Health Science Campus

FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Sciences

Pituitary Adenylate Cyclase Activating Polypeptide Signaling Alters Gene Expression In Chick Ciliary Ganglion Neurons

Submitted by: Adriane D. Sumner

In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Sciences

Examination Committee

Major Advisor: Joseph Margiotta, Ph.D.

Academic Linda Dokas, Ph.D. Advisory Committee: David Giovannucci, Ph.D.

Marthe Howard, Ph.D.

Phyllis Pugh, Ph.D.

Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D.

Date of Defense: January 22, 2008

Pituitary Adenylate Cyclase Activating Polypeptide

Signaling Alters Gene Expression

In Chick Ciliary Ganglion Neurons

Adriane D. Sumner

University of Toledo College of Medicine

2008 ACKNOWLEDGEMENTS

I would like to thank my major advisor, Dr. Joseph Margiotta, and the other members of my advisory committee, Dr. Phyllis Pugh, Dr. Linda Dokas, Dr. Marthe

Howard, and Dr. David Giovannucci, for their advice and support during my graduate education.

I would like to thank the members of my lab; Dr. Gail Adams, whose help made the microarray experiments possible, Dr. Phyllis Pugh, who designed the primers used in the PAC1 splice variant and VPAC receptor conventional RT-PCR experiments, and

Selwyn Jayakar, who has not only been a valuable colleague but a wonderful friend.

I am very thankful for the love and support of my family and friends. I am especially grateful to my mom, Pat Sumner, and my sister, Erin Barthel, for all of those long talks and words of encouragement which sustained me through the tough times. I would never have made it without them.

ii TABLE OF CONTENTS

Acknowledgements ii

Table of Contents iii

Introduction 1

Literature 6

Methods and Materials 25

Results 38

Discussion 77

Conclusions 89

References 90

Abstract 108

iii INTRODUCTION

Neuropeptides often co-localize to the same presynaptic terminals as conventional neurotransmitters and have been shown to modulate neurotransmitter functions as well as influence neuronal development and regulation (Hokfelt et al. 2000). The neuropeptide,

PACAP (Pituitary adenylate cyclase-activating polypeptide), is known to be present throughout the central nervous system (CNS), the peripheral nervous system (PNS), and even in some peripheral organs (Peeters et al. 2000) and has been implicated in a wide range of biological functions (Vaudry et al. 2000). PACAP can bind to three types of G protein-coupled receptors (GPCRs); VPAC1, VPAC2, and PAC1. The VPAC1 and

VPAC2 receptors have an equal affinity for both PACAP and its most closely related peptide, vasoactive intestinal peptide (VIP) which shares 68% sequence identity with

PACAP. However, PAC1 is a specific PACAP receptor with a 100-1000 fold greater affinity for PACAP than for VIP (Vaudry et al. 2000). PAC1 is also known to have a number of splice variants, the majority of which result from inclusion or exclusion of exons in the N-terminal domain which determines ligand binding specificity and/or the third intracellular loop which determines the G-protein or ion channel to which the receptor will couple (Lutz et al. 2006).

Previous studies from this laboratory have demonstrated that PACAP is present in the chick parasympathetic ciliary ganglion (CG) at developmental stages from embryonic day 8 (E8) through E20 (Margiotta and Pardi 1995; Pugh and Margiotta 2006). However, its location within the CG is unknown. While the presence of PAC1 receptors has also been established, it is still unknown if VPAC1 or VPAC2 are present in the chick CG.

1 This laboratory has also demonstrated that application of exogenous PACAP results in activation of PAC1 receptors leading to increased signaling through adenylate cyclase

(AC) and phospholipase C (PLC), resulting in increased cAMP production and

2+ intracellular calcium (Ca in) respectively (Margiotta and Pardi 1995; Pardi and Margiotta

1999). In the chick CG, PACAP has been shown to have temporally diverse effects, exerting both gradual, survival-promoting trophic actions (Pugh and Margiotta 2006) and rapid-onset neuromodulatory effects impacting nicotinic receptors and synapses

(Margiotta and Pardi 1995; Pardi and Margiotta 1999).

Neuronal survival in the CG is influenced by preganglionic synaptic transmission, innervation of postganglionic targets, and neurotrophins (Nishi and Berg 1981a; Nishi and Berg 1981b). Most CG neurons do not survive when maintained in a basal culture medium lacking tissue extracts over a period of seven days (Landmesser and Pilar

1974a). However, this laboratory has demonstrated that the percentage of neurons that survive increases to approximately 70% when the culture medium is supplemented with exogenous PACAP (Pugh and Margiotta 2000). The fact that the concentration of

PACAP levels off during the period of cell death in the CG suggest that PACAP plays an important role in neuronal survival in vivo as well. The neurotrophic properties of

PACAP in the CG are dependent upon the AC signaling cascade involving both cAMP and PKA and by the mitogen-activated protein kinase (MAPK) signaling pathway which involves the phosphorylation of MAPK by MEK, but not the PLC signaling cascade

(Pugh and Margiotta 2006).

2 The neuromodulatory actions of PACAP are rapid, occurring in most cases within minutes (Pardi and Margiotta 1999). In CG neurons, PACAP signaling rapidly influences the function of both -bungarotoxin- ( Bgt-) sensitive nicotinic acetylcholine receptors, containing only 7 subunits ( 7-nAChRs), and heteropentameric receptors, containing 3, 5, 4, and, in some cases, 2 subunits ( 3*-nAChRs) (Vernallis et al.

1993; Nai et al. 2003) which underlie normal ganglionic neurotransmission (Zhang et al.

1994; Wilson Horch and Sargent 1995). Specifically, after brief PACAP treatment (10-

60 min), both 7-nAChR and 3*-nAChR-mediated whole-cell currents recorded from

CG neurons markedly increase, an effect requiring PAC1 receptors and a signal cascade triggering AC activation, cAMP accumulation, and PKA phosphorylation (Margiotta and

Pardi 1995). The net nAChR modulation likely depends on an interplay between AC and

PLC activation since after blocking AC with 2‟5‟-dideoxyadenosine (ddA), PACAP treatment rapidly leads to selective inhibition of 7-nAChR currents by a PLC-dependent

2+ process requiring inositol phosphate (IP) turnover and increased Ca in that leaves 3*- nAChR currents unaffected (Margiotta and Pardi 1995; Pardi and Margiotta 1999).

Relevant to synaptic interactions, exposure to PACAP enhanced activity at synapses that form between CG neurons in culture, utilizing PAC1 -, AC-, cAMP- and PKA-dependent processes to increase both the frequency and amplitude of nAChR-mediated spontaneous excitatory synaptic currents (sEPSCs) by 400% and 50%, respectively (2004 Abstract and

Pugh and Margiotta, unpublished). While these changes in synaptic function occur within minutes of PACAP application, they were sustained for up to 48 hours following a single 15 min exposure (Pugh and Margiotta, unpublished). These results demonstrate

3 that PACAP actions have long term consequences on both trophic and modulatory functions which could result from alterations in gene expression. This theory is further supported by the fact that changes in intracellular calcium, cAMP, and MAPK, which are observed in response to PACAP, have all previously been linked to the regulation of gene transcription as well (Squire et al. 2003).

Therefore, in this study, the ability of PACAP to alter gene expression was explored. Immunostaining and microscopy techniques were used to examine the ability of PACAP to phosphorylate and activate the transcription factor CREB (cAMP/Ca2+ response element binding protein) and microarrays were used to investigate the global effect PACAP has on altering gene transcription. The activation of the transcription factor CREB was characterized as a marker for gene expression since CREB has previously been implicated in neuronal plasticity and survival and has been shown to be activated by increased levels of intracellular calcium, cAMP, and MAPK (Bito and

Takemoto 2003). In this study, it is demonstrated that application of exogenous PACAP results in the phosphorylation of CREB at Ser133 in a time- and concentration-dependent manner, an effect that persists for at least 90 minutes after only a 15 min exposure to

PACAP. The ability of PACAP to activate CREB requires PAC1 since it was mimicked by the PAC1 selective agonist, maxadilan, inhibited by the PAC1 antagonist, PACAP(6-

38), and showed an expected increase in the EC50 of the concentration curve when induced by VIP. PKA may play a role in the intracellular signaling cascade since two pharmacological blockers of PKA, H89 and KT5720, inhibited PACAPs ability to phosphorylate CREB.

4 It was also examined whether varying PACAP exposure regimens result in recruitment of unique or overlapping sets of genes. Using the Affymetrix (Affymetrix inc., Santa Clara, CA) 28K chicken genome array it was demonstrated that brief (15min), intermediate (24h), and chronic (96h) treatment with exogenous PACAP differentially alters gene expression in E8 CG neurons maintained in cell culture for four days.

Analysis with Genesifter revealed 672 known genes regulated by PACAP including genes implicated in synaptic function, neuronal growth, survival, and development. Each

PACAP treatment condition altered a unique set of genes. However, 9 genes were up- regulated and 2 genes were down-regulated in all three PACAP treatment conditions.

Real-time RT-PCR was used to confirm the microarray findings of select genes of interest and also revealed that application PACAP results in a time-dependent decrease in the expression of WAS3, WAS1, and NESH3 and a time-dependent increase in the expression of Syanpsin IIa and Urocortin 3. These results support the theory that altered gene expression likely underlies PACAP‟s neurotrophic actions, such as the survival support observed during chronic exposure in CG neuron cultures (Pugh and Margiotta

2006), but may also sustain PACAP‟s neuromodulatory effects on nicotinic synapses that persist long after a single brief exposure (Pugh and Margiotta; unpublished).

5 LITERATURE

The Chicken Ciliary Ganglion (CG) Model System

The sympathetic and parasympathetic divisions of the autonomic nervous system

(ANS) are vitally important for controlling the internal viscera and thereby maintain homeostasis necessary to sustain life. As in other parts of the nervous system, fast chemical synaptic transmission is vital for appropriate autonomic and hence visceral functions (Kirstein and Insel 2004). This laboratory utilizes the chicken ciliary ganglion

(CG) as a model parasympathetic system to study the formation, regulation, and function of these synapses.

In the chicken, the CG is formed by Hamburger-Hamilton (HH) stage 25

(embryonic day 4.5, E4.5) with both neuronal and non-neuronal cells arising from precursor cells which begin migrating from both the caudal mesencephalic and the rostral metencephalic portions of the neural crest at HH stage 9 (E2) (Hamburger and Hamilton

1951; Pilar and Tuttle 1982; Gilardino et al. 2000). From E6 to hatching (E21), the CG is easily dissected, making it one of the few parasympathetic ganglia that are accessible throughout stages that include the critical developmental milestones of synaptogenesis

(E5-E8), cell death (E8-E14), and synapse maturation (E8-post hatching) (Dryer 1994).

Unlike other parasympathetic ganglia (e.g. cardiac and submandibular), CG neurons coalesce to form true ganglia rather than being diffusely distributed on the surface of their target organs (Pilar and Tuttle 1982). Another key advantage to using the chicken CG as a model system is that following dissection, CG neurons can be treated with enzymes and

6 dissociated and plated for subsequent morphological, biochemical and/or electrophysiological study. Two such preparations are commonly employed by this laboratory. In the first, E14 CG are treated with collagenase and the neurons acutely dissociated by mechanical trituration and plated for use on the same day, thereby providing a source of mature neurons devoid of synaptic connections. In the second, E8

CG neurons are dissociated and maintained in cell culture medium based on Eagle‟s minimum essential medium (MEM) that contains antibiotics, horse serum (10% v/v) and an extract of eye tissue (3% v/v) to provide target-derived trophic support. Over the course of several days in culture, CG neurons will grow and establish interneuronal synaptic connections with one another that are spontaneously active and mediated by nAChRs (Chen et al. 2001).

The chick CG is a relatively simple system composed only of glia and two neuronal populations; ciliary and choroid. The ciliary neurons have an ovoid shape and are larger than the choroid neurons, which have a more irregular angular shape (diameters approximately 23 m versus 13 m respectively at HH stage 40, embryonic day 14)

(Landmesser and Pilar 1974; McNerney et al. 2000). The ciliary neurons are primarily located ventrolaterally while the choroid neurons are found in the ventromedial portion of the ganglia (Marwitt et al. 1971; Pilar et al. 1980).

Both ciliary and choroid neurons are innervated by preganglionic axons that travel to the CG via the occulomotor (third) cranial nerve (N-III) (Pilar and Tuttle 1982).

Preganglionic axons in both the sympathetic and parasympathetic divisions of the ANS are cholinergic (Kirstein and Insel 2004). Therefore, the presynaptic inputs on CG

7 neurons are excitatory and synaptic transmission in the CG is mediated by nicotinic acetylcholine receptors (nAChRs) (De Biasi 2002). These preganglionic axons originate in the accessory occulomotor nucleus (AON). The AON is located in the midbrain dorsolateraly to the main occulomotor nucleus and is the avian equivalent of the mammalian Edinger-Westphal nucleus (Niimi et al. 1958; Cowan and Wenger 1968).

The preganglionic fibers which synapse on ciliary neurons are large-diameter rapid- conducting fibers while smaller, slower-conducting fibers synapse on choroid neurons

(Pilar and Tuttle 1982). Individual choroid neurons receive inputs from several different axon fibers which form typical bouton-like terminals on the postsynaptic choroid neurons. In contrast, individual ciliary neurons receive axon terminal inputs from a single preganglionic fiber which form calyx-like terminals that engulf the postsynaptic ciliary neurons during development (Landmesser and Pilar 1974). However, approximately one week after hatching (P7), the calyx-like terminals on the ciliary neurons begin breaking apart into the more typical bouton-like terminals (Pilar and Tuttle

1982).

Postganglionic fibers originating in the ganglia to synapse on target organs utilize different neurotransmitters in the sympathetic and parasympathetic divisions of the ANS.

Postganglionic fibers in the sympathetic division are considered noradrenergic since they utilize the neurotransmitter norepinephrine. However, in the parasympathetic system, the postganglionic fibers utilize ACh as in the preganglionic fibers and, therefore, are cholinergic (Kirstein and Insel 2004). Although postganglionic fibers in the chick CG originate from both ciliary and choroid neurons, these fibers innervate different targets.

8 The ciliary neurons project to the striated muscle of the iris and ciliary body to regulate the constriction of the pupil and the accommodation of the lens, respectively. The choroid neurons project to the smooth muscle in the choroid coat and regulate the choroidal vasculature (Pilar and Tuttle 1982).

During embryonic development, the number of neurons in the chick CG is reduced by approximately 50%. The ciliary and choroid neuron populations are both affected by this cell death which reduces the number of neurons from approximately

6500 to 3200 during HH stages 35-39 (approximately embryonic day 9 through 13)

(Landmesser and Pilar 1974a). This results in approximately 1,400 ciliary neurons and

1,800 choroid neurons (Pilar and Tuttle 1982). Neuropeptides, neuronal growth factors, preganglionic synaptic transmission, and innervation of postganglionic targets all play important roles in overseeing this neuronal survival (Pugh and Margiotta 2006).

Neuropeptides

Neuropeptides often co-localize to the same presynaptic terminals as conventional neurotransmitters and have been shown to modulate neurotransmitter functions as well as influence neuronal development and regulation (Hokfelt et al. 2000). Although the characteristics of many neuropeptides may satisfy the criteria to be termed neurotransmitters, there are several important differences particularly regarding synthesis, storage, and release (Lundberg 1996).

Bioactive neuropeptides can be up to fifty times larger than conventional neurotransmitters ranging anywhere from three to one hundred amino acid residues

9 (Hokfelt et al. 2003). Many neuropeptides are synthesized as large, inactive pre- propeptides, usually in the cell body on ribosomes at the endoplasmic reticulum (ER).

These pre-propeptides are then transferred to the trans-Golgi network for packaging in large (~100nm), dense cored secretory vesicles (LDV) along with processing enzymes which will cut out the bioactive peptides. These LDVs are then transported along the axon to the axon terminals (Bean et al. 1994; Hokfelt et al. 2000). Conventional neurotransmitters are chiefly synthesized at the nerve terminals and stored in smaller

(~50nm), electron lucent, synaptic vesicles (Bean et al. 1994).

Neuropeptides and neurotransmitters localized in the same presynaptic terminals can be co-released (Lundberg 1996). However, since they are stored in two different types of vesicles, they have different properties. The formation of synaptic vesicles follows the constitutive pathway of secretion as early endosomes before being processed into a synaptic vesicle at the nerve terminal. These synaptic vesicles are localized near

2+ 2+ the active zones of synapses and require a local increase of intracellular Ca (Ca in) for exocytosis to occur (Matthews 1996). However, since formation of LDVs follows the regulated pathway of secretion these vesicles lack several key proteins which are needed for localization at active zones and exocytosis can occur anywhere along the axon

2+ terminal‟s membrane and require general Ca in elevation (Verhage et al. 1991). Due to the difference in release properties of LDVs, exocytosis of vesicles containing neuropeptides often require greater stimulation frequencies than for those containing neurotransmitters (Lundberg et al. 1994). The combination of neurotransmitters and

10 neuropeptides in the same neuron terminal enables a range of fast (2-5ms) and slow (100-

500ms) communication at the synapse (Hokfelt et al. 2003).

The difference in structure of synaptic vesicles and LDVs also regulates neurotransmitter and neuropeptide release in another way. Synaptic vesicles are capable of being recycled at the axon terminal which, combined with the production of neurotransmitters at the nerve terminals, allows for rapid as well as sustained release of neurotransmitters. However, LDVs lack several key proteins which are necessary for recycling. Since neuropeptides cannot be replenished as quickly at synaptic terminals as neurotransmitters, degradation is a relatively slow process. Therefore, neuropeptides are removed more slowly from the synaptic cleft than neurotransmitters and as a result, neuropeptide-mediated effects are often long-lived in comparison to neurotransmitters

(Strand 1999).

Although synaptic transmission in the chicken CG is mediated by aceylcholine

(ACh), it has been previously demonstrated that a number of neuropeptides are present as well. Substance P and the enkephalin (ENK) pentapeptides, leucine-enkephalin (LENK) and methionine-enkephalin (MENK), have been found in the preganglionic axon terminals with ACh (Erichsen et al. 1982). A key focus of this laboratory has been investigating the possibility that the neuropeptide PACAP (Pituitary adenylate cyclase- activating polypeptide) is present in the chicken CG and exploring its role at the synapse.

11 Pituitary adenylate cyclase-activating polypeptide (PACAP)

PACAP is one of nine bioactive, structurally related-neuropeptides which belongs to the secretin/glucagon/GRH/VIP superfamily (Sherwood et al. 2000). As would probably be expected, there is a large degree of homology between members of this superfamily with vasoactive intestinal peptide (VIP) being the most closely related peptide to PACAP, sharing 68% sequence identity (Vaudry et al. 2000). PACAP is highly conserved among species and, in fact, is the most conserved member of its superfamily (Sherwood et al. 2000). PACAP is identical within mammalian species while PACAP in the chicken has a single amino acid change compared to the mammalian form; the second amino acid is an isoleucine rather than a serine (Nowak and Zawilska

2003). This high degree of evolutionary conservation underscores the importance of

PACAP in biological functions.

PACAP exists in two forms, with its predominant form consisting of 38 amino acids (PACAP38). However, PACAP also exists as a C-terminal truncated form which contains only the first 27 amino acids of PACAP38 (PACAP27) (Miyata et al. 1990).

The two forms of PACAP are both derived from the same pre-propeptide. The pre- propeptide in chicken comprises not only the PACAP precursor as in mammals, but also the precursor for another member of the superfamily; the Growth Hormone Releasing

Factor (GRF) (McRory et al. 1997).

PACAP was originally isolated in 1989 from ovine hypothalamic extracts on its ability to stimulate cAMP through the activation of adenylate cyclase (AC) in rat anterior pituitary cells (Miyata et al. 1989). However, PACAP has since been shown to be more

12 than just a hypophysiotropic neuropeptide. PACAP is now known to be present throughout the central nervous system (CNS) and even in some peripheral organs including the gastrointestinal tract, pancreas, adrenal glands, gonads, and the respiratory tract (Peeters et al. 2000).

It was previously suggested that the neuropeptide VIP co-localizes in avian CG presynaptic terminals with the neurotransmitter acetylcholine (ACh) (Reiner 1987).

However, the high degree of sequence homology between PACAP and VIP would have allowed the antiserum previously used to identify VIP in cholinergic presynaptic terminals to cross-react with PACAP. This laboratory has since demonstrated that

PACAP is, in fact, present in the chicken CG (Margiotta and Pardi 1995). This was established by radioactive immunoassay (RIA) using an antiserum specific for PACAP-

38 that shows no cross-reaction with VIP. It has now been shown that PACAP is present in the chick CG at all developmental stages from E8 through E20 and, as a general trend, it increases during development, leveling off during the period of cell death between the ages of E11 and E14 (Pugh and Margiotta 2006). It is unknown where PACAP is localized within the chick CG. Since previous studies using RIA have shown that

PACAP is not present in the iris, it is possible that PACAP is synthesized in neurons in the accessory occulomotor nucleus and transported down the axons to the presynaptic terminals projecting into the CG.

