sign in sign up
<<
Home , Histamine, Tyrosine

Article and Inhibit and d-Glucuronic Acid Catabolism in Clinically Significant Salmonella in A Serotype-Independent Manner

Raquel Burin 1 and Devendra H. Shah 1,2,*

1 Department of Veterinary Microbiology and Pathology, College of Veterinary Medicine, Washington State University, Pullman, WA 99164, USA; [email protected] 2 Paul Allen School for Global Animal Health, College of Veterinary Medicine, Washington State University, Pullman, WA 99164, USA * Correspondence: [email protected]; Tel.: +1-509-335-6071

Abstract: Non-typhoidal Salmonella ingeniously scavenges energy for growth from tyramine (TYR) and d-glucuronic acid (DGA), both of which occur in the host as the metabolic byproducts of the gut microbial . A critical first step in energy scavenging from TYR and DGA in Salmonella involves TYR-oxidation via TYR-oxidoreductase and production of free-DGA via β-glucuronidase (GUS)-mediated hydrolysis of d-glucuronides (conjugated form of DGA), respectively. Here, we report that Salmonella utilizes TYR and DGA as sole sources of energy in a serotype-independent manner. Using colorimetric and radiometric approaches, we report that genes SEN2971, SEN3065,   and SEN2426 encode TYR-oxidoreductases. Some Salmonella serotypes produce GUS, thus can also scavenge energy from d-glucuronides. We repurposed phenelzine (monoaminoxidase-inhibitor) Citation: Burin, R.; Shah, D.H. and amoxapine (GUS-inhibitor) to inhibit the TYR-oxidoreductases and GUS encoded by Salmonella, Phenelzine and Amoxapine Inhibit respectively. We show that phenelzine significantly inhibits the growth of Salmonella by inhibiting Tyramine and d-Glucuronic Acid TYR-oxidoreductases SEN2971, SEN3065, and SEN2426. Similarly, amoxapine significantly inhibits Catabolism in Clinically Significant the growth of Salmonella by inhibiting GUS-mediated hydrolysis of d-glucuronides. Because TYR Salmonella in A Serotype-Independent and DGA serve as potential energy sources for Salmonella growth in vivo, the data and the novel Manner. Pathogens 2021, 10, 469. https://doi.org/10.3390/ approaches used here provides a better understanding of the role of TYR and DGA in Salmonella pathogens10040469 pathogenesis and nutritional virulence.

Academic Editor: Marialaura Keywords: Salmonella; d-glucuronic acid; tyramine; phenelzine; amoxapine Corrente

Received: 3 March 2021 Accepted: 9 April 2021 1. Introduction Published: 13 April 2021 Host–microbiota interactions within the gastrointestinal (GI) tract have profound effects on the physiology and of the host. Turbulence in the commensal Publisher’s Note: MDPI stays neutral microbiota of the GI tract plays an important role in aiding the survival, growth, and with regard to jurisdictional claims in persistence of pathogens, such as Salmonella, within this niche. Several factors including the published maps and institutional affil- production of inhibitory substances of microbial origin, competition for adhesion sites, and iations. acquisition of nutrients contribute to protective mechanisms afforded by the GI microbiota. For the efficient acquisition of nutrients within the nutritionally challenging environment of the GI tract, Salmonella has evolved to scavenge energy from the metabolic byproducts of the commensal microbiota. The metabolic versatility of Salmonella is therefore increasingly Copyright: © 2021 by the authors. recognized as a pathogenicity factor [1–10]. However, the precise metabolic requirements of Licensee MDPI, Basel, Switzerland. Salmonella in the host GI tract remain poorly defined. Therefore, identification of metabolic This article is an open access article byproducts and the knowledge of the metabolic pathways used by Salmonella to scavenge distributed under the terms and energy from such byproducts is essential to better understand the mechanisms underlying conditions of the Creative Commons the nutritional virulence of Salmonella. Attribution (CC BY) license (https:// Recently, we reported that Salmonella can ingeniously scavenge energy from tyramine creativecommons.org/licenses/by/ 4.0/). (TYR, an aromatic ) and d-glucuronic acid (DGA, a hexuronic acid), both of which

Pathogens 2021, 10, 469. https://doi.org/10.3390/pathogens10040469 https://www.mdpi.com/journal/pathogens Pathogens 2021, 10, 469 2 of 18

are known to naturally occur in the host as byproducts of gut microbial metabolism [11]. Within the mammalian GI tract, TYR is produced as a result of (a semi-essential ) , a reaction mediated by the gut microbial [12–16]. TYR is also naturally found in fermented food products [12]. As a result, varying concentrations of TYR can be detected in cecal contents (0.3 to 0.9 µM) and other host tissues (1.5 to 32 ng/g) [17,18]. Interestingly, enteric bacteria such as E. coli and Salmonella can utilize TYR as a source of energy for growth [11,19–23]. In E. coli, TYR serves as a substrate for oxidoreductase enzyme TynA (also known as monoamine oxidoreductase or MAO). TynA oxidizes TYR in a reaction that liberates peroxide and ammonia, thereby activating the TYR catabolic pathway which shunts the resulting pyruvate and acetyl-CoA into the TCA cycle [20,22]. TynA mediated TYR oxidation is considered a critical first step in the TYR catabolic pathway. It has been reported that the tynA deletion mutant of E. coli fails to grow when TYR is used as a sole source of energy [21]. We reported that Salmonella can also derive energy from TYR as a sole source of carbon and ; however, tynA gene is not present in this [11,23]. Thus, to identify genes encoding alternative TYR oxidoreductases, we recently conducted TYR-induced transcriptome profiling of Salmonella [23]. In that study, we identified three TYR-responsive genes (SEN2971, SEN3065, and SEN2426) (Figure S2) and reported that these genes encode putative oxidoreductase [23]. We also reported that deletion of SEN2971 signifi- cantly impairs, but does not eliminate the ability of Salmonella to efficiently derive energy for growth from TYR, suggesting that SEN2971 likely serves as a primary TYR oxidoreduc- tase [11,23], whereas encoded by SEN3065 and SEN2426 likely serve as alternative TYR oxidoreductases [23]. However, it is currently unknown if SEN2971, SEN3065, and SEN2426 are indeed TYR-oxidoreductases. Because oxidoreductase-mediated TYR oxida- tion is the critical first step in the TYR catabolism, here we aimed to determine whether non-typhoidal Salmonella (NTS) utilize TYR as a sole source of energy for growth, in a serotype-independent manner and whether SEN2971, SEN3065, and SEN2426 are TYR oxidoreductases. Additionally, we aimed to test whether inhibition of oxidoreductase activity of these newly identified TYR oxidoreductases could be used as a strategy to block the ability of Salmonella to derive energy from TYR in a serotype-independent manner. To test this hypothesis, we repurposed phenelzine, a broad-spectrum MAO inhibitor (MAOi) known to inhibit MAO-mediated oxidation of other monoamine such as , , and [24,25]. Unlike TYR, DGA is a carboxylic acid derived from the oxidation of , and it commonly occurs in a conjugated form (known as d-glucuronide) in the liver and the layers of the mammalian GI tract [26]. In the liver, conjugation of DGA with drugs and other toxic compounds of endogenous and exogenous origins occurs as the most abundant phase-II reaction (i.e., glucuronidation), and through enterohepatic circulation, these conjugates reach the mammalian GI tract. Glucuronidation increases the water of toxic compounds, makes them less biologically active (inert), and promotes their removal from the body via kidneys or GI tract [27]. Thus, a high concentration of d- glucuronides can be detected in the (40 to 104 µg/g), cecum (14 to 28 µg/g), and colon (5 to 14 µg/g) [26]. Interestingly, d-glucuronides also serve as a substrate for microbial β-glucuronidase (GUS) enzymes in the GI tract. More specifically, d-glucuronides are hydrolyzed by the GUS enzymes produced by commensal which results in recirculation of the toxic compounds in the enterohepatic cycle and the release of the free-DGA moiety [23,27]. The free-DGA then enters the Entner–Doudoroff pathway (a bacterial alternative to glycolysis) that catabolizes sugar acids and shunts the resulting pyruvate into the TCA cycle. Pathogenic strains of E. coli such as enterohemorrhagic E. coli and several clinically significant Salmonella serotypes including Salmonella enterica sub sp enterica serovar Enteritidis (Salmonella Enteritidis) and Salmonella Typhimurium do not produce GUS enzymes; thus, these pathogens cannot directly hydrolyze d-glucuronide. However, they can utilize free-DGA as an energy source for growth [11,28,29]. In contrast, several commensal or pathogenic strains of E. coli and a few serotypes of Salmonella Pathogens 2021, 10, 469 3 of 18

such as S. Montevideo and S. Schwarzengrund carry GUS operon, thus are capable of hydrolyzing d-glucuronide [11,28–30]. Therefore, the free-DGA released due to the action of either the microbiota or the pathogen produced GUS serves as an energy source for the propagation of enteric pathogens such as enterohaemorrhagic E. coli O157:H7 as well as for Salmonella [2,11,23,31]. In summary, GUS enzymes mediate the hydrolysis of d-glucuronide resulting in the reactivation of toxic molecules important in host health and disease, with the simultaneous release of free-DGA, which is then utilized by enteric pathogens as an energy source. Interestingly, in human medicine, there is increased interest in the development and use of GUS inhibitory compounds as a clinical strategy to reduce the hydrolytic breakdown of d-glucuronides by commensal microbiota to reduce reactivation of toxic metabolites in the GI tract [31–34]. Given that the GUS enzymes are at the interface of a metabolic symbiosis between enteric pathogens and the host microbiota, in this study, we aimed to repurpose amoxapine (a tricyclic GUS-inhibitor and of the dibenzoxazepine class) to inhibit the GUS-mediated hydrolysis of d-glucuronides by Salmonella, thereby limiting the ability of Salmonella to derive energy from d-glucuronides for growth. Here, we show that Salmonella ingeniously scavenges energy for growth from TYR and DGA, in a serotype-independent manner. We also report that MAO inhibitor phenelzine and GUS inhibitor amoxapine significantly impair the ability of Salmonella to derive energy from TYR and d-glucuronides in vitro and consequently cause a growth defect in Salmonella in a serotype-independent manner. Given that TYR and DGA may serve as an important source of energy for Salmonella growth in vivo, the data and the novel approaches used in this study will open new avenues to investigate the role of TYR and DGA in Salmonella pathogenesis and nutritional virulence in vivo.

