistochemistry using tissue microarrays. Results: We identified the mitotic regulator polo-like kinase (PLK1) as a gene whose depletion is particularly detrimental to the viability of Pim1-overexpressing prostate cancer. Inhibition of PLK1 by shRNA or BI 2536 in Pim1-overexpressing prostate cancer xenograft models resulted in a dramatic inhibition of tumor progression. Notably, Pim1-overexpressing cells were more prone to mitotic arrest followed by apoptosis due to PLK1 inhibition than control cells. Furthermore, inhibition of PLK1 led to the reduction of MYC protein levels both in vitro and in vivo. Our data also suggest that PIM1 and PLK1 physically interact and PIM1 might phosphorylate PLK1. Finally, PLK1 and PIM1 are frequently co- expressed in human prostate tumors, and co-expression of PLK1 and PIM1 was significantly correlated to higher Gleason grades.
    [Show full text]