13 PACAP Receptors

PACAP is capable of binding to three types of receptors: VPAC1, VPAC2, and

PAC1 (Sherwood et al. 2000). VPAC1 and VPAC2 have an equal affinity for both

PACAP and VIP. However, PAC1 is a PACAP specific receptor with a 100-1000 fold greater affinity for PACAP than for VIP. Although VPAC1 and VPAC2 show the same binding properties for PACAP and VIP they have different binding affinities for another member of the PACAP/VIP superfamily; secretin (Laburthe et al. 2002).

VPAC and PAC1 receptors can also be distinguished from one another by their ability to bind known agonists and antagonists. Maxadilan is a vasoactive neuropeptide isolated from the sandfly salivary gland and is capable of specifically binding and activating the PAC1 type receptor. Maxadilan is a 63 amino acid peptide and since it shares very little sequence homology with PACAP it is unclear why maxadilan binds and activates the PAC1 receptor. Maxadilan can also be converted into a PAC1 antagonist known as M65 following the deletion of the amino acid sequence 25-41 (Uchida et al.

1998). Another potent antagonist of the PAC1 receptor is a truncated form of PACAP-38 known as P6-38 which has several amino acids deleted in the N-terminal domain

(Robberecht et al. 1992). This is understandable since it is known that the C-terminal domain of PACAP is important for recognition in binding to the receptor while the N- terminal domain is required only for activation (Vaudry et al. 2000).

All three types of PACAP receptors are members of the class II family of G protein-coupled receptors (GPCR). As with all GPCRs, the PACAP receptors consist of seven-transmembrane -helical domains. The N-terminal domain extends into the

14 extracellular region (Lodish et al. 2001) and has been shown to be important in determining ligand binding while the C-terminal domain extends into the intracellular region (Lutz et al. 2006). The third intracellular loop of the GPCR is usually longer than the other intracellular regions and is important for interaction with G proteins (Lodish et al. 2001).

G proteins consist of three subunits; G ,), G ), and G ). When G proteins are inactive, all three of these subunits are associated with one another and GDP

(guanosine diphosphate) is bound to G . However, when a ligand binds and activates the

GPCR, the receptor undergoes a conformational change allowing it to interact with the

subunit of the inactive, heterotrimeric G protein (Lodish et al. 2001; Squire et al. 2003).

This interaction induces a conformational change in the subunit subsequently causing the bound GDP to be released and replaced by GTP (guanosine triphosphate).

Additionally, it allows the dissociation of the G subunit from the G and G subunits.

The G and G subunits do not change conformation and remain tightly bound to one another (G ) (Sondek et al. 1996; Clapham and Neer 1997). The released G is able to interact with and activate nearby effector enzymes or channels. Inactivation of the G protein is achieved by hydrolysis of GTP to GDP which results in the dissociation of the

G subunit from the effector enzyme or channel and re-association with G to form the inactive, heterotrimeric structure (Lodish et al. 2001). The association of G with G not only serves to block interaction of the G subunit with the effector enzyme or channel but also increases its affinity for the receptor (Squire et al. 2003).

15 It was once believed that only the subunit was capable of functioning as a transduction molecule. However, it is now believed that some G subunits help regulate the functions of the subunit and are even capable of directly regulating effectors as well. G have been shown to mediate effects through ion channels, the MAP kinase cascade, AC, and PLC (Rawlings 1994; Clapham and Neer 1997). Interestingly, there has been evidence that activation of the G subunit of a G protein by a truncated form of glucagon (a member of the PACAP superfamily) plays a role in the regulation of the plasma membrane calcium ATPase pump (Lotersztajn et al. 1992).

There are now known to be a number of different isoforms for each of the three subunits of G proteins which can combine in a variety of ways. However, G proteins are generally divided into four basic groups based on sensitivity to toxins and the effectors that the subunit (G ) interacts with; Gi , Gs , Gq , and Go . The Gs and Gi stimulate and inhibit the adenylate cyclase (AC) signaling cascade, respectively. Gq activates the phospholipase C (PLC) signaling cascade. Go couples to a number of other effectors including direct coupling to ion channels such as the L-type calcium channel.

Additionally, Gs can be distinguished by its ability to be stimulated by cholera toxin while Gi is inhibited by pertussis toxin (Lodish et al. 2001). Consequently, exposure to either toxin will result in an increase in AC activity.

Since G-proteins are activated by the third intracellular loop of the receptor, it is not surprising that differences in the sequence of the third intracellular loop helps determine which type of G-protein the receptor will couple to and activate (Lutz et al.

2006). This, in turn, will determine which effector enzyme or ion channel the receptor

16 will ultimately influence. This diversity in signal transduction induced by GPCR is a relatively common phenomenon. It is achieved by alternate splicing of the receptor.

Splice variants can also influence the binding specificity of ligands if the N-terminal region is affected (Bockaert and Pin 1999). Until recently, it was believed that there were no splice variants for the VPAC receptors (Laburthe et al. 2002). However, there is now evidence suggesting that may not be the case. Two splice variants of the VPAC2 receptors have been identified (Miller et al. 2006). In contrast, there are a large number of splice variants for the PAC1 receptor.

There are presently eighteen known splice variants of the human PAC1 receptor

(Lutz et al. 2006). The majority of these splice variants are a result of the exclusion or inclusion of one or more exons. Two cassettes known as “hip” and “hop” are present in the third intracellular loop of the PAC1 receptor corresponding to exons 14 and 15.

Splice variants involving these exons influence which effector or ion channel will couple to the receptor. Exons 4, 5, and 6 are present in the N-terminus. Since the extracellular

N-terminus is responsible for determining the binding specificity of ligands the inclusion or exclusion of these exons results in changes in binding affinity for VIP and PACAP.

Additionally, there is the transmembrane domain (TM4) PAC1 splice variant which is identified by two amino acid substitutions and deletions in the fourth transmembrane domain. The consequences of alternative PAC1 receptor splicing on signal transduction is illustrated by the fact that the hip variant has a very weak ability to activate AC.

Additionally, the TM4 variant is unable to stimulate either the AC or PLC intracellular

17 signaling cascades. Rather, it couples to L-type voltage dependent calcium channels

(VDCC) leading to an increase in intracellular Ca2+ (Nowak and Zawilska 2003).

The idea of unique roles for splice variants can also be supported by the fact that distinct expression patterns are observed for splice variants of many GPCRs (Kilpatrick et al. 1999; Lutz et al. 2006). Additionally, there are known to be differences in the expression of PAC1 receptor splice variants during development (D'Agata et al. 1996).

The distribution patterns of VPAC1 and VPAC2 are also different from one another and from PAC1. VPAC and PAC1 receptors are widely distributed. This is not unexpected, given the wide distribution of PACAP. As with PACAP, the receptors are most abundant in the brain. However, they are also present in moderate amounts in peripheral organs such as the lungs, heart, gut, ovaries, testis, kidney, and pancreas (Peeters et al. 2000).

This laboratory has previously determined that the PAC1 receptor is present in the chick CG. The affinity of the receptor for PACAP over VIP has been demonstrated with regard to the binding of the ligands, as well as, stimulation of cAMP (Margiotta and Pardi

1995). However, it is unknown if the VPAC1 or VPAC2 receptors are present in the CG.

This laboratory has also demonstrated that both AC and PLC are activated by PACAP

(Pardi and Margiotta 1999). This indicates that multiple splice variants of the PAC1 receptor may be present since, as preciously mentioned, splice variants in the third intracellular loop determine the ability of the receptor to couple to the various types of G- proteins to activate different effectors or ion channels.

18 PACAP Signaling Pathways

An important aspect of G protein-activated signaling cascades is that amplification of the signal occurs at each step beginning at the receptor which can interact with multiple G proteins. Signaling cascades also allow the convergence of multiple signaling pathways and have some built-in redundancy since there are often multiple ways to activate a given step in a pathway (Lodish et al. 2001). As a result, there are a number of possible downstream effects following activation of the effectors

PLC and AC by G proteins. However, there are preferential signaling cascades for both.

The effector PLC is a membrane-associated enzyme which cleaves phosphatidylinositol 4,5-biphosphate (PIP2) into 1,2-diacylglycerol (DAG) and inositol

1,4,5-triphosphate (IP3). Once formed, these two molecules function as second messengers. DAG is a lipophilic molecule and, therefore, remains in the cellular membrane. IP3, however, is hydrophilic and capable of diffusing into the cytosol where

2+ it binds to IP3-sensitive Ca channels on the endoplasmic reticulum causing the channels to open. Calcium is consequently released from these internal stores. This increase in cytosolic calcium induces influx of extracellular calcium into the cell. These calcium ions mediate a variety of functions including recruitment of protein kinase C (PKC) to the membrane where it can be phosphorylated and activated by DAG (Lodish et al. 2001;

Squire et al. 2003).

Activation of the effector AC causes the conversion of ATP into cAMP which then functions as a second messenger capable of activating a number of enzymes including its most commonly known substrate cAMP-dependent protein kinase (PKA).

19 PKA is a tetramer composed of two regulatory and two catalytic subunits. In its tetrameric form, PKA is inactive. However, binding of cAMP to the regulatory subunits causes a conformational change and dissociation of the catalytic subunits. These catalytic subunits are then capable of phosphorylating a number of different substrates including cAMP/Ca2+ response element binding protein (CREB) and mitogen-associated protein-kinase-kinase-kinase (MAPKKK) (Lodish et al. 2001).

Since this laboratory has previously shown that PAC1 receptors present in the chicken CG couple through both AC and PLC dependent signaling cascades it is not surprising that application of exogenous PACAP results in increased levels of cAMP as

2+ 2+ well as increases in inositol phospholipid (IP) turnover and intracellular Ca , (Ca in)

(Deutsch and Sun 1992; Spengler et al. 1993; Margiotta and Pugh 2004).

PACAP Functions

Since PACAP receptors are known to couple to a wide range of signaling cascades and are present throughout the central nervous system as well as peripheral organs it is not surprising that it is involved in a wide range of biological functions.

PACAP and its receptors have been implicated in the control of the circadian clock, neurotrophic, neuromodulatory, and learning and memory processes ( Vaudry et al. 1998;

Vaudry et al. 2000; Vaudry et al. 2000; Vaudry et al. 2002; Somogyvari-Vigh and

Reglodi 2004). Recently, PAC1 has even been implicated in the Gulf War Syndrome

(Staines 2004). This laboratory is interested in exploring the possible roles of PACAP, not only in modulating and regulating synapses mediated by nicotinic AChRs, but also in

20 influencing neuronal survival and differentiation (Margiotta and Pardi 1995; Pardi and

Margiotta 1999; Margiotta and Pugh 2004; Pugh and Margiotta; unpublished).

Previous studies from this laboratory have addressed the neuromodulatory and neurotrophic consequences of activating PAC1 signaling following application of exogenous PACAP (reviewed in Margiotta and Pugh 2004). The majority of CG neurons do not survive when maintained in a basal culture medium lacking tissue extracts over a period of seven days (Landmesser and Pilar 1974a). However, this laboratory has demonstrated that the percentage of neurons that survive increases to approximately 70% when the culture medium is supplemented with exogenous PACAP [100nM] (Pugh and

Margiotta 2000). It appears that these neurotrophic properties of PACAP are dependent upon the AC signaling cascade involving both cAMP and PKA. This laboratory has shown that PACAP-mediated survival was mimicked by both the AC activator, forskolin

[10 M], and the cAMP analog, 8Br-cAMP [2mM]. Additionally, it was found that application of two different AC blockers, SQ22536 [10 M] and MDL12330A [1 M], as well as a PKA blocker, H89 [10 M], all individually inhibited the PACAP-mediated survival. This survival also appears to be mediated by the mitogen-activated protein kinase (MAPK) signaling pathway which involves the phosphorylation of MAPK by

MEK since PACAP-mediated survival was blocked by inhibiting MEK with PD98059

[7 M]. The PLC signaling cascade does not appear to be involved since neither the inhibition of PLC with U73122 [1 M] nor the inhibition of its downstream messenger,

PKC, with bisindolylmaleimide I HCl [0.5mM] prevented PACAP from supporting neuronal survival. However, L-type voltage dependent calcium channels (VDCC) appear

21 to be important since the application of nifedipine [10 M] to block these channels inhibited PACAP mediated survival. Since PACAP is capable of modulating nAChR, it is not surprising that treatment with PACAP in combination with depolarizing levels of

KCl has been shown to further increase CG neuron survival to approximately 100%

(Pugh and Margiotta 2006).

Neuromodulation targets the two functional nAChR classes present in CG neurons. One class of nAChRs are homopentameric receptors that contain only 7 subunits ( 7-nAChRs). The other class of nAChRs present in the chick CG are heteropentameric receptors and can contain 3, 5, 4, and 2 subunits but not 7 subunits ( 3*-nAChRs) (Vernallis et al. 1993; Nai et al. 2003). While 7-nAChRs have a high affinity for and can be blocked by -bungarotoxin, 3*-nAChRs are insensitive to this toxin (Zhang et al. 1994). Both classes of receptors contribute to the whole-cell current generated by the application of nicotine. This current is made up of two components; a large, rapidly desensitizing, initial component generated by 7-nAChRs and a smaller, slowly desensitizing, later component generated by 3*-nAChRs

(Blumenthal et al. 1999). As previously mentioned, PACAP couples through both AC and PLC signaling pathways. This laboratory has demonstrated that application of exogenous PACAP utilizes the AC signaling cascade to not only induce a robust increase in cAMP but to concomittantly up-regulate both 7-nAChR and 3*-nAChR-mediated whole-cell currents. However, following blockade of AC, the ability of PACAP to

2+ activate the PLC signaling cascade is unmasked, resulting in IP turnover, increased Ca in

22 and inhibition of 7-nAChR currents (Margiotta and Pardi 1995; Pardi and Margiotta

1999).

Exposure to PACAP also enhanced activity at synapses that form between E8 CG neurons in culture, utilizing PAC1-, AC-, cAMP- and PKA-dependent processes to increase both the frequency and amplitude of nAChR-mediated spontaneous excitatory synaptic currents (sEPSCs) by 400% and 50%, respectively (2004 Abstract and Pugh and

Margiotta, unpublished). While these robust changes in synaptic function occur within minutes of PACAP application, they were sustained for up to 48 hours following a single

15 min exposure (Pugh and Margiotta; unpublished). These results demonstrate that

PACAP actions have long-term consequences on both trophic and modulatory functions.

Since long term changes in synaptic plasticity and survival often require alterations in

2+ gene expression and since PACAP has been shown to increase Ca in, cAMP, and MAPK all of which are linked to altered gene expression (Squire et al. 2003) this laboratory is interested in whether PAC1 stimulation alters the activity of transcription factors and thereby regulates neuronal gene expression.

CREB (cAMP/Ca2+ response element binding protein) is one of the best characterized stimulus induced transcription factors and has previously been implicated in neuronal plasticity and survival (Bito and Takemoto 2003). As its name implies,

CREB was originally identified as a substrate of cAMP (Shaywitz and Greenberg 1999).

However, it has since been implicated as a substrate in a number of signaling cascades including Ca2+, MAPK, CaMKII/IV, and AKT all of which have been shown to be regulated by PACAP (Mayr and Montminy 2001). Since CREB contains both a basic

23 helix-loop-helix domain and a leucine zipper domain it belongs to a larger family of transcription factors which includes, but is not limited to, CREM, c-fos, ATF1, and c-jun.

CREB is localized almost exclusively in the nucleus and contains a serine at reside 133

(Shaywitz and Greenberg 1999). Phosphorylation of this serine is required for activation and initiation of gene transcription. Once activated, CREB forms a homodimer and recruits other proteins such as co-activator CREB-binding protein (CBP) and polymerase

II (Mayr and Montminy 2001). Phosphorylated CREB recognizes a conserved DNA sequence known as the cAMP-responsive element (CRE) and thus far over 100 genes have been identified as containing functional CREs (Impey et al. 2004). Interestingly, it was found that application of exogenous PACAP to CG neurons activated CREB, as indicated by its ability to induce phosphorylation at Ser133 resulting in pCREB (Sumner et al. 2004; Zhou et al. 2004). PACAP activation of CREB may be an indicator for more global changes in transcription factor activation and regulation of gene expression.

24 METHODS and MATERIALS

Immunostaining for PACAP and Synapsin in whole ciliary ganlia

To localize PACAP and assess its depletion, E19 or E20 ciliary ganglia were incubated (30 min, 21°C) in MEM containing normal (5 mM control) or depolarizing (50 mM) KCl, and then processed using a previous whole ganglion protocol (Rubio et al.

2005) modified to accommodate PACAP signal amplification (Tyramide signal amplification (TSA) kit, Molecular Probes/Invitrogen, Carlsbad, CA). Control and KCl- treated ganglia were fixed with 4% paraformaldehyde freshly prepared in 0.1M phosphate buffered saline (30 min, 21°C), washed (PBS, 16h, 4°C), and incubated in PBS containing 3% H2O2 (1h, 21°C) to quench endogenous peroxidase activity. Ganglia were then incubated (16h, 4°C) in block solution (PBS containing 0.1% Triton X-100, and 1%

TSA kit block reagent) with Avidin D added to quench endogenous biotin (150 µl/ml;

Avidin/Biotin Blocking Kit; Vector Laboratories, Burlingame CA). Ganglia were then washed in PBS, and incubated with antibodies recognizing the presynaptic marker

Synapsin-I (pAb1543, 1:250, Chemicon/Millipore, Billerica, MA) and PACAP-38

(mAbJHH1, 1:100, provided by Jens Hannibal, University of Copenhagen) in block solution containing Biotin (16h, 4°C, 150 µl/ml; Avidin/Biotin Blocking Kit; Vector

Laboratories, Burlingame CA)). Ganglia were then washed in PBS, and Synapsin-I and

PACAP labeling was detected using Alexa Fluor 488-conjugated goat anti-rabbit IgG

(Molecular Probes/Invitrogen, Carlsbad, CA) and biotinylated goat anti-mouse IgG

(Kirkegaard Perry Laboratories, Gaithersburg, MD), respectively (both at 1:200 in block

25 solution lacking Triton X-100, 16hr, 4°C). To amplify the PACAP signal, ganglia were washed in PBS, incubated in Triton-free block solution containing horseradish peroxidase-conjugated streptavidin (1:100, TSA kit, 1h, 21°C), washed, and then incubated in amplification buffer with 0.0015% H2O2 and Alexa Fluor 546-labeled tyramide (1:100, TSA kit, 10 min, 21°C). Ganglia were then washed again, mounted in

Vectashield (Vector Laboratories; Burlingame, CA) and examined using an Olympus

BX51 microscope equipped with a 1.2 NA 60X objective, and a BioRad Radiance2000 laser scanning confocal system (Carl Zeiss MicroImaging, Thornwood, NY). Optical Z- sections were acquired sequentially through the ganglia in 1.0 µm steps using BioRad

Lasersharp software, with power and gain settings that minimized pixel saturation and produced no detectable bleedthrough between Ar (488 nm) and Green HeNe (543 nm) laser channels.

Immunostaining for phospho-CREB in acutely dissociated neurons

Ciliary ganglia were dissected from E14 chick embryos and the neurons were isolated as previously described (Margiotta et al. 1987; Gurantz et al. 1994; Margiotta and Pardi 1995; Pardi and Margiotta 1999). Briefly, ganglion pieces were treated with collagenase A, washed and triturated, and the dissociated neurons were plated on poly-D- lysine coated glass coverslips. To reduce basal levels of pCREB (Zauli et al. 2001), dissociated neurons were starved by pre-incubating in serum-free minimum essential medium (MEM, Invitrogen, Carlsbad, CA) for 2 x 15 min (37oC) and then treated with test reagents. Following treatment with PACAP or other test reagents (see below),

26 neurons were washed for 2 min in 0.1 M phosphate buffered saline (PBS, pH 7.4, 21oC), fixed in 4% paraformaldehyde (freshly prepared in PBS) for 30 min, and washed again for 5 min (21oC). Neurons were then blocked in PBS containing 5% normal goat serum

(NGS) and supplemented with 0.1% TritonX-100 (TX-100) to permeabilize cell membranes (21oC, 1 h). Cells were then incubated with Phospho-CREB (Ser133)

Antibody, a primary antibody that recognizes the Ser133-phosphorylated form of the transcription factor CREB (pCREB; Cell Signaling Technology; Danvers, MA) in block solution (16 h, 4oC). Cells were washed in PBS containing 0.1% TX-100 (21oC, 3 x 5 min) and then incubated in block solution containing an Alexafluor-488 conjugated secondary antibody (goat-anti rabbit IgG, Invitrogen; Carlsbad, CA) (21oC, 1 h). Cells were again washed in PBS (21oC, 3 x 5 min) and mounted on glass slides with

Vectashield (Vector Laboratories; Burlingame, CA) containing propyl gallate as an anti- fading agent.

