Product Data Sheet
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Table S1. 49 Histone Variants Were Identified with High Sequence Coverage Through LC-MS/MS Analysis Electronic Supplementary
Electronic Supplementary Material (ESI) for Analytical Methods. This journal is © The Royal Society of Chemistry 2020 Table S1. 49 histone variants were identified with high sequence coverage through LC-MS/MS analysis Sequence Uniprot IDs Protein Name Protein Description Coverage Ratio E2+/E2- RSD P07305 H10_HUMAN 67.5% Histone H1.0 OS=Homo sapiens GN=H1F0 PE=1 SV=3 4.85 23.3% Histone H1.1 OS=Homo sapiens GN=HIST1H1A PE=1 Q02539 H11_HUMAN 74.4% SV=3 0.35 92.6% Histone H1.2 OS=Homo sapiens GN=HIST1H1C PE=1 P16403 H12_HUMAN 67.1% SV=2 0.73 80.6% Histone H1.3 OS=Homo sapiens GN=HIST1H1D PE=1 P16402 H13_HUMAN 63.8% SV=2 0.75 77.7% Histone H1.4 OS=Homo sapiens GN=HIST1H1E PE=1 P10412 H14_HUMAN 69.0% SV=2 0.70 80.3% Histone H1.5 OS=Homo sapiens GN=HIST1H1B PE=1 P16401 H15_HUMAN 79.6% SV=3 0.29 98.3% Testis-specific H1 histone OS=Homo sapiens GN=H1FNT Q75WM6 H1FNT_HUMAN 7.8% \ \ PE=2 SV=3 Histone H1oo OS=Homo sapiens GN=H1FOO PE=2 Q8IZA3 H1FOO_HUMAN 5.2% \ \ SV=1 Histone H1t OS=Homo sapiens GN=HIST1H1T PE=2 P22492 H1T_HUMAN 31.4% SV=4 1.42 65.0% Q92522 H1X_HUMAN 82.6% Histone H1x OS=Homo sapiens GN=H1FX PE=1 SV=1 1.15 33.2% Histone H2A type 1 OS=Homo sapiens GN=HIST1H2AG P0C0S8 H2A1_HUMAN 99.2% PE=1 SV=2 0.57 26.8% Q96QV6 H2A1A_HUMAN 58.0% Histone H2A type 1-A OS=Homo sapiens 0.90 11.2% GN=HIST1H2AA PE=1 SV=3 Histone H2A type 1-B/E OS=Homo sapiens P04908 H2A1B_HUMAN 99.2% GN=HIST1H2AB PE=1 SV=2 0.92 30.2% Histone H2A type 1-C OS=Homo sapiens Q93077 H2A1C_HUMAN 100.0% GN=HIST1H2AC PE=1 SV=3 0.76 27.6% Histone H2A type 1-D OS=Homo sapiens P20671 -
UNIVERSITY of CALIFORNIA, SAN DIEGO Functional Analysis of Sall4
UNIVERSITY OF CALIFORNIA, SAN DIEGO Functional analysis of Sall4 in modulating embryonic stem cell fate A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Molecular Pathology by Pei Jen A. Lee Committee in charge: Professor Steven Briggs, Chair Professor Geoff Rosenfeld, Co-Chair Professor Alexander Hoffmann Professor Randall Johnson Professor Mark Mercola 2009 Copyright Pei Jen A. Lee, 2009 All rights reserved. The dissertation of Pei Jen A. Lee is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Co-Chair ______________________________________________________________ Chair University of California, San Diego 2009 iii Dedicated to my parents, my brother ,and my husband for their love and support iv Table of Contents Signature Page……………………………………………………………………….…iii Dedication…...…………………………………………………………………………..iv Table of Contents……………………………………………………………………….v List of Figures…………………………………………………………………………...vi List of Tables………………………………………………….………………………...ix Curriculum vitae…………………………………………………………………………x Acknowledgement………………………………………………….……….……..…...xi Abstract………………………………………………………………..…………….....xiii Chapter 1 Introduction ..…………………………………………………………………………….1 Chapter 2 Materials and Methods……………………………………………………………..…12 -
Anti-HIST1H1E K51ac Antibody
