Molecular Mechanisms of Regulation
of SLC11A1 Gene Expression
By:
Yong Zhong Xu
Department of Medicine, Division of Experimental Medicine
McGill University, Montreal
May 2013
A thesis submitted to McGill University in partial fulfillment of the
requirements of the degree of Doctor of Philosophy
Copyright 2013, Yong Zhong Xu
1 TABLE OF CONTENTS
Abstract………………………………………………………………………………………………………...5
Résume…………………………………………………………………………………...... 8
Acknowledgements………………………………………………………………………………………11
Preface & Contribution of Authors……………………………………………………………….13
Abbreviations………………………………………………………………………………………………15
List of Figures and Tables……………………………………………………………………………..18
Rationale, Objectives and General Outline of the Research………………………...21
Chapter 1: Literature review……………………………………………………………………….29
1.1 Genetics of infectious disease…………………………………………………………….31
1.2 SLC11A1 ……………………………………………………………………………………….…..34
1.2.1 Identification…………………………………………………………………………..…34
1.2.2 SLC11A1 Structure…………………………………………………………………..…37
1.2.2.1 Gene structure…………………………………………………………..…….37
1.2.2.2 Protein Structure…………………………………………………………..…38
1.2.3 Expression and Localization……………………………………………………..…42
1.2.4 SLC11A1 Function …………………………………………………………………..…..43
1.2.4.1 Regulation of macrophage activation ………………………………….44
1.2.4.2 Divalent cation transport …………………………………………………....45
1.2.4.3 SLC11A1 and Resistance to infection …………………………………..51
1.2.4.4 SLC11A1 polymorphism and disease susceptibility ………...... 55
1.2.5 Orthologs ……………………………………………………………………………….……58
2 1.3 Regulation of SLC11A1 gene expression ………………………………………...59
1.3.1 Overview ………………………………………………………………………………….59
1.3.2 Induction of Slc11a1 (nramp1) expression …………………………….…59
1.3.3 Regulation of Slc11a1/SLC11A1 gene expression at transcriptional
Level ………………………………………………………………………………………..60
1.3.4 Regulation of Slc11a1/SLC11A1 gene expression by mRNA stability
……………………………………………………………………………………………….…62
1.3.5 Regulation of Slc11a1 subcellular localization ……………………….…64
Chapter 2: Nuclear Translocation of ‐actin is Involved in Transcriptional
Regulation of SLC11A1 Gene during Macrophage Differentiation of HL‐60 Cells ………………………………………………………………...... ………..66
Abstract …………………………………………………………………………………………………...67
Introduction ……………………………………………………………………………………………..68
Materials and Methods …………………………………………………………………………….71
Results………………………………………………………………………………………………………78
Discussion ……………………………………………………………………………………………...104
Acknowledgements ……………………………………………………………………………..…114
Supplementary Materials ……………………………………………………………………....115
Chapter 3: Recruitment of SWI/SNF complex is required for transcriptional activation of SLC11A1 gene during macrophage differentiation of HL‐60 cells ………………………………………………………………………………………….124
Abstract ………………………………………………………………………………………………..125
3 Introduction ………………………………………………………………………………………….….126
Materials and Methods …………………………………………………………………………….130
Results ……………………………………………………………………………………………………..139
Discussion …………………………………………………………………………………………………167
Acknowledgements ………………………………………………………………………………….172
Chapter 4: Src family kinase activity is involved in tyrosine phosphorylation and subcellular localization of SLC11A1 in macrophages …………………………………..173
Abstract …………………………………………………………………………………………………....174
Introduction …………………………………………………………………………………………..…175
Materials and Methods …………………………………………………………………………....178
Results ……………………………………………………………………………………………………….186
Discussion ……………………………………………………………………………………………….…213
Acknowledgements …………………………………………………………………………………. 220
Chapter 5: Summary and General Discussion …………………………………………….221
5.1 Summary ………………………………………………………………………………………….222
5.2 Discussion ………………………………………………………………………………………..224
5.3 Conclusion ………………………………………………………………………………………..231
Chapter 6: Claims to Originality ………………………………………………………………….233
Reference List …………………………………………………………………………………………….235
Appendix I: Table S2.3 β‐actin target genes identified by ChIP‐on‐chip in HL‐60 cells left untreated or treated with PMA for 48 hrs …………………………………….265
Appendix II: List of other published papers and book chapters ………………..293
Appendix III: Research Compliance Certificates …………………………………………295
4 ABSTRACT
Solute carrier family 11 member 1 protein (SLC11A1), also known as natural resistance‐associated macrophage protein 1 (NRAMP1), plays an important role in the host immune defense and inflammatory response. It is a highly conserved transmembrane protein which transports divalent metal cations in a proton‐ dependent manner. It regulates iron homeostasis in macrophages and exerts pleiotropic effects on macrophage activation. In mice, natural resistance or susceptibility to a range of intracellular pathogens is controlled by the Slc11a1 gene. In human, genetic polymorphisms of the SLC11A1 gene have been shown to be associated with a susceptibility to a variety of infectious and autoimmune diseases. The expression of the SLC11A1 gene is strictly regulated during myeloid differentiation. The human promyelocytic leukemia cell lines such as HL‐60 and
U937 cells are useful models to study the regulation of SLC11A1 gene expression during experimentally induced granulocytic, monocytic, or macrophage‐like differentiation. Herein, we demonstrated that during the PMA‐induced differentiation of HL‐60 cells and human monocytes toward macrophages, ‐ actin translocates from the cytoplasm to the nucleus where it is associated with
RNA polymerase II and binds to the promoter of the SLC11A1 gene. ‐actin knockdown inhibits the SLC11A1 promoter‐driven transcription, and neutralization of nuclear actin by in vivo microinjection of antibodies against ‐
5 actin into nuclei significantly blocks the expression of SLC11A1 mRNA. Further studies revealed that an AP‐1‐like element present in the proximal region of the
SLC11A1 gene promoter is essential for PMA‐induced transcriptional activation of this gene. β‐actin, as a subunit of the SWI/SNF complex, and another subunit
BRG1 are associated with the transcription factor ATF‐3 and are recruited to the
AP‐1 like element in an ATF‐3‐dependant manner . ATF‐3 cooperates with BRG1
and β‐actin to activate the SLC11A1 promoter. Furthermore, a proximal (GT/AC)n repeat (t(gt)5ac(gt)5ac(gt)9g) region adjacent to the AP‐1‐like element is converted into a Z‐DNA structure in response to PMA treatment, and BRG1 is involved in this process. Our results suggest that recruitment of the SWI/SNF complex initiates Z‐DNA formation and subsequently helps to transactivate the
SLC11A1 gene. Previous studies have shown that SLC11A1 is extensively glycosylated and phosphorylated, and is localized at the membrane of late endosomes/lysosomes in macrophages. The present study revealed that
SLC11A1 is tyrosine‐phosphorylated during the differentiation of U937 cells into macrophages induced by PMA. Using the kinase inhibitor PP2 and RNA interference experiments, we demonstrated that Src family kinases including c‐
Src are required for the tyrosine phosphorylation of SLC11A1 protein. In vitro phosphorylation assays showed that SLC11A1 is a direct substrate for active c‐Src kinase. Furthermore, tyrosine 15 is identified as the tyrosine phosphorylation site by Src family kinases and phosphorylation of tyrosine 15 modulates
SLC11A1‐mediated nitric oxide production. We also showed that the Src family
6 kinases including c‐Src are also involved in lysosomal targeting of SLC11A1. These results suggest an important role of Src family kinases in subcellular localization and function of SLC11A1 in macrophages. Overall, our studies contributed important information on the regulation of expression of SLC11A1 in macrophages and its role in regulation of macrophage functions.
7 Résumé
La protéine « Solute carrier family 11 member 1 » (SLC11A1), aussi connue sous le nom « natural resistance associated macrophage protein 1 » (NRAMP1), jour un rôle important dans la défense immunitaire et réponse inflammatoire de l'hôte. C’est une protéine transmembranaire hautement conservée qui transporte des cations divalents métalliques d’une manière dépendent des protons. Elle régularise l’homéostasie du fer dans les macrophages et a des effets pléiotropiques sur l’activation de ces cellules. Chez les souris, le gène
Slc11a1 contrôle la resistance naturelle ou la susceptibilité aux pathogènes intracellulaires. Chez les humains, les polymorphismes génétiques de SLC11A1 sont associés à une susceptibilité à une variété de maladies infectieuses ou auto‐ immunitaires. L’expression du gène SLC11A1 est strictement régularisée pendant la différenciation myéloïde. Les lignées cellulaires humaines dérivées de la leucémie aiguë promyélocytaire, telles que la HL‐60 et l’U937, sont des modèles utiles pour étudier le contrôle de l’expression du gène SLC11A1 pendant la différenciation de type granulocytaire, monocytaire ou de macrophage induite expérimentalement. Ici, nous avons démontré que durant la différenciation induite par PMA des cellules HL‐60 et des monocytes humains aux macrophages,
β‐actine passe du cytoplasme au noyau où il s’associe avec l’ARN polymérase II et se fixe sure le promoteur du gène SLC11A1. Le « knock‐down » de la β‐actine inhibe la transcription menée par le promoteur de gène SLC11A1. Dans le noyau,
8 l’expression de l’ARN de SLC11A1 est bloqué significativement en neutralisant l’actine par la microinjection in vivo des anticorps contre β‐actine. Autres études ont démontré qu’un élément « semblable à AP‐1 » est présent dans la région proximale du promoteur de SLC11A1 et celui‐ci est essentiel pour l’activation transcriptionnelle de ce gène induite par PMA. β‐actine, étant une sous‐unité du complexe SWI/SNF, et la sous‐unité BRG1 sont associés avec le facteur de transcription ATF‐3. Ensemble, elles sont recrutées à l’élément semblable à AP‐1 en une manière qui dépendante sur ATF‐3. ATF‐3 coopère avec BRG1 et β‐actine pour activer le promoteur de SLC11A1. De plus, la région du répète proximale
(GT/AC)n [t(gt)5ac(gt)5ac(gt)9g] adjacent au élément semblable à AP‐1 est convertit en une structure de Z‐ADN en réponse au traitement de PMA, un processus dans lequel BRG1 est impliqué. Nos résultats suggèrent que le recrutement du complexe SWI/SNF amorce la formation de Z‐ADN et aide à transactiver le gène SLC11A1. Des études précédentes ont démontrés que
SLC11A1 est extensivement glycosylée et phosphorylée, et que cette protéine se trouve chez les macrophages dans les membranes des endosomes tardifs ou des lysosomes. L’étude présentée ici a révélé que SLC11A1 est phosphorylée sur les tyrosines pendant la différenciation des cellules U937 aux macrophages par PMA.
En utilisant l’inhibiteur de kinase PP2 et des essais d’interférence d’ARN, nous avons démontré que les kinases de la famille Src, incluant c‐Src, sont requises pour la phosphorylation de tyrosine de la protéine SLC11A1. Les essais in vitro de phosphorylation ont montré que SCL11A1 est un substrat direct pour la kinase
9 active c‐Src. De plus, la tyrosine 15 a été identifiée comme étant le site de phosphorylation de kinases de la famille Src. La phosphorylation de tyrosine 15 fait moduler la production de l’oxyde nitrique de laquelle SLC11A1 fait parti.
Nous avons aussi montré que les kinases de la famille Src ont un rôle important dans la localisation subcellulaire et dans le fonctionnement de SLC11A1 dans les macrophages. Globalement, nos études ont contribué d’information importante sur la régularisation de l’expression de SCL11A1 dans les macrophages et son rôle dans le fonctionnement des macrophages.
10 ACKNOWLEDGEMENTS
First and foremost, I’ll be eternally grateful to my supervisor Dr. Danuta
Radzioch, whose professional knowledge, deep insight, and patience, added considerably to my research experience. I have been remarkably fortunate to have her as my supervisor who, at one hand, has given me the freedom to explore what interested me, on the other hand, provided unreserved help and guidance when needed. I appreciate her extensive knowledge and skills in many areas such as molecular biology, biochemistry, genetics and immunology.
I would also like to thank the other members of my PhD committee, Dr. Mario
Chevrette, Dr. Imed Gallouzi, Dr. Marek Rola‐Pleszczynski and Dr. Gergely Lukacs for the advice and assistance they provided during the development of the research project. Their guidance has served me well and I owe them my heartfelt appreciation.
Special thanks go to Dr. James Garnon for his invaluable help, advice and support of experimental techniques when I started my research work in Dr.
Danuta Radzioch’s laboratory. Many thanks also go to Dr. Thusanth Thuraisingam for his friendship and close collaboration, and to Dr. Claude Lachance for his technical support including computer skills. I would like to thank Mr. Ning Zhang who assisted with Figure 1.1 and 1.2 of the Chapter 1. I am very grateful to
Cynthia Kanagaratham and Gabriella Wojewodka for their language correction of
11 the thesis and French translation of the abstract. Daniel Houle, your friendship and assistance has meant more to me than I could ever express.
I would like to thank all the past and present members of our laboratory whose discussion and suggestions have contributed to the improvement of my research. I would also like to express my gratitude to all those who gave me the possibility to commence and complete this dissertation.
This thesis is dedicated to my wife, Hong Chen, who has always supported me in my endeavors, always given me the strength and encouragement to complete this work. Without her unwavering support and love, this thesis would have never been written.
12 Preface & Contribution of Authors
In concordance with the Guidelines for Thesis Preparation, the author will present a manuscript‐based thesis that was prepared under the supervision and guidance of Dr. Danuta Radzioch at the Research Institute of the McGill
University Health Center. The following indicates the specific contributions of all authors for each chapter of this thesis.
In the first Chapter “Literature Review”, the thesis author gives an overview of the identification, structure, functions and expression regulation of
Slc11a1/SLC11A1 gene. The thesis author contributed to the entire process of literature collecting, writing and correcting. Dr. Danuta Radzioch gave a review and correction of this chapter.
Chapter 2 is based on a published manuscript “Nuclear Translocation of ‐ actin is Involved in Transcriptional Regulation during Macrophage differentiation of HL‐60 Cells” by Yong Zhong Xu, Thusanth Thuraisingam, David Anderson de
Lima Morais, Marek Rola‐Pleszczynski and Danuta Radzioch, published in
Molecular Biology of the Cell (MBC, 2010 March,21(5):811‐820). YZX designed the study, performed plasmid construction, ChIP, co‐immunoprecipitation, cell transfection, luciferase reporter analysis, microinjection, immunofluorescence staining, mRNA in situ hybridization, data analysis as well as prepared the manuscript. TT performed RT‐PCR/ qPCR analysis and helped YZX in Western blot analysis and immunofluorescence staining. DAM performed the data processing
13 of ChIP‐on‐chip and statistical analysis. MR contributed to the preparation of human peripheral blood monocytes. DR was involved in the data analysis, design and coordination of the study.
Chapter 3 “Recruitment of SWI/SNF Complex Is Required for Transcriptional activation of the SLC11A1 Gene during Macrophage Differentiation of HL‐60
Cells” by Yong Zhong Xu, Thusanth Thuraisingam, Rafael Marino, and Danuta
Radzioch was originally published in The Journal of Biological Chemistry (JBC,
2011April, 286:12839‐12849). TT was responsible for RT‐PCR/ qPCR analysis and assisted YZX in Western blot analysis and statistical analysis. RM performed DNA affinity pulldown assays and assisted YZX in expression and purification of
ZaaFOK. DR assisted YZX in the data analysis and design of the study. YZX was in charge of designing the experiments, performing all other experiments, analyzing data and writing manuscript.
The work presented in Chapter 4 “Src family kinase activity is involved in tyrosine phosphorylation and subcellular localization of SLC11A1 in macrophages” has been prepared as a manuscript for submission to The Journal of Biological Chemistry. Cynthia Kanagaratham, a PhD candidate in the laboratory of Dr. Danuta Radzioch, was responsible for NO production analysis and assisted the thesis author in Western blot analysis and RNA interference experiments. The thesis author planned the experimental work outlined in this
Chapter under the supervision of Dr.Danuta Radzioch. The thesis author was responsible for other experiments, data analysis and manuscript preparation.
14 LIST OF ABBREVIATIONS
ABP actin‐binding protein
AP‐1 activator protein 1
ARE AU‐rich element
ARP actin‐related protein
ATF‐3 activating transcription factor 3
BAF BRG1/hBRM‐ associated factor
BCG bacille Calmette‐Guérin
Bcgr resistant allele of Bcg gene
Bcgs susceptible allele of the Bcg gene
BRCA1/2 breast cancer 1/2, early onset
BRG1 brahma‐related gene 1
C/EBPs CCAAT enhancer binding proteins
ChIP chromatin immunoprecipitation
DC dendritic cells
DMSO dimethyl sulfoxide
ERK1/2 extracellular signal‐regulated protein kinases 1 and 2
GAPDH glyceraldehyde‐3‐phosphate dehydrogenase
HIV human immunodeficiency virus
HO‐1 heme oxygenase‐1
15 IFN‐γ interferon‐gamma
IRF‐8 interferon regulatory factor 8
IL interleukin
LM‐PCR linker ligation‐mediated PCR iNOS inducible nitric oxide synthase
Inrs initiator elements
JNK c‐Jun N‐terminal kinase
LAMP1 lysosomal‐associated membrane protein 1
LPS lipopolysaccharide
MAPK mitogen‐activated protein kinase
MHC II major histocompatibility complex class II
Miz‐1 myc interacting zinc finger protein 1
MMP‐9 matrix metallopeptidase 9
MSMD mendelian susceptibility to mycobacterial diseases
GM‐CSF granulocyte macrophage colony stimulating factor
NRAMP1 natural resistance associated macrophage protein 1
NF‐κB nuclear factor kappa B
NO nitric oxide
PI 3 phosphatidylinositide 3
PKC protein kinase C
PMA phorbol myristate acetate
PRD proline‐rich domain
16 RE reticuloendothelial
RNAP II RNA polymerase II
SFK src family kinase
SH2 src homology 2
SH3 src homology 3 siRNA small interfering RNA
SLC11A1 solute carrier family 11 member 1 protein
SNP single nucleotide polymorphism
Sp1 specificity protein 1
SWI/SWF mating type switching /sucrose non‐fermenting
TB tuberculosis
TGF‐β transforming growth factor beta
TM transmembrane domains
TNF‐α tumor necrosis factor‐α
TSS transcriptional start site
3’‐UTR 3’‐untranslated region
V‐ATPase vacuolar‐type proton ATPase
17 LIST OF FIGURES AND TABLES
Chapter 1
Figure 1.1 ………………………………………………………………………………………………………..41
Figure 1.2 ………………………………………………………….…………………………………………….50
Table 1.1 …………………………………………………………………………………………………………39
Chapter 2
Figure 2.1 PMA treatment induces ‐actin translocation to the nucleus…… …82
Figure 2.2 Effects of JNK, PI3‐K or p38 MAPK inhibitors on PMA‐induced translocation of ‐actin into nucleus……………………………………………………………….85
Figure 2.3 Endogenous or exogenous ‐actin is associated with RNA polymerase II (RNAP II) during the differentiation of HL‐60 cells…………………….89
Figure 2.4 High‐resolution ChIP‐on‐chip analysis of ‐actin binding to chromosome 2 ………………………………………………………………………………………………92
Figure 2.5 Validation of ‐actin target genes identified by ChIP‐on‐chip……..97
Figure 2.6 Effects of ‐actin knockdown on ‐actin binding and RNA Pol II recruitment at selected promoters in HL‐60 cells as assayed by ChIP‐qPCR…..99
Figure 2.7 Effects of ‐actin knockdown on the expression of six target genes …………………………………………………………………………………………………………..102
Figure 2.8 Nuclear ‐actin is required for PMA‐induced transactivation of
SLC11A1………………………………………………………………………………………………………….107
18 Figure S2.1 Effects of JNK, PI3‐K or p38 MAPK inhibitors on PMA‐induced differentiation of HL‐60 cells ………………………………………………………………………….118
Table 2.1 Gene ontology (GO) categories significantly enriched for ‐actin target genes……………………………………………………………………………………………………95
Table S2.1 PCR primers used for conventional ChIP……………………………………..119
Table S2.2 Survey of inhibitors of signalling pathways: effects on nuclear translocation of ‐actin…………………………………………………………………………………120
Table S2.4 Identified ‐actin targets involved in chromatin remodelling, transcription, RNA splicing and nucleocytoplasmic transport……………………….121
Chapter 3
Figure 3.1 The AP‐1‐like element is required for SLC11A1 transcriptional activation by PMA……………………………………………………………………………….……….141
Figure 3.2 PMA induces the binding of ATF‐3/Jun B to the AP‐1 like element…………………………………………………………………………………………………….…145
Figure 3.3 BRG1 and β‐actin are recruited to the AP‐1‐like site in response to
PMA…………………………………………………………………………………………………………….148
Figure 3.4 ATF‐3 mediates the recruitment of BRG1 and β‐actin to the SLC11A1 promoter………………………………………………………………………………………………………151
Figure 3.5 ATF‐3 forms a complex with BRG1 and β‐actin in response to
PMA……………………………………………………………………………………………………………..155
Figure 3.6 RNA interference‐mediated depletion of BRG1 and ATF‐3 reduces
PMA‐ induced SLC11A1 expression…………………………………………………………….….158
19 Figure 3.7 ATF‐3, BRG1 and ‐actin cooperate to activate the SLC11A1 promoter……………………………………………………………………………………………………….162
Figure 3.8 Recruitment of BRG1 to the AP‐1‐like element is required for PMA‐ induced Z‐DNA formation at the SLC11A1 promoter …………………………………...166
Chapter 4
Figure 4.1 Effect of PMA treatment on the tyrosine phosphorylation of
SLC11A1 and Src kinase activity ……………………………………………………………………189
Figure 4.2 Inhibition of Src family kinase activity blocks tyrosine phosphorylation of SLC11A1 ………………………………………………………………………..192
Figure 4.3 Effects of Src knockdown or overexpression of kinase‐inactive Src on the tyrosine phosphorylation of SLC11A1……………………………………………………..195
Figure 4.4 In vitro phosphorylation of SLC11A1 by c‐Src ……………………………197
Figure 4.5 PMA‐induced association of SLC11A1 with c‐Src in intact cells….200
Figure 4.6 The proline‐rich region of Slc11a1 is required for association with
Src kinase ………………………………………………………………………………………………………203
Figure 4.7 Identification of the tyrosine phosphorylation site of SLC11A1 by c‐
Src…………………………………………………………………………………………………………………206
Figure 4.8 Effects of Src family kinase inhibitor, PP2, on the subcellular localization of SLC11A1 protein …………………………………………………………….………210
Figure 4.9 Effects of Src knockdown on the subcellular localization of
SLC11A1………………………………………………………………………………………………………..212
Figure 4.10 Phosphorylation of SLC11A1 at Y15 is not required for its lysosomal targeting ………………………………………………………………………………………………………215
20 Rationale, Objectives and General Outline of the Research
Solute carrier family 11 member 1 (Slc11a1) gene, responsible for BCG phenotype, also known as natural resistance associated macrophage protein 1
(Nramp1) gene, was initially identified in 1993 by positional cloning of the locus mapped on mouse chromosome 1(Vidal et al., 1993). The mouse Slc11a1 is expressed in professional phagocytes and functions as a divalent metal‐ion transporter at the membrane of phagosomes to restrict the growth of endocytosed pathogens (Gruenheid and Gros, 2000;Gruenheid et al.,
1997;Mackenzie and Hediger, 2004). However, a naturally occurring glycine to aspartic acid substitution at position 169 (G169D) of Slc11a1 gene makes the mice carrying this variant of the gene susceptible to infection with a range of unrelated intracellular parasites such as Salmonella enterica , serovar
Typhimurium, Leishmania donovani, and various Mycobacterium species, including Mycobacterium bovis and Mycobacterium lepraemurium (Blackwell et al., 1994;Bradley, 1977;Plant and Glynn, 1976a;Plant and Glynn, 1976b;Skamene et al., 1982;Vidal et al., 1993). Functional studies have shown that Slc11a1 regulates antimicrobial activity of macrophages and dendritic cells, including up‐ regulation of production of chemokine KC and proinflammatory cytokines, induction of nitric oxide (NO) release and oxidative burst, enhancement of major histocompatibility complex class II molecule expression (Blackwell et al.,
21 2003;Forbes and Gros, 2001;Fritsche et al., 2003;Kuhn et al., 1999;Nevo and
Nelson, 2006;Valdez et al., 2009;Wojciechowski et al., 1999;Zwilling et al., 1987), and modulation of antigen presentation to T cells (Lang et al., 1997;Stober et al.,
2007). The genetic polymorphisms in the human homologue (SLC11A1) gene has also been reported to be linked to susceptibility to infectious diseases, such as tuberculosis, leprosy, and human immunodeficiency virus infection, as well as to autoimmune diseases, such as rheumatoid arthritis, juvenile rheumatoid arthritis, sarcoidosis, and Crohn's diseases (Blackwell et al., 2001;Donninger et al., 2004).
During the past two decades, researchers have been trying to elucidate the mechanism of how Slc11a1/SLC11A1 functions and to link the genetic polymorphisms to disease susceptibility but the detailed molecular mechanism of regulation of this gene has remained to be fully elucidated and understood.
The expression of the Slc11a1 gene in murine macrophages cells is up‐regulated by bacterial lipopolysaccharide, interferon γ, granulocyte/macrophage colony‐ stimulating factor, and inflammatory stimuli (Atkinson et al., 1997;Baker et al.,
2000;Brown et al., 1995;Govoni et al., 1997;Govoni et al., 1995;Xu et al., 2005).
In human, the SLC11A1 gene expression is strictly regulated during myeloid differentiation. SLC11A1 gene expression is undetectable in transformed human cell lines from either erythroid or lymphoid T or B lineages as well as in the progenitors of the monocyte/macrophage pathway (KG1, U937, THP) and the promyelocytic leukemia cell line HL‐60 (Cellier et al., 1997;Xu et al., 2005).
However, the expression of this gene is strongly induced when these cells are
22 differentiated toward either the monocyte/macrophage or the granulocyte pathway (Cellier et al., 1997;Xu et al., 2005). So far, little has been known about the molecular mechanism of the regulation of Slc11a1/SLC11A1 gene expression by the above‐mentioned stimuli.
HL‐60 cells have been shown to be a useful model to study the regulation of
SLC11A1 gene expression during experimentally induced granulocytic, monocytic, or macrophage‐like differentiation. Richer et al. (Richer et al., 2008) demonstrated that transcription factors Sp1 and CCAAT/enhancer‐binding protein are recruited to two cis‐acting elements in the SLC11A1 promoter region and regulate its transcriptional activity during the monocytic differentiation of
HL‐60 cells by vitamin D. Our previous study demonstrated that HuR binds to an
AU‐rich element present in the 3′UTR of SLC11A1 mRNA and significantly increases SLC11A1 mRNA stability and protein expression during PMA‐induced macrophage‐like differentiation of HL‐60 cells (Xu et al., 2005). Our findings also revealed that under the specific conditions in which SLC11A1 mRNA is strongly induced by PMA in HL‐60 cells, β‐actin redistributes and translocates from the cytoplasm to the nucleus (Xu et al., 2010). Actin is one of the most abundant proteins in eukaryotic cells. It has been extensively studied as a cytoplasmic cytoskeletal protein that plays roles in cellular processes such as cell motility, growth, cytokinesis, endocytosis and intracellular trafficking (Ascough,
2004;Brakebusch and Fassler, 2003;Suetsugu and Takenawa, 2003). However, during the past decade, more and more evidence support the direct functional
23 involvement of actin in diverse nuclear activities, ranging from chromatin remodeling to transcription to RNA splicing and nucleocytoplasmic trafficking
(Blessing et al., 2004;Chen and Shen, 2007;Olave et al., 2002;Xu et al., 2012). The essential roles of actin in transcription by RNA polymerase I (Fomproix and
Percipalle, 2004;Philimonenko et al., 2004;Sjolinder et al., 2005), II (Hofmann et al., 2004;Kukalev et al., 2005;Percipalle et al., 2003;Sjolinder et al., 2005) and III
(Hu et al., 2003;Hu et al., 2004) have been well documented. Therefore, we hypothesized that PMA‐induced nuclear accumulation of actin is involved in activation of SLC11A1 gene transcription. A series of experiments were designed as described in detail in Chapter 2 of this thesis to confirm our hypothesis. Firstly, to identify the signaling pathway(s) influencing the nuclear accumulation of actin, we tested a series of inhibitors of signaling pathways. Our results demonstrated that p38 MAPK inhibitors can block PMA‐induced translocation of actin into nuclei but do not prevent the differentiation of HL‐60 cells to the macrophage‐ like phenotype. Secondly, using Chromatin Immunoprecipitation (ChIP)‐on‐chip assays, the genome‐wide maps of ‐actin binding to gene promoters in response to PMA treatment is analyzed in HL‐60 cells. Conventional ChIP experiments using PCR primers confirmed that SLC11A1 is one of the ‐actin target genes.
Finally, siRNA‐mediated ‐actin knockdown, p38 MAPK inhibitors as well as microinjection of ‐actin antibody demonstrated that ‐actin is involved in the transactivation of SLC11A1 gene induced by PMA.
24 Next, we have enquired how SLC11A1 gene is transactivated in response to
PMA treatment and how is ‐actin bound to the gene promoter. In order to answer these questions, a first important step is to find out the cis‐acting element that is required for PMA‐induced transactivation of SLC11A1 gene. As described in Chapter 3, we constructed a series of luciferase reporters that contain progressive deleted promoters of SLC11A1 gene. Promoter deletion analysis demonstrated that a proximal promoter region between nucleotide ‐395 to ‐ 264 is essential for PMA ‐induced gene transcription. When it is deleted, the transcriptional induction will not occur following treatment with PMA. Inspection of the sequence revealed the presence of an AP‐1 like element (TGACTCT) within this region. Further studies demonstrated that this AP‐1 like element is crucial for Slc11a1 gene promoter activity induced by PMA. The AP‐1‐like element is also known as activating transcription factor 3 (ATF‐3) ‐binding site, which has been shown to be bound by ATF and AP‐1 transcription factor families (Karin et al.,
1997;Schreiber et al., 1999). DNA affinity pulldown and ChIP assays showed that binding of ATF‐3 /Jun B to the AP‐1‐like element is PMA‐inducible. Since ATF‐3 has been shown to be able to recruit SWI/SNF complex to target gene promoter, we tested, if by any chance, Brg‐1 and β‐actin, two components of SWI/SNF complex, could bind to AP1 like element via interaction with ATF‐3. Indeed, we found that PMA induce the complex formation among ATF‐3, BRG1 and the recruitment of β‐actin and BRG1 to AP1‐like element in an ATF‐3‐ dependent manner. Furthermore, our results demonstrated that ATF‐3 cooperates with β‐
25 actin and BRG1 to activate the SLC11A1 gene promoter. BRG1‐mediated transcriptional activation of the SLC11A1 gene and the recruitment of BRG1 to the SLC11A1 gene promoter strongly suggest that chromatin remodeling occurs at the promoter in response to PMA treatment. Through analysis of the SLC11A1 promoter, a Z‐DNA forming dinucleotide repeat, t(gt)5ac(gt)5ac(gt)9g, was identified immediately downstream of the AP‐1‐like element in the promoter
(spanning nucleotides −273 to −317). As expected, further studies confirmed that
PMA can induce Z‐DNA formation in SLC11A1 promoter and BRG1 is involved in this process. Taken together, our results presented in the chapter suggest that
PMA‐induced recruitment of the SWI/SNF complex by ATF‐3 to the SLC11A1 promoter initiate the Z‐DNA formation and subsequently help to transactivate the SLC11A1 gene.
Biochemical studies have shown that mouse Slc11a1protein is localized to the membrane of late endosome and lysosome with a molecular mass of 90 to
110 kDa which is extensively glycosylated and phosphorylated in macrophages
(Atkinson and Barton, 1998;Gruenheid et al., 1997;Searle et al., 1998;Vidal et al.,
1996). Human SLC11A1 protein has a similar electrophoretic mobility to that of mouse counterpart (Xu et al., 2005). In vitro phosphorylation assay enabled to demonstrate that mouse Slc11a1 can be phosphorylated at its N‐terminus
(Barton et al., 1999). Sequence analysis indicates that the N‐terminal of
Slc11a1/SLC11A1 contains a proline‐rich domain (PRD) that resembles the Src homology 3 (SH3) binding domain. SH3 domain‐containing proteins mediate
26 protein‐protein interactions via binding to specific PRDs in their respective target proteins, which are required for signal transduction, subcellular localization, and cytoskeletal organization in eukaryotic organisms (Dalgarno et al., 1997;Mayer and Baltimore, 1993;Pawson, 1995). The Src family kinases (SFKs) are non‐ receptor tyrosine kinases and composed of nine members (Src, Lck, Hck, Fyn, Fgr,
Yes, Blk, Lyn and Yrk). Each member of the SFKs is composed of a series of modular domains that regulate cellular localization (SH4), interaction with binding partners (SH2 and SH3) and enzymatic activity (SH1) (Geahlen et al.,
2004). Previous studies have shown that the c‐ Src kinase and its family members have been implicated in many intracellular signaling pathways in macrophages, initiated by a diverse set of receptors ranging from integrins toToll‐like receptors
(Brunton et al., 1997;Edwards et al., 2006;Fleming et al., 1997b;Holmes et al.,
1996;Owens et al., 2000). Analysis of the amino acid sequence of human
SLC11A1 using Netphos 2.0 server (Blom et al., 1999) and GPS2.1 (Xue et al.,
2008a) revealed the presence of two potential tyrosine phosphorylation sites
(Y15 and Y38) at its N‐terminus. Therefore, it was tempting to speculate that Src family kinases might be involved in the tyrosine phosphorylation and subcellular localization of SLC11A1 protein. In Chapter 4, we clearly demonstrated that
SLC11A1 is phosphorylated by Src family kinases including c‐Src on tyrosine 15 during the PMA‐induced differentiation of U937‐SLC11A1 cells into macrophages, and this type of phosphorylation is required for SLC11A1‐mediated nitric oxide production. We also confirmed that the activities of c‐Src and its family members
27 are required for lysosomal targeting of SLC11A1. Our results reveal an important role of Src family kinases in phosphorylation and subcellular localization of
SLC11A1 in macrophages.
28
Chapter 1: Literature Review
29 Solute carrier family 11 member 1 protein (SLC11A1), formerly known as natural resistance associated macrophage protein 1 (NRAMP1), is an integral membrane protein which is expressed in cells of the myeloid lineage: monocytes, macrophages, neutrophils and dendritic cells (Cellier et al., 1997;Stober et al.,
2007). It functions as a proton‐dependent transporter for divalent metal cations such as iron and manganese (Goswami et al., 2001;Govoni et al., 1999;Jabado et al., 2000;Kuhn et al., 1999;Kuhn et al., 2001). It is also involved in iron metabolism (Biggs et al., 2001;Soe‐Lin et al., 2009;Soe‐Lin et al., 2010;Soe‐Lin et al., 2008) and exerts pleiotropic effects on macrophage activation (Blackwell et al., 2003;Forbes and Gros, 2001;Fritsche et al., 2003;Kuhn et al., 1999;Nevo and
Nelson, 2006;Valdez et al., 2009;Wojciechowski et al., 1999;Zwilling et al., 1987).
In mice, mutations in the Slc11a1 gene, whether naturally occurring or experimentally induced, cause susceptibility to infection with unrelated intracellular pathogens (Blackwell et al., 1994;Bradley, 1977;Plant and Glynn,
1976a;Skamene et al., 1982;Vidal et al., 1993). In human, genetic polymorphisms of SLC11A1 gene have been identified and been shown to be associated with susceptibility to a number of infectious and autoimmune diseases (Blackwell et al., 2001;Donninger et al., 2004). For decades, researchers have been trying to elucidate the detailed mechanism of how SLC11A1 functions; however, the detailed molecular mechanism of the regulation of this gene remains to be elucidated. The research presented in this thesis contributes to the knowledge on the regulation of SLC11A1 gene expression.
30 1.1 Genetics of infectious disease
Infectious disorders are major causes of mortality in the world, particularly among the poor in developing countries. According to the WHO’s Global Burden of disease: 2004 update (2008), nearly 40 percent of all deaths in low‐income countries and about 23 percent of deaths world‐wide are caused by infectious diseases, including HIV/AIDS and lower respiratory infections. In low‐income countries, infectious diseases cause more than 65 percent of all deaths among children under five. A better understanding of host‐pathogen interaction is more and more necessary to cope with the increasing threats including emergence of de novo pathogens, recurrence of old pathogens, and resistance to antibiotics.
Although it has been years since researchers tried to explore the complex interactions, the mysterious disease mechanisms remain poorly understood.
When people are suffering from some serious diseases such as cancer or cardiovascular diseases, they recognize the risk of inheriting “bad genes” from parents as readily as bad living habits. It is known that a woman’s risk of developing breast and/or ovarian cancer is greatly increased if she inherits a harmful BRCA1 or BRCA 2 gene mutation (Mai et al., 2009). It is also too clear that if both of our parents suffered myocardial infarction at an early age we are deemed to be at an increased risk of this disease (Barrett‐Connor and Khaw,
1984;Chow et al., 2011). However, when we speak of infectious diseases, it is a common misapprehension that these diseases are purely infectious and our
31 genes are not important in determining our ability to fight off infectious diseases.
Epidemiological and experimental evidence has been accumulating to demonstrate that host genetics plays an important role in pathogenesis of infectious disease. In an early study of almost 1000 adoptees in Denmark, it was found that the mortality risk of adoptees suffering from infectious diseases was
5.8‐fold higher if one of their biological parents had died of an infectious disease before 50‐year‐old. In this study, the host genetic component of susceptibility to infectious diseases was higher than that for cancer or cardiovascular disease
(Sorensen et al., 1988). A recent study by the same group found that being biological full siblings to an adoptee who died of an infectious disease, their mortality rate with infection was increased significantly (hazard ratio 9.36; 2.94‐
29.8, p=0.0001), whereas half‐siblings were not significantly different from non‐ related individuals (Petersen et al., 2010). Twin studies have also provided strong evidence for the contribution of genetic factors to infectious disease susceptibility (Alter et al., 2011;Fortin et al., 2007). In the case of tuberculosis
(TB), previous published studies concur in demonstrating higher concordance rates of TB in monozygotic than in dizygotic twin pairs (Cervino et al., 2002).
Similarly, studies have also found a higher concordance for leprosy, both per se and subtype, among monozygotic twins compared to dizygotic twins (Alter et al.,
2011).
Mendelian susceptibility to mycobacterial diseases (MSMD) has provided further evidence for a role of host genetic factors in susceptibility to intracellular
32 pathogens. MSMD is a rare congenital syndrome characterized by a predisposition to infections caused by weakly virulent mycobacteria, such as
Mycobacterium bovis Bacille Calmette‐Guérin (BCG) and nontuberculosis environmental mycobacteria (Casanova and Abel, 2002). In addition to poorly pathogenic mycobacteria, individuals with MSMD are also vulnerable to more virulent species of mycobacterium tuberculosis (Alcais et al., 2005) and invasive salmonellosis in nearly half cases (Casanova and Abel, 2002;Dorman and Holland,
2000;MacLennan et al., 2004). Many of these patients were unable to produce or respond to interferon γ, due to deleterious mutations in genes that encode major proteins in the type 1 cytokine (interleukin 12/interleukin 23/interferon γ) signaling pathway. This pathway is a major immunoregulatory system that bridges innate and adaptive immunity for fighting infections caused by intracellular pathogens. In individuals with MSMD, mutations have been identified in genes encoding interleukin 12/23 subunit p40 (IL12B), interleukin
12/23 receptor β1 (IL12RB1), interferon γ receptors 1 and 2 (IFNGR1 and IFNGR2), or signal transducer and activator of transcription 1 (STAT1) (Liu et al., 2011;Patel et al., 2008;van, V et al., 2009). In addition, mutations in other pathways related to innate immune system also result in susceptibility to infections with different causative pathogens. For example, genetic defects in NEMO, a key regulatory molecule in the nuclear factor κB pathway was associated with susceptibility to a variety of infections caused by mycobacterial, viral, fungal and other bacterial pathogens (Picard et al., 2011). Mutations in other genes have been reported so
33 far including Toll‐like receptor 3, UNC93 homologue B, NF‐B inhibitor α, tyrosine kinase 2, and interleukin‐1 receptor‐associated kinase 4 (IRAK4)
(Dropulic and Cohen, 2011;Picard et al., 2011;Vidal et al., 2008).
1.2 SLC11A1
1.2.1 Identification
The innate resistance of a host to infection with a wide range of viral, bacterial, and parasitic pathogens is strongly influenced by genetic factors
(Schurr et al., 1991;Skamene and Pietrangeli, 1991). Over three decades ago, it was recognized that innate resistance or susceptibility to infection with several mycobacterial species such as Mycobacterium bovis (BCG), M. lepraemurium, M. intracellulare and M. avium was controlled by a chromosome 1 locus Bcg. In inbred mouse strains, Bcg is present in two allelic forms: the dominant resistant allele (Bcgr) and the recessive susceptible allele (Bcgs). When infected with BCG, inbred mouse strains go through two distinct phases of infection. Bcg gene regulates bacterial growth in the reticuloendothelial (RE) organs (liver and spleen) at the early stage of infection (0 to 3 weeks) characterized by either rapid proliferation of bacteria in susceptible strains (Bcgs) or absence of bacterial growth in resistant strains (Bcgr). During the late phase of infection (3‐6 weeks), the bacterial load is completely cleared or causes persistent infection in the RE organs. This late phase infection is under the control of genes associated with
34 the H2 locus, which encodes mouse major histocompatability complex. However, prior to the cell‐mediated acquired immune response, the natural resistance to
BCG is controlled by the expression of Bcg gene. Further studies have found that natural resistance to infection with other mycobacteria, such as M. lepraemurium, M. intracellulare, M. smegmatis and M. avium, was also linked to
Bcg locus.
Genetic control of natural resistance to other pathogens was also found in the mouse. For example, Ity (Plant and Glynn, 1976a;Plant and Glynn, 1979) and
Lsh (Bradley, 1977) have been shown to control resistance to infection with antigenically and taxonomically unrelated intracellular parasites such as
Salmonella typhimurium and Leishmania donovani. Similar to Bcg, the kinetics of infection with L. donovani in the RE organs is controlled by Lsh at an early preimmune phase, and is influenced by genes linked to H2 locus in a late recovery phase. However, the progression of S. typhimurium infection is very rapid without an immune response phase linked to H2 locus. Mice with Ityr allele
(resistant) consistently survive while those bearing Itys (susceptible) allele rapidly succumb to an infectious inoculum. Genetic Linkage studies (Skamene et al.,
1982) found that the strain distribution of Bcg resistant and susceptible alleles matched perfectly to that for resistance/susceptibility to S. typhimurium (Lsh) and Leishmania donovani (Ity) (Plant et al., 1982). These findings suggested that
Bcg, Lsh and Ity were the same loci or very closed linked. In vivo and in vitro studies have shown that macrophage is the predominant cell population
35 responsible for the phenotypic expression of the Lsh/Ity/Bcg gene (Mock et al.,
1990).
The Ity /Lsh /Bcg locus was first mapped to mouse chromosome 1 and later identified via positional cloning. To isolate the Bcg gene, a high‐resolution genetic linkage map of the Bcg region on chromosome 1 was constructed and the maximal genetic interval overlapping Bcg was reduced to 0.3 cM (Malo et al.,
1993b;Schurr et al., 1990). Furthermore, a physical mapping of this region redefined a physical interval of approximately 1.1 Mb (Malo et al., 1993a). Using a method known as “exon trapping”, six potential candidate gene were identified within this region. One of the six candidate genes had mRNA expression only in
RE organs (liver and spleen) and had enriched expression in macrophages derived from them, which are the tissues and cell‐type responsible for the Bcg phenotype. The gene was then named Nramp1 (Vidal et al., 1993). Barton et al. obtained a full length cDNA sequence (Barton et al., 1994) and did a transfection to the macrophage cell lines, functional analysis of which indicated that the candidate was correct (Barton et al., 1995). This was further confirmed by a loss‐ of‐function (Vidal et al., 1995b) and a gain‐of‐function transgenic mouse model
(Govoni et al., 1996).
After the mouse Nramp1 gene was cloned, its human counterpart, NRAMP1, was quickly identified and mapped to chromosome 2q35 with a bunch of syntenic loci conserved with proximal mouse 1 (Cellier et al., 1994). The gene contains 15 exons and covers 14kb (Marquet et al., 2000). The NRAMP1 gene
36 was renamed to SLC11A1 after its function as a transporter was confirmed
(Goswami et al., 2001). The association of polymorphisms in human SLC11A1 with infectious and autoimmune diseases susceptibility has been extensively studied.