Drug treatments

To determine the onset and efficacy of pCREB activation, CG neurons were incubated with peptide (PACAP or VIP) in MEM applied for varying times (0, 1, 2, 5,

10, 15, 30 min) and concentrations (10-12 to 10-7M for PACAP or 10-12 to 10-5M for VIP).

The persistence of pCREB activation was assessed by treating with a maximal PACAP dose (10-7 M) for 15 min and then returning cells to MEM for varying times (0, 30, 60, 90 minutes) before fixation. For cell signaling pathway studies, cells were incubated with pharmacological inhibitors before (2 X 15min, 37oC) and during PACAP treatment (5

27 min, 1 nM, 37oC). The inhibitors used to block AC were MDL-12330A (10uM,

Calbiochem; La Jolla, CA), SQ22536 (10uM, Sigma-Aldrich, St. Louis, MO), and 2‟5‟- dideoxyadenosine (ddA; 200uM, Calbiochem; La Jolla, CA). H89 (10uM, Calbiochem;

La Jolla, CA), KT5720 (10uM, Calbiochem; La Jolla, CA), Rp-cAMP (2uM, Sigma-

Aldrich, St. Louis, MO), and myristoylated PKI (1uM, Biomol International; Plymouth

Meeting, PA) were used to block PKA. U73122 (100nM, Calbiochem; La Jolla, CA) was used to block PLC while Bisindolymaleimide I (500nM, Sigma-Aldrich, St. Louis, MO) was used to block PKC. PD98059 was used to block MEK (7uM, Sigma-Aldrich, St.

Louis, MO) and KN93 was used to inhibit CaMK II (50uM, Calbiochem; La Jolla, CA).

Increased levels of intracellular Ca2+ was prevented by pre-treating with the membrane permeant calcium chelator BAPTA-AM (50uM, Invitrogen, Carlsbad, CA), depleting caffeine-sensitive intracellular stores with Ryanodine (10uM, Biomedicals, Solon, OH) or

SERCA pumps with Thapsigargin (1uM, Sigma-Aldrich, St. Louis, MO), or by blocking

L-type Ca2+ channels with Nifidipine (10uM, Sigma-Aldrich, St. Louis, MO). In experiments to determine receptor subtype, cells were treated with PACAP (1 nM,

American Peptide; Sunnyvale, CA), with PACAP (1 nM) and the antagonist P6-38

(100nM, American Peptide; Sunnyvale, CA), or with maxadilan (1nM or 100nM, generously provided by E.A. Lerner) for 15 minutes. The antagonist P6-38 (100nM) was also present during the serum starvation pre-treatment steps.

28 Immunostaining Analysis

Fluorescence microscopy (BX50, UplanFL 40X, 0.75 numerical aperture objective; Olympus, Tokyo, Japan) digital image acquisition (Q-Imaging Retiga cooled digital camera) under control of IP-Lab (v 3.6, Scanalytics) was used to detect pCREB immunoreactivity in the neuronal nuclei under the various treatment conditions. Digital images were obtained of fields of neurons, selected using bright field optics to determine healthy cells. The number of neurons in analyzed fields (5 fields of view/coverslip; ranging from 1 to 15 neurons/field) showing detectable pCREB immunoreactivity (≥

15% above background) was calculated. The intensity of the nuclear fluorescence in pCREB immunopositive cells was calculated relative to background for the same conditions by comparing the net nuclear fluorescence relative to the background cytoplasmic fluorescence ( F/F).

Mircoarray

Ciliary ganglia were dissected from E8 chick embryos and the dissociated neurons were grown on laminin and poly-DL-ornithine coated 35mm culture dishes in culture medium (MEM, Invitrogen, Carlsbad, CA) containing heat inactivated horse serum (10% v/v) and embryonic chick eye extract (3% v/v) as previously described

(Chen et al., 2001). PACAP (100 nM) was applied to triplicate dishes for varying times

(15 min followed by 6 h washout, 24 h, and 96 h) each terminating at 4 d, and total RNA extracted from treated and parallel triplicate control cultures (Qiagen RNeasy kit, Qiagen

Inc., Valencia, CA) following the vendor‟s specifications. Briefly, cells were scraped

29 from the culture dishes in lysis buffer containing -mercaptoethanol (1% v/v), homogenized using a QIAshredder spin column, and the sample applied to a column for binding, washing, DNase treatment and RNA elution in water. An aliquot was removed from each RNA sample and the concentrations calculated from the absorbance at 260 nm to ensure each sample was at least 200ng/ul (actual concentrations ranged from 300ng/ul to 520ng/ul). Each sample was then prepared for hybridization using the standard HT one-cycle target labeling Affymetrix protocols (GeneChip® Expression Analysis Data

Analysis Fundamentals). These steps were performed by this laboratory for the 96h time point. However, frozen RNA samples from the 15 min and 24h time points were submitted to the NIH Neuroscience Microarray Consortium for preparation. Briefly, gel electrophoresis was used to ensure that the RNA was not degraded and that the 28S ribosomal RNA products have an intensity approximately twice that of the 18S ribosomal

RNA products. Additionally, the purity of the RNA was ensured by determining if the

260 nm and 280 nm absorbance ratio was at least 1.8. Double stranded cDNA was synthesized from total RNA by reverse transcription. This laboratory used 3ug of total

RNA from each sample from the 96h time point while the NIH array consortium used

1ug for each sample from the 15min and 24h time points. A T7-Oligo (dT) Promoter

Primer was utilized in the first-strand cDNA synthesis reaction followed by RNase H- mediated second strand cDNA synthesis. This double-stranded cDNA was then purified and served as a template for the in vitro transcription (IVT) reaction, which was carried out in presence of T7 RNA polymerase and biotinylated nucleotide analog/ribonucleotide mix for cRNA amplification and biotin labeling. The biotin-labeled cRNA was then

30 purified and fragmented. Samples were removed for gel electrophoresis analysis both after the IVT and the fragmentation steps. The hybridization, washing, and laser scanning steps for the 15min and 24h time points were also performed by the NIH

Neuroscience Microarray Consortium while the 96h time point was performed by the

University of Toledo College of Medicine Proteomics and Genomics Core Facility.

Briefly, 10ug of fragmented and labeled cRNA were hybridized to Affymetrix

GeneChip Chicken Genome Arrays, which represent >28,000 genes

(http://www.affymetrix.com/products/arrays/specific/chicken.affx). After a 16-hour incubation at 45ºC, the GeneChips were washed and stained according to the manufacturer‟s recommendations (Affymetrix) using the GeneChips Fluidics Station

400 or 450. This procedure includes washing the chips with phycoerythrin-streptavidin, signal amplification by a second staining with biotinalyted anti-streptavadin and a third staining with phycoerythrin-streptavidin. Each array was scanned using the GeneChip

Scanner 3000 (Affymetrix). The image data was uploaded to the Affymetrix GeneChip®

Operating Software version 1.4 (GCOS). The absolute intensity values of each chip were globally scaled to the same target intensity value of 150 in order to normalize the data for inter-array comparisons. The target intensity levels and detection calls of each gene were generated using the Statistical Expression Algorithm. All genes without „present‟ calls

(i.e., undetectable) for any of the samples were excluded from further consideration.

31 Microarray Analysis

Microarray data was analyzed using GeneSifter software

(http://www.genesifter.net/web/; VizX Labs, Seattle, WA). Differential expression of genes was determined by averaging the triplicate samples for each treatment condition and running a pairwise analysis between treated and control. Statistical significance was determined by Student's t test using the Benjamini-Hockberg false discovery rate adjustment with a p-value of < 0.05 to identify those genes which were increased or deceased by at least 1.5 fold. Only known genes that fit the criteria were included in the list; cDNA clones, transcribed locus, or hypothetical proteins were not included. Genes are named as in NCBI; in cases where genes are predicted based on homologies to chicken sequences, the “similar to” nomenclature has been omitted, and these names are listed in italics.

Conventional RT-PCR

The presence of mRNA encoding chicken VPAC1, VPAC2, and various PAC1 splice variants as well as -actin ( A) or glyceraldehydes-3-phosphate dehydrogenase

(GAPDH) for controls were assessed by reverse transcriptase-based PCR (RT-PCR) as previously described (Burns et al. 1997; Zhou et al. 2004). Total RNA was extracted from E19 brain and E19/E20 CG (Qiagen RNeasy kit, Qiagen Inc., Valencia, CA) following the vendor‟s specifications as described above. An aliquot was removed from each RNA sample and the absorbance ratio at 260 versus 280 nm was used to confirm the purity and the concentrations were calculated from the absorbance at 260nm;

32 concentrations of brain and CG RNAs were 100 and 370 ng/ul respectively. Total RNA

(2 ul) was used to synthesize cDNA in a 10 ul reaction mixture using 0.5ul (200U/ul)

Superscript II reverse transcriptase (RT+; RT- lacked Superscript II reverse transcriptase) in the presence of 5 uM random hexamers, 10 mM DTT, 1 mM each dNTPs (New

England Biolabs; Ipswich, MA), 2U/ul RNasin, 75 mM KCl, 50 mM Tris-HCl, and 3 mM MgCl2. These cDNAs were then used as templates for PCR amplification in 25 ul reaction volumes containing 1x PCR buffer, 1U TaqDNA polymerase, 2.5mM MgCl2,

0.5mM dNTPs (New England Biolabs; Ipswich, MA), and 0.8 uM forward (F) and reverse (R) oligonucleotide primers (synthesized by SeqWright DNA Synthesis

Department; Houston, TX). The forward (F) and reverse (R) primers used (IN 5‟ TO 3‟

ORIENTATION) were:

VPAC1:

F: GACAGTGGGACAACATCACG

R: ACAAAGCAATGTTCGGGTTC

VPAC2:

F: CCTCCACATCCTCCTTGTGT

R: TGTCTGCTTCCAGCACAAAC

33 PAC1 NT:

F “a”: GTCCTGCGCTGTTCAGATTT

F “b”: TCCTGCGCTGTTCAGATTTA

R “a & b”: CCTGAAACGACACAGGATCA

PAC1 hiphop:

F: GATACTGGCTGCTGGGACAT

R: CCCAGTCCCAATTCAAACAC

PAC1 hop:

F: CCCGACAATTTGTGTCACTG

R: CATTTCTGAACGCAGCTGAA

PCR reactions were conducted in a programmable thermocycler (Eppendorf

Master Cycler; Westbury, NY) with reactions starting with 2 min at 94oC, continuing for

30 cycles (30 sec at 94oC, 45 sec at 46oC, 60 sec at 72oC), and followed by 2 min at 72oC.

The amplified PCR products were resolved by gel electrophoresis on a 1.5-2.5% agarose gels stained with ethidium bromide using a 50 bp ladder as a marker. All PCR reagents were obtained from Invitrogen (Carlsbad, CA) unless otherwise stated.

34 Real-time RT-PCR

PACAP induced changes in mRNA expression of WAS3, WAS1, NESH3,

Urocortin 3, Synapsin IIa, and HAND2 were determined using real-time RT-PCR as previously described (Zhou et al. 2004). Qiagen RNeasy kit protocols were used as described above to extract RNA from E8 CG neuron cultured for 4 days with or without

PACAP treatment (100 nM) for the final 24, 48, 72, or 96hrs. Reverse transcription was performed for each sample using 50 ng RNA. The resulting cDNAs were then used in the real-time PCR reaction performed with Taq-man universal PCR master mix (Rouche;

Branchburg, NJ), forward (F) and reverse (R) primers (0.4 uM), and Taqman probes (0.1 uM) with 6-FAM (carboxyfluorescein) reporter dye and TAMRA (tetramethylrhodamine) quencher dye inserted at 5‟ and 3‟ ends respectively. Primers and probes were designed using Primer express software (Applied Biosystems, Foster City, CA). HAND2 primers and probes were taken from Liu et al. 2005. As a cytoplasmic marker for mRNA normalization, GAPDH mRNA levels were also determined (Stone et al. 1985; Zhou et al. 2004). The forward (F) and reverse (R) primers and Probes used (ALL IN 5‟ TO 3‟

ORIENTATION) were:

WAS 3:

F: CAAATTCCCTTCAAGACAGAATCG

R: AGTGATACTTCTTCTACCGTTGAATCC

Probe: 6FAM-TCGCCTTGCTGTCAAAGTTACCCAGC-TAMRA

35 WAS 1:

F: TCCACCGTCCCAAGTGATTC

R: GCATCACTGATTACAGGAAGAGTTG

Probe: 6FAM-CTCCTGAACCCAAACGCCACCCT–TAMRA

NESH 3:

F: TGCTCTGGAACCAATTACGTTTAG

R: GTTTGGCAGGCCCATGAC

Probe: 6FAM-TGAAAAACCAAAGTCAACGTCAGTTCCTAGAGA

GAC-TAMRA

Urocortin 3:

F: CGCCAATGCACATCTCATG

R: CTGCCCCACGAGCATCA

Probe: FAM6- CCCAAATTGGGCGGCGGAA- TAMRA

Synapsin IIa:

F: AAGCCAGGAGCCATTGCA

R: AAGTGGAGGGCTTTGCTGACT

Probe: FAM6- CAGCGCATGTACCCCCCTGGG- TAMRA

36 HAND 2:

F: AGGACTCAGAGCATCAACAGCG

R: TCCATGAGGTAGGCGATGTAGC

Probe: 6FAM-CCGCCGACACCAAGCTCTCTAAGATCA-TAMRA

GAPDH:

F: CCGTCCTCTCTGGCAAAGTC

R: AACATACTCAGCACCTGCATCTG

Probe: 6FAM-ATCAATGGGCACGCCATCACTATCTTCC-TAMRA

The PCR reactions (25 ul) were performed in triplicate using a GeneAmp 5700 detection system (Applied Biosystems, Foster City, CA) which was based on the threshold number of cycles (CT) required to produce a detectable change in fluorescence allows increases in PCR products to be directly monitored. Relative levels of cDNA for each gene of interest were determined by calculating the difference in CT values for amplification in control versus PACAP treated samples compared to those of the housekeeping gene, GAPDH.

37 RESULTS

PACAP localization and release

Although radioimmunoassay (RIA) has previously been used to demonstrate the presence of PACAP in the chick CG (Margiotta and Pardi 1995; Pugh and Margiotta

2006), PACAP‟s location and mechanism of release in the CG are unknown. It is plausible that PACAP is localized to presynaptic terminals with ACh since it is known that neuropeptides often co-localize with conventional neurotransmitters at presynaptic terminals and can be co-released (Hokfelt et al. 2000). This possibility seems likely, especially when the fact that PACAP has been shown to modulate nAChRs and modulate synaptic function in the CG is taken into consideration (Margiotta and Pardi 1995; Pardi and Margiotta 1999). Therefore, as a preliminary experiment to access PACAP‟s potential for modulating gene expression, its localization and voltage-dependent release in situ was first determined. In the chick CG, ciliary neurons receive 1:1 cholinergic input from accessory occulomotor neuron axons that terminate in a distinctive calyx enveloping most of the postsynaptic neuron surface (Hess 1965; Landmesser and Pilar

1972; Cantino and Mugnaini 1975; Paysan et al. 2000). Consistent with their role as presynaptic terminals, calyces are strongly immunoreactive for SV2 (Wilson Horch and

Sargent 1995) and Synapsin-1 (Fig. 1). It was determined that Synapsin-1 and PACAP immunolabeling overlap considerably, indicating that PACAP co-localizes with ACh in presynaptic terminals within the CG (Fig. 1 Merged Control).

38

39 Previous studies have shown that neurotransmission from calyx to ciliary neuron reliably follows stimuli delivered at frequencies up to 50 Hz (Dryer and Chiappinelli

1985) and that 20 Hz stimulation is sufficient to trigger PACAP release from splanchnic nerve terminals (Lamouche and Yamaguchi 2003) where it is a co-transmitter with ACh

(Hamelink et al. 2002). Consistent with activity-dependent PACAP release in the CG, sustained depolarization achieved by treating ciliary ganglia with 50 mM KCl (30 min) selectively abolishes PACAP immunolabeling in calyces, leaving Synapsin-1 immunolabeling unaffected (Fig. 1 KCl).

Dose dependence of PACAP-induced CREB activation

Since PACAP is depleted by depolarization, bouts of synaptic activity likely cause its release from presynaptic terminals. Such localized, activity-dependent release would suggest PACAP can not only modulate synaptic function, but can also regulate gene transcription relevant to maintaining or changing synaptic properties. This would require PACAP to be capable of regulating transcription factor activity. The transcription factor CREB is activated by phosphorylation at Ser133 producing PSer133-CREB (pCREB), a signal that is readily detectable with antibodies recognizing PSer133 of pCREB and routinely used as an initial assay to explore alterations in neuronal gene expression

(Shaywitz and Greenberg 1999). Previous studies from this laboratory indicated that

PACAP (100nM) reliably activated CREB in CG neuron nuclei (Zhou et al., 2004). In the present experiments, the dose-, receptor-, signaling pathway- and time-dependence of this effect were determined using acutely dissociated E14 CG neurons which were treated

40 with PACAP under various conditions and then fixed and immunostained for pCREB

(Bito et al. 1996; Wicht et al. 1999; McIlvain et al. 2006; Lalonde and Chaudhuri 2007;

McPherson et al. 2007).

Images of CG neuron preparations reveal that 15 min PACAP exposure increased both the incidence of neurons displaying pCREB immunoreactive nuclei and the intensity of nuclear pCREB immunofluorescence ( F/F) in a concentration dependent manner

(Fig. 2A). Quantification within randomly chosen microscope fields revealed similar dose-dependencies for both the incidence of pCREB positive nuclei as well as the F/F values of individual immuno-positive neuronal nuclei (Fig. 2B). In particular, varying

-11 the PACAP concentration predicted EC50 values of 6 X 10 M for incidence and

9 X 10-11M for F/F, with maximal results for both achieved using 10-9 M through 10-7 M

PACAP. At 10-7 M PACAP, the mean incidence of pCREB positive neurons within randomly chosen microscope fields was 93 ± 3% (N=15 fields, 65 neurons), significantly larger than the corresponding value of 32 ± 6% (N=15 fields, 62 neurons) obtained from untreated controls within the same experiments (p<0.05). In the same microscope fields,

F/F values in neurons that scored as pCREB positive were also significantly increased following 10-7 M PACAP treatment relative to untreated controls (3.23 ± 0.19 versus 1.98

± 0.24, respectively, p<0.05). These results indicate PACAP potently and significantly stimulates both the incidence and intensity of CREB phosphorylation in CG neurons and thus results in the activation of this transcription factor.

41

42 Presence of VPAC receptors and PAC1 receptor splice variants

Although PACAP is capable of binding to three types of GPCRs, thus far only

PAC1 has previously been implicated in mediating PACAP induced effects in the chick

CG (Margiotta and Pardi 1995); Pugh and Margiotta, unpublished). Therefore, prior to determining the contributions of PAC1 and VPAC receptors (VPAC1 and VPAC2) in mediating the PACAP induced phosphorylation of CREB, it was first determined if the

VPAC receptors are expressed in the chick ciliary ganglia. This was performed by conventional RT-PCR with RNA that was extracted from E19/E20 CG and, as a comparison, RNA from whole E19 chick brain was also used. The amplified PCR products were resolved by gel electrophoresis.

Primers sets were designed against sequences in VPAC1 and VPAC2 mRNA. The expected length of the PCR products obtained using the VPAC1 primers was 432 bp and

518 bp for the VPAC2 primers. Products of the expected sizes were produced using the

VPAC1 and VPAC2 primers in the CG but not in the brain. Additionally, VPAC1 primers produced an unidentified, smaller product in the CG (VPAC1 and VPAC2 in Fig. 3B).

These results indicate that despite prior evidence that only PAC1 receptors are present to mediate PACAP effects in the CG neurons, VPAC receptors are present as well.

The human PAC1 receptor is presently known to have 18 splice variants, most of which involve the inclusion or exclusion of the N-terminal exons 4, 5, and 6 and the third intracellular loop exons 14 and 15 resulting in differences in ligand binding affinities or signal pathway and ion channel activation respectively (Lutz et al. 2006). Since it is

43 unknown which splice variants are present in the chick CG, PCR primers against the

PAC1 receptor mRNA sequence were also designed (Fig. 3A).