2. Results and Discussion 2.1. SEN2971, SEN3065, and SEN2426 Are TYR Oxidoreductases We recently reported that the expression of SEN2971, SEN3065, and SEN2426 encod- ing putative oxidoreductases was highly upregulated when TYR is used as a sole energy source for the growth of Salmonella [23]. Previously, it was reported that the expression of STM3128 (gene corresponding to SEN2971) is also upregulated in response to TYR in S. Typhimurium [35]. Moreover, the deletion of SEN2971 in S. Enteritidis and STM3128 in S. Typhimurium was also reported to significantly impair the ability of these two serotypes to utilize TYR as a sole energy source for growth [11,23,35–37]. In this study, we produced recombinant SEN2971 (50.87 KDa), SEN3065 (39.93 KDa), and SEN2426 (30.87 KDa) and determined their oxidoreductase activity through a radiometric assay using tritium (3H) labeled TYR as a substrate. The results of the radiometric assays show that the oxidoreductase activity of SEN2971 was highest (25 CPM), followed by SEN3065 (10 CPM) and SEN2426 (6 CPM) (Figure1a). We confirmed the oxidoreduc- tase activity of SEN2971, SEN3065, and SEN2426 using a colorimetric assay that detects the oxidoreductase-dependent formation of H2O2. As expected, SEN2971 showed the strongest TYR oxidoreductase activity (OD562: 0.087) (Figure1b). The oxidoreductase activity of SEN2971 was similar to H2O2 as a positive control (OD562 = 0.086); however, the oxidoreductase activity of SEN3065 (OD562 = 0.015) and SEN2426 (OD562 = 0.011) was significantly (p < 0.05) lower than SEN2971 (Figure1b). These results corroborate with the TYR oxidoreductase activity of these recombinant proteins observed with the radiometric assay. Although three recombinant oxidoreductases tested in this study showed differential TYR oxidoreductase activities, it is possible that these differences are likely confounded by potential differences in the recombinant concentrations used in the assays. Follow-up studies are needed to confirm the differential efficiency of individual TYR oxidoreductases in Salmonella. Nevertheless, the data clearly show that Salmonella is capable to efficiently oxidize TYR through the combined actions of three oxidoreductases SEN2971, SEN3065, and SEN2426, and that the oxidoreductase encoded by SEN2971 likely exhibits the highest oxidoreductase activity. Pathogens 2021, 10, x FOR PEER REVIEW 4 of 19

Pathogens 2021, 10, x FOR PEER REVIEW 4 of 19

SEN2426, and that the oxidoreductase encoded by SEN2971 likely exhibits the highest ox- idoreductase activity. Pathogens 2021, 10, 469 4 of 18 SEN2426, and that the oxidoreductase encoded by SEN2971 likely exhibits the highest ox- idoreductase activity.

Figure 1. TYR oxidoreductase activity of the recombinant SEN2971, SEN3065 and SEN2426, meas- ured by a radiometric (a) and colorimetric assay (b). In the radiometric assay, the enzymatic activ- ity of the recombinant proteins is expressed as normalized counts per minutes (CPM). In the color- Figure 1. TYR oxidoreductaseFigure 1. TYR oxidoreductase activity of the recombinantactivity of the SEN2971, recombinant SEN3065 SEN2971, and SEN3065 SEN2426, and measured SEN2426, by meas- a radiometric imetric assay, the MAO-dependent formation of H2O2 is expressed as normalized OD562. The posi- (a) and colorimetricured assayby a radiometric (b). In the radiometric(a) and colorimetric assay, the assay enzymatic (b). In activitythe radiometric of the recombinant assay, the enzymatic proteins is activ- expressed as tive control (+) consisted of the addition of 100 µL (10 µM) of H2O2 (hatched bar). normalized countsity of per the minutes recombinant (CPM). proteins In the colorimetricis expressed assay,as normalized the MAO-dependent counts per minutes formation (CPM). of H In2O the2 is color- expressed as normalized ODimetric562. The assay, positive the controlMAO-dependent (+) consisted formation of the addition of H2O2 of is 100expressedµL (10 µasM) normalized of H2O2 (hatched OD562. The bar). posi- tive control (+) Toconsisted determine of the whether addition SEN2971, of 100 µL (10 SEN3065, µM) of H and2O2 SEN2426(hatched bar). are MAO-A or MAO-B type, we testedTo differential determine whetherinhibition SEN2971, of these SEN3065,recombinant and oxidoreductases SEN2426 are MAO-A with clorgyline, or MAO-B an type, To determineinhibitorwe tested of whether the differential MAO-A SEN2971, activity, inhibition SEN3065, and of , these and recombinantSEN2426 as an are inhibitor MAO-A oxidoreductases of orMAO-B MAO-B withactivity, type, clorgyline, respec- an we testedtively. differentialinhibitor The oxidoreductase of inhibition the MAO-A of these activity,activity recombinant and of SEN3065 pargyline, oxidoreductases (17%) as an and inhibitor SEN2426 with of clorgyline, MAO-B (13%) activity,was an signifi- respec- inhibitorcantly of tively.the (MAO-Ap The< 0.05) oxidoreductase activity, lower than and pargyline,SEN2971 activity of (101%) as SEN3065 an inhibitor and (17%) the ofpositive and MAO-B SEN2426 control activity, (13%) (100%) respec- was (Figure significantly 2). tively. TheThe (oxidoreductasep TYR< 0.05) oxidoreductase lower thanactivity SEN2971 activity of SEN3065 (101%)of SEN2971 and(17%) the was and positive significantly SEN2426 control (13%) ( (100%)p < 0.05)was (Figure signifi-reduced2). Theby the TYR cantly (pinhibitor < oxidoreductase0.05) lower clorgyline than activity (23%),SEN2971 followed of SEN2971(101%) by and pargy was the significantlyline positive (64%), control suggesting (p < 0.05)(100%) reducedthat (Figure SEN2971 by 2). the is inhibitorlikely The TYRan oxidoreductase clorgylineMAO-A type (23%), (Figureactivity followed 2).of InSEN2971 by corroboration pargyline was (64%),significantly with suggesting these (results,p < that0.05) SEN2971others reduced have is by likely also the reported an MAO-A inhibitorthat clorgylinetype the (Figureactivity (23%),2 ).of In followedE. corroborationcoli oxidoreductase by pargy withline these TynA (64%), results, is suggesting more others efficiently have that alsoSEN2971 inhibited reported is with likely that clorgyline the activity an MAO-Awhen oftypeE. compared coli(Figureoxidoreductase 2). with In corroboration pargyline, TynA issuggesting more withefficiently these results,at TynA inhibited others is likely with have clorgylineMAO-A also reported type when [38]. compared The that the activityoxidoreductasewith of pargyline, E. coli activityoxidoreductase suggesting of SEN3065 that TynA TynA (17%) is is more likelywas efficiently similar MAO-A when typeinhibited treated [38]. Thewith with oxidoreductase clorgyline clorgyline (17%); activity when comparedhowever,of SEN3065 with reduced pargyline, (17%) activity was similarsuggesting was detected when th treatedat when TynA with treated is clorgylinelikely with MAO-A pargyline (17%); type however, (13%). [38]. reducedTheseThe differ- activity oxidoreductaseenceswas were activity detected not ofstatistically when SEN3065 treated (17%)significant with was pargyline similar (p > 0.05). when (13%). Similarly, treated These withthe differences oxidoreductase clorgyline were (17%); not activity statistically of however,SEN2426 reducedsignificant (13%) activity (p was> was 0.05). similar detected Similarly, when when treated the oxidoreductasetreated with withclorgyline pargyline activity (15%); (13%). of however, SEN2426 These reduced (13%)differ- was activity similar ences werewas whennot detected statistically treated when with significant treated clorgyline with (p (15%); >pargyline 0.05). however, Similarly, (8%).reduced These the oxidoreductase differences activity was were detected activity also not whenof statisti- treated SEN2426cally (13%)with significant was pargyline similar (p (8%). >when 0.05). These treated differences with clorgyline were also (15%); not however, statistically reduced significant activity (p > 0.05). was detected when treated with pargyline (8%). These differences were also not statisti- cally significant (p > 0.05).

FigureFigure 2. Differential 2. Differential inhibition inhibition of ofTYR TYR oxidoreducta oxidoreductasese activity activity of of the the recombinant recombinant SEN2971, SEN3065, SEN3065,and SEN2426 and SEN2426 by clorgyline by clorgyline (inhibitor (inhibitor of MAO-A of MAO-A activity) andactivity) pargyline and pargyline (inhibitor (inhibitor of MAO-B of activity). MAO-B activity). The numbers on the top of the bar show percentage of enzymatic activity. NS, Figure 2. DifferentialThe numbers inhibition on the of top TYR of theoxidoreducta bar showse percentage activity of of the enzymatic recombinant activity. SEN2971, NS, non-significant. non-significant. SEN3065, and SEN2426 by clorgyline (inhibitor of MAO-A activity) and pargyline (inhibitor of 2.2. Phenelzine Inhibits the TYR Oxidoreductase Activity of Recombinant SEN2971, SEN3065, MAO-B activity). The numbers on the top of the bar show percentage of enzymatic activity. NS, and SEN2426 non-significant. Phenelzine is a broad-spectrum inhibitor (MAOi) that inhibits both MAO-A and MAO-B [39]. Phenelzine is also known to inhibit the activity of an E. coli MAO, TynA [38]. In the current study, treatment with phenelzine significantly (p < 0.05) inhibited the TYR oxidoreductase activity from 25 CPM (SEN2971), 10 CPM Pathogens 2021, 10, x FOR PEER REVIEW 5 of 19

2.2. Phenelzine Inhibits the TYR Oxidoreductase Activity of Recombinant SEN2971, SEN3065, and SEN2426 Phenelzine is a broad-spectrum monoamine oxidase inhibitor (MAOi) that inhibits Pathogens 2021, 10, 469 both MAO-A and MAO-B [39]. Phenelzine is also known to inhibit the activity of an E.5 coli of 18 MAO, TynA [38]. In the current study, treatment with phenelzine significantly (p < 0.05) inhibited the TYR oxidoreductase activity from 25 CPM (SEN2971), 10 CPM (SEN3065), and 6 CPM (SEN2426) down to 4 CPM (SEN2971 and SEN3065) and <1 CPM (SEN2426), (SEN3065), and 6 CPM (SEN2426) down to 4 CPM (SEN2971 and SEN3065) and <1 CPM respectively(SEN2426), respectively(Figure 3). These (Figure data3). Theseshow datathat showphenelzine that phenelzine can efficiently can efficiently inhibit the inhibit oxi- doreductasethe oxidoreductase activity of activity all three of TYR all three oxidor TYReductases oxidoreductases SEN2971, SEN3065, SEN2971, and SEN3065, SEN2426. and Consequently,SEN2426. Consequently, it can be expected it can be that expected the use that of phenelzine the use of phenelzinemay abrogate may the abrogate ability of the Salmonellaability of toSalmonella scavengeto energy scavenge from energy TYR from and may TYR andsignificantly may significantly impair the impair growth the of growth Sal- monellaof Salmonella when TYRwhen is TYRsupplemented is supplemented as the sole as the energy soleenergy source. source.

FigureFigure 3. 3.PhenelzinePhenelzine inhibits inhibits TYR TYR oxidoreductase oxidoreductase activity activity of recombinan of recombinantt SEN2971, SEN2971, SEN3065, SEN3065, and SEN2426.and SEN2426.