1.2.2 SLC11A1 Structure
1.2.2.1 Gene structure
Mouse Slc11a1 is 11.5kb in size with 15 exons. The Slc11a1 may have a
TATA‐ less promoter since a classical TATA or CAAT box (Smale, 1994) cannot be found in its promoter, which corresponds to the fact that it lacks precise transcription initiation and has multiple start sites. It has 2 initiator elements
(Inrs) close to the major start site. The Inr has been demonstrated as a core promoter element that can substitute for the TATA box in TATA‐less promoter
(Bowen, 2002). The Slc11a1 promoter region contains binding sites for transcriptional factor Myc interacting zinc finger protein 1 (Miz‐1), c‐Myc and
Sp1. These sites are critical for its expression and regulation (Bowen,
2002;Bowen et al., 2003). Slc11a1 promoter region also contains certain cis‐ acting sequence elements associated with regulation of its expression including
AP‐1, AP‐2, AP‐3, TGF‐β, PU.1, and granulocyte macrophage colony stimulating factor (GM‐CSF) (Govoni et al., 1995), as well as several sequences related with gene expression induced by IFN‐γ and bacterial LPS (Govoni et al., 1995).
Additionally, Slc11a1 exon 10 encodes N‐linked glycosylation signals in the
37 extracellular domain while exon 11 encodes a consensus transport motif (Govoni et al., 1995).
Upon analysis of nucleotide sequence upstream of the major transcription start sites of human SLC11A1, a putative TATA box was found. No CAAT box element has been detected near the transcription site. A binding site for the transcription factor PU.1, which is implicated in macrophage and B cell specific gene expression, was located (Kishi et al., 1996;Klemsz et al., 1990). The proximal promoter region of SLC11A1 possesses a polymorphic (GT)n microsatellite repeat, which differ in microsatellite length and regulates the gene expression
(Searle and Blackwell, 1999). The polymorphism of SLC11A1 has been linked to susceptibility to infectious and autoimmune diseases. Up to now, nine SLC11A1 alleles, designated alleles 1‐9, have been identified in different populations worldwide (Table 1.1). These alleles are unevenly distributed along ethnic and racial groups (Bayele et al., 2007;Chermesh et al., 2007;Liu et al., 1995;Zaahl et al., 2004).
1.2.2.2 Protein Structure
Mouse Slc11a1 was predicted to have 12 putative transmembrane domains
(TM1‐12) and a conserved transport motif (Figure 1.1) (Blackwell et al.,
2000;Vidal et al., 1995a). It is composed of 548 amino acid residues that is extensively glycosylated (Vidal et al., 1996). The calculated molecular weight of
38
Table 1.1 Polymorphic microsatellite (GT)n repeat in the proximal promoter region of SLC11A1 gene, based on the reports from Chermesh et al., 2007 and
Zaahlll et al., 2004.
Allele sequence
1 t(gt)5ac(gt)5ac(gt)11ggcaga(g)6
2 t(gt)5ac(gt)5ac(gt)10ggcaga(g)6
3 t(gt)5ac(gt)5ac(gt)9ggcaga(g)6
4 t(gt)5ac(gt)9ggcaga(g)6
5 t(gt)4ac(gt)5ac(gt)10ggcaga(g)6
6 t(gt)5ac(gt)5ac(gt)4at(gt)4ggcaga(g)7
7 t(gt)5ac(gt)5at(gt)11ggcaga(g)6
8 t(gt)5ac(gt)5ac(gt)6ggcaga(g)6
9 t(gt)5ac(gt)5ac(gt)8ggcaga(g)6
39
Figure 1.1 Schematic representation of transmembrane structure of Slc11a1/
SLC11A1 protein, modified from Vidal et al., 1995a to take account of the conserved YXX motif (where Y is tyrosine, X is any residue and is a bulky hydrophobic residue) and the putative SH3‐binding domain (proline‐rich domain,
PRD) (Barton et al., 1994;Cellier et al., 2007). The SLC11A1 has 12 predicted transmembrane (TM) domains, which are embedded in the membrane of lysosome or phagosome. The N‐ and C‐termini of the protein are identified on the cytoplasmic side of the membrane. Two predicted N‐linked glycosalation sites are located between TM7 and TM8. A consensus transport motif (CTM), which has been found in several prokaryotic and eukaryotic membrane transport proteins, is located between TM8 and TM9.
40
N‐linked glycosalation sites Lumen
Cytoplasm
Figure 1.1
41 this protein is about 60 kDα, however; a band of 90‐100 kDα Slc11a1 has often been detected to express in macrophages, representing a result of extensive glycosylation (Atkinson and Barton, 1999;Vidal et al., 1996). A glycine (Gly) to aspartic acid (Asp) substitution at position 169 of Slc11a1 within TM4 affects the maturation and/or trafficking and no mature Slc11a1 can be detected in macrophages from BCGs mice (bearing Slc11a1Asp169 allele) (Vidal et al., 1996).
Human SLC11A1 contains 550 amino acid residues and is also an integral membrane protein with 12 putative transmembrane domains. SDS‐PAGE gel electrophoresis reveals that human SLC11A1 protein has a similar electrophoretic mobility of 90‐100 kDα as mouse Slc11a1 in macrophages differentiated from HL‐60 cells or human peripheral blood monocytes by PMA or
G‐CSF (Xu et al., 2005), as well as in dendritic cells (unpublished data).
1.2.3 Expression and Localization
Mouse Slc11a1 encodes a transmembrane protein expressed predominantly in neutrophils, macrophages, dendritic cells (DC) and neurons (Cellier et al.,
1997;Evans et al., 2001;Stober et al., 2007). Slc11a1 has been shown to localize to late endosomal and lysosomal membranes of macrophages (Atkinson et al.,
1997;Gruenheid et al., 1997;Searle et al., 1998) but not to early endosomal membranes (Gruenheid et al., 1997), which is in consistency with the presence of endocytic targeting signals in the 5’ and 3’ ends of Slc11a1 (Atkinson et al., 1997).
This suggests that Slc11a1 is targeted directly from trans‐Golgi net work (TGN).
42 Moreover, studies have shown that upon phagocytosis, Slc11a1 is translocated to the membrane of phagosomes containing inert particles such as latex beads
(Gruenheid et al., 1997) pathogens (Govoni et al., 1999;Jabado et al., 2000), where it serves as a divalent metal cation transporter (Goswami et al.,
2001;Jabado et al., 2000;Kuhn et al., 2001). The recruitment of Slc11a1 to the phagosomal membrane supports the hypothesis that Slc11a1 restricts the replication of intracellular microbes via modifying the microenvironment of microbe‐containing phagosomes. Recently, it has been reported that Slc11a1 also expressed in the retinal pigment epithelium (Gelineau‐van et al., 2008).
Human SLC11A1 transcription results in 22 alternative spliced mRNAs and 6 unspliced ones. Some of the alternative spliced isoforms were characterized
(Thierry‐Mieg and Thierry‐Mieg, 2006). The gene has been found to be expressed in spleen, liver and lungs, but most abundant in polymorphonuclear neutrophils
(Cellier et al., 1994). SLC11A1 localizes to the granules of polymorphonuclear leukocytes (Canonne‐Hergaux et al., 2002;Cellier et al., 1997). Researchers failed to detect the expression of SLC11A1 in transformed cell lines from lymphoid T or
B or erythroid lineages. No expression was found in the progenitors of the monocyte/macrophage process either (Cellier et al., 1997). Nevertheless, the expression was quite strong when those cells were differentiated toward monocyte/macrophage or the granulocyte process.
1.2.4 SLC11A1 Function
43 1.2.4.1 Regulation of macrophage activation
It has been shown that Slc11a1 gene has various pleiotropic effects on macrophage activation such as regulation of the chemokine KC, interleukin‐1β
(IL‐1β), tumor necrosis factor‐α (TNF‐α), induction of nitric oxide (NO) release, iNOS, L‐arginine flux, oxidative burst; major histocompatibility complex class II molecule expression and tumouricidal as well as antimicrobial activity (Blackwell et al., 2001;Radzioch et al., 1994;Roach et al., 1991;Valdez et al., 2009). A study on RAW264.7 murine phagocytes has shown that Slc11a1 deficient macrophages resulted in reduced formation of NO, TNF‐α and interleukin‐6 while interleukin‐
10 was increased (Nairz et al., 2009). It has also been shown that an early inflammatory response against bacterial infection occurred only in Slc11a1 +/+ mice as a result of secretion of pro‐inflammatory cytokines such as IFN‐γ, TNF‐α and MIP‐1α (Valdez et al., 2009). In murine dendritic cells, Slc11a1 was also expressed in the late endosomal/lysosomal compartments and modulated the expression of cytokines (IL‐10 and IL‐12) and MHC class II molecules as well as antigen‐presentation to T cells (Stober et al., 2007).
Previous mouse studies have also suggested that Slc11a1 is associated with kinetics of wound healing (De et al., 2007;Thuraisingam et al., 2006). In vivo and in vitro experiments demonstrated that mRNA and protein expression of
Secretary leukocyte protease inhibitor (SLPI) , which has been shown to have pleiotropic roles in antiviral (McNeely et al., 1997), antibacterial (Hiemstra et al.,
1996;Weldon and Taggart, 2007) and antifungal activities (Tomee et al., 1997), is
44 linked to Slc11a1 gene. SLPI expression is much higher in B10A.Nramp1+/+ macrophages than that in B10A.Nramp1‐/‐ macrophages (Thuraisingam et al.,
2006).
It has been previously shown that PKC activity is reduced in Slc11a1‐ deficient macrophage (Lafuse et al., 2000;Olivier et al., 1998). PKC family of kinases comprises at least 12 isoforms. Our laboratory demonstrated that atypical PKCζ activity is lower in B10A.Nramp‐/‐ macrophages compared with
B10A.Nramp1+/+ (Moisan et al., 2006). TLR7 ligand induced activation of p38 mitogen‐activated protein kinase was also reduced in B10A.Nramp‐/‐ macrophages (Moisan et al., 2006). All of these were associated with the induction of NO and TNF production as well as respiratory burst. In addition,
Slc11a1 regulates macrophage functions through inhibition of protein‐tyrosine phosphatase activity, in turn modulating the signal pathway associated with NO production and the macrophage response to infection (Gomez et al., 2007).
1.2.4.2 Divalent cation transport
Slc11a1 is not an isolated gene but a member of a large gene family encoding metal ion transporters. The structure and function of the Slc11a family has been highly conserved throughout evolution from bacteria to human (Cellier et al., 2001;Forbes and Gros, 2001;Nevo and Nelson, 2006). The family members perform similar transport functions for homeostasis, which delivers divalent cations such as Mn2+ , Zn2+, Cu2+, Fe2+, Ni2+, and Co2+ (Chen et al., 1999;Liu et al.,
45 1997;Nevo and Nelson, 2004;Nevo and Nelson, 2006;Supek et al., 1996;Supek et al., 1997). In yeast, there are three Slc11a homologues: SMF1, SMF2 and SMF3
(Portnoy et al., 2000). SMF1 was originally identified as a high‐affinity Mn2+ transporter that was inhibited by Zn2+ (Supek et al., 1996) and later, indirect evidence demonstrated that other divalent ions such as Cd2+, Co2+, and Cu2+ are also substrates of SMF1 (Liu and Culotta, 1999;Liu et al., 1997). SMF2 and SMF3 have also been shown to be broad range metal ion transporters but exhibit different specificity from SMF1 (Nelson, 1999). Chen and coworkers demonstrated that both SMF1 and SMF2 can stimulate iron uptake into Xenopus oocytes (Chen et al., 1999). The Drosophila melanogaster homologue Malvolio
(Mvl) is expressed in macrophage and nervous system and is required for normal taste behavior (Rodrigues et al., 1995). Mutations at this locus result in a loss of taste perception for sugars which can be recovered by adding Mn2+ or Fe2+ to the diet, suggesting that Mvl protein functions as Mn2+ and Fe2+ transporter and
Mn2+ and/or Fe2+are involved in taste discrimination in Drosophila adults (Orgad et al., 1998). In mammals, Slc11a1 has a close paralog Slc11a2 (also known as
Nramp2, Dmt1, Dct1) (Gruenheid et al., 1995;Gunshin et al., 1997). Studies using
Xenopus laevis oocytes and mammalian cell lines have revealed that Slc11a2 transports a wide range of divalent metal ions including Fe2+, Mn2+, Co2+, Zn2+,
Cu2+ and Cd2+ (Gunshin et al., 1997;Marciani et al., 2004;Nevo and Nelson,
2004;Okubo et al., 2003;Sacher et al., 2001). Slc11a2 functions as a symporter of proton and metal ions that use a proton electrochemical gradient as a driving
46 force for the transport of divalent metal ions (Mackenzie and Hediger, 2004). In mice, Slc11a2 is responsible for transferrin‐independent uptake of dietary iron from the intestinal lumen (Canonne‐Hergaux et al., 1999) and for iron transport across the membrane of acidified endosomes into the cytoplasm (Canonne‐
Hergaux et al., 2001;Gruenheid et al., 1999). A mutation in the murine and rat
Slc11a2 (Gly185Arg) impairs the iron uptake and causes severe microcytic anaemia in the mk mice and Belgrade rats (Canonne‐Hergaux et al.,
2001;Fleming et al., 1998;Fleming et al., 1997a). Since Slc11a2 and its distant fly and yeast relatives share a common divalent cation transport function, it is reasonable to expect that the more closely related Slc11a1 will also function as a divalent metal ion transporter. This has been confirmed by the observations that, like Slc11a2, Slc11a1 can transport divalent cations including Mn2+, Fe2+ , Zn2+ and
Co2+ when expressed in Xenopus oocytes (Goswami et al., 2001) or at the plasma membrane of CHO cells (Forbes and Gros, 2003).
Although it is well known that Slc11a1 functions as a transporter for protons, iron and other divalent cations across the membranes (Blackwell et al.,
2001;Jabado et al., 2000;Kuhn et al., 1999), the direction of divalent ion transport in macrophage is still under dispute. One group of studies have suggested that Slc11a1 transports iron and other divalent cations from the phagosome into the cytosol and even out of the cells via an endocytic pathway
(Atkinson and Barton, 1999;Biggs et al., 2001;Forbes and Gros, 2001;Jabado et al.,
2000;Wyllie et al., 2002) (Figure 1.2 A). The function of Slc11a1 in this process
47 was thought to deprive intraphagosomal bacteria of their availability of divalent cations which are essential micronutrients for bacteria survive. These metal ions also act as crucial cofactors required for intraphagosomal bacteria to have effective antioxidant defence (Goswami et al., 2001;McDermid and Prentice,
2006;Wyllie et al., 2002). Another group of studies have supported the hypothesis that Slc11a1 pumps iron into the phagosomes to catalyze the
Fenton/Harber‐Weiss reaction, generating highly reactive and damaging hydroxyl radicals for host bactericidal activity (Blackwell et al., 2001;Kuhn et al.,
1999;Kuhn et al., 2001)(Figure 1.2 B). The former view is gaining more experimental support (Jabado et al., 2003). Goswami et al. suggested that
SLC11A1 severs as an antiporter fluxing bivalent cations in either direction depending on the pH on either side of the membrane (Goswami et al., 2001).
Slc11a1 is expressed within the late endosomal and phagolysosomal membranes of iron‐recycling macrophages and other professional phagocytes
(Forbes and Gros, 2003;Gruenheid et al., 1997), suggesting that Slc11a1 might be involved in the recycling of iron acquired via phagocytosis. The majority of iron required by the body is acquired by recycling iron from senescent red blood cells.
Reticuloendothelial macrophages play a unique role in this process (Knutson and
Wessling‐Resnick, 2003). Macrophages identify senescent red blood cells by a series of senescent markers (Bratosin et al., 1998). Following recognition and binding, red blood cells are phagocytosed and hemoglobin is proteolytically degraded into globin and heme and then, iron is liberated from heme via the
48
Figure 1.2 Two hypotheses for divalent metal transport by Slc11a1 protein at the interface of host–pathogen interaction, modified from Nevo and Nelson,
2006 , and Lam‐Yuk‐Tseung and Gros, 2003. In macrophages, pathogen‐ containing phagosomes mature by fusion with vacuolar H+/ATPase (V‐ATPase) positive vesicles, and Lamp1/ Slc11a1 positive lysosomes. At the phagosomal membrane, the V‐ATPase creates a gradient of H+, which is necessary for divalent metal transport by Slc11a1. (A) Slc11a1 delivers divalent metal ions from the phagosomal lumen into the cytoplasm by a H+ symport mechanism. (B) Slc11a1 functions as an antiporter of H+, and transports divalent metal ions from the cytoplasm into the phagosomal lumen. Inside the phagosome, pathogens express Slc11a1 homologues, such as bacterial MntH, that may import divalent metal from the phagosomal lumen into the pathogen. M2+‐ divalent metal ions.
49
A
B
Figure 1.2
50 enzyme heme oxygenase‐1 (HO‐1) (Maines, 2005;Poss and Tonegawa, 1997).
Once released from the hemoglobin, a fraction of iron is stored in ferritin within the macrophages and another fraction of iron is recycled back to the plasma via iron transporter ferroportin (Bleackley et al., 2009;Knutson et al., 2003). The plasma iron is bound to transferrin and transported to bone marrow for a new cycle of erythropoiesis (Harris et al., 1999) or to other cell types in need of iron.
In vitro and in vivo experiments have shown that Slc11a1 plays an important role in the process of recycling of erythrocyte‐derived iron in macrophages (Biggs et al., 2001;Soe‐Lin et al., 2009;Soe‐Lin et al., 2010;Soe‐Lin et al., 2008).
1.2.4.3 SLC11A1 and Resistance to infection
It has been shown that mutations in the Slc11a1 gene in mice, whether naturally occurring (Malo et al., 1994) or experimentally induced (Vidal et al.,
1995b), cause susceptibility to infection with several unrelated intracellular pathogens such as Salmonella, Leishmania, Mycobacteria and Campylobacteria
(Champion et al., 2008;Vidal et al., 1995b). In vitro studies have also demonstrated that Slc11a1 restricts the growth of intracellular pathogens in mouse primary macrophages or transfected macrophage cell lines using
Mycobacteria, Salmonella and Leishmania spp. (Govoni et al., 1999). However, the exact mechanism by which Slc11a1 controls the microbial proliferation in phagosomes is uncertain. As stated above, Slc11a1 exerts pleiotropic effects on macrophage functions. The antimicrobial activities of Slc11a1 are attributable, in
51 partly, to modulation of macrophage immune function and cellular iron homeostasis‐ the latter restricting the availability of essential iron to the intracellular bacteria; however, the exact mechanism for this is not fully elucidated. Iron is a ubiquitous element in biological systems that have been shown to be involved in various aspects of immune functions (Doherty et al.,
2002;McDermid and Prentice, 2006;Oppenheimer, 2001;Weiss, 2002). It plays a crucial role in modulating the battle for survival between mammalian hosts and invading pathogens. Both sides possess a series of mechanisms of acquiring and maintaining iron including iron responsive absorbing, transporting, storing and detoxificating systems which are able to adapt to different phases of infection
(McDermid and Prentice, 2006). It is interesting to note that bacterial virulence is associated with the genes that code for iron acquisition (Fishbane, 1999;Ike et al.,
1992). Since iron is an essential growth factor for intracellular pathogens (Ike et al., 1992;Weinberg, 1999), deprivation of intracellular iron affects growth and replication of intracellular bacteria. It has been shown that overexpression of ferroportin 1, an iron exporter, in murine macrophages inhibits the growth of intracellular Salmonellae by restricting iron acquisition within the microenvironment of the bacteria (Chlosta et al., 2006;Nairz et al., 2007). In addition, immune effector functions of macrophages are modulated by cellular iron level. For example, iron regulates the transcriptional expression of inducible nitric oxide synthase (iNOS) gene by altering the binding activity of transcriptional factor NF‐IL6 to the iNOS promoter. Iron deprivation enhances
52 the binding activity of NF‐IL6 and then up‐regulates the transcription of iNOS
(Dlaska and Weiss, 1999;Weiss et al., 1994). It is tempting to hypothesize that
Slc11a1 either restricts the iron availability for pathogens or up‐regulates the expression of iNOS and other pro‐inflammatory genes by reducing the intracellular iron concentration and thus control the survival of intracellular pathogens.
Intracellular mycobacteria, including M. tuberculosis, M. bovis, and M avium, can avoid being destroyed by phagocytes via inhibiting the process of phagosomal maturation and survive within the compartment with attenuated acidity (Clemens and Horwitz, 1995;Sturgill‐Koszycki et al., 1996). These mycobacteria‐containing phagosomes are able to fuse with early endosomes but unable to fuse with lysosomes (Deretic and Fratti, 1999). Interestingly, several M. bovis BCG genes implicated in blocking phagosomal acidification and promoting bacterial growth, were identified by transposon mutagenesis and high throughput sequence analyses (Stewart et al., 2005).
Several studies indicated that Slc11a1 is essential for phagosome maturation and acidification, a process necessary for bactericidal activity (Dai et al.,
2009;Frehel et al., 2002;Govoni et al., 1999;Hackam et al., 1998;Jabado et al.,
2003). Slc11a1 has also been shown to be involved in altering the trafficking of vacuoles containing intracellular parasites (Cuellar‐Mata et al., 2002;Steele‐
Mortimer et al., 1999). For example, the phagosomes containing viable
Mycobacterium bovis from Slc11a1 expressing macrophages display a significant
53 lower pH than these from mutant cells due to enhanced acquisition of vacuolar‐ type proton ATPase (V‐ATPase) (Hackam et al., 1998). Studies have shown that phagosomal acidification is initiated and maintained primarily by V‐ATPase activity and exerts direct toxic effect on intracellular pathogens (Hackam et al.,
1997;Lukacs et al., 1990). These data suggest that Slc11a1 may act as a fusogen to promote vacuole fusion resulting in phagosome maturation and recruitment of V‐ATPase activity and subsequently acidification.
It has been suggested that Slc11a1 affects adaptive immune responses.
Slc11a1 influences the magnitude and type of host inflammatory response
(Caron et al., 2006;Valdez et al., 2009). Slc11a1 wild‐type macrophages have enhanced lipopolysaccharide‐dependent antigen processing for presentation to
T cells. The ability to process and present antigen was impaired in Slc11a1 deficient macrophages due to downregulated MHC class II molecules (Lang et al.,
1997). Slc11a1‐deficient dendritic cells (DC) could not fully process antigen or cells, which led to poor activation of antigen‐specific T cells and poor induction of IL‐12 (Stober et al., 2007). Controversial conclusions were drawn from different studies on the function of Slc11a1 in cytokine production in infection.
Some studies suggested that Slc11a1‐deficient macrophages had a decreased level of secreted IFN‐γ when infected (Dai et al., 2009;Hedges et al.,
2013;Lalmanach et al., 2001). Others showed no significant difference between wild type and null Slc11a1 (Eckmann et al., 1996). The contradictory conclusions may be due to the use of different models of infection. The studies mentioned
54 above were all using different routes of infection and different bacteria, resulting in difficulty to understand the true function Slc11a1 played in cytokine‐mediated responses to bacterial infection.
1.2.4.4 SLC11A1 polymorphism and disease susceptibility
Given the pivotal roles that SLC11A1 plays in macrophage activation and innate immunity, the association between SLC11A1 polymorphisms and disease susceptibility has been widely explored (Blackwell, 2001). It has been found that
SLC11A1 polymorphic variants have been associated with susceptibility or resistance to a number of autoimmune diseases such as rheumatoid arthritis and juvenile rheumatoid arthritis (Ates et al., 2009;Yang et al., 2000;Yen et al.,
2006), multiple sclerosis (Comabella et al., 2004;Kotze et al., 2001), type 1 diabetes mellitus (Esposito et al., 1998;Paccagnini et al., 2009;Takahashi et al.,
2004), inflammatory bowel disease (IBD) (Gazouli et al., 2008;Hofmeister et al.,
1997;Kotlowski et al., 2008;Sechi et al., 2006), sarcoidosis (Akcakaya et al.,
2012;Maliarik et al., 2000), and Kawasaki disease (Ouchi et al., 2003) as well as infection‐related disorders including leprosy (Abel et al., 1998;Ferreira et al.,
2004), tuberculosis (Asai et al., 2008;Bellamy et al., 1998;Jin et al., 2009;Malik et al., 2005;Meilang et al., 2012), visceral leishmaniasis (Mohamed et al., 2004), human immunodeficiency virus infection (Donninger et al., 2004;Marquet et al.,
1999) and the progression of liver fibrosis due to hepatitis C virus (Romero‐
Gomez et al., 2004). Most of these diseases have been reported to be associated
55 with a promoter dinucleotide microsatellite (GT)n that is known to affect
SLC11A1 expression levels. Up to date, a total of 9 (GT)n promoter alleles, which display different number of (GT)n repeats, have been identified. Of the 9 alleles, alleles 2 and 3 are predominant and have opposite effect on SLC11A1 gene expression (O'Brien et al., 2008;Searle and Blackwell, 1999). Allele 3, the most common allele in humans, drives high expression of SLC11A1 gene while allele 2 drives low SLC11A1 expression (Searle and Blackwell, 1999;Zaahl et al., 2004).
Interestingly, it has been demonstrated that in the presence of promoter polymorphism ‐237CT, gene expression of allele 3 is significantly decreased comparable to that of allele 2 or even lower (Zaahl et al., 2004). It has been postulated that high expression of SLC11A1 driven by allele 3 contributes to autoimmunity and inflammation but protects against infectious diseases, whereas low expression of SLC11A1 driven by allele 2 is functionally linked to infectious disease susceptibility but protects against autoimmunity and inflammation (Awomoyi, 2007;O'Brien et al., 2008;Searle and Blackwell, 1999).
This hypotheis has been supported by some studies (O'Brien et al., 2008). Except for promoter dinucleotide microsatellite (GT)n , SLC11A1 also contains a number of single nucleotide polymorphisms (SNPs) including SLC11A1 1730G>A
(rs17235409; D543N), SLC11A1 469+14G>C (rs3731865; INT4G>C), a 3’UTR TGTG deletion (rs17235416;1729+55 del4) and a trinucleotide microsatellite (ATA)n in intron 8 (Ates et al., 2009;Awomoyi et al., 2006;O'Brien et al., 2008;Taype et al.,
2006). Of these, the non‐synonymous SNP 1730G>A is the only known
56 polymorphism that can affect SLC11A1 function (Gazouli et al., 2008;Liu et al.,
1995).
A number of studies have demonstrated that host genetic factors are important determinants of susceptibility to tuberculosis (TB) and one of the best characterized is that of SLC11A1. In 1998, for the first time, Bellamy et al. reported that four SLC11A1 polymorphisms (5’ (GT)n, INT4, D543N and 3’UTR
TGTG deletion) were each significantly associated with TB susceptibility in a population from the Gambia, a country in West Africa (Bellamy et al., 1998).
Since then, the association between SLC11A1 polymorphisms and TB have been extensively investigated in a number of genetically distinct populations. However, the results are lack of consistence. A number of studies have demonstrated that frequencies of various SLC11A1 polymorphisms are overrepresented among TB patients from Guinea (Cervino et al., 2000), Japan (Gao et al., 2000), Korean (Ryu et al., 2000), Chinese Han population (Liu et al., 2004b) and so on. Similarly, in a case‐control study in Cambodia, D543N and 3’UTR TGTG deletion polymorphisms were shown to be associated with pulmonary TB. However, these two genotypes were associated with resistance to TB (Delgado et al., 2002). In contrast to the findings above, some studies have failed to find the association of SLC11A1 polymorphisms with TB susceptibility or resistance (Abe et al., 2003;El et al.,
2003;Liaw et al., 2002). Additionally, SLC11A1 may affect the phenotypic expression of TB. Abe and colleagues demonstrated that patients with the
D543N allele were more likely to develop a cavitary lesion (Abe et al., 2003).
57 Zhang and colleagues showed that SLC11A1 polymorphisms were associated with the severity of pulmonary TB but not with the disease itself in China (Zhang et al., 2005).
SLC11A1 polymorphism has also been shown to be associated with cancer including esophageal cancer (EC) in a South African population (Zaahl et al.,
2005). In this study, the polymorphic alleles of SLC11A1 were analyzed in 105
South African colored patients with EC (squamous cell carcinoma), as well as 110 population‐matched health controls. The authors found that the genetic variation in both the promoter region and intron 1 of the SLC11A1 gene is significantly associated with EC susceptibility.
1.2.5 Orthologs
SLC11A protein is highly conserved in evolution. Homologus exhibit generally over 30% sequence identity and contain 11 to 12 predicted transmembrane domains (Cellier et al., 1996;Richer et al., 2004). In Gram negative bacteria, MntH has been suggested as a mycobacterial orthologue of
Slc11a1 (Cole et al., 1998). Comparative analysis showed that MntH shares 26 to
29% identical sequence and an overall similarity of 40 to 45% with human counterpart. The fact that iron deficiency induced the expression of MntH suggests that MntH might serve as a proton/divalent iron import system in an iron deficient environment of the host phagosome (Agranoff et al., 1999)(Figure
1.2).
58
1.3 Regulation of SLC11A1 gene expression
1.3.1 Overview
Gene expression is a process by which gene information is used in synthesizing a functional product of that gene. These gene products are often proteins but sometimes functional RNAs transcribed from non‐protein coding genes such as ribosomal RNA (rRNA), transfer RNA (tRNA) and microRNA. For synthesizing a protein, the process usually including structural changes in the chromatin to make a particular gene accessible for transcription, transcription of
DNA into RNA, mRNA processing and modification, mRNA transport and stability, translation of mRNA into protein, post‐translational modification of the protein, protein targeting and transport as well as protein degradation. Gene expression can be regulated at each step of the process described above but it is mostly controlled at the level of transcription. Regulation of gene expression is essential for diverse biological processes including cell growth, development and differentiation as well as adaptation to environmental changes.
1.3.2 Induction of Slc11a1 (nramp1) expression
The murine Slc11a1 expression is shown to be up‐regulated by treatment with interferon γ, granulocyte/macrophage colony‐stimulating factor, bacterial lipopolysaccharide (LPS) and inflammatory stimuli (Atkinson et al., 1997;Baker et al., 2000;Brown et al., 1995;Govoni et al., 1997;Govoni et al., 1995), which is in
59 accordance with the characteristics of the mouse Slc11a1 promoter region. For example, the slc11a1 mRNA expression is dramatically induced in J774A.1 and
RAW264.7 macrophage cell lines by treatment with IFN‐ γ and LPS (Govoni et al.,
1995) and is up‐regulated in splenic macrophages isolated from both Bcg‐ resistant (Bcgr) and Bcg‐susceptible mice in response to treatment with IFN‐ γ or
GM‐CSF (Brown et al., 1995;Brown et al., 1997). The expression of porcine
SLC11A1 is up‐regulated in macrophages, neutrophils and peripheral blood mononuclear cells in response to LPS, TNF‐α and IL‐1β stimulation. The MAPK signalling pathway, particularly p38 and ERK1/2 activity, is involved in this induction process. Additionally, infection with S. enterica serovar Typhimurium enhanced the SLC11A1 expression in both liver and spleen of pigs (Zhang et al.,
2000). The human SLC11A1 gene expression is undetectable in transformed human cell lines from either erythroid or lymphoid T or B lineages as well as the progenitors of the monocyte/macrophage pathway (KG1, U937, THP), and the promyelocytic leukemia cell line HL‐60. It can however be strongly induced in these cells differentiating toward the monocyte/ macrophage or the granulocyte pathway (Cellier et al., 1997;Xu et al., 2005). So far, little is known about how the
SLC1A1 gene is regulated by these stimuli.
1.3.3 Regulation of Slc11a1/SLC11A1 gene expression at transcriptional level
Furthermore, Slc11a1 transcription activities were enhanced by redox stress and decreased by oxidant stress (Yeung et al., 2004). The activation of Slc11a1 is
60 mediated by transcription factor Myc interacting zinc finger protein 1 (Miz‐1) while the repression is mediated by c‐Myc (Bowen et al., 2002;Lapham et al.,
2004). The activation by Miz‐1 requires a consensus transcription factor specific protein 1 (Sp1) binding site or GC box and is inhibited by an E box (CAACTG)
(Bowen et al., 2003). Sp1 is known to regulate myelopoiesis (Friedman, 2007).
Together with other tissue specific factors such as CCAAT enhancer binding proteins (C/EBPs), it regulates expression of genes involved in innate immunity
(Resendes and Rosmarin, 2004). One cofactor required for activation is p300/CBP.
The repression is mediated by c‐Myc competing with p300/CBP to interact with
Miz‐1 (Bowen et al., 2003). Additionally, the restricted expression of Slc11a1 is mediated by myeloid cell‐specific transcription factor termed IRF‐8, also known as interferon consensus sequence binding protein (ICSBP). IRF‐8 is mainly expressed in myeloid and B‐cells (Nelson et al., 1993) and can be induced to express by IFN‐γ and Toll like receptor ligands such as LPS and CpG (Ozato et al.,
2002). IRF‐8 can interact with Miz‐1 which occurs exclusively in immune cells.
This interaction leads to synergistic activation of Slc11a1 promoter and is further enhanced with PU.1, a transcription factor required for myelopoiesis (Alter‐
Koltunoff et al., 2003). Further studies demonstrated that IRF‐8 competes with c‐
Myc for binding with Miz‐1. Upon interaction between IRF‐8 and Miz‐1, PU.1 is also recruited leading to maximal activation of Slc11a1 expression (Alter‐
Koltunoff et al., 2008).
61 The Slc11a1 human ortholog, SLC11A1, has been revealed to have several transcriptional start sites (TSSs) in different cell types (Blackwell et al., 1995;Kishi et al., 1996). Richer et al. (Richer et al., 2008) demonstrated that transcription factors Sp1 and CCAAT/enhancer‐binding protein are recruited to two cis‐acting elements in the SLC11A1 promoter region and regulate its transcriptional activity during the monocytic differentiation of HL‐60 cells by vitamin D.
In addition, it has been shown that SLC11A1 and its orthologs have highly identical amino acid sequences while quite different nucleotide sequences at introns and both ends of UTRs. This suggests the possibility of the gene being regulated differentially in various species (Awomoyi, 2007).
1.3.4 Regulation of Slc11a1/SLC11A1 gene expression by mRNA stability
In mice, it has been shown that Slc11a1 mRNA was more stable in BCGr macrophages than in BCGs macrophages (Brown et al., 1995;Brown et al., 1997).
Corticosterone, a type of glucocorticoid hormone secreted by adrenal cortex, has been shown to down‐regulate the Scl11a1 gene expression in macrophages from
BCGs mice via destabilizing its mRNA, and increases the susceptibility of BCGs mice to in vivo growth of Mycobacterium avium. Additionally, Slc11a1 mRNA stability is affected by intracellular iron level. Chelation of iron with desferrioxamine resulted in an increased half‐life of Slc11a1 mRNA while addition of iron to the macrophages resulted in a decrease in Slc11a1 mRNA half‐ life (Zwilling et al., 1999). Lafuse et al (Lafuse et al., 2000) found the Slc11a1
62 mRNA stability was higher in bacteria infected macrophages expressing Slc11a1 resistant allele than in those expressing Slc11a1 susceptible allele. Protein kinase
C (PKC) activity was greater in Slc11a1 resistant macrophages than in Slc11a1 susceptible macrphages. Treatment with antioxidants and protein kinase C (PKC) inhibitors destablized the Slc11a1 mRNA in Slc11a1 resistant macrophages.
Treatment with menadione which produced reactive oxygen species (ROS) in cells increased the Slc11a1 mRNA stability. Nevertheless, this increase was inhibited when PKC inhibitors were added. Thus, it was proposed that the
Slc11a1 mRNA stability is regulated by an oxidant‐generated signalling pathway requiring PKC. Similarly, they showed in a following study that inhibition of
ERK1/2 and p38 MAP kinase destabilized Slc11a1 mRNA in SLC11a1 resistant macrophages. It was suggested that the higher stability of Slc11a1 mRNA in the
Slc11a1 resistant phenotype resulted from iron mobilization and ROS generated through the Haber‐Weiss reaction (Lafuse et al., 2002).
The human SLC11A1 message contains four AUUUA repeats, a typical AU‐ rich element (ARE). In general, mRNAs that contain AREs are rapidly degraded in unstimulated cells, but specific growth or stress conditions can modify the fate of specific messages. For example, IL‐1α has been shown to enhance the stability of a variety of cytokine and chemokine mRNAs that otherwise exhibit short half‐ lives, and this depends, at least in part, upon the presence of ARE motifs in the
3′UTRs (Holtmann et al., 1999;Lasa et al., 2000). Similarly, eotaxin mRNA is stabilized following treatment with TNF‐α and IL‐4 (Atasoy et al., 2003), and
63 treatment with phorbol esters, calcium ionophores, or interleukins increases the stability of lymphokine mRNA in lymphoid cells (Iwai et al., 1993;Shaw and
Kamen, 1986;Wodnar‐Filipowicz and Moroni, 1990). Furthermore, multiple studies have shown that a specific mRNA/protein complex is formed or increased in response to extracellular stimulation, leading to changes in the half‐lives of the target mRNAs (Dean et al., 2001;Rousseau et al., 2002;Wang et al., 2002b;Yaman et al., 2002). In the case of SLC11A1 mRNA, our previous studies demonstrated that RNA binding protein HuR is recruited to the ARE present in the 3′UTR of
SLC11A1 mRNA and significantly increases SLC11A1 mRNA stability and protein expression during the differentiation of HL‐60 cells into macrophages induced by
PMA.
1.3.5 Regulation of Slc11a1 subcellular localization
Not many studies have been done in elucidating regulation of SLC11A1 expression at translational level and subcellular localization level. The Slc11a1 was found localized to the late endosomes‐Lysosome compartment of WT3 cells while the bulk of mutant Slc11a1 carrying a G169D was found within the endoplasmic reticulum of MUT12 cells (White et al., 2004) and subsequently, degraded. Lam‐Yuk‐Tseung and colleagues (Lam‐Yuk‐Tseung et al., 2006) constructed a series of plasmids to express Slc11a1/Slc11a2 chimeric proteins.
The Slc11a1 homolog,Slc11a2 is expressed on the cellular surface, however;
Slc11a2 isoform II chimera containing the amino terminal of Slc11a1 was not
64 expressed at the cellular surface but targeted to lysosomes. Further study demonstrated that a tyrosine‐based motif (15YGSI18) in the amino terminal of
Slc11a1 is critical for lysosomal targeting of Slc11a1. In contrast, a recent study
(Cheng and Wang, 2012) demonstrated that 15YGSI18 motif is not necessary for lysosomal targeting of Slc11a1. Slc11a1 contains multiple motifs dispersed in different regions of the amino acid sequence for its targeting to lysosomes, such as AA 73‐144 within the N‐terminal, AA 263‐334, as well as AA 451‐483 and AA
489‐522 within the C‐terminal (Cheng and Wang, 2012).
65 CHAPTER 2
Nuclear Translocation of ‐actin is Involved in
Transcriptional Regulation of SLC11A1 Gene
during Macrophage Differentiation
of HL‐60 Cells
Xu Y. Z., Thuraisingam T., Morais D. A., Rola‐Pleszczynski M., and Radzioch D.
(2010) Nuclear Translocation of ‐actin is Involved in Transcriptional Regulation of SLC11A1 during Macrophage Differentiation of HL‐60 Cells. Mol. Biol. Cell. 21,
811–820
66 2.1 Abstract
Studies have shown that nuclear translocation of actin occurs under certain conditions of cellular stress; however, the functional significance of actin import remains unclear. Here, we demonstrated that during the phorbol 12‐myristate
13‐acetate (PMA)‐induced differentiation of HL‐60 cells toward macrophages, ‐ actin translocates from the cytoplasm to the nucleus and this process is dramatically inhibited by pretreatment with p38 MAPK inhibitors. Using
Chromatin Immunoprecipitation (ChIP)‐on‐chip assays, the genome‐wide maps of ‐actin binding to gene promoters in response to PMA treatment was analyzed in HL‐60 cells. A gene ontology‐based analysis showed that the identified genes belong to a broad spectrum of functional categories such as cell growth and differentiation, signal transduction, response to external stimulus, ion channel activity as well as immune response. SLC11A1 gene, which has been shown to be important for macrophage activation, was confirmed to be one of these target genes. We found that ‐actin knockdown decreases the recruitment of RNA polymerase II to the SLC11A1 promoter and its mRNA expression level induced by PMA. Further studies showed that nuclear ‐actin is required for
PMA‐induced transactivation of SLC11A1 gene. Our data provide novel evidence that nuclear accumulation of ‐actin is involved in SLC11A1 gene expression during macrophage‐like differentiation of HL‐60 cells.
67 2.2 Introduction
Actin is one of the most abundant proteins in eukaryotic cells. It has been extensively studied as a cytoplasmic cytoskeletal protein that plays important roles in cellular processes such as cell motility, growth, cytokinesis, endocytosis and intracellular trafficking (Ascough, 2004;Brakebusch and Fassler,
2003;Suetsugu and Takenawa, 2003). For many years, its presence in the nucleus has been questioned. However, during the past decade, convincing evidence has clearly demonstrated that actin, actin‐related proteins (ARPs), as well as actin‐ binding proteins (ABPs), are not only present in the nucleus but also play important roles in diverse nuclear activities such as chromatin remodeling and
RNA transcription (Blessing et al., 2004;Chen and Shen, 2007;Dopie et al.,
2012;Miyamoto and Gurdon, 2012;Miyamoto et al., 2011;Olave et al.,
2002;Vartiainen et al., 2012). The mammalian BAF (BRG1/hBRM‐ associated factor) complex is one of several SWI/SWF‐like chromatin‐remodeling complexes that can remodel chromatin in vitro. Purification of the subunits of the BAF complex revealed that the complex consists of actin, ARP BAF53 and nine additional proteins. When the actin subunit is absent from the complex, the activity of BAF is reduced and overall chromatin reorganization is altered (Rando et al., 2002;Zhao et al., 1998). Chromatin‐remodeling INO80 complexes lacking actin as well as Arp5 and Arp8 are compromised for ATPase activity and DNA binding, suggesting that actin, Arp5 and Arp8 are necessary for these activities and for ATP‐dependent chromatin remodeling (Shen et al., 2003). Involvement
68 of nuclear actin in RNA transcription was reported many years ago (Egly et al.,
1984;Scheer et al., 1984;Smith et al., 1979), but was received with skepticism. In recent years, however, more and more evidence regarding the transcriptional function of nuclear actin have been shown. Percipalle and colleagues demonstrated that actin bound to the hnRNP hrp36 is necessary for transcription from Balbiani rings by RNAP II in Chironomus tentants (Percipalle et al., 2001), and actin‐hrp65‐2 interaction is required for the maintenance of normal transcriptional activity in the cell (Percipalle et al., 2003). Furthermore, several studies have indicated that nuclear actin is associated with transcription by RNA polymerase I (Fomproix and Percipalle, 2004;Philimonenko et al., 2004;Sjolinder et al., 2005), II (Dopie et al., 2012;Hofmann et al., 2004;Kukalev et al.,
2005;Sjolinder et al., 2005) and III (Hu et al., 2003;Hu et al., 2004). In addition to chromatin remodeling and transcription, actin has also been implicated in other nuclear processes, including assembly of the nuclear structure (Krauss et al.,
2003;Krauss et al., 2002), RNA processing (Hofmann et al., 2001;Percipalle et al.,
2001) and nuclear export (Hofmann et al., 2001).
Although actin accumulation in the nuclei in response to cellular stress has been reported, it is still not clear whether the occurrence of actin in nuclei is universal and what biological significance it has. Sanger and colleagues demonstrated that a disappearance of stress fibers from the cytoplasm and a reversible translocation of cytoplasmic actin into the nucleus occurred after treatment of PtK2 and WI‐38 cells with 10% dimethyl sulfoxide (Sanger et al.,
69 1980a;Sanger et al., 1980b). Courgeon et al. (Courgeon et al., 1993) showed that heat shock caused actin to accumulate in the nucleus in Drosophila cells. In mast cells, entry of actin into the nucleus was induced by either treatment with latrunculin B, which led to disassembly of F‐actin in the cytoplasm, or depletion of ATP (Pendleton et al., 2003). It has been suggested that nuclear actin is in a soluble monomeric form rather than in a filament polymeric form as that in the cytoskeleton (Bettinger et al., 2004;Gonsior et al., 1999). So far, the molecular mechanism by which actin enters into the nucleus in response to cellular stress has not been established, and the potential functions of nuclear accumulation of actin in response to external signals remain unclear. It has been reported that nuclear actin is involved in gene transcription either by direct interaction with the DNA (Ou et al., 2005) or indirectly as a member of a DNA‐binding complex such as chromatin remodeling (Xu et al., 2012;Zhao et al., 1998). Under stress, ‐ actin translocate into nuclei to function as a transcriptional modulator, playing an important role in the regulation of gene transcription along with stress‐ activated transcription factor.