To determine if PAC1 receptors in the chick CG contain exons 4, 5, and 6, two forward primers and one reverse primer were designed against sequence regions flanking these exons (PAC1-NT a & b primer sets). In the PAC1 receptor, exon 4 is 108 bp, exon

5 is 21 bp, and exon 6 is 42 bp (Table 1). Therefore, using the PAC1-NT a primer set, a

PCR product that is 317 bp in length is expected if the PAC1 receptors present contain all three exons, 296 bp if exon 5 is absent, 254 bp if exons 5 and 6 are both missing, and 146 bp if all three exons (4, 5, and 6) are absent (Fig 3A). The PAC1-NT b primer set would be expected to produce PCR products only one base pair less than those predicted for the

PAC1-NT a primer set due to the placement of the forward primer; 316bp, 294bp, 252bp, and 144bp respectively. Only one product, corresponding to the maximum expected size, was observed using either the PAC1-NT a or PAC1-NT b forward primer in both the brain and the CG, indicating that the only PAC1 receptors present contain all three exons (4, 5, and 6) in the N-terminal (PAC1-NT a and PAC1-NT b in Fig. 3A & 3B).

To determine if the PAC1 receptors present contain exons 14 and 15 (also known as the hip or hop cassettes respectively) two sets of primers were designed (Fig. 3A). The first set of primers were designed against regions of the mRNA sequence flanking exons

14 and 15 (PAC1 hiphop in Fig. 3A). Exon 14 (hip) is 84 bp while exon 15 (hop) has two variants, hop1 (84 bp) and hop2 (81 bp), with hop1 having an additional glutamate

44

45

46 residue (Table. 1). Since both exons are of similar sizes, this first set of primers will demonstrate if the PAC1 receptor splice variants present in the chick CG contain neither, both, or one of the two exons. The predicted product sizes for this primer set are approximately 455-458 bp if both exons are present, 290 bp if neither exon is present, and 371-374 bp if one exon is present depending on whether the additional glutamate residue is present or not (Fig 3A). Products corresponding to all three of the expected sizes were observed in the chick CG as well as the brain, using the PAC1 hiphop primers

(PAC1 hiphop in Fig. 3C). These results indicate that PAC1 splice variants are present that contain both exons, lack both exons, or either one of the two exons in the third intracellular loop region. To specifically determine if PAC1 splice variants containing exon 15 (hop) are present in the chick CG a second set of primers were designed. For this primer set, the forward primer was also designed against the sequence before exon

14, while the reverse primer was designed against the hop cassette itself (exon 15) (PAC1 hop in Fig. 3A). Therefore, it can be expected that if the PAC1 splice variant containing the hop cassette is not present in the chick CG there will be no product at all, if the hop cassette is present then the predicted product sizes are approximately 237 bp if the hip cassette is absent, and 321 bp if the hip cassette is also present (Fig. 3A). One product was observed in the brain and a single bright band of the same size was in the CG.

Although the size of these products (approximately 265 bp) did not correspond with either of the expected sizes, the presence of a RT-PCR product indicates the presence of

PAC1 receptors containing the hop sequence (PAC1 hop in Fig. 3C).

47 PAC1 Receptor-dependence of PACAP-induced CREB activation

In order to identify the PACAP receptor type relevant for mediating CREB activation, the potencies of different peptide agonists were compared. Of the three GPCR types that recognize PACAP with high affinity (VPAC1, VPAC2, and PAC1), VPAC1 and

VPAC2 receptors have comparable affinities (Kd ~1nM) for PACAP and for vasoactive intestinal peptide (VIP) a closely related neuropeptide sharing 68% amino acid identity with PACAP (Vaudry et al. 2000). By contrast, PAC1 is a PACAP-specific receptor, having a 100-1000 fold higher affinity for PACAP than for VIP (Kd ~ 0.5nM versus

>500nM respectively) (Vaudry et al. 2000). The relative potency of VIP in activating

CREB in CG neurons was therefore compared to that of PACAP using the immunostaining and imaging approaches described above (Fig. 4). While VIP activated

-9 -6 CREB in CG neurons, the EC50 for pCREB incidence was 9.6 X 10 M, and a 10 M dose was required to achieve 90% incidence (Fig. 4A), concentrations that were 100- and

-11 1000-fold higher than those seen for PACAP (EC50 = 6 X 10 M Fig. 2). In accord with its lower potency for increasing the incidence of pCREB, VIP was also less potent in

-8 increasing F/F in pCREB positive neurons (EC50 = 2 X 10 M, data not shown)

-11 compared to PACAP (EC50 = 9 X 10 M, Fig. 2). These findings are consistent with

PACAP acting via PAC1 receptors to induce pCREB in CG neurons.

Further verification of PAC1 receptor involvement in CREB activation was obtained using a PAC1 receptor agonist (maxadilan) and antagonist (P6-38). Maxadilan, a vasoactive sandfly peptide, is a highly selective PAC1 agonist as demonstrated with

48

49 binding competition studies between maxadilan, VIP, and PACAP in COS cells expressing the PAC1 or VPAC receptors (Moro and Lerner 1997). Treating CG neurons with maxadilan mimicked the effect of PACAP, with 1 and 100 nM doses producing concentration-dependent increases in the incidence (39 ± 7% and 89 ± 6% respectively) and intensity ( F/F; 1.64 ± 0.32 and 2.34 ± 0.24 respectively) of pCREB nuclear labeling relative to untreated controls (22 ± 11% and 0.91 ± 0.19 F/F) (Fig. 4B and data not shown). PACAP(6-38) is a truncated form of PACAP that functions as a specific PAC1 receptor antagonist since it lacks the first 5 amino acids required for activation

(Robberecht et al. 1992). Pre-incubating CG neurons with 10-7 M PACAP (6-38), followed by co-treatment with the antagonist and PACAP, reduced the incidence of pCREB from 92 ± 6% in neurons treated with PACAP (N=5 fields, 17 neurons) to

60 ± 4% in neurons treated with PACAP and antagonist (N=5 fields, 38 neurons) (Fig.

4B; p<0.05). A similar reduction in intensity was also observed (2.07 ± 0.39 versus 1.18

± 0.17, respectively, p<0.05, Data not shown). Taken together, the results of these experiments indicate that potent activation of pCREB in CG neurons is mediated by

PAC1 receptors with little or no contribution from VPAC receptors.

Signaling Pathway from PACAP to CREB

PAC1 receptors couple via two distinct G-proteins that stimulate canonical AC- and PLC-dependent transduction cascades, causing either cAMP accumulation and PKA- dependent phosphorylation, or inositol phospholipid (IP) turnover, PKC-dependent

2+ phosphorylation, and IP3-mediated Ca mobilization, respectively (Margiotta and Pardi

50 1995). To assess the relative contribution of AC- and PLC-dependent cascades in signaling from PAC1 to pCREB, pharmacological reagents were used that perturb relevant signal transduction steps (Fig. 5). Using this approach, PLC-dependent processes appear dispensable since inhibiting PLC with U73122, previously shown to be sufficient to block PACAP-induced IP turnover and Ca2+ mobilization in CG neurons

(Pardi and Margiotta, 1999) failed to interfere with the ability of PACAP to activate

CREB. Additionally, inhibition of PKC activity with Bis I did not reduce PACAP induced phosphorylation of CREB. Moreover, preventing intracellular Ca2+ elevation by depleting intracellular stores with Ryanodine or Thapsigargin, pre-treating with the membrane permeant calcium chelator BAPTA-AM, or blocking L-type Ca2+ channels with Nifidipine failed to reduce PACAP‟s ability to activate CREB. By contrast, the

PKA pathway appears important for PACAP activation of CREB since inhibiting PKA with either H89, shown previously to block AC-dependent PACAP modulation of nAChR function (Pardi and Margiotta 1999), or with KT5720 both significantly reduced pCREB incidence (79 ± 6% and 36 ± 6% respectively) and intensity (1.25 ± 0.0.24 and

1.8 ± 0.37 respectively) in CG neurons compared to PACAP alone (98 ± 2% and 4.88 ±

0.28 F/F; p-value <0.05) (Fig. 5 and data now shown). PKA is a critical intermediate for CREB activation in other systems and H89 has previously been shown to block

CREB activation in striatal neurons (Das et al. 1997) schwann cells (Lee et al. 1999) while KT5720 has been used in hippocampal neurons (Lu et al. 1999) and SH-SY5Y

51

52 cells (Kim et al. 2002). However, two other PKA inhibitors (Rp-cAMP and PKI) and three AC inhibitors (MDL12330A, SQ22536, or ddA) failed to significantly inhibit

PACAP-induced CREB activation (Fig. 5).

Kinetics of PACAP-induced CREB activation

The ability of PACAP to regulate gene transcription relevant to maintaining or changing synaptic properties would require both that PACAP activates transcription factors such as CREB on a rapid time scale, and that the activation persists long after

PACAP is removed. Both predictions were observed. Images of CG neuron preparations reveal that varying durations of 1nM PACAP exposure increased both the incidence of neurons displaying pCREB immunoreactive nuclei and the intensity of nuclear pCREB immunofluorescence (Fig. 6A). As seen in CG neurons exposed to PACAP (1nM or

100nM) for varying times, full activation of CREB incidence and intensity (% and DF/F) was achieved with exposures as brief as 1 min for 100 nM PACAP and 5 min for 1nM

PACAP (Fig. 6B and data not shown). Moreover, after incubation with PACAP (100nM) for 15 min, pCREB incidence remained elevated for at least 90 minutes while control neurons showed baseline levels of phosphorylated CREB (Fig. 6C). These results support the hypothesis that PACAP is capable of activating CREB rapidly and persistently, as required to result in changes in gene expression in situ.

53 54 Regulation of Gene Expression by PACAP Treatment

PACAP is known to mediate both short-term and long-term effects. In the chick

CG, this laboratory has demonstrated that PACAP modulates nAChRs in a matter of minutes while effects on survival can take days (Margiotta and Pardi 1995; Pardi and

Margiotta 1999; Pugh and Margiotta 2006). A possible mechanism for these effects is changes in gene expression. Therefore, the Affymetrix 28K chicken gene array was utilized to study the effects of both short-term and long-term exposures of PACAP on the global levels of gene transcription. Embryonic day 8 (E8) chick CG neurons were cultured for 4 days before extracting RNA to examine three different PACAP (100nM) treatment times. CG neurons were pulsed with PACAP for 15 minutes followed by a 6hr wash-out before RNA extraction, neurons were incubated with PACAP for the final

24hrs of the 4 day culturing, and PACAP was applied immediately following plating and allowed to remain present for the full 96hrs before RNA extraction. Microarray experiments were performed in triplicate for each condition with controls for each of the three PACAP treatments.

Microarray results revealed that there were significant differences in gene expression in CG neuron cultures following PACAP treatment compared to controls.

Data was analyzed using Genesifter to generate a list of 672 known genes altered by

PACAP by at least 1.5 fold (p-value < 0.05) in at least one of the three PACAP treatment conditions (Table 2). These 672 PACAP regulated genes were classified by their function and sorted into one of 12 categories (Table 2 and Figure 8).

55 Table 2. Transcripts regulated by PACAP in CG neuron cultures Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Peptides / Hormones / Transmitters Adenylate cyclase activating polypeptide 1 (pituitary) 3.77 1 1 ATL-derived PMA-responsive peptide 1.64 1 1 C-type natriuretic peptide I precursor 1 1 -2.05 Ephrin-A5 1 1.64 1 Follicle stimulating hormone, beta polypeptide 2.3 1 1 Galanin 1 1 -3.29 Gastrokine 2 1 1 -2.27 Glycoprotein M6A 1 1 -1.58 Neuromedin U 1.78 2.82 7.18 Prepronociceptin 1.66 1.78 1 Preprourotensin II 9.23 5.77 1 Prepro-urotensin II-related peptide 2.85 3.06 1 Proenkephalin 1 2.59 4.7 Prolactin-b 3.13 3.58 1.59 Tcte-1 peptide 1 1 -1.97 Urocortin 3 5.82 13.01 1

Peptide processing enzymes Carboxypeptidase Z 1 1.89 1 Endothelin converting enzyme-like 1 1 1 -2.01 HtrA serine peptidase 3 1 1.56 1 peptidylglycine alpha-amidating monooxygenase 1.76 1 1

Growth factors / Cytokines / Chemokines Angiopoietin Y1 1 1 1.5 Angiopoietin-2B (Ang-2B) 1 1 1.73 Bone morphogenetic protein 2 2.01 1 1 Bone morphogenetic protein 7 (osteogenic protein 1) 1 1 -2.71 CCR4 carbon catabolite repression 4-like (S. cerevisiae) 1.94 1 1 Chemokine K203 1 1 2.49 Fibroblast growth factor 10 1 1 1.9 Fibroblast growth factor 12 1 1.58 1 Fibroblast growth factor 13 1 1.64 1 Fibroblast growth factor 14 1 1.51 1 Fibroblast growth factor 19 1 1 -2.29 Fibroblast growth factor 7 (keratinocyte growth factor) 3.49 1 1 Follistatin 3.37 1 1 Follistatin-like 4 2.04 1 1 Hepatoma-derived growth factor, related protein 3 1 1 -1.55 Interleukin 16 (lymphocyte chemoattractant factor) -1.84 1 1.58 Interleukin 6 (interferon, beta 2) -1.82 1 1 Nerve growth factor, beta polypeptide 1.93 1 1 Neuregulin 4 1 1 -1.74 Neuronal growth regulator 1 1 -1.66 -2.62 Oxidative stress induced growth inhibitor 1 1 1 1.73 Platelet derived growth factor D 1 1 1.73 RANTES factor of late activated T lymphocytes-1 1 1 1.53

56 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Growth factors / Cytokines / Chemokines (Continued) Suppressor of cytokine signaling 1 -1.99 -1.79 1 Suppressor of cytokine signaling 2 -1.84 1 1 TAFA1 1 1 -1.67 Transforming growth factor, beta 3 1 2.51 2.15 Tumor necrosis factor ligand superfamily member 4 -1.66 1 1 tumor necrosis factor, alpha-induced protein 2 1 3.29 1 tumor necrosis factor, alpha-induced protein 8-like 3 1.81 2.44 1

Receptors / Effector / Associated proteins 5-hydroxytryptamine (serotonin) receptor 2C 1.58 1 1 5-hydroxytryptamine 2C receptor 2.28 1.71 1 Adenosine A1 receptor 1.51 1.64 1.5 adenylate cyclase activating polypeptide 1 (pituitary) receptor type I 1 1.78 1 Alpha1A-adrenoceptor 1 1 -1.79 Anaplastic lymphoma kinase receptor 1 1.87 1 Arrestin domain containing 3 2.24 1 1 brain-specific angiogenesis inhibitor 3 -1.63 1 1 Calcium and integrin binding family member 2 -1.53 1 1 Cannabinoid receptor 1 (brain) 1 1.96 1 CD36 molecule (thrombospondin receptor) 1 1 1.69 CD47 molecule 1.63 1.55 1 CD82 molecule 1 1 1.64 cholinergic receptor, muscarinic 4 -1.74 1 -1.51 Cholinergic receptor, nicotinic, alpha 5 1 1 -2.51 Cholinergic receptor, nicotinic, alpha 7 1 1.97 1 C-mer proto-oncogene tyrosine kinase 1 1 1.53 coagulation factor II (thrombin) receptor-like 1 1 1 1.62 Complement receptor 1 1.66 1 1 Copine IV 1 -1.52 -1.66 Delta/notch-like EGF repeat containing 1 1 -1.65 dopamine receptor D1 2.17 1 1 EPH receptor A3 -1.5 1 1 EPH receptor A5 1 1 -1.74 EPH receptor A7 -1.65 1 -1.94 Fms-related tyrosine kinase 1 1 1 -1.53 Follicle stimulating hormone receptor -1.66 -1.86 -1.6 G protein-coupled receptor 1 1 1 1.56 G protein-coupled receptor 149 2.29 1 -1.53 G protein-coupled receptor 23 1 1 1.52 Glutamate receptor 1 1 -1.84 Glutamate receptor, ionotrophic, AMPA 3 1 -1.59 -1.92 Glutamate receptor, metabotropic 4 1 -1.92 -2.19 glutamate receptor, metabotropic 8 -1.66 -1.71 1 Homer-1b 1 1 -1.56 Interleukin 1 receptor, type I 1.5 1 2.89 Interleukin 1 receptor-like 1 1 -1.62 -3.19 Interleukin 13 receptor, alpha 2 1 1 1.94

57 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Receptors / Effector / Associated proteins (Continued) Interleukin 20 receptor, alpha 1.92 2.99 1 Interleukin 23 receptor 1.53 1 1 interleukin 7 receptor 1 -1.52 1 KIAA0550 protein -1.52 1 1 Liprin-beta-2 -1.5 1 1 Melatonin receptor 1B 1 -2.07 -2.6 Membrane associated guanylate kinase-like protein; DLGH3 1 1.66 1 Metabotropic glutamate receptor 8b 1 1 -1.71 Metabotropic glutamate receptor mGluR7 1 1 -1.55 mKIAA1232 protein 1 1.51 1 Neurotrophic tyrosine kinase, receptor, type 2 1.62 1 -1.82 Nuclear receptor subfamily 2, group C, member 2 -1.76 1 1 nuclear receptor subfamily 4, group A, member 2 1.85 1 1 Nuclear receptor subfamily 4, group A, member 3 2.16 1 1 P2Y-like G-protein coupled receptor 1 1 -1.52 parathyroid hormone receptor 1 1 2.40 1 PDZ domain-containing guanine nucleotide exchange factor PDZ-GEF2 -1.64 1 1 Pleckstrin homology domain containing, family B (evectins) member 1 1 1 -1.53 plexin A2 1 1.88 1 Plexin A2 1 1 1.95 Plexin-A4 1 2.12 1 prostaglandin E receptor 4 (subtype EP4) 1.97 1 1 protein tyrosine phosphatase, receptor type, B 1 1.85 1 Protein tyrosine phosphatase, receptor type, O 1 1 -1.78 Putative membrane steroid receptor 1 -1.58 1 RAP1, GTP-GDP dissociation stimulator 1 1 2.7 1.81 Rap2 interacting protein x 1 1 -1.51 Receptor (G protein-coupled) activity modifying protein 3 1 -1.65 1 Receptor tyrosine kinase-like orphan receptor 1 -1.51 1 1 Regulator of G-protein signalling 17 1 1 -1.75 Regulator of G-protein signalling 2, 24kDa 1.75 1 1 Regulator of G-protein signalling 20 1 1 -1.74 Regulator of G-protein signalling 3 -2.3 1 1 Regulator of G-protein signalling 4 1 -1.83 -2.81 Regulator of G-protein signalling 7 1 1.91 1 Reticulon 4 receptor -4.96 1 1.5 Retinal G protein coupled receptor 1 1.68 1 SAM domain and HD domain 1 1 1 -1.59 Scavenger receptor class B member 1 1 1 -1.59 SH3-domain GRB2-like 2 1 1.72 1 sortilin-related VPS10 domain containing receptor 3 -1.71 1 1 Sulfonylurea receptor 1 1 -1.63 Syndecan 3 1 1.76 1 Teneurin 2 1 1 -1.69 toll-like receptor 7 1 1 1.5 Transient receptor potential cation channel, subfamily C, member 4 1 1 -2.01 Transient receptor potential protein 1 1 1.56

58 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Receptors / Effector / Associated proteins (Continued) Transient receptor potential protein-like mRNA, partial sequence 1 1 1.52 Tumor necrosis factor receptor superfamily, member 6b, decoy 1.85 1.82 1 Tumor-associated calcium signal transducer 1 1 1.53 1 TYRO3 protein tyrosine kinase 1.66 1 1 Very low density lipoprotein receptor -1.5 1 1 Vitamin D (1,25- dihydroxyvitamin D3) receptor 1.83 1 1 WAS protein family, member 3 -1.55 1 -1.73

Transcriptional factors / Associated proteins Achaete-scute complex homolog 1 (Drosophila) 1 1 -1.98 Activating transcription factor 3 1.59 -1.97 1 AF4/FMR2 family, member 3 -1.55 1 1 B-cell CLL/lymphoma 6 (zinc finger protein 51) 1.58 1 1 bHLH factor Math6 1.79 1 1 bHLH protein Hesr-1/Hey1 1 1.57 1 Bromodomain adjacent to zinc finger domain, 1B -1.7 1 1 BTB (POZ) domain containing 8 1 1.63 1 Cajalin 2 1 1 -1.52 CAMP responsive element binding protein-like 2 1 1 -1.51 CCAAT/enhancer binding protein (C/EBP), beta 1 1 1.51 Chromobox homolog 4 (Pc class homolog, Drosophila) 1.54 1 1 Core histone macroH2A2.2 2.43 1 1 Cysteine-rich secretory protein LCCL domain containing 1 1 1 1.78 Dickkopf homolog 1 (Xenopus laevis) 1 -1.88 1 DNA helicase HEL308 -1.51 1 1 Domesticus (clone 1.6 kB) islet-2 1.59 1.88 1 Early B-cell factor 1 -1.71 1 -1.57 Early growth response 1 2.2 1.61 1.57 ELL associated factor 2 2.37 1 1 Ets domain protein 1 1.6 1.62 Ets variant gene 1 1 1 1.55 GLI pathogenesis-related 1 (glioma) 1 1 1.52 GPBP-interacting protein 130b -1.57 1 1 Heart and neural crest derivatives expressed 2 1.73 2.43 1 HIV-1 Tat interactive protein 2, 30kDa 1 1 -1.57 IBR domain containing 1 3.11 1 1 ICER protein 3.69 1 1 IKAROS family zinc finger 2 (Helios) -1.72 1 1 Interferon regulatory factor 4 1.75 1 1 Interferon regulatory factor 6 1 1.6 1 ISL1 transcription factor, LIM/homeodomain, (islet-1) 1.68 1 1 Jumonji domain containing 1C -1.69 1 1 Jun dimerization protein p21SNFT 1.55 1 1 KIAA0298 protein 1.56 1 1 KIAA0940 protein 1 1.55 1 KIAA1718 protein 1.67 1 1 Kruppel-like factor 7 (ubiquitous) -1.5 1 1