2.3.2.3. Phenelzine Phenelzine Inhibits Inhibits the the Growth Growth of ofS. S. Ent Enteritidiseritidis in in the the Presence Presence of of TYR TYR as as the the Sole Sole Energy SourceEnergy Source Previously, we reported that deletion of SEN2971 significantly impaired the growth, Previously, we reported that deletion of SEN2971 significantly impaired the growth, but did not abrogate the ability of Salmonella to grow by deriving energy from TYR [11]. but did not abrogate the ability of Salmonella to grow by deriving energy from TYR [11]. We hypothesized that the residual growth of S. Enteritidis ∆SEN2971 was likely due to We hypothesized that the residual growth of S. Enteritidis ΔSEN2971 was likely due to the activity of alternative oxidoreductases encoded by TYR-inducible genes SEN3065 and the activity of alternative oxidoreductases encoded by TYR-inducible genes SEN3065 and SEN2426 [23]. Because phenelzine is a broad-spectrum MAO inhibitor that inhibits the SEN2426 [23]. Because phenelzine is a broad-spectrum MAO inhibitor that inhibits the activity of SEN2971, SEN3065, and SEN2426 (Figure3), we reasoned that treatment with activity of SEN2971, SEN3065, and SEN2426 (Figure 3), we reasoned that treatment with phenelzine should inhibit any residual growth of ∆SEN2971 due to the actions of alternative phenelzine should inhibit any residual growth of ΔSEN2971 due to the actions of alterna- oxidoreductases SEN3065 and SEN2426. To test this hypothesis, we tested the growth tive oxidoreductases SEN3065 and SEN2426. To test this hypothesis, we tested the growth of WT S. Enteritidis str. 1 and ∆SEN2971 in the medium supplemented with TYR as a of WT S. Enteritidis str. 1 and ΔSEN2971 in the medium supplemented with TYR as a sole sole energy source, with or without the treatment with phenelzine. The untreated WT energy source, with or without the treatment with phenelzine. The untreated WT of S. of S. Enteritidis grew up to 4.16 log10 during 48 h with a doubling time (Td) of 3.52 h Enteritidis(Figure4a). grew As expected, up to 4.16 the log growth10 during of untreated 48 h withS. a Enteritidisdoubling time∆SEN2971 (Td) ofwas 3.52 significantly h (Figure 4a). As expected, the growth of untreated S. Enteritidis ΔSEN2971 was significantly (p < (p < 0.05) lower (1.89 log10) with a Td of 7.62 h when compared with the untreated WT 0.05)strain. lower The (1.89 residual log10) growthwith a Td of of∆SEN2971 7.62 h whenhere compared can be attributed with the untreated to the activity WT strain. of two Thealternative residual growth oxidoreductases of ΔSEN2971 (SEN3065 here can and be SEN2426).attributed to When the activity WT and of ∆twoSEN2971 alternativewere oxidoreductasestreated with 30 (SEN3065µM of phenelzine, and SEN2426). the Td When of phenelzine WT and Δ treatedSEN2971 WT were (18.80 treated h) increased with 30 µMsignificantly of phenelzine, when the compared Td of phenelzine with non-treated treated WT WT (18.80 (3.52 h).h) increa Similarly,sed thesignificantly Td of ∆SEN2971 when comparedincreased with significantly non-treated from WT 7.62 (3.52 h to h). 29.49 Similarly, h (Figure the4 Tda). of These ΔSEN2971 results increased clearly show signifi- that cantlythe inhibition from 7.62 of h theto 29.49 residual h (Figure growth 4a). of Thes∆SEN2971e resultsis clearly likely show due to that the the inhibition inhibition of of the theoxidoreductase residual growth activity of ΔSEN2971 of SEN2426 is likely and SEN3065. due to the The inhibiti inhibitionon of of theS. oxidoreductaseEnteritidis growth ac- is tivityunlikely of SEN2426 due to the and off-target SEN3065. effects The ofinhibition phenelzine of S. because Enteritidis WT andgrowth∆SEN2971 is unlikelytreated due with to the30 off-targetµM of phenelzine effects of grew phenelzine up to 6 logbecause10 with WT a Td and of 2.26ΔSEN2971 h and2.25 treated h, respectively, with 30 µM when of phenelzineTYR was replaced grew up with to 6 glucoselog10 with as a soleTd of source 2.26 h of and energy 2.25 (Figureh, respectively,4b). These when data showTYR was that replacedphenelzine with is notglucose toxic toas thea sole bacterial source cells ofand energy that this(Figure inhibitor 4b). canThese specifically data show block that the utilization of TYR as a source of energy by Salmonella by inhibiting TYR-oxidoreductases.

Pathogens 2021, 10, x FOR PEER REVIEW 6 of 19

phenelzine is not toxic to the bacterial cells and that this inhibitor can specifically block Pathogens 2021, 10, 469 6 of 18 the utilization of TYR as a source of energy by Salmonella by inhibiting TYR-oxidoreduc- tases.

FigureFigure 4. 4. GrowthGrowth kinetics kinetics of of S.S. EnteritidisEnteritidis WT and ∆ΔSEN2971 inin thethe presencepresence of of TYR TYR ( a()a or) or glucose glucose (b ) (bas) as a solea sole energy energy source, source, with with or withoutor without 30 µ30M µM of phenelzine.of phenelzine. The The doubling doubling time time (Td) (Td) for eachfor each strain strainwas calculatedwas calculated using using the following the following formula: formula: t/(3.3 t/×(3.3log(b/B)) × log(b/B)) where where t is the t is time the time interval interval (48 h), (48 b is h),the b is CFU the atCFU the at end the of end 48 hof and 48 h B and is the B is CFU the atCF 0U h. at Asterisks 0 h. Asterisks indicate indicate a significant a significant difference differ- in the ence in the Td (p < 0.05) when compared with the WT parent. Comparisons with p-value > 0.05 are Td (p < 0.05) when compared with the WT parent. Comparisons with p-value > 0.05 are shown as shown as non-significant (NS). non-significant (NS).

2.4.2.4. Clinically Clinically Significant Significant NTS NTS Ut Utilizeilize TYR TYR as as a aSource Source of of Energy Energy PreviouslyPreviously we we reported reported that that S. S.EnteritidisEnteritidis can can utilize utilize TYR TYR as a as sole a soleenergy energy source source for growthfor growth [11,23]. [11 ,To23]. determine To determine whether whether TYR TYRis also is alsoutilized utilized by other by other NTS NTS serotypes serotypes as an as energyan energy source, source, we wetested tested the theability ability of oftwelve twelve SalmonellaSalmonella serotypesserotypes to toutilize utilize TYR TYR as as a a sourcesource of of energy energy for for growth, growth, as as previously previously determined determined for for the the WT WT S.S. EnteritidisEnteritidis str. str. 11 as as aa modelmodel organism. organism. These These 12 12 serotypes serotypes were recently reportedreported asas thethe most-prevalent most-prevalent poultry- poul- try-associatedassociated Salmonella Salmonellaserotypes serotypes (MPPSTs) (MPPSTs) and and all, all, except exceptS. Kentucky S. Kentucky were were also also identified iden- tifiedas the as clinically the clinically most significantmost significant serotypes serotypes associated associated with food-borne with food-borne illnesses illnesses in humans in humansin the USA in the [40 USA,41]. All[40,41]. the Salmonella All the Salmonellastrains showed strains growth showed in growth M9 containing in M9 containing 5 mM of TYR 5 mM(without of TYR NH (without4Cl) ranging NH4Cl) from ranging 1.42 (S. fromThompson) 1.42 (S. Thompson) to 5.08 (S. I 4,to 5,5.08 12: (S. I:-) I log4, 5,10 12:within I:-) log 4810 h within(Figure 485). h A(Figure few serotypes 5). A few such serotypes as S. Thompsonsuch as S. Thompson (1.42 log10 )(1.42 and S.logMbandaka10) and S. Mbandaka (1.52 log10 ) (1.52showed log10 lower) showed growth lower when growth compared when compared with S. Enteritidis with S. Enteritidis str. 1, whereas str. 1, otherwhereas serotypes other serotypessuch as S. suchSeftenberg as S. Seftenberg (4.98 log10), (4.98S. Schwarzengrund log10), S. Schwarzengrund (5.06 log10), and(5.06S. logI4,5,12:I:-10), and (5.08 S. I4,5,12:I:-log10) showed (5.08 log higher10) showed growth higher than S. growthEnteritidis than str. S. Enteritidis 1. These data str. suggest 1. These that data all suggest serovars thatutilize all serovars TYR as energy utilize source TYR as for energy growth source with differentialfor growth efficiency.with differential We tested efficiency. each serovar We testedfor the each presence serovar of forSEN2971 the presence, SEN3065 of SEN2971, and SEN2426, SEN3065genes, and SEN2426 encoding genes oxidoreductase encoding oxidoreductaseenzymes. All serovars enzymes. showed All serovars positive showed amplification positive of amplification each gene, suggesting of each gene, that sug- these gestinggenes arethat present these genes within are the present genome within of each the serovar genome (Figure of each S2). serovar It is currently (Figure unknown S2). It is if currentlythe differential unknown growth if the in differential TYR supplemented growth in media TYR supplemented is due to the differential media is due expression to the differentialof these genes expression or the of differential these genes ability or the ofdifferential these serovars ability toof these degrade serovars , to degrade in acetaldehyde,which the rate in of acetaldehydewhich the rate synthesis of acetal maydehyde exceed thesynthesis rate of acetaldehydemay exceed consumptionthe rate of leading to toxic effects in some serotypes [23]. Despite some differences in the growth rates, these results show that all serotypes tested in this study can grow by utilizing TYR as a sole energy source.

Pathogens 2021, 10, x FOR PEER REVIEW 7 of 19

Pathogens 2021, 10, 469acetaldehyde consumption leading to toxic effects in some serotypes [23]. Despite some 7 of 18 differences in the growth rates, these results show that all serotypes tested in this study can grow by utilizing TYR as a sole energy source.