FOR RESEARCH USE ONLY! 02/20 Anti-HIST1H1E K51ac Antibody CATALOG NO.: A2051-100 (100 µl) BACKGROUND DESCRIPTION: Histones are basic nuclear proteins responsible for nucleosome structure of the chromosomal fiber in eukaryotes. Two molecules of each of the four core histones (H2A, H2B, H3, and H4) form an octamer, around which approximately 146 bp of DNA is wrapped in repeating units, called nucleosomes. The linker histone, H1, interacts with linker DNA between nucleosomes and functions in the compaction of chromatin into higher order structures. This gene is intronless and encodes a replication-dependent histone that is a member of the histone H1 family. Transcripts from this gene lack poly A tails but instead contain a palindromic termination element. This gene is found in the large histone gene cluster on chromosome 6. Histone H1.4 (Histone H1b) (Histone H1s-4), HIST1H1E, H1F4 ALTERNATE NAMES: ANTIBODY TYPE: Polyclonal HOST/ISOTYPE: Rabbit / IgG IMMUNOGEN: Acetylated peptide sequence targeting residues around Lysine 51 of human Histone H1.4 PURIFICATION: Antigen Affinity purified FORM: Liquid FORMULATION: In 0.01 M PBS, pH 7.4, 50% Glycerol, 0.03% proclin 300 SPECIES REACTIVITY: Human STORAGE CONDITIONS: Store at -20ºC. Avoid freeze / thaw cycles. APPLICATIONS AND USAGE: ICC 1:20-1:200, IF 1:50-1:200 This information is only intended as a guide. The optimal dilutions must be determined by the user Immunocytochemistry analysis of HeLa cells using Anti-HIST1H1E K51ac antibody at dilution of 1:100. Immunofluorescent analysis of HeLa cells (treated with sodium butyrate, 30 mM, 4 hrs) using Anti-HIST1H1E K51ac antibody at dilution of 1:100 and Alexa Fluor 488-conjugated Goat Anti-Rabbit IgG (H+L) as secondary antibody. -
Deletions of IKZF1 and SPRED1 Are Associated with Poor Prognosis in A
Leukemia (2014) 28, 302–310 & 2014 Macmillan Publishers Limited All rights reserved 0887-6924/14 www.nature.com/leu ORIGINAL ARTICLE Deletions of IKZF1 and SPRED1 are associated with poor prognosis in a population-based series of pediatric B-cell precursor acute lymphoblastic leukemia diagnosed between 1992 and 2011 L Olsson1, A Castor2, M Behrendtz3, A Biloglav1, E Forestier4, K Paulsson1 and B Johansson1,5 Despite the favorable prognosis of childhood acute lymphoblastic leukemia (ALL), a substantial subset of patients relapses. As this occurs not only in the high risk but also in the standard/intermediate groups, the presently used risk stratification is suboptimal. The underlying mechanisms for treatment failure include the presence of genetic changes causing insensitivity to the therapy administered. To identify relapse-associated aberrations, we performed single-nucleotide polymorphism array analyses of 307 uniformly treated, consecutive pediatric ALL cases accrued during 1992–2011. Recurrent aberrations of 14 genes in patients who subsequently relapsed or had induction failure were detected. Of these, deletions/uniparental isodisomies of ADD3, ATP10A, EBF1, IKZF1, PAN3, RAG1, SPRED1 and TBL1XR1 were significantly more common in B-cell precursor ALL patients who relapsed compared with those remaining in complete remission. In univariate analyses, age (X10 years), white blood cell counts (4100 Â 109/l), t(9;22)(q34;q11), MLL rearrangements, near-haploidy and deletions of ATP10A, IKZF1, SPRED1 and the pseudoautosomal 1 regions on Xp/Yp were significantly associated with decreased 10-year event-free survival, with IKZF1 abnormalities being an independent risk factor in multivariate analysis irrespective of the risk group. Older age and deletions of IKZF1 and SPRED1 were also associated with poor overall survival. -
Gene Ontology Functional Annotations and Pleiotropy
Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question -
ACE2 Gene Variants May Underlie Interindividual Variability and Susceptibility to COVID-19 in the Italian Population