59 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Transcriptional factors / Associated proteins (Continued) Lymphoid enhancer-binding factor 1 -1.65 1 1 Mesenchyme homeobox 2 -1.5 1 1 myelin transcription factor 1-like 1 1.53 1 Osteoblast regulatory factor 3A 1.51 1 1 Piwi-like 1 (Drosophila) 1 1.9 1 Probox protein 1 1 1.52 Rel-associated pp40 (LOC396093), mRNA 1 1.57 1 Single stranded DNA binding protein-2 1 1.59 1 SRY (sex determining region Y)-box 11 -1.58 1 1 SRY (sex determining region Y)-box 5 -1.59 1 1 synovial sarcoma translocation gene on chromosome 18-like 1 -1.64 1 1 T-box 20 1 1.68 -1.62 teashirt family zinc finger 1 1.55 1 1 Teashirt family zinc finger 3 1 1 -1.78 Transcription elongation regulator 1-like 1 1.69 1 Transcription factor 7-like 2 (T-cell specific, HMG-box) 1 1.6 1 transcription factor AP-2 gamma -1.58 1 1 V-ets erythroblastosis virus E26 oncogene 1 1 1.5 V-fos FBJ murine osteosarcoma viral oncogene homolog 1.62 1 1 V-maf musculoaponeurotic fibrosarcoma oncogene homolog A 1 1 1.84 V-myc myelocytomatosis viral related oncogene, neuroblastoma derived -1.64 1 1 Yes-associated protein 1, 65kDa -1.59 1 1 zinc finger and BTB domain containing 38 -1.64 1 1 zinc finger protein 238 1.56 1 1 Zinc finger protein 291 1.55 1 1 zinc finger protein 295 -1.56 1 1 zinc finger, FYVE domain containing 28 1.75 1 1 zinc finger, matrin type 4 1 1.6 1

Intracellular signal transduction molecules 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 1.55 1 1 ABI gene family, member 3 (NESH) binding protein 1 1 -2.65 Adenylyl cyclase 1 1 -1.65 ankyrin repeat and kinase domain containing 1 1.57 1 1 ankyrin repeat domain 9 1 1.85 1 ARPP-21 protein 1 1.73 1 Ataxin 2-binding protein 1 1 1 -1.68 BC033915 protein 1 1.51 1 Calcipressin 1 large 1.63 1 1 Calcium/calmodulin-dependent protein kinase ID 1.51 1 1 calcium/calmodulin-dependent serine protein kinase (MAGUK family) -1.5 1 1 Calmodulin-dependent phosphodiesterase 1 1 -2.3 Cas-Br-M (murine) ecotropic retroviral transforming sequence b 1.82 1 1 Caspase recruitment domain protein 7 -1.7 1 1 Centaurin, gamma 3 1.5 1 1 Chondrolectin 1 -1.92 -1.93 dedicator of cytokinesis 9 1 1.87 1

60 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Intracellular signal transduction molecules (Continued) Dedicator of cytokinesis protein 9 (Cdc42 GEF zizimin 1) 1 1.72 1 diacylglycerol kinase, theta 110kDa 2.32 1 1 Downstream of tyrosine kinase 5 1 1 -1.74 Dual specificity phosphatase 1 1.73 1 1 Dystrobrevin alpha 1 1 -1.56 Engulfment and cell motility 1 isoform 1; ced-12 homolog 1 -1.5 1 1 FYN oncogene related to SRC, FGR, YES 1 1 -1.56 GTPase activating Rap/RanGAP domain-like 4 1 1.88 1 GTP-binding protein SB128 1.62 1 1 Guanine nucleotide binding protein (G protein), inhibiting activity polypeptide 1 1 1 -1.51 JNK3 beta2 protein kinase 1 1.76 1 Kelch repeat and BTB (POZ) domain containing 2 1 -1.53 1 KIAA0712 protein -1.69 1 1 KIAA0882 protein 1 1 -1.55 KIAA1700 protein 1 1 1.53 LOC540879 protein 1 1 1.52 MGC81705 protein 1.53 1 1 MGC83985 protein -1.54 1 1 mitogen-activated protein kinase 10 1 1.5 1 Mitogen-activated protein kinase 8 1 1.6 1 Muscle RAS oncogene homolog 1 1 -1.67 Neuroepithelial cell transforming gene 1 1.6 1 1 NOD3 protein; CARD15-like 1.84 1 1 Nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 1.63 1 1 OTTHUMP00000016670 1 1 -1.59 PCTAIRE protein kinase 2 1.6 1 1 Phosphatidylinositol 3-kinase regulatory subunit alpha 1 -1.52 -1.84 phosphodiesterase 10A 1.67 1.51 1 Phosphodiesterase 3B, cGMP-inhibited 2.35 1 1 Phosphodiesterase 4B, cAMP-specific 2.44 1 1 phosphodiesterase 7B 1.54 1 1 phosphodiesterase 8A 1 1 1.53 phosphodiesterase 8B 1.63 1 1 phosphoinositide-3-kinase, catalytic, beta polypeptide 1.73 1 1 Phosphoinositide-3-kinase, regulatory subunit 5, p101 1.62 -1.53 1 phospholipase C, beta 1 (phosphoinositide-specific) 1 1.66 1 Phospholipase C, eta 1 1.97 1 1 phosphoprotein associated with glycosphingolipid microdomains 1 -1.74 1 1 Pim-3 protein 3.27 2.25 1 PREX1 protein -1.72 1 1 protein kinase C, eta 1.98 1 1 Protein kinase C, eta 2.21 1.74 1 protein phosphatase 1, regulatory (inhibitor) subunit 14C 1 2.17 1.57 Protein phosphatase 1, regulatory (inhibitor) subunit 9A 1 1 -1.51 protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform 1 1 -1.75 protein phosphatase 2C, magnesium-dependent, catalytic subunit 1 -1.67 1 Protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform 1 1 -1.57

61 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Intracellular signal transduction molecules (Continued) Protein tyrosine phosphatase, non-receptor type 2 1.63 1 1 Putative serine/threonine kinase SADA gamma 1 1 -1.52 RAB15 1 1 -1.57 Rab26 protein 1 1 -2.29 RAB31, member RAS oncogene family 1 1 1.57 RAP1 GTPase activating protein 1 1.61 1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 -1.52 1 1 RAS guanyl releasing protein 3 (calcium and DAG-regulated) 1 1 1.99 RAS p21 protein activator 3 -1.58 1 1 RAS, dexamethasone-induced 1 1.91 1 1.86 RAS-like, estrogen-regulated, growth inhibitor 1 1.55 1 RAS-like, family 11, member A 1 -1.96 1 Rho GTPase activating protein 20 1.85 1 1 Rho GTPase activating protein 24 1 1 1.54 Rho guanine nucleotide exchange factor (GEF) 17 1 2.12 1 Rho-GAP domain containing protein ARHGAP12b 1.58 1 1 ring finger and FYVE-like domain containing 1 1.56 1 1 Serine/threonine kinase 17b -1.56 1 1.62 Serine/threonine kinase 32A 1 1 -1.54 serine/threonine kinase 32B 1 1 -1.77 Serum/glucocorticoid regulated kinase family, member 3 1 1 1.51 SH3 and cysteine rich domain 1.82 1.93 1 SLIT-ROBO Rho GTPase activating protein 1 1.5 1 1 SNF1-like kinase 2.74 1 1 sparc/osteonectin, cwcv and kazal-like domains proteoglycan (testican) 3 1 2.26 1 Sperm associated antigen 9 1 1 -1.52 Sprouty homolog 2 (Drosophila) -1.74 1 1 TBC1 domain family, member 4 1 1 -1.55 Tec protein tyrosine kinase 1 1.72 1.87 V-akt murine thymoma viral oncogene homolog 3 (protein kinase B, gamma) 1 1.54 1 Vav 2 oncogene 1 -1.6 1

Channels / Carriers / Pumps ATPase, Na+/K+ transporting, beta 1 polypeptide 1 1.58 1 bA305P22.2.1 (novel protein, isoform 1) 1 1.58 1 breast carcinoma amplified sequence 1 1 1.56 1 Calcium channel, voltage-dependent, beta 4 subunit 1 1 -1.62 calcium channel, voltage-dependent, gamma subunit 2 1 1.89 1 Calcium channel, voltage-dependent, gamma subunit 4 1 1.56 1 ChaC, cation transport regulator homolog 1 (E. coli) 1.5 1 1 Facilitative glucose transporter GLUT11 1 1 -1.52 Kv channel interacting protein 4 1 1.56 1 Leucine-rich, glioma inactivated 1 1 -1.85 -1.74 potassium channel tetramerisation domain containing 3 -1.62 1 1 Potassium voltage-gated channel, shaker-related subfamily, member 2 -1.5 1 1 Potassium voltage-gated channel, subfamily G, member 4 -1.91 1.84 1 Solute carrier family 16, member 10; T-type amino acid transporter 1 1 1.5 1

62 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Channels / Carriers / Pumps (Continued) Solute carrier family 16, member 3 (monocarboxylic acid transporter 4) 2.49 1 1 Solute carrier family 16, member 6 (monocarboxylic acid transporter 7) 1.91 1 1 Solute carrier family 16, member 9 (monocarboxylic acid transporter 9) 1 1 -1.5 Solute carrier family 18 (vesicular acetylcholine), member 3 1 2.81 1 solute carrier family 22 (organic cation transporter), member 4 1 -1.51 1 Solute carrier family 5 (choline transporter), member 7 2.15 2.79 1 Solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2 2.11 3.56 2.84 solute carrier family 6 (neurotransmitter transporter, taurine), member 6 1 1.56 1 solute carrier family 7 (cationic amino acid transporter, y+ system), member 14 1 2.07 1 solute carrier family 9 (sodium/hydrogen exchanger), member 9 1 2.08 1 TASK-1 potassium channel 1 1 -2.26 Voltage-dependent calcium channel gamma-5 subunit 1 2.22 1.89 Voltage-gated calcium channel alpha2/delta-1 subunit 1 1 -2.34 Voltage-gated potassium channel 1 1.81 1

Cell cycle / Proliferation / Differentiation AXIN1 up-regulated 1 2.03 1 1 BCL2-related protein A1 1 1 1.55 BMP/Retinoic acid-inducible neurai-specific protein-2 1 -1.75 -1.57 Brain-specific protein p25 alpha 1 1 -1.87 C6orf37 1.57 1 1 Carbonic anhydrase II 1 1.94 2.34 Centrosomal protein 192kDa 2.91 1 1 C-Maf-inducing protein 1.57 1.78 1 coiled-coil domain containing 57 2.33 1 1 cyclin-dependent kinase-like 5 1.52 1 1 DBCCR1-like -1.56 1 1 development and differentiation enhancing factor 1 -1.55 1 1 dopey family member 1 1.55 1 1 Echinoderm microtubule associated protein like 1 1 1.53 1 EGF-like repeats and discoidin I-like domains 3 1 1 -1.7 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B) 1.56 1 -1.53 Epithelial membrane protein 1 1.51 1 1 Epithin 3.28 1 1 fibroblast activation protein, alpha 1 1 1.62 Frizzled homolog 9 (Drosophila) 1 1 -1.97 Ganglioside-induced differentiation-associated protein 1-like 1 1 1 -2.07 Growth arrest and DNA-damage-inducible, alpha 3.14 1 1 Growth arrest and DNA-damage-inducible, gamma 1 1 -1.52 Human homolog of Drosophila lethal discs large 1 1 1.92 1 Human phosphotyrosine phosphatase kappa 1 1.68 1 Inhibin, beta A (activin A, activin AB alpha polypeptide) 1.57 1 1 Lethal giant larvae homolog 2 (Drosophila) -1.82 1 1 leucine rich repeat containing 4C -1.56 1 1 Leucine-rich repeats and immunoglobulin-like domains 3 1 1 1.58 LRRTM1 protein 1 1 -1.5 Mab-21-like 1 (C. elegans) 1 1 -2.12

63 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Cell cycle / Proliferation / Differentiation (Continued) microfibrillar-associated protein 3-like 2.18 1 1 myc target 1 -1.51 1 1.74 Myogenic differentiation 1 1 1 1.85 naked cuticle homolog 1 (Drosophila) 1.58 1 1 Nephroblastoma overexpressed gene 1 2.08 1 neural precursor cell expressed, developmentally down-regulated 9 1 1 -1.59 Neuralized homolog (Drosophila) 1 1 -1.96 Neuronal transmembrane protein Slitrk4 1 1.58 1 Oxidored-nitro domain-containing protein 1 1 -1.5 P311 POU 1 1 -1.59 Paired-like homeobox 2b 1 2 1 PC1 2.61 3.95 2.09 PDZ domain containing RING finger 3 -1.68 1 1 PiggyBac transposable element derived 5 2.26 1 1 Polo-like kinase 2 (Drosophila) -1.55 1 1 Polycystic kidney and hepatic disease 1 -1.51 1 1 Quiescence-specific protein 1 1 -1.6 Retinoic acid receptor responder (tazarotene induced) 1 1.67 2.39 1.57 R-spondin 3 homolog (Xenopus laevis) 1 1 1.54 secreted frizzled-related protein 4 5.62 2.23 1 Secreted frizzled-related protein 4 9.1 3.86 1 Sema domain, immunoglobulin domain (Ig), (semaphorin) 3C 1 1 1.69 Serpin peptidase inhibitor,( -2 antiplasmin,pigment epithelium derived factor), 1 1 1 -1.58 Serpin peptidase inhibitor, clade I (neuroserpin), member 1 1 1 -1.63 SHC (Src homology 2 domain containing) transforming protein 3 1 1.62 1 SLIT and NTRK-like family, member 4 1 1.62 1 SLIT and NTRK-like family, member 6 1.55 1 1.6 Snail like protein -1.52 1 1 TBC1 domain family, member 2B -1.57 1 1 Tetraspanin 15 1.63 1 1 Tetraspanin 7 1 1 -1.58 Tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 1 1 1.62 Tissue factor pathway inhibitor 2 2.34 1 1 TOB protein 1.89 1 1 Transforming, acidic coiled-coil containing protein 2 -1.59 1 1 Transmembrane 9 superfamily protein member 2 precursor (p76) 1 1 -1.87 tripartite motif-containing 2 -1.67 1 1 tripartite motif-containing 9 1.54 1 1 Tumor suppressor candidate 3 1 1 -1.6 WEE1 homolog (S. pombe) 1 -1.6 1 WNT inhibitory factor 1 1 2.03 1

Metabolism / Homeostasis 3-hydroxymethyl-3-methylglutaryl-Coenzyme A lyase-like 1 1 1 -2.03 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 1.96 1 1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiolase) 1 1 1.72 ADP-ribosylation factor-like 4A 1.65 1 1

64 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Metabolism / Homeostasis (Continued) ADP-ribosylation factor-like 6 1 1.56 1 Aldo-keto reductase family 1, member B10 (aldose reductase) 1 1 1.52 Angiotensin I converting enzyme 2 1 -1.55 1 Apolipoprotein A-I 2.01 1 1 ATP-binding cassette, sub-family A (ABC1), member 1 1 1 2.29 ATP-binding cassette, sub-family B (MDR/TAP), member 4 2.1 1.68 1 ATP-binding cassette, sub-family C (CFTR/MRP), member 8 1 -1.59 1 AVIToxin-VAR1 1 1 1.54 Beta-1,3-glucuronyltransferase 1 (glucuronosyltransferase P) 1.62 1 1 Butyrylcholinesterase 1 1 -1.6 C9orf77 protein 2.36 1 1 calpain 5 -1.5 1 1 Carbonic anhydrase IV 1 1 -1.55 Carbonic anhydrase-related protein 10 1 1 1.62 Carboxymethylenebutenolidase homolog (Pseudomonas) 1.67 1 2.23 Cholesterol 25-hydroxylase 2.09 1.53 1 coagulation factor V (proaccelerin, labile factor) 1.66 1 1 Complement component 4 binding protein, alpha 1.51 1 1 Cordon-bleu homolog (mouse) -1.85 1 1 Core 2 beta-1,6-N-acetylglucosaminyltransferase 3 1 1 2.4 Cytochrome P450 A 37 2.53 1.57 1.62 Cytochrome P450, family 2, subfamily R, polypeptide 1 2.8 1.62 1 Cytochrome P450, family 24, subfamily A, polypeptide 1 -1.62 -1.54 -1.75 Cytochrome P450, family 4, subfamily v 1.98 1 1 Cytochrome P450, family 8, subfamily B 1 -1.53 1 D7H11orf14 protein 1 1.54 1 D-cry 1 1 -1.61 Deiodinase, iodothyronine, type II 2.3 -1.6 1 Deleted in bladder cancer 1 -1.8 1 1 Digestive tract-specific calpain; calcium-dependent cysteine proteinase 1 1 1.81 DnaJ (Hsp40) homolog, subfamily C, member 11 1.5 1 1 E.coli 7,8-diamino-pelargonic acid (bioA), (bioB), (bioF), bioC protein, (bioD) 1 1.6 1 Endothelial lipase 1 1 1.63 Enhancer binding factor 2C -2.1 1 1 Eukaryotic translation initiation factor 2 alpha kinase PEK 1 1 -1.58 F-box and WD repeat domain containing 7 1.63 1 1 F-box only protein 2 1 1 -1.57 F-box protein 32 1 -1.8 1 Ferritoid 1 1.64 1 Gamma-glutamyltransferase 1 1 -1.53 1 glucosaminyl (N-acetyl) transferase 4, (beta-1,6-N-acetylglucosaminyltransferase) 2.73 1 1 glutamic pyruvate transaminase (alanine aminotransferase) 2 1.87 1 1 Glutathione S-transferase A1 1 1 1.79 Glutathione S-transferase omega 1 1 1 -1.78 Glycosyltransferase 25 domain containing 2 1 1 -1.52 Guanylate cyclase 1, soluble, alpha 3 1 1 -1.7 gypsy retrotransposon integrase 1 1.57 1 1

65 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Metabolism / Homeostasis (Continued) Heat shock 70kDa protein 14 2.42 1 1 Heat shock protein 25 1 1 -1.61 Heme oxygenase (decycling) 1 1 1 1.73 Hemopexin 1 1 -1.7 Heparan sulfate 6-O-sulfotransferase 3 1 2.76 1 Heparan sulfate D-glucosaminyl 3-O-sulfotransferase 2 1.78 1 1 Hyaluronan synthase 2 1.56 1 1 Insulin induced gene 1 1 1 -1.56 iodotyrosine deiodinase 1 1.83 1 KIAA1627 protein 2.03 1 1 Leucine aminopeptidase 3 1 1.58 1 leucine rich repeat neuronal 2 1 1.84 1 leucine rich repeat transmembrane neuronal 3 2.44 1 -2.17 Leucine-rich repeats containing F-box protein FBL3 1 1 -1.97 like-glycosyltransferase 1 2.07 1 LON peptidase N-terminal domain and ring finger 3 1.84 1 1 Lysozyme G (1,4-beta-N-acetylmuramidase) (Goose-type lysozyme) 1 -3.35 -3.02 lysozyme G-like 2 -1.55 -4.66 1 Malin -1.52 1 1 MGC82474 protein 2.07 2.21 1.99 Myoferlin 1 1 1.61 N-acetylglucosamine-6-sulfatase 1 1 1.84 N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4 1 -1.96 1 N-deacetylase/N-sulfotransferase 4 1 1 -2.19 Neutrophil cytosolic factor 1 1 1 1.5 Neutrophil cytosolic factor 4, 40kDa 1 1 1.52 oxysterol binding protein-like 6 1 1.91 1 PASK protein 1.51 1 1 Peptidase (mitochondrial processing) beta -1.57 1 1 Peripheral myelin protein 2 1 1 1.81 Peroxisomal protein (PeP) 1 1.77 1 phosphatidic acid phosphatase type 2B 2.2 1 1 Phosphatidic acid phosphatase type 2B 2.33 1 1 phosphatidylglycerophosphate synthase 1 2.67 1 1 phospholipid transfer protein 1 1 1.61 PLCPI=cysteine proteinase inhibitor 1 1 2.2 Polypeptide N-acetylgalactosaminyltransferase 17 -1.68 1 1 Polypeptide N-acetylgalactosaminyltransferase 9 1 1.69 1 PPM2C protein 1 1 -1.87 procollagen C-endopeptidase enhancer 2 1 1.69 1 Prostaglandin D2 synthase 21kDa (brain) 1 1 -2.05 Prostaglandin-D synthase 1 1 1.59 Prostaglandin-endoperoxide synthase 2 1 1 1.57 Protease 1 1.66 1.56 Protein phosphatase 1J 2.2 1.64 1 PTPN5 protein 1 1.69 1 Pyridoxal kinase 1 1.63 1