In the present study, we find that when HL‐60 cells and human peripheral blood monocytes are differentiated toward macrophages by PMA, ‐actin translocates from the cytoplasm to the nucleus and accumulates therein. In order to establish whether the accumulated nuclear ‐actin is involved in gene transcription regulation during the differentiation of HL‐60 cells towards macrophages; the ChIP‐on‐chip assay was used to identify ‐actin target genes.
70 Gene ontology‐based analysis shows a broad spectrum of functional categories of the ‐actin enriched genes. Furthermore, our data demonstrates that nuclear translocation of ‐actin is involved in the transcriptional activation of SLC11A1 gene during macrophage differentiation.
2.3 Materials and Methods
Plasmid constructs pREP4‐luc was constructed as described previously (Liu et al., 2001). The promoter regions of the SLC11A1 gene and SCG2 gene were amplified using human genomic DNA as a template, prepared from U937 cells, and using the following two pairs of primers: 5’‐GAGCTAGCACTCCAGTCTGGGCAACAGAGTAA ‐
3’ and 5’‐ CAAAGCTTAGT GCCCTGCCTCTTACATCAACA‐3’; 5’‐GAGCTAGC GTA CGA
AGCTTCCTTTCGAT TGCA‐3’ and 5’‐ CAAAGCTTGGCTCCACAGCATATTCC TCCCGTT
CT‐3’. The two PCR products (one covering nucleotides ‐750 to + 46 of the human SLC11A1 promoter and showing the highest peak of enrichment by the ‐ actin antibody, another covering nucleotides ‐857 to + 52 of the human SCG2 promoter) were gel‐ purified and digested with NheI and HindIII, and then cloned into pREP4‐luc vector. These two constructs were termed pREP4‐SLC11A1 –Luc and pREP4‐SCG2 –Luc, respectively.
Preparation of monocytes and cell culture
71 Human venous blood from healthy medication‐free volunteers was collected, and isolation of peripheral blood monocytes was performed as described before
(Xu et al., 2005). Both monocytes and HL‐60 cells were cultured in RPMI 1640 medium supplemented with 10% FBS, 2 mM L‐Glutamine and 1% penicillin/ streptomycin.
Western blot analysis
After the appropriate treatment, total cellular extracts as well as nuclear and cytoplasmic fractions were prepared and Western blot analysis was performed as described previously (Xu et al., 2005). A monoclonal antibody against GAPDH
(Sigma, Saint Louis, MO) was used at a 1:10,000 dilution and a monoclonal antibody against β‐actin (clone AC‐15 from Sigma) was used at a 1:5,000 dilution.
A polyclonal antibody HDAC1 (Santa Cruz) or GFP (Molecular Probes, Eugene, OR) was used at a 1:1,000 dilution.
Immunoprecipitation assays
Cells were treated with PMA for 48 h or left untreated; subsequently, the cells were washed once with ice‐cold PBS and lysed in EBMK/0.1% NP‐40 buffer (25 mM HEPES, pH 7.6, 5 mM MgCl2, 1.5 mM KCl, 75 mM NaCl , 175 mM sucrose ,
0.1% NP‐40 and protease inhibitors) on ice for 10 min. The nuclear pellet was collected by centrifugation at 500g for 4 min and washed three times with
EBMK buffer (no NP‐40). The nuclei were then lysed in 1 ml of RIPA buffer
72 containing protease inhibitors, passed repeatedly through a 22‐gauge needle and centrifuged at 10,000g for 30 min. The supernatants were pre‐cleared with protein A/G agarose for 30 min. Immunoprecipitation was performed overnight at 4C using the antibody against RNAP II (Covance, Berkeley, CA) or GFP. To precipitate the antigen‐antibody complex, protein A/G agarose was added and incubated for 1 hr at 4C. After washing with RIPA buffer, the precipitated proteins were eluted by boiling in SDS sample buffer and analyzed by immunoblotting using antibodies to ‐actin or RNAP II.
ChIP‐on‐chip
HL‐60 cells were treated with PMA (10ng/ml) or left untreated. A complete protocol for chromatin immunoprecipitation and amplification can be found on the website at http:// www.vmrf.org/researchcenters/gene‐ chip/chromatin_immunoprecipitation.pdf. High‐density promoter arrays (2006‐
04‐28 HG18_ RefSeq _promoter) were created by NimbleGen Systems and contained 390,000 50‐75 mer probes per array that tiled through 2200 bp upstream and 500 bp downstream of the transcriptional start sites of the selected genes. Promoter array were hybridized and data were extracted by
NimbleGen System Inc. (Madsion, WI) as part of a Chromatin
Immunoprecipitation custom array service.
ChIP‐qPCR
73 The ChIP assay was performed by using a chromatin immunoprecipitation assay kit (Upstate, Lake Placid, NY) according to the manufacturer’s instructions. HL‐60 cells were treated with PMA for 48 h or left untreated, and then fixed with 1% formaldehyde for 10 min, washed with ice‐cold PBS containing protease inhibitors and lysed with SDS lysis buffer. The lysate was sonicated to yield DNA fragments between 300 and 1000 base pairs, and centrifuged at 13,000 rpm for
10 min. The supernatant was diluted 10‐fold with ChIP dilution buffer and pre‐ cleared with salmon sperm DNA/protein A agarose. Immunoprecipitation was performed overnight at 4C using either non‐specific mouse IgG or the antibodies against ‐actin (clone AC‐15, Sigma) or RNAP II (clone 8WG16 from
Covance, Berkeley, CA). Immunoprecipitates were washed and eluted, and the cross‐links were reversed by adding 20 l of 5M NaCl to the eluates and heating for 4 h at 65C. The precipitated DNA fragments were purified and quantified by
Quant‐iTTM dsDNA Assay Kit (Molecular Probes, Eugene, OR) and were then amplified by real‐time qPCR as described in the following Quantitative real‐time
PCR. Primer sequences used for real‐time PCR are listed in Supplementary Table
S2.1
Small RNA interference experiment
HL‐60 cells were transiently transfected with either control or β‐actin siRNA using the Cell Line NucleofectorTM kit V (Amaxa, Gaithersburg, MD) according to the manufacturer’s instructions. Briefly, 2106 log‐growth cells were suspended
74 in 100 l of Cell Line NucleofectorTM Solution V and mixed with 2.5 g of control siRNA or β‐actin siRNA. The siRNA duplexes used in the experiment are Silencer®
β‐actin siRNA (Ambion, Austin, TX). Transfection was performed with a
NucleofectorTM II device using the program T‐019. Transfected cells were cultured for 24 h at 37 C in 5% CO2 and were then further treated with PMA (10 ng/ml) for 48 hrs or left untreated, followed by Real‐Time qRT‐PCR analysis.
Quantitative real‐time PCR
Total RNA was extracted from cells using TRIzol Reagent (Invitrogen) according to the manufacturer’s instruction. Next, 1 µg of total RNA was reverse‐ transcribed with the QuantiTect reverse transcription kit (Qiagen, Mississauga,
ON, Canada). An equal amount of cDNA from each experimental condition or purified DNA fragment from ChIP was amplified by real‐time PCR using the
Stratagene Mx‐4000 and BrilliantSYBR Green QPCR Master Mix. We normalized gene expression to a house‐keeping gene (GAPDH) and the relative expression value between the samples was calculated based on the threshold cycle (CT) value using the 2‐CT method (Livak and Schmittgen, 2001).
Luciferase activity
The HL‐60 cells were transfected with either control or β‐actin siRNA as described above. Twenty four hours after transfection, transient transfections of siRNA‐transfected or untransfected HL‐60 cells with luciferase reporter constructs were performed using HiFect transfection reagent (Amaxa,
75 Gaithersburg, MD) according to manufacturer’s instruction. Four hours after transfection, cells were treated with PMA (10 ng/ml) for 48 h or left untreated; following this the cells were harvested. Luciferase reporter assays were performed using the Dual‐Luciferase Reporter Assay System (Promega,
Madison, WI) and the luminescence measurements were done with a Turner
Designs model TD‐20/20 luminometer. Firefly luciferase activity was normalized to Renilla luciferase activity (Xu et al., 2013).
Immunofluorescence
HL‐ 60 cells were seeded on 4‐well culture slides (Becton Dickinson Labware,
Franklin Lakes, NJ), pretreated with signal inhibitors or DMSO (the vehicle for inhibitors) and then stimulated with PMA. Unstimulated HL‐60 cells were collected by centrifugation at 500g for 5 min, placed on culture slides. Both treated and untreated cells were fixed for 15 min in PBS containing 3.0% paraformaldehyde and permeabilized for 20 min with 0.18% Triton X‐100 in M‐ buffer(containing 50 mM imidazole, 50mM KCl, 0.5mM MgCl2, 1mM EGTA, 0.1 mM EDTA, 1mM ‐mercaptoethanol, 4mM glycerol, pH6.8). After soaking in blocking buffer (PBS containing 1% goat serum and 1% BSA) for 30 min, cells were incubated with a mouse anti‐‐actin antibody (clone AC‐15 from Sigma) at
1:1000 dilution in blocking buffer for 16h at 4C. Following washes with PBS, cells were incubated with an Alexa Fluor 568 goat anti‐mouse IgG (1:300, Molecular
Probes, Eugene, OR) for 1h at room temperature. After washing in PBS, the cells
76 were mounted in Vectashield with DAPI (Vector Laboratories, Burlingame, CA) and visualized with a Zeiss Axiovision 3.1 microscope using 63oil objective, and an Axiocam HR (Zeiss) digital camera was used for photography.
Microinjection
HL‐60 cells were plated on 1‐well Lab‐Tek chambers in RPMI 1640 medium with
10% heat‐inactivated FBS, 100 U/ml penicillin and 100ng/ml streptomycin, and treated with 10 ng/ml PMA. 30 hr after PMA treatment, the nuclei of PMA‐ treated HL‐60 cells were co‐microinjected with TRITC‐labelled dextran (Sigma) with either anti‐‐actin antibody (Sigma) or mouse IgG using an Eppendorf microinjection system (micromanipulator model 5170 and microinjector model
5242) linked to an Olympus microscope. The pressure injection device was fitted with sterile glass capillaries (Ø 0.5 0.2 m, Femtotips, Eppendorf). The antibodies were dialysed in PBS, concentrated and combined with dextran. The final concentration of ‐actin antibody, IgG or dextran is 5.0 mg/ml. About 40 fl were injected into each nucleus and about 30 nuclei were microinjected in 30 min for each chamber. 18 hr after injection, SLC11A1 mRNA expression was detected by using RNA in situ hybridization. mRNA in situ hybridization
Plasmid PGEM‐T‐3’UTR (Xu et al., 2005) was linearized with the restriction endonuclease Pst I and then used as the template to produce anti‐sense biotin‐
77 labeled RNA probes by in vitro transcription. mRNA in situ hybridization was performed by using ELF ® 97 mRNA in situ hybridization kit #2 (Molecular Probes).
HL‐60 cells were fixed with 3.7% formaldehyde and 5% acetic acid in 0.9% NaCl for 15 min, and then washed twice in PBS. Samples were rinsed in 100% xylene for 5 min and washed with PBS. Samples were then pre‐hybridized for 1 hr, and hybridized overnight at 42C. Pre‐hybridization was done in 25% formamide,
6SSC, 5Dehardt’s solution and 500 g/ml salmon sperm DNA; hybridization was done in the same solution with biotinylated anti‐sense probes. The following day, samples were sequentially washed three times with 2SSC, three times with
0.1SSC, and once with wash buffer (1). Subsquently the samples were blocked with blocking buffer for 30 min, and then incubated with a dilution of 1:50 streptavidin‐alkaline phosphatase in the same blocking buffer for 30 min.
Samples were then washed, and incubated with substrate working solution (1:10 dilution of phosphatase substrate and 1:500 dilution of substrate additives 1 and
2 in the development buffer) for 1 hr. After wash, the cells were mounted in mounting medium and viewed with a Zeiss Axioskop II microscope.
2.4 Results
PMA‐treatment, which induces differentiation of HL‐60 cells and human monocytes, stimulates nuclear accumulation of ‐actin
78 When HL‐60 cells were induced with PMA to differentiate into macrophage‐like cells, we found that actin redistribution occurred. Western blot analysis using whole‐cell lysates revealed that total ‐actin content increased by 1.48 (±0.16) ‐ fold HL‐60 cells treated with PMA for 24 h, and the content of ‐actin remained stable after 24 h of treatment. The analysis of subcellular fractions revealed that
‐actin was strongly expressed in the cytoplasm, and very weakly (scarcely detectable) in the nuclei in untreated HL‐60 cells. Following treatment of HL‐60 cells with PMA, ‐actin content was increased by 1.38 (±0.13) ‐fold in the cytoplasm during the 72 h of differentiation, while the content of nuclear actin increased 12.5 (±2.1) ‐fold after 24 h and increased 32.9 (±3.8) ‐fold after 48 h and 72 h of treatment (Figure 2.1A). These results demonstrate that the observed nuclear accumulation of ‐actin in response to PMA treatment was not only due to an overall increase in ‐actin expression, but likely resulted from an elevated import of cytoplasmic ‐actin to the nucleus. Western blotting of the same membranes to detect nucleus‐ and cytoplasm‐specific markers (histone deacetylase 1 and GAPDH, respectively) verified that the cytoplasmic protein did not leak into the nuclear fractions during cell treatment or fractionation, and further monitored the equal loading and transfer of the samples. As shown in
Figure 2.1B, similar results were observed when human monocytes were used.
PMA‐induced nuclear accumulation of ‐actin was further confirmed by immunofluorescence analysis using a mouse anti‐‐actin antibody. As shown in
Figure 2.1C, in untreated cells, we observed that ‐actin was exclusively
79 cytoplasmic, whereas in PMA‐treated HL‐60 cells, ‐actin was intensely stained in the nuclei while the cytoplasmic staining diminished. In control experiments, anti‐‐actin antibodies were omitted from the immunostaining and no fluorescence signals were observed either in the nucleus or cytoplasm (not shown). To rule out any possibility that some of the cytoplasmic actin might enter into the nucleus during immunostaining, HL‐60 cells were transfected with vector pAcGFP1‐Actin and GFP‐‐actin fusion protein expression was then directly monitored by fluorescence microcopy. As shown in Figure 1D, after PMA treatment, the fluorescence of GFP‐‐actin fusion protein could also be observed in the nuclei from differentiating HL‐60 cells.
Signaling events involved in PMA‐induced nuclear localization of ‐actin
Given the growing evidence showing that actin translocates to the nucleus in response to cellular stress and that nuclear actin is involved in diverse nuclear activities, we sought to identify the signaling pathway(s) influencing the nuclear accumulation of actin. We first tested a series of inhibitors of signaling pathways at two different concentrations to determine their influence on PMA‐induced nuclear accumulation of actin. This assessment was carried out by Western blot analysis of actin abundance in the cytoplasmic and nuclear fractions. Our results showed that all MEK/ERK, p38 MAPK and PKC inhibitors could block PMA‐ induced translocation of actin into nuclei, whereas treatment with inhibitors of
80 Figure 2.1. PMA treatment induces ‐actin translocation to the nucleus. HL‐60 cells (A) and human monocytes (B) were left untreated or treated with PMA (10 ng/ml) for 24, 48 and 72 h. Total cell, cytoplasmic and nuclear extracts (TE, CE and NE, respectively) were prepared as described in the Materials and Methods.
Total and subcellular ‐actin expression was analyzed by Western blot analysis.
The expression of the cytoplasmic marker GAPDH and nuclear marker histone deacetylase 1(HDAC1) were also monitored. (C) HL‐60 cells treated with or without PMA (10 ng/ml) for 48 h were then fixed with 3% paraformaldehyde and permeabilized with 0.18% Triton X‐100. Subsequently the cells were labeled with a monoclonal mouse anti‐‐actin antibody, followed by Alexa Four 568 goat anti‐mouse IgG (red). The nuclei were stained with DAPI (blue). (D) Transfected
HL‐60 cells expressing GFP‐‐actin fusion protein were left untreated or treated with PMA for 48 h, and then the effects of PMA treatment on GFP‐‐actin distribution in the transfected cells was observed with a Zeiss Axiovision 3.1 microscope.
81
Figure 2.1
82 JNK or PI 3‐kinase had no effect on nuclear translocation (Supplementary Table
S2.2). The PKC and MEK/ERK signal pathway inhibitors could also block PMA‐ induced morphological changes of HL‐60 cells undergoing differentiation such as cellular adherence to plastic and spreading in a manner characteristic for macrophages (data not shown). In contrast, the p38 inhibitor (p38 inhibitor III),
JNK inhibitor (JNK inhibitor II) and PI 3‐kinase inhibitor (Wortamannin) did not prevent the differentiation of HL‐60 cells to the macrophage‐like phenotype
(data not shown) and their effects on PMA‐induced differentiation of HL‐60 cells were assessed both by NBT reduction assay (Supplementary Figure S2.1A) and by monitoring of CD11b expression using flow cytometry analysis (Supplementary
Figure S2.1B and 2.1C). The percentage of NBT positive cells and CD11b expression were greatly increased after 48 h of PMA treatment, compared with untreated control. Both JNK inhibitor II and Wortamannin did not significantly inhibit the HL‐60 cell differentiation induced by PMA, as indicated by NBT reduction ability and CD11b expression (both in terms of the percentage of
CD11b‐positive cells and mean fluorescence intensity). The p38 inhibitor III increased the PMA‐induced differentiation of HL‐60 cells, but not significantly, as assessed using the same assays. The representative Western blot analysis illustrating the effects of p38 inhibitor III, JNK inhibitor II and Wortamannin on
PMA–induced nuclear translocation of actin was shown in Figure 2.2A. As stated above, the p38 inhibitor III blocked the nuclear accumulation of ‐actin whereas the JNK inhibitor II and Wortamannin did not. Indirect Immunofluorescence
83 Figure 2.2. Effects of JNK, PI3‐K or p38 MAPK inhibitors on PMA‐induced translocation of ‐actin into nucleus. (A) The JNK inhibitor (JNK inhibitor II, 5
M), PI3‐K inhibitor (Wortmannin, 1 M), p38 MAPK inhibitor (p38 inhibitor III,
20 M) or DMSO (the vehicle for inhibitors) was separately added to HL‐60 cells
1 h before treating with PMA (10ng/ml) for 48h. (A) ‐actin levels in cytoplasmic fractions and nuclear fractions were monitored using Western blot analysis. The expression of the cytoplasmic marker GAPDH and nuclear marker HDAC1 were also monitored. (B) Effects of signal inhibitors on PMA‐induced nuclear translocation of ‐actin were detected by indirect immunofluorescence as described in Figure 1C. Red color represents ‐actin; blue color depicts nucleus.
(C) HL‐60 cells expressing GFP‐‐actin fusion protein were pretreated with kinase inhibitors or DMSO as in (A) for 1 h, and then cultured with PMA for 48 h.
Fluorescence microscopy was used to observe the effects of kinase inhibitors on
PMA‐induced GFP‐‐actin translocation.
84
C DMSO p38 inhibitor III
JNK inhibitor II Wortamannin β-actin
GAPDH
HDAC1
B DMSO p38 inhibitor III JNK inhibitor II Wortamannin
Figure 2.2
85 analysis of ‐actin distribution in HL‐60 cells, illustrated in Figure 2.2B, confirmed the results of Western blot analysis. Pretreatment with JNK inhibitor II or
Wortmannin (inhibitor of PI3‐K) had no effect on PMA‐induced nuclear accumulation of ‐actin, whereas ‐actin was confined to the cytoplasm following pretreatment with p38 inhibitor III. Similar results were also obtained when using HL‐60 cells expressing GFP‐‐actin fusion protein (Figure 2.2C). Our results demonstrate that p38 signal pathway is involved in PMA‐induced nuclear translocation of ‐actin.
Accumulated nuclear actin is co‐localized with RNA polymerase II
To determine whether the nuclear ‐actin accumulation is associated with an interaction with RNA polymerase II (RNAP II) we have performed series of immunoprecipitations and Western blot analyses. Nuclear extracts from HL‐60 cells either untreated or treated with PMA for 48 h were immunoprecipitated with anti‐RNAP II antibody. The immunocomplexes were detected by immunoblotting with an antibody against ‐actin and reprobed with an antibody against RNAP II. As shown in Figure 2.3A, ‐actin was undetectable in RNAP II complexes from untreated HL‐60 cells, but it appeared in the complexes from
PMA‐treated HL‐60 cells. In both untreated and PMA‐treated HL‐60 cells, RNAP II could be detected (Figure 2.3B). Similar results were obtained when the same experiments were performed using human peripheral blood monocytes (data
86 not shown). To investigate whether exogenous ‐actin could incorporate into the
RNAP II complex, binding of GFP‐tagged ‐actin to RNAP II was tested in HL‐60 cells transfected with expression vector pAcGFP1‐actin. RNAP II complexes were immunoprecipitated from lysates of the transfected HL‐60 cells, and the precipitated complexes were then probed with a GFP antibody and reprobed with an antibody against RNAP II. As shown in Figure 2.3C and 2.3D, GFP‐‐actin was associated with RNAP II only when transfected HL‐60 cells were treated with
PMA, as in wild‐type HL‐60 cells. Our results demonstrate that PMA treatment promotes interaction between nuclear ‐actin and RNAP II.
Identification of genome‐wide binding of ‐actin to the promoters in HL‐60 cells
To further investigate whether accumulated nuclear ‐actin is associated with genome‐wide transcriptional regulation, we used an anti‐‐actin antibody to perform ChIP‐on‐chip experiments, searching for genome‐wide promoters enriched in ‐actin binding. HL‐60 cells were untreated or treated with PMA for
48 h, and standard ChIP assays were performed using the ‐actin antibody and a non‐specific mouse IgG as a control. The immunoprecipitated DNAs were amplified by two rounds of ligation‐mediated PCR (LM‐PCR) as described in the
Materials and Methods section. The produced amplicons contained DNA fragments spanning from 200 bp to 600 bp. The amplicons from the ‐actin and
87 Figure 3. Endogenous or exogenous ‐actin is associated with RNA polymerase
II (RNAP II) during the differentiation of HL‐60 cells. (A) Nuclear extracts prepared from 5107 HL‐60 cells untreated or treated with PMA (10 ng/ml) for
48 h were subjected to immunoprecipitation with an RNAP II antibody. The bound proteins were eluted by boiling in SDS sample buffer and separated on
SDS/PAGE gel, and analyzed by Western blotting with a mouse monoclonal antibody against ‐actin. (B) The Western blots from (A) were stripped and re‐ probed using an anti‐RNAP II antibody. (C) Co‐immunoprecipitation experiments and Western blot analyses were performed as in (A), except that HL‐60 cells transfected with vector pAcGFP1‐actin were used. Nuclear extracts were immunoprecipitated with an anti‐RNAP II antibody and probed with a GFP antibody. (D) The Western blots from (C) were stripped and re‐probed using the anti‐RNAP II antibody. IP: immunoprecipitation; WB: Western blot analysis
88
Figure 2.3
89 IgG‐immunoprecipitated chromatin samples were labeled with Cy5 dye, and the amplicons from unenriched input chromatin samples were labeled with Cy3 dye.
Equal amounts of Cy5‐labeled and Cy3‐labeled amplicons were co‐hybridized onto separate HG18_RefSeq_ promoter arrays. A representative profile of the ‐ actin complex along chromosome 2 and a close‐up of ‐actin ChIP‐on‐chip hybridization signals around the 5’ end of the SLC11A1 gene are shown in Figure
2.4A and 2.4B.
To identify the promoters that were significantly bound by ‐actin, we compared the hybridization intensities between the ‐actin array and the input array, and calculated a ‐actin/input ratio for each oligonucleotide probe. To eliminate from consideration promoter regions that are enriched nonspecifically during the ChIP procedure, we also calculated an IgG/input ratio for each oligonucleotide probe. We considered a promoter positive for ‐actin binding based on data analysis when (a) significant differences were found(P< 0.01 by t‐ test) in hybridization signals between the immunoprecipitation‐enriched DNA channel as compared with the input control channel, and (b) log2 (‐actin/input ratio) was higher than 1.0, and at the same time, log2 (IgG/input ratio) was less than 0.5. This was further analyzed using SignalMap1.8 (NimbleGen Inc). In untreated cells, only 25 gene promoters were identified as actin binding targets, whereas at 48h after PMA treatment, 827 gene promoters were identified
(Supplementary Table S2.3, Appendix I). To gain insights into the functions of the identified target genes, Go enrichment analysis was performed using DAVID
90 Figure 2.4. High‐resolution ChIP‐on‐chip analysis of ‐actin binding to chromosome 2. Cross‐linked and sonicated chromatin was prepared from HL‐60 cells with or without PMA treatment for 48 h. ChIP experiments were performed, and then the precipitated DNAs prepared from a ‐actin antibody and a non‐ specific IgG as well as total input DNA were used to prepare amplicons by LM‐
PCR. High‐density HG18_RefSeq_ promoter arrays were hybridized with the amplicons. (A) A representative profile of the ‐actin complex along the
chromosome 2 was shown. The logarithmic ratio (log2R) means hybridization intensities between ‐actin or IgG enriched DNA and input DNA. (B) A close‐up view of ChIP‐on‐chip hybridization signals for ‐actin and non‐specific IgG binding around the 5’‐end of SLC11A1 gene.
91
Figure 2.4
92 (Dennis, Jr. et al., 2003) and EASE (http://david.abcc.ncifcrf.gov/ ease/ ease.jsp)
This analysis revealed that the 20 gene ontology (GO) categories, such as cell growth and/or maintenance, apoptosis, cell surface receptor linked signal transduction, response to external stimuli and immune response were significantly enriched after 48 h of PMA treatment (Table 2.1). We also identified a number of genes that are associated with ion transport, immune response and apoptosis.
The results from these ChIP‐on‐chip experiments were validated in independent conventional ChIP experiments using PCR primers (Supplementary
Table S2.1) that spanned the regions showing the highest peak of enrichment by the ‐actin antibody. Twelve of 48 promoters bound by ‐actin in chromosome 2 were randomly selected. As shown in Figure 2.5A, the results demonstrated that
‐actin was not associated with the selected promoters in undifferentiated cells
(without PMA‐treatment); however, after PMA treatment, ‐actin was recruited to the promoter regions, which was in agreement with the observations from
ChIP‐on‐chip analysis. The ChIP experiments verified the binding of ‐actin to 11 of the selected promoters of ‐actin target genes analyzed by ChIP‐on‐chip
(Figure 2.5B).
Correlation between ‐actin and RNA polymerase II occupancy at target promoters
Our results have shown that nuclear ‐actin interacts with RNA Pol II in
93 macrophages. To examine potential correlation between ‐actin binding and
RNA Pol II recruitment at the promoters of ‐actin targeted genes, we performed
ChIP‐qPCR for ‐actin and RNA Pol II occupancies at six target promoters
(SLC11A1, TCF23, PEX13, ZNF638, NCOA1 and ANXA4) and one non‐target promoter (SCG2). As shown in Figures 2.6A and 2.6B, both the occupancies of ‐ actin and RNA Pol II at the selected target promoters increased upon PMA treatment in control siRNA‐ or ‐actin siRNA‐treated HL‐60 cells. ‐actin knockdown resulted in the decrease of PMA‐induced ‐actin binding to the promoters accompanied by a diminished recruitment of RNA Pol II. Both the
PMA treatment and ‐actin knockdown had no effects on the occupancies of ‐ actin and RNA Pol II at the SCG2 promoter. To examine the relationship between
‐actin and RNA Pol II binding at target gene promoters, the results for ‐actin occupancies were compared with the results obtained for RNA Pol II occupancies.
Using Spearman rank correlation analysis, we revealed a significant correlation between PMA‐induced ‐actin occupancy and RNA Pol II occupancy at the selected promoters (correlation coefficient = 0.83, P =0.000785 at 48 h) (Figure
2.6C). As shown in Figure 2.6D, transfection of ‐actin siRNA significantly decreased the nuclear translocation of ‐actin induced by PMA treatment in HL‐
60 cells. The ‐actin siRNA treatment had no significant effect on the protein levels of RNAP II and nuclear marker HDAC1. These results demonstrate that nuclear ‐actin is involved in recruiting RNA Pol II to the target genes.
94 Table1 Gene Ontology (GO) categories significantly enriched for -actin target genes
GO category -actin target *P-value genes (EASE score)
Apoptosis (GO:0006915) 17 0.028 Cell surface receptor linked Signal transduction (GO:0007166) 60 0.0054 Response to external stimulus (GO:0009605) 64 0.013 Chemotaxis (GO:0006935) 15 0.0029 Immune response (GO:0006955) 36 0.0036 Cell cycle (GO:0007049) 29 0.0081 Protein biosynthesis (GO:0006412) 34 0.0041 Protein modification (GO:0006464) 46 0.0086 Catabolism (GO:0009056) 53 0.0018 Biosynthesis (GO:0009058) 51 0.0036 RNA biosynthetic process (GO:0032774) 28 0.0046 RNA processing (GO:0006396) 23 0.0027 DNA repair (GO:0006281) 11 0.0012 DNA replication (GO:0006260) 14 0.0052 Ion channel activity (GO:0005216) 46 0.0025 Ion transport (GO:0006811) 28 0.0093 Cell motility (GO:0048870) 15 0.0053 Cell growth and/or maintenance (GO:0009987) 87 0.0062 Cell differentiation (GO:0043697) 12 0.0039 Cell development (GO:0007275) 72 0.0076
*The threshold of EASE Score, a modified Fisher Exact P-Value, for gene- enrichment analysis. Usually P-Value is equal or smaller than 0.05 to be considered strongly enriched in the annotation categories.
95
Figure 2.5. Validation of ‐actin target genes identified by ChIP‐on‐chip.
(A)Twelve of 48 targets bound by ‐actin on chromosome 2 were randomly selected, and were confirmed by conventional ChIP. The immunoprecipitated
DNAs prepared as described in the Materials and Methods section were analyzed by PCR using primers specific to the promoters of the indicated genes. A non‐ specific IgG was used as a negative control, and input DNAs were used as positive controls. (B) Treeview depiction of the binding changes of the 12 target genes in
HL‐60 cells treated or left untreated with PMA analyzed by ChIP‐on‐chip.
96
Figure 2.5
97 Figure 2.6. Effects of ‐actin knockdown on ‐actin binding and RNA Pol II recruitment at selected promoters in HL‐60 cells as assayed by ChIP‐qPCR. HL‐
60 cells were transiently transfected with either control siRNA (‐) or β‐actin siRNA (+). Twenty‐four hours after transfection, HL‐60 cells were left untreated or treated with PMA (10 ng/ml) for 48h. (A) ChIP experiments were performed, and then the precipitated DNAs prepared from a ‐actin antibody and a non‐ specific mouse IgG as well as total input DNA were quantified and were amplified using real‐time PCR with primers that target the selected regions of 6 target genes. β‐actin occupancy level is represented as the ratio of signal from IP samples versus that of the input minus background of IgG control. (B) ChIP and real‐time PCR experiments were performed and RNAP II occupancy was calculated the same as in (A) except for a RNA polymerase II antibody used for IP.
(C) Correlation between β‐actin and RNAP II occupancy at the 6 target promoters at 48 h after PMA treatment. The correlation coefficient (r) is 0.83 at 48 h (P
=0.000785). (D) Nuclear extracts from PMA‐treated or untreated transfected cells were prepared and analyzed by Western blot analysis using antibodies specific to β‐actin and HDAC1.
98
Figure 2.6
99 ‐actin binding to the gene promoters is functionally relevant in actin‐ mediated modulation of target gene expression
To determine the target genes whose proper expression depends, directly or indirectly, on the presence of nuclear ‐actin in differentiating HL‐60 cells, ‐ actin was knocked down using a small RNA interference experiment as in Figure
6A and cells were treated with PMA for 48 h. We further performed quantitative
RT‐PCR analysis to measure the time‐dependent changes in the expression of the selected 6 target genes (SLC11A1, TCF23, PEX13, ZNF638, NCOA1 and ANXA4) in
HL‐60 cells. As shown in Figure 2.7, mRNA expression levels of SLC11A1, PEX13,
NCOA1, ANXA4, and ZNF638 in ‐actin siRNA‐treated cells decreased significantly when compared with those in control siRNA‐treated cells after 48 h of PMA treatment. The mRNA levels of these genes correlated with the ‐actin occupancies at the promoters (Figure 2.7 and Figure 2.6A) after PMA treatment.
‐actin knockdown had no effect on the mRNA expression level of one target gene TCF23 and the non‐target gene SCG2. The results demonstrate that the ‐ actin occupancy level at the promoters is associated with the expression level of
‐actin target gene.
Nuclear ‐actin is required for transactivation of SLC11A1 gene
The findings described above about ‐actin’s binding to the gene promoters and its association with the mRNA expression of the target genes prompted us to
100
Figure 2.7. Effects of ‐actin knockdown on the expression of six target genes.
HL‐60 cells were transfected with either control (‐) or β‐actin (+) siRNA and were then treated with PMA as described in Figure 7. The expression level of six target genes SLC11A1, TCF23, PEX13, ZNF638, NCOA1, ANXA4, and one non‐target gene,
SCG2, were measured by real‐time PCR. Experiments were conducted in quadruplicate and normalized to GAPDH mRNA level (data shown are mean
SEM, n=4, unpaired t‐test, **P<0.001 compared with mRNA level in β‐actin siRNA‐treated cells at the corresponding time point of PMA treatment).
101
9 8 ** 0h 7 48h ** 6 ** ** 5 ** 4 3 2 1
Relative mRNA level mRNA Relative 0 siRNA - + - + - + - + - + - + - +
SLC11A1 TCF23 PEX13 ZNF638 NCOA1 ANXA4 SCG2
Figure 2.7
102 investigate further the importance of nuclear ‐actin in the transactivation of the target genes. We selected one of the ‐actin regulated genes, SLC11A1, which is important in macrophage‐mediated natural resistance to a variety of intracellular pathogens. We also selected a non‐target gene, SCG2, as a control.
We compared the SLC11A1 or SCG2 promoter‐driven luciferase activity between
HL‐60 cells transfected with siRNA specific for ‐actin and those with control siRNA. As shown in Figure 2.8A, ‐actin knockdown had no effect on both
SLC11A1 and SCG2 promoter‐driven transactivation of luciferase activity in untreated HL‐60 cells; however, in PMA‐treated cells, ‐actin knockdown significantly decreased the luciferase activity driven by the SLC11A1 promoter but not the SCG2 promoter. As shown in Figure 2.8B, transfection of ‐actin siRNA significantly decreased the nuclear ‐actin level in PMA‐treated HL‐60 cells but had no effect on nuclear marker HDAC1 expression. Similarly, blocking the
PMA‐induced accumulation of nuclear ‐actin by p38 inhibitor III inhibits the luciferase activity driven by SLC11A1 promoter but not SCG2 promoter (Figure
2.8C). In order to further assess the role of nuclear ‐actin in SLC11A1 mRNA expression, HL‐60 cells were treated with PMA for 30 hr to induce cell adherence and SLC11A1 mRNA expression. The adherent cells were then microinjected into the nuclei with an antibody against ‐actin or with mouse nonspecific IgG as a control together with TRITC‐labeled dextran to identify the injected cells. 18 hr following microinjection, the cells were fixed and mRNA in situ hybridization was performed to detect the level of SLC11A1 mRNA expression. As shown in Figure
103 2.8D, PMA‐induced SLC11A1 mRNA expression in HL‐60 cells were significantly inhibited when cells were injected with ‐actin antibody but not mouse nonspecific IgG, These data indicate that ‐actin is involved in the transcription of SLC11A1 gene. Our results demonstrate that nuclear accumulation of ‐actin is associated with the transactivation of the SLC11A1 gene.
2.5 Discussion
Evidence has gradually been accumulating to prove that actin is present in the nucleus and plays key roles in nuclear functions, although it is still not clear whether its occurrence in nuclei is universal. The human promyelocytic leukemia cell line, HL‐60, has been used as a unique model to study the cellular and molecular events involved in the proliferation and differentiation of myeloid cells.
The cell line can be induced to differentiate into monocytic cells by treatment with 1, 25 –dihydroxyvitamin D3 or into macrophage‐like cells by treatment with phorbol esters, such as PMA, or into granulocytic cells by treatment with retinoic acid (Trayner et al., 1998). In this study, we found that although HL‐60 cells and human monocytes express substantial levels of actin, it is predominantly cytoplasmic and is scarcely detectable in the nuclei in both types of untreated cells; however, PMA treatment induces actin accumulation in the nucleus. We also observed an increase in ‐actin synthesis after PMA treatment.
Total ‐actin content and cytoplasmic ‐actin content increased marginally
104 Figure 2.8. Nuclear ‐actin is required for PMA‐induced transactivation of
SLC11A1. HL‐60 cells were respectively transfected with siRNA control or siRNAs specific for ‐actin. 24h after transfection, cells were transiently co‐transfected again with the luciferase reporter vector pREP4‐SLC11A1‐Luc or pREP4‐SCG2‐Luc with pRL‐CMV. Transfected cells were cultured for 48 h with or without PMA
(10ng/ml). (A) Total protein extracts were prepared and the luciferase activities driven by SLC11A1 or SCG promoter were analysed by the dual‐luciferase reporter assay system. (B) Nuclear extracts were prepared and β‐actin and
HDAC1 expression was detected by Western blot analysis. (C) HL‐60 cells were transiently co‐transfected with the luciferase reporter vector pREP4‐SLC11A1‐Luc or pREP4‐SCG2‐Luc with pRL‐CMV. The cells were treated with the p38 MAPK inhibitor (p38 inhibitor III, 20 M) at 24 h post transfection and then treated with
PMA (10ng/ml) 1 h later. The luciferase activities were analysed at 48 h after
PMA treatment. The data shown (meanS.E.) are the averages of three independent experiments performed in triplicate. **P<0.001, when compared with the respective group of untreated cells. (D) Microinjection of antibody to ‐ actin inhibits SLC11A1 transcription in vivo. HL‐60 cells were treated with PMA
(10 ng/ml) for 30 hr and were then microinjected into the nuclei with an antibody against ‐actin or with mouse IgG as a control, together with TRITC‐ labelled dextran to identify the injected cells. 18 hr after microinjection, the cells were fixed with 3.7% formaldehyde and hybridized in situ with biotinylated anti‐ sense RNA probe to SLC11A11 mRNA. The biotinylated probe was developed for
105 visualization with alkaline phosphatase‐mediated techniques using the ELF97 mRNA in situ hybridization kit. Cells containing the biotinylated probes were then detected using streptavidin‐alkaline phosphatase conjugate and the ELF97 phosphatase substrate.
106
A SLC11A1 SCG2 B 15 siRNA(-) siRNA(-) ** 2 siRNA - + - + siRNA(+) siRNA(+) PMA - - + + 10 1.5 β 1 -actin
5 activity activity 0.5 HDAC1
0 Relative luciferase 0 Relative luciferase PMA - + PMA - + SLC11A1 C D Dextran mRNA
p38 inhibitor III (-) 1.2 ** p38 inhibitor III (+) 1 Mouse IgG 0.8 0.6
activity 0.4 0.2 β-actin Relative luciferase Relative 0 antibody SLC11A1 SCG2
Figure 2.8
107 during the course of macrophage differentiation. In contrast, there was a dramatic increase of in ‐actin content in the nucleus. These results suggest that increased ‐actin in the nucleus most likely arise from the cytoplasmic pool of actin. The mechanism of ‐actin translocation into the nucleus remains to be elucidated.
Given the numerous data demonstrating the regulation of nuclear import and export of proteins such as transcription factors, it seems reasonable to propose that actin might appear in the nucleus at high concentrations only when signaling cascades either increase the rate of import or inhibit export. A number of cell signaling pathways can be activated by PMA treatment, but the signaling pathway(s) whereby PMA regulates the translocation of actin from the cytoplasm to nuclei remains unknown. Previous studies have established an essential role of PKC signaling in PMA‐induced myeloid differentiation (Schultz et al., 1997;Tonetti et al., 1994). It has also been demonstrated that the MEK/ERK
MAPK signaling pathway is activated, and plays a critical role, during PMA‐ induced macrophage‐like differentiation of HL‐60 cells (Miranda et al., 2002). In this study, we found that PKC and MEK/ERK inhibitors potently inhibit PMA‐ induced differentiation and at the same time block the translocation of cytoplasmic ‐actin into the nuclei. In addition, we demonstrated that although the p38 MAPK signaling pathway is not essential for differentiation (FigureS1), as previously reported, it is necessary for ‐actin translocation.
108 The impact of actin and actin‐binding protein on chromatin remodeling and gene transcription has long been an interesting issue for cell biologists. Egly et al.(Egly et al., 1984) showed that a purified protein with many of the characteristics of actin was able to stimulate transcription by RNAP II in vitro, and that this activity was positively correlated with the concentration of G–actin in the in vitro system. More and more studies have implicated actin in the regulation of RNAP II‐mediated transcription (Dopie et al., 2012;Hofmann et al.,
2004;Kukalev et al., 2005;Miyamoto et al., 2011;Sjolinder et al., 2005). Our present studies demonstrate that nuclear ‐actin plays an important role in transcription regulation during PMA‐induced differentiation of HL‐60 cells towards macrophages. Interestingly, although nuclear actin was barely detectable in untreated HL‐60 cells by Western blot and immunofluorescence analysis, 25 gene promoters bound by ‐actin were identified by ChIP‐on‐chip analysis. The majority of these genes (18 of 25 genes) are involved in cellular response to stimuli and chemotaxis. After treatment with PMA for 48 h, 827 gene promoters displayed enriched binding by actin. These genes are involved in multiple functions including signaling pathway, cell growth and differentiation, apoptosis, ion transport, as well as immune response. Notably, ‐actin not only directly functions in chromatin remodeling, transcription, RNA splicing, and nucleocytoplasmic trafficking, but also regulates the genes involved in the biological processes above (Supplementary Table S2.4). Our data also belie the notion that ‐actin non‐specifically interacts with the promoter region; if this
109 were the case, ‐actin would have been found at the promoter in all the genes and in the absence of PMA treatment. The complex nature of ‐actin activity is observed not only in its diverse involvement in many different biological processes, but also in the ways it controls transcription of its target genes: (1) Ou et al. demonstrated that ‐actin specifically binds to a 27‐nt repeat element in intron 4 of the endothelial nitric oxide synthase gene and regulates the expression of this gene (Ou et al., 2005;Wang et al., 2002a); (2) ‐actin participates in chromatin remodeling as a component of the human chromatin remodeling complex (BAF), which interacts with chromatin during gene activation (Rando et al., 2002;Song et al., 2007;Zhao et al., 1998); (3) ‐actin plays a direct role in RNA transcription as a part of the pre‐initiation complex with RNA polymerase II (Hofmann et al., 2004). Recently, we have found that ‐ actin is recruited to SLC11A1 gene promoter via interaction with transcription factor ATF‐3, which binds to a AP‐1 like element of this promoter (unpublished data). Therefore, ‐actin might also adopt different ways to regulate the identified target genes in differentiating HL‐60 cells.
Here, by using co‐immunoprecipitation, we demonstrated a specific interaction between nuclear actin and RNAP II in PMA‐treated HL‐60 cells and human monocytes; this interaction is not seen in either type of untreated cells.
Through ChIP‐on‐chip assay, we demonstrated that ‐actin was associated with few gene promoters of PMA‐induced genes; however, after PMA treatment, ‐ actin was recruited to the promoter regions of many genes. These results
110 suggest that the association of ‐actin and RNAP II depends on the differentiation status of HL‐60 cells, and the RNAP II complex containing ‐actin could regulate the RNAP II–mediated transcription of the PMA‐induced genes.
Several possible mechanisms could be responsible for this association. PMA treatment could: (1) induce enough concentration of monomeric ‐actin and/or
‐actin‐binding proteins to accumulate in the nuclei and affect the formation of
‐actin‐containing RNAP II complexes; (2) cause covalent modification of ‐actin and/or ‐actin‐binding protein (phosphorylation or methylation) and make the interaction between ‐actin and RNAP II possible; (3) cause covalent modification of RNAP II, as Sjolinder and colleagues reported that ‐actin binds to the hyperphosphorylated C‐terminal domain (CTD) of the largest subunit of
Pol II (Sjolinder et al., 2005). Our results also revealed a strong positive correlation between PMA‐induced recruitment of ‐actin and the recruitment of
RNA Pol II at the promoters.
Previous studies have demonstrated that the recruitment of a transcription factor or modulator to its target genes does not mean that the transcriptional status of the target genes must be activated or repressed (Blais et al., 2005;Martone et al., 2003). In this study, regulation of the six target genes by
‐actin was analyzed by real‐time RT‐PCR in response to PMA treatment. The results indicated that all, except for one (TCF23), of the target genes were dependent on ‐actin for their transcriptional regulation after PMA treatment.