Figure 5. Growth kinetics of the twelve clinically significant NTS serotypes in the presence of TYR as a sole energy source. S. EnteritidisFigure str. 1 and 5. GrowthS. Montevideo kinetics str.of the 2 served twelve as clinically controls. significant NTS serotypes in the presence of TYR as a sole energy source. S. Enteritidis str. 1 and S. Montevideo str. 2 served as controls. 2.5. Phenelzine Inhibits the Ability of NTS to Utilize TYR as a Sole Energy Source in a 2.5. PhenelzineSerotype-Independent Inhibits the Ability of MannerNTS to Utilize TYR as a Sole Energy Source in a Serotype- Independent MannerGiven that all Salmonella serotypes tested in this study utilize TYR as a sole source Given thatof all energy Salmonella for growth serotypes and thattested all in serotypes this study carry utilizeSEN2971 TYR as, SEN3065 a sole source, and ofSEN2426 genes energy for growthencoding and oxidoreductasethat all serotypes enzymes, carry SEN2971 we tested, SEN3065 whether, and phenelzine SEN2426 treatment genes inhibits the encoding oxidoreductasegrowth of these enzymes,Salmonella we testedstrains whether when TYR phenelzine is supplemented treatment as inhibits a sole energythe source. In growth of thesethis Salmonella assay, the strains untreated whenSalmonella TYR is supplementedstrains grew with as a a sole Td of energy 9.48 h source. (S. Thompson) In to 4.72 h this assay, the( S.untreatedI 4, 5, 12:I:-) Salmonella (Table 1strains). The grew treatment with witha Td 30of 9.48µM h of (S. phenelzine Thompson) significantly to 4.72 increased h (S. I 4, 5, 12:I:-)the (Table Td ranging 1). The from treatment 13.89 h with (S. Thomson) 30 µM of phenelzine to 14.55 h ( S.significantlyI 4, 5, 12:I:-), increased respectively (Table1). the Td rangingThese from results 13.89 showh (S. Thomson) that phenelzine to 14.55 significantly h (S. I 4, 5, inhibits 12:I:-), the respectively utilization (Table of TYR as an energy 1). These resultssource show in NTSthat phenelzine in a serotype-independent significantly inhibits manner. the utilization of TYR as an energy source in NTS in a serotype-independent manner. Table 1. Doubling time (Td) for the twelve clinically significant NTS serotypes grown in the presence Table 1. Doublingof TYR time as (Td) a sole for energythe twelve source, clinically with significant or without NTS 30 µ Mserotypes of phenelzine. grown in The the Td pres- for each strain was ence of TYR as calculateda sole energy as describedsource, with in Figureor with5.out Asterisks 30 µM of indicate phenelzine. significant The Td difference for each ( strainp < 0.05). S. Enteritidis was calculated str.as described 1 and S. Montevideo in Figure 5. str.Asterisks 2 served indicate as controls. significant difference (p < 0.05). S. Enter- itidis str. 1 and S. Montevideo str. 2 served as controls. Doubling Time (h) Doubling Time (h) TYR TYR + 30 µM of Phenelzine TYR TYR + 30 µM of Phenelzine S. Thompson S. Thompson 9.48 9.48 13.89 * 13.89 * S. Mbandaka S. Mbandaka 9.43 9.43 13.76 * 13.76 * S. Kentucky S. Kentucky 7.89 7.89 13.61 * 13.61 * S. Infantis S. Infantis 8.09 8.09 13.56 * 13.56 * S. HeidelbergS . Heidelberg 4.72 4.72 14.55 * 14.55 * S. Enteritidis S.str.Enteritidis 1 str. 17.45 7.45 13.61 * 13.61 * S. Enteritidis S. Enteritidis 7.26 7.26 14.12 * 14.12 * S. Montevideo 6.88 13.94 * S. Montevideo 6.88 13.94 * S.Montevideo str. 2 6.80 13.83 * S. Montevideo str. 2 6.80 13.83 * S. Hadar 6.29 13.27 * S. Hadar 6.29 13.27 * S. Typhimurium 5.34 13.89 * S. TyphimuriumS. Schwarzengrund 5.34 4.86 13.89 * 13.29 * S. SchwarzengrundS. Seftenberg 4.86 5.00 13.29 * 14.55 * S. Seftenberg S. I 4, 5, 12:I:- 5.00 4.72 14.55 * 14.55 * S. I 4, 5, 12:I:- 4.72 14.55 * * p < 0.05. * p < 0.05.

Pathogens 2021, 10,Pathogens x FOR PEER2021 REVIEW, 10, 469 8 of 19 8 of 18

2.6. Clinically Significant2.6. Clinically NTS Significant Utilize Free-DGA NTS Utilize as a Sole Free-DGA Source asof aEnergy Sole Source for Growth of Energy in a for Growth in a Serotype-IndependentSerotype-Independent Manner Manner Previously, wePreviously, reported that we S. reported Enteritidis that canS. Enteritidis utilize free-DGA can utilize as a free-DGAsole source as of a sole source of energy for growthenergy [11,23]. for growth In this [ 11study,,23]. Inwe this tested study, the we growth tested of the 11 growth additional of 11 additionalNTS sero- NTS serotypes types in M9 containingin M9 containing 1 mM of DGA 1 mM as of a DGAsole source as a sole of energy source for of energygrowth. for In growth.this assay, In this assay, all all the Salmonellathe strainsSalmonella showedstrains growth showed ranging growth from ranging 6.79 fromlog10 6.79(S. Seftenberg) log10 (S. Seftenberg) to 9.38 to 9.38 log10 log10 (S. Typhimurium)(S. Typhimurium) within 24 within h (Figure 24 h 6). (Figure These6 ).data These suggest data suggestthat all thatNTSall serotypes NTS serotypes utilize utilize free-DGAfree-DGA as a sole as source a sole of source energy of for energy growth for in growth a serotype-independent in a serotype-independent manner. manner.

Figure 6. Growth kinetics of twelve clinically significant NTS serotypes in the presence of DGA as a sole energy source. Figure 6. Growth kinetics of twelve clinically significant NTS serotypes in the presence of DGA as S. S. Enteritidisa sole str. 1energy and source.Montevideo S. Enteritidis str. 2 served str. 1 as and controls. S. Montevideo str. 2 served as controls. 2.7. NTS Hydrolyze d-Glucuronide in a Serotype-Dependent Manner 2.7. NTS Hydrolyze d-Glucuronide in a Serotype-Dependent Manner We previously reported that not all NTS serotypes carry GUS operon, thus Salmonella We previously reported that not all NTS serotypes carry GUS operon, thus Salmonella serotypes that carry GUS operon may hydrolyze d-glucuronide resulting in the production serotypes that carry GUS operon may hydrolyze d-glucuronide resulting in the produc- of free-DGA which is then utilized as an energy source for growth [11]. To determine tion of free-DGA which is then utilized as an energy source for growth [11]. To determine the differential ability of NTS serotypes to hydrolyze d-glucuronide, we first performed a the differentialcell-based ability of NTS colorimetric serotypes assay to hydrolyze that measures d-glucuronide, the level of we dissociation first performed of the a d-glucuronide -based colorimetricPNPG (colorless) assay that to measures p-nitrophenol the level (yellow). of dissociation In this assay,of the wed-glucuronide used S. Enteritidis str. 1, PNPG (colorless)which to p-nitrophenol lacks GUS operon, (yellow). and S.In Montevideothis assay, we str. used 2, which S. Enteritidis carries GUS str.operon 1, [11,42] as which lacks GUSreference operon, test and strains S. Montevideo (Table2). str. 2, which carries GUS operon [11,42] as reference test strainsAs (Table expected, 2). p-nitrophenol production was not detected in a reaction containing S. Enteritidis, suggesting that this serotype does not produce GUS and thus cannot hydrolyze Table 2. Salmonellad-glucuronide strains used in PNPG this study. (Figure 7a). In contrast, a significantly ( p < 0.05) high amount of Strain p-nitrophenol was detectedStrains Used in a reactionPheno- containing S. Montevideo, suggesting that S. Mon- Salmonella Serotype AMR Pattern Reference Number tevideo produces GUSin the and Study therefore type this serotype can efficiently hydrolyze d-glucuronide Allard et al., SPNPG. Enteritidis (Figure str. 7a). Next,WT we and tested the ability of the S. Enteritidis str. 1 and S. Montevideo str. 1 GUS- N/A 2013; Elder et al., CDC_2010K_09682 to hydrolyze p-AcetamidophenylΔSEN2971 β-d-glucuronide sodium salt (d-glucuronide AA-Gluc) as an energy source for growth. d-glucuronide AA-Gluc was chosen2018 for the growth assay S. Montevideo str. Harhay et al., 2 because the hydrolysisWT of d-glucuronideGUS+ PNPG usedN/A in the cell-based colorimetric assay USDA_ARS_USMARC-1921 2017 releases p-nitrophenol, a compound that inhibits bacterial growth (data not shown). For 3 S. Thompson WT GUS- ACSSuTSxtAmcCaz Shah et al., 2017 S. S. 4 theS. Mbandaka growth assay, Enteritidis WT str. GUS- 1 and ACSSuTAmcCazKMontevideo str. Shah 2 were et al., cultured 2017 for 24 h in 5 M9S. Kentucky containing 1 mM of WT d-glucuronide GUS- AA-Gluc AAmcCCipKNalSSxtT as a sole energy Shah source. et al., 2017 As expected, the 6 growthS. Infantis of S. Montevideo WT was significantly GUS- ACGSSuTSxtAmcCaz (p < 0.05) higher (4.82 Shah log et al.,10 with2017 a Td of 2.41 h) 7 whenS. Heidelberg compared with S. WTEnteritidis GUS- (0.56 ACSSuTSxtAmcNalCazlog10 with a doubling Shah time et al., of 2017 5.98 h) (Figure7b), 8 indicatingS. Enteritidis that the lack WT of S. Enteritidis GUS- growth ACKSSuTSxtAmcCaz in this assay is Shah due et to al., the 2017 lack of GUS. We 9 thenS. Hadar tested the growth of WT twelve clinically GUS- significant ACKSSuTAmc NTS serotypes Shah et in al., M9 2017 containing 1 mM of d-glucuronide AA-Gluc as a sole energy source. Two serotypes, S. Schwarzengrund

Pathogens 2021, 10, 469 9 of 18

Pathogens 2021, 10, x FOR PEER REVIEW 9 of 19 (3.93 log10) and S. Montevideo (5.07 log10) grew at levels similar to that of the GUS pro- ducing S. Montevideo str. 2 (5.28 log10) (Figure7c). However, all other NTS serotypes showed significant growth defects, suggesting that due to the lack of GUS these serotypes ACKSSuTSxtAmcNal- 10 cannotS. Typhimurium scavenge free-DGA WT via hydrolysis GUS- of d-glucuronide AA-Gluc.Shah et al., 2017 Collectively, these data show that NTS differ in their ability to hydrolyzeCaz d-glucuronide, and, as a result, show 11 a differentialS. I4,4,5,12:I:- ability to scavenge WT energy GUS- from ACSSuTAmcCaz d-glucuronide for Shah growth. et al., 2017 12 S. Seftenberg WT GUS- AKSSuTAmcCaz Shah et al., 2017 13 S. Schwarzengrund WT GUS+ ACKSSuTSxt Shah et al., 2017 Table 2. Salmonella strains used in this study. 14 S. Montevideo WT GUS+ ASSuTSxt Shah et al., 2017 Strain Strains Used in Salmonella Serotype Phenotype AMR Pattern Reference Number As expected, p-nitrophenolthe Studyproduction was not detected in a reaction containing S. Enteritidis, suggesting that this serotype does not produce GUS and thus cannot hydro- S. Enteritidis str. Allard et al., 2013; 1 WT and ∆SEN2971 GUS- N/A CDC_2010K_0968lyze d-glucuronide PNPG (Figure 7a). In contrast, a significantly (p < 0.05) high amountElder et al., 2018 of p-nitrophenol was detected in a reaction containing S. Montevideo, suggesting that S. S. Montevideo str. 2 Montevideo produces GUS and WTtherefore this serotype GUS+ can efficiently N/A hydrolyze d-glucu- Harhay et al., 2017 USDA_ARS_USMARC-1921 ronide PNPG (Figure 7a). Next, we tested the ability of the S. Enteritidis str. 1 and S. Mon- 3 tevideoS. Thompson str. 2 to hydrolyze p-Acetamidophenyl WT GUS-β-d-glucuronide ACSSuTSxtAmcCaz sodium salt (d-glucu- Shah et al., 2017 4 ronideS. Mbandaka AA-Gluc) as an energy source WT for growth. GUS- d-glucuronide ACSSuTAmcCazK AA-Gluc was chosen for Shah et al., 2017 the growth assay because the hydrolysis of d-glucuronide PNPG used in the cell-based 5 S. Kentucky WT GUS- AAmcCCipKNalSSxtT Shah et al., 2017 colorimetric assay releases p-nitrophenol, a compound that inhibits bacterial growth (data 6 notS shown).. Infantis For the growth assay, WT S. Enteritidis GUS-str. 1 and S. ACGSSuTSxtAmcCazMontevideo str. 2 were cul- Shah et al., 2017 7 turedS. Heidelberg for 24 h in M9 containing 1 WT mM of d-glucuronide GUS- AA-Gluc ACSSuTSxtAmcNalCaz as a sole energy source. Shah et al., 2017 8 AsS .expected, Enteritidis the growth of S. Montevideo WT was GUS-significantly ACKSSuTSxtAmcCaz (p < 0.05) higher (4.82 log Shah10 et al., 2017 with a Td of 2.41 h) when compared with S. Enteritidis (0.56 log10 with a doubling time of 9 S. Hadar WT GUS- ACKSSuTAmc Shah et al., 2017 5.98 h) (Figure 7b), indicating that the lack of S. Enteritidis growth in this assay is due to 10 Sthe. Typhimurium lack of GUS. We then tested WTthe growth of twelve GUS- clinicallyACKSSuTSxtAmcNalCaz significant NTS serotypesShah et al., 2017 11 inS M9. I4,4,5,12:I:- containing 1 mM of d-glucuronide WT AA-Gluc GUS- as a sole energy ACSSuTAmcCaz source. Two serotypes, Shah et al., 2017 S. Schwarzengrund (3.93 log10) and S. Montevideo (5.07 log10) grew at levels similar to that 12 S. Seftenberg WT GUS- AKSSuTAmcCaz Shah et al., 2017 of the GUS producing S. Montevideo str. 2 (5.28 log10) (Figure 7c). However, all other NTS 13 S.serotypes Schwarzengrund showed significant growth WT defects, suggesting GUS+ that due ACKSSuTSxtto the lack of GUS these Shah et al., 2017 14 serotypesS. Montevideo cannot scavenge free-DGA WT via hydrolysis GUS+ of d-glucuronide ASSuTSxt AA-Gluc. Collec- Shah et al., 2017 tively, these data show that NTS differ in their ability to hydrolyze d-glucuronide, and, as a result, show a differential ability to scavenge energy from d-glucuronide for growth.