66 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Metabolism / Homeostasis (Continued) Ribophorin II 1 1 -1.53 RW1 protein 1 1 1.87 SARM1 protein 1 1 -1.7 sepiapterin reductase 1 1.85 1 sepiapterin reductase (7,8-dihydrobiopterin:NADP+ oxidoreductase) 1 1.77 1 Serine /threonine protein phosphatase 1 1.84 1 SMAD specific E3 ubiquitin protein ligase 1 -1.61 1 1 Spermidine/spermine N1-acetyltransferase 1 1.6 1 1 Sphingomyelin phosphodiesterase, acid-like 3A 1 1.87 1 ST3 beta-galactoside alpha-2,3-sialyltransferase 1 1.5 1 1 ST3 beta-galactoside alpha-2,3-sialyltransferase 5 1 1.52 1 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2 1 1.84 1 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3 1 1 -1.57 ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 6 1.99 1.62 1 STARD3 N-terminal like 1.9 1 1 Steryl-sulfatase precursor 1.84 1 1 sulfide quinone reductase-like (yeast) 1.51 1 1 Superoxide dismutase 1, soluble 1 -1.54 1 TIMP metallopeptidase inhibitor 3 -1.66 1 1 topoisomerase (DNA) III alpha -1.5 1 1 Trafficking protein particle complex subunit 3 (BET3 homolog) 1 1 -1.83 transmembrane and tetratricopeptide repeat containing 2 2.4 1 1 Tyrosine phosphatase 1 1.63 1 Ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) 1 1 -1.68 Ubiquitin specific peptidase 28 -1.5 1 1 UDP-N-acetyl-alpha-D-galactosamine: N-acetylgalactosaminyltransferase 14 -1.58 1.51 1 UDP-N-acetyl-alpha-D-galactosamine: N-acetylgalactosaminyltransferase 6 1.84 1 1 UDP-N-acteylglucosamine pyrophosphorylase 1 3.46 1.64 1 Uridine phosphorylase 1 1 1 -1.54 Von Willebrand factor C domain containing 2 1 1 -1.5

Cytoskeleton / Synapse / Junction Organization Acp1 protein 1 1 2.34 Actin binding LIM protein family member 2 1 1.74 1 Actinin, alpha 1 -1.53 1 1 Activated leukocyte cell adhesion molecule 1 1.8 1 Adhesion molecule with Ig-like domain 2 1 1.75 1 Adipocyte-specific adhesion molecule 1 1 1.53 Axonemal dynein heavy chain DNAH5 1 1 1.96 Bicaudal-D 1 1 -1.99 Cadherin 1 1 -1.51 Cadherin 20, type 2 1 1 -1.67 Cadherin-8 1 3.47 1 Calponin alpha 1 1.64 1 Calsyntenin-2 1 1 -1.61 Cell adhesion molecule 2 1 1 -2.16 Choline acetyltransferase 1.51 2.22 1

67 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Cytoskeleton / Synapse / Junction Organization (Continued) Clathrin, light chain (Lca) 1 1 -1.63 CNS specific microtubule-associated protein tau, adult 1 1 -1.52 Contactin 5 1 1.51 1 Contactin associated protein-like 5 1.68 1 1 coronin, actin binding protein, 2A -1.51 1 1 cortactin binding protein 2 2.77 1 1 Densin-180 1.65 1 1 desmoplakin 1 1.56 1 discs, large homolog 2, chapsyn-110 (Drosophila) 1 1.75 1 docking protein 5 1 -1.66 1 doublecortin and CaM kinase-like 2 1 1 -1.74 ELAV (embryonic lethal, abnormal vision, Drosophila)-like 4 (Hu antigen D) 1 1 -1.58 Epidermal growth factor receptor pathway substrate 15 1 1.53 1 FERM domain containing 4B -1.63 1 1 Fibronectin leucine rich transmembrane protein 3 1.58 1 1.58 FLI-LRR associated protein-1 1 1.95 1 Gap junction protein, alpha 9, 36kDa 1 2.32 1 Keratin 23 (histone deacetylase inducible) 1.51 1 1 KIAA0799 protein 1 1 1.57 KIAA0843 protein 1 1 -1.84 Leucine rich repeat and fibronectin type III domain containing 5 1 1 -2.04 LIM and cysteine-rich domains 1 -1.58 1 1 MAM domain-containing glycosylphosphatidylinositol anchor 2 1 1 -1.74 Microfibrillar associated protein 5 1 1 -1.63 Mint2; neuronal munc18-1 binding protein 1 1 -1.6 Myosin regulatory light chain interacting protein 1 1 1.94 Myosin, heavy chain 1, skeletal muscle, adult 1.51 1 1 Myosin, light chain 4, alkali; atrial, embryonic 1 1 -1.68 Myozenin 1 1 -1.52 1 neurofilament, medium polypeptide 150kDa 1 1 -1.73 Neuroligin 1 1 1.51 1 neuroligin 4, X-linked 1 1.53 1 Neuron navigator 2 2.18 1 1 Neuronal pentraxin II precursor (NP-II) (NP2) 2.34 1 2.94 Ninjurin 2 1 1 1.62 Pentraxin-related PTX3 1 1 1.5 protocadherin alpha subfamily C, 2 1 1.5 1 Protocadherin-9 1 1.68 1.62 Rabconnectin 1 1.56 1 Raftlin, lipid raft linker 1 1 1.61 1 regulating synaptic membrane exocytosis 4 1 -1.94 1 RIM4 gamma 1 1 -2.49 RIMS binding protein 2 2.58 1.91 1 RUN and FYVE domain containing 2 1 1.64 1 Sarcoglycan, epsilon 1 1 1.53 Serine/threonine-protein kinase Nek3 (NimA-related protein kinase 3-HSPK 36) 1 1 -1.53 Shank2E -2.91 1.63 1

68 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Cytoskeleton / Synapse / Junction Organization (Continued) Stathmin-like 3 1 1 -1.58 Stathmin-like-protein RB3 1 1 -1.91 Synapsin II isoform IIa 1 2.49 1 Synaptosomal-associated protein, 91kDa homolog (mouse) 1 1 -1.64 synaptotagmin IV 1.83 1.67 1 synaptotagmin VI 1 -2.41 1 synaptotagmin XII 1 1.75 1 Synuclein, alpha (non A4 component of amyloid precursor) 1 1 -1.96 Talin 2 1 1.52 1 Taurine transporter 1 1 1.55 Tropomodulin 2 (neuronal) 1 1 -1.52 Tubulin, beta 3 1 1 -1.78 Type I hair keratin KA31 8.58 1.77 1 Vesicle-associated membrane protein 2 (synaptobrevin 2) 2.09 1 1

Extracellular matrix ADAM metallopeptidase with thrombospondin type 1 motif, 17 1.61 1 1 ADAM metallopeptidase with thrombospondin type 1 motif, 3 proprotein 1 1 1.5 Aggrecanase-2 1 1 1.61 Alpha 1 (V) collagen 1 1 1.59 Alpha-5 type IV collagen 1 1 1.56 Collagen type XII alpha 1 chain 1 1 1.6 Collagen, type III, alpha 1 (Ehlers-Danlos syndrome type IV, autosomal dominant) 1 1 1.56 Collagen, type IX, alpha 3 1 1.51 1 Collagen, type XII, alpha 1 1 1 1.92 HSAJ1454 1 1 1.83 Kallmann syndrome 1 sequence 1 1 -1.95 laminin, alpha 1 1 1 1.52 Matrix Gla protein 1 1 2.34 Matrix metallopeptidase 2 1 1 1.51 Matrix-remodelling associated 8 1 1 1.52 MMP24 protein 1 1 -1.65 Neurofascin 1 1 -1.75 Olfactomedin 3 1 1 -1.62 Osteopontin 1 1 1.77 Proteoglycan 1 1 1.71 Spondin 2, extracellular matrix protein 1 1 1.72 Thrombospondin 1 1 1 1.52 Vitronectin 1 1 -1.84

Miscellaneous AGPA3119 1 1 -1.71 BC022687 protein 1 1 1.52 Chromosome 14 open reading frame 135; F protein-binding protein 2 1.51 1 1 Chromosome 2 open reading frame 32 1 1 -1.56 Chromosome 20 open reading frame 39 1 1 -1.9 Chromosome 6 open reading frame 60 1.64 1 1

69 Table 2. Continued Fold after PACAP treatment for: Category 15min 24hrs 96hrs Gene Name Miscellaneous (Continued) Chromosome X open reading frame 23 1 1 -1.9 Coiled-coil domain containing 57 4.67 1.94 1 Ellis van Creveld syndrome 1 1 -1.55 Family with sequence similarity 123A 1 1 -1.73 G2 1 2.27 1 GRGP2438 1 1 -1.81 Hole -1.82 1 -1.84 HSPC223 1 1 -1.69 IBRDC3 protein 1 1 -1.5 interferon-induced protein with tetratricopeptide repeats 5 -1.5 -4.78 1 KIAA0888 protein 2.22 1 1 KIAA1412 protein 1.70 1 1 KIAA1867 protein 1 1 -1.59 KIAA2019 protein -1.6 1 1.57 leucine zipper protein 2 1 2.16 1 LOC387763 protein 1 1 -1.56 LOC420939 1 1 -1.58 LOC443709 protein 1 1 -1.54 LRTS841 3.6 2.41 1 MGC79481 protein 1 1 -1.91 mKIAA0515 protein -1.5 1 1 nucleotide binding protein-like 1 1.78 1 period homolog 3 (Drosophila) 2.14 2.52 1 Primglo1 1.95 1 1 Putative protein product of HMFN2073 1 1 1.93 Response gene to complement 32 2.77 1 1 Retinoic acid induced 2 1 1 -1.58 RIKEN cDNA 2010011I20 1 1 1.81 RIKEN cDNA 5430407P10 1 1 -1.94 RIKEN cDNA 6330442E10 gene 1 1.55 1 SH3 domain binding glutamic acid-rich protein 1 2.88 -1.74 Testis specific leucine rich repeat protein 1 1.81 1 Transmembrane activator and CAML interactor 1 1.56 1 Transmembrane and coiled-coil domain family 3 1.68 1 1 Transmembrane protein 108 1.57 1 1 VLLH2748 1 1 1.84

70

71

72 Each PACAP treatment produced a unique set of regulated genes. Treatment with

PACAP for 15min resulted in up-regulation of 185 genes and down-regulation of 89 genes six hours later. Treatment with PACAP for 24 hours up-regulated 174 genes and down-regulated 42 genes, while PACAP treatment for 96 hours up-regulated 118 genes and down-regulated 172 genes (Figure 7 A & B). Of the 672 known genes, 9 genes were up-regulated under all three PACAP treatment conditions; Adenosine A1 receptor,

Cytrochrome P450 A 37, Early growth response 1, Neuromedin U, Retinoic acid receptor responder, MGC82474 protein, PC1, Prolactin-b, and Solute carrier family 6

(neurotransmitter transporter, noradrenalin) member 2 (Table 2 and Fig. 7A). Two genes were down-regulated in all three conditions; Follicle stimulating hormone receptor and

Cytochrome P450, family 24, subfamily A, polypeptide 1 (Table 2 and Fig. 7B).

Time-course of selected transcripts regulated by PACAP

Real-time RT-PCR was used to perform a 4-day time-course for five genes of interest; WAS 3, WAS 1, NESH 3, Urocortin 3, and Synapsin IIa. As with the microarray studies, E8 CG neurons were cultured for 4 days under different PACAP treatment conditions before RNA extraction. CG neurons were exposed to 100nM PACAP for the final 24hr, 48hr, 72hr, or for the entire 96hr of culturing prior to RNA extraction. Real- time RT-PCR experiments were performed in triplicate and transcript levels were normalized to GAPDH mRNA levels (Stone et al. 1985; Zhou et al. 2004).

Wiskott–Aldrich Syndrome protein 3 (WAS 3) is a member of the AKAP family, which microarray analysis revealed was down-regulated by -1.73 fold following chronic

73 96hr PACAP treatment and -1.55 fold following 15min PACAP treatment, but was not significantly altered following 24hr PACAP treatment. Real-time RT-PCR revealed similar results, indicating that WAS 3 transcript levels were only decreased -1.20 fold following 24hr PACAP treatment, but were showed a more significant decrease with longer exposure times; -2.50 fold for 48hr exposure, -3.57 fold for 72hr exposure, and

-1.52 fold for 96hr exposure (Fig. 9A).

Microarray analysis identified another member of the AKAP family, Wiskott–

Aldrich Syndrome protein 1 (WAS 1), was down-regulated in a similar manner.

Therefore, the 4-day time course was performed using real-time RT-PCR for this gene as well despite the fact that microarray results indicated that WAS 1 transcript levels were only reduced -1.43 fold following 96hr PACAP treatment (below the imposed 1.5 fold cut-off) and were not significantly altered following 15min or 24hr exposures. Real-time

RT-PCR experiments produced a similar pattern of results to WAS 3 with transcript levels gradually diminishing with extended PACAP exposure time, reaching a maximal decrease at 72hr PACAP exposure, before beginning to return to baseline levels following 96hr PACAP treatment. Specifically, WAS 1 transcript levels showed a -2.13 fold decrease for 24hr, a -3.85 fold decrease for 48hr, a -4.76 fold decrease for 72hr and a

-2.00 fold decrease for 96hr PACAP treatment (Fig. 9B).

The microarray findings indicated that mRNA transcripts encoding for the Abl interactor 3 protein, NESH 3, was down-regulated -2.65 fold as a result of chronic

PACAP treatment, while 15min and 24hr PACAP exposure had no significant effect.

74

75 Real-time RT-PCR analysis produced similar results showing only a 1.10 fold increase for 24hr exposure, with longer treatment times producing significant reductions in

NESH3 expression levels; -1.79 fold for 48hr, -4.17 fold for 72hr, and -1.69 fold for

96hr (Fig. 9C).

Microarray analysis revealed a 2.49 fold increase in the transcript levels of the presynaptic terminal protein, Synapsin IIa, following 24hr exposure to PACAP, while no significant effect was observed following the 15min or 96hr PACAP treatment. Real- time RT-PCR results confirmed the increased mRNA expression for 24 hr PACAP exposure. However, contrary to microarray findings, 96hr PACAP treatment produced transcript level increases of similar magnitude as well. Real-time RT-PCR showed a moderate 1.88 fold increase for 24hr followed by a steady transcript level increase in response to increased PACAP treatment time, reaching a maximal effect at 72hr before producing a reduced, but still significant increase at 96hr; 3.01 fold for 48hr, 3.68 fold for

72hr, and 2.13 fold for 96hr (Fig. 9D).

The mRNA transcript levels which exhibited the largest increase in the microarray studies encoded for the vasodilator protein, Urocortin 3, with a 13.01 fold increase following 24hr PACAP treatment. Additionally, 15 min PACAP exposure resulted in a 5.82 fold increase, while chronic, 96hr, treatment did not significantly alter the transcript level. Real-time PCR time course showed similar findings with an 11.42 fold increase for 24hr, peaking at 48hr, with a 12.40 fold increase, before diminishing to a 2.55 fold increase for 72hr, and only a 1.64 fold increase following 96hr PACAP treatment (Fig. 9E).

76 DISCUSSION

The activation of PAC1 receptors in the chick CG by exogenous PACAP leads to changes in synaptic function and neuronal survival. These effects have been shown to be both rapid and long-lasting, suggesting that altered gene expression may contribute to the neuromodulatory and neurotrophic functions of endogenous PACAP. This study supports that hypothesis; first, by demonstrating the localization and release of endogenous PACAP from presynaptic terminals, as well as the presence of PAC1 splice variants and VPAC receptors, second, by characterizing the ability of PACAP to activate the transcription factor CREB, and finally, by revealing the ability of PACAP to alter gene expression.

Localization of PACAP and presence of VPAC receptors and PAC1 splice variants

Localization of endogenous PACAP to presynpatic terminals was demonstrated by co-immunolabeling for PACAP and the presynaptic marker, Synapsin. Additionally, membrane depolarization resulted in reduction of PACAP labeling in the presynaptic terminal, indicating release of PACAP. This localization of endogenous PACAP and activity-dependent release from cholinergic terminals suggests a functional role for

PACAP in vivo.

Further support for endogenous PACAP functioning in the chick CG was provided by the use of RT-PCR to demonstrate the presence of VPAC1 and VPAC2 receptor transcripts, as well as a number of PAC1 splice variants. Since differences in

77 receptor sequence can influence ligand binding and activation of signaling pathways or ion channels, determining which PAC1 splice variants are present in the chick CG may provide valuable insight into the ability of PACAP to bind to these receptors as well as what effects its binding may have.

These RT-PCR experiments addressed the possibility of PAC1 splice variants that result from the exclusion or inclusion of one or more exons; exons 4, 5, and 6 in the N- terminus and exons 14 and 15 in the third intracellular loop (also known as “hip” and

“hop” respectively). Results indicate that all of the PAC1 splice variants present in the chick CG contain all three exons in the N-terminal regions (exons 4, 5 and 6).

Additionally, it appears that all possible combinations of the absence or presence of exons 14 and 15 in the third intracellular loop are present in the chick CG as indicated by the three RT-PCR products of the expected sizes using the PAC 1 hiphop primer set.

Results from the PAC 1 hop primer set, which utilized a reverse primer designed against exon 15 itself, conclusively demonstrated the presence of PAC1 splice variants containing the hop exon. However, the presence of hip and hop in the same splice variant was not able to be determined with this primer set since a RT-PCR product of an unanticipated size was produced (approximately 265 bp). Since the sequence of hip is presently unknown in the chicken, it is possible that there is an unknown splice variant in hip resulting in the unexpected size. For this same reason primers against the hip cassette itself cannot be designed at this time.

Based on the results of these RT-PCR experiments, it can be concluded that, of the 18 known PAC1 splice variants, 13 are not present in the chick CG, leaving only five

78 possible candidates; null, hip, hop, hiphop, or TM4 (Table 1). Since the TM4 splice variant is identified by single point mutations, the RT-PCR method is inadequate to determine if it is present in the chick CG. Three of these 4 remaining splice variants, null, hip, and hop all have been shown to have similar EC50 values for activation of InsP by PACAP (EC50 3.3 - 9.7 nM) and VIP (EC50 >1000 nM). However, EC50 values for the activation of AC demonstrate more of a difference among the three splice variants with

EC50 values for activation by VIP ranging from 3.2 nM to 257 nM (Lutz et al. 2006).

Based on these values, the EC50 values previously determined for activation of cAMP by

PACAP (0.38 nM) and VIP (306 nM) in the chick CG (Margiotta and Pardi 1995) are most consistent with the hop splice variant.

PACAP activation of the transcription factor CREB

To explore the role of PACAP in regulating gene expression, immunostaining techniques were used to examine the ability of PACAP to activate the transcription factor

CREB. Results demonstrated that PACAP is capable of phosphorylating CREB in a concentration- and time- dependent manner. Application of exogenous PACAP produced maximal CREB phosphorylation with regards to incidence and intensity at 100nM.

PACAP induced phosphorylation of CREB occurred rapidly and was long-lived producing maximal effects within five minutes and persisting for up to 90 minutes following removal of PACAP.

Immunostaining techniques also demonstrated that despite the presence of VPAC1 and VPAC2 receptors in the CG, PACAP-induced phosphorylation of CREB was

79 mediated exclusively by PAC1 receptors since CREB phosphorylation was mimicked by the PAC1 agonist, maxadilan, inhibited by a PAC1 antagonist, P6-38, and VIP was far less effective than PACAP. The prominence of PAC1 receptors for CREB activation is consistent with previous findings demonstrating the presence of PAC1 receptors on CG neurons having a 100-1000 fold greater affinity for PACAP over VIP (Margiotta and

Pardi 1995) and their predominant role in mediating the ability of PACAP to modulate nAChR function and increase neuronal survival (Margiotta and Pardi 1995; Pardi and

Margiotta 1999; Pugh and Margiotta 2006).