Such an observation could be explained by combinatorial regulation by
111 recruitment of additional transcriptional factors or modulators. Therefore, knowledge of the location of a given transcriptional modulator does not provide information about whether the modulator actually regulates a nearby gene under the prevailing conditions. Therefore additional functional analyses are always required to complement ChIP‐on‐chip data and thereby achieve a more accurate depiction of regulatory networks.
The solute carrier family 11 member 1 (SLC11A1) gene encodes the natural resistant ‐associated macrophage protein 1. It has been shown to be associated with susceptibility to infectious diseases, such as tuberculosis, leprosy, leishmaniasis and HIV infection (Blackwell, 2001;Donninger et al., 2004). It has been proposed as a candidate gene for autoimmune diseases such as rheumatoid arthritis, juvenile rheumatoid arthritis, sarcoidosis and Crohn’s diseases (Blackwell, 2001;Dubaniewicz et al., 2005). In humans, SLC11A1 is expressed in monocytes/macrophages and polymorphonuclear neutrophils
(Cellier et al., 1997;Roig et al., 2002). SLC11A1 gene expression is low or undetectable in normal and quiescent cells. These include transformed human cell lines from either erythroid or lymphoid T or B lineages, as well as the progenitors of the monocyte/macrophage lineage (KG1, U937, THP), the promyelocytic leukemia cell line HL‐60 and human monocytes (Cellier et al.,
1997;Xu et al., 2005). It can however be strongly induced in these cells differentiated toward either the macrophage or the granulocyte pathway. In this study, we found that ‐actin accumulation in nucleus is required for the PMA‐
112 induced SLC11A1 gene expression. To confirm the function of nuclear ‐actin on
PMA‐induced expression of the SLC11A1 gene, we either knocked‐down the expression of ‐actin or used the p38 MAPK inhibitor to block the nuclear accumulation of ‐actin. We found that SLC11A1 promoter‐driven luciferase activity was reduced significantly or was even completely inhibited. Furthermore, microinjection of specific ‐actin antibodies into nuclei could inhibit PMA‐ induced SLC11A1 mRNA expression. These results indicate that nuclear ‐actin is involved in the PMA‐induced transcriptional activation of the SLC11A1 gene.
To our knowledge, this study provides the first direct proof that translocation of ‐actin into the nucleus is associated with transcriptional regulation of gene expression such as SLC11A1 gene during macrophage differentiation. The study of nuclear translocation of β‐actin is likely to contribute to better understanding cellular gene expression in response to extracellular stimuli.
113 2.6 Acknowledgements
We are grateful to Maryse Thivierge for monocyte preparation, to Claude
Lachance for data processing and to Gabriella Wojewodka for a critical review of the manuscript. This work was supported by a Canadian Institute of Health
Research Grant FRN #36337 (DR), a National Sciences and Engineering Research
Council of Canada Grants 6844(DR), a Strategic Training Centre in Infectious
Diseases and Autoimmunity CIHR Grant (YZ) and a Canadian Institute of Health
Research Grant MOP #6822 (MR‐P).
114 2.7 Supplementary Materials
Supplementary Materials and Methods
Cell transfection and sorting
HL‐60 cells were transfected with pAcGFP1‐Actin vector (BD Biosciences‐
Clontech, Mountain View, CA) using the Cell Line NucleofectorTM kit V(Amaxa,
Gaithersburg, MD) according to manufacturer’s instructions. Briefly, 2106 log‐ growth cells were suspended in 100 l of Cell Line NucleofectorTM Solution V and mixed with 2.0 g of vector. Transfection was carried out using the program T‐
019. Transfected cells were cultured in RPMI 1640 medium containing 20% FBS for 24 hr, and a FACSAria sorter (BD Biosciences, San Jose, CA) was then used to quantitate and sort cells that expressed GFP‐‐actin fusion protein. The cell sorting was performed after obtaining the basal green fluorescence distribution at excitation and emission wavelengths of 488 and 520 nm, respectively. Of those cells expressing green fluorescence, only the brightest ~73% were sorted and collected. The sorted cells were cultured in RPMI 1640 complete medium supplemented with 0.8mg/ml G418.
Differentiation assay
Cell differentiation was assessed by the nitroblue tetrazolium (NBT) reduction assay as previously described and by flow cytometric analysis of CD11b
115 expression, a marker of myeloid differentiation. For NBT reduction assay, 2105 cells were washed twice with PBS and resuspended in 200 l of 2mg/ml NBT in
PBS containing 200ng/ml TPA. The cell suspension was incubated for 30 min at
37C with occasional vortexing. Cells were counted using a hemacytometer, and the percentage of cells with blue formazan deposits was determined. At least
200 cells were assessed for each experiment. CD11b expression was measured by flow cytometry using a FITC‐conjugated CD11b antibody. Briefly, a total of
1106 cells were harvested, washed twice with ice‐cold PBS containg 1% BSA and
0.1% sodium azide and re‐suspended in 50 l of PBS. 2 l of FITC‐conjugated anti‐CD11b (BD PharmingenTM) were added and incubated for 30 min on ice.
After incubation, the cells were washed 3 times with PBS and were fixed in 0.5 ml of 1% paraformaldehyde. Background staining was determined by staining the cells with FITC‐conjugated isotype control antibodies (BD PharmingenTM). Flow cytometry was performed by FACSCalibur with CELLQuest software (BD
Biosciences).
116
Figure S2.1 Effects of JNK, PI3‐K or p38 MAPK inhibitors on PMA‐induced differentiation of HL‐60 cells. HL‐60 cells were treated for 48 h with PMA
(10ng/ml) after preincubation with 20 M p38 inhibitor III, 5 M JNK inhibitor II,
1 M Wortmannin or DMSO (the vehicle for inhibitors) for 1h. (A) The cell differentiation was assessed by the NBT reduction assay. The results are presented as a percentage of differentiated cells with the mean S.E.M (n3).
*P<0.001, compared with (B) Flow cytometric analysis of CD11b expression, a marker of myeloid differentiation. As a control, cells were also analyzed by FITC‐ conjugated IgG isotype‐specific antibodies. (C) CD11B expression presented as geometry mean fluorescence intensity (MFI). The data is a representative of 3 independent experiments.
117
Figure S2.1
118 Table S2.1 PCR primers used for conventional ChIP
SLC11A1 Forward: 5’‐TGAAGACTCGCATTAGGCCAACGA‐3’ Reverse: 5’‐TGTGCCTCCCAAGTTAGCTCTGAT‐3’
CDKL4 Forward: 5’‐TAGGCTGCTTGTCGAATGAGAGAGGT‐3’ Reverse: 5’‐ ACGCTCTTTCTTCTCTCCACCAGGT‐3’
NCOA1 Forward: 5’‐TTGGAGCAATGTGGATGAACCTGG‐3’ Reverse: 5’‐TCCCAATACCTGCCTCCCGATTAT‐3’
ZNF638 Forward: 5’‐AACGTGCTAGGCGCGAATATAACC‐3’ Reverse: 5’‐AAGATTGCACCACTGCACTCCA‐3’
SLC4A3 Forward: 5’‐AGACAATGTGGGCGTCCAACAGAT‐3’ Reverse: 5’‐CCTGCAATAGGGGTGTTCCAAAGT‐3’
ANXA4 Forward: 5’‐AGACGAACGGTTTCCCGAGGT‐3 Reverse: 5’‐AGGGTGGGAGCAGTTGGATTCTT‐3’
TCF23 Forward: 5’‐AACACAGAGTGGAAATCGGAGGCA‐3’ Reverse: 5’‐ATGCCTAACCTCAACAGTGGTCCT‐3’
PLA2R1 Forward: 5’‐ TCAATCTTGCTCCCTGCTAGGCAT ‐3’ Reverse: 5’‐ TCCTTTGACTTGTGGAGCACTGGA ‐3’
ARHGAP15 Forward: 5’‐CGTATGAGAGCCACAGTCACAGCA‐3 Reverse: 5’‐TGGTGCCTCTGCCTCATTCATGAA‐3’
PEX13 Forward: 5’‐GAAGAATGGGAGAGTTTAGCCGTC‐3’ Reverse: 5’‐ACACAGAGACCAGTAGAGAGTAAGA ‐3’
INPP1 Forward: 5’‐ GTCAAGGCTGCAATGAGCTGTGTT ‐3’ Reverse: 5’‐ ACTTATGCTGTCAGTTCCAGGGCA ‐3’
SCG2 Forward: 5’‐ CATCTGATTCAACAGGAGAAGGGA ‐3’ Reverse: 5’‐ AAGGGAAGCTCAGAAGTTGAGTGC ‐3’
119 Table S2.2 Survey of inhibitors of signalling pathways: effects on nuclear translocation of ‐actin.
Treatment target tested dose effect on translocation
Ro 31‐8220 PKC 6 and 12M blocking
HA 1004 PKC 10 and 20M blocking
PD 098059 MEK1/2 10 and 20M blocking
U0126 ERK1/2 15 and 30M blocking
SB 203580 p38 MAPK 10 and 20M blocking p38 inhibitor III p38 MAPK 10 and 20M blocking
Wortmannin PI 3‐K 0.2 and1M no effect
JNK inhibitor II JNK 5 and 10M no effect
120 Table S2.4 Identified ‐actin targets involved in chromatin remodelling, transcription, RNA splicing and nucleocytoplasmic transport.
GeneBank accession no. Gene name and description
Chromatin remodelling
NM_016352 Carboxypeptidase A4 precursor (CPA4) NM_005189 Chromobox homolog 2 (Pc class homolog, Drosophila) (CBX2) NM_001002916 H2B histone family, member W, testis‐specific (H2BFWT) NM_002106 H2A histone family, member Z (H2AFZ) NM_003521 Histone 1, H2bm (HIST1H2BM) NM_022743 SET and MYND domain‐containing 3 (SMYD3) NM_020159 SWI/SNF‐related, matrix associated, actin‐dependent regulator of chromatin subfamily A containing DEAD/H box 1 (SMARCAD1) Transcription
NM_174886 TGFB‐induced factor (TALE family homeobox)
NM_006079 Cbp/p300‐interacting transactivator, with Glu/Asp‐rich
carboxy‐terminal domain, 2 (CITED2)
NM_005230 ELK3, ETS‐domain protein (SRF accessory protein 2) (ELK3)
NM_012384 Glucocorticoid modulatory element binding protein 2 (GMEB2)
NM_001030004 Hepatocyte nuclear factor 4, alpha (HNF4A)
NM_181054 Hypoxia‐inducible factor 1, alpha subunit (basic helix‐loop‐helix
transcription factor) (HIF1A)
NM_130800 Multiple endocrine neoplasia I (MEN1)
NM_006190 Origin recognition complex, subunit 2‐like (yeast) (ORC2L)
NM_173516 Poly (A)‐specific ribonuclease (PARN)‐like domain containing 1 (PNLDC1)
121 Table S2.4 (continued)
NM_002955 RAS‐responsive element binding protein 1 (RREB‐1)
NM_002938 Ring finger protein 4 (RNF4)
NM_001031695 RNA‐binding motif protein 9 (RBM9)
NM_022739 SMAD specific E3 ubiquitin protein ligase 2 (SMURF2)
NM_006662 Snf2‐related CBP activator protein (SRCAP)
NM_004599 Sterol regulatory element binding transcription factor 2 (SREBF2)
NM_007114 TATA element modulatory factor 1 (TMF1)
NM_003250 Thyroid hormone receptor alpha (C‐erbA‐alpha) (THRA)
NM_003216 Thyrotroph embryonic factor (TEF)
NM_006879 Mdm2, transformed 3T3 cell double minute 2, p53 binding
protein (mouse) (MDM2)
RNA splicing
NM_007007 cleavage and polyadenylation specific factor 6, 68kDa (CPSF6) NM_030627 cytoplasmic polyadenylation element binding protein 4 (CPEB4) NM_006372 Synaptotagmin binding, cytoplasmic RNA interacting protein (SYNCRIP) NM_173848 Hypothetical protein LOC138046 (LOC138046)
NM_004792 Peptidylprolyl isomerase G (cyclophilin G) (PPIG)
NM_033527 Cell division cycle 2‐like 1 (PITSLRE proteins) (CDC2L1)
NM_016196 RNA‐binding motif protein 19 (RBM19)
NM_021239 RNA‐binding motif protein 25 (RBM25)
NM_003587 DEAH (Asp‐Glu‐Ala‐His) box polypeptide 16 (DHX16)
NM_005156 ROD1 regulator of differentiation 1 (S. pombe) (ROD1)
NM_005066 Splicing factor proline/glutamine‐rich (polypyrimidine tract
binding protein associated) (SFPQ)
122 Table S2.4 (continued)
NM_020449 THO complex 2 (THOC2)
NM_180703 U11/U12 snRNP 35K (U1SNRNPBP)
NM_032881 LSM10, U7 small nuclear RNA associated (LSM10)
NM_001014972 Zinc finger protein 638 (ZNF638) nucleocytoplasmic transport
NM_020449 THO complex 2 (THOC2)
NM_002266 Karyopherin alpha 2 (RAG cohort 1, importin alpha 1) (KPNA2)
NM_033297 NACHT, leucine rich repeat and PYD containing 12
NM_015934 Nucleolar protein NOP5/NOP58 (NOP5/NOP58)
123 CHAPTER 3
Recruitment of SWI/SNF Complex is Required for Transcriptional
Activation of SLC11A1 Gene during Macrophage
Differentiation of HL‐60 Cells
Xu Y. Z., Thuraisingam T., Marino R., and Radzioch D. (2011) Recruitment of
SWI/SNF Complex is Required for Transcriptional Activation of SLC11A1 Gene during Macrophage Differentiation of HL‐60 Cells. J. Biol. Chem. 286, 12839‐
12849
124 3.1 Abstract
The solute carrier family 11 member 1 (SLC11A1) gene is strictly regulated and exclusively expressed in myeloid lineage cells. However, little is known about the transcriptional regulation of the SLC11A1 gene during myeloid development. In the current study, we used HL‐60 cells as a model to investigate the regulatory elements/factors involved in the transactivation of the SLC11A1 gene during phorbol 12‐myristate 13‐acetate (PMA)–induced macrophage differentiation of
HL‐60 cells. Promoter deletion analysis showed that a seven‐base AP‐1‐like element (TGACTCT) is critical for the SLC11A1 promoter’s responsiveness to PMA.
Stimulation by PMA induces the binding of ATF‐3 and the recruitment of two components of the SWI/SNF complex, BRG1 and β‐actin, to this element in an
ATF‐3‐dependant manner. RNAi‐mediated depletion of ATF‐3 or BRG1 markedly decreases SLC11A1 gene expression and its promoter activity induced by PMA.
Luciferase reporter experiments demonstrated that ATF‐3 cooperates with BRG1 and β‐actin to activate the SLC11A1 promoter. Furthermore, we showed that
PMA can induce the proximal (GT/AC)n repeat sequence to convert to Z‐DNA structure in the SLC11A1 gene promoter, and depletion of BRG1 results in a significant decrease of Z‐DNA formation. Our results demonstrate that recruitment of the SWI/SNF complex initiates Z‐DNA formation and subsequently helps to transactivate the SLC11A1 gene.
125 3.2 Introduction
In humans, the SLC11A1 gene is located on chromosome 2q35 and has 15 exons spanning about 14 kb (Cellier et al., 1994;Marquet et al., 2000). The gene encodes a transmembrane protein exclusively expressed in the myeloid lineage: monocytes, macrophages, polymorphonuclear neutrophils and dendritic cells
(Cellier et al., 1997;Stober et al., 2007). The SLC11A1 gene expression is strictly regulated during myeloid development and SLC11A1 protein expression parallels with its mRNA level (Cellier et al., 1997), suggesting that SLC11A1 expression is controlled primarily at the level of transcription. The human promyelocytic leukemia cell line HL‐60 has been shown to be a useful model to study the regulation of SLC11A1 gene expression. SLC11A1 gene expression is undetectable in HL‐60 cells; however, it can be strongly induced both at mRNA and protein levels in these cells when differentiated towards either the monocyte/ macrophage pathway or the granulocyte pathway (Cellier et al., 1997;Xu et al.,
2005). Previous studies have shown that PMA induces the transcriptional activation of the SLC11A1 gene, and its mRNA stability is mediated by HuR‐AU‐ rich element interaction in HL‐60 cells (Xu et al., 2005). However, the molecular mechanism of transcriptional activation of the SLC11A1 gene during the macrophage‐like differentiation remains largely unknown. Identification of the specific determinants controlling SLC11A1 gene expression in response to PMA treatment demonstrated in this study sheds light on the regulatory cis‐acting elements and trans‐acting factors involved during myeloid differentiation and
126 immune responses. This will further improve our understanding of the possible influence of SLC11A1 promoter gene polymorphisms in human susceptibility to diseases.
Chromatin remodeling is involved in the regulation of gene transcription, including pre‐initiation complex formation, transcriptional initiation, and elongation (Agalioti et al., 2000;Corey et al., 2003;Debril et al., 2004;Fry and
Peterson, 2002;Soutoglou and Talianidis, 2002). Currently, several ATP‐ dependent chromatin remodeling complexes have been characterized by the identity of their central catalytic subunit, including the SWI/SNF complex (Ko et al., 2008). The SWI/SNF chromatin remodeling complex can alter chromatin structure by either shifting nucleosomes along the DNA or twisting DNA to modulate the nucleosome structure in an ATP‐dependent manner (Sudarsanam and Winston, 2000), thereby yielding a permissive or non‐permissive state. In yeasts, SWI/SNF complexes regulate hundreds of genes involved in a wide variety of cellular functions through strictly controlled targeting mechanisms
(Peterson and Workman, 2000;Sudarsanam et al., 2000) and can both promote and suppress gene expression (Liu et al., 2001;Zhang et al., 2007). There is a growing body of evidence demonstrating the roles of the SWI/SNF complex in cell differentiation (de la Serna et al., 2001a;Gresh et al., 2005;Juliandi et al.,
2010), proliferation (Cohet et al., 2010;Hah et al., 2010;Nagl, Jr. et al., 2007), neural development (Yoo and Crabtree, 2009), hematopoietic development
(Bakshi et al., 2010;Bultman et al., 2005;Vradii et al., 2006), as well as in
127 malignant processes (Reisman et al., 2009;Wilson and Roberts, 2011). The human SWI/SNF complex includes a heterogeneous mixture of proteins, where most purified complexes contain BRG1 (or hBRM) as the central ATPase subunit, as well as BRG1 (or hBRM)‐associated factors (BAFs) such as BAF47/INI1 and actin (Wang et al., 1996;Zhao et al., 1998). Biochemical analysis demonstrates that β‐actin is directly bound to BRG1 in the SWI/SNF complex. The association of β‐actin with BRG1 is so tight that it is impossible to break this interaction without denaturing BRG1 (Zhao et al., 1998). To date, all studies have shown that
SWI/SNF complexes are recruited to target genes via association with transcription factors such as c‐Myc (Cheng et al., 1999) and C/EBPβ (Villagra et al., 2006), or nuclear receptors (Debril et al., 2004) such as glucocorticoid receptor (Fryer and Archer, 1998;Hsiao et al., 2003) and estrogen receptor
(Belandia et al., 2002;Garcia‐Pedrero et al., 2006).
PMA‐induced chromatin remodeling is critical for the transcriptional regulation of MMP‐9 gene transcription. Upon PMA stimulation, transcription factors, the SWI/SNF chromatin‐remodeling complex and the coactivators
CBP/p300, as well as coactivator ‐associated arginine methyltransferase I, are recruited to the MMP‐9 promoter in a stepwise manner. This ordered recruitment results in a relaxed or “open” chromatin structure and allows for the binding of RNA polymerase II to the promoter to initiate transcription (Ma et al.,
2004). Transcriptional activation of the HIV‐1 promoter in human cells in response to PMA involves the recruitment of the SWI/SNF chromatin remodeling
128 complex (Henderson et al., 2004) and cellular proteins with histone acetyltransferase activity (Lusic et al., 2003). In the previous chapter, we demonstrated that during PMA‐induced differentiation of HL‐60 cells towards macrophages, nuclear ‐actin and RNA polymerase II are recruited to the
SLC11A1 promoter and are involved in the transcriptional activation of the
SLC11A1 gene. However, the mechanism by which ‐actin contributes to transcriptional activation of the SLC11A1 gene remains unknown. β‐actin is a component of SWI/SNF complex and has been shown to be involved in chromatin remodeling, suggesting a possible functional relationship between the
β‐actin‐ containing SWI/SNF complex and chromatin remodeling in the transcriptional activation of the SLC11A1 gene during the differentiation of HL‐60 cells towards macrophages.
In the current study, to understand how the SLC11A1 gene is transactivated in response to PMA treatment, we used promoter deletion analysis to define a seven‐base AP‐1‐like element in the SLC11A1 promoter which is critical for responsiveness to PMA. We found that the SWI/SNF complex is recruited to this element via interaction with transcriptional factor ATF‐3, and is required for
PMA–induced activation of human SLC11A1 gene transcription. The SLC11A1 gene promoter contains a (GT/AC)n repeat sequence that favors left‐handed Z‐
DNA formation. Our results also demonstrate that PMA can induce the Z‐DNA formation in the SLC11A1 gene promoter, and that BRG1 is essential during this
129 process. Our results suggest that recruitment of the SWI/SNF complex initiates Z‐
DNA formation and subsequently helps to transactivate the SLC11A1 gene.
3.3 Materials and Methods
Cells and cell culture
HL‐60 cells were purchased from the American Type Culture Collection, and maintained in RPMI 1640 medium supplemented with 10% FBS, 2 mM L‐
Glutamine and 1% penicillin/streptomycin at 37C in a 5% CO2 incubator.
Plasmid constructs pREP4‐luc was constructed as described previously (Liu et al., 2001). For construction of SLC11A1 promoter ‐1625Luc, human genomic DNA (Roche, Laval,
QC) was first amplified by PCR using the primers: 5’‐ACTCTGTCACCAAAGCTGAA
GTGC‐3’ and 5’‐TCTTGTTCCTCAAGTCTCC ACCA‐3’. The PCR product was then amplified again using a forward primer 5’‐GAGCTAGCATGTTAAC CAGGATGGTCT
CG ‐3’, bearing a NheI restriction site (underlined) and a reverse primer 5’‐
CAAAGCTTAGTGCCCTGCCTCTTACAT CA‐3’ bearing a HindIII restriction site
(underlined). The final PCR product (spanning nucleotides ‐1625 to +19 of the
SLC11A1 promoter, numbers relative to the major transcription start site) was gel‐ purified and inserted into the NheI‐HindIII sites of the pREP4‐luc. The
130 construct was sequenced to ensure accurate replication and used as a template for several other constructs: ‐938Luc, ‐550Luc, ‐395Luc, ‐264Luc and ‐161Luc using a constant reverse primer as the same as above bearing the HindIII restriction site and the following forward primers, respectively: 5’‐GAGCTAGC A
GAGCAAGACGCCATCTCA‐3’; 5’‐GAGCTAGCATGATCTGGTGACAAT CTCAAGTG‐3’;
5’‐GAGCTAGCAGGACATGAAGACTCGCATTAGG‐3’; 5’‐GAGCTAGCT GTGGTCATGG
GGTATTGAC‐3’; 5’‐GAGCTAGCATGTGTTGTGGGGCACAG‐3’. The two deletion mutants [‐550(AP‐1)Luc and ‐395(AP‐1)Luc], lacking the AP‐1‐like element
TGACTCT, were constructed using QuickChange II XL site‐directed mutagenesis kit. Primers used for deletion were 5’‐AAAGAGA ATAAGAAAGACCGTGTGTGTGTA
CGTGTGTG‐3’ and 5’‐CACACACGTACACACACACG GTCTTTCTTATTCTCTTT‐3’. To create a pCG‐β‐actin expression plasmid, human β‐actin was amplified by PCR using a pAcGFP1‐Actin vector (BD Biosciences‐Clontech, Mountain View, CA) as a template, and subcloned into XbaI/BamHI sites of the pCG plasmid. Plasmid pCG‐
ATF‐3 was generously provided by Dr. Hai T. (Ohio state university, Columbus,
OH). Two expression plasmids encoding human BRG1 (pBJ5 BRG1) and the
ATPase‐defective variant of BRG1 (pBJ5 BRG1 DN, K798R mutant) were obtained from AddGene (Cambridge, MA, USA).
Expression and purification of ZaaFOK
131 The fusion protein His‐ZaaFOK was expressed and purified as previously described (Liu and Zhao, 2004). Briefly, Escherichia coli BL21 were transformed with the plasmid pET‐His‐ZaaFOK (kindly provided by Dr. Zhao K., Laboratory of
Molecular Immunology, NIH, Bethesda, MD), grown in LB medium (containing 60
g/ml ampicillin) until OD595 0.45, and then induced with 1 mM IPTG (final concentration) for 3 hrs. After induction, cell pellets were washed with and then resuspended in lysis buffer (0.3M NaCl, 0.1mM EDTA and 0.5% NP‐40 in 1×PBS).
Following sonication, the lysate was centrifuged and the supernatant was incubated with Ni‐NTA agarose beads (Amersham Biosciences, Baie d’Urfé, QC) for 30 min at 4C. The beads were washed with wash buffer (lysis buffer plus 15 mM imidazole) three times, and the recombinant proteins were then eluted from the beads with elution buffer (20 mM Tris, pH8.0, 10% Glycerol, 0.4 M imidazole, 1mM EDTA, 0.1 M NaCl and 0.1% NP‐40). A protease inhibitor cocktail was added to the lysis buffer and elution buffer (Roche, Laval, QC) just before use.
Western blot analysis
After appropriate treatments, cells were collected and total cellular extracts or nuclear fractions were prepared. Western blot analysis was then performed as described previously (Xu et al., 2005). A mouse monoclonal antibody against β‐ actin and a rabbit polyclonal antibody against Brm were purchased from Sigma
132 (Saint Louis, MO) and Abcam (Cambridge, MA), respectively. Rabbit polyclonal antibodies against BRG1 (sc10768×), ATF‐3 (sc188×), c‐fos (sc‐253x), c‐jun (sc‐
1694x), Jun B (sc‐8051x) and Jun D (sc‐74x) were purchased from Santa Cruz
Biotechnology (Santa Cruz, CA).
DNA affinity pull‐down assays
DNA affinity pull‐down assays were performed as described previously
(Henderson et al., 2004). Two hundred micrograms of Dynabeads M280 streptavidin (Dynal; Invitrogen) was prepared, concentrated and resuspended in
20 l of buffer T (10mM Tris[pH 7.5], 1 mM EDTA, 1 M NaCl), which included 10 pmol of biotinylated AP‐1 Wt or AP‐1 mutant probe (Figure 3.2A). The mixture was gently agitated for 1 hr at room temperature (RT), and the beads were then washed 4 times in buffer T to remove unbound probes. Bead‐coupled probes were equilibrated in buffer R (10 mM Tris [pH 7.5], 1mM MgCl2, 0.1% NP‐40,
1mM EDTA, 10 mM DTT, 5% glycerol, 60 mM KCl, 12 mM HEPES [pH 7.9], 0.03%
BSA) for 30min, centrifuged and resuspended in buffer R containing 200 g of nuclear extract and 40 ng/l of poly (dG‐dC) (120 l final volume), and agitated for 30 min at RT. Following the binding reaction, the beads were washed three times using buffer R containing 10 ng/l of poly (dG‐dC). The bound proteins were eluted by boiling them in SDS sample buffer and the presence of AP‐1
133 family transcription factors, BRG1 and ‐actin was detected by Western blot analysis.
Chromatin Immunoprecipitation (ChIP) assay, Re‐ChIP and ChIP‐qPCR
The ChIP assay was performed using a chromatin immunoprecipitation assay kit
(Upstate, Lake Placid, NY) according to the manufacturer’s instructions. Briefly, cells were fixed, lysed and sonicated to yield short DNA fragments. The
DNA/protein complexes were immunoprecipitated with either non‐specific IgG or the indicated specific antibodies. Immunoprecipitates were washed and eluted, and the cross‐links were reversed. The precipitated DNA fragments were purified. The 5’‐promoter region spanning the AP‐1 like‐element (nucleotide position ‐389 to ‐190) were amplified by PCR using a pair of primers: 5’‐TGAAGA
CTCGCATTAGGCCAACGA‐3’, and 5’‐ TGTGCCTCCCAAGTTAGCTCTGAT ‐3’. For Re‐
ChIP assays, after immunoprecipitation with the first antibody, the primary immunocomplex was eluted by 10 mM dithiothreitol with agitation at 37C for
30 min. The eluate was diluted 50 times with buffer (20mM Tris‐HCl, pH 8.1, 150 mM NaCl, 2Mm EDTA, and 1% Triton X‐100) and was immunoprecipitated using the second antibodies. For ChIP‐qPCR assays, the precipitated DNA fragments were purified, and quantified with the Quant‐iTTM dsDNA Assay Kit (Molecular
Probes, Eugene, Oregon). They were then amplified by real‐time qPCR using the same primers as for regular ChIP.
134
Quantitative real‐time PCR
Total RNA was extracted from cells using TRIzol Reagent (Invitrogen, Burlington,
ON, Canada) according to the manufacturer’s instructions. One µg of total RNA was reverse‐transcribed with the QuantiTect reverse transcription kit (Qiagen,
Mississauga, ON, Canada). An equal amount of cDNAs or purified DNA fragments from ChIP was then amplified by real‐time PCR using the Stratagene Mx‐4000 and the BrilliantSYBR Green QPCR Master Mix. Gene expression was normalized to a house‐keeping gene (GAPDH) and the relative expression values between the samples were calculated based on the threshold cycle (CT) value using the 2‐CT method (Livak and Schmittgen, 2001). The following forward and reverse SLC11A1‐specific primers were used for cDNA amplification: 5’‐AGCGGA
CATCAGAGAAG CCAACAT‐3’ and 5’‐CTGCCCAAA GACAGC CATGACAAA‐3’, respectively.
Small RNA interference experiment
HL‐60 cells were transiently transfected with control, ATF‐3 or BRG1 siRNA using the Cell Line NucleofectorTM kit V (Amaxa, Gaithersburg, MD) according to the manufacturer’s instructions. Briefly, 2106 log‐growth cells were suspended in
100 l of Cell Line NucleofectorTM Solution V and mixed with 100 pmol of control
135 siRNA, ATF‐3 siRNA or BRG1siRNA (1µM at final concentration). The siRNA duplexes used in the experiment are as follows: the previously described siATF‐3
(Averous et al., 2004), 5’‐GCACCUCUGCCACCGGAUGdTdT‐3’ and 5’‐CAUCCGGUG
GCAGAGGUGCdTdT‐3’ (synthesized by Dharmacon, Lafayette, CO); the siRNAs against BRG1 and control siRNA were purchased from Santa Cruz Biotechnology,
Inc. (Santa Cruz, CA). Transfection was performed with a NucleofectorTM II device using the program T‐019. Transfected cells were cultured for 6 hrs at 37 C in 5%
CO2, and were then further treated with PMA (10 ng/ml) for 48 hrs or left untreated before cell harvest.
Immunoprecipitation assays
The immunoprecipitation assays were prepared as described previously (Lal et al.,
2005). For IP, protein A‐Sepharose beads (Sigma) were coated with the appropriate antibodies against ATF‐3 (Santa Cruz), BRG1 (Santa Cruz) or nonspecific IgG as a control. Antibody‐coated beads were then added to a mixture of 100l (200g) nuclear lysate and 400 l NT2 buffer (50mM Tris‐
HCl[pH7.4], 150mM NaCl, 1mM MgCl2, and 0.05% NP‐40), and the mixture was rotated gently at 4C for 2 hrs. After washing four times with NT2 buffer, the precipitated proteins were eluted by adding 100 l 2SDS sample buffer and heating at 95C for 10 min. Samples were resolved on a 4‐12% Bis‐Tris gel
(Invitrogen, Burlington, ON) and electrophoretically transferred to PVDF
136 membranes (Millipore, Bedford, MA). The blots were blocked with 5% milk in
TBS‐T (Tris‐buffered saline/0.1% Tween 20) for 2 hrs and were then incubated with primary antibodies recognizing ATF‐3 or BRG1 for 1 hr (both at RT). After washing 5 times with TBS‐T (5 min. each), blots were incubated with a 1:5000 dilution of Protein A‐HRP (Amersham) for another 1 hr at RT. The blots were washed the same way as above and developed with ECL detection reagents
(Amersham).
Luciferase activity
To detect the effect of knockdown of ATF‐3 or BRG1 on the transcriptional activity, the HL‐60 cells were co‐transfected with luciferase reporter constructs and control, ATF‐3 or BRG1 siRNA. To detect the overexpression of ATF‐3, BRG1 or β‐actin on the transcriptional activity, plasmids expressing BRG1, BRG1DN mutant, ATF‐3 or their different combinations, as well as luciferase reporter constructs, were co‐transfected into HL‐60 cells. Transfections were performed using the Cell Line NucleofectorTM kit V (Amaxa, Gaithersburg, MD) according to the manufacturer’s instructions. As needed, empty plasmids pCG and pBJ5 were added to adjust the total amount of transfected DNA. Six hrs after transfection, cells were treated with PMA (10 ng/ml) for 48 hrs or left untreated; following this the cells were harvested. Luciferase reporter assays were performed using the Dual‐Luciferase Reporter Assay System (Promega, Madison, WI) and the
137 luminescence was measured with a Turner Designs model TD‐20/20 luminometer. Firefly luciferase activity was normalized to Renilla luciferase activity.
Detection of Z‐DNA structure
Detection of Z‐DNA structure was performed as described previously (Liu et al.,
2006b;Liu and Zhao, 2004). HL‐60 cells were transfected with empty vector pREP4‐Luc, reporter construct ‐395 Luc or siRNA specific to BRG1. Six hrs after transfection, transfected or untransfected HL‐60 cells were treated with PMA for
48 hrs and the cells were then cross‐linked with 1% formaldehyde for 15 minutes.
Following cross‐linking, the cells were washed once with 1M glycine and once with 1×PBS, and then permeabilized with 0.5% Triton‐X 100 in 1×PBS for 3 minutes. The cells were digested with 5ng/µl ZaaKOF in 100 µl of 1 × NEB4 buffer
(20 mM Tris‐acetate [pH 7.0], 10mM magnesium acetate, 50 mM potassium acetate and 1 mM DTT) for 30 min at 37C. The digestion was stopped by the addition of 100 µl of 1mg/ml proteinase K and 1% SDS in TE buffer, and was maintained at 55C for 2 hrs. After reverse cross‐linking at 65C for 6 hrs, the
DNA was purified, digested completely with NcoI and analyzed by linker ligation‐ mediated PCR (LM‐PCR). Primers used in LM‐PCR are as follows: universal linker primers (WL1: 5’‐GCGGTGACCCGGGAGATCTGAATTC‐3’ and WL2: 5’‐GAATTCAG
ATC‐3’), and primers specific to the luciferase cDNA in the reporter construct
138 (reverse PCR primer: 5’‐TATGCAGTTGCTCTCCAGCGG‐3’ and reverse labeling primer: 5’‐GGTTCCATCTTCCAGCGGATAGA A‐3’) or to the endogenous SLC11A1 promoter (forward PCR primer:5’‐CATGATCTGGTGACAATCTCAAGTG‐3’ and forward labeling primer: 5’‐CATGTCCCTTCTGCAGTGCCT‐ 3’).
Statistical analysis
All data are presented as means ± standard errors (SE) of three or four experiments. Analysis was performed using unpaired student’s t test. P0.05 was considered significant.
3.4 Results
Identification of the PMA responsive element
We have previously demonstrated that PMA can activate the human SLC11A1 gene transcription (Xu et al., 2005). To identify the cis‐acting elements responsive to PMA stimulation, we generated a series of deletion constructs
(Figure 3.1A) and evaluated them in transient transfection assays. The luciferase reporters ‐1625Luc, ‐938Luc, ‐550Luc, ‐395Luc, ‐264Luc and ‐161Luc represent their 5’‐ends corresponding to nucleotide position ‐1625, ‐938, ‐550, ‐395, ‐264
139
Figure 3.1 The AP‐1‐like element is required for SLC11A1 transcriptional activation by PMA. (A) Schematic representation of the SLC11A1 reporter constructs. The AP‐1‐like element (also known as ATF‐3 binding site) is shown. (B)
HL‐60 cells were transfected with the indicated SLC11A1 promoter‐reporter constructs. Six hours after transfection, cells were incubated in the presence or absence of 10 ng/ml PMA for 48 hrs before harvesting and were analysed for luciferase activity. The data shown (mean S.E.) are the averages of at least three independent experiments performed in triplicate. Compared with corresponding wild‐type promoter, *P<0.001
140
Figure 3.1
141 and ‐161 from the transcription start site, respectively. As shown in Figure 3.1B,
PMA stimulated luciferase activity driven by the SLC11A1 gene promoter. The promoter activities of ‐1625Luc, ‐938Luc, ‐550Luc and ‐395Luc were markedly increased following PMA treatment, whereas ‐264Luc and ‐161 Luc were not affected, indicating that the sequence between nucleotide ‐395 and ‐264 is required for PMA response. Inspection of the sequence between nucleotides ‐
395 to ‐264 revealed the presence of an AP‐1‐like element (TGACTCT). To test if the AP‐1‐like element is necessary for induction of SLC11A1 gene promoter activity in response to PMA, this element was deleted in the luciferase reporters
‐550 Luc and ‐395 Luc. As shown in Figure 3.1B, in PMA‐treated HL‐60 cells, the luciferase activity driven by these two mutant reporter constructs was significantly lower than the activity driven by the corresponding wild‐type reporters, revealing that the 7‐base element is essential for induction of luciferase activity by PMA. Our results demonstrate that the AP‐1‐like element within the proximal region of the SLC11A1 gene promoter is necessary for PMA‐ induced transcriptional activation of this gene.
Binding of ATF‐3/Jun B to the AP‐1‐like element is inducible by PMA
The AP‐1‐like element is also known as ATF‐3 binding site, which has been shown to be bound by ATF and AP‐1 transcription factor families. To identify the proteins that interact with the AP‐1‐like element, DNA affinity pull‐down assays
142 were performed using antibodies against ATF‐3 and members of the AP‐1 transcription factor family, such as c‐Jun and Jun B, as indicated. The wild‐type and mutant probes used in this assay are shown in Figure 3.2A. Western blot analysis (Figure 3.2B, left panel) clearly showed that ATF‐3, c‐fos, c‐Jun, Jun B and
Jun D are all present in the nuclear extract, of which ATF‐3, c‐Jun and Jun B expression is PMA inducible. As shown in Figure 3.2B (middle panel), c‐fos, c‐Jun, and Jun D show little or no affinity for the AP‐1‐like element, irrespective of PMA treatment. Interestingly, binding of ATF‐3 and Jun B to this element increased in response to PMA treatment. None of these transcription factors is bound to the mutant probe. In order to know if ATF‐3 and Jun B are associated with the AP‐1‐ like element within the promoter of the SLC11A1 gene in living cells, we performed ChIP assays using antibodies to ATF‐3 and Jun B. An antibody against
Jun D or nonspecific rabbit IgG was used as a control. A pair of primers spanning a 200‐bp DNA fragment (‐389/‐190) of the proximal region encompassing the AP‐
1‐like element was used for PCR. As shown in Figure 3.2C (left panel), binding of
ATF3 and Jun B to the region spanning the AP‐1‐like element was obviously increased in response to PMA treatment in living cells. However, neither ATF‐3 nor Jun B was associated with the far upstream region of the SLC11A1 gene promoter in living cells (Figure 3.2C, right panel). The results demonstrate that binding of ATF‐3/Jun B to the AP‐1‐like element at SLC11A1 promoter is PMA‐ inducible.
143 Figure 3.2 PMA induces the binding of ATF‐3/Jun B to the AP‐1 like element.
(A) Nucleotide sequences of the two probes (AP‐1 Wt and AP‐1 mutant) used for isolation of the proteins that bind to the AP‐1‐like element. (B) HL‐60 cells were left untreated or treated with 10 ng/ml PMA for 24 and 48 hrs, and nuclear extracts (NE) were then prepared. Proteins that bind to the AP‐1‐like element at each time point were isolated from the nuclear extracts using the DNA affinity pull‐down assay. They were then subjected to Western blot analysis with antibodies raised against different AP‐1/ATF family members. Unpurified total nuclear extracts were also subjected to Western blot analysis and probed with the same antibodies. (C) HL‐60 cells were grown in the presence or absence of
PMA for 24 and 48 hrs. Cells were then cross‐linked and subjected to sonication, and the chromatin fragments were immunoprecipitated (ChIP) with the antibodies against ATF‐3, Jun B or nonspecific rabbit IgG (rIgG) as a control.
Immunoprecipitated DNA and input genomic DNA were amplified using primers targeting the core region (‐389/‐190, left panel) or the far upstream region (‐
3260/‐3083, right panel) of the SLC11A1 promoter. PCR products were analyzed using 2.0 % agarose gels and stained with ethidium bromide.
144
Figure 3.2
145 BRG1 and ‐actin are recruited to the AP‐1‐like element in response to PMA
Given that ATF3 can recruit BRG1 to a gene promoter (e.g. human immunodificiency virus type 1 promoter) (Henderson et al., 2004) and that ‐ actin is involved in the transactivation of the SLC11A1 gene in response to PMA
(Chapter 2), we wanted to investigate whether the two components of SWI/SNF complex, β‐actin and BRG1, are recruited to the AP‐1‐ like element during the differentiation of HL‐60 cells towards macrophages. HL‐60 cells were treated with PMA (10ng/ml) for 24 and 48 hrs, and DNA affinity pull‐down assays were performed using anti‐BRG1 or anti‐‐actin antibodies. As shown in Figure 3.3A, the recruitment of BRG1 and ‐actin to the wild‐type probe was markedly enhanced in response to PMA; however, neither BRG1 nor ‐actin binds to the mutant probe even in response to PMA treatment. The negative control, Jun D, was not associated with either wild‐type or mutant probes. To investigate whether BRG1 and ‐actin are associated with the proximal region of the
SLC11A1 gene in living cells, we performed ChIP assays using antibodies to BRG1,
‐actin or nonspecific IgG as a control. As shown in Figure 3.3B, both the antibodies recognizing BRG1 and ‐actin precipitated the same promoter fragment as ATF‐3 and Jun B antibodies did (Figure 3.2C), while the nonspecific rabbit or mouse IgG failed to do so. Our results suggest that ‐actin and BRG1 may be recruited to the AP‐1‐ like element via their interaction with transcription factor ATF‐3.
146
Figure 3.3 BRG1 and β‐actin are recruited to the AP‐1‐like site in response to
PMA. (A) Nuclear extracts were prepared from untreated HL‐60 cells or cells treated with 10 ng/ml PMA for 24 and 48 hrs. Proteins that bind to the wild type
(middle panel) or mutant (right panel) AP‐1‐like binding site were isolated from the nuclear extracts by using the DNA affinity pull‐down assay, and resolved on a
4‐12% Bis‐Tris gel. The presence of BRG1 and β‐actin was detected by Western blot analysis. Jun D was used as a negative control. The expression of BRG1 and
β‐actin in total nuclear extracts was also detected (left panel). (B) ChIP assay was performed as described in Figure 3.2C, except that BRG1 and ‐actin antibodies were used for immunoprecipitation. Nonspecific rabbit IgG (rIgG) and mouse IgG
(mIgG) were used as controls.