Figure 7. DifferentialFigure 7. ability Differential of NTS ability serotypes of NTS to serotypes hydrolyze to hydrolyze d-glucuronide d-glucuronide detected detected through through a cell-based a cell- colorimetric assay (a) and growthbased colorimetric kinetics assays assay (b ,(ca).) and Asterisks growth indicate kinetics significantassays (b,c). differences Asterisks indicate (p < 0.05). significantS. Enteritidis differ- str. 1 and S. Montevideo str.ences 2 served (p < as0.05). controls. S. Enteritidis str. 1 and S. Montevideo str. 2 served as controls.

Pathogens 2021, 10, 469 10 of 18

2.8. Amoxapine Inhibits the GUS-Mediated Hydrolysis of d-Glucuronide PNPG by S. Montevideo Amoxapine is a of the dibenzoxazepine class which has been reported to exhibit broad-spectrum inhibitory activity against bacterial GUS including E. coli [31,34]. Therefore, we tested whether GUS-mediated hydrolysis of d-glucuronide PNPG by S. Montevideo can also be inhibited by amoxapine. In the case of S. Montevideo, the GUS mediated hydrolysis of d-glucuronide PNPG was inhibited by amoxapine in a concentration-dependent manner with the highest inhibitory activity detected at con- centrations of ≥10 µM (Figure8a). A GUS-negative S. Enteritidis str. 1 was used as a control in this assay. As expected, the GUS activity was not detected in S. Enteritidis at any concentration of amoxapine used (Figure8a). A purified β-glucuronidase from E. coli was also used as a comparison in the colorimetric assay. E. coli GUS revealed a strong activity (OD450 = 0.637) which was completely inhibited by 50 µM of amoxapine (Figure8b). Cell survivability was also assessed by plating 10-fold dilutions of the cultures treated with varying concentrations of amoxapine (1 µM to 100 µM). At 10 µM of amoxapine, the sur- vivability of S. Enteritidis and S. Montevideo was 100% and 94%, respectively (Figure8c). To rule out the off-target effects of amoxapine at 10 µM concentration, we tested the growth of S. Enteritidis and S. Montevideo in the presence of free-DGA as a sole source of energy with or without the addition of 10 µM of amoxapine. There was no significant difference in the overall growth or the Td of either serotype in the presence or absence of amoxapine when free-DGA was supplemented as an energy source (Figure8d). Collectively, these data show that 10µM of amoxapine specifically blocks the hydrolysis of d-glucuronide by S. Montevideo, thereby reducing the availability of free-DGA for the propagation of S. Montevideo without showing toxicity to the bacterial cells. The EC50 of amoxapine for S. Montevideo was 2.1 µM (Figure8e). The EC 50 of amoxapine for S. Montevideo in this study was higher when compared with the previously reported EC50 of amoxapine for E. coli GUS (EC50 ranging from 58.5 nM to 119 nM) [31,34]. This is likely due to the differences in the assay conditions. For instance, the concentration of d-glucuronide (1 mM) used in this study was significantly higher when compared with the concentrations used for E. coli (125 µM) in the published studies. Moreover, we incubated the assay for an overnight period, whereas, in other studies, the assay incubation time varied from 2 to 6 h [31,34]. Despite these differences, our data clearly shows that amoxapine can efficiently inhibit GUS-mediated hydrolysis of d-glucuronide PNPG by S. Montevideo.

2.9. Amoxapine Inhibits the Ability of GUS-Positive NTS Serotypes to Hydrolyze d-Glucuronide AA-Gluc in a Serotype-Independent Manner Here, we tested if amoxapine can also inhibit the ability of other GUS-positive serotypes such as S. Schwarzengrund to hydrolyze d-glucuronide AA-Gluc. To accomplish this, S. Schwarzengrund was grown for 24 h in M9 containing 1 mM of d-glucuronide AA-Gluc with or without the addition of 10 µM of amoxapine. For comparison, we in- cluded GUS-positive control S. Montevideo str. 2 and an additional strain of S. Montevideo str. 27002. In the presence of amoxapine, the growth of S. Schwarzengrund (1.54 log10 with Td of 4.45 h) and S. Montevideo str. 27002 (1.07 log10 with Td of 5.09 h) was signifi- cantly (p < 0.05) impaired when compared with their counterparts grown in the absence of amoxapine (Figure9). Similarly, significant impairment in growth was observed for the S. Montevideo str. 2 used as control (1.52 log10 with Td of 4.53 h). These results show that both serotypes can hydrolyze d-glucuronide AA-Gluc and thereby release free-DGA, which is used as a sole energy source for growth. The addition of amoxapine inhibits GUS-mediated hydrolysis of d-glucuronide AA-Gluc by GUS-positive serotypes, thereby limiting the availability of free-DGA as an energy source for their growth, resulting in significant growth defects. Pathogens 2021, 10, 469 11 of 18 Pathogens 2021, 10, x FOR PEER REVIEW 11 of 19

Pathogens 2021, 10, x FOR PEER REVIEW 12 of 19 Figure 8. AmoxapineFigure 8 inhibits. Amoxapine GUS-mediated inhibits GUS-mediated hydrolysis hydr of d-glucuronideolysis of d-glucuronide PNPG byPNPGSalmonella by Salmonella(a–d) ( anda– E. coli (e). d) and E. coli (e).

2.9. Amoxapine Inhibits the Ability of GUS-Positive NTS Serotypes to Hydrolyze d-Glucuronide AA-Gluc in a Serotype-Independent Manner Here, we tested if amoxapine can also inhibit the ability of other GUS-positive sero- types such as S. Schwarzengrund to hydrolyze d-glucuronide AA-Gluc. To accomplish this, S. Schwarzengrund was grown for 24 h in M9 containing 1 mM of d-glucuronide AA- Gluc with or without the addition of 10 µM of amoxapine. For comparison, we included GUS-positive control S. Montevideo str. 2 and an additional strain of S. Montevideo str. 27002. In the presence of amoxapine, the growth of S. Schwarzengrund (1.54 log10 with Td of 4.45 h) and S. Montevideo str. 27002 (1.07 log10 with Td of 5.09 h) was significantly (p < 0.05) impaired when compared with their counterparts grown in the absence of amoxap- ine (Figure 9). Similarly, significant impairment in growth was observed for the S. Mon- tevideo str. 2 used as control (1.52 log10 with Td of 4.53 h). These results show that both serotypes can hydrolyze d-glucuronide AA-Gluc and thereby release free-DGA, which is used as a sole energy source for growth. The addition of amoxapine inhibits GUS-medi- ated hydrolysis of d-glucuronide AA-Gluc by GUS-positive serotypes, thereby limiting FigureFigure 9. 9. AmoxapineAmoxapine inhibits inhibits GUS-mediated GUS-mediated hydrolysis hydrolysis of d-glucuronide of d-glucuronide AA-Gluc AA-Gluc by GUS-posi- by GUS-positive the availability of free-DGA as an energy source for their growth, resulting in significant tiveserotypes, serotypes, thereby thereby limiting limiting thethe availability of of free-DGA free-DGA as an as energy an energy source source for growth. for growth. Aster- Asterisks growth defects. isksindicate indicate significant significant difference difference ( p(p< < 0.05).0.05). Td, Td, duplication duplication time. time.

2.10.2.10. Combination Combination of Phenelzine of Phenelzine and andAmoxapine Amoxapine Inhibits Inhibits the Ability the Abilityof NTS Serotypes of NTS Serotypes to Derive to Derive Energy for for Growth Growth from from D-Glucuronide D-Glucuronide and TYR and TYR ConsideringConsidering that that TYR TYR and and d-glucuronide d-glucuronide are both are present both present in the GI in tract the GIand tract can be and can be concurrentlyconcurrently utilized utilized by Salmonella by Salmonella as energyas energy sources sources for growth, for growth,we tested wethe testedgrowth theof growth Salmonellaof Salmonella underunder similar similar conditions. conditions. For this assay, For thisS. Montevideo assay, S. Montevideostr. 2 (GUS+), S. str. Typhi- 2 (GUS+), S. murium_22711Typhimurium_22711 (GUS-), (GUS-),and S. Enteritidis and S. Enteritidis str. 1 (GUS-) str. strains 1 (GUS-) werestrains grown in were medium grown sup- in medium plemented with both micronutrients, TYR and AA-Gluc, with or without the combination supplemented with both micronutrients, TYR and AA-Gluc, with or without the combi- of phenelzine and amoxapine. As expected, in the absence of inhibitors, all three strains nation of phenelzine and amoxapine. As expected, in the absence of inhibitors, all three grew up to 5.56 (S. Montevideo), 3.87 (S. Typhimurium), and 1.54 (S. Enteritidis) log10 with astrains doubling grew time up of to 4.47, 5.56 5.33, (S. Montevideo), and 9.04 h, respectively 3.87 (S. Typhimurium), (Figure 10). When and treated 1.54 ( S.withEnteritidis) phenelzinelog10 with alone a doubling (30 µM), time the ofgrowth 4.47, 5.33,of S. Typhimurium and 9.04 h, respectively and S. Enteritidis (Figure was 10 ).signifi- When treated cantlywith phenelzineimpaired because alone these (30 serotypesµM), the can growth only utilize of S. TYRTyphimurium as an energy and sourceS. (FigureEnteritidis was 10b,c).significantly In contrast, impaired treatment because with phenelzine these serotypes (30 µM) canalone only did utilizenot negatively TYR as impact an energy the source growth of S. Montevideo because this serotype is also able to hydrolyze d-glucuronide AA-Gluc and, as a result, can utilize the free-DGA as an energy source for growth (Figure 10a). Interestingly, the addition of amoxapine (10 µM) alone significantly reduced the growth of S. Montevideo. This was an unexpected result considering that amoxapine is a GUS inhibitor, thus S. Montevideo should still be able to efficiently utilize TYR as an en- ergy source for growth in this assay. The underlying mechanism for this phenotype is currently unknown; however, it has been reported that supplementation of TYR with other preferred sources of carbon such as glucose can repress TYR oxidoreductase TynA in E. coli [22]. Moreover, tynA promoters can be induced when TYR was added in condi- tions containing a non-preferred carbon source (e.g., glycerol). Thus, it is possible that, in the culture conditions used in this study, AA-Gluc likely serve as preferred carbon source resulting in repression of TYR oxidoreductases leading to impaired growth of S. Monte- video. On the other hand, amoxapine does not significantly impair the growth of S. Typhi- murium (1.09 log10 and Td:8.12 h) and S. Enteritidis (1.96 log10 and Td:10.31 h) since these serotypes do not carry GUS but are still capable of activating the TYR oxidoreductases to metabolize TYR. Finally, the combination of amoxapine and phenelzine completely inhib- its the growth of Salmonella when TYR and AA-Gluc are used as sources of energy for growth (Figure 10a–c), suggesting that phenelzine efficiently inhibits consumption of TYR and amoxapine reduce the availability of free-DGA utilized by Salmonella for propagation in vitro. Overall, the findings of this study should serve as the foundation for the testing combination of phenelzine and amoxapine in vivo, which could potentially be utilized as an anti-nutritional strategy to inhibit the propagation of Salmonella in the host.