The use of pharmacological inhibitors in conjunction with immunostianing techniques implicated canonical AC-cAMP-PKA transduction from PAC1 to CREB activation since the PKA inhibitors KT5720 and H89 reduced the incidence and intensity of PACAP mediated CREB phosphorylation. However, the results obtained using other pharmacological reagents suggest a more complex signaling route. Two other PKA inhibitors, Rp-cAMP and PKI, did not inhibit the ability of PACAP to phosphorylate

CREB. Additionally, three AC inhibitors (MDL12330A, SQ22536, or ddA) failed to reduce CREB activation subsequent to PACAP treatment despite the fact that SQ22536 and ddA both previously inhibited PACAP-induced cAMP production in CG neurons by

≈80% (Margiotta and Pardi, 1995) and were consequently expected to potently reduce

PKA activity. Moreover, the AC activator, Forskolin, as well as membrane permeant cAMP derivatives, dibutyryl-cAMP (dbcAMP) or 8-Bromo-cAMP (8Br-cAMP), were insufficient to induce significant CREB activation (data not shown).

80 Several possibilities may explain these unusual findings. One is that PAC1 signaling to CREB activation may arise from non-canonical, PKA-independent intermediates such as MEK, p38 MAP kinase (Monaghan et al. 2008), or the Rit small

GTPase (Shi et al. 2006). An alternative possibility is that in CG neurons, canonical AC- dependent signaling leading to CREB activation requires both PKA and one or more additional effectors. In this case, the failure of dbcAMP and 8Br-cAMP to induce CREB could reflect differential potency of native cAMP in activating PKA, for example when in free form or when sequestered by A-kinase activating proteins (AKAPs) known to be functional in CG neurons (Jayakar and Margiotta, unpublished). The possibility of

AKAP bound PKA also provides another means for PKA activation without AC activation or cAMP since direct activation of AKAPs by interaction with G-proteins has previously been implicated in cAMP-independent PKA activation (Niu et al. 2001). In addition, the residual cAMP production seen following SQ22536 or ddA treatments

(Margiotta and Pardi, 1995) may sufficiently stimulate PKA to fully activate CREB especially since a common characteristic of signal transduction cascades is amplification at each step in the pathway. Lastly, since H89 and KT5720 are both known to inhibit multiple kinases in addition to PKA (Davies et al. 2000) it is possible other kinases (e.g.

MEK, p38 MAPK, CamKII) or effectors (Rit) may participate in achieving full CREB activation in conjunction with PKA or alone. While any of these possibilities may be valid, the failure of highly specific PKA inhibitors (PKI and Rp-cAMP) to block CREB activation, and the observation that KT5720 reduced the incidence of PACAP-induced

CREB activation to a much greater degree than did H89 (p<0.05) indicates that a

81 mechanism whereby other effectors participate with PKA-dependent signaling in the steps from PAC1 to CREB activation may apply. Indeed, PACAP support of survival in cerebellar granule cells (Obara et al. 2007) and CG neurons (Pugh and Margiotta, 2006) involves both PKA and MAPK signaling, and a MEK-dependent signaling pathway does lead to CREB activation in CG neurons (Zhou et al., 2004). A similar multi-effector mechanism has been proposed for hippocampal neurons where the reduction in CREB activation following PKA inhibition was augmented when CamKII was also inhibited

(Blanquet et al. 2003). Thus, while signal transduction from PAC1 to CREB activation via a non-canonical, AC/PKA-independent route is possible, these experiments cannot rule out the possibility that canonical PKA-dependent signaling recruits additional effectors necessary to achieve full CREB activation.

PACAP regulation of gene expression

Microarray experiments demonstrated the ability of PACAP to produce global changes in gene transcription in a time-dependent manner. Treatment of CG cultures with PACAP for 15min, 24hr, or 96hr resulted in unique sets of regulated genes.

Genesifter analysis produced a list of 672 genes which were up-regulated or down- regulated by in at least one of the three treatment times (> 1.5 fold). These genes were classified by their function and sorted into one of 12 categories (Table 2 and Figure 8).

The largest category of genes regulated by PACAP was “Metabolism/Homeostasis” comprising 19%. More than 14% of the regulated genes were included in the

“Intracellular signal transduction molecules” category making it the second largest.

82 Among these genes were those that encode for signal transduction molecules previously shown to be important steps for mediating PACAP effects in CG neurons, including adenylyl cyclase which was down-regulated by -1.65 fold after 96hr PACAP treatment.

Genes encoding PKC and PLC were both up-regulated in the 15min and 24hr time points but not in the 96hr time point.

It is also interesting to note that a number of transcription factors were themselves regulated by PACAP, including CREB, which was decreased by -1.51 fold following chronic (96hr) PACAP treatment. The “Transcription factors / Associated proteins” classification accounts for almost 10% of the genes regulated by PACAP. An interesting result in this category is the up-regulation of a member of the basic helix-loop-helix family of transcription factors; HAND 2 (Heart and neural crest derivatives expressed 2, also known as dHAND). Increased expression of this DNA binding protein was observed following 15min (1.73 fold) and 24hr (2.43 fold) PACAP exposure. Expression of

HAND 2 mRNA in the CG neuron cultures was unexpected since, as with all parasympathetic ganglia, CG neurons are cholinergic and HAND 2 has previously been shown to be necessary and sufficient to induce catacholaminergic phenotypic expression in avian neural crest cells (Howard et al. 1999). A possible explanation for this unusual result may be the fact that Bone morphogenetic proteins (BMPs), which are known to regulate the expression of HAND2 (Howard et al. 2000), were also regulated by PACAP.

Microarray data demonstrates that BMP2 was up-regulated by 2.01 fold after only 15 min

PACAP treatment while BMP7 was down-regulated by -2.71 fold following chronic exposure to PACAP. Regulation of BMP by PACAP is interesting not only due to its

83 relation to HAND 2 expression but also because it has previously been shown to increase

PKA activity by an AC- and cAMP- independent mechanism (Liu et al. 2005).

Therefore, PACAP mediated transcription regulation of BMP family members may provide another possible explanation for the observation that PACAP induced phosphorylation of CREB is decreased by PKA inhibitors but not AC inhibitors and that cAMP analogs do not result in pCREB in CG neurons.

BMP has also been previously shown to contribute to survival (Xiao et al. 2007) and is classified under “Growth factors / Cytokines / Chemokines”. Although this category accounted for less than 5% of PACAP regulated genes it included a number of important genes which may underlie the finding that PACAP increases neuronal survival similar to growth factors (Pugh and Margiotta 2006). Nerve growth factor (NGF) was up-regulated 2.51 fold at 24hr and 2.15 fold at 96hr PACAP treatment while Platelet derived growth factor (PDGF) was up-regulated 1.73 fold at 96hr. Additionally, the trophic effects of PACAP may also be influenced by regulation of genes categorized as

“Cell cycle / Proliferation / Differentiation” which comprises more that 10% of the genes regulated by PACAP.

As previously mentioned, in addition to PACAP‟s trophic properties, PACAP also has the ability to modulate synaptic function. Therefore, it is not surprising that a number of the genes regulated by PACAP contribute a functional role in synaptic transmission. More than 13% of the regulated genes were classified as “Receptors /

Effectors / Associated Proteins”. Among these genes were those that encode the 5 and

7 subunits of the nAChR. The 5 subunit was down-regulated by -1.51 fold in the 96

84 hr treatment. The 7 subunit was up-regulated in the 24 hr treatment by 1.97 fold which may help explain the increase in nAChR function observed in response to PACAP

(Margiotta and Pardi 1995). Additionally, the muscarinic 4 AChR was down-regulated

-1.74 fold after 15min and -1.51 fold after 96hr treatment. EPH receptors A3, A5, and

A7 were also down-regulated by PACAP. More than 11% of the genes were also included in the category of “Cytoskeleton/Synapse/Junction Organization”. Genes involved in presynaptic vesicle release such as synaptotagmin IV, VI, and XII, as well as

Synapsin IIa were among this list.

Although the number of genes classified as “Peptides / Hormones / Transmitters” accounted for only slightly more than 2%, it contains two of the most drastically up- regulated genes; the peptides preprourotensin II and urocortin 3. Preprourotensin II was up-regulated by 9.23 fold after 15min and 5.77 fold after 24hr, while urocortin 3 was up- regulated 5.82 after 15min and 13.01 after 24hr. Urotensin II is a known vasoconstrictor

(Ames et al. 1999) while urocortin 3 is a known vasodilator (Fekete and Zorrilla 2007).

Regulation of these genes by PACAP is interesting since PACAP itself is known to cause vasodilatation (Vaudry et al. 2000). Another interesting and unexpected gene in the

“Peptides / Hormones / Transmitters” category was that which encodes for PACAP itself.

A 15min treatment produced a 3.77 fold increase in the expression of PACAP. This result was of particular interest since previous RIA studies from this laboratory were unable to detect PACAP in the iris which is a major target for ciliary neurons in the CG, supporting the idea that PACAP is not produced in CG neurons. RIA (Pugh and

Margiotta 2006). Rather, it is theorized that PACAP is produced in the neurons of the

85 Accessory Occulomotor nucleus and transported down the axons to presynaptic terminals in the CG since immunostaining techniques have demonstrated that PACAP is localized to the presynaptic terminals in the CG.

Since data obtained from microarray analysis is only semi-quantitative, real-time

RT-PCR was used to confirm the microarray findings for the 24hr and 96hr PACAP treatment time for specific genes of interest. Additionally, this technique was used to explore the 48hr and 72hr PACAP treatment time points as well, providing a 4-day time course for five genes; WAS 3, WAS 1, NESH 3, Synapsin IIa, and Urocortin 3.

The down-regulation of WAS 3 (Wiskott–Aldrich Syndrome protein 3) and WAS1

(Wiskott–Aldrich Syndrome protein 1) were of particular interest since they are members of the AKAP family. AKAPs are scaffolding proteins which are known to bind PKA

(Colledge and Scott 1999; Wong and Scott 2004). As previously mentioned, the localization of PKA to specific areas in the cell by AKAP may be a possible explanation for the unusual results found in the PACAP signaling pathway to CREB. Additionally,

AKAP regulation by PACAP is of interest since findings from this laboratory have demonstrated the presence of functional members of the AKAP family with a combination of techniques; immunostaining, conventional RT-PCR (Sumner and

Margiotta; unpublished), Western blot analysis, and overlay assays using the RII subunit of PKA (Jayakar and Margiotta; unpublished). Additionally, the PACAP mediated increase in amplitude and frequency of sEPSCs is blocked by St-Ht31 (Promega,

InCELLect) which disrupts the special coupling of PKA via AKAPs (Vijayaraghavan et

86 al. 1997). These results provide evidence for the involvement of AKAPs in PACAP signaling pathways (Pugh and Margiotta; unpublished).

A protein which has been shown to form complexes with AKAP is the Abl tyrosine kinase-binding protein, NESH 3 (Abl interactor 3) (Hirao et al 2006). Down- regulation of this gene was of particular interest since results from this laboratory demonstrate that a pharmalogical inhibitor of Abl, STI-571, decreases the frequency and amplitude of sEPSCs as well as whole-cell 3 and 7 nAChR currents (Jayakar and

Margiotta; unpublished). Additionally, STI-571 has been shown to block the observed

PACAP induced increase in sEPSC frequency and amplitude (Jayakar and Margiotta; unpublished).

Changes in presynaptic function may help to explain the findings from this laboratory indicating that PACAP modulation of EPSCs is presynaptic since it produced an increase in quantal content without changing quantal size (Pugh and Margiotta; unpublished). Therefore, the up-regulation of presynaptic protein, Synapsin IIa, in response to PACAP treatment was of particular significance as well.

Urocortin 3 was the most drastically up-regulated gene in the chick CG following

PACAP treatment. This very dramatic increase of Urocortin 3 and altered expression levels of other vasodilators and vasoconstrictors, including PACAP itself, may seem surprising in the CG. However, it is important to consider the fact that approximately half of the neuronal population in the CG is comprised of choroid neurons which innervate the vasculature in the choroid coat of the eye.

87 As previously mentioned, the expression of HAND2 in cholinergic neurons was an interesting and unexpected finding. Therefore, following the 96hr microarray experiment, real-time RT-PCR was used to confirm this result despite the fact that following chronic PACAP treatment there was only a 1.37 fold increase (below the 1.5 fold cut-off). Real-time RT-PCR results confirmed this unusual finding showing a 1.46 fold increase (data not shown) and the microarray results from the 15min and 24 hr

PACAP treatments later revealed much more dramatic increases in HAND 2 expression following PACAP treatment with 1.73 fold and 2.43 fold increases respectively.

The results from the microarray experiments demonstrate PACAPs ability to globally modulate transcription. Real-time RT-PCR results further confirm these findings. The resultant changes in gene expression may underlie the diverse roles of

PACAP not only in the parasympathetic CG, but in other systems as well. Although the fold changes of many genes were minimal, small differences in mRNA gene expression often lead to large functional changes within the cell.

88 CONCLUSIONS

1. PACAP is localized in presynaptic terminals in the chick CG and is released by

membrane depolarization.

2. PACAP induces phosphorylation of the transcription factor CREB at Ser133 in a

concentration-dependent manner.

3. PAC1 receptor splice variants are present in the chick CG and brain.

4. VPAC1 and VPAC2 receptors are present in the chick CG.

5. PACAP induced phosphorylation of CREB occurs via PAC1 receptors.

6. Phosphorylation of CREB may involve PKA signal transduction.

7. PACAP rapidly induces CREB phosphorylation at Ser133 in a time dependent manner.

8. Brief PACAP exposure results in prolonged phosphorylation of CREB.

9. Pulsed, short-term, and long-term PACAP treatments uniquely alter gene expression

in CG neuron cultures.

10. PACAP results in the down-regulation of WAS1, WAS3, and NESH3 mRNA

expression and the up-regulation of Urocortin 3 and Synapsin IIa mRNA expression

in a time-dependent manner.

89 REFERENCES

Ames, R. S., H. M. Sarau, J. K. Chambers, R. N. Willette, N. V. Aiyar, A. M. Romanic,

C. S. Louden, J. J. Foley, C. F. Sauermelch, R. W. Coatney, Z. Ao, J. Disa, S. D.

Holmes, J. M. Stadel, J. D. Martin, W. S. Liu, G. I. Glover, S. Wilson, D. E.

McNulty, C. E. Ellis, N. A. Elshourbagy, U. Shabon, J. J. Trill, D. W. Hay, E. H.

Ohlstein, D. J. Bergsma and S. A. Douglas (1999). "Human urotensin-II is a

potent vasoconstrictor and agonist for the orphan receptor GPR14." Nature 401:

282-286.

Bean, A. J., X. Zhang and T. Hokfelt (1994). "Peptide secretion: what do we know?"

FASEB Journal 8: 630-638.

Bito, H., K. Deisseroth and R. W. Tsien (1996). "CREB phosphorylation and

dephosphorylation: a Ca2+- and stimulus duration-dependent switch for

hippocampal gene expression." Cell 87: 1203-1214.

Bito, H. and -. K. Takemoto, S. (2003). "Ca(2+)/CREB/CBP-dependent gene regulation:

a shared mechanism critical in long-term synaptic plasticity and neruonal

survival." Cell Calcium 34(3-4): 425-430.

Blanquet, P. R., J. Mariani and P. Derer (2003). "A calcium/calmodulin kinase pathway

connects brain-derived neurotrophic factor to the cyclic AMP-responsive

transcription factor in the rat hippocampus." Neuroscience 118: 477-490.

90 Blumenthal, E. M., R. D. Shoop and D. K. Berg (1999). "Developmental changes in the

nicotinic responses of ciliary ganglion neurons." J. Neurophysiol. 81(1): 111-120.

Bockaert, J. and J. P. Pin (1999). "Molecular tinkering of G protein-coupled receptors: an

evolutionary success." EMBO J. 18: 1723-1729.

Burns, A. L., D. Benson, M. J. Howard and J. F. Margiotta (1997). "Chick ciliary

ganglion neurons contain transcripts coding for acetylcholine receptor-associated

protein at synapses (Rapsyn)." J. Neurosci. 17: 5016-5026.

Cantino, D. and E. Mugnaini (1975). "The structural basis for electrotonic coupling in the

avian ciliary ganglion. A study with sectioning and freeze-fracturing." J.

Neurocytol. 4(5): 505-536.

Chen, M., P. Pugh and J. Margiotta (2001). "Nicotinic synapses formed between chick

ciliary ganglion neurons in culture resemble those present on the neurons in vivo."

J Neurobiol 47: 265-79.

Clapham, D. E. and E. J. Neer (1997). "G protein subunits." Annu. Rev. Pharmacol.

Toxicol. 37: 167-203.

Colledge, M. and J. D. Scott (1999). "AKAPs: from structure to function." trends in Cell

Biology 9: 216-221.

91 Cowan, W. M. and E. Wenger (1968). "Degeneration in the nucleus of origin of the

preganglionic fibers to the chick ciliary ganglion following early removal of the

optic vesicle." J. exp. Zool. 168: 105-123.

D'Agata, V., S. Cavallaro, F. Stivala, S. Travali and P. L. Canonico (1996). "Tissue-

specific and developmental expression of pituitary adenylate cyclase-activating

polypeptide (PACAP) receptors in rat brain." Eur. J. Neurosci. 8: 310-318.

Das, S., M. Grunert, L. Williams and S. R. Vincent (1997). "NMDA and D1 receptors

regulate the phosphorylation of CREB and the induction of c-fos in striatal

neurons in primary culture." Synapse 25: 227-233.

Davies, S. P., H. Reddy, M. Caivano and P. Cohen (2000). "Specificity and mechanism

of action of some commonly used protein kinase inhibitors." Biochem. J. 351: 95-

105.

De Biasi, M. (2002). "Nicotinic mechanisms in the autonomic control of organ systems."

J. Neurobiology 53: 568-579.

Deutsch, P. J. and Y. Sun (1992). "The 38-amino acid form of pituitary adenylate

cyclase-activating polypeptide stimulates dual signaling cascades in PC12 cells

and promotes neurite outgrowth." J. Biol. Chem. 267: 5108-5113.

Dryer, S. E. (1994). "Functional development of the parasympathetic neurons of the

avian ciliary ganglion: a classic model system for the study of neuronal

differentiation and development." Prog. Neurobiol. 43: 281-322.

92 Dryer, S. E. and V. A. Chiappinelli (1985). "Properties of choroid and ciliary neurons in

the avian ciliary ganglion and evidence for substance P as a neurotransmitter." J.

Neurosci. 5: 2654-2661.

Erichsen, J. T., H. J. Karten, W. D. Eldred and N. C. Brecha (1982). "Localization of

substance P-like and enkephalin-like immunoreactivity within preganglionic

terminals of the avain ciliary ganglion: light and electron microscopy." J.

Neurosci. 2: 994-1003.

Fekete, E. M. and E. P. Zorrilla (2007). "Physiology, pharmacology, and theraputic

relevance of urocortins in mammals: Nacient CRF paralogs." Frontiers in

Neuroendocrinology 28: 1-27.

Gilardino, A., I. Perroteau, D. Lovisolo and C. Distasi (2000). "In vitro identification of

dividing neuronal precursors from chick embryonic ciliary ganglion." Neuroreport

11(6): 1209-12.

Gurantz, D., A. T. Harootunian, R. Y. Tsien, V. E. Dionne and J. F. Margiotta (1994).

"VIP modulates neuronal nicotinic acetylcholine receptor function by a cyclic

AMP-dependent mechanism." Journal of Neuroscience 14(6): 3540-3547.

Hamburger, V. and H. L. Hamilton (1951). "A series of normal stages in the development

of the chick embryo." J. Morphol. 88: 49-92.

Hamelink, C., O. Tjurmina, R. Damadzic, W. S. Young, E. Weihe, H.-W. Lee and L. E.

Eiden (2002). "Pituitary adenylate cyclase-activating polypeptide is a

93 sympathoadrenal neurotransmitter involved in catecholamine regulation and

glucohomeostasis." Proceedings National Academy of Sciences USA 99(1): 461-

466.

Hess, A. (1965). "Developmental changes in the structure of the synapse on the

myelinated cell bodies of the chicken ciliary ganglion." J. Cell Biol. 25: 1-19.

Hokfelt, T., T. Bartfai and F. Bloom (2003). "Neuropeptides: opportunities for drug

discovery." Neurology 2: 463-472.

Hokfelt, T., C. Broberger, Z. D. Xu, V. Sergeyev, R. Ubink and M. Diez (2000).

"Neuropeptides- an overview." Neuropharmacology 39: 1337-1356.

Howard, M. J., D. N. Foster and P. Cserjesi (1999). "Expression of HAND gene products

may be sufficient for the differentiation of avian neural crest-derived cells into

catecholaminegic neurons in culture." Dev. Biology 215: 62-77.

Howard, M. J., M. Stanke, C. Schneider, X. Wu and H. Rohrer (2000). "The transcription

factor dHAND is a downstream effector of BMPs in sympathetic neuron

specification." Development 127: 4073-4081.