147
Figure 3.3
148 BRG1 and ‐actin are recruited to the AP‐1‐like element of the SLC11A1 gene promoter in an ATF‐3‐dependent manner
To determine whether ATF‐3 actively recruits BRG1 and ‐actin to the AP‐1‐like element, we transfected ATF‐3 specific siRNA or control siRNA into HL‐60 cells and treated the cells with PMA for 48 hrs. The effect of ATF‐3 knockdown on the binding of BRG1 and ‐actin to the AP‐1‐like element of the SLC11A1 gene promoter was then analyzed by using a DNA affinity pull‐down assay. As shown in Figure 3.4A, transfection of specific ATF‐3 siRNAs into HL‐60 cells led to a substantial down‐regulation of ATF‐3 protein levels (approximately 63% decrease), without any effects on BRG1 and ‐actin protein expression. The protein expression of Braham (Brm), an alternative ATPase subunit of the
SWI/SNF complex, was also analyzed and its expression level was not affected by
ATF‐3 knockdown. Transfection using a control siRNA had no effect on either
ATF‐3, BRG1, ‐actin or Brm protein levels. Interestingly, binding of either BRG1 or ‐actin to the AP‐1‐ like element in the SLC11A1 gene promoter was significantly diminished when using nuclear extract from ATF‐3 siRNA‐ transfected cells (Figure 3.4B). The Brm did not bind to the AP‐1‐like element, suggesting that BRG1 but not Brm is specifically recruited to this element (Figure
3.4B). To further test the role of ATF‐3 in mediating BRG1 and ‐actin to bind to the SLC11A1 promoter in living cells, a ChIP‐qPCR assay was performed using HL‐
60 cells transfected with ATF‐3 siRNA. As shown in Figure 3.4C, transfection with
ATF‐3 siRNA significantly decreased the amount of
149 Figure 3.4 ATF‐3 mediates the recruitment of BRG1 and β‐actin to the SLC11A1 promoter. HL‐60 cells were transfected alone with Mock (transfection reagent only), control siRNA (CTR) or siRNA specific for ATF‐3. Six hrs after transfection,
HL‐60 cells were treated with PMA (10 ng/ml) for 48 hrs. (A) Total cell extracts were prepared from transfected HL‐60 cells and protein expression was analyzed by Western blotting using antibodies specific to ATF‐3, BRG1, β‐actin and Brm. (B)
Nuclear extracts were prepared and the binding of ATF‐3, BRG1, β‐actin and Brm to the AP‐1‐like element was analyzed by using the DNA affinity pull‐down assay together with Western blot analysis. The probe used in the assay is AP‐1 Wt. (C)
Cells were cross‐linked and sonicated and ChIP assay was performed as described in Figure 3B. The precipitated DNAs and input DNA were quantified and then amplified using real‐time qPCR. The occupancy level of BRG1 or ‐actin at the SLC11A1 promoter is represented as the ratio of signal from IP samples versus that of the input minus background of IgG control. The relative occupancy level of BRG1 or ‐actin in mock‐treated HL‐60 cells is set as 100%. Data presented as mean ± S.E. (n=3).
150
Figure 3.4
151 BRG1 (left panel) and ‐actin (right panel) bound to the SLC11A1 promoter.
These results suggest that the ATF‐3 transcription factor is essential for efficient binding of BRG1 and ‐actin to the AP‐1‐like element in the SLC11A1 promoter.
PMA induces complex formation and the binding of ATF‐3, BRG1 and ‐actin to the SLC11A1 gene promoter in HL‐60 cells
Since knockdown of ATF‐3 diminished BRG1 and ‐actin binding to the SLC11A1 gene promoter, we postulated that BRG1 and ‐actin are recruited to the
SLC11A1 promoter by forming a complex with ATF‐3. To test this hypothesis, we performed co‐immunoprecipitation experiments using nuclear extracts from HL‐
60 cells treated with PMA for 24 and 48 hrs, or which were left untreated. As shown in Figure 3.5A (upper panel), PMA induced the complex formation among
ATF‐3, BRG1 and ‐actin. The BRG1 and ‐actin were found in the complex with
ATF‐3 but not with the IgG control. The presence of ATF‐3, BRG1 and ‐actin in the nuclei was also detected by Western blot analysis. As shown in Figure 3.5A, bottom panel, the nuclear protein levels of ATF‐3 and ‐actin were significantly increased after 24 and 48 hrs of treatment with PMA while the protein level of
Brg‐1 did not change significantly. These co‐immuno‐ precipitation assays were repeated in a reciprocal fashion using an anti‐BRG1 antibody. Inducible association of ATF‐3, ‐actin and BRG1 was again detected by immunoblotting of these complexes with anti‐ATF‐3 or anti‐‐actin antibodies (Figure 3.5B). We
152 next determined by Re‐ChIP analyses whether BRG1 and ‐actin are associated with the ATF‐3‐containing SLC11A1 promoter fragment in living cells. Briefly, chromatin fragments from cross‐linked HL‐60 cells were first immunoprecipitated using antibodies against ATF‐3. The resulting immunocomplex was then eluted and subjected to immunoprecipitation using antibodies against BRG1 or ‐actin. PCR analysis was then used to determine whether the promoter fragment was present in the final precipitate. As shown in
Figure 3.5C, we found that the promoter fragment present in the first immunocomplex generated using anti‐ATF‐3 antibodies was pulled down again by either anti‐BRG1 or anti‐‐actin antibodies in PMA‐treated cells. These results indicate an association among ATF‐3, BRG1 and ‐actin at the proximal promoter region containing the AP‐1‐like element in differentiating HL‐60 cells.
ATF‐3 and BRG1 are required for PMA‐induced expression of the SLC11A1 gene
To further confirm the importance of ATF‐3 and BRG1 in SLC11A1 gene expression, we used RNA interference to knockdown endogenous ATF‐3 or BRG1.
As shown in Figure 3.6A, transfection of HL‐60 cells with specific ATF‐3 or BRG1 siRNAs led to a significant down‐regulation of ATF‐3 and BRG1 protein levels, respectively, with no effect on ‐tubulin expression. Transfection using a control siRNA had no effect on ATF‐3, BRG1 and ‐tubulin protein levels. As expected,
SLC11A1 gene expression was significantly
153 Figure 3.5 ATF‐3 forms a complex with BRG1 and β‐actin in response to PMA. (A)
Nuclear extracts prepared from HL‐60 cells left untreated or treated with PMA
(10 ng/ml) for 24 and 48 hrs were subjected to immunoprecipitation (IP) with an
ATF‐3 antibody or nonspecific rabbit IgG (rIgG) as a negative control. The bound proteins were eluted by boiling in SDS sample buffer, separated on a NuPAGE 4‐
12% Bis‐Tris gel and analyzed by Western blotting with antibodies against BRG1,
β‐actin and ATF‐3 (upper panel). Unimmunoprecipitated total nuclear extracts were also subjected to Western blot analysis using the same antibodies (bottom panel). (B) Co‐immunoprecipitation experiments and Western blot analyses were performed as in (A), except using BRG1 antibody for IP. The precipitated proteins were probed with antibodies against ATF‐3, β‐actin and BRG1. (C) ChIP was first carried out using the ATF‐3 antibody, and the immunocomplex was eluted using
10 mM dithiothretiol. The aliquots of the diluted elution were immunoprecipitated with antibodies against BRG1, β‐actin or non‐specific rIgG and mIgG used as negative controls. The precipitated DNA fragments were amplified by PCR using the primers specific to the SLC11A1 promoter region containing the AP‐1‐like element. The illustrated results are representative of three independent experiments.
154
Figure 3.5
155
Figure 3.6 RNA interference‐mediated depletion of BRG1 and ATF‐3 reduces
PMA‐induced SLC11A1 expression. SLC11A1 gene expression is inhibited in
BRG1 and ATF‐3 knockdown cells. HL‐60 cells were transfected with mock, siRNA control, siRNA specific for ATF‐3 (siATF‐3) or siRNA specific for BRG1 (siBRG1). Six hours after transfection, HL‐60 cells were left untreated or treated with PMA for
64 hrs. (A) Total cell extracts were prepared from PMA‐treated HL‐60 cells and
Western blot analysis was performed to detect the protein expression levels of
ATF‐3, BRG1, SLC11A1 and β‐tubulin. The expression of β‐tubulin is shown as a loading control (left panel). Protein expression was also quantified (right panel).
Results represent the mean ± S.E. for three independent experiments. Compared with corresponding protein level in mock‐treated cells,*P<0.01, **P<0.001. (B)
Total RNA was isolated from PMA‐treated HL‐60 cells using TRIzol reagent.
SLC11A1 mRNA levels were analyzed using real‐time RT‐QPCR. The relative
SLC11A1 mRNA level is represented as a percentage of the SLC11A1 mRNA level in mock‐treated HL‐60 cells. Data are expressed as mean S.E. of four independent experiments. Compared with the SLC11A1 mRNA level in mock‐ treated HL‐60 cells, *P<0.001. (C) Effects of ATF‐3 and BRG1 knockdown on the activation of the SLC11A1 promoter. The luciferase reporter vector pREP4‐
SLC11A1 (‐395)‐Luc (‐395Luc) was co‐transfected into HL‐60 cells respectively with mock, siRNA control, siRNA specific for ATF‐3 (siATF‐3) or siRNA specific for
BRG1 (siBRG1). The pRL‐CMV reporter was also transfected as an internal control.
156 Six hrs post‐transfection, transfected cells were cultured for 48 hrs with or without 10 ng/ml of PMA, and the luciferase activity was analyzed by the dual‐ luciferase reporter assay system. Relative luciferase activity is expressed as a fold of the luciferase activity of HL‐60 cells transfected with mock and treated with
PMA. The data shown (mean S.E.) are the averages of three independent experiments performed in triplicate. *P<0.001, when compared with the group of cells transfected with mock and treated with PMA. (D) The expression of
SLC11A1 protein induced by PMA treatment for different time period was detected by Western blot analysis and the molecular weight (MW) of SLC11A1 was shown.
157
Figure 3.6
158 inhibited in ATF‐3 or BRG1 knockdown cells. The levels of SLC11A1 protein and mRNA were reduced by 48% and 56%, respectively in ATF‐3 knockdown cells, while in BRG1 knockdown cells they were reduced by 57% and 64% (Figures 3.6A and 3.6B). To further study the influence of ATF‐3 and BRG1 on SLC11A1 promoter activity, we compared the SLC11A1 promoter‐driven luciferase activity between HL‐60 cells transfected with siRNA specific for ATF‐3 or BRG1 and those with control siRNA. As shown in Figure 3.6C, ATF‐3 or BRG1 knockdown had no significant effect on SLC11A1 promoter‐driven transactivation of luciferase activity in untreated HL‐60 cells; however, in PMA‐treated cells, ATF‐3 or BRG1 knockdown significantly decreased the luciferase activity driven by the SLC11A1 promoter. The molecular weight of SLC11A1 protein induced by PMA treatment in HL‐60 cells was shown in Figure 3.6D, demonstrating that SLC11A1 protein is modified (Glycosalation and/or phosphorylation) after translation. Our results demonstrate that ATF‐3 and BRG1 are required for PMA‐induced SLC11A1 gene transactivation.
ATF‐3 cooperates with the SWI/SNF complex to activate the SLC11A1 promoter
Since the recruitment of BRG1 and ‐actin to the SLC11A1 gene promoter is ATF‐
3 –dependent and PMA inducible (Figures 3.2 and 3.3), we investigated the cooperation between ATF‐3 and the SWI/SNF complex in transactivation of
SLC11A1 gene in response to PMA stimulation. The expression plasmids for BRG1,
159 a dominant negative mutant of BRG1, ATF‐3, or different combinations of these plasmids were transiently co‐transfected with luciferase reporter ‐395 Luc into
HL‐60 cells. As shown in Figure 3.7A, transfection of BRG1 alone increases PMA‐ induced transcriptional activity in a dose‐dependent manner. Overexpression of dominant negative BRG1 inhibits the transcriptional activity, demonstrating that
BRG1 activity is required for efficient transactivation of the SLC11A1 gene promoter. Co‐transfection of ATF‐3 and BRG1 caused an additive, but not synergistic, effect on the PMA‐induced transcriptional activity. In order to further evaluate the cooperative effect of ATF‐3 and the SWI/SNF complex, we performed luciferase reporter assays using the expression plasmids at lower concentrations. As shown in Figure 7B, transfection of expression plasmids for
BRG1, ATF‐3 or β‐actin individually at lower concentrations (0.5g, 0.5g and 0.6
g per transfection, respectively) with PMA treatment resulted in only a slight increase in transcriptional activity compared with PMA treatment alone. When
BRG1 was used in combination with ATF‐3, a clear additive effect on activation of the SLC11A1 gene promoter was seen. A similar result was also observed when
β‐actin was co‐transfected with ATF‐3. Not surprisingly, the highest induction of the transcriptional activity was obtained when BRG1, ATF‐3 and ‐actin were concomitantly transfected into HL‐60 cells. In conclusion, these results reveal a cooperation between ATF‐3 and SWI/SNF complex during the PMA‐induced transcriptional activation of the SLC11A1 gene, and that ATPase activity of BRG1 is necessary for this process.
160
Figure 3.7 ATF‐3, BRG1 and ‐actin cooperate to activate the SLC11A1 promoter. (A) HL‐60 cells were transiently transfected with luciferase reporter construct ‐395Luc alone or in combination with different amounts of expression plasmids for BRG1, BRG1 mutant and ATF‐3 as indicated. (B) HL‐60 cells were transiently transfected with luciferase reporter construct ‐395 Luc alone or in combination with expression plasmids for BRG1, ‐actin and ATF‐3 as indicated.
Six hrs after transfection, the cells were treated with or without PMA (10 ng/ml) for another 48 hrs and subjected to luciferase assays. Results of the luciferase assays are expressed as relative luciferase activity (fold change), as compared with luciferase activity of HL‐60 cells transfected with ‐395 Luc alone. The data shown (mean S.E.) are the averages of three independent experiments performed in triplicate.
161
Figure 3.7
162 BRG1 mediates Z‐DNA‐formation at the SLC11A1 gene promoter in response to
PMA treatment
BRG1‐mediated transcriptional activation of the SLC11A1 gene and the recruitment of BRG1 to the SLC11A1 gene promoter strongly suggest that chromatin remodelling occurs at the promoter in response to PMA treatment.
Through analysis of the SLC11A1 promoter, a Z‐DNA forming dinucleotide repeat, t(gt)5ac(gt)5ac(gt)9g, was identified immediately downstream of the AP‐1‐like element in the promoter (spanning nucleotides ‐273 to ‐317). This stretch of GT repeats is shown to have Z‐DNA‐forming propensity in vitro and in vivo (Bayele et al., 2007). To confirm the Z‐DNA formation in response to PMA stimulation, HL‐
60 cells were transfected with the reporter construct ‐395 Luc or the empty vector pREP4‐Luc and the Z‐DNA formation in the SLC11A1 promoter was detected by a combination of in vivo cross‐linking and ZaaFOK digestion. ZaaFOK is a fusion protein which can specifically bind Z‐DNA structure and make double‐ stranded cleavages within or around the Z‐DNA region to which it is bound. The generation of cleavage sites was then detected by LM‐PCR. As shown in Figure
3.8A, PMA treatment resulted in several new ZaaFOK cleavage sites within or near the GT/AC repeat sequence in the wild‐type SLC11A1 gene promoter
(compare lanes 3 and 4), indicating the formation of Z‐DNA structure. However, no significant Z‐DNA structure was detected in the empty vector (lanes 1 and 2) even in the presence of PMA. These results demonstrate that PMA can induce Z‐
DNA formation in the SLC11A1 promoter. As shown in Figure 3.8B, the formation
163 of Z‐DNA in the endogenous SLC11A1 promoter in response to PMA treatment was also detected. Similarly, several new cleavage products were generated when HL‐60 cells were treated with PMA compared to the results from untreated HL‐60 cells.
BRG1 assistance in Z‐DNA formation is often needed to form open‐ chromatin structures in gene regulatory regions (Liu et al., 2006b;Liu et al., 2001).
Thus, we hypothesized that PMA‐induced recruitment of the SWI/SNF complex to the AP‐1‐like element promotes the conversion of the (GT/AC)n repeat sequence to Z‐DNA structure. To confirm this, HL‐60 cells were transfected with
BRG1 siRNA, and the effects of BRG1 depletion on Z‐DNA formation were then analyzed. As expected, knockdown of BRG1 significantly reduced the intensity of bands (Figure 3.8C). Knockdown of BRG1 by RNA interference was analyzed using
Western blot analysis. As shown in Figure 3.8D, BRG1 protein expression was significantly reduced in specific siRNA‐transfected cells but not in control siRNA‐ transfected cells. As a control, Brm protein expression was not affected. Taken together, our results demonstrate that during the PMA‐induced transcriptional activation of the SLC11A1 gene, recruitment of the SWI/SNF complex by ATF‐3 to the SLC11A1 promoter is required for the (GT/AC)n repeat sequence to be converted to Z‐DNA conformation.
164 Figure 3.8 Recruitment of BRG1 to the AP‐1‐like element is required for PMA‐ induced Z‐DNA formation at the SLC11A1 promoter. (A) Control reporter plasmid pREP4‐Luc or luciferase reporter plasmid ‐395Luc were individually transfected into HL‐60 cells. Six hours after transfection, cells were left untreated or treated with 10 ng/ml PMA for 48 hrs. Following cross‐linking with formaldehyde, the cells were permeabilized and treated with ZaaFOK. The cleavage sites in the SLC11A1 promoter in the reporter constructs were detected by LM‐PCR using primers specific to the luciferase cDNA in the constructs. The
GT/AC repeat region is indicated on the right. (B) HL‐60 cells were cultured in the presence or absence of 10ng/ml PMA for 48 hrs. The cells were then cross‐linked, permeabilized and treated with ZaaFOK. The DNA was purified and digested completely with NcoI, which recognizes a site downstream of the (GT/AC)n repeat sequence in the endogenous SLC11A1 promoter. The cleavage sites were detected by LM‐PCR using SLC11A1 promoter‐specific primers upstream of the repeat sequence. The GT/AC repeat region is indicated on the right. (C) HL‐60 cells were transfected with control siRNA or BRG1‐specific siRNA. Six hours after transfection, cells were treated with 10 ng/ml PMA for 48 hrs. The Z‐DNA structure was detected as described in B. D, The knockdown of BRG1 by RNA interference experiments in C was analyzed by Western blot analysis. Expression of Brm protein was also detected as a control. The result shown is representative of three independent experiments.
165
Figure 3.8
166 3.5 Discussion
The SLC11A1 gene expression is strictly regulated during myeloid differentiation. HL‐60 cells have been shown to be a useful model to study the regulation of SLC11A1 gene expression during experimentally induced granulocytic, monocytic or macrophage‐like differentiation (Cellier et al.,
1997;Roig et al., 2002;Xu et al., 2005). Our previous study demonstrated that
HuR binds to an AU‐rich element (ARE) present in the 3’UTR of SLC11A1 mRNA and significantly increases SLC11A1 mRNA stability and protein expression (Xu et al., 2005). Richer et al. demonstrated that transcription factors Sp1 and C/EBP are recruited to two cis‐acting elements in the SLC11A1 promoter region and regulate its transcriptional activity during the monocytic differentiation of HL‐60 cells by vitamin D (Richer et al., 2008). However, the role of the chromatin remodeling complex on the activation of SLC11A1 has not been determined. The present study provides evidence that during PMA‐induced differentiation of HL‐
60 cells towards the macrophage pathway, two components of the SWI/SNF complex, BRG1 and ‐actin, are recruited to the SLC11A1 gene promoter via interaction with transcription factor ATF‐3, and activate gene transcription.
Using a series of deletion constructs, a promoter region, located between ‐
395 and ‐264, was found to be necessary for PMA‐induced transcriptional activation of the SLC11A1 gene. Sequence analysis of this promoter fragment revealed that it contains an AP‐1‐like element (TGACTCT). AP‐1‐like elements are
167 highly homologous to the consensus AP‐1 binding site (TGAC/GTCA) and are involved in transcriptional regulation of some genes via interaction with the AP‐1 and ATF/CREB family factors or their dimmers (Karin et al., 1997;Schreiber et al.,
1999). ATF3 is a member of the ATF/CREB transcription factor family and has at least 5 isoforms derived from alternative splicing events (Pan et al., 2003;Wang et al., 2003). The ATF‐3 isoforms can form a homodimer or it can heterodimerize with other transcription factors such as Jun‐B, c‐Jun, ATF‐2 and Smad3. In human umbilical vein endothelial cells (HUVECs) and cardiac myocytes, over‐expression of ATF3 down‐regulated p53 expression (Kawauchi et al., 2002;Nobori et al.,
2002). The regulation occurred at the transcription level, through binding of
ATF3 to the PF‐1 sequence “TGACTCT”, an AP‐1‐like site in the promoter of p53
(Kawauchi et al., 2002;Nobori et al., 2002). In this study, we observed that PMA induces ATF‐3 to bind to the AP‐1‐like element within the SLC11A1 gene promoter. We also found that ATF‐3 is required for recruitment of BRG1 and ‐ actin, two components of the SWI/SNF complex, to the SLC11A1 gene promoter, and for activating the transcription of the SLC11A1 gene. Therefore, ATF‐3 may function either as a transcriptional activator or repressor according to its partner, target gene and cellular context.
Previous studies have shown that ‐actin participates in chromatin remodeling as a component of the human SWI/SNF complex during gene activation (Rando et al., 2002;Song et al., 2007;Zhao et al., 1998). It has been proposed that ‐actin and actin‐related proteins are required for the maximum
168 ATPase activity of SWI/SNF (Rando et al., 2002;Shen et al., 2003) and for the stable association of the chromatin remodeling complex with chromatin (Olave et al., 2002). In Chapter 2, it was shown that ‐actin binds to the SLC11A1 promoter, and is involved in transcriptional activation of the SLC11A1 gene during the PMA‐induced macrophage‐like differentiation of HL‐60 cells. In this study, we have established that ‐actin is recruited to the AP‐1‐like element together with BRG1, suggesting that it is involved in chromatin remodeling during the transactivation of the SLC11A1 gene in differentiating HL‐60 cells.
Modulation of chromatin structure by ATP‐dependent remodeling SWI/SNF complexes has been implicated in cell differentiation, proliferation and transcriptional control of tissue‐specific and inducible genes (Albini and Puri,
2010;Bakshi et al., 2010;Cohet et al., 2010;Gresh et al., 2005;Hah et al.,
2010;Juliandi et al., 2010;Moshkin et al., 2007). The functional selectivity of the
SWI/SNF complex at specific genes is attributable to its recruitment to the target genes through interaction with sequence‐specific transcriptional activators or repressors (Li et al., 2007;Roberts and Orkin, 2004). BRG1, one of the ATPase subunits of the SWI/SNF chromatin remodeling complex, plays a critical role in
SWI/SNF‐mediated transcriptional regulation (Trotter and Archer, 2008). The essential role of BRG1 in hematopoietic development has previously been established (Bultman et al., 2005;Vradii et al., 2006). A recent study has demonstrated that Brg1 and INI1, two core subunits of the hSWI/SNF complex, associate with the acute myeloid leukemia 1(AML1/ RUNX1) transcription factor,
169 and are recruited to RUNX1 target gene promoters to control hematopoietic‐ specific gene expression (Bakshi et al., 2010). Studies with ATPase‐deficient BRG1 have demonstrated that the ATPase activity of SWI/SNF is required for expression of tissue‐specific genes in muscle (de la Serna et al., 2001a;de la
Serna et al., 2001b), adipose (Salma et al., 2004) and mammary epithelial cells
(Xu et al., 2007), as well as for myeloid differentiation to granulocytes (Vradii et al., 2006). Chromatin immunoprecipitation analysis revealed that NF‐E2‐related factor (Nrf2) recruits BRG1 to the regulatory region of its target gene HO‐1, and the chromatin‐remodeling activity of BRG1 is specifically required for HO‐1 induction in response to oxidative stress (Zhang et al., 2006). Similarly, the present study shows that BRG1 is recruited to the AP‐1‐like element in the
SLC11A1 gene promoter in an ATF‐3‐dependent manner. BRG1 knockdown markedly decreased the PMA‐induced expression of the SLC11A1 gene, as well as the transcriptional activity of its promoter. Furthermore, overexpression of
BRG1 mutant also leads to a reduction in the PMA‐induced transcriptional activity of the SLC11A1 gene promoter. Our results demonstrate that the ATPase activity of SWI/SNF is necessary for transcriptional activation of the SLC11A1 gene during macrophage differentiation.
DNA is capable of adopting different conformations besides the canonical
Waston‐Crick B‐DNA. One of the best characterized alternative DNA confirmations is left‐handed Z‐DNA, which can be formed by stretches of dinucleotide repeats such as (CG)n, (TG)n or (CA/TG)n (Rich et al., 1984;Wang
170 and Vasquez, 2007). In the promoter region of SLC11A1, nine different alleles
(alleles 1‐9) with polymorphisms containing a functional Z‐DNA forming repeat
(GT/AC)n have been reported in different populations worldwide. Bayele HK et al.
(Bayele et al., 2007) demonstrated that a polymorphism of (GT/AC)n dinucleotides is associated with the transcriptional activity of the SLC11A1 promoter, and that the (GT/AC)n repeat has a propensity to form Z‐DNA in vitro and in vivo. In this study, we confirm that the (GT/AC)n repeat
(t(gt)5ac(gt)5ac(gt)9g) can be converted into Z‐DNA structure in the SLC11A1 promoter in response to PMA stimulation, and we demonstrate that recruitment of the chromatin remodeling factor BRG1 to the SLC11A1 promoter is essential for Z‐DNA formation. Taken together, these data suggest that a polymorphism in the (GT/AC)n repeat sequence may affect Z‐DNA formation; consequently, it would affect the transcription and expression of the SLC11A1 gene.
In summary, we found that chromatin remodeling is involved in the transcriptional regulation of SLC11A1 gene expression during the macrophage‐ like differentiation of HL‐60 cells. We demonstrated that a proximal (GT/AC)n repeat sequence is converted into Z‐DNA conformation by the cooperation between transcription factor ATF‐3 and SWI/SNF chromatin remodeling complex.
Our findings provide new insights into the mechanism of transcriptional regulation of the SLC11A1 gene during myeloid development.
171 3.6 Acknowledgements
We greatly appreciate Dr. Zhao K. and Dr. Hai T. for kindly providing the plasmids pET‐His‐ZaaFOK and pCG‐ATF3, respectively. We are grateful to Marie‐
Linda Boghdady for a critical review of the manuscript. This work was supported by the Canadian Institute of Health Research and NSERC grants (to DR), and
Fonds de la recherche en santé du Québec (17734, to YZX).
172
CHAPTER 4
Src family kinase activity is involved in tyrosine phosphorylation
and subcellular localization of SLC11A1 in macrophages
173 4.1 Abstract
Studies have demonstrated that the solute carrier family 11 member 1
(Slc11a1) is phosphorylated in macrophages and is localized at the membrane of late endosomes/lysosomes. The aim of this study was to confirm if human
SLC11A1 is tyrosine‐phosphorylated and if the phosphorylation has effects on
SLC11A1 activity and subcellular localization. Here, the tyrosine phosphorylation of SLC11A1 is observed during the differentiation of U937‐
SLC11A1 into macrophages induced by phorbol myristate acetate (PMA). The phosphorylation of SLC11A1 is almost completely blocked by treatment with PP2, a selective inhibitor of Src family kinases. Furthermore, siRNA‐mediated knockdown of c‐Src expression results in a significant decrease in tyrosine phosphorylation and SLC11A1 is a direct substrate for active Src kinase in vitro.
We found that PMA induces the interaction between N‐terminus of SLC11A1 and c‐Src kinase. We demonstrated that SLC11A1 is phosphorylated by Src family kinases at tyrosine 15 and this type of phosphorylation is required for SLC11A1‐ mediated nitric oxide (NO) production. We also showed that either PP2 treatment or c‐Src knockdown decreases the colocalization of SLC11A1 with
LAMP1. Our results demonstrate an important role of Src family kinases in phosphorylation and subcellular localization of SLC11A1 in macrophages.
174 4.2 Introduction
The SLC11A1 protein has been shown to be expressed in monocytes/ macrophages and polymorphonuclear leukocytes (Cellier et al., 1997;Govoni et al., 1997) and to function as a divalent cation transporter(Goswami et al.,
2001;Jabado et al., 2000;Kuhn et al., 2001). SLC11A1 plays pleiotropic effects influencing macrophage activation process including induction of chemokine KC and proinflammatory cytokines, up‐regulation of MHC class II molecules and release of reactive oxygen and nitrogen intermediates (Blackwell et al.,
2001;Govoni and Gros, 1998). SLC11A1 is present in the membranes of LAMP‐1 positive late endosomes/lysosomes (Gruenheid et al., 1997). Upon phagocytosis of live bacteria or inert particles such as latex beads and zymosan (Jabado et al.,
2000), SLC11A1 is rapidly recruited to the membrane of maturing phagosomes
(Cuellar‐Mata et al., 2002;Govoni et al., 1999;Gruenheid et al., 1997;Searle et al.,
1998). Recruitment of SLC11A1 to the membrane of Mycobacteria‐containing phagosomes appears to impair the ability of Mycobacterium to block phagolysosomal fusion and acidification. It also affects the bacteriostasis or bactericidal activity of phagocytes and the survival of intracellular pathogens.
Indeed, it has been reported that Slc11a1‐positive mycobacterial phagosomes show enhanced fusion to vacuolar H+‐ATPase‐positive vesicles (Hackam et al.,
1998) and lysosomes (de and Thilo, 1997;Frehel et al., 2002), increased acidification (Hackam et al., 1998) and enhanced bactericidal activity (Govoni et al., 1999) compared with their Slc11a1‐ablated counterparts. Previous studies
175 have also shown that SLC11A1 functions as a pH‐dependent metal efflux pump that transports divalent cations such as Mn2+ and Fe2+ from acidified phagosomes down a proton gradient created by the vacuolar H+‐ATPase (Forbes and Gros, 2003;Jabado et al., 2003;Jabado et al., 2000). White and colleagues found that mutant SLC11A1 protein (G169D) was mostly retained within the endoplasmic reticulum (ER) and subsequently degraded, resulting in its loss of function (White et al., 2004). While studies have demonstrated that the correct localization of SLC11A1 is important for its function, the molecular mechanism involved in the localization of SLC11A1 remains poorly understood.
The Slc11a1/SLC11A1 gene encodes a ~90 to ~ 100 kDa integral membrane phosphoglycoprotein, composed of an amino‐terminal and a carboxyl‐terminal region as well as 12 transmembrane domains (TM1 to TM12). In vitro phosphorylation assay have shown that murine Slc11a1 can be phosphorylated at the N‐terminal region (Barton et al., 1999). Sequence analysis indicates that the N‐terminal of Slc11a1/SLC11A1 contains a proline‐rich domain (PRD) that resembles the Src homology 3 (SH3) binding domain found to be involved in signal transduction (Barton et al., 1994;Gout et al., 1993;Kaneko et al., 2008;Kay et al., 2000;Mayer, 2001). The SH3 domain is a small protein domain of about 60 amino acid residues first identified as a conserved sequence in the non‐catalytic part of several cytoplasmic tyrosine kinases such as Abl and Src. It has since been identified in a number of other unrelated protein families such as phospholipases, PI3 kinases, ras GTPase activating proteins, adaptor proteins,
176 CDC24 and CDC25 (Kaneko et al., 2008;Kay et al., 2000). SH3 domain‐containing proteins mediate protein‐protein interactions via binding to specific proline‐rich sequences in their respective target proteins (Kaneko et al., 2008;Kay et al.,
2000;Mayer, 2001;Yu et al., 1994), which are required for signal transduction, subcellular localization, and cytoskeletal organization in eukaryotic organisms
(Aitio et al., 2010;Dalgarno et al., 1997;Mayer and Baltimore, 1993;Pawson,
1995). c‐Src is a well‐characterized cytoplasmic and membrane‐associated tyrosine kinase that serves as the prototypical Src family kinase (SFK) for at least eight related proteins in mammals. Each member of the SFKs is composed of a series of modular domains that regulate cellular localization (SH4), interaction with binding partners (SH2 and SH3) and enzymatic activity (SH1) (Geahlen et al.,
2004). It has been shown that c‐Src associates with a variety of growth factor receptors, integrins, and ion channels as well as with several other cellular proteins, leading to the activation of multiple phosphorylation signaling cascades and increased transcription and/or activity of proteins involved in cell growth and proliferation, ion transport, cell motility and invasion (Brunton et al.,
1997;Edwards et al., 2006;Fleming et al., 1997b;Holmes et al., 1996;Owens et al.,
2000). Activated c‐Src localizes to all areas of the cell and has also been shown to facilitate the relocalization of proteins within the cell (Dib et al., 2003;Wrobel et al., 2004).
In this study, we found that c‐Src indirectly interacts with SLC11A1 protein during the differentiation of U937‐SLC11A1 cells into macrophage by PMA, and
177 deletion of the PRD within the N‐terminal of SLC11A1 results in the abrogation of the interaction. We demonstrated that Src family kinases activity is involved in the phosphorylation of SLC11A1 on tyrosine 15, and that this type of phosphorylation is necessary for SLC11A1‐mediated nitric oxide production.
Finally, Src family kinases activity is also involved in subcellular localization of
SLC11A1 protein.
4.3 Materials and Methods
Antibodies and Reagents
The rabbit anti‐SLC11A1 antibody was purchased from Santa Cruz Biotechnology,
Inc. (Santa Cruz, CA). The rabbit polyclonal antibody to Src and mouse monoclonal antibody 9E10 directed against the c‐Myc protein were purchased from Abcam (Cambridge, MA). Purified recombinant active c‐Src, Anti‐phospho‐
Src (Tyr 418) and anti‐phosphotyrosine antibody 4G10 were from Upstate (Lake
Placid, NY). The rat anti‐Lamp1 (lysosomal‐associated membrane protein 1) monoclonal antibody was from Pharmingen (San Diego, CA). The mouse anti‐ actin monoclonal antibody was from CHEMICON (Tenecula, CA). FITC‐ conjugated goat anti‐mouse IgG was from Santa Cruz Biotechnology. Texas Red– conjugated anti‐rat IgG was purchased from Molecular Probes (Eugene, OR).
HRP‐conjugated rabbit anti‐mouse and goat anti‐rabbit IgG were from Sigma
(Saint Louis, MO) and Santa Cruz Biotechnology, respectively. Src substrate
178 Sam68 (amino acids 331‐443) and mouse anti‐Sam 68 monoclonal antibody used for in vitro phosphorylation by Src kinase were purchased from Santa Cruz
Biotechnology. Cell Line NucleofectorTM kit V was purchased from Amaxa
(Gaithersburg, MD). siRNA SMARTpool (c‐Src) was from Dharmacon (Lafayette,
CO). SFK inhibitor PP2 and PP3 were purchased from Calbiochem (San Diego, CA).
The QuickChange II XL site‐directed mutagenesis kit was purchased from
Stratagene (La Jolla, CA). Activated CH‐Sepharose 4B was from Amersham
Bioscience.
Plasmids and constructs
The SLC11A1 gene was amplified by PCR using full‐length human SLC11A1 cDNA
(R&D system) as a template. The forward and reverse primers were as follows: forward primers, 5’‐GTCGAATTCGCCACCATGACAGGTGACAAGGGTCCCCAAAG‐3’ with an EcoRI site and a Kozak sequence (bold type); reverse primer, 5’‐ AT GGA
TCCTTACAGATCCTCTTCTGAGATGAGTTTTTGTTC GCCAGAG GTCTCCC CTTT CTGG‐
3’ with a BamHI site and a sequence encoding myc epitope (bold type). The PCR product was digested with EcoRI and BamHI and inserted in the corresponding sites of plasmid pCB6, yielding a construct pCB6‐SLC11A1‐Myc with a Myc tag
(EQKLISEEDL) at the C‐terminal end of SLC11A1. The c‐Myc‐tagged SLC11A1 with an N‐terminal deletion (amino acids 58‐548) and with a C‐terminal deletion
(amino acids1‐521) expression vectors were prepared by PCR amplification of the appropriate region of SLC11A1 cDNA using the construct pCB6‐SLC11A1‐Myc as a
179 template. The PCR products were digested with EcoRI/BamHI, and were then subcloned into the pCB6. The c‐Myc‐tagged PRD‐deletion mutant, lacking amino acids 21‐29, was constructed using QuickChange II XL site‐directed mutagenesis kit. Primers used for deletion were 5’‐TCCAGCTATGGTTCCATCTCCAGCCAGCAAG
CACCTCCCAGAGAGACC‐3’ and 5’‐GGTCTCTCTGGGAGGTGCTTGCTGGCTGGAGAT
GGAACCATAGCTGGA‐3’. The Y15F and Y38F mutants were generated by replacing Tyr‐15 and Tyr‐38 by phenylalanine using the QuickChange II XL site‐ directed mutagenesis kit according to the manufacturer’s instructions. The cDNA encoding wild‐type c‐Src in the pUSE(‐) vector (Upstate Biotechonology, Lake
Placid, NY) was subcloned into XhoI /BamHI sites of pCB6 vector, yielding a construct pCB6‐Src. All mutations and cDNA constructs were confirmed by DNA sequencing.
In vitro peptide binding assay
Two peptides were synthesized by NEO BioScience (Cambridge, MA). The
SLC11A1 PRD peptide (ISSPTSPTSPGPRQAPPRET) comprised the SH3 binding site in the N‐terminal of the SLC11A1 protein (amino acids 19‐38). The negative control peptide (IPDTKPGTFSLRKLWAFTGPGFLM) comprised a sequence from the
N‐terminal of the SLC11A1 protein that lacks the PRD (amino acids 45‐68).The positive control peptide is Src substrate Sam68 (amino acids 331‐443). Each peptide was coupled to activated CH‐Sepharose 4B according to the manufacturer’s instructions. In vitro binding of Src to peptides was performed as
180 described previously (Liu et al., 2004a). The bound proteins were eluted by boiling in SDS sample buffer and analyzed by Western blotting using a rabbit polyclonal antibody to c‐Src.
Cell culture and transfection
The U937‐SLC11A1 cell line (stably expressing c‐Myc‐tagged SLC11A1) (Canonne‐
Hergaux et al., 2002) was kindly provided by Dr. Phillippe Gros (McGill University,
Montreal, QC, Canada), and was cultured in RPMI medium supplemented with
10% heat‐inactivated fetal bovine serum (FBS), 20 mM Hepes pH 7.6, 2mM L‐
Glutamine and 0.5 mg/ml G418. Cell lines were transfected or cotransfected with different kinds of expression vectors using the Cell Line NucleofectorTM kit V according to the manufacturer’s instructions. Briefly, 2106 log‐growth cells were suspended in 100l of Cell Line NucleofectorTM Solution V and mixed with the appropriate amount of expression vector. The mixture was transferred into an
Amaxa‐certified cuvette and the cuvette was then inserted into the cuvette holder of the Nucleofector II (Amaxa, Gaithersburg, MD). Transfection was carried out using the program T‐19. As for stable transfection, cells were cultured in RPMI containing 20% FBS and allowed to recover for 3 days, followed by G418
(Geneticin, Invitrogen, Burlington, ON) selection for 10 days at a final concentration of 1.0 mg/ml. Clonal sublines were selected by plating on semi‐ solid methyl cellulose Iscove’s medium (Stem Cell Technologies, Paisley, Scotland) containing 1.0 mg/ml G418. The stably transfected colonies were grown in
181 complete RPMI medium supplemented with 0.5 mg/ml G418, and screened for protein expression.
Co‐immunoprecipitation and immunoblotting.
Cultured cells were lysed in 1ml of RIPA buffer (Sigma) containing protease inhibitors. Lysates were incubated at 4C for 30 min and centrifuged at 10,000g for 20 min. The supernatants were pre‐cleared with protein A‐ or protein G‐ sepharose for 30 min. Immunoprecipitation was performed overnight at 4C using a specific antibody. To precipitate the antigen‐antibody complex, protein
A‐ or protein G‐ sepharose was added and incubated for 1 hr at 4C. After washing with RIPA buffer, the precipitated proteins were eluted by boiling in SDS sample buffer. Immunoprecipitates or equal amount of cell lysates from each cell line were resolved on SDS‐PAGE gel, electrophoretically transferred to PVDF membranes and probed with appropriate antibodies. Immunoreactive proteins were detected by the ECL system and quantified by densitometry. For normalization of the signals, the membranes were stripped of antibodies and reprobed with rabbit anti‐SLC11A1 antibody, and the proteins were quantified as above.
Immunoprecipitation and in vitro kinase assay
182 After appropriate treatment, cells were lysed in RIPA buffer, pre‐cleared and immunoprecipitated with the antibody 9E10. The immunoprecipitates were washed using a stringent eight‐wash protocol following immunoprecipitation, including 4 x RIPA buffer, 2 x low salt buffer (10 mM NaCl, 20 mM Hepes, pH 7.4,
5 mM MnCl2) and 2 X kinase reaction buffere (100mM Tris‐HCl, pH 7.2, 125mM
MgCl2, 5mM MnCl2, 2mM EGTA, 250M sodium orthovanadate and 2mM DTT ) washes. Then, kinase reaction buffer containing 200 M ATP and 5ng/ l substrate Sam68 (amino acids 331‐443) was added to the immunoprecipitates, and in vitro kinase reaction was performed at 30 C for 30 minutes.
Immunoprecipitates were boiled in SDS sample buffer, separated on SDS‐PAGE gel and probed with an anti‐phosphotyrosine (4G10), anti‐Sam68 or anti‐c‐Src antibody.
In vitro phosphorylation of SLC11A1 protein
Briefly, purified recombinant human SLC11A1 with a GST tag (a.a.1‐a.a.178,
Novus Biological) was incubated with 5U of recombinant active c‐Src for 20 min at 30C in kinase reaction buffer (100mM Tris‐HCl Ph 7.2, 125mM MgCl2, 5mM
MnCl2, 2mM EGTA, 250M sodium orthovanadate and 2mM DTT ) with 100M
ATP. The kinase reaction was stopped by adding appropriate 4 XSDS sample buffer. Phosphorylation of SCL11A1 was detected by Western blotting using antibody 4G10.
183
Immunofluorescence
Each cell line was seeded on 4‐well culture slides (Becton Dickinson Labware,
Franklin Lakes, NJ) and left untreated or treated as indicated. Cells were fixed for
15 min in PBS containing 3.7% paraformaldehyde and 0.18% Triton‐X. After soaking in blocking buffer (PBS containing 1% goat serum) for 30 min, chambers were incubated with the primary antibodies (mouse monoclonal antibody
9E10(1:100) and rat anti‐Lamp1 monoclonal antibody (1:50) in blocking buffer) for 1h at room temperature. Following washes with blocking buffer, samples were incubated for 1h with a mixture of FITC and Texas Red–labeled secondary antibodies, both at a 1:500 dilution in blocking buffer. After washing with blocking buffer, slides were mounted in Vectashield (Vector Laboratories,
Burlingame, CA). Colocalization studies were performed using a Zeiss laser confocal microscope fitted with a 63 oil objective, and an Axiocam HR (Zeiss) digital camera was used for photography. Yellow pixels, representing co‐ localization of SLC11A1 and Lamp1, were quantified in single cells using Meta
Imaging Series version 4.5(Universal Imaging Corporation, Downingtown, PA). In brief, the images representing SLC11A1 and Lamp1 were normalized for their intensities before single cells were selected. The number of yellow pixels representing co‐localization versus the number of green pixels representing total
SLC11A1 was recorded. The extent of co‐localization was expressed as a percentage of the total SLC11A1 detected.
184
Small RNA interference experiment
U937‐SLC11A1 cells were transiently transfected with the siRNA targeting c‐Src using the Cell Line NucleofectorTM kit V according to the manufacturer’s instructions. Briefly, 2106 log‐growth cells were suspended in 100l of Cell Line
NucleofectorTM Solution V and mixed with 2g of c‐Src siRNA (20M in siRNA buffer). The siRNA duplexes used in the experiment were SMARTpool® SRC.
Transfection was performed with a NucleofectorTM II device using the program D‐
32. Transfected cells were cultured for 48 hrs at 37 C in 5%CO2.
NO Production
Cell were seeded in 12‐well plates and were differentiated with PMA (10 ng/ml) for 0, 6, 24, 72 hrs. NO production was evaluated by measuring the accumulation of nitrite in the culture medium by the Griess reaction, as previously described
(Chen et al., 1996)
Statistics
Data are presented as mean ± S.E. Comparisons between groups were performed using the student’s t‐test. Significance was established at P<0.05.
185 4.4 Results
PMA induces tyrosine phosphorylation of SLC11A1 and Src kinase activity in
U937‐SLC11A1 cells
Analysis of the amino acid sequence of human SLC11A1 using Netphos 2.0 server
(Blom et al., 1999) and GPS2.1 (Xue et al., 2008b) revealed the presence of two potential tyrosine phosphorylation sites (Y15 and Y38) at its N‐terminal. In order to know if SLC11A1 is tyrosine‐phosphorylated, U937 –SLC11A1 cells were left untreated or treated with PMA for 6 hrs, 24 hrs and 48 hrs. Protein extracts were prepared and subjected to immunoprecipitation using the antibody 9E10. The precipitated SLC11A1 protein complexes were then probed with antibody 4G10 to detect phosphotyrosine residues. As shown in Figure 4.1A, treatment of U937‐
SLC11A1 cells with PMA for up to 24 hrs significantly increased the tyrosine phosphorylation level of SLC11A1. PMA‐induced phosphorylation was more evident in cells cultured for longer periods. Next, to assess if tyrosine phosphorylation of SLC11A1 is associated with Src kinase, we investigated the expression and activity of Src kinase in response to PMA treatment. Cells were lysed at various time points after PMA treatment and immunopreciated with a monoclonal antibody specific for c‐Src. The Src kinase activity was analyzed in vitro using Sam 68 as a phosphorylation substrate for c‐Src. The total expression of c‐Src kinase was also monitored by Western blot analysis. As shown in Figure
4.1B and 4.1C, PMA treatment significantly increased the expression and activity
186 of c‐Src kinase. These results suggest that PMA‐induced tyrosine phosphorylation of SLC11A1 is caused, at least in part, by increased c‐Src kinase activity due to increased c‐Src kinase expression.