medRxiv preprint doi: https://doi.org/10.1101/2020.04.03.20047977; this version posted June 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. All rights reserved. No reuse allowed without permission. ACE2 gene variants may underlie interindividual variability and susceptibility to COVID-19 in the Italian population ACE2 gene variants in the Italian population Benetti Elisa1 , Tita Rossella2 , Spiga Ottavia3, Ciolfi Andrea4, Birolo Giovanni5, Bruselles Alessandro6, Doddato Gabriella7, Giliberti Annarita7, Marconi Caterina8, Musacchia Francesco9, Pippucci Tommaso10, Torella Annalaura11, Trezza Alfonso3, Valentino Floriana7, Baldassarri Margherita7, Brusco Alfredo5,12, Asselta Rosanna13,14, Bruttini Mirella2,7, Furini Simone1, Seri Marco8,10, Nigro Vincenzo9,11, Matullo Giuseppe5,12, Tartaglia Marco4, Mari Francesca2,7, Renieri Alessandra2,7*, Pinto Anna Maria2 1 Department of Medical Biotechnologies, University of Siena, Siena, Italy 2 Genetica Medica, Azienda Ospedaliera Universitaria Senese, Siena, Italy 3 Dept. of Biotechnology, Chemistry and Pharmacy, University of Siena, Siena, Italy 4 Genetics and Rare Diseases Research Division, Ospedale Pediatrico Bambino Gesù, Rome, Italy 5 Department of Medical Sciences, University of Turin, Turin, Italy 6 Department of Oncology and Molecular Medicine, Istituto Superiore di Sanità, Rome, Italy 7 Medical Genetics, University of Siena, Siena, Italy 8 Department of -
H1 Linker Histones Silence Repetitive Elements by Promoting Both Histone H3K9 Methylation and Chromatin Compaction
H1 linker histones silence repetitive elements by promoting both histone H3K9 methylation and chromatin compaction Sean E. Healtona,1,2, Hugo D. Pintoa,1, Laxmi N. Mishraa, Gregory A. Hamiltona,b, Justin C. Wheata, Kalina Swist-Rosowskac, Nicholas Shukeirc, Yali Doud, Ulrich Steidla, Thomas Jenuweinc, Matthew J. Gamblea,b, and Arthur I. Skoultchia,2 aDepartment of Cell Biology, Albert Einstein College of Medicine, Bronx, NY 10461; bDepartment of Molecular Pharmacology, Albert Einstein College of Medicine, Bronx, NY 10461; cMax Planck Institute of Immunobiology and Epigenetics, Stübeweg 51, Freiburg D-79108, Germany; and dDepartment of Pathology, University of Michigan, Ann Arbor, MI 48109 Edited by Robert G. Roeder, Rockefeller University, New York, NY, and approved May 1, 2020 (received for review December 15, 2019) Nearly 50% of mouse and human genomes are composed of repetitive mechanisms of this regulation have not been fully explored. To sequences. Transcription of these sequences is tightly controlled during further investigate the roles of H1 in epigenetic regulation, we have development to prevent genomic instability, inappropriate gene used CRISPR-Cas9–mediated genome editing to inactivate addi- activation and other maladaptive processes. Here, we demonstrate tional H1 genes in the H1 TKO ES cells and thereby deplete the H1 an integral role for H1 linker histones in silencing repetitive elements in content to even lower levels. mouse embryonic stem cells. Strong H1 depletion causes a profound Nearly 50% of the mouse and human genomes consist of re- de-repression of several classes of repetitive sequences, including major petitive sequences, including tandem repeats, such as satellite se- satellite, LINE-1, and ERV. -
A Bacterial Protein Targets the BAHD1 Chromatin Complex to Stimulate Type III Interferon Response