Impey, S., S. McCorkle, H. Cha-Molstad, J. Dwyer, G. Yochum, J. Boss, S. McWeeney,

J. Dunn, G. Mandel and R. Goodman (2004). "Definng the CREB regulon: a

genome-wide analysis of transcrpition factor regulatory regions." Cell 119: 1041-

1054.

94 Kilpatrick, G. J., F. M. Dautzenberg, G. R. Martin and R. M. Eglen (1999). "7TM

receptors: the splicing of the cake." Trends Pharmacol. Sci. 20: 294-301.

Kim, M.-S., Y.-P. Cheong, H.-S. So, K.-M. Lee, Y. Son, C.-S. Lee, J.-S. Yun and R. Park

(2002). "Regulation of cyclic AMP-depedent response element binding protein

(CREB) by the nociceptin/orphanin FQ in human dopaminergic SH-SY5Y cells."

Biochemical and biophysical research communications 291: 663-668.

Kirstein, S. L. and P. A. Insel (2004). "Autonomic nervous system pharmacogenomics: a

progess report." Pharmacological Reviews 56(1): 31-52.

Laburthe, M., A. Couvineau and J.-C. Marie (2002). "VPAC receptors for VIP and

PACAP." Receptors and Channels 8: 137-153.

Lalonde, J. and A. Chaudhuri (2007). "Dynamic changes in CREB phosphorylation and

neuroadaptive gene expression in area V1 of adult monkeys after monocular

enucleation." Molecular and Cellular Neuroscience 35: 24-37.

Lamouche, S. and N. Yamaguchi (2003). "PACAP release from the canine adrenal gland

in vivo: its functional role in severe hypotension." Am J Physiol Regul Integr

Comp Physiol 284: R588-R597.

Landmesser, L. and G. Pilar (1972). "The onset and development of transmission in the

chick ciliary ganglion." J. Physiol. 222: 691-713.

95 Landmesser, L. and G. Pilar (1974). "Synapse formation during embryogenesis on

ganglion cells lacking a periphery." J. Physiol 241: 715-736.

Landmesser, L. and G. Pilar (1974a). "Synaptic transmission and cell death during

normal ganglionic development." J. Physiol. 241: 737-749.

Lee, M. L., A. Badache and G. H. DeVries (1999). "Phosphorylation of CREB in axon-

induced schwann cell proliferation." Journal of Neuroscience 55: 702-712.

Liu, H., J. F. Margiotta and M. J. Howard (2005). "BMP4 supports noradrenergic

differentiation by a PKA-dependent mechanism." Dev. Biology 286: 521-536.

Lodish, H., A. Berk, S. L. Zipursky, P. Matsudaira, D. Baltimore and J. Darnell (2001).

Molecular Cell Biology, W.H. Freeman and Company.

Lotersztajn, S., C. Pavoine, P. Deterre, J. Capeau, A. Mallat, D. LeNguye, M. Dufour, B.

Rouot, D. Bataille and F. Pecker (1992). "Role of G protein subunits in the

regulation of the plama membrane Ca2+ pump." Journal of Biological Chemistry

267(4): 2375-2379.

Lu, Y.-F., E. R. Kandel and R. D. Hawkins (1999). "Nitric oxide signaling contributes to

late-phase LTP and CREB phosphorylation in the hippocampus." Journal of

Neuroscience 19(23): 10250-10261.

96 Lundberg, J. M. (1996). "Pharmacology of cotransmission in the autonomic nervous

system: integrative aspects on amines, neuropeptides, adenosine triphosphate,

amino acids, and nitric oxide." Pharmacological Reviews 48(1): 113-178.

Lundberg, J. M., A. Franco-Cereceda, Y. P. Lou, A. Modin and J. Pernow (1994).

"Differential release of classical transmitters and peptides." Advances in Second

Messenger and Phosphoprotein Research: Molecular and Cellular Mechanisms of

Release 29: 223-234.

Lutz, E. M., E. Ronaldson, P. Shaw, M. S. Johnson, P. J. Holland and R. Mitchell (2006).

"Characterization of noval splice varients of the PAC1 receptor in human

neuroblastoma cells: Consequences for signaling by VIP and PACAP." Molecular

and Cellular Neuroscience 31: 193-209.

Margiotta, J., D. Berg and V. Dionne (1987). "Cyclic AMP regulates the proportion of

functional acetylcholine receptors on chick ciliary ganglion neurons." Proc Natl

Acad Sci U S A 84: 8155-8159.

Margiotta, J. and D. Pardi (1995). "Pituitary adenylate cyclase-activating polypeptide

type I receptors mediate cyclic AMP-dependent enhancement of neuronal

acetylcholine sensitivity." Mol Pharmacol 48: 63-71.

Margiotta, J. and P. Pugh (2004). Nicotinic acetylcholine receptors in the nervous system.

Molecular and Cellular Insights to Ion Channel Biology. R. A. Maue. Amsterdam,

Elsevier B.V. 32: 269-302.

97 Marwitt, R., G. Pilar and J. N. Weakley (1971). "Characterization of two cell populations

in the avian ciliary ganglion." Brain Research 25: 317-334.

Matthews, G. (1996). "Neurotransmitter Release." Annual Review of Neuroscience 19:

219-233.

Mayr, B. and M. Montminy (2001). "Transcriptional regulation by the phosphorylation-

dependent factor CREB." Nature 2: 599-609.

McIlvain, H. B., A. Baudy, K. Sullivan, D. Liu, K. Pong, M. Fennell and J. Dunlop

(2006). "Pituitary adenylate cyclase-activating peptide (PACAP) induces

differentiation in the neuronal F11 cell line through a PKA-dependent pathway."

Brain Research 1077: 16-23.

McNerney, M., D. Pardi, P. Pugh, Q. Nai and J. Margiotta (2000). "Expression and

channel properties of -bungarotoxin-sensitive acetylcholine receptors on chick

ciliary and choroid neurons." J Neurophysiol 84: 1314-1329.

McPherson, C. S., T. Featherby, E. Krstew and J. Lawrence (2007). "Quantification of

phosphorylated cAMP-response element binding protein expression thoughout the

brain of amphetamine-sensitized rats: activation of hypothalamic orexin a-

containing neurons." Journal of Pharmacology and Experimental Treatments

323(3): 805-812.

McRory, J. E., R. L. Parker and N. M. Sherwood (1997). "Expression and alternative

processing of a chick gene encoding both growth hormone-releasing hormone and

98 pituitary adenylate cyclase-activating polypeptide." DNA and Cell Biology 16(1):

95-102.

Miller, A. L., D. Verma, C. Grinninger, M.-C. Huang and E. J. Goetzl (2006).

"Functional splice variants of the type II G-protein-coupled receptor (VPAC2) for

vasoactive intestinal peptide in mouse and human lymphocytes." Ann. NY Acad.

Sci. 1070: 422-426.

Miyata, A., A. Arimura, R. R. Dahl, N. Minamino, A. Uehara, L. Jiang, M. D. Culler and

D. H. Coy (1989). "Isolation of a novel 38-residue-hypothalamic polypeptide

which stimulates adenylate cyclase in pituitary cells." Biochemical and

biophysical research communications 164: 567-574.

Miyata, A., L. Jiang, R. R. Dahl, C. Kitada, K. Kudo, M. Fujino, N. Minamino and A.

Arimura (1990). "Isolation of a neuropeptide corresponding to the N-terminal 27

residues of the pituitary adenylate cyclase-activating polypeptide with 38 residues

(PACAP38)." Biochemical and biophysical research communications 170: 643-

648.

Monaghan, T. K., C. J. MacKenzie, R. Plevin and E. M. Lutz (2008). "PACAP-38

induces neuronal differentiation of human SH-SY5Y neuroblastoma cells via

cAMP-mediated activation of ERK and p38 MAP kinases." Journal of

Neurochemistry 104: 74-88.

99 Moro, O. and E. A. Lerner (1997). "Maxadilan, the vasodilator from sand flies, is a

specific pituitary adenylate cyclase activating peptide type I receptor agonist."

Journal of Biological Chemistry 272(2): 966-970.

Nai, Q., J. M. Mcintosh and J. F. Margiotta (2003). "Relating neuronal nicotinic

acetylcholine receptor subtypes defined by subunit composition and channel

function." Molecular Pharmacology 63(2): 311-324.

Niimi, K., T. Sakai and J. Takasu (1958). "The ontogenetic development of the

oculomotor nucleus in the chick." Tokushima Journal of Experimental Medicine

5: 311-325.

Nishi, R. and D. K. Berg (1981a). "Effects if high K+ concentration on the growth and

development of ciliary ganlion neurons in cell culture." Dev. Biology 87(301-

307).

Nishi, R. and D. K. Berg (1981b). "Two components from eye tissue that differentially

stimulate the growth and development of ciliary ganglion neurons in cell culture."

Journal of Neuroscience 1: 505-513.

Niu, J., R. Vaisknaite, N. Suzuki, T. Kozasa, D. W. Carr, N. Dulin and T. A. Voyno-

Yasenetskaya (2001). "Interaction of heterotrimeric G13 protein with an A-

kinase-anchoring protein 110 (AKAP110) mediates c-AMP-indepdent activation."

Current Biology brief communication 11(21): 1686-1691.

100 Nowak, J. and J. Zawilska (2003). "PACAP in avians: origin, occurrence, and receptors -

pharmacological and functional considerations." Current Pharmaceutical Design

9: 467-481.

Obara, Y., A. M. Horgan and P. J. S. Stork (2007). "The requirement of Ras and Rap1 for

the activation of ERKs by cAMP, PACAP, and KCl in cerebellar granule cells."

Journal of Neurochemistry 101: 470-482.

Pardi, D. and J. F. Margiotta (1999). "Pituitary adenylate cyclase-activating polypeptide

activates a phospholipase C-dependent signal pathway in chick ciliary ganglion

neurons that selectively inhibits 7-containing nicotinic receptors." J. Neurosci.

19: 6327-6337.

Paysan, J., W. G. Conroy, J. S. Coggan and D. K. Berg (2000). "The neurofilament

infrastructure of a developing presynaptic calyx." Journal of Comparative

Neurology 425: 284-294.

Peeters, K., H. H. J. Gerets, L. Arckens and F. Vandesande (2000). "Distribution of

pituitary adenylate cyclase-activating polypeptide and pituitary adenylate cyclase-

activating polypeptide type I receptor mRNA in the chicken brain." J. Comp.

Neurol. 423: 66-82.

Pilar, G., L. Landmesser and L. Burstein (1980). "Competition for survival among

developing ciliary ganglion cells." J. Neurophysiology 43: 233-254.

101 Pilar, G. and J. B. Tuttle (1982). A simple neuronal system with a range of uses: the

avian ciliary ganglion. Progress in Cholinergic Biology: Model Cholinergic

Synapses. I. Hanin and A. M. Goldberg. New York, Raven Press.

Pugh, P. and J. Margiotta (2000). "Nicotinic acetylcholine receptor agonists promote

survival and reduce apoptosis of chick ciliary ganglion neurons." Mol Cell

Neurosci 15(2): 113-122.

Pugh, P. and J. Margiotta (2006). "PACAP support of neuronal survival requires MAPK-

and activity-generated signals." Molecular and Cellular Neuroscience 31: 586-

595.

Rawlings, S. R. (1994). "At the cutting edge: PACAP, PACAP receptors and

intracellular signaling." Mol. Cell. Endocrinol. 101: C5-C9.

Reiner, A. (1987). "A VIP-like peptide co-occurs with substance P and enkephalin in

cholinergic preganglionic terminals of the avian ciliary ganglion." Neurosci. Lett.

78: 22-28.

Robberecht, P., P. Gourlet, P. De Neef, M.-C. Woussen-Colle, M.-C. Vandermeers-Piret,

A. Vandermeers and J. Christophe (1992). "Structural requirements for the

occupancy of pituitary adenylate cyclase-activating peptide (PACAP) receptors

and adenylate cyclase activation in human neuroblastoma NB-OK-1 cell

membranes. Discovery of PACAP(6-38) as a potent antagonist." Eur. J. Biochem

207: 239-246.

102 Rubio, M. E., C. Curcio, N. Chauvet and J. L. Bruses (2005). "Assembly of the N-

cadherin complex during synapse formation involves uncoupling of p120-catenin

and association with presenilin 1." Molecular and Cellular Neuroscience 30: 118-

130.

Shaywitz, A. and M. E. Greenberg (1999). "CREB: A stimulus-induced transcription

factor activated by a diverse array of extracellular signals." Annu Rev Biochem.

68: 821-861.

Sherwood, N. M., S. L. Krueckl and J. E. McRory (2000). "The origin and function of the

pituitary adenylate cyclase-activating polypeptide (PACAP)/glucagon

superfamily." Endocrine Reviews 21(6): 619-670.

Shi, G.-X., H. Rehmann and D. A. Andres (2006). "A novel cyclic AMP-dependent

Epac-Rit signaling pathway contributes to PACAP38-mediated neuronal

differentiation." Molecular and Cellular Biology 26(23): 9136-9147.

Somogyvari-Vigh, A. and D. Reglodi (2004). "Pituitary adenylate cyclase activating

polypeptide: a potential neuroprotective peptide." Curent Pharmacology Des.

10(23): 2861-2869.

Sondek, J., A. Bohm, D. G. Lambright, H. E. Hamm and P. B. Sigle (1996). "Crystal

structure of a G protein simer at 2.1 A resolution." Nature 379: 269-274.

103 Spengler, D., C. Waeber, C. Pantaloni, F. Holsboer, J. Bockaert, P. Seeburg and L.

Journot (1993). "Differential signal transduction by five splice variants of the

PACAP receptor." Nature 365: 170-175.

Squire, L. R., F. E. Bloom, S. K. McConnell, J. L. Roberts, N. C. Spitzer and M. J.

Zigmond, Eds. (2003). Fundamental Neuroscience. San Diego, Elsevier Science.

Staines, D. R. (2004). "Is gulf war syndrome an autoimmune disorder of endogenous

neuropeptides, exogenous sandfly maxadilan and molecular mimicry?" Medical

Hypotheses 62: 658-664.

Stone, E. M., K. N. Rothblum, M. C. Alevy, T. M. Kuo and R. J. Schwartz (1985).

"Complete coding sequence of the chicken glyceraldehyde-3-phosphate

dehydrogenase gene." Proceedings National Academy of Sciences USA 82(6):

1628-1632.

Strand, F. L. (1999). Peptides: Regulators of Physiological Procsses, MIT Press.

Sumner, A., L. Przepyszny and J. Margiotta (2004). "PACAP localizes to presynaptic

terminals and activates CREB in ciliary ganglion neurons." Society for

Neuroscience Abstract Viewer 2004: 847.14.

Uchida, D., I. Tatsuno, T. Tanaka, A. Hirai, Y. Saito, O. Moro and M. Tajima (1998).

"Maxadilan is a specific agonist and its deleted peptide (M65) is a specific

anatagonist for PACAP type I receptor." Ann. NY Acad. Sci. 865: 253-258.

104 Vaudry, D., Y. Chen, C. M. Hsu and L. E. Eiden (2002). "PC12 cells as a model to study

the neurotrophic activities of PACAP." Ann. NY Acad. Sci. 971: 491-496.

Vaudry, D., B. Gonzalez, M. Basille, T. Pamantung, M. Fontaine, A. Fournier and H.

Vaudry (2000). "The neuroprotective effect of pituitary adenylate cyclase-

activating polypeptide on cerebellar granule cells is mediated through inhibition

of the CED-related cysteine protease caspase-3/CPP32." Proceedings National

Academy of Sciences USA 97(24): 13390-13395.

Vaudry, D., B. Gonzalez, M. Basille, L. Yon, A. Fournier and H. Vaudry (2000).

"Pituitary adenylate cyclase-activating polypeptide and its receptors: from

structure to functions." Pharmacological Reviews 52(2): 269-324.

Vaudry, D., B. J. Gonzalez, M. Basille, Y. Anouar, A. Fournier and H. Vaudry (1998).

"Pituitary adenylate cyclase-activating polypeptide stimulates both c-fos gene

expression and cell survival in rat cerebellar granule neurons through activation of

the protein kinase A pathway." Neuroscience 84(3): 801-812.

Verhage, M., H. T. McMahon, W. E. J. M. Ghijsen, F. Boomsma, G. Scholten, V. M.

Wiegant and D. G. Nicholls (1991). "Differential release of amino acids,

neuropeptides, and catacholamines from isolated nerve terminals." Neuron 6: 517-

524.

105 Vernallis, A. B., W. G. Conroy and D. K. Berg (1993). "Neurons assemble AChRs with

as many as 3 kinds of subunits while maintaining subunit segregation among

subtypes." Neuron 10: 451-464.

Vijayaraghavan, S., S. A. Goueli, M. P. Davey and D. W. Carr (1997). "Protein kinase A

anchoring inhibitor peptides arrest mammalian sperm motility." J. Biological

Chemistry 272: 4747-4752.

Wicht, H., E. Maronde, J. Olcese and H.-W. Korf (1999). "A semiquantitative image-

analytical method for the recording of dose-response curves in

immunocyctochemical preparations." Journal of Histochemistry and

Cytochemistry 47(3): 411-419.

Wilson Horch, H. and P. Sargent (1995). "Perisynaptic surface distribution of multiple

classes of nicotinic acetylcholine receptors on neurons in the chicken ciliary

ganglion." J Neurosci 15: 7778-7795.

Wong, W. and J. D. Scott (2004). "AKAP signaling complexes: focal points in space and

time." Nature Reviews Molecular Cell Biology 5: 959-970.

Xiao, Y.-T., L.-X. Xiang and J.-Z. Shao (2007). "Bone morphogenetic protein."

Biochemical and biophysical research communications 362: 550-553.

Zauli, G., D. Milani, P. Mirandola, M. Mazzoni, P. Secchiero, S. Miscia and S. Capitani

(2001). "HIV-1 Tat protein down-regulates CREB transcription factor expression

106 in PC12 neuronal cells through a phosphatidylinositol 3-kinase/AKT/cyclic

nucleoside phosphodiesterase pathway." FASEB Journal 15: 483-491.

Zhang, Z.-W., S. Vijayaraghavan and D. K. Berg (1994). "Neuronal acetylcholine

receptors that bind -bungarotoxin with high affinity function as ligand-gated ion

channels." Neuron 12: 167-177.

Zhou, X., Q. Nai, M. Chen, J. D. Dittus, M. J. Howard and J. F. Margiotta (2004).

"Brain-derived neurotrophic factor and trkB signaling in parasympathetic

neurons: relevance to regulating 7-containing nicotinic receptors and synaptic

function." Journal of Neuroscience 24(18): 4340-4350.

107 ABSTRACT

Pituitary adenylate cyclase activating polypeptide (PACAP) modulates a spectrum of cellular functions, with many effects persisting for hours to days. PACAP and its high affinity receptors (PAC1) are known to be present in the chick ciliary ganglion (CG).

Here it is demonstrated that PACAP is localized to presynaptic terminals and can be released by membrane depolarization. This study also establishes the presence of the

PACAP and VIP equal affinity receptors, VPAC1 and VPAC2, as well as several splice variants of the PAC1 receptors in the CG. PAC1 receptors have previously been shown to couple through adenylate cyclase (AC) and phospholipase-C dependent (PLC) signaling cascades to increase levels of intracellular cAMP and Ca2+ respectively. Since both messengers influence gene transcription, the ability of PACAP to activate the transcription factor CREB (cAMP/Ca2+ response element binding protein) and to alter subsequent neuronal gene expression was examined. PACAP persistently activated

CREB, as indicated by dose- and time-dependent increases in the incidence and intensity of Ser133 phosphorylated CREB (pCREB) labeling in CG neuron nuclei that remained elevated ≥90 min after PACAP exposures (15 min). Despite the presence of VPAC receptors in the CG, pCREB induction required PAC1 receptors since it was mimicked by a PAC1 agonist (maxadilan) and inhibited by a PAC1 antagonist (P6-38). The cAMP- dependent protein kinase (PKA) may be involved in signal transduction cascades since pCREB was reduced by PKA inhibition (with H89 or KT5720). Since PACAP is abundant in the CG and released from depolarized cholinergic terminals, it could alter gene expression relevant to synapses and other activity-dependent processes. Affymetrix

108 28K chicken genome arrays were therefore screened using RNA extracted from 4-day

CG neuron cultures grown with or without 100 nM PACAP for 15min, 24h, or 96h.

Diverse categories of genes were altered by PACAP treatment, including those implicated in synaptic function, neuronal growth, survival, and development. Regulation of particular genes of interest; WAS3, WAS1, NESH3, Synapsin IIa, and Urocortin 3 were further explored with real-time RT-PCR. These results underscore the importance of PACAP in exerting modulatory and trophic influences on neurons by differentially altering gene expression in a time dependent fashion.

109