Src family kinase activities are required for tyrosine phosphorylation of
SLC11A1
Tyrosine phosphorylation of SLC11A1 has not been previously reported. In order to determine if Src family kinases are involved in PMA‐induced tyrosine phosphorylation of SLC11A1, U937 cells stably expressing SLC11A1 were first treated with PMA for 2 days, and were then treated with Src family kinase inhibitor PP2, PP3 (an inactive derivative) or left untreated. Initially, we examined the effect of PP2, a broad‐spectrum inhibitor of SFKs, on Src kinase activity. We used a phospho‐specific antibody to detect the active p‐Src that is phosphorylated on tyrosine 418. This residue, located in the Src tyrosine kinase domain, is autophosphorylated when Src is activated and its phosphorylation state is correlated with the kinase activity (Abram and Courtneidge, 2000). As shown in Figure 4.2A, Src phosphorylation on Tyr‐418, an indicator of Src activation, was clearly inhibited after treatment with 5 M PP2, and was almost completely inhibited at 10M. However, PP2 treatment had no effect on the expression of total Src. Neither Src kinase activation nor Src expression was affected by PP3 treatment. Next, to assess whether Src family kinase activity is involved in the tyrosine phosphorylation of SLC11A1, protein extracts from
187
Figure 4.1 Effect of PMA treatment on the tyrosine phosphorylation of SLC11A1 and Src kinase activity. U937‐SLC11A1 cells (stably expressing SLC11A1‐c‐Myc fusion protein) were left untreated or treated with PMA (10ng/ml) for 6, 24 and
72 hrs. (A) Cell lysates were immunoprecipitated with an anti‐c‐Myc antibody
(9E10). The phosphorylation levels of SLC11A1 were analyzed by immuoblotting with an antibody to phosphotyrosine (4G10). The same blots were reprobed with an anti‐SLC11A1 antibody. (B) Cell lysates were immunoprecipated with a specific antibody against c‐Src. In vitro kinase activity assay was performed using
Sam 68 as a substrate. Phosphorylation of Sam 68 was detected by the phosphotyrosine antibody (4G10). Western blots were stripped and analyzed for total Sam 68 and c‐Src. (C) Cell lysates were separated on SDS‐PAGE and the expression of c‐Src protein was detected by Western blot analysis. The blots were stripped and re‐probed with an antibody against β‐tubulin as a loading control.
188
Figure 4.1
189 untreated, PP3‐ or PP2‐treated cells were used to detect phosphotyrosine residues in the SLC11A1 protein. As shown in Figures 4.2B and 4.2C, tyrosine phosphorylation of SLC11A1 was observed in untreated cells. However, the tyrosine phosphorylation was reduced by more than 70% in cells treated with 5
M PP2 and reduced by more than 90% with 10 M PP2 (P<0.001). The expression of total SLC11A1 protein was not significantly changed with PP2 treatment. PP3, as an inactive analogue of PP2, did not affect the phosphorylation of the SLC11A1 protein. These results demonstrate that Src family kinase activities are required for tyrosine phosphorylation of SLC11A1.
SLC11A1 protein can be tyrosine phosphorylated by c‐Src kinase.
To further determine whether the observed inhibition of tyrosine phosphorylation of SLC11A1 protein by PP2 was due specifically to the blocking of c‐Src kinase activity, we knocked down c‐Src kinase using small interfering
RNA (siRNA) specifically directed against the c‐Src gene. As shown in Figure 4.3A, transfection of specific c‐Src siRNAs into U937 cells led to a nearly complete inhibition of c‐Src protein expression, with no effect on actin expression. Mock transfection (transfection of reagents only) had no effect on either c‐Src or actin levels (Figure 4.3A). Interestingly, the phosphorylation of SLC11A1 was significantly inhibited in c‐Src knockdown cells (P<0.001), whereas the expression of total SLC11A1 was not significantly changed (Figures 4.3B and 4.3C). Further analysis showed that the level of tyrosine phosphorylation of SLC11A1 in c‐Src
190
Figure 4.2 Inhibition of Src family kinase activity blocks tyrosine phosphorylation of SLC11A1. U937‐SLC11A1 cells were cultured with PMA
(10ng/ml) for 48 hrs and were then left untreated (CTR) or treated with PP2 or
PP3 (inactive analogue) for another 24 hours. Cell lysates were prepared. (A) Src and active Src (pY418) were monitored by Western blotting analysis. (B) Cell lysates were immunoprecipitated with the antibody 9E10, and the immunoprecipitates were probed with antibody 4G10 to phosphotyrosine for phosphorylated SLC11A1. The Western blots were stripped and re‐probed with an antibody against SLC11A1. (C) The level of SLC11A1 phosphorylation was quantified and normalized as described in “Materials and Methods”, and was expressed as a percentage of the level of total SLC11A1 protein. The inhibitory effect of PP2 on SLC11A1 phosphorylation was assessed in 3 separate experiments (mean± SE, *P<0.001).
191
Figure 4.2
192 knockdown cells were higher than those in the cells treated with PP2 (P<0.005), which suggests that molecular knockdown of c‐Src was unable to completely block the phosphorylation. These results demonstrate that c‐Src, although important, may not be the only one of SFKs that is involved in tyrosine phosphorylation. Therefore, to further establish if c‐Src activity is required for the phosphorylation of SLC11A1, U973 cells stably expressing SLC11A1 were transiently transfected with vectors to express either kinase‐dead Src (K297R) or wild type Src or transfected with empty vectors as a control. As shown in Figure
4.3D, the tyrosine phosphorylation level of SLC11A1 significantly decreased in cells transfected with kinase‐dead Src but increased in Wt Src‐transfected cells.
Transfection of empty vector did not affect the tyrosine phosphorylation. All these data demonstrate that Src kinase activity is involved in the PMA‐induced tyrosine phosphorylation of SLC11A1. In order to know if Src phosphorylates
SLC11A1 directly, in vitro kinase assays were performed using purified Src and
GST‐tagged SLC11A1 protein. As shown in Figure 4.4, tyrosine phosphorylation of
SLCA11A1 increased in a Src concentration‐dependent manner. Taken together, our results demonstrate that SLC11A1 is directly phosphorylated by Src.
PMA induces the association between Src and SLC11A1 in intact cells
To determine whether SLC11A1 and c‐Src are associated in vivo, U937‐SLC11A1 cells were transiently transfected with c‐Src and the interaction between
SLC11A1 and Src was analyzed by co‐immunoprecipitation followed by protein
193
Figure 4.3 Effects of Src knockdown or overexpression of kinase‐inactive Src on the tyrosine phosphorylation of SLC11A1. U937‐SLC11A1 cells were transiently trannsfected with c‐Src siRNA or mock (transfection reagents only) for 24 h and were then treated with PMA for another 48 hrs. (A) Protein extracts from untransfected cells (CTR), mock transfected cells, as well as siRNA transfected cells were prepared and analyzed by Western blot analysis using antibodies specific to Src, SLC11A1 and actin. (B) Protein extracts from untransfected cells
(CTR), mock transfected cells, as well as siRNA transfected cells were prepared and immunoprecipitated with a mouse monoclonal antibody 9E10.
Immunoprecipitates were probed with antibody 4G10 to phosphotyrosine. The
Western blots were stripped and re‐probed with an antibody against SLC11A1. (C)
The level of SLC11A1 phosphorylation was quantified and normalized as described in “Materials and Methods”, and was expressed as a percentage of the level of total SLC11A1 protein. (D) U937 cells were transiently transfected with empty plasmid (pCB6), plasmid expressing wild type c‐Src (pCB6‐Src) or expressing kinase‐inactive c‐Src (pCB6‐KI‐Src). 24 hrs after transfection, cells were treated with PMA for another 48 hrs and then lysed. Immunoprecipitation and immunoblotting were performed as in (B). Expression of c‐Src was also analysed using an anti‐c‐Src antibody. The effect of c‐Src knockdown or overexpression of KI‐Src on SLC11A1 phosphorylation was assessed in 3 separate experiments (mean± SE, *P<0.001).
194
195
Figure 4.4 In vitro phosphorylation of SLC11A1 by c‐Src. A fixed amount of GST‐
SLC11A1 (500ng, a.a.1‐a.a.178) was incubated with increasing amounts (50‐
200ng) of purified Src, as indicated. Phosphorylation levels of protein were analyzed by immunoblotting with anti‐phosphotyrosine antibodies (4G10) (top).
The same blots were then reprobed with anti‐GST antibodies for GST‐SLC11A1 fusion protein as a loading control.
196
197 immunoblotting with specific antibodies to SLC11A1 and c‐Src. As shown in
Figure 4.5A, when using antibody 9E10 to immunoprecipitate the c‐Myc tagged
SLC11A1 and associated proteins, we were unable to detect the co‐precipitation of endogenous and co‐expressed c‐Src without PMA treatment. However, when cells were treated with PMA for 48 hrs, either endogenous or co‐expressed c‐Src was found in the complex with SCL11A1. Similarly, when c‐Src and associated proteins were immunoprecipitated with a specific antibody against c‐Src, we were able to detect the co‐precipitation of SLC11A1 with endogenous and co‐ expressed c‐Src in response to PMA treatment. Note that significantly more
SLC11A1‐c‐Src complexes were immunoprecipitated after increasing the c‐Src protein levels by transfection (Figure 4.5A). To determine whether native c‐Src and SLC11A1 are also associated under physiological conditions, HL‐60 cells were differentiated into macrophages and the association between SLC11A1 and c‐Src was also detected using co‐immunoprecipitation assay. As shown in Figure 4.5B,
SLC11A1 expression was undetectable in untreated HL‐60 cells as we showed previously (Xu et al., 2005) and it was also undetectable in c‐Src complexes from the untreated HL‐60 cells, but it appeared in the c‐Src complexes from PMA‐ treated HL‐60 cells. In both untreated and PMA‐treated HL‐60 cells, c‐Src could be detected. Our results demonstrate that association of SLC11A1 and c‐Src occurs under physiological conditions and does not depend on expression in a heterologous system.
198
Figure 4.5 PMA‐induced association of SLC11A1 with c‐Src in intact cells. U937‐
SLC11A1 cells were transiently transfected with a vector pCB6‐Src to express wild‐type c‐Src. Untransfected cells used as a control. Both transfected and untransfected cells were treated with or without PMA (10ng/ml) for 48 hrs as indicated. (A) Cell lysates were prepared and immunoprecipitated with a mouse monoclonal antibody (9E10) directed against the c‐Myc tag or anti‐Src antibodies.
Immunoprecipitates were analyzed by Western blot analysis as indicated. (B) HL‐
60 cells were either treated or untreated with PMA (10ng/ml) for 72 hrs. Cell lysates were prepared and the expression of SLC11A1 and c‐Src in response to
PMA treated were detected by using Western blot analysis (left panel). Protein extracts were immunoprecipitated with a c‐Src antibody. The immunocomplexes were detected by immunoblotting with an antibody against SLC11A1 and reprobed with an antibody against c‐Src.
199
200 Interaction of c‐Src with the N‐terminal of SLC11A1
The amino‐terminus of SLC11A1 contains a proline‐rich domain (PRD) characteristic of an SH3 binding domain and two potential tyrosine phosphorylation sites (Barton et al., 1994). This suggests that c‐Src may bind to the N‐terminal region of SLC11A1. To confirm that the PRD of SLC11A1 protein is involved in the binding to c‐Src, we constructed three vectors for expression of c‐
Myc‐tagged SLC11A1 mutants that lack the N‐terminus, C‐terminus or PRD
(Figure 4.6A). U937 cells were transfected with these vectors together with the vector expressing c‐Src and were then treated with PMA for 48 hrs. Transfected cells were lysed and immunoprecipitated with anti‐c‐Myc antibody (9E10). The precipitated proteins were separated on an SDS‐PAGE gel and probed with a rabbit polyclonal antibody against c‐Src. The results showed a protein band of
~60 kDa corresponding to the expected size of c‐Src, which bound to the truncated SLC11A1 that lacks a C‐terminal region but not to the truncated
SLC11A1 that lacks an N‐terminal region or the PRD‐ deletion mutant (Figure 6B, upper panel). Expression of the c‐Myc‐tagged wild‐type SLC11A1, N‐terminal deletion, C‐terminal deletion or PRD‐deletion mutant in transfected cells was also detected by Western blot analysis (Figure 4.6B, bottom panel). In order to know if c‐Src binds directly to the PRD of SLC11A1, in vitro Src binding assays were performed with synthetic peptides. As shown in Figure 4.6C, c‐Src binds to the Src substrate Sam68 (amino acids 331‐443) which was used as a positive control but not to either a synthetic peptide (ISSPTSPTSPGPRQAPPRET)
201
Figure 4.6 The proline‐rich region of Slc11a1 is required for association with Src kinase. (A) Schematic representation of the C‐terminal, N‐terminal and PRD‐ deletion constructs of SLC11A1 (N‐terminal del, C‐terminal del and PRD del).
Amino acid residues 1‐57 and 522‐550 were considered to be the N‐terminal and
C‐terminal regions, respectively. (B) U937 cells were transfected with constructed pCB6 vectors expressing c‐Myc‐tagged wild‐type Slc11a1, N‐ terminal‐, C‐terminal‐ or PRD‐deletion mutant together with c‐Src expression vector. Transfected cells were treated with PMA for 48 hrs and cell lysates were immunoprecipitated with anti‐c‐Myc antibody (9E10). The bound proteins were probed with a rabbit polyclonal antibody against c‐Src. Expression of c‐Myc‐ tagged wild‐type SLC11A1, N‐terminal, C‐terminal or PRD‐deletion mutant in transfected cells were also detected by Western blot analysis. (C) In vitro binding of c‐Src to the PRD of SLC11A1. The SLC11A1 PRD peptide (ISSPTSPTSPGPRQAPP
RET), the negative control peptide (IPDTKPGTFSLRKLWAFTGPGFLM) and the positive control peptide (Src substrate Sam68), which were described in
Materials and Methods, were coupled to activated CH‐Sepharose 4B. Binding of these peptides to purified c‐Src was detected by immunoblotting with anti‐Src antibody. A representative Western blot is shown.
202
203 that matches the proline‐rich region of the SLC11A1 protein (SLC11A1 PRD peptide) nor a negative control peptide (IPDTKPGTFSLRKLWAFTGPGFLM) designed from the N‐terminal region that lacks the PRD did not display appreciable binding to c‐Src. These results suggest that c‐Src kinase might be recruited via an adaptor protein binding to the PRD of the SLC11A1 protein.
Phosphorylation of SLC11A1 at Tyr‐15 residue by Src kinase is required for
SLC11A1‐mediated NO production
The N‐terminal region of SLC11A1 protein contains two tyrosine residues, Y15 and Y38, which could potentially be phosphorylated by c‐Src kinase. To identify the specific phospho‐tyrosine residue(s), we generated SLC11A1 constructs bearing tyrosine‐to‐phenylalanine substitutions at Y15 or Y38 (Figure 4.7A). c‐
Myc‐tagged wild‐type SLC11A1 or substitution mutants were expressed in U937 cells. Transfected cells were treated with PMA for 48 hrs and cell lysates were prepared and subjected to immunoprecipitation with antibody 9E10. The precipitated protein complexes were probed with the anti‐phosphotyrosine antibody 4G10 to detect phosphorylated wild‐type SLC11A1 or its substitution mutants and their phosphorylation levels were quantitated. As illustrated in
Figures 4.7B and 4.7C, tyrosine phosphorylation of the Y15F mutant of SLC11A1 protein was dramatically lower compared to wild‐type SLC11A1 (P<0.001).
Conversely, the phosphorylation level of the Y38F mutant was almost the same as for the wild‐type SLC11A1. Overall, these results demonstrate that the
204 Figure 4.7 Identification of the tyrosine phosphorylation site of SLC11A1 by c‐
Src. (A) Site‐directed mutagenesis was used to make the Tyr to Phe substitution at position 15 or 38 of SLC11A1. (B) U937 cells stably expressing c‐Myc‐tagged wild‐type or mutated SLC11A1 (Y15F or Y38F) were transiently transfected with a pCB6‐Src vector. 24 hours after transfection, cells were treated with PMA for 48 hrs. Cell lysates were prepared and immunoprecipitated with anti‐c‐Myc antibody (9E10). The tyrosine phosphorylation of SLC11A1 was analyzed by immunoblotting with antibody 4G10 to phosphotyrosine (top panel). The
Western blots were stripped and re‐probed with an antibody against SLC11A1
(middle panel). The expression of c‐Src (bottom panel) was also analyzed using anti‐Src antibody. (C) The level of SLC11A1 phosphorylation in transfected cells was quantified and normalized as described in “Materials and Methods”, and was expressed as a percentage of the level of total SLC11A1 protein (mean ± S.E., n=3, *P <0.001). (D) U937 cells were stably transfected with constructed pCB6 vectors expressing c‐Myc‐tagged wild‐type or mutated SLC11A1 (Y15F).
Transfected cells were treated with PMA for 0, 6, 24 and 72hrs. Release of NO was measured using Griess reagent (mean ± S.E., n=4, *P <0.01).
205
206 SLC11A1 protein is primarily phosphorylated by c‐Src kinase on tyrosine 15. To assess if tyrosine phosphorylation affect the function of SLC11A1, we detected the NO production induced by PMA treatment. As shown in Figure 4.7D, compared with wild type SLC11A1, PMA‐induced NO production was significantly decreased in U937 cells expressing the Y15F mutant. The result demonstrate that tyrosine 15 phosphorylation is required for SLC11A1‐mediated NO production.
Src family kinase activity is required for lysosomal targeting of SLC11A1 in macrophages.
In order to establish whether the activity of Src family kinases is essential for lysosomal targeting and localization of the SLC11A1 protein, U937‐SLC11A1 cells were pretreated with PMA for 48 h to induce the macrophage differentiation and were then left untreated or treated with 10 M PP2 or 10 M PP3. After treatment with PP2 for 24 hours, the cells were double‐labeled with an antibody against c‐Myc (9E10) and another antibody against Lamp1 (a marker for late endosomal and lysosomal compartments) followed by staining with a mixture of
FITC and Texas Red–labeled secondary antibodies. Consistent with previously published data (White et al., 2004), in untreated macrophages, the SLC11A1 protein localized in vesicular compartments that showed strong colocalization with the lysosomal marker Lamp1 (Figures 4.8A and 4.8B). In contrast, the
SLC11A1 protein in PP2‐treated cells displayed little colocalization with Lamp1 and showed a reticular distribution that was more intense in the perinuclear
207 region. PP3 treatment did not affect the colocalization of the SLC11A1 protein with Lamp1 (Figures 4.8A and 4.8B). In control untransfected U937 cells, double staining showed a normal signal for Lamp1, but did not show any signal for
SLC11A1, indicating that the observed colocalization of SLC11A1 and Lamp1 in transfected cells was not due to the cross‐reaction of the secondary antibodies.
Quantification analysis showed that the colocalization of SLC11A1 with Lamp1 was reduced by more than 90% in PP2‐treated cells (Figure 4.8B, P<0.001). These findings demonstrate that Src family kinase activity is also required for the lysosomal localization of SLC11A1.
Effect of c‐Src knockdown on the lysosomal targeting of SLC11A1 protein
To further determine whether the observed down‐regulation of SLC11A1 protein expression in lysosomes was due specifically to the inhibition of c‐Src kinase. As shown in Figures 4.9A and 4.9B, siRNA‐mediated knockdown of c‐Src expression resulted in a significant decrease in colocalization of SLC11A1 with
Lamp1. Further analysis showed that the colocalization of SLC11A1 with Lamp1 in c‐Src knockdown cells were higher than that in the cells treated with PP2
(P<0.005), which suggests that molecular knockdown of c‐Src was unable to completely block the phosphorylation and lysosomal targeting of Slc11a1. These results demonstrate that c‐Src may not be the only one of SFKs that is involved in lysosomal targeting of the SLC11A1 in macrophages.
208
Figure 4.8 Effects of Src family kinase inhibitor, PP2, on the subcellular localization of SLC11A1 protein. U937‐SLC11A1 cells were treated with PMA for
48 hrs followed by treatment with PP2 or PP3 for another 24h. Untransfected
U937 cells were also treated with PMA for 72 hrs. Cells were then fixed, permeabilized, and incubated with a mouse monoclonal antibody 9E10 and a rabbit anti‐Lamp1 monoclonal antibody, followed by staining with a mixture of
FITC and Texas Red–labeled secondary antibodies. The localization of Slc11a1 and Lamp1 in individual cells was detected by confocal microscopy. The combined fluorescence in the merge, representing co‐localization, is shown in yellow. These data are representative of at least three separate experiments and observations of approximately 100 cells from each. (B) Co‐localization of
SLC11A1 and Lamp1 was expressed as a percentage of total SLC11A1 protein as described in “Materials and Methods”. The data shown are the mean± SE of results from 50 individual cells from a total of three experiments. *P<0.001.
209
Figure 4.8
210
Figure 4.9 Effects of Src knockdown on the subcellular localization of SLC11A1.
(A) U937‐SLC11A1 cells were transiently transfected with c‐Src siRNA or mock
(transfection reagents only) for 24 hrs followed by treatment with PMA for 48 hrs. Immunofluorescence analysis of colocalization of SLC11A1 and Lamp1 was performed as described in Figure 8A. (B) The effect of c‐Src knockdown on co‐ localization of SLC11A1 and Lamp1 was expressed as a percentage of total
SLC11A1 as described in “Materials and Methods”. The data shown are the mean± SE of results from 50 individual cells from a total of three experiments.*P<0.001.
211
Figure 4.9
212 Tyr‐15 phosphorylation is not required for SLC11A1 targeting to lysosomes
In order to establish whether Y15 phosphorylation of SLC11A1 is important for its sorting to lysosomes, U937 cells were transiently transfected with the constructs expressing c‐Myc‐tagged wild‐type SLC11A1 or Y15F mutant and treated with
PMA for 48 hrs for differentiation. Colocalization of wild‐type SLC11A1 or Y15F mutant with Lamp1 was detected using indirect immunofluorescence analysis.
The transfected cells were double‐stained for SLC11A1 (green) and Lamp1 (red).
As shown in Figures 4.10A and 4.10B, tyrosine‐to‐phenylalanine substitutions at
Y15 (Y15F mutant) did not significantly affect the colocalization of the mutant with Lamp1. Our results indicate that phosphorylation of SLC11A1 on tyrosine 15 is not necessary for its lysosomal localization.
4.5 Discussion
The SLC11A1 protein has been shown to be a highly glycosylated, 12 transmembrane domain‐containing protein. This protein resides in the membrane of late endosomes and lysosomes, where it functions as a divalent cation transporter. Although the targeting of SLC11A1 to the membrane of lysosomes is critical for its antimicrobial activity, so far, little is known about the sorting mechanism. White and colleagues have shown that N‐glycosylation of
SLC11A1 does not influence protein folding or sorting. The mutant Slc11a1, carrying a glycine to aspartic acid substitution at position 169 (G169D) within
213
Figure 4.10 Phosphorylation of SLC11A1 at Y15 is not required for its lysosomal targeting. (A) U937 cells expressing c‐Myc‐tagged wild‐type SLC11A1 or Y15F mutant were treated with PMA for 48 hrs and were then fixed and permeabilized.
Immunofluorescence analysis of colocalization of SLC11A1 and Lamp1 was performed as described in Figure 8A. (B) Co‐localization of SLC11A1 and Lamp1 was expressed as a percentage of total SLC11A1 protein as described in
“Materials and Methods”. The data shown are the mean± SE of results from 50 individual cells from a total of three experiments. *P<0.001.
214
Figure 4.10
215 transmembrane domain 4 of Slc11a1, showed localized misfolding that resulted in its retention in the endoplasmic reticulum (White et al., 2004). Slc11a2 is a close homologue of Slc11a1 which is expressed both at the duodenal brush border and at the plasma membrane/recycling endosomes of many cell types
(Canonne‐Hergaux et al., 1999;Canonne‐Hergaux et al., 2001;Gruenheid et al.,
1995;Gruenheid et al., 1997). It was recently reported that a Slc11a2 isoform II chimera bearing the N‐terminus of Slc11a1 was not expressed at the cell surface but was targeted to the lysosome, as is Slc11a1. This lysosomal targeting was abolished by a single alanine substitution at either Tyr15 or Ile18 of the 15YGSI18 motif present in the N‐terminus of Slc11a1, suggesting that tyrosine‐based motif
(Y15GSI18) functions as a sorting signal for lysosomal targeting of Slc11a1(Lam‐
Yuk‐Tseung et al., 2006). In this study, we observed that a Tyr to Phe substitution at position 15 of SLC11A1 does not significantly affect its lysosomal localization, which suggest that, except for YGSI motif, there might be other signal peptide (s) to direct SLC11A1 targeting to lysosome. At least at the C‐terminal domain of
SLC11A1, there is another conserved tyrosine residue in the context of YGLP.
Both meet the requirement for the residues to be present in a tyrosine‐based sorting motif, YXX (where Y is tyrosine, X is any residue and is a bulky hydrophobic residue) (Marks et al., 1997). Indeed, a recent study showed that bovine SLC11A1 contains multiple signal motifs for targeting to lysosome (Cheng and Wang, 2012). SLC11A1 protein would more likely be directly delivered from the trans‐Golgi network (TGN) to late endosomal/ lysosomal compartments
216 because of the presence of tyrosine‐based targeting signals. Such signals have been implicated in directing the sorting of transmembrane proteins (Marks et al.,
1997;Ohno et al., 1995). Our research demonstrates that c‐Src kinase activity is involved in this targeting process.
Computer‐assisted sequence analysis of SLC11A1 amino acids indicates that the SLC11A1 protein N‐terminal region contains a PRD and two potential tyrosine phosphorylation sites. Also, it has been shown that the SLC11A1 is phosphorylated in macrophages and SLC11A1 phosphorylation is altered in response to cytokine stimulation (Barton et al., 1999;Vidal et al., 1996). However, the tyrosine phosphorylation has not been confirmed and the phosphorylation sites have not been identified. The correlation between phosphorylation status and SLC11A1 protein activity remains unknown. To assess whether the two potential tyrosine phosphorylation sites are targets of Src family kinases, we analyzed the interaction between SLC11A1 and c‐Src. An association of c‐Src with
SLC11A1 was observed during the differentiation of U937‐SLC11A1 as well as HL‐
60 cells into macrophages by PMA. Further study revealed that c‐Src was associated with the N‐terminal of SLC11A1 and this association was abrogated when the PRD in the N‐terminus of SLC11A1 was removed. However, in vitro binding assay showed that c‐Src did not bind to the synthetic peptide
(ISSPTSPTSPGPRQAPPRET) that matches the proline‐rich region of the SLC11A1 protein. These results suggest that c‐Src is likely associated with the SLC11A1 via
217 another adaptor protein bound to the PRD at the N‐terminus which remains to be identified.
In this study, we found that SLC11A1 is phosphorylated by Src family kinases at tyrosine 15 present in a conserved tyrosine‐based motif (YGSI) among all species. The phosphorylated 15YGSI18 motif resembles the SH2 domain binding motif pYXX(I/L/V), which can be recognized and bound by a class of SH2 domain‐ containing proteins. The SH2 domain was first identified in the oncoproteins Src and Fps and this domain has about 100 amino‐acid residues in length. Human genomic analysis revealed 121 SH2 domains that are distributed in 115 individual proteins involved in a wide range of signaling events (Liu et al., 2006a). SH2 domains typically bind a specific tyrosine phosphorylation site within a target protein and thereby linking activated protein tyrosine kinases to downstream signaling pathways that regulate gene expression and cellular activation processes. These include cell differentiation, cell migration and recognition of receptor tyrosine kinases (Liu et al., 2012). Here, we found that tyrosine 15 phosphorylation is required for SLC11A1‐mediated NO production during the differentiation of U937 cells by PMA treatment. It is postulated that a certain
SH2 domain‐containing protein is recruited to the pYGSI motif in response to
PMA stimulation controlling the downstream events such as NO production and
NF‐kB signaling pathway.
This study demonstrated that knockdown of c‐Src kinase by siRNA results in a significant reduction in tyrosine phosphorylation of SLC11A1 and its
218 colocalization with Lamp1 compared with untreated cells. However, when compared to the cells treated with PP2, a broad‐spectrum inhibitor of Src family kinases, both the tyrosine phosphorylation of SLC11A1 and its colocalization with
Lamp1are much higher. This suggests that aside from c‐Src, other Src family kinase(s) might also be involved in the tyrosine phosphorylation of SLC11A1 and in directing the lysosomal targeting of this protein. The Src family of protein‐ tyrosine kinases is composed of at least eight members (Src, Lck, Hck, Fyn, Fgr,
Yes, Blk and Lyn), which share major structural and regulatory features. Along with Src, Hck, Fyn and Fgr are also found in macrophages (Ziegler et al., 1988).
Gotoh and colleagues demonstrated that ‐adducin is phosphorylated by Fyn at tyrosine 489, resulting in its recruitment to the Fyn‐enriched region in the plasma membrane (Gotoh et al., 2006a). Radha and colleagues have shown that the guanine nucleotide exchange factor C3G is phosphorylated by HcK on tyrosine 504. Unlike C3G, which is mostly cytosolic, pY504‐C3G translocates to the Golgi and subcortical cytoskeleton, indicating that Hck regulates the C3G localization within the cell (Radha et al., 2004). As Fyn and Hck kinases are also involved in the protein phosphorylation and localization, it remains to be established whether or not Fyn and Hck participate in the phosphorylation and lysosomal targeting of SLC11A1.
In conclusion, we provide strong evidence that Src family kinases play a crucial role in tyrosine phosphorylation of the SLC11A1 protein and their activity is required for the sorting of SLC11A1 to the lysosomes.
219 4.6 Acknowledgements
We greatly appreciate Dr. Philip Gross for kindly providing the U937‐NRAMP1 cell line. We are also grateful to Jenney Chen for his help with the confocal microscope analysis. This work was supported by the Canadian Institute of
Health Research and NSERC grants (to DR), and Fonds de la recherche en santé du Québec (17734, to YZX).
220
CHAPTER 5
Summary and General Discussion
221 5.1 Summary
The expression of SLC11A1/Slc11a1 gene is limited to myeloid lineages such as macrophages, polymorphonuclear neutrophils and dendritic cells, and is acquired during the maturation of these professional phagocytes derived from hematopoietic progenitors (Cellier M, J Leukoc. Biol., 1996, 61:96‐105; Xu YZ, MBC,
2005). However, the cell‐ type specific mechanism to control the SLC11A1 gene expression remains to be elucidated. The human promyelocytic leukemia cell lines, such as HL‐60 and U937 cells, provide useful models to study the regulation of SLC11A1 gene expression during experimentally induced monocytic or granulocytic differentiation pathways. In this thesis, we used HL‐60 and U937 cells as models to identify the cis‐acting elements, transcriptional factors and regulators involved in the activation of SLC11A1 gene expression, and to investigate the phosphorylation modification and subcellular localization of
SLC11A1 protein. The major original findings presented in this thesis are summarized as follows:
During the phorbol 12‐myristate 13‐acetate (PMA)‐induced differentiation
of HL‐60 cells into macrophage‐like cells, β‐actin translocates from the
cytoplasm to the nucleus, and nuclear accumulation of ‐actin is
dependent on p38 MAPK pathway.
Chromatin immunoprecipitation‐on‐chip assays demonstrated that in
untreated HL‐60 cells only few gene promoters bound by nuclear β‐actin
but over 800 gene promoters display enriched binding by β‐actin in
222 response to PMA treatment. SLC11A1 gene promoter is one of the targets.
A gene ontology‐based analysis showed that the identified genes belong
to a broad spectrum of functional categories such as cell growth and
differentiation, signal transduction, response to external stimulus, ion
channel activity, and immune response.
Down‐regulation of nuclear ‐actin by siRNA‐mediated ‐actin knockdown,
nuclear microinjection of ‐actin antibody or p38 MAPK inhibitors results
in a significant decrease in PMA‐induced SLC11A1 mRNA level and
luciferase activity driven by SLC11A1 promoter. Our results demonstrate
that ‐actin is involved in the transcriptional activation of SLC11A1 gene
induced by PMA.
Promoter deletion analysis demonstrates that a proximal promoter region
between nucleotide ‐395 and ‐ 264 is essential for PMA‐induced
transactivation of SLC11A1 gene. A 7‐base AP‐1‐like element (TGACTCT)
within this region is identified as PMA‐response element.
PMA induces the complex formation among ATF‐3, Brg‐1 and β‐actin, and
ATF‐3 mediates the recruitment of Brg‐1 and β‐actin to the AP‐1‐like
element. Knockdown of Brg‐1 or ATF‐3 diminishes the PMA‐induced
SLC11A1 expression. ATF‐3 cooperates with Brg‐1 and β‐actin (two
subunits of the SWI/SNF complex) to activate the SLC11A1 promoter in
response to PMA treatment.
223 The dinucleotide repeats, t(gt)5ac(gt)5ac(gt)9g, adjacent to the AP‐1‐like
element, is converted into Z‐DNA conformation in response to PMA
stimuli and BRG1 is involved in this process. Our results suggest that PMA‐
induced recruitment of SWI/SNF complex initiates Z‐DNA formation and
subsequently helps to transactivate the SLC11A1 gene.
PMA induces the phosphorylation of SLC11A1 protein on tyrosine 15 and
Src family kinases activities including c‐Src kinase are required for the
tyrosine 15 phosphorylation.
Phosphorylation of SLC11A1 on tyrosine 15 is necessary for SLC11A1‐
mediates nitric oxide production.
Src family kinases activities including c‐Src kinase are involved in lysosomal
targeting of SLC11A1 protein.
5.2 General Discussion
The proximal promoter region of SLC11A1 possesses a polymorphic
(GT/AC)n microsatellite repeat, which has been linked to susceptibility to infectious and autoimmune diseases. To date, 9 SLC11A1 alleles, which differ in microsatellite length, have been identified in different populations worldwide
(designated alleles 1‐9, Table 1). Interestingly, studies have shown that the
224 polymorphic repeat acts as a functional polymorphism, influencing SLC11A1 gene expression (Searle and Blackwell, 1999;Zaahl et al., 2004). Allele 2 and allele 3, two predominant alleles of the 9, have opposite effects on SLC11A1 gene expression (O'Brien et al., 2008;Searle and Blackwell, 1999). Allele 3, the most common allele in humans, drives high expression of SLC11A1 gene while allele 2 exhibits low promoter activity (Searle and Blackwell, 1999;Zaahl et al., 2004).
Given the important roles of SLC11A1 gene in macrophage activation, it is natural to postulate that high expression of SLC11A1 driven by allele 3 contributes to autoimmunity and inflammation but protects against infectious diseases, whereas low expression of SLC11A1 driven by allele 2 is functionally linked to infectious disease susceptibility but protects against autoimmunity and inflammation (Awomoyi, 2007;O'Brien et al., 2008;Searle and Blackwell, 1999).
This hypothesis has been supported by some studies, especially by Bronwyn and colleagues (O'Brien et al., 2008). Therefore, host susceptibility to a disease may be linked to differential expression level of SLC11A1 gene resulting from a particular genetic variant of the gene. Gene expression is controlled both by cis‐ acting elements and trans‐acting factors, as well as epigenetic factors and environmental factors of the cells (Jones and Swallow, 2011;Stranger et al.,
2007). Analysis of the SLC11A1 microsatellite repeat (GT/CA) n revealed the presence of two putative cis‐acting elements: hypoxia responsive elements
(HREs, TACGTG). Cotransfection of BHK cells with SLC11A1 promoter (allele 3)‐ driven luciferase reporter and either HIF‐1α or HIF‐2α demonstrated that under
225 normoxic conditions HIF‐1α induced up to 4‐fold increase in lucifearse activity whereas HIF‐2α had no effect on transactivation of SLC11A1 promoter. The HIF‐
1α‐induced transactivation of SLC11A1 promoter was abrogated when both HREs were mutated. Further studies revealed that HIF‐1α regulates allelic variation in
SLC11A1 expression by binding directly to the HREs‐containing microsatellite during the activation of macrophages by infection or proinflammatory stimuli
(Bayele et al., 2007).
A high level of SLC11A1 gene expression in mature myeloid cells prompted researchers to study the mechanism of regulation of SLC11A1 gene expression during either monocytic or granulocytic differentiation pathways. For example,
SLC11A1 is induced to express during the differentiation of HL‐60 cells into monocytes by 1alpha, 25‐dihydroxy‐vitamin D3 (VitD). Studies have shown that a
263 bp proximal region upstream of the SLC11A1 ATG drives maximal promoter activity in non myeloid cell lines whereas the more distal region between 264 and 588 bp upstream of SLC11A1 ATG confers myeloid specificity and is required for transactivation of SLC11A1 during the differentiation of HL‐60 cells by VitD
(Richer et al., 2008;Roig et al., 2002). Two cis‐acting elements in the SLC11A1 promoter were identified for myelo‐monocytic expression. One distal cis‐acting element binds transcription factor Sp1, which transactivates SLC11A1 promoter in vivo and is required for SLC11A1 myeloid expression. Another site in the proximal region binds to CCAAT enhancer binding proteins (C/EBPs) α or β, which is required for transcriptional activation during monocytic and granulocytic
226 differentiation. Site‐directed mutagenesis of this C/EBPs binding site also abrogated the SLC11A1 promoter activity in non myeloid cells, suggesting it is essential for recruitment of the basal transcription machinery (Richer et al.,
2008).
In chapter 2 of present study, we found that during the process of PMA‐ induced macrophage‐like differentiation of HL‐60 cells, β‐actin translocates from the cytoplasm to the nucleus and p38 MAPK activity is involved in the β‐actin translocation. Although nuclear translocation of actin in response to cellular stress, such as DMSO treatment, heat shock, latrunculin B treatment and depletion of ATP (Courgeon et al., 1993;Pendleton et al., 2003;Sanger et al.,
1980a;Sanger et al., 1980b), has been reported for many years, the biological significance of nuclear accumulation of actin in response to external signals remains unclear. Our results demonstrated that PMA induces the binding of nuclear β‐actin to hundreds of promoters of target genes involved in diverse functions. SLC11A1 promoter is one of those targets and nuclear translocation of
β‐actin is involved in transcriptional activation and expression of SLC11A1 gene.
Therefore, it is tempting to postulate that under stress, β‐actin translocates into the nucleus and functions as a transcriptional modulator, playing an important role in the regulation of gene expression along with stress‐activated transcription factors. Previous studies have shown that β‐actin is involved in transcriptional regulation through different ways: 1) Actin participates in chromatin remodeling for gene activation as a component of the chromatin remodeling complex
227 (Rando et al., 2002;Song et al., 2007;Zhao et al., 1998); 2) Actin plays a direct role in RNA transcription by being part of the pre‐initiation complex with RNA polymerase II (Hofmann et al., 2004); 3) Actin participates in transcriptional elongation as a component of RNP particles (Xu et al., 2012). In addition, actin was also shown to specifically bind to a 27‐nt repeat element in the intron 4 of the endothelial nitric oxide synthase gene to regulate its expression (Ou et al.,
2005;Wang et al., 2002a). Therefore, the next question is how β‐actin is involved in the transcriptional regulation of SLC11A1 gene.
In Chapter 3 of this thesis, an AP‐1‐like element which is crucial for transactivation of SLC11A1 gene expression along macrophage‐like differentiation of HL‐60 cells by PMA was characterized. The AP‐1‐like element is also known as activating transcription factor 3 (ATF‐3) ‐binding site, which has been shown to be bound by ATF and AP‐1 transcription factor families. We found that PMA induces the binding of ATF‐3 together with BRG1 and β‐actin to
AP‐1‐like element. BRG1 and β‐actin are two important subunits of SWI/SNF chromatin remodelling complex. It has been proposed that β‐actin and actin‐ related proteins are required for the maximum ATPase activity of SWI/SNF
(Rando et al., 2002;Shen et al., 2003) and for the stable association between chromatin and chromatin remodeling complex (Olave et al., 2002). BRG1, an
ATPase subunit of the SWI/SNF chromatin remodeling complex, plays a critical role in SWI/SNF‐mediated transcriptional regulation (Trotter and Archer, 2008).
The essential role of BRG1 in hematopoietic development has previously been
228 established (Bultman et al., 2005;Vradii et al., 2006). A study has demonstrated that BRG1 and INI1, two core subunits of the hSWI/SNF complex, associate with the acute myeloid leukemia 1(AML1/RUNX1) transcription factor and are recruited to RUNX1 target gene promoters to control hematopoietic‐specific gene expression (Bakshi et al., 2010). Our results demonstrated that a co‐ operation between ATF‐3 and SWI/SNF complex is necessary for transcriptional activation of the SLC11A1 gene during macrophage differentiation. Previous studies have shown that C/EBPs can also recruit SWI/SNF complex (Kowenz‐Leutz and Leutz, 1999;Muller et al., 2004), it would be interesting to determine if nuclear β‐actin is also involved in VitD‐induced SLC11A1 gene expression.
The functional selectivity of the SWI/SNF complex at specific genes is attributable to its recruitment to the target genes through interaction with sequence‐specific transcriptional activators or repressors (Li et al., 2007;Roberts and Orkin, 2004). In chapter 3, we demonstrated that the ATF‐3 mediates the recruitment of SWI/SNF complex to the AP‐1‐like element. The (GT/AC) n repeat sequence adjacent in 3’ to the AP‐1‐like element has been shown to have the propensity to form Z‐DNA (Bayele et al., 2007). Z‐DNA is a left‐handed helical form of DNA which can be transiently induced during gene transcription by a movement of RNA polymerase along DNA template and is stabilized by negative supercoils behind the progressing RNA polymerase (Wang and Vasquez, 2007). Z‐
DNA has been shown to either active or repress gene transcription in a context‐ dependent manner (Oh et al., 2002;Rothenburg et al., 2001). For example, the
229 SW1/SNF‐like BAF chromatin remodeling complex is recruited to and induces Z‐
DNA in the colony‐stimulating factor 1 gene promoter to activate the gene. We demonstrated here that macrophage‐like differentiation induced binding of ATF‐
3/JunB allows the recruitment of β‐actin and BRG1 to the SLC11A1 promoter and initiates the Z‐DNA formation. The Z‐DNA structure may facilitate the interaction of HREs‐containing microsatellite with HIF1‐α/ ARNT heterodimers and transcriptional activation of the SLC11A1 gene. In addition, microsatellite allelic variation can affect the binding of ATF‐3 (Taka et al., 2012) that may affect Z‐
DNA formation and SLC11A1 gene expression.
The Src family kinases are a family of non‐receptor tyrosine kinases that are involved in many signal transduction pathways in normal and cancer cells, and play important roles in different cellular process such as migration, apoptosis, differentiation, transcriptional regulation and subcellular localization (Gotoh et al., 2006b;Tatosyan and Mizenina, 2000). In Chapter 4, we found that SLC11A1 is phosphorylated by Src family kinases at tyrosine 15 during the PMA‐induced differentiation of U937‐SLC11A1 cells into macrophages, and the tyrosine phosphorylation is required for SLC11A1‐mediated nitric oxide production. The phosphorylated 15YGSI18 motif resembles the SH2 domain binding motif pYXX(I/L/V), that can be recognized and bound by a class of SH2 domain‐ containing proteins. SH2 domains typically bind a specific tyrosine phosphorylation site within a target protein and thereby couple activated protein tyrosine kinases to downstream signaling pathways that regulate gene
230 expression. It is tempting to postulate that a certain SH2 domain‐containing protein is recruited to the pYGSI motif in response to PMA stimulation controlling the downstream events such as NO production and NF‐kB signaling pathway. Identification of the SH2 domain‐containing protein would help to understand the role of SLC11A1 in macrophage activation. In addition, Src family kinases have been shown to be implicated in the macrophage inflammatory response to various stimuli (Freudenburg et al., 2010), it will be interesting to investigate if tyrosine 15 phosphorylated by Src family kinases is involved in
SLC11A1‐mediated regulation of signal pathways and inflammatory gene expression. Finally, we demonstrated in Chapter 4 that the activities of c‐Src and its family members are required for lysosomal targeting of SLC11A1 but the molecular mechanisms await further investigation.
5.3 Conclusion
SLC11A1 is specifically expressed in professional phagocytes and a polymorphic (GT/AC)n repeat sequence in the proximal promoter region regulates the expression of SLC11A1 and has been linked to susceptibility to infectious and autoimmune diseases. In this thesis, we found that during macrophage‐like differentiation of HL‐60 cells by PMA, β‐actin translocates from the cytoplasm to the nucleus, and wherein β‐actin and BRG1, two important subunits of SWI/SNF chromatin remodeling complex, are recruited to the proximal promoter region of SLC11A1 gene by transcription factor ATF‐3 and
231 activate SLC11A1 transcription. We have identified the AP‐1‐like element in the proximal SLC11A1 promoter as a cis‐acting element to which SWI/SNF complex and ATF‐3 bind, and induce adjacent downstream (GT/AC)n repeat to convert into Z‐DNA conformation. Since the (GT/AC)n repeat contains two binding sites for transcriptional activator HIF‐1α, it is tempting to speculate that SWI/SNF complex‐induced Z‐DNA structure facilitates the binding of HIF‐1α and the activation of SLC11A1 transcription. In addition, genetic polymorphism in the
(GT/AC)n repeat may affect the Z‐DNA formation and HIF‐1α binding, regulating allelic dependent variation in SLC11A1 expression.