A bacterial protein targets the BAHD1 chromatin complex to stimulate type III interferon response Alice Lebreton, Goran Lakisic, Viviana Job, Lauriane Fritsch, To Nam Tham, Ana Camejo, Pierre-Jean Matteï, Béatrice Regnault, Marie-Anne Nahori, Didier Cabanes, et al. To cite this version: Alice Lebreton, Goran Lakisic, Viviana Job, Lauriane Fritsch, To Nam Tham, et al.. A bacterial protein targets the BAHD1 chromatin complex to stimulate type III interferon response. Science, American Association for the Advancement of Science, 2011, 331 (6022), pp.1319-21. 10.1126/sci- ence.1200120. cea-00819299 HAL Id: cea-00819299 https://hal-cea.archives-ouvertes.fr/cea-00819299 Submitted on 26 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Lebreton et al. Science 2011 doi:10.1126/science.1200120 A Bacterial Protein Targets the BAHD1 Chromatin Complex to Stimulate Type III Interferon Response Alice Lebreton1,2,3, Goran Lakisic4, Viviana Job5, Lauriane Fritsch6, To Nam Tham1,2,3, Ana Camejo7, Pierre-Jean Matteï5, Béatrice Regnault8, Marie-Anne Nahori1,2,3, Didier Cabanes7, Alexis Gautreau4, Slimane Ait-Si-Ali6, Andréa Dessen5, Pascale Cossart1,2,3* and Hélène Bierne1,2,3* 1. -
New Developments in Epigenetics and Potential Clinical Applications
NEW DEVELOPMENTS IN EPIGENETICS AND POTENTIAL CLINICAL APPLICATIONS Susan E. Bates, M.D. Columbia University Medical Center, New York, NY and J.J.P Bronx VA Medical Center, Bronx, NY TARGETING THE EPIGENOME What do we mean? “Targeting the Epigenome” - Meaning that we identify proteins that impact transcriptional controls that are important in cancer. “Epigenetics” – Meaning the right genes expressed at the right time, in the right place and in the right quantities. This process is ensured by an expanding list of genes that themselves must be expressed at the right time and right place. Think of it as a coordinated chromatin dance involving DNA, histone proteins, transcription factors, and over 700 proteins that modify them. Transcriptional Control: DNA Histone Tail Modification Nucleosomal Remodeling Non-Coding RNA HISTONE PROTEIN FAMILY 146 bp DNA wrap around an octomer of histone proteins H2A, H2B, H3, H4 are core histone families H1/H5 are linker histones >50 variants of the core histones Some with unique functions Post translational modification of “histone tails” key to gene expression Post-translational modifications include: – Acetylation – Methylation – Ubiquitination – Phosphorylation – Citrullation – SUMOylation – ADP-ribosylation THE HISTONE CODE Specific histone modifications determine function H3K9Ac, H3K27Ac, H3K36Ac H3K4Me3 – Gene activation H3K36Me2 – Inappropriate gene activation H3K27Me3 – Gene repression; Inappropriate gene repression H2AX S139Phosphorylation – associated with DNA double strand break, repair http://www.slideshare.net/jhowlin/eukaryotic-gene-regulation-part-ii-2013 KEY MODIFICATION - SPECIFIC FUNCTIONS H3K36Me: ac Active transcription, me H3K27Me: RNA elongation me Key Silencing ac ac me me Residue me me H3K4Me: H3K4 ac me Key Activating me me me Residue me H3K9 me H3K36 H3K9Ac:: H3K27 Activating Residue H3K18 H4K20 Activation me me me ac Modified from Mosammaparast N, et al. -
Germline Mutations in Histone 3 Family 3A and 3B Cause a Previously Unidentified Neurodegenerative Disorder in 46 Patients
Washington University School of Medicine Digital Commons@Becker Open Access Publications 2020 Histone H3.3 beyond cancer: Germline mutations in Histone 3 Family 3A and 3B cause a previously unidentified neurodegenerative disorder in 46 patients Laura Bryant Marcia C Willing Linda Manwaring et al Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs SCIENCE ADVANCES | RESEARCH ARTICLE GENETICS Copyright © 2020 The Authors, some rights reserved; Histone H3.3 beyond cancer: Germline mutations in exclusive licensee American Association Histone 3 Family 3A and 3B cause a previously for the Advancement of Science. No claim to unidentified neurodegenerative disorder in 46 patients original U.S. Government Laura Bryant1*, Dong