Pathogens 2021, 10, 469 12 of 18

(Figure 10b,c). In contrast, treatment with phenelzine (30 µM) alone did not negatively impact the growth of S. Montevideo because this serotype is also able to hydrolyze d- glucuronide AA-Gluc and, as a result, can utilize the free-DGA as an energy source for growth (Figure 10a). Interestingly, the addition of amoxapine (10 µM) alone significantly reduced the growth of S. Montevideo. This was an unexpected result considering that amoxapine is a GUS inhibitor, thus S. Montevideo should still be able to efficiently utilize TYR as an energy source for growth in this assay. The underlying mechanism for this phenotype is currently unknown; however, it has been reported that supplementation of TYR with other preferred sources of carbon such as glucose can repress TYR oxidoreductase TynA in E. coli [22]. Moreover, tynA promoters can be induced when TYR was added in conditions containing a non-preferred carbon source (e.g., glycerol). Thus, it is possible that, in the culture conditions used in this study, AA-Gluc likely serve as preferred carbon source resulting in repression of TYR oxidoreductases leading to impaired growth of S. Montevideo. On the other hand, amoxapine does not significantly impair the growth of S. Typhimurium (1.09 log10 and Td:8.12 h) and S. Enteritidis (1.96 log10 and Td:10.31 h) since these serotypes do not carry GUS but are still capable of activating the TYR oxidoreduc- tases to metabolize TYR. Finally, the combination of amoxapine and phenelzine completely inhibits the growth of Salmonella when TYR and AA-Gluc are used as sources of energy for growth (Figure 10a–c), suggesting that phenelzine efficiently inhibits consumption of TYR and amoxapine reduce the availability of free-DGA utilized by Salmonella for propagation in vitro. Overall, the findings of this study should serve as the foundation for the testing Pathogens 2021, 10, x FOR PEER REVIEW 13 of 19 combination of phenelzine and amoxapine in vivo, which could potentially be utilized as an anti-nutritional strategy to inhibit the propagation of Salmonella in the host.

FigureFigure 10. 10. UseUse of phenelzine, of phenelzine, amoxapine, amoxapine, and the comb andination the combination thereof to inhibit thereof the growth to inhibit of S. the growth of S. Montevideo (a), S. Typhimurium (b), and S. Enteritidis (c) in the presence of TYR and d-glucu- ronideMontevideo AA-Gluc. (a ), S. Typhimurium (b), and S. Enteritidis (c) in the presence of TYR and d-glucuronide AA-Gluc. 3. Materials and Methods 3.1. Bacterial Strains According to CDC, except S. Kentucky, all other Salmonella serotypes used in this study (Table 2) are identified as the most clinically significant serotypes associated with food-borne illness in the USA [40,41]. Unless otherwise specified, frozen stocks of these Salmonella strains were cultured on Luria–Bertani (LB) agar at 37 °C for 16 h. From each agar plate, a single colony was selected and then inoculated in 5 mL of minimal salt media (M9) containing 20 mM of glucose, followed by incubation at 37 °C for 16 h with shaking at 180 rpm [11,43]. Aliquots (1 mL) from the overnight culture were washed three times with M9 salts. A starting inoculum of ~200 CFU was prepared by serial 10-fold dilution in M9 medium.

3.2. Cloning, Expression, and Purification of Recombinant SEN2971, SEN3065, and SEN2426 The open reading frames encoding putative oxidoreductases SEN2971, SEN3065, and SEN2426 were amplified from the genomic DNA extracted from S. Enteritidis str. CDC_2010K_0968, using the primers listed in Table 3 and the 2X Platinum SuperFi master mix (Invitrogen, Waltham, MA, USA) following the manufacturer’s instructions (Figure S2). Thermal cycling conditions on an iCycler (Bio-Rad, Hercules, CA, USA) included 1

Pathogens 2021, 10, 469 13 of 18

3. Materials and Methods 3.1. Bacterial Strains According to CDC, except S. Kentucky, all other Salmonella serotypes used in this study (Table2) are identified as the most clinically significant serotypes associated with food-borne illness in the USA [40,41]. Unless otherwise specified, frozen stocks of these Salmonella strains were cultured on Luria–Bertani (LB) agar at 37 ◦C for 16 h. From each agar plate, a single colony was selected and then inoculated in 5 mL of minimal salt media (M9) containing 20 mM of glucose, followed by incubation at 37 ◦C for 16 h with shaking at 180 rpm [11,43]. Aliquots (1 mL) from the overnight culture were washed three times with M9 salts. A starting inoculum of ~200 CFU was prepared by serial 10-fold dilution in M9 medium.

3.2. Cloning, Expression, and Purification of Recombinant SEN2971, SEN3065, and SEN2426 The open reading frames encoding putative oxidoreductases SEN2971, SEN3065, and SEN2426 were amplified from the genomic DNA extracted from S. Enteritidis str. CDC_2010K_0968, using the primers listed in Table3 and the 2X Platinum SuperFi master mix (Invitrogen, Waltham, MA, USA) following the manufacturer’s instructions (Figure S2). Thermal cycling conditions on an iCycler (Bio-Rad, Hercules, CA, USA) included 1 cy- cle at 98 ◦C for 30 s, 30 cycles at 98 ◦C for 10 s, 58 ◦C for 10 s, 72 ◦C for 30 s, and 1 cycle of 72 ◦C for 5 min. The PCR products were purified with GeneJet PCR purifica- tion Kit (ThermoFisher Scientific, Waltham, MA, USA) followed by ligation into pET-100 Directional-TOPO (Invitrogen) according to the manufacturer’s protocol. The recombinant plasmids (pET100::SEN2971, pET100::SEN3065, and pET100::SEN2426) were used to trans- form TOP10 chemically competent cells (Invitrogen). The transformed TOP10 cells were plated into LB agar containing 100 µg/mL of carbenicillin and incubated overnight at 37 ◦C. The transformants were screened for the presence of the recombinant plasmid using gene- specific PCR as described above (Table3). After confirmation, the recombinant plasmids (pET100::SEN2971, pET100::SEN3065, and pET100::SEN2426) were extracted with GeneJET Plasmid Miniprep Kit following the manufacturer’s instructions (ThermoFisher Scientific).

Table 3. Primers.

Gene Primers Sequence 50 to 30 Product Size (bp) RA01clonSEN2971Fw CACCATGAATACAAAAATCGAT SEN2971 1302 RA01clonSEN2971Rv TTAATTCCGGCCTTTCCAG RA04clonSEN3065Fw CACCATGATACGTTTCGCTGTA SEN3065 999 RA04clonSEN3065Rv TTACGCAGTAAGGGGATGA RA03clonSEN2426Fw CACCATGGGTAAACTCACGGGC SEN2426 792 RA03clonSEN2426Rv TCAGACGCCTACGCTTACG

For recombinant protein expression, BL21*DE3 cells (Invitrogen) were transformed with each of the purified recombinant plasmids (pET100::SEN2971, pET100::SEN3065, and pET100::SEN2426). The transformation reaction was transferred to 10 mL of LB broth containing carbenicillin (100 µg/mL) and incubated overnight at 37 ◦C with shaking (200 rpm). Next, 200 mL of LB broth was inoculated with 4 mL of the overnight culture and then allowed to grow to mid-log phase for approximately 1.5 h at 37 ◦C with shaking. The recombinant protein expression was induced by the addition of 0.5 mM of IPTG followed by overnight incubation at 20 ◦C with shaking. The induced culture was centrifuged at 4600 rpm for 15 min and the cell pellets were stored at −80 ◦C until further use. The cell pellet was resuspended with 8 mL of 1× native binding buffer containing 8 mg of (ThermoFisher Scientific) and incubated on ice for 30 min. Subsequently, the cells were lysed by 3 freezing (liquid nitrogen) and thawing (42 ◦C) cycles and then centrifuged at 3000 g for 15 min. The recombinant proteins were purified from the supernatant using ProBond Purification System (ThermoFisher Scientific) following the manufacturer’s instructions. Pathogens 2021, 10, 469 14 of 18

The purified proteins were eluted in the native elution buffer, evaluated by SDS-PAGE (Figure S2), and stored at 4 ◦C until further use.

3.3. Determination of Oxidoreductase Activity of Recombinant SEN2971, SEN3065, and SEN2426 3.3.1. Radiometric Assay The oxidoreductase activity of recombinant SEN2971, SEN3065, and SEN2426 was measured by a radiometric assay using [ring-3, 5-3H]-tyramine hydrochloride (American Radiolabeled Chemicals, St. Louis, MO, USA, Catalog # ART 0425). The reaction buffer consisted of the following: 50 mM of monosodium phosphate, pH 7.5, 10 µM of nonra- dioactive tyramine hydrochloride (Sigma-Aldrich, St. Louis, MO, USA), and 0.051 nM of [ring-3, 5-3H]-tyramine hydrochloride, with or without 100 µM of phenelzine (Sigma- Aldrich, USA, Catalog # CDS015167). The reaction started by adding 100 µl of the purified proteins, and the mixture was kept at room temperature for 1 h. The deaminated products were extracted with 1 mL of toluene (Sigma-Aldrich), shaken vigorously for 5 min, and centrifuged at 5000× g for 5 min. The toluene layer (0.9 mL) was then transferred to a counting vial and mixed with 5 mL of the liquid scintillation cocktail Ecoscint-O (National Diagnostics, Atlanta, GA, USA). The oxidoreductase activity of the purified proteins was detected through the rate of ionization events per min or counts per min (CPM) using a Tri-Carb 2900TR liquid scintillation analyzer (PerkinElmer, Seattle, WA, USA). The data were normalized against the CPM obtained from the negative control reaction (without enzyme and radiolabeled TYR). Each protein was tested in three independent experiments and the data was statistically analyzed using two-way ANOVA with Dunnett’s posthoc.