We also demonstrated that Src family kinases are involved in phosphorylation of SLC11A1 at tyrosine 15. Tyrosine phosphorylation plays a key role in regulation of protein function and signal transduction. Therefore, it will be interesting to investigate the effects of tyrosine phosphorylation on the
SLC11A1‐mediated signal pathways and macrophage activation. In addition, Src kinases activities are required for lysosomal targeting of SLC11A1 protein, and appropriate subcellular localization is critical for SLC11A1 function. These findings provide novel evidence to use Src kinase inhibitors for treatment of inflammatory and autoimmune diseases.
Taken together, the data presented in this thesis has shed further light on the understanding of molecular mechanisms involved in the control of tissue specific expression and function of the SLC11A1 gene.
232 CHAPTER 6: Claims to Originality
Expression of SLC11A1 is restricted to mature myeloid cells: primary monocytes, macrophages, neutrophils and dendrtic cells but the mechanisms controlling the tissue‐specific expression remain largely unknown. The studies included in this thesis have identified the specific determinants involved in the activation of SLC11A1 transcription, and characterized the role of Src kinase family in tyrosine phosphorylation modification and subcellular localization of
SLC11A1 protein during the PMA‐induced macrophage differentiation of promyelocytic leukemia cell lines. The specific original findings from this thesis are as follows:
I. During the PMA‐induced macrophage‐like differentiation of HL‐60 cells,
β‐actin translocates from the cytoplasm to the nucleus, and this process is
dependent on p38 MAPK pathway.
II. During the differentiation, nuclear β‐actin is induced to bind to a number
of gene promoters (827 genes) and to recruit RNA polymerase II to several
selected target genes. This supports an idea that nuclear β‐actin level is an
important determinant for transcriptional activity and differentiation.
III. Nuclear translocation of β‐actin is involved in PMA‐induced
transcriptional activation of SLC11A1 gene. This is the first time to
demonstrate that nuclear translocation of β‐actin is involved in
transcriptional regulation in response to external signals.
233 IV. A seven‐base pairs long AP‐1‐like element (TGACTCT) in the proximal
region of SLC11A is identified as PMA‐response element and is required
for transcriptional activation of SLC11A1 gene by PMA.
V. ATF‐3 mediates the recruitment of BRG1 and β‐actin to the AP‐1‐like
Element and cooperation among ATF‐3, BRG1 and β‐actin is required for
activation of SLC11A1 gene expression during the differentiation induced
by PMA.
VI. A polymorphic (GT/AC)n repeat, adjacent to the AP‐1‐like element at its
3’ end, is converted into Z‐DNA conformation in response to PMA
treatment and BRG1 activity is essential for Z‐DNA formation. These data
as well as the data stated above enhance our understanding of how
SLC11A1 gene expression is regulated during macrophage differentiation.
VII. SLC11A1 is phosphorylated at tyrosine 15 by Src family kinases in PMA‐
treated U937 cells. This is the first report to demonstrate the tyrosine
phosphorylation of SL11A1 protein
VIII. Tyrosine 15 phosphorylation is required for SLC11A1‐mediated NO
production in response to PMA stimulation.
IX. Src kinases family is involved in subcellular localization of SLC11A1
protein.
234 Reference List
Abe,T., Iinuma,Y., Ando,M., Yokoyama,T., Yamamoto,T., Nakashima,K., Takagi,N., Baba,H., Hasegawa,Y., and Shimokata,K. (2003). NRAMP1 polymorphisms, susceptibility and clinical features of tuberculosis. J. Infect. 46, 215‐220.
Abel,L., Sanchez,F.O., Oberti,J., Thuc,N.V., Hoa,L.V., Lap,V.D., Skamene,E., Lagrange,P.H., and Schurr,E. (1998). Susceptibility to leprosy is linked to the human NRAMP1 gene. J. Infect. Dis. 177, 133‐145.
Abram,C.L. and Courtneidge,S.A. (2000). Src family tyrosine kinases and growth factor signaling. Exp. Cell Res. 254, 1‐13.
Agalioti,T., Lomvardas,S., Parekh,B., Yie,J., Maniatis,T., and Thanos,D. (2000). Ordered recruitment of chromatin modifying and general transcription factors to the IFN‐beta promoter. Cell. 103, 667‐678.
Agranoff,D., Monahan,I.M., Mangan,J.A., Butcher,P.D., and Krishna,S. (1999). Mycobacterium tuberculosis expresses a novel pH‐dependent divalent cation transporter belonging to the Nramp family. J. Exp. Med. 190, 717‐724.
Aitio,O., Hellman,M., Kazlauskas,A., Vingadassalom,D.F., Leong,J.M., Saksela,K., and Permi,P. (2010). Recognition of tandem PxxP motifs as a unique Src homology 3‐ binding mode triggers pathogen‐driven actin assembly. Proc. Natl. Acad. Sci. U. S. A. 107, 21743‐21748.
Akcakaya,P., Azeroglu,B., Even,I., Ates,O., Turker,H., Ongen,G., and Topal‐Sarikaya,A. (2012). The functional SLC11A1 gene polymorphisms are associated with sarcoidosis in Turkish population. Mol. Biol. Rep. 39, 5009‐5016.
Albini,S. and Puri,P.L. (2010). SWI/SNF complexes, chromatin remodeling and skeletal myogenesis: it's time to exchange! Exp. Cell Res. 316, 3073‐3080.
Alcais,A., Fieschi,C., Abel,L., and Casanova,J.L. (2005). Tuberculosis in children and adults: two distinct genetic diseases. J. Exp. Med. %19;202, 1617‐1621.
Alter,A., Grant,A., Abel,L., Alcais,A., and Schurr,E. (2011). Leprosy as a genetic disease. Mamm. Genome. 22, 19‐31.
Alter‐Koltunoff,M. et al. (2003). Nramp1‐mediated innate resistance to intraphagosomal pathogens is regulated by IRF‐8, PU.1, and Miz‐1. J. Biol. Chem. 278, 44025‐44032.
Alter‐Koltunoff,M., Goren,S., Nousbeck,J., Feng,C.G., Sher,A., Ozato,K., Azriel,A., and Levi,B.Z. (2008). Innate immunity to intraphagosomal pathogens is mediated by interferon regulatory factor 8 (IRF‐8) that stimulates the expression of macrophage‐
235 specific Nramp1 through antagonizing repression by c‐Myc. J. Biol. Chem. 283, 2724‐ 2733.
Asai,S., Abe,Y., Fujino,T., Masukawa,A., Arami,S., Furuya,H., and Miyachi,H. (2008). Association of the SLC11A1 Gene Polymorphisms With Susceptibility to Mycobacterium Infections in a Japanese Population. Infectious Diseases in Clinical Practice 16, 230‐234.
Ascough,K.R. (2004). Endocytosis: Actin in the driving seat. Curr. Biol. 14, R124‐R126.
Atasoy,U., Curry,S.L., Lopez,d.S., I, Shyu,A.B., Casolaro,V., Gorospe,M., and Stellato,C. (2003). Regulation of eotaxin gene expression by TNF‐alpha and IL‐4 through mRNA stabilization: involvement of the RNA‐binding protein HuR. J. Immunol. 171, 4369‐ 4378.
Ates,O., Dalyan,L., Musellim,B., Hatemi,G., Turker,H., Ongen,G., Hamuryudan,V., and Topal‐Sarikaya,A. (2009). NRAMP1 (SLC11A1) gene polymorphisms that correlate with autoimmune versus infectious disease susceptibility in tuberculosis and rheumatoid arthritis. Int. J. Immunogenet. 36, 15‐19.
Atkinson,P.G. and Barton,C.H. (1998). Ectopic expression of Nramp1 in COS‐1 cells modulates iron accumulation. FEBS Lett. 425, 239‐242.
Atkinson,P.G. and Barton,C.H. (1999). High level expression of Nramp1G169 in RAW264.7 cell transfectants: analysis of intracellular iron transport. Immunology. 96, 656‐662.
Atkinson,P.G., Blackwell,J.M., and Barton,C.H. (1997). Nramp1 locus encodes a 65 kDa interferon‐gamma‐inducible protein in murine macrophages. Biochem. J. 325, 779‐786.
Averous,J., Bruhat,A., Jousse,C., Carraro,V., Thiel,G., and Fafournoux,P. (2004). Induction of CHOP expression by amino acid limitation requires both ATF4 expression and ATF2 phosphorylation. J. Biol. Chem. 279, 5288‐5297.
Awomoyi,A., Sirugo,G., Newport,M.J., and Tishkoff,S. (2006). Global distribution of a novel trinucleotide microsatellite polymorphism (ATA)n in intron 8 of the SLC11A1 gene and susceptibility to pulmonary tuberculosis. Int. J. Immunogenet. 33, 11‐15.
Awomoyi,A.A. (2007). The human solute carrier family 11 member 1 protein (SLC11A1): linking infections, autoimmunity and cancer? FEMS Immunol. Med. Microbiol. 49, 324‐ 329.
Baker,S.T., Barton,C.H., and Biggs,T.E. (2000). A negative autoregulatory link between Nramp1 function and expression. J. Leukoc. Biol. 67, 501‐507.
Bakshi,R., Hassan,M.Q., Pratap,J., Lian,J.B., Montecino,M.A., van Wijnen,A.J., Stein,J.L., Imbalzano,A.N., and Stein,G.S. (2010). The human SWI/SNF complex associates with RUNX1 to control transcription of hematopoietic target genes. J. Cell Physiol. 225, 569‐ 576.
236 Barrett‐Connor,E. and Khaw,K. (1984). Family history of heart attack as an independent predictor of death due to cardiovascular disease. Circulation. 69, 1065‐ 1069.
Barton,C.H., Biggs,T.E., Baker,S.T., Bowen,H., and Atkinson,P.G. (1999). Nramp1: a link between intracellular iron transport and innate resistance to intracellular pathogens. J. Leukoc. Biol. 66, 757‐762.
Barton,C.H., White,J.K., Roach,T.I., and Blackwell,J.M. (1994). NH2‐terminal sequence of macrophage‐expressed natural resistance‐associated macrophage protein (Nramp) encodes a proline/serine‐rich putative Src homology 3‐binding domain. J. Exp. Med. 179, 1683‐1687.
Barton,C.H., Whitehead,S.H., and Blackwell,J.M. (1995). Nramp transfection transfers Ity/Lsh/Bcg‐related pleiotropic effects on macrophage activation: influence on oxidative burst and nitric oxide pathways. Mol. Med. 1, 267‐279.
Bayele,H.K. et al. (2007). HIF‐1 regulates heritable variation and allele expression phenotypes of the macrophage immune response gene SLC11A1 from a Z‐DNA forming microsatellite. Blood. 110, 3039‐3048.
Belandia,B., Orford,R.L., Hurst,H.C., and Parker,M.G. (2002). Targeting of SWI/SNF chromatin remodelling complexes to estrogen‐responsive genes. EMBO J. 21, 4094‐ 4103.
Bellamy,R., Ruwende,C., Corrah,T., McAdam,K.P., Whittle,H.C., and Hill,A.V. (1998). Variations in the NRAMP1 gene and susceptibility to tuberculosis in West Africans. N. Engl. J. Med. 338, 640‐644.
Bettinger,B.T., Gilbert,D.M., and Amberg,D.C. (2004). Actin up in the nucleus. Nat. Rev. Mol. Cell Biol. 5, 410‐415.
Biggs,T.E., Baker,S.T., Botham,M.S., Dhital,A., Barton,C.H., and Perry,V.H. (2001). Nramp1 modulates iron homoeostasis in vivo and in vitro: evidence for a role in cellular iron release involving de‐acidification of intracellular vesicles. Eur. J. Immunol. 31, 2060‐2070.
Blackwell,J.M. (2001). Genetics and genomics in infectious disease susceptibility. Trends Mol. Med. 7, 521‐526.
Blackwell,J.M., Barton,C.H., White,J.K., Roach,T.I., Shaw,M.A., Whitehead,S.H., Mock,B.A., Searle,S., Williams,H., and Baker,A.M. (1994). Genetic regulation of leishmanial and mycobacterial infections: the Lsh/Ity/Bcg gene story continues. Immunol. Lett. 43, 99‐107.
Blackwell,J.M., Barton,C.H., White,J.K., Searle,S., Baker,A.M., Williams,H., and Shaw,M.A. (1995). Genomic organization and sequence of the human NRAMP gene: identification and mapping of a promoter region polymorphism. Mol. Med. 1, 194‐205.
237 Blackwell,J.M. et al. (2001). SLC11A1 (formerly NRAMP1) and disease resistance. Cell Microbiol. 3, 773‐784.
Blackwell,J.M., Searle,S., Goswami,T., and Miller,E.N. (2000). Understanding the multiple functions of Nramp1. Microbes. Infect. 2, 317‐321.
Blackwell,J.M., Searle,S., Mohamed,H., and White,J.K. (2003). Divalent cation transport and susceptibility to infectious and autoimmune disease: continuation of the Ity/Lsh/Bcg/Nramp1/Slc11a1 gene story. Immunol. Lett. 85, 197‐203.
Blais,A., Tsikitis,M., costa‐Alvear,D., Sharan,R., Kluger,Y., and Dynlacht,B.D. (2005). An initial blueprint for myogenic differentiation. Genes Dev. 19, 553‐569.
Bleackley,M.R., Wong,A.Y., Hudson,D.M., Wu,C.H., and Macgillivray,R.T. (2009). Blood iron homeostasis: newly discovered proteins and iron imbalance. Transfus. Med. Rev. 23, 103‐123.
Blessing,C.A., Ugrinova,G.T., and Goodson,H.V. (2004). Actin and ARPs: action in the nucleus. Trends Cell Biol. 14, 435‐442.
Blom,N., Gammeltoft,S., and Brunak,S. (1999). Sequence and structure‐based prediction of eukaryotic protein phosphorylation sites. J. Mol. Biol. 294, 1351‐1362.
Bowen,H. (2002). c‐Myc represses and Miz‐1 activates the murine natural resistance‐ associated protein 1 promoter.
Bowen,H., Biggs,T.E., Phillips,E., Baker,S.T., Perry,V.H., Mann,D.A., and Barton,C.H. (2002). c‐Myc represses and Miz‐1 activates the murine natural resistance‐associated protein 1 promoter. J. Biol. Chem. %20;277, 34997‐35006.
Bowen,H., Lapham,A., Phillips,E., Yeung,I., Alter‐Koltunoff,M., Levi,B.Z., Perry,V.H., Mann,D.A., and Barton,C.H. (2003). Characterization of the murine Nramp1 promoter: requirements for transactivation by Miz‐1. J. Biol. Chem. 278, 36017‐36026.
Bradley,D.J. (1977). Regulation of Leishmania populations within the host. II. genetic control of acute susceptibility of mice to Leishmania donovani infection. Clin. Exp. Immunol. 30, 130‐140.
Brakebusch,C. and Fassler,R. (2003). The integrin‐actin connection, an eternal love affair. EMBO J. 22, 2324‐2333.
Bratosin,D., Mazurier,J., Tissier,J.P., Estaquier,J., Huart,J.J., Ameisen,J.C., Aminoff,D., and Montreuil,J. (1998). Cellular and molecular mechanisms of senescent erythrocyte phagocytosis by macrophages. A review. Biochimie. 80, 173‐195.
Brown,D.H., LaFuse,W., and Zwilling,B.S. (1995). Cytokine‐mediated activation of macrophages from Mycobacterium bovis BCG‐resistant and ‐susceptible mice: differential effects of corticosterone on antimycobacterial activity and expression of the Bcg gene (Candidate Nramp). Infect. Immun. 63, 2983‐2988.
238 Brown,D.H., Lafuse,W.P., and Zwilling,B.S. (1997). Stabilized expression of mRNA is associated with mycobacterial resistance controlled by Nramp1. Infect. Immun. 65, 597‐603.
Brunton,V.G., Ozanne,B.W., Paraskeva,C., and Frame,M.C. (1997). A role for epidermal growth factor receptor, c‐Src and focal adhesion kinase in an in vitro model for the progression of colon cancer. Oncogene. 14, 283‐293.
Bultman,S.J., Gebuhr,T.C., and Magnuson,T. (2005). A Brg1 mutation that uncouples ATPase activity from chromatin remodeling reveals an essential role for SWI/SNF‐ related complexes in beta‐globin expression and erythroid development. Genes Dev. 19, 2849‐2861.
Canonne‐Hergaux,F., Calafat,J., Richer,E., Cellier,M., Grinstein,S., Borregaard,N., and Gros,P. (2002). Expression and subcellular localization of NRAMP1 in human neutrophil granules. Blood. 100, 268‐275.
Canonne‐Hergaux,F., Gruenheid,S., Ponka,P., and Gros,P. (1999). Cellular and subcellular localization of the Nramp2 iron transporter in the intestinal brush border and regulation by dietary iron. Blood. 93, 4406‐4417.
Canonne‐Hergaux,F., Zhang,A.S., Ponka,P., and Gros,P. (2001). Characterization of the iron transporter DMT1 (NRAMP2/DCT1) in red blood cells of normal and anemic mk/mk mice. Blood. 98, 3823‐3830.
Caron,J., Lariviere,L., Nacache,M., Tam,M., Stevenson,M.M., McKerly,C., Gros,P., and Malo,D. (2006). Influence of Slc11a1 on the outcome of Salmonella enterica serovar Enteritidis infection in mice is associated with Th polarization. Infect. Immun. 74, 2787‐2802.
Casanova,J.L. and Abel,L. (2002). Genetic dissection of immunity to mycobacteria: the human model. Annu. Rev. Immunol. 20:581‐620. Epub;%2001 Oct 4., 581‐620.
Cellier,M., Belouchi,A., and Gros,P. (1996). Resistance to intracellular infections: comparative genomic analysis of Nramp. Trends Genet. 12, 201‐204.
Cellier,M., Govoni,G., Vidal,S., Kwan,T., Groulx,N., Liu,J., Sanchez,F., Skamene,E., Schurr,E., and Gros,P. (1994). Human natural resistance‐associated macrophage protein: cDNA cloning, chromosomal mapping, genomic organization, and tissue‐ specific expression. J. Exp. Med. 180, 1741‐1752.
Cellier,M., Shustik,C., Dalton,W., Rich,E., Hu,J., Malo,D., Schurr,E., and Gros,P. (1997). Expression of the human NRAMP1 gene in professional primary phagocytes: studies in blood cells and in HL‐60 promyelocytic leukemia. J. Leukoc. Biol. 61, 96‐105.
Cellier,M.F., Bergevin,I., Boyer,E., and Richer,E. (2001). Polyphyletic origins of bacterial Nramp transporters. Trends Genet. 17, 365‐370.
239 Cellier,M.F., Courville,P., and Campion,C. (2007). Nramp1 phagocyte intracellular metal withdrawal defense. Microbes. Infect. 9, 1662‐1670.
Cervino,A.C., Lakiss,S., Sow,O., Bellamy,R., Beyers,N., Hoal‐van,H.E., van,H.P., McAdam,K.P., and Hill,A.V. (2002). Fine mapping of a putative tuberculosis‐ susceptibility locus on chromosome 15q11‐13 in African families. Hum. Mol. Genet. 11, 1599‐1603.
Cervino,A.C., Lakiss,S., Sow,O., and Hill,A.V. (2000). Allelic association between the NRAMP1 gene and susceptibility to tuberculosis in Guinea‐Conakry. Ann. Hum. Genet. 64, 507‐512.
Champion,O.L., Valdez,Y., Thorson,L., Guttman,J.A., Menendez,A., Gaynor,E.C., and Finlay,B.B. (2008). A murine intraperitoneal infection model reveals that host resistance to Campylobacter jejuni is Nramp1 dependent. Microbes. Infect. 10, 922‐ 927.
Chen,F., Kuhn,D.C., Gaydos,L.J., and Demers,L.M. (1996). Induction of nitric oxide and nitric oxide synthase mRNA by silica and lipopolysaccharide in PMA‐primed THP‐1 cells. APMIS. 104, 176‐182.
Chen,M. and Shen,X. (2007). Nuclear actin and actin‐related proteins in chromatin dynamics. Curr. Opin. Cell Biol. 19, 326‐330.
Chen,X.Z., Peng,J.B., Cohen,A., Nelson,H., Nelson,N., and Hediger,M.A. (1999). Yeast SMF1 mediates H(+)‐coupled iron uptake with concomitant uncoupled cation currents. J. Biol. Chem. 274, 35089‐35094.
Cheng,S.W., Davies,K.P., Yung,E., Beltran,R.J., Yu,J., and Kalpana,G.V. (1999). c‐MYC interacts with INI1/hSNF5 and requires the SWI/SNF complex for transactivation function. Nat. Genet. 22, 102‐105.
Cheng,X. and Wang,H. (2012). Multiple targeting motifs direct NRAMP1 into lysosomes. Biochem. Biophys. Res. Commun. 419, 578‐583.
Chermesh,I., Azriel,A., Alter‐Koltunoff,M., Eliakim,R., Karban,A., and Levi,B.Z. (2007). Crohn's disease and SLC11A1 promoter polymorphism. Dig. Dis. Sci. 52, 1632‐1635.
Chlosta,S., Fishman,D.S., Harrington,L., Johnson,E.E., Knutson,M.D., Wessling‐ Resnick,M., and Cherayil,B.J. (2006). The iron efflux protein ferroportin regulates the intracellular growth of Salmonella enterica. Infect. Immun. 74, 3065‐3067.
Chow,C.K., Islam,S., Bautista,L., Rumboldt,Z., Yusufali,A., Xie,C., Anand,S.S., Engert,J.C., Rangarajan,S., and Yusuf,S. (2011). Parental history and myocardial infarction risk across the world: the INTERHEART Study. J. Am. Coll. Cardiol. 57, 619‐627.
Clemens,D.L. and Horwitz,M.A. (1995). Characterization of the Mycobacterium tuberculosis phagosome and evidence that phagosomal maturation is inhibited. J. Exp. Med. 181, 257‐270.
240 Cohet,N., Stewart,K.M., Mudhasani,R., Asirvatham,A.J., Mallappa,C., Imbalzano,K.M., Weaver,V.M., Imbalzano,A.N., and Nickerson,J.A. (2010). SWI/SNF chromatin remodeling enzyme ATPases promote cell proliferation in normal mammary epithelial cells. J. Cell Physiol. 223, 667‐678.
Cole,S.T. et al. (1998). Deciphering the biology of Mycobacterium tuberculosis from the complete genome sequence. Nature. 393, 537‐544.
Comabella,M., Altet,L., Peris,F., Villoslada,P., Sanchez,A., and Montalban,X. (2004). Genetic analysis of SLC11A1 polymorphisms in multiple sclerosis patients. Mult. Scler. 10, 618‐620.
Corey,L.L., Weirich,C.S., Benjamin,I.J., and Kingston,R.E. (2003). Localized recruitment of a chromatin‐remodeling activity by an activator in vivo drives transcriptional elongation. Genes Dev. 17, 1392‐1401.
Courgeon,A.M., Maingourd,M., Maisonhaute,C., Montmory,C., Rollet,E., Tanguay,R.M., and Best‐Belpomme,M. (1993). Effect of hydrogen peroxide on cytoskeletal proteins of Drosophila cells: comparison with heat shock and other stresses. Exp. Cell Res. 204, 30‐37.
Cuellar‐Mata,P., Jabado,N., Liu,J., Furuya,W., Finlay,B.B., Gros,P., and Grinstein,S. (2002). Nramp1 modifies the fusion of Salmonella typhimurium‐containing vacuoles with cellular endomembranes in macrophages. J. Biol. Chem. 277, 2258‐2265.
Dai,Y.D., Marrero,I.G., Gros,P., Zaghouani,H., Wicker,L.S., and Sercarz,E.E. (2009). Slc11a1 enhances the autoimmune diabetogenic T‐cell response by altering processing and presentation of pancreatic islet antigens. Diabetes. 58, 156‐164.
Dalgarno,D.C., Botfield,M.C., and Rickles,R.J. (1997). SH3 domains and drug design: ligands, structure, and biological function. Biopolymers. 43, 383‐400. de la Serna,I.L., Carlson,K.A., and Imbalzano,A.N. (2001a). Mammalian SWI/SNF complexes promote MyoD‐mediated muscle differentiation. Nat. Genet. 27, 187‐190. de la Serna,I.L., Roy,K., Carlson,K.A., and Imbalzano,A.N. (2001b). MyoD can induce cell cycle arrest but not muscle differentiation in the presence of dominant negative SWI/SNF chromatin remodeling enzymes. J. Biol. Chem. 276, 41486‐41491. de,C.C. and Thilo,L. (1997). Phagosome maturation and fusion with lysosomes in relation to surface property and size of the phagocytic particle. Eur. J. Cell Biol. 74, 49‐ 62.
De,F.M., Carneiro,P.S., Peters,L.C., Vorraro,F., Borrego,A., Ribeiro,O.G., Starobinas,N., Cabrera,W.K., and Ibanez,O.M. (2007). Slc11a1 (Nramp1) alleles interact with acute inflammation loci to modulate wound‐healing traits in mice. Mamm. Genome. 18, 263‐269.
241 Dean,J.L., Wait,R., Mahtani,K.R., Sully,G., Clark,A.R., and Saklatvala,J. (2001). The 3' untranslated region of tumor necrosis factor alpha mRNA is a target of the mRNA‐ stabilizing factor HuR. Mol. Cell Biol. 21, 721‐730.
Debril,M.B., Gelman,L., Fayard,E., Annicotte,J.S., Rocchi,S., and Auwerx,J. (2004). Transcription factors and nuclear receptors interact with the SWI/SNF complex through the BAF60c subunit. J. Biol. Chem. 279, 16677‐16686.
Delgado,J.C., Baena,A., Thim,S., and Goldfeld,A.E. (2002). Ethnic‐specific genetic associations with pulmonary tuberculosis. J. Infect. Dis. 186, 1463‐1468.
Dennis,G., Jr., Sherman,B.T., Hosack,D.A., Yang,J., Gao,W., Lane,H.C., and Lempicki,R.A. (2003). DAVID: Database for Annotation, Visualization, and Integrated Discovery. Genome Biol. 4, 3.
Deretic,V. and Fratti,R.A. (1999). Mycobacterium tuberculosis phagosome. Mol. Microbiol. 31, 1603‐1609.
Dib,K., Melander,F., Axelsson,L., Dagher,M.C., Aspenstrom,P., and Andersson,T. (2003). Down‐regulation of Rac activity during beta 2 integrin‐mediated adhesion of human neutrophils. J. Biol. Chem. 278, 24181‐24188.
Dlaska,M. and Weiss,G. (1999). Central role of transcription factor NF‐IL6 for cytokine and iron‐mediated regulation of murine inducible nitric oxide synthase expression. J. Immunol. 162, 6171‐6177.
Doherty,C.P., Weaver,L.T., and Prentice,A.M. (2002). Micronutrient supplementation and infection: a double‐edged sword? J. Pediatr. Gastroenterol. Nutr. 34, 346‐352.
Donninger,H., Cashmore,T.J., Scriba,T., Petersen,D.C., Janse van,R.E., and Hayes,V.M. (2004). Functional analysis of novel SLC11A1 (NRAMP1) promoter variants in susceptibility to HIV‐1. J. Med. Genet. 41, e49.
Dopie,J., Skarp,K.P., Rajakyla,E.K., Tanhuanpaa,K., and Vartiainen,M.K. (2012). Active maintenance of nuclear actin by importin 9 supports transcription. Proc. Natl. Acad. Sci. U. S. A. 109, E544‐E552.
Dorman,S.E. and Holland,S.M. (2000). Interferon‐gamma and interleukin‐12 pathway defects and human disease. Cytokine Growth Factor Rev. 11, 321‐333.
Dropulic,L.K. and Cohen,J.I. (2011). Severe viral infections and primary immunodeficiencies. Clin. Infect. Dis. 53, 897‐909.
Dubaniewicz,A., Jamieson,S.E., Dubaniewicz‐Wybieralska,M., Fakiola,M., Nancy,M.E., and Blackwell,J.M. (2005). Association between SLC11A1 (formerly NRAMP1) and the risk of sarcoidosis in Poland. Eur. J. Hum. Genet. 13, 829‐834.
242 Eckmann,L., Fierer,J., and Kagnoff,M.F. (1996). Genetically resistant (Ityr) and susceptible (Itys) congenic mouse strains show similar cytokine responses following infection with Salmonella dublin. J. Immunol. 156, 2894‐2900.
Edwards,J.C., Cohen,C., Xu,W., and Schlesinger,P.H. (2006). c‐Src control of chloride channel support for osteoclast HCl transport and bone resorption. J. Biol. Chem. 281, 28011‐28022.
Egly,J.M., Miyamoto,N.G., Moncollin,V., and Chambon,P. (1984). Is actin a transcription initiation factor for RNA polymerase B? EMBO J. 3, 2363‐2371.
El,B.J., Remus,N., Benslimane,A., El,A.H., Chentoufi,M., Abel,L., and Schurr,E. (2003). Variants of the human NRAMP1 gene and susceptibility to tuberculosis in Morocco. Int. J. Tuberc. Lung Dis. 7, 599‐602.
Esposito,L. et al. (1998). Genetic analysis of chromosome 2 in type 1 diabetes: analysis of putative loci IDDM7, IDDM12, and IDDM13 and candidate genes NRAMP1 and IA‐2 and the interleukin‐1 gene cluster. IMDIAB Group. Diabetes. 47, 1797‐1799.
Evans,C.A., Harbuz,M.S., Ostenfeld,T., Norrish,A., and Blackwell,J.M. (2001). Nramp1 is expressed in neurons and is associated with behavioural and immune responses to stress. Neurogenetics. 3, 69‐78.
Ferreira,F.R., Goulart,L.R., Silva,H.D., and Goulart,I.M. (2004). Susceptibility to leprosy may be conditioned by an interaction between the NRAMP1 promoter polymorphisms and the lepromin response. Int. J. Lepr. Other Mycobact. Dis. 72, 457‐467.
Fishbane,S. (1999). Review of issues relating to iron and infection. Am. J. Kidney Dis. 34, S47‐S52.
Fleming,M.D., Romano,M.A., Su,M.A., Garrick,L.M., Garrick,M.D., and Andrews,N.C. (1998). Nramp2 is mutated in the anemic Belgrade (b) rat: evidence of a role for Nramp2 in endosomal iron transport. Proc. Natl. Acad. Sci. U. S. A. 95, 1148‐1153.
Fleming,M.D., Trenor,C.C., III, Su,M.A., Foernzler,D., Beier,D.R., Dietrich,W.F., and Andrews,N.C. (1997a). Microcytic anaemia mice have a mutation in Nramp2, a candidate iron transporter gene. Nat. Genet. 16, 383‐386.
Fleming,R.Y., Ellis,L.M., Parikh,N.U., Liu,W., Staley,C.A., and Gallick,G.E. (1997b). Regulation of vascular endothelial growth factor expression in human colon carcinoma cells by activity of src kinase. Surgery. 122, 501‐507.
Fomproix,N. and Percipalle,P. (2004). An actin‐myosin complex on actively transcribing genes. Exp. Cell Res. 294, 140‐148.
Forbes,J.R. and Gros,P. (2001). Divalent‐metal transport by NRAMP proteins at the interface of host‐pathogen interactions. Trends Microbiol. 9, 397‐403.
243 Forbes,J.R. and Gros,P. (2003). Iron, manganese, and cobalt transport by Nramp1 (Slc11a1) and Nramp2 (Slc11a2) expressed at the plasma membrane. Blood. 102, 1884‐ 1892.
Fortin,A., Abel,L., Casanova,J.L., and Gros,P. (2007). Host genetics of mycobacterial diseases in mice and men: forward genetic studies of BCG‐osis and tuberculosis. Annu. Rev. Genomics Hum. Genet. 8:163‐92., 163‐192.
Frehel,C., Canonne‐Hergaux,F., Gros,P., and de,C.C. (2002). Effect of Nramp1 on bacterial replication and on maturation of Mycobacterium avium‐containing phagosomes in bone marrow‐derived mouse macrophages. Cell Microbiol. 4, 541‐556.
Freudenburg,W., Buller,R.M., and Corbett,J.A. (2010). Src family kinases participate in the regulation of encephalomyocarditis virus‐induced cyclooxygenase‐2 expression by macrophages. J. Gen. Virol. 91, 2278‐2285.
Friedman,A.D. (2007). Transcriptional control of granulocyte and monocyte development. Oncogene. 26, 6816‐6828.
Fritsche,G., Dlaska,M., Barton,H., Theurl,I., Garimorth,K., and Weiss,G. (2003). Nramp1 functionality increases inducible nitric oxide synthase transcription via stimulation of IFN regulatory factor 1 expression. J. Immunol. 171, 1994‐1998.
Fry,C.J. and Peterson,C.L. (2002). Transcription. Unlocking the gates to gene expression. Science. 295, 1847‐1848.
Fryer,C.J. and Archer,T.K. (1998). Chromatin remodelling by the glucocorticoid receptor requires the BRG1 complex. Nature. 393, 88‐91.
Gao,P.S. et al. (2000). Genetic variants of NRAMP1 and active tuberculosis in Japanese populations. International Tuberculosis Genetics Team. Clin. Genet. 58, 74‐76.
Garcia‐Pedrero,J.M., Kiskinis,E., Parker,M.G., and Belandia,B. (2006). The SWI/SNF chromatin remodeling subunit BAF57 is a critical regulator of estrogen receptor function in breast cancer cells. J. Biol. Chem. 281, 22656‐22664.
Gazouli,M., Atsaves,V., Mantzaris,G., Economou,M., Nasioulas,G., Evangelou,K., Archimandritis,A.J., and Anagnou,N.P. (2008). Role of functional polymorphisms of NRAMP1 gene for the development of Crohn's disease. Inflamm. Bowel. Dis. 14, 1323‐ 1330.
Geahlen,R.L., Handley,M.D., and Harrison,M.L. (2004). Molecular interdiction of Src‐ family kinase signaling in hematopoietic cells. Oncogene. 23, 8024‐8032.
Gelineau‐van,W.J., Smith,L., van,W.M., Wilberding,J., Eudy,J.D., Bauer,L.K., and Maddox,J. (2008). Altered expression of the iron transporter Nramp1 (Slc11a1) during fetal development of the retinal pigment epithelium in microphthalmia‐associated transcription factor Mitf(mi) and Mitf(vitiligo) mouse mutants. Exp. Eye Res. 86, 419‐ 433.
244 Gomez,M.A., Li,S., Tremblay,M.L., and Olivier,M. (2007). NRAMP‐1 expression modulates protein‐tyrosine phosphatase activity in macrophages: impact on host cell signaling and functions. J. Biol. Chem. 282, 36190‐36198.
Gonsior,S.M., Platz,S., Buchmeier,S., Scheer,U., Jockusch,B.M., and Hinssen,H. (1999). Conformational difference between nuclear and cytoplasmic actin as detected by a monoclonal antibody. J. Cell Sci. 112 ( Pt 6), 797‐809.
Goswami,T., Bhattacharjee,A., Babal,P., Searle,S., Moore,E., Li,M., and Blackwell,J.M. (2001). Natural‐resistance‐associated macrophage protein 1 is an H+/bivalent cation antiporter. Biochem. J. 354, 511‐519.
Gotoh,H., Okumura,N., Yagi,T., Okumura,A., Shima,T., and Nagai,K. (2006a). Fyn‐ induced phosphorylation of beta‐adducin at tyrosine 489 and its role in their subcellular localization. Biochem. Biophys. Res. Commun. 346, 600‐605.
Gotoh,H., Okumura,N., Yagi,T., Okumura,A., Shima,T., and Nagai,K. (2006b). Fyn‐ induced phosphorylation of beta‐adducin at tyrosine 489 and its role in their subcellular localization. Biochem. Biophys. Res. Commun. 346, 600‐605.
Gout,I. et al. (1993). The GTPase dynamin binds to and is activated by a subset of SH3 domains. Cell. 75, 25‐36.
Govoni,G., Canonne‐Hergaux,F., Pfeifer,C.G., Marcus,S.L., Mills,S.D., Hackam,D.J., Grinstein,S., Malo,D., Finlay,B.B., and Gros,P. (1999). Functional expression of Nramp1 in vitro in the murine macrophage line RAW264.7. Infect. Immun. 67, 2225‐2232.
Govoni,G., Gauthier,S., Billia,F., Iscove,N.N., and Gros,P. (1997). Cell‐specific and inducible Nramp1 gene expression in mouse macrophages in vitro and in vivo. J. Leukoc. Biol. 62, 277‐286.
Govoni,G. and Gros,P. (1998). Macrophage NRAMP1 and its role in resistance to microbial infections. Inflamm. Res. 47, 277‐284.
Govoni,G., Vidal,S., Cellier,M., Lepage,P., Malo,D., and Gros,P. (1995). Genomic structure, promoter sequence, and induction of expression of the mouse Nramp1 gene in macrophages. Genomics. 27, 9‐19.
Govoni,G., Vidal,S., Gauthier,S., Skamene,E., Malo,D., and Gros,P. (1996). The Bcg/Ity/Lsh locus: genetic transfer of resistance to infections in C57BL/6J mice transgenic for the Nramp1 Gly169 allele. Infect. Immun. 64, 2923‐2929.
Gresh,L. et al. (2005). The SWI/SNF chromatin‐remodeling complex subunit SNF5 is essential for hepatocyte differentiation. EMBO J. 24, 3313‐3324.
Gruenheid,S., Canonne‐Hergaux,F., Gauthier,S., Hackam,D.J., Grinstein,S., and Gros,P. (1999). The iron transport protein NRAMP2 is an integral membrane glycoprotein that colocalizes with transferrin in recycling endosomes. J. Exp. Med. 189, 831‐841.
245 Gruenheid,S., Cellier,M., Vidal,S., and Gros,P. (1995). Identification and characterization of a second mouse Nramp gene. Genomics. 25, 514‐525.
Gruenheid,S. and Gros,P. (2000). Genetic susceptibility to intracellular infections: Nramp1, macrophage function and divalent cations transport. Curr. Opin. Microbiol. 3, 43‐48.
Gruenheid,S., Pinner,E., Desjardins,M., and Gros,P. (1997). Natural resistance to infection with intracellular pathogens: the Nramp1 protein is recruited to the membrane of the phagosome. J. Exp. Med. 185, 717‐730.
Gunshin,H., Mackenzie,B., Berger,U.V., Gunshin,Y., Romero,M.F., Boron,W.F., Nussberger,S., Gollan,J.L., and Hediger,M.A. (1997). Cloning and characterization of a mammalian proton‐coupled metal‐ion transporter. Nature. 388, 482‐488.
Hackam,D.J., Rotstein,O.D., Zhang,W., Gruenheid,S., Gros,P., and Grinstein,S. (1998). Host resistance to intracellular infection: mutation of natural resistance‐associated macrophage protein 1 (Nramp1) impairs phagosomal acidification. J. Exp. Med. 188, 351‐364.
Hackam,D.J., Rotstein,O.D., Zhang,W.J., Demaurex,N., Woodside,M., Tsai,O., and Grinstein,S. (1997). Regulation of phagosomal acidification. Differential targeting of Na+/H+ exchangers, Na+/K+‐ATPases, and vacuolar‐type H+‐atpases. J. Biol. Chem. 272, 29810‐29820.
Hah,N., Kolkman,A., Ruhl,D.D., Pijnappel,W.W., Heck,A.J., Timmers,H.T., and Kraus,W.L. (2010). A role for BAF57 in cell cycle‐dependent transcriptional regulation by the SWI/SNF chromatin remodeling complex. Cancer Res. 70, 4402‐4411.
Harris,Z.L., Durley,A.P., Man,T.K., and Gitlin,J.D. (1999). Targeted gene disruption reveals an essential role for ceruloplasmin in cellular iron efflux. Proc. Natl. Acad. Sci. U. S. A. 96, 10812‐10817.
Hedges,J.F., Kimmel,E., Snyder,D.T., Jerome,M., and Jutila,M.A. (2013). Solute Carrier 11A1 Is Expressed by Innate Lymphocytes and Augments Their Activation. J. Immunol. 190, 4263‐4273.
Henderson,A., Holloway,A., Reeves,R., and Tremethick,D.J. (2004). Recruitment of SWI/SNF to the human immunodeficiency virus type 1 promoter. Mol. Cell Biol. 24, 389‐397.
Hiemstra,P.S., Maassen,R.J., Stolk,J., Heinzel‐Wieland,R., Steffens,G.J., and Dijkman,J.H. (1996). Antibacterial activity of antileukoprotease. Infect. Immun. 64, 4520‐4524.
Hofmann,W. et al. (2001). Cofactor requirements for nuclear export of Rev response element (RRE)‐ and constitutive transport element (CTE)‐containing retroviral RNAs. An unexpected role for actin. J. Cell Biol. 152, 895‐910.
246 Hofmann,W.A. et al. (2004). Actin is part of pre‐initiation complexes and is necessary for transcription by RNA polymerase II. Nat. Cell Biol. 6, 1094‐1101.
Hofmeister,A., Neibergs,H.L., Pokorny,R.M., and Galandiuk,S. (1997). The natural resistance‐associated macrophage protein gene is associated with Crohn's disease. Surgery. 122, 173‐178.
Holmes,T.C., Fadool,D.A., Ren,R., and Levitan,I.B. (1996). Association of Src tyrosine kinase with a human potassium channel mediated by SH3 domain. Science. 274, 2089‐ 2091.
Holtmann,H., Winzen,R., Holland,P., Eickemeier,S., Hoffmann,E., Wallach,D., Malinin,N.L., Cooper,J.A., Resch,K., and Kracht,M. (1999). Induction of interleukin‐8 synthesis integrates effects on transcription and mRNA degradation from at least three different cytokine‐ or stress‐activated signal transduction pathways. Mol. Cell Biol. 19, 6742‐6753.
Hsiao,P.W., Fryer,C.J., Trotter,K.W., Wang,W., and Archer,T.K. (2003). BAF60a mediates critical interactions between nuclear receptors and the BRG1 chromatin‐ remodeling complex for transactivation. Mol. Cell Biol. 23, 6210‐6220.
Hu,P., Wu,S., and Hernandez,N. (2003). A minimal RNA polymerase III transcription system from human cells reveals positive and negative regulatory roles for CK2. Mol. Cell. 12, 699‐709.
Hu,P., Wu,S., and Hernandez,N. (2004). A role for beta‐actin in RNA polymerase III transcription. Genes Dev. 18, 3010‐3015.
Ike,K., Kawahara,K., Danbara,H., and Kume,K. (1992). Serum resistance and aerobactin iron uptake in avian Escherichia coli mediated by conjugative 100‐megadalton plasmid. J. Vet. Med. Sci. 54, 1091‐1098.
Iwai,Y., Akahane,K., Pluznik,D.H., and Cohen,R.B. (1993). Ca2+ ionophore A23187‐ dependent stabilization of granulocyte‐macrophage colony‐stimulating factor messenger RNA in murine thymoma EL‐4 cells is mediated through two distinct regions in the 3'‐untranslated region. J. Immunol. 150, 4386‐4394.
Jabado,N., Cuellar‐Mata,P., Grinstein,S., and Gros,P. (2003). Iron chelators modulate the fusogenic properties of Salmonella‐containing phagosomes. Proc. Natl. Acad. Sci. U. S. A. 100, 6127‐6132.
Jabado,N., Jankowski,A., Dougaparsad,S., Picard,V., Grinstein,S., and Gros,P. (2000). Natural resistance to intracellular infections: natural resistance‐associated macrophage protein 1 (Nramp1) functions as a pH‐dependent manganese transporter at the phagosomal membrane. J. Exp. Med. 192, 1237‐1248.
Jin,J., Sun,L., Jiao,W., Zhao,S., Li,H., Guan,X., Jiao,A., Jiang,Z., and Shen,A. (2009). SLC11A1 (Formerly NRAMP1) gene polymorphisms associated with pediatric tuberculosis in China. Clin. Infect. Dis. 48, 733‐738.
247 Jones,B.L. and Swallow,D.M. (2011). The impact of cis‐acting polymorphisms on the human phenotype. Hugo. J. 5, 13‐23.
Juliandi,B., Abematsu,M., and Nakashima,K. (2010). Chromatin remodeling in neural stem cell differentiation. Curr. Opin. Neurobiol. 20, 408‐415.