Li1*, Samuel G. Cox2, Dylan Marchione3, Evan F. Joiner4, Khadija Wilson3, Works. Distributed 3 5 1 1 6 6 under a Creative Kevin Janssen , Pearl Lee , Michael E. March , Divya Nair , Elliott Sherr , Brieana Fregeau , Commons Attribution 7 7 8 9 Klaas J. Wierenga , Alexandrea Wadley , Grazia M. S. Mancini , Nina Powell-Hamilton , NonCommercial 10 11 12 12 13 Jiddeke van de Kamp , Theresa Grebe , John Dean , Alison Ross , Heather P. Crawford , License 4.0 (CC BY-NC). Zoe Powis14, Megan T. Cho15, Marcia C. Willing16, Linda Manwaring16, Rachel Schot8, Caroline Nava17,18, Alexandra Afenjar19, Davor Lessel20,21, Matias Wagner22,23,24, Thomas Klopstock25,26,27, Juliane Winkelmann22,24,27,28, Claudia B. Catarino25, Kyle Retterer15, Jane L. Schuette29, Jeffrey W. Innis29, Amy Pizzino30,31, Sabine Lüttgen32, Jonas Denecke32, 22,24 15 3 30,31 Tim M. Strom , Kristin G. Monaghan ; DDD Study, Zuo-Fei Yuan , Holly Dubbs , Downloaded from Renee Bend33, Jennifer A. -
Primepcr™Assay Validation Report
PrimePCR™Assay Validation Report Gene Information Gene Name Histone H1.5 Gene Symbol Hist1h1b Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.218561 Ensembl Gene ID ENSRNOG00000018073 Entrez Gene ID 680522 Assay Information Unique Assay ID qRnoCED0009574 Assay Type SYBR® Green Detected Coding Transcript(s) ENSRNOT00000024304 Amplicon Context Sequence CGCCTTGGGCCTTGCCGGGCTCTTAGTCGCCTTTTTAGGCTTGGCAGCAGCCTT GGCCTTCTTAGGGCTCTTGGTAACTTTCTTTACTCCAGCCGCTGCAGGCTTCTTT GCTTTCTTTGGAGTTTTCTTCACGGTCTTCTTGG Amplicon Length (bp) 113 Chromosome Location 17:58699834-58699976 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 101 R2 0.9998 cDNA Cq 19.67 cDNA Tm (Celsius) 84.5 gDNA Cq 25.81 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Hist1h1b, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect. Details for each transcript can be found on the Ensembl website at www.ensembl.org. -
Supplemental Data.Pdf
Supplementary material -Table of content Supplementary Figures (Fig 1- Fig 6) Supplementary Tables (1-13) Lists of genes belonging to distinct biological processes identified by GREAT analyses to be significantly enriched with UBTF1/2-bound genes Supplementary Table 14 List of the common UBTF1/2 bound genes within +/- 2kb of their TSSs in NIH3T3 and HMECs. Supplementary Table 15 List of gene identified by microarray expression analysis to be differentially regulated following UBTF1/2 knockdown by siRNA Supplementary Table 16 List of UBTF1/2 binding regions overlapping with histone genes in NIH3T3 cells Supplementary Table 17 List of UBTF1/2 binding regions overlapping with histone genes in HMEC Supplementary Table 18 Sequences of short interfering RNA oligonucleotides Supplementary Table 19 qPCR primer sequences for qChIP experiments Supplementary Table 20 qPCR primer sequences for reverse transcription-qPCR Supplementary Table 21 Sequences of primers used in CHART-PCR Supplementary Methods Supplementary Fig 1. (A) ChIP-seq analysis of UBTF1/2 and Pol I (POLR1A) binding across mouse rDNA. UBTF1/2 is enriched at the enhancer and promoter regions and along the entire transcribed portions of rDNA with little if any enrichment in the intergenic spacer (IGS), which separates the rDNA repeats. This enrichment coincides with the distribution of the largest subunit of Pol I (POLR1A) across the rDNA. All sequencing reads were mapped to the published complete sequence of the mouse rDNA repeat (Gene bank accession number: BK000964). The graph represents the frequency of ribosomal sequences enriched in UBTF1/2 and Pol I-ChIPed DNA expressed as fold change over those of input genomic DNA.