3.3.2. Colorimetric Assay The oxidoreductase activity of recombinant SEN2971, SEN3065, and SEN2426 was also measured by the colorimetric Amplex™ Red Monoamine Oxidase Assay Kit (ThermoFisher, Waltham, MA, USA) following the manufacturer’s instructions. Briefly, the reaction was conducted in 96-well clear-bottom plates (Evergreen Sci., Vernon, CA, USA, Catalog #222- 8050) and consisted of 100 µL of each purified protein and 100 µL of the assay buffer. In this assay, TYR is used as a substrate, and the oxidoreductase activity of the purified proteins is determined quantitatively by detection of the oxidoreductase-dependent formation of H2O2, which is measured as the change in absorbance at 562 nm using the EL808 plate reader (BioTek, Winooski, VT, USA). Differential inhibition of oxidoreductase activity of each recombinant protein for TYR was achieved by the addition of clorgyline as MAO-A inhibitor or pargyline as MAO-B inhibitor at a final concentration of 100 µM each. The controls included wells with H2O2 (positive control) or without the purified proteins (negative control). The data were normalized against the OD562 obtained from the negative control. Each protein was tested in three independent experiments and the data were analyzed using two-way ANOVA with Dunnett’s posthoc.

3.4. Cell-Based Oxidoreductase Inhibition Assays For this assay, a starting inoculum of ~200 CFU of each Salmonella strain (Table2) was added to the 2 mL of M9 (without NH4Cl) containing 5mM of TYR, with or without 30 µM of phenelzine, in 96-well blocks and incubated at 37 ◦C for 48 h without shaking. For controls, growth in M9 (with NH4Cl) containing 20 mM of glucose, with or without 30 µM of phenelzine, was used to evaluate the cytotoxicity of phenelzine. Each strain was tested in triplicates in 3 independent experiments. The colony-forming units (CFU) were enumerated at 24 h and 48 h, transformed to log10, and the data were analyzed by one-way ANOVA with Dunnett’s posthoc.

3.5. Cell-Based GUS Activity and Inhibition Assays GUS activity of Salmonella was determined in a cell-based colorimetric assay by quantitative monitoring the release of p-nitrophenol from 4-Nitrophenyl β-d-glucuronide Pathogens 2021, 10, 469 15 of 18

(PNPG, Sigma-Aldrich, Catalog #N1627), a standard in vitro GUS assay substrate. It is expected that only Salmonella strains that express GUS can hydrolyze PNPG. To determine the GUS activity, a single colony of S. Enteritidis str. 1 (GUS-negative serotype) or S. Montevideo str. 2 (GUS-positive serotype) was inoculated in 5 mL of LB broth, followed by incubation at 37 ◦C for 16 h with shaking at 180 rpm. In addition, 50 µL of the overnight culture was used to initiate a fresh 5 mL culture in LB followed by incubation at 37 ◦C with shaking at 180 rpm until an OD600 of 0.6 was achieved. The cultures were then washed twice with 50 mM of HEPES (pH 7.4) and concentrated by centrifugation to an OD600 of 1. The reaction consisted of 40 µL of the bacterial cells (~3.2 × 107), 20 µL of assay buffer (50 mM of HEPES and 1% DMSO), and 40 µL of 2.5 mM of PNPG (final concentration of 1 mM). As a control, 40 µL (a final concentration of 5 nM) of purified GUS encoded by E. coli (G8420-25KU, Sigma-Aldrich, USA) was also included in the reaction for comparison. To determine the EC50 of amoxapine (Sigma-Aldrich, Catalog #A129), 20 µL of the assay buffer containing amoxapine was added to achieve five different concentrations (1, 5, 10, 50, and 100 µM). Additional controls included wells without PNPG (background, 0% activity) and wells without amoxapine (100% activity). Plates were incubated overnight at 37 ◦C and the absorbance at 450 nm was measured using an EL808 plate reader (BioTek). The absorbance data were normalized to the background with 0% activity. The EC50 of amoxapine was calculated using nonlinear regression with GraphPad Prism software (GraphPad Software Inc., La Jolla, CA, USA). Cell survivability in the presence of a different concentration of amoxapine was assessed by plating the 10-fold dilutions of the 100 µl of overnight reactions on LB agar followed by incubation for overnight at 37 ◦C and the CFU were counted as described above. These data were used to select an optimal concentration of amoxapine for follow-up cell-based assays to determine the GUS inhibitory activity of amoxapine against different Salmonella serotypes. For the cell-based GUS-inhibitory assays, frozen stocks of Salmonella strains (Table2) were cultured on Luria–Bertani (LB) agar at 37 ◦C for 16 h. A single colony of each strain was inoculated in 5 mL of minimal salt media (M9) containing 20 mM of glucose, followed by incubation at 37 ◦C for 16 h with shaking at 180 rpm [11,43]. Aliquots (1 mL) from the overnight culture were washed three times with M9 salts. A starting inoculum of ~200 CFU was added to the 2 mL of M9 medium containing 1 mM of P-acetamidophenyl β- d-glucuronide sodium salt (AA-Gluc, Santa Cruz Biotechnology, Dallas, TX, USA, Catalog # sc-222105A) with or without 10 µM of amoxapine, followed by incubation at 37 ◦C for 24 h. In this assay, AA-Gluc was used as a substrate because the hydrolysis of d-glucuronide PNPG in the cell-based colorimetric assay releases p-nitrophenol, a compound that can be toxic for bacterial growth (data not shown). Each Salmonella strain was also grown in M9 containing 1 mM of DGA with or without 10 µM of amoxapine to confirm if all the test Salmonella strains can utilize DGA as a sole source of energy for growth and to evaluate the cytotoxicity of amoxapine. Each strain was tested in triplicate in three independent experiments. The CFU was enumerated, transformed to log10, and the data were analyzed by one-way ANOVA with Dunnett’s posthoc.

4. Conclusions In this study, we show that Salmonella scavenges energy for growth from TYR and DGA, in a serotype-independent manner. Three TYR oxidoreductases encoded by the genes SEN2971, SEN3065, and SEN2426 were confirmed to be involved as key enzymes in the first step of TYR oxidation in Salmonella. Among the three TYR oxidoreductases, SEN2971 appears to be most efficient, whereas SEN3065 and SEN2426 are likely less efficient and may serve as alternative oxidoreductases. Our data also show that a few Salmonella serotypes including S. Montevideo and S. Schwarzengrund produce β-glucuronidase (GUS), a key enzyme capable of hydrolyzing d-glucuronide into free-DGA. This mechanism enables these serotypes to hydrolyze D-glucuronides, thereby facilitating the scavenging of free- DGA as energy source for propagation. It is noteworthy that phenelzine (MAO inhibitor) and amoxapine (GUS inhibitor) are used as antidepressant drugs. Antidepressant drugs are Pathogens 2021, 10, 469 16 of 18

being increasingly recognized for their potential anti-microbial activity [43–46]; however, the mechanisms of antimicrobial activity remain poorly understood. Here, we repurposed phenelzine and amoxapine to inhibit the key enzymes committed to the first steps within the TYR and DGA metabolic pathways in Salmonella. Phenelzine significantly blocked the activity of the TYR oxidoreductases SEN2971, SEN3065, and SEN2426, leading to the inability of Salmonella to utilize TYR as an energy source for propagation. Amoxapine significantly blocked GUS-mediated hydrolysis of d-glucuronide, reducing availability of free-DGA used by Salmonella as energy source for propagation. The results also revealed that the combination of phenelzine and amoxapine efficiently inhibits consumption of TYR and DGA simultaneously, thereby inhibiting the growth of Salmonella. Given the potential role of TYR and DGA as an important source of energy for Salmonella growth in vivo, the data and the novel approaches used in this study will open new avenues to investigate the role of TYR and DGA in Salmonella pathogenesis and nutritional virulence in vivo.

Supplementary Materials: The following are available online at https://www.mdpi.com/article/10 .3390/pathogens10040469/s1, Figure S1: SDS-PAGE (12% w/v) of the recombinant SEN2971, SEN3065 and SEN2426. The gel was stained with Coomassie blue solution. Marker, Figure S2: Agarose gel electrophoresis of SEN2971, SEN3065 and SEN2426 PCR products amplified from the Salmonella serotypes used in this study. S. Seftenberg (1), S. Infantis (2), S. Typhimurium (3), S. Mbandaka (4), S. Heidelberg (5), S. I 4, 5, 12:I:- (6), S. Enteritidis (7), S. Hadar (8), S. Thompson (9), S. Kentucky (10), S. Enteritidis str. CDC_2010K_0968 (11), S. Schwarzengrund (12), S. Montevideo (13), S. Montevideo str. USDA_ARS_USMARC-1921 (14) and Negative Control (Neg). Author Contributions: Conceptualization, D.H.S., R.B.; methodology, D.H.S., R.B.; formal analysis, R.B.; investigation, R.B.; resources, D.H.S.; writing—original draft preparation, R.B.; writing—review and editing, D.H.S., R.B.; visualization, D.H.S., R.B.; supervision, D.H.S. Both authors have read and agreed to the published version of the manuscript. Funding: This project was funded in part by Safe Food Initiative, Agricultural Animal Health Program (AAHP) at College of Veterinary Medicine at Washington State University and by USDA National Institute of Food and Agriculture, Grant Number: #1016366. Raquel Burin was supported by CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico), Brazil. Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: Data are contained within the article or Supplementary Materials. Acknowledgments: We thank William Davis, Santanu Bose and Leigh Knodler from Washington State University for the technical discussions during the course of this research. Conflicts of Interest: The authors declare no conflict of interest.

References 1. Cameron, E.; Sperandio, V. Frenemies: Signaling and nutritional integration in pathogen- microbiota-host interactions. Cell Host Microbe 2015, 18, 275–284. [CrossRef] 2. Fabich, A.J.; Jones, S.A.; Chowdhury, F.Z.; Cernosek, A.; Anderson, A.; Smalley, D.; Mchargue, J.W.; Hightower, G.A.; Smith, J.T.; Autieri, S.M.; et al. Comparison of Carbon for Pathogenic and Commensal Escherichia coli Strains in the Mouse Intestine. Infect. Immun. 2008, 76, 1143–1152. [CrossRef][PubMed] 3. Baumler, A.; Sperandio, V. Interactions between the microbiota and pathogenic bacteria in the gut. Nature 2016, 535, 85–93. [CrossRef] 4. Staib, L.; Fuchs, T.M. From food to cell: Nutrient exploitation strategies of enteropathogens. Microbiology 2014, 160, 1020–1039. [CrossRef][PubMed] 5. Khan, C.M.A. The Dynamic Interactions between Salmonella and the Microbiota, within the Challenging Niche of the Gastroin- testinal Tract. Int. Sch. Res. Not. 2014, 2014, 1–23. [CrossRef] 6. Macfarlane, S.; Woodmansey, E.J.; Macfarlane, G.T. Colonization of Mucin by Human Intestinal Bacteria and Establishment of Biofilm Communities in a Two-Stage Continuous Culture System. Appl. Environ. Microbiol. 2005, 71, 7483–7492. [CrossRef] 7. Ng, K.M.; Ferreyra, J.A.; Higginbottom, S.K.; Lynch, J.B.; Kashyap, P.C.; Gopinath, S.; Naidu, N.; Choudhury, B.; Bart, C.; Monack, D.M.; et al. Microbiota-liberated host sugars facilitate post- expansion of enteric pathogens. Nature 2014, 502, 96–99. [CrossRef][PubMed] Pathogens 2021, 10, 469 17 of 18