Kaneko,T., Li,L., and Li,S.S. (2008). The SH3 domain‐‐a family of versatile peptide‐ and protein‐recognition module. Front Biosci. 13:4938‐52., 4938‐4952.
Karin,M., Liu,Z., and Zandi,E. (1997). AP‐1 function and regulation. Curr. Opin. Cell Biol. 9, 240‐246.
Kawauchi,J., Zhang,C., Nobori,K., Hashimoto,Y., Adachi,M.T., Noda,A., Sunamori,M., and Kitajima,S. (2002). Transcriptional repressor activating transcription factor 3 protects human umbilical vein endothelial cells from tumor necrosis factor‐alpha‐ induced apoptosis through down‐regulation of p53 transcription. J. Biol. Chem. 277, 39025‐39034.
Kay,B.K., Williamson,M.P., and Sudol,M. (2000). The importance of being proline: the interaction of proline‐rich motifs in signaling proteins with their cognate domains. FASEB J. 14, 231‐241.
Kishi,F., Tanizawa,Y., and Nobumoto,M. (1996). Structural analysis of human natural resistance‐associated macrophage protein 1 promoter. Mol. Immunol. 33, 265‐268.
Klemsz,M.J., McKercher,S.R., Celada,A., Van,B.C., and Maki,R.A. (1990). The macrophage and B cell‐specific transcription factor PU.1 is related to the ets oncogene. Cell. 61, 113‐124.
Knutson,M. and Wessling‐Resnick,M. (2003). Iron metabolism in the reticuloendothelial system. Crit Rev. Biochem. Mol. Biol. 38, 61‐88.
Knutson,M.D., Vafa,M.R., Haile,D.J., and Wessling‐Resnick,M. (2003). Iron loading and erythrophagocytosis increase ferroportin 1 (FPN1) expression in J774 macrophages. Blood. 102, 4191‐4197.
Ko,M., Sohn,D.H., Chung,H., and Seong,R.H. (2008). Chromatin remodeling, development and disease. Mutat. Res. 647, 59‐67.
Kotlowski,R., Bernstein,C.N., Silverberg,M.S., and Krause,D.O. (2008). Population‐ based case‐control study of alpha 1‐antitrypsin and SLC11A1 in Crohn's disease and ulcerative colitis. Inflamm. Bowel. Dis. 14, 1112‐1117.
Kotze,M.J., de Villiers,J.N., Rooney,R.N., Grobbelaar,J.J., Mansvelt,E.P., Bouwens,C.S., Carr,J., Stander,I., and du,P.L. (2001). Analysis of the NRAMP1 gene implicated in iron transport: association with multiple sclerosis and age effects. Blood Cells Mol. Dis. 27, 44‐53.
248 Kowenz‐Leutz,E. and Leutz,A. (1999). A C/EBP beta isoform recruits the SWI/SNF complex to activate myeloid genes. Mol. Cell. 4, 735‐743.
Krauss,S.W., Chen,C., Penman,S., and Heald,R. (2003). Nuclear actin and protein 4.1: essential interactions during nuclear assembly in vitro. Proc. Natl. Acad. Sci. U. S. A. 100, 10752‐10757.
Krauss,S.W., Heald,R., Lee,G., Nunomura,W., Gimm,J.A., Mohandas,N., and Chasis,J.A. (2002). Two distinct domains of protein 4.1 critical for assembly of functional nuclei in vitro. J. Biol. Chem. 277, 44339‐44346.
Kuhn,D.E., Baker,B.D., Lafuse,W.P., and Zwilling,B.S. (1999). Differential iron transport into phagosomes isolated from the RAW264.7 macrophage cell lines transfected with Nramp1Gly169 or Nramp1Asp169. J. Leukoc. Biol. 66, 113‐119.
Kuhn,D.E., Lafuse,W.P., and Zwilling,B.S. (2001). Iron transport into mycobacterium avium‐containing phagosomes from an Nramp1(Gly169)‐transfected RAW264.7 macrophage cell line. J. Leukoc. Biol. 69, 43‐49.
Kukalev,A., Nord,Y., Palmberg,C., Bergman,T., and Percipalle,P. (2005). Actin and hnRNP U cooperate for productive transcription by RNA polymerase II. Nat. Struct. Mol. Biol. 12, 238‐244.
Lafuse,W.P., Alvarez,G.R., and Zwilling,B.S. (2000). Regulation of Nramp1 mRNA stability by oxidants and protein kinase C in RAW264.7 macrophages expressing Nramp1(Gly169). Biochem. J. 351 Pt 3:687‐96., 687‐696.
Lafuse,W.P., Alvarez,G.R., and Zwilling,B.S. (2002). Role of MAP kinase activation in Nramp1 mRNA stability in RAW264.7 macrophages expressing Nramp1(Gly169). Cell Immunol. 215, 195‐206.
Lal,A., Haynes,S.R., and Gorospe,M. (2005). Clean Western blot signals from immunoprecipitated samples. Mol. Cell Probes. 19, 385‐388.
Lalmanach,A.C., Montagne,A., Menanteau,P., and Lantier,F. (2001). Effect of the mouse Nramp1 genotype on the expression of IFN‐gamma gene in early response to Salmonella infection. Microbes. Infect. 3, 639‐644.
Lam‐Yuk‐Tseung,S., Picard,V., and Gros,P. (2006). Identification of a tyrosine‐based motif (YGSI) in the amino terminus of Nramp1 (Slc11a1) that is important for lysosomal targeting. J. Biol. Chem. 281, 31677‐31688.
Lang,T., Prina,E., Sibthorpe,D., and Blackwell,J.M. (1997). Nramp1 transfection transfers Ity/Lsh/Bcg‐related pleiotropic effects on macrophage activation: influence on antigen processing and presentation. Infect. Immun. 65, 380‐386.
Lapham,A.S., Phillips,E.S., and Barton,C.H. (2004). Transcriptional control of Nramp1: a paradigm for the repressive action of c‐Myc. Biochem. Soc. Trans. 32, 1084‐1086.
249 Lasa,M., Mahtani,K.R., Finch,A., Brewer,G., Saklatvala,J., and Clark,A.R. (2000). Regulation of cyclooxygenase 2 mRNA stability by the mitogen‐activated protein kinase p38 signaling cascade. Mol. Cell Biol. 20, 4265‐4274.
Li,B., Carey,M., and Workman,J.L. (2007). The role of chromatin during transcription. Cell. 128, 707‐719.
Liaw,Y.S., Tsai‐Wu,J.J., Wu,C.H., Hung,C.C., Lee,C.N., Yang,P.C., Luh,K.T., and Kuo,S.H. (2002). Variations in the NRAMP1 gene and susceptibility of tuberculosis in Taiwanese. Int. J. Tuberc. Lung Dis. 6, 454‐460.
Liu,B.A., Engelmann,B.W., and Nash,P.D. (2012). The language of SH2 domain interactions defines phosphotyrosine‐mediated signal transduction. FEBS Lett. 586, 2597‐2605.
Liu,B.A., Jablonowski,K., Raina,M., Arce,M., Pawson,T., and Nash,P.D. (2006a). The human and mouse complement of SH2 domain proteins‐establishing the boundaries of phosphotyrosine signaling. Mol. Cell. 22, 851‐868.
Liu,H., Mulholland,N., Fu,H., and Zhao,K. (2006b). Cooperative activity of BRG1 and Z‐ DNA formation in chromatin remodeling. Mol. Cell Biol. 26, 2550‐2559.
Liu,H. and Zhao,K. (2004). Assay of Z‐DNA induction by chromatin remodeling factors. Methods Enzymol. 377:412‐20., 412‐420.
Liu,J. et al. (1995). Identification of polymorphisms and sequence variants in the human homologue of the mouse natural resistance‐associated macrophage protein gene. Am. J. Hum. Genet. 56, 845‐853.
Liu,J., Liao,Z., Camden,J., Griffin,K.D., Garrad,R.C., Santiago‐Perez,L.I., Gonzalez,F.A., Seye,C.I., Weisman,G.A., and Erb,L. (2004a). Src homology 3 binding sites in the P2Y2 nucleotide receptor interact with Src and regulate activities of Src, proline‐rich tyrosine kinase 2, and growth factor receptors. J. Biol. Chem. 279, 8212‐8218.
Liu,L. et al. (2011). Gain‐of‐function human STAT1 mutations impair IL‐17 immunity and underlie chronic mucocutaneous candidiasis. J. Exp. Med. 208, 1635‐1648.
Liu,R., Liu,H., Chen,X., Kirby,M., Brown,P.O., and Zhao,K. (2001). Regulation of CSF1 promoter by the SWI/SNF‐like BAF complex. Cell. 106, 309‐318.
Liu,W. et al. (2004b). VDR and NRAMP1 gene polymorphisms in susceptibility to pulmonary tuberculosis among the Chinese Han population: a case‐control study. Int. J. Tuberc. Lung Dis. 8, 428‐434.
Liu,X.F. and Culotta,V.C. (1999). Post‐translation control of Nramp metal transport in yeast. Role of metal ions and the BSD2 gene. J. Biol. Chem. %19;274, 4863‐4868.
Liu,X.F., Supek,F., Nelson,N., and Culotta,V.C. (1997). Negative control of heavy metal uptake by the Saccharomyces cerevisiae BSD2 gene. J. Biol. Chem. 272, 11763‐11769.
250 Livak,K.J. and Schmittgen,T.D. (2001). Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐Delta Delta C(T)) Method. Methods. 25, 402‐408.
Lukacs,G.L., Rotstein,O.D., and Grinstein,S. (1990). Phagosomal acidification is mediated by a vacuolar‐type H(+)‐ATPase in murine macrophages. J. Biol. Chem. 265, 21099‐21107.
Lusic,M., Marcello,A., Cereseto,A., and Giacca,M. (2003). Regulation of HIV‐1 gene expression by histone acetylation and factor recruitment at the LTR promoter. EMBO J. 22, 6550‐6561.
Ma,Z., Shah,R.C., Chang,M.J., and Benveniste,E.N. (2004). Coordination of cell signaling, chromatin remodeling, histone modifications, and regulator recruitment in human matrix metalloproteinase 9 gene transcription. Mol. Cell Biol. 24, 5496‐5509.
Mackenzie,B. and Hediger,M.A. (2004). SLC11 family of H+‐coupled metal‐ion transporters NRAMP1 and DMT1. Pflugers Arch. 447, 571‐579.
MacLennan,C. et al. (2004). Interleukin (IL)‐12 and IL‐23 are key cytokines for immunity against Salmonella in humans. J. Infect. Dis. 190, 1755‐1757.
Mai,P.L., Chatterjee,N., Hartge,P., Tucker,M., Brody,L., Struewing,J.P., and Wacholder,S. (2009). Potential excess mortality in BRCA1/2 mutation carriers beyond breast, ovarian, prostate, and pancreatic cancers, and melanoma. PLoS. One. 4, e4812.
Maines,M.D. (2005). The heme oxygenase system: update 2005. Antioxid. Redox. Signal. 7, 1761‐1766.
Maliarik,M.J., Chen,K.M., Sheffer,R.G., Rybicki,B.A., Major,M.L., Popovich,J., Jr., and Iannuzzi,M.C. (2000). The natural resistance‐associated macrophage protein gene in African Americans with sarcoidosis. Am. J. Respir. Cell Mol. Biol. 22, 672‐675.
Malik,S. et al. (2005). Alleles of the NRAMP1 gene are risk factors for pediatric tuberculosis disease. Proc. Natl. Acad. Sci. U. S. A. 102, 12183‐12188.
Malo,D., Vidal,S., Lieman,J.H., Ward,D.C., and Gros,P. (1993a). Physical delineation of the minimal chromosomal segment encompassing the murine host resistance locus Bcg. Genomics. 17, 667‐675.
Malo,D., Vidal,S.M., Hu,J., Skamene,E., and Gros,P. (1993b). High‐resolution linkage map in the vicinity of the host resistance locus Bcg. Genomics. 16, 655‐663.
Malo,D., Vogan,K., Vidal,S., Hu,J., Cellier,M., Schurr,E., Fuks,A., Bumstead,N., Morgan,K., and Gros,P. (1994). Haplotype mapping and sequence analysis of the mouse Nramp gene predict susceptibility to infection with intracellular parasites. Genomics 23, 51‐61.
Marciani,P., Trotti,D., Hediger,M.A., and Monticelli,G. (2004). Modulation of DMT1 activity by redox compounds. J. Membr. Biol. 197, 91‐99.
251 Marks,M.S., H.Ohno, T.Kirchnausan, and J.S.Bonracino (1997). Protein sorting by tyrosine‐based signals:adapting to the Ys and wherefores. Trends Cell Biol. 7, 124‐128.
Marquet,S., Lepage,P., Hudson,T.J., Musser,J.M., and Schurr,E. (2000). Complete nucleotide sequence and genomic structure of the human NRAMP1 gene region on chromosome region 2q35. Mamm. Genome. 11, 755‐762.
Marquet,S., Sanchez,F.O., Arias,M., Rodriguez,J., Paris,S.C., Skamene,E., Schurr,E., and Garcia,L.F. (1999). Variants of the human NRAMP1 gene and altered human immunodeficiency virus infection susceptibility. J. Infect. Dis. 180, 1521‐1525.
Martone,R. et al. (2003). Distribution of NF‐kappaB‐binding sites across human chromosome 22. Proc. Natl. Acad. Sci. U. S. A. 100, 12247‐12252.
Mayer,B.J. (2001). SH3 domains: complexity in moderation. J. Cell Sci. 114, 1253‐1263.
Mayer,B.J. and Baltimore,D. (1993). Signalling through SH2 and SH3 domains. Trends Cell Biol. 3, 8‐13.
McDermid,J.M. and Prentice,A.M. (2006). Iron and infection: effects of host iron status and the iron‐regulatory genes haptoglobin and NRAMP1 (SLC11A1) on host‐pathogen interactions in tuberculosis and HIV. Clin. Sci. (Lond). 110, 503‐524.
McNeely,T.B., Shugars,D.C., Rosendahl,M., Tucker,C., Eisenberg,S.P., and Wahl,S.M. (1997). Inhibition of human immunodeficiency virus type 1 infectivity by secretory leukocyte protease inhibitor occurs prior to viral reverse transcription. Blood. 90, 1141‐1149.
Meilang,Q., Zhang,Y., Zhang,J., Zhao,Y., Tian,C., Huang,J., and Fan,H. (2012). Polymorphisms in the SLC11A1 gene and tuberculosis risk: a meta‐analysis update. Int. J. Tuberc. Lung Dis. 16, 437‐446.
Miranda,M.B., McGuire,T.F., and Johnson,D.E. (2002). Importance of MEK‐1/‐2 signaling in monocytic and granulocytic differentiation of myeloid cell lines. Leukemia. 16, 683‐692.
Miyamoto,K. and Gurdon,J.B. (2012). Transcriptional regulation and nuclear reprogramming: roles of nuclear actin and actin‐binding proteins. Cell Mol. Life Sci.
Miyamoto,K., Pasque,V., Jullien,J., and Gurdon,J.B. (2011). Nuclear actin polymerization is required for transcriptional reprogramming of Oct4 by oocytes. Genes Dev. 25, 946‐958.
Mock,B., Krall,M., Blackwell,J., O'Brien,A., Schurr,E., Gros,P., Skamene,E., and Potter,M. (1990). A genetic map of mouse chromosome 1 near the Lsh‐Ity‐Bcg disease resistance locus. Genomics. 7, 57‐64.
Mohamed,H.S., Ibrahim,M.E., Miller,E.N., White,J.K., Cordell,H.J., Howson,J.M., Peacock,C.S., Khalil,E.A., El Hassan,A.M., and Blackwell,J.M. (2004). SLC11A1 (formerly
252 NRAMP1) and susceptibility to visceral leishmaniasis in The Sudan. Eur. J. Hum. Genet. 12, 66‐74.
Moisan,J., Thuraisingam,T., Henault,J., De,S.J., and Radzioch,D. (2006). Role of SLC11A1 (formerly NRAMP1) in regulation of signal transduction induced by Toll‐like receptor 7 ligands. FEMS Immunol. Med. Microbiol. 47, 138‐147.
Moshkin,Y.M., Mohrmann,L., van Ijcken,W.F., and Verrijzer,C.P. (2007). Functional differentiation of SWI/SNF remodelers in transcription and cell cycle control. Mol. Cell Biol. 27, 651‐661.
Muller,C., Calkhoven,C.F., Sha,X., and Leutz,A. (2004). The CCAAT enhancer‐binding protein alpha (C/EBPalpha) requires a SWI/SNF complex for proliferation arrest. J. Biol. Chem. %20;279, 7353‐7358.
Nagl,N.G., Jr., Wang,X., Patsialou,A., Van,S.M., and Moran,E. (2007). Distinct mammalian SWI/SNF chromatin remodeling complexes with opposing roles in cell‐ cycle control. EMBO J. 26, 752‐763.
Nairz,M., Fritsche,G., Crouch,M.L., Barton,H.C., Fang,F.C., and Weiss,G. (2009). Slc11a1 limits intracellular growth of Salmonella enterica sv. Typhimurium by promoting macrophage immune effector functions and impairing bacterial iron acquisition. Cell Microbiol. 11, 1365‐1381.
Nairz,M., Theurl,I., Ludwiczek,S., Theurl,M., Mair,S.M., Fritsche,G., and Weiss,G. (2007). The co‐ordinated regulation of iron homeostasis in murine macrophages limits the availability of iron for intracellular Salmonella typhimurium. Cell Microbiol. 9, 2126‐2140.
Nelson,N. (1999). Metal ion transporters and homeostasis. EMBO J. 18, 4361‐4371.
Nelson,N., Marks,M.S., Driggers,P.H., and Ozato,K. (1993). Interferon consensus sequence‐binding protein, a member of the interferon regulatory factor family, suppresses interferon‐induced gene transcription. Mol. Cell Biol. 13, 588‐599.
Nevo,Y. and Nelson,N. (2004). The mutation F227I increases the coupling of metal ion transport in DCT1. J. Biol. Chem. 279, 53056‐53061.
Nevo,Y. and Nelson,N. (2006). The NRAMP family of metal‐ion transporters. Biochim. Biophys. Acta. 1763, 609‐620.
Nobori,K., Ito,H., Tamamori‐Adachi,M., Adachi,S., Ono,Y., Kawauchi,J., Kitajima,S., Marumo,F., and Isobe,M. (2002). ATF3 inhibits doxorubicin‐induced apoptosis in cardiac myocytes: a novel cardioprotective role of ATF3. J. Mol. Cell Cardiol. 34, 1387‐ 1397.
O'Brien,B.A., Archer,N.S., Simpson,A.M., Torpy,F.R., and Nassif,N.T. (2008). Association of SLC11A1 promoter polymorphisms with the incidence of autoimmune and inflammatory diseases: a meta‐analysis. J. Autoimmun. 31, 42‐51.
253 Oh,D.B., Kim,Y.G., and Rich,A. (2002). Z‐DNA‐binding proteins can act as potent effectors of gene expression in vivo. Proc. Natl. Acad. Sci. U. S. A. 99, 16666‐16671.
Ohno,H., Stewart,J., Fournier,M.C., Bosshart,H., Rhee,I., Miyatake,S., Saito,T., Gallusser,A., Kirchhausen,T., and Bonifacino,J.S. (1995). Interaction of tyrosine‐based sorting signals with clathrin‐associated proteins. Science. 269, 1872‐1875.
Okubo,M., Yamada,K., Hosoyamada,M., Shibasaki,T., and Endou,H. (2003). Cadmium transport by human Nramp 2 expressed in Xenopus laevis oocytes. Toxicol. Appl. Pharmacol. 187, 162‐167.
Olave,I.A., Reck‐Peterson,S.L., and Crabtree,G.R. (2002). Nuclear actin and actin‐ related proteins in chromatin remodeling. Annu. Rev. Biochem. 71:755‐81. Epub;%2001 Nov 9., 755‐781.
Olivier,M., Cook,P., DeSanctis,J., Hel,Z., Wojciechowski,W., Reiner,N.E., Skamene,E., and Radzioch,D. (1998). Phenotypic difference between Bcg(r) and Bcg(s) macrophages is related to differences in protein‐kinase‐C‐dependent signalling. Eur. J. Biochem. 251, 734‐743.
Oppenheimer,S.J. (2001). Iron and its relation to immunity and infectious disease. J. Nutr. 131, 616S‐633S.
Orgad,S., Nelson,H., Segal,D., and Nelson,N. (1998). Metal ions suppress the abnormal taste behavior of the Drosophila mutant malvolio. J. Exp. Biol. 201, 115‐120.
Ou,H., Shen,Y.H., Utama,B., Wang,J., Wang,X., Coselli,J., and Wang,X.L. (2005). Effect of nuclear actin on endothelial nitric oxide synthase expression. Arterioscler. Thromb. Vasc. Biol. 25, 2509‐2514.
Ouchi,K., Suzuki,Y., Shirakawa,T., and Kishi,F. (2003). Polymorphism of SLC11A1 (formerly NRAMP1) gene confers susceptibility to Kawasaki disease. J. Infect. Dis. 187, 326‐329.
Owens,D.W., McLean,G.W., Wyke,A.W., Paraskeva,C., Parkinson,E.K., Frame,M.C., and Brunton,V.G. (2000). The catalytic activity of the Src family kinases is required to disrupt cadherin‐dependent cell‐cell contacts. Mol. Biol. Cell. 11, 51‐64.
Ozato,K., Tsujimura,H., and Tamura,T. (2002). Toll‐like receptor signaling and regulation of cytokine gene expression in the immune system. Biotechniques. Suppl:66‐8, 70, 72 passim., 66‐8, 70, 72.
Paccagnini,D., Sieswerda,L., Rosu,V., Masala,S., Pacifico,A., Gazouli,M., Ikonomopoulos,J., Ahmed,N., Zanetti,S., and Sechi,L.A. (2009). Linking chronic infection and autoimmune diseases: Mycobacterium avium subspecies paratuberculosis, SLC11A1 polymorphisms and type‐1 diabetes mellitus. PLoS. One. 4, e7109.
254 Pan,Y., Chen,H., Siu,F., and Kilberg,M.S. (2003). Amino acid deprivation and endoplasmic reticulum stress induce expression of multiple activating transcription factor‐3 mRNA species that, when overexpressed in HepG2 cells, modulate transcription by the human asparagine synthetase promoter. J. Biol. Chem. 278, 38402‐38412.
Patel,S.Y., Doffinger,R., Barcenas‐Morales,G., and Kumararatne,D.S. (2008). Genetically determined susceptibility to mycobacterial infection. J. Clin. Pathol. 61, 1006‐1012.
Pawson,T. (1995). Protein modules and signalling networks. Nature. 373, 573‐580.
Pendleton,A., Pope,B., Weeds,A., and Koffer,A. (2003). Latrunculin B or ATP depletion induces cofilin‐dependent translocation of actin into nuclei of mast cells. J. Biol. Chem. 278, 14394‐14400.
Percipalle,P., Fomproix,N., Kylberg,K., Miralles,F., Bjorkroth,B., Daneholt,B., and Visa,N. (2003). An actin‐ribonucleoprotein interaction is involved in transcription by RNA polymerase II. Proc. Natl. Acad. Sci. U. S. A 100, 6475‐6480.
Percipalle,P., Zhao,J., Pope,B., Weeds,A., Lindberg,U., and Daneholt,B. (2001). Actin bound to the heterogeneous nuclear ribonucleoprotein hrp36 is associated with Balbiani ring mRNA from the gene to polysomes. J. Cell Biol. 153, 229‐236.
Petersen,L., Andersen,P.K., and Sorensen,T.I. (2010). Genetic influences on incidence and case‐fatality of infectious disease. PLoS. One. 5, e10603.
Peterson,C.L. and Workman,J.L. (2000). Promoter targeting and chromatin remodeling by the SWI/SNF complex. Curr. Opin. Genet. Dev. 10, 187‐192.
Philimonenko,V.V. et al. (2004). Nuclear actin and myosin I are required for RNA polymerase I transcription. Nat. Cell Biol. 6, 1165‐1172.
Picard,C., Casanova,J.L., and Puel,A. (2011). Infectious diseases in patients with IRAK‐4, MyD88, NEMO, or IkappaBalpha deficiency. Clin. Microbiol. Rev. 24, 490‐497.
Plant,J. and Glynn,A.A. (1976a). Genetics of resistance to infection with Salmonella typhimurium in mice. J. Infect. Dis. 133, 72‐78.
Plant,J. and Glynn,A.A. (1976b). Genetics of resistance to infection with Salmonella typhimurium in mice. J. Infect. Dis. 133, 72‐78.
Plant,J. and Glynn,A.A. (1979). Locating salmonella resistance gene on mouse chromosome 1. Clin. Exp. Immunol. 37, 1‐6.
Plant,J.E., Blackwell,J.M., O'Brien,A.D., Bradley,D.J., and Glynn,A.A. (1982). Are the Lsh and Ity disease resistance genes at one locus on mouse chromosome 1? Nature. 297, 510‐511.
255 Portnoy,M.E., Liu,X.F., and Culotta,V.C. (2000). Saccharomyces cerevisiae expresses three functionally distinct homologues of the nramp family of metal transporters. Mol. Cell Biol. 20, 7893‐7902.
Poss,K.D. and Tonegawa,S. (1997). Heme oxygenase 1 is required for mammalian iron reutilization. Proc. Natl. Acad. Sci. U. S. A. 94, 10919‐10924.
Radha,V., Rajanna,A., and Swarup,G. (2004). Phosphorylated guanine nucleotide exchange factor C3G, induced by pervanadate and Src family kinases localizes to the Golgi and subcortical actin cytoskeleton. BMC. Cell Biol. 5:31., 31.
Radzioch,D., Kramnik,I., and Skamene,E. (1994). Molecular mechanisms of natural resistance to mycobacterial infections. Circ. Shock. 44, 115‐120.
Rando,O.J., Zhao,K., Janmey,P., and Crabtree,G.R. (2002). Phosphatidylinositol‐ dependent actin filament binding by the SWI/SNF‐like BAF chromatin remodeling complex. Proc. Natl. Acad. Sci. U. S. A. 99, 2824‐2829.
Reisman,D., Glaros,S., and Thompson,E.A. (2009). The SWI/SNF complex and cancer. Oncogene. 28, 1653‐1668.
Resendes,K.K. and Rosmarin,A.G. (2004). Sp1 control of gene expression in myeloid cells. Crit Rev. Eukaryot. Gene Expr. 14, 171‐181.
Rich,A., Nordheim,A., and Wang,A.H. (1984). The chemistry and biology of left‐handed Z‐DNA. Annu. Rev. Biochem. 53:791‐846., 791‐846.
Richer,E., Campion,C.G., Dabbas,B., White,J.H., and Cellier,M.F. (2008). Transcription factors Sp1 and C/EBP regulate NRAMP1 gene expression. FEBS J. 275, 5074‐5089.
Richer,E., Courville,P., and Cellier M. (2004). Molecular Evolutionary Analysis of the Nramp Family. In: The Nramp Family, ed. M.Cellier and P.GrosNew York: Landes Bioscience/Kluwer Academic, 178‐193.
Roach,T.I., Kiderlen,A.F., and Blackwell,J.M. (1991). Role of inorganic nitrogen oxides and tumor necrosis factor alpha in killing Leishmania donovani amastigotes in gamma interferon‐lipopolysaccharide‐activated macrophages from Lshs and Lshr congenic mouse strains. Infect. Immun. 59, 3935‐3944.
Roberts,C.W. and Orkin,S.H. (2004). The SWI/SNF complex‐‐chromatin and cancer. Nat. Rev. Cancer. 4, 133‐142.
Rodrigues,V., Cheah,P.Y., Ray,K., and Chia,W. (1995). malvolio, the Drosophila homologue of mouse NRAMP‐1 (Bcg), is expressed in macrophages and in the nervous system and is required for normal taste behaviour. EMBO J. 14, 3007‐3020.
Roig,E.A., Richer,E., Canonne‐Hergaux,F., Gros,P., and Cellier,M.F. (2002). Regulation of NRAMP1 gene expression by 1alpha,25‐dihydroxy‐vitamin D(3) in HL‐60 phagocytes. J. Leukoc. Biol. 71, 890‐904.
256 Romero‐Gomez,M. et al. (2004). SLC11A1 promoter gene polymorphisms and fibrosis progression in chronic hepatitis C. Gut. 53, 446‐450.
Rothenburg,S., Koch‐Nolte,F., Rich,A., and Haag,F. (2001). A polymorphic dinucleotide repeat in the rat nucleolin gene forms Z‐DNA and inhibits promoter activity. Proc. Natl. Acad. Sci. U. S. A. 98, 8985‐8990.
Rousseau,S., Morrice,N., Peggie,M., Campbell,D.G., Gaestel,M., and Cohen,P. (2002). Inhibition of SAPK2a/p38 prevents hnRNP A0 phosphorylation by MAPKAP‐K2 and its interaction with cytokine mRNAs. EMBO J. 21, 6505‐6514.
Ryu,S., Park,Y.K., Bai,G.H., Kim,S.J., Park,S.N., and Kang,S. (2000). 3'UTR polymorphisms in the NRAMP1 gene are associated with susceptibility to tuberculosis in Koreans. Int. J. Tuberc. Lung Dis. 4, 577‐580.
Sacher,A., Cohen,A., and Nelson,N. (2001). Properties of the mammalian and yeast metal‐ion transporters DCT1 and Smf1p expressed in Xenopus laevis oocytes. J. Exp. Biol. 204, 1053‐1061.
Salma,N., Xiao,H., Mueller,E., and Imbalzano,A.N. (2004). Temporal recruitment of transcription factors and SWI/SNF chromatin‐remodeling enzymes during adipogenic induction of the peroxisome proliferator‐activated receptor gamma nuclear hormone receptor. Mol. Cell Biol. 24, 4651‐4663.
Sanger,J.W., Gwinn,J., and Sanger,J.M. (1980a). Dissolution of cytoplasmic actin bundles and the induction of nuclear actin bundles by dimethyl sulfoxide. J. Exp. Zool. 213, 227‐230.
Sanger,J.W., Sanger,J.M., Kreis,T.E., and Jockusch,B.M. (1980b). Reversible translocation of cytoplasmic actin into the nucleus caused by dimethyl sulfoxide. Proc. Natl. Acad. Sci. U. S. A 77, 5268‐5272.
Scheer,U., Hinssen,H., Franke,W.W., and Jockusch,B.M. (1984). Microinjection of actin‐ binding proteins and actin antibodies demonstrates involvement of nuclear actin in transcription of lampbrush chromosomes. Cell. 39, 111‐122.
Schreiber,M., Kolbus,A., Piu,F., Szabowski,A., Mohle‐Steinlein,U., Tian,J., Karin,M., Angel,P., and Wagner,E.F. (1999). Control of cell cycle progression by c‐Jun is p53 dependent. Genes Dev. 13, 607‐619.
Schultz,H., Engel,K., and Gaestel,M. (1997). PMA‐induced activation of the p42/44ERK‐ and p38RK‐MAP kinase cascades in HL‐60 cells is PKC dependent but not essential for differentiation to the macrophage‐like phenotype. J. Cell Physiol. 173, 310‐318.
Schurr,E., Radzioch,D., Malo,D., Gros,P., and Skamene,E. (1991). Molecular genetics of inherited susceptibility to intracellular parasites. Behring Inst. Mitt. 1‐12.
Schurr,E., Skamene,E., Morgan,K., Chu,M.L., and Gros,P. (1990). Mapping of Col3a1 and Col6a3 to proximal murine chromosome 1 identifies conserved linkage of
257 structural protein genes between murine chromosome 1 and human chromosome 2q. Genomics. 8, 477‐486.
Searle,S. and Blackwell,J.M. (1999). Evidence for a functional repeat polymorphism in the promoter of the human NRAMP1 gene that correlates with autoimmune versus infectious disease susceptibility. J. Med. Genet. 36, 295‐299.
Searle,S., Bright,N.A., Roach,T.I., Atkinson,P.G., Barton,C.H., Meloen,R.H., and Blackwell,J.M. (1998). Localisation of Nramp1 in macrophages: modulation with activation and infection. J. Cell Sci. 111, 2855‐2866.
Sechi,L.A., Gazouli,M., Sieswerda,L.E., Molicotti,P., Ahmed,N., Ikonomopoulos,J., Scanu,A.M., Paccagnini,D., and Zanetti,S. (2006). Relationship between Crohn's disease, infection with Mycobacterium avium subspecies paratuberculosis and SLC11A1 gene polymorphisms in Sardinian patients. World J. Gastroenterol. 12, 7161‐ 7164.
Shaw,G. and Kamen,R. (1986). A conserved AU sequence from the 3' untranslated region of GM‐CSF mRNA mediates selective mRNA degradation. Cell. 46, 659‐667.
Shen,X., Ranallo,R., Choi,E., and Wu,C. (2003). Involvement of actin‐related proteins in ATP‐dependent chromatin remodeling. Mol. Cell. 12, 147‐155.
Sjolinder,M., Bjork,P., Soderberg,E., Sabri,N., Farrants,A.K., and Visa,N. (2005). The growing pre‐mRNA recruits actin and chromatin‐modifying factors to transcriptionally active genes. Genes Dev. 19, 1871‐1884.
Skamene,E., Gros,P., Forget,A., Kongshavn,P.A., St,C.C., and Taylor,B.A. (1982). Genetic regulation of resistance to intracellular pathogens. Nature. 297, 506‐509.
Skamene,E. and Pietrangeli,C.E. (1991). Genetics of the immune response to infectious pathogens. Curr. Opin. Immunol. 3, 511‐517.
Smale,S.T. (1994). Core Promoter Architecture for Eukaryotic Protein‐Coding Genes. In: Transcription: Mechanism and Regulation, ed. R.C.Conaway and Conaway J.W.New York: Raven Press, 63‐81.
Smith,S.S., Kelly,K.H., and Jockusch,B.M. (1979). Actin co‐purifies with RNA polymerase II. Biochem. Biophys. Res. Commun. 86, 161‐166.
Soe‐Lin,S., Apte,S.S., Andriopoulos,B., Jr., Andrews,M.C., Schranzhofer,M., Kahawita,T., Garcia‐Santos,D., and Ponka,P. (2009). Nramp1 promotes efficient macrophage recycling of iron following erythrophagocytosis in vivo. Proc. Natl. Acad. Sci. U. S. A. 106, 5960‐5965.
Soe‐Lin,S., Apte,S.S., Mikhael,M.R., Kayembe,L.K., Nie,G., and Ponka,P. (2010). Both Nramp1 and DMT1 are necessary for efficient macrophage iron recycling. Exp. Hematol. 38, 609‐617.
258 Soe‐Lin,S., Sheftel,A.D., Wasyluk,B., and Ponka,P. (2008). Nramp1 equips macrophages for efficient iron recycling. Exp. Hematol. 36, 929‐937.
Song,Z., Wang,M., Wang,X., Pan,X., Liu,W., Hao,S., and Zeng,X. (2007). Nuclear actin is involved in the regulation of CSF1 gene transcription in a chromatin required, BRG1 independent manner. J. Cell Biochem. 102, 403‐411.
Sorensen,T.I., Nielsen,G.G., Andersen,P.K., and Teasdale,T.W. (1988). Genetic and environmental influences on premature death in adult adoptees. N. Engl. J. Med. 318, 727‐732.
Soutoglou,E. and Talianidis,I. (2002). Coordination of PIC assembly and chromatin remodeling during differentiation‐induced gene activation. Science. 295, 1901‐1904.
Steele‐Mortimer,O., Meresse,S., Gorvel,J.P., Toh,B.H., and Finlay,B.B. (1999). Biogenesis of Salmonella typhimurium‐containing vacuoles in epithelial cells involves interactions with the early endocytic pathway. Cell Microbiol. 1, 33‐49.
Stewart,G.R., Patel,J., Robertson,B.D., Rae,A., and Young,D.B. (2005). Mycobacterial mutants with defective control of phagosomal acidification. PLoS. Pathog. 1, 269‐278.
Stober,C.B., Brode,S., White,J.K., Popoff,J.F., and Blackwell,J.M. (2007). Slc11a1, formerly Nramp1, is expressed in dendritic cells and influences major histocompatibility complex class II expression and antigen‐presenting cell function. Infect. Immun. 75, 5059‐5067.
Stranger,B.E. et al. (2007). Population genomics of human gene expression. Nat. Genet. 39, 1217‐1224.
Sturgill‐Koszycki,S., Schaible,U.E., and Russell,D.G. (1996). Mycobacterium‐containing phagosomes are accessible to early endosomes and reflect a transitional state in normal phagosome biogenesis. EMBO J. 15, 6960‐6968.
Sudarsanam,P., Iyer,V.R., Brown,P.O., and Winston,F. (2000). Whole‐genome expression analysis of snf/swi mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. U. S. A. 97, 3364‐3369.
Sudarsanam,P. and Winston,F. (2000). The Swi/Snf family nucleosome‐remodeling complexes and transcriptional control. Trends Genet. 16, 345‐351.
Suetsugu,S. and Takenawa,T. (2003). Regulation of cortical actin networks in cell migration. Int. Rev. Cytol. 229:245‐86., 245‐286.
Supek,F., Supekova,L., Nelson,H., and Nelson,N. (1996). A yeast manganese transporter related to the macrophage protein involved in conferring resistance to mycobacteria. Proc. Natl. Acad. Sci. U. S. A. 93, 5105‐5110.
259 Supek,F., Supekova,L., Nelson,H., and Nelson,N. (1997). Function of metal‐ion homeostasis in the cell division cycle, mitochondrial protein processing, sensitivity to mycobacterial infection and brain function. J. Exp. Biol. 200, 321‐330.
Taka,S., Gazouli,M., Politis,P.K., Pappa,K.I., and Anagnou,N.P. (2012). Transcription factor ATF‐3 regulates allele variation phenotypes of the human SLC11A1 gene. Mol. Biol. Rep.
Takahashi,K. et al. (2004). Promoter polymorphism of SLC11A1 (formerly NRAMP1) confers susceptibility to autoimmune type 1 diabetes mellitus in Japanese. Tissue Antigens. 63, 231‐236.
Tatosyan,A.G. and Mizenina,O.A. (2000). Kinases of the Src family: structure and functions. Biochemistry (Mosc. ). 65, 49‐58.
Taype,C.A., Castro,J.C., Accinelli,R.A., Herrera‐Velit,P., Shaw,M.A., and Espinoza,J.R. (2006). Association between SLC11A1 polymorphisms and susceptibility to different clinical forms of tuberculosis in the Peruvian population. Infect. Genet. Evol. 6, 361‐ 367.
Thierry‐Mieg,D. and Thierry‐Mieg,J. (2006). AceView: a comprehensive cDNA‐ supported gene and transcripts annotation. Genome Biol. 7 Suppl 1:S12.1‐14. Epub;%2006 Aug 7., S12‐S14.
Thuraisingam,T., Sam,H., Moisan,J., Zhang,Y., Ding,A., and Radzioch,D. (2006). Delayed cutaneous wound healing in mice lacking solute carrier 11a1 (formerly Nramp1): correlation with decreased expression of secretory leukocyte protease inhibitor. J. Invest Dermatol. 126, 890‐901.
Tomee,J.F., Hiemstra,P.S., Heinzel‐Wieland,R., and Kauffman,H.F. (1997). Antileukoprotease: an endogenous protein in the innate mucosal defense against fungi. J. Infect. Dis. 176, 740‐747.
Tonetti,D.A., Henning‐Chubb,C., Yamanishi,D.T., and Huberman,E. (1994). Protein kinase C‐beta is required for macrophage differentiation of human HL‐60 leukemia cells. J. Biol. Chem. 269, 23230‐23235.
Trayner,I.D., Bustorff,T., Etches,A.E., Mufti,G.J., Foss,Y., and Farzaneh,F. (1998). Changes in antigen expression on differentiating HL60 cells treated with dimethylsulphoxide, all‐trans retinoic acid, alpha1,25‐dihydroxyvitamin D3 or 12‐O‐ tetradecanoyl phorbol‐13‐acetate. Leuk. Res. 22, 537‐547.
Trotter,K.W. and Archer,T.K. (2008). The BRG1 transcriptional coregulator. Nucl. Recept. Signal. 6:e004. doi: 10.1621/nrs.06004., e004.
Valdez,Y., Grassl,G.A., Guttman,J.A., Coburn,B., Gros,P., Vallance,B.A., and Finlay,B.B. (2009). Nramp1 drives an accelerated inflammatory response during Salmonella‐ induced colitis in mice. Cell Microbiol. 11, 351‐362.
260 van,d., V, van Dissel,J.T., and Ottenhoff,T.H. (2009). Genetic deficiencies of innate immune signalling in human infectious disease. Lancet Infect. Dis. 9, 688‐698.
Vartiainen,M.K., Huet,G., and Skarp,K.P. (2012). Nuclear actin levels as an important transcriptional switch. Transcription. 3.
Vidal,S., Gros,P., and Skamene,E. (1995a). Natural resistance to infection with intracellular parasites: molecular genetics identifies Nramp1 as the Bcg/Ity/Lsh locus. J. Leukoc. Biol. 58, 382‐390.
Vidal,S., Tremblay,M.L., Govoni,G., Gauthier,S., Sebastiani,G., Malo,D., Skamene,E., Olivier,M., Jothy,S., and Gros,P. (1995b). The Ity/Lsh/Bcg locus: natural resistance to infection with intracellular parasites is abrogated by disruption of the Nramp1 gene. J. Exp. Med. 182, 655‐666.
Vidal,S.M., Malo,D., Marquis,J.F., and Gros,P. (2008). Forward genetic dissection of immunity to infection in the mouse. Annu. Rev. Immunol. 26:81‐132., 81‐132.
Vidal,S.M., Malo,D., Vogan,K., Skamene,E., and Gros,P. (1993). Natural resistance to infection with intracellular parasites: isolation of a candidate for Bcg. Cell. 73, 469‐485.
Vidal,S.M., Pinner,E., Lepage,P., Gauthier,S., and Gros,P. (1996). Natural resistance to intracellular infections: Nramp1 encodes a membrane phosphoglycoprotein absent in macrophages from susceptible (Nramp1 D169) mouse strains. J. Immunol. 157, 3559‐ 3568.
Villagra,A. et al. (2006). Chromatin remodeling and transcriptional activity of the bone‐specific osteocalcin gene require CCAAT/enhancer‐binding protein beta‐ dependent recruitment of SWI/SNF activity. J. Biol. Chem. 281, 22695‐22706.
Vradii,D., Wagner,S., Doan,D.N., Nickerson,J.A., Montecino,M., Lian,J.B., Stein,J.L., van Wijnen,A.J., Imbalzano,A.N., and Stein,G.S. (2006). Brg1, the ATPase subunit of the SWI/SNF chromatin remodeling complex, is required for myeloid differentiation to granulocytes. J. Cell Physiol. 206, 112‐118.
Wang,G. and Vasquez,K.M. (2007). Z‐DNA, an active element in the genome. Front Biosci. 12:4424‐38., 4424‐4438.
Wang,J., Cao,Y., and Steiner,D.F. (2003). Regulation of proglucagon transcription by activated transcription factor (ATF) 3 and a novel isoform, ATF3b, through the cAMP‐ response element/ATF site of the proglucagon gene promoter. J. Biol. Chem. 278, 32899‐32904.
Wang,J., Dudley,D., and Wang,X.L. (2002a). Haplotype‐specific effects on endothelial NO synthase promoter efficiency: modifiable by cigarette smoking. Arterioscler. Thromb. Vasc. Biol. 22, e1‐e4.
Wang,W. et al. (1996). Purification and biochemical heterogeneity of the mammalian SWI‐SNF complex. EMBO J. 15, 5370‐5382.
261 Wang,W. et al. (2002b). AMP‐activated kinase regulates cytoplasmic HuR. Mol. Cell Biol. 22, 3425‐3436.
Weinberg,E.D. (1999). Iron loading and disease surveillance. Emerg. Infect. Dis. 5, 346‐ 352.
Weiss,G. (2002). Iron and immunity: a double‐edged sword. Eur. J. Clin. Invest. 32 Suppl 1:70‐8., 70‐78.
Weiss,G., Werner‐Felmayer,G., Werner,E.R., Grunewald,K., Wachter,H., and Hentze,M.W. (1994). Iron regulates nitric oxide synthase activity by controlling nuclear transcription. J. Exp. Med. 180, 969‐976.
Weldon,S. and Taggart,C.C. (2007). Innate host defense functions of secretory leucoprotease inhibitor. Exp. Lung Res. 33, 485‐491.
White,J.K., Stewart,A., Popoff,J.F., Wilson,S., and Blackwell,J.M. (2004). Incomplete glycosylation and defective intracellular targeting of mutant solute carrier family 11 member 1 (Slc11a1). Biochem. J. 382, 811