8. Pacheco, A.R.; Sperandio, V. Enteric Pathogens Exploit the Microbiota-generated Nutritional Environment of the Gut. Microbiol. Spectr. 2016, 3, 1–21. [CrossRef] 9. Rivera-Chaves, F.; Winter, S.E.; Lopez, C.A.; Xavier, M.N.; Winter, M.G.; Nuccio, S.; Russell, J.M.; Laughlin, R.C.; Lawhon, S.D.; Sterzenbach, T.; et al. Salmonella Uses Energy Taxis to Benefit from Intestinal Inflammation. PLoS Pathog. 2013, 9, 1–13. [CrossRef] 10. Steeb, B.; Claudi, B.; Burton, N.A.; Tienz, P.; Schmidt, A.; Farhan, H.; Bumann, D.; Maze, A. Parallel Exploitation of Diverse Host Nutrients Enhances Salmonella Virulence. PLoS Pathog. 2013, 9, 1–16. [CrossRef] 11. Elder, J.R.; Paul, N.C.; Burin, R.; Guard, J.; Shah, D.H. Genomic organization and role of SPI-13 in nutritional fitness of Salmonella. Int. J. Med. Microbiol. 2018, 308, 1043–1052. [CrossRef] 12. Marcobal, A.; Las Rivas, B.D.; Landete, J.M.; Tabera, L.; Ia, M.A.R. Tyramine and Phenylethylamine Biosynthesis by Food Bacteria. Food Sci. Nutr. 2012, 448–467. [CrossRef][PubMed] 13. De Palencia, P.F.; Fernández, M.; Mohedano, M.L.; Ladero, V.; Quevedo, C.; Alvarez, M.A.; López, P. Role of tyramine synthesis by food-borne enterococcus durans in adaptation to the environment. Appl. Environ. Microbiol. 2011, 77, 699–702. [CrossRef] 14. Bargossi, E.; Gardini, F.; Gatto, V.; Montanari, C.; Torriani, S.; Tabanelli, G. The capability of tyramine production and correlation between phenotypic and genetic characteristics of Enterococcus faecium and Enterococcus faecalis strains. Front. Microbiol. 2015, 6, 1–12. [CrossRef][PubMed] 15. Pircher, A.; Bauer, F.; Paulsen, P. Formation of , histamine, and tyramine by bacteria isolated from meat, fermented sausages and . Eur. Food Res. Technol. 2007, 226, 225–231. [CrossRef] 16. Leisner, J.J.; Laursen, B.G.; Prévost, H.; Drider, D.; Dalgaard, P. Carnobacterium: Positive and negative effects in the environment and in foods. FEMS Microbiol. Rev. 2007, 31, 592–613. [CrossRef][PubMed] 17. Sridharan, G.V.; Choi, K.; Klemashevich, C.; Wu, C.; Prabakaran, D.; Pan, L.B.; Steinmeyer, S.; Mueller, C.; Yousofshahi, M.; Alaniz, R.C.; et al. Prediction and quantification of bioactive microbiota metabolites in the mouse gut. Nat. Commun. 2014, 5, 1–13. [CrossRef] 18. Philips, S.R.; Durden, D.A.; Boulton, A. Identification and distribution of p-tyramine in the rat. Can. J. Biochem. 1974, 366–377. [CrossRef] 19. Díaz, E.; Ferrández, A.; Prieto, M.A.; García, J.L. Biodegradation of aromatic compounds by Escherichia coli. Microbiol. Mol. Biol. Rev. 2001, 65, 523–569. [CrossRef] 20. Elovaara, H.; Huusko, T.; Maksimow, M.; Elima, K.; Yegutkin, G.G.; Skurnik, M.; Dobrindt, U.; Siitonen, A.; McPherson, M.J.; Salmi, M.; et al. Primary amine oxidase of Escherichia coli is a metabolic enzyme that can use a human leukocyte molecule as a substrate. PLoS ONE 2015, 10, 1–20. [CrossRef] 21. Rankin, L.D.; Bodenmiller, D.M.; Partridge, J.D.; Nishino, S.F.; Spiro, S. Escherichia coli NsrR Regulates a Pathway for the Oxidation of 3-Nitrotyramine to 4-Hydroxy-3-Nitrophenyllacetate. J. Bacteriol. 2008, 190, 6170–6177. [CrossRef][PubMed] 22. Zeng, J.; Spiro, S. Finely tuned regulation of the aromatic amine degradation pathway in Escherichia coli. J. Bacteriol. 2013, 195, 5141–5150. [CrossRef][PubMed] 23. Burin, R.; Shah, D.H. Global transcriptional profiling of tyramine and D -glucuronic acid catabolism in Salmonella. Int. J. Med. Microbiol. 2020, 310, 151452. [CrossRef] 24. Finberg, J.P.M.; Rabey, J.M.; Gillman, K. Inhibitors of MAO-A and MAO-B in Psychiatry and Neurology. Front. Pharmacol. 2016, 7, 1–15. [CrossRef] 25. Bortolato, M.; Chen, K.; Shih, J.C. Monoamine oxidase inactivation: From pathophysiology to therapeutics. Adv. Drug Deliv. Rev. 2008, 60, 1527–1533. [CrossRef] 26. Rothe, M.; Alpert, C.; Loh, G.; Blaut, M. Novel Insights into E. coli’ s Hexuronate Metabolism: KduI Facilitates the Conversion of Galacturonate and Glucuronate under Osmotic Stress Conditions. PLoS ONE 2013, 8, 1–14. [CrossRef][PubMed] 27. Pellock, S.J.; Redinbo, M.R. Glucuronides in the gut: Sugar-driven symbioses between microbe and host. J. Biol. Chem. 2017, 292, 8569–8576. [CrossRef][PubMed] 28. McDaniels, A.E.; Rice, E.W.; Reyes, A.L.; Johnson, C.H.; Haugland, R.A.; Stelma, J. Erratum: Confirmational identification of Escherichia coli, a comparison of genotypic and phenotypic assays for and β-D- glucuronidase (Applied and Environmental Microbiology (1996) 62:9 (3350- 3354)). Appl. Environ. Microbiol. 1998, 64, 4113. [CrossRef] 29. Feng, P.C.S.; Hartman, P.A. Fluorogenic assays for immediate confirmation of Escherichia coli. Appl. Environ. Microbiol. 1982, 43, 1320–1329. [CrossRef] 30. Chang, G.W.; Brill, J.; Lum, R. Proportion of beta-D-glucuronidase-negative Escherichia coli in human fecal samples. Appl. Environ. Microbiol. 1989, 55, 335–339. [CrossRef] 31. Kong, R.; Liu, T.; Zhu, X.; Ahmad, S.; Williams, A.L.; Phan, A.T.; Zhao, H.; Scott, J.E.; Yeh, L.A.; Wong, S.T.C. Old drug new use—Amoxapine and its metabolites as potent bacterial β-glucuronidase inhibitors for alleviating cancer drug toxicity. Clin. Cancer Res. 2014, 20, 3521–3530. [CrossRef] 32. Wallace, B.D.; Wang, H.; Lane, K.T.; Scott, J.E.; Orans, J.; Koo, S.; Venkatesh, M.; Jobin, C.; Yeh, L.; Mani, S.; et al. Alleviating Cancer Drug Toxicity by Inhibiting a Bacterial Enzyme. Natl. Inst. Health 2011, 330, 831–835. [CrossRef] 33. Wallace, B.D.; Roberts, A.B.; Pollet, R.M.; Mani, S.; Kelly, L.; Redinbo, M.R.; Wallace, B.D.; Roberts, A.B.; Pollet, R.M.; Ingle, J.D.; et al. Structure and Inhibition of Microbiome b-Glucuronidases Essential to the Alleviation of Cancer Drug Toxicity. Chem. Biol. 2015, 22, 1238–1249. [CrossRef] Pathogens 2021, 10, 469 18 of 18

34. Ahmad, S.; Hughes, M.A.; Yeh, L.; Scott, J.E. Potential Repurposing of Known Drugs as Potent Bacterial β -Glucuronidase Inhibitors. J. Biomol. Screen. 2012.[CrossRef][PubMed] 35. Das, S. Functional and Genetic Characterization of Sulfatases in Salmonella Enterica Serovar Typhimurium; University of Wisconsin Milwaukee: Milwaukee, WI, USA, 2014. 36. Murooka, Y.; Harada, T. Regulation of derepressed synthesis of arylsulfatase by tyramine oxidase in Salmonella typhimurium. J. Bacteriol. 1981, 145, 796–802. [CrossRef] 37. Murooka, Y.; Higashiura, T.; Harada, T. Genetic mapping of tyramine oxidase and arylsulfatase genes and their regulation in intergeneric hybrids of enteric bacteria. J. Bacteriol. 1978, 136, 714–722. [CrossRef][PubMed] 38. Roh, J.H.; Suzuki, H.; Azakami, H.; Yamashita, M.; Murooka, Y.; Kumagai, H. Purification, characterization, and crystallization of monoamine oxidase from Escherichia coli K-12. Biosci. Biotechnol. Biochem. 1994, 58, 1652–1656. [CrossRef][PubMed] 39. Sidhu, G.; Marwaha, R. Phenelzine. Available online: https://www.ncbi.nlm.nih.gov/books/NBK554508/ (accessed on 2 November 2020). 40. Shah, D.H.; Paul, N.C.; Sischo, W.C.; Crespo, R.; Guard, J. Population dynamics and antimicrobial resistance of the most prevalent poultry-associated Salmonella serotypes. Poult. Sci. 2017, 96, 687–702. [CrossRef][PubMed] 41. CDC. An Atlas of Salmonella in the United States, 1968–2011; US Department of Health and Human Services, CDC: Atlanta, GA, USA, 2013; Volume 1. 42. Harhay, D.; Smith, T.P.L.; Bono, J.; Wang, R.; Arthur, T.M.; Bosilevac, J.M.; Harhay, G.P. Annotation of the Salmonella enterica subspecies enterica USDA-ARS-USMARC-1921 complete genome. Unpublished work. 2017. 43. da Rosa, T.F.; de Souza Machado, C.; Serafin, M.B.; Bottega, A.; Foletto, V.S.; Coelho, S.S.; Hörner, R. Repositioning or Redirection of Antidepressant Drugs in the Treatment of Bacterial and Fungal . Am. J. Ther. 2020, 27, e528–e532. [CrossRef] [PubMed] 44. Ait Chait, Y.; Mottawea, W.; Tompkins, T.A.; Hammami, R. Unravelling the antimicrobial action of on gut commensal microbes. Sci. Rep. 2020, 10, 17878. [CrossRef] 45. Macedo, D.; Filho, A.J.M.C.; Soares de Sousa, C.N.; Quevedo, J.; Barichello, T.; Júnior, H.V.N.; Freitas de Lucena, D. Antidepres- sants, antimicrobials or both? Gut microbiota dysbiosis in depression and possible implications of the antimicrobial effects of antidepressant drugs for antidepressant effectiveness. J. Affect. Disord. 2017, 208, 22–32. [CrossRef][PubMed] 46. McGovern, A.S.; Hamlin, A.S.; Winter, G. A review of the antimicrobial side of antidepressants and its putative implications on the gut microbiome. Aust. N. Z. J. Psychiatry 2019, 53, 1151–1166. [CrossRef][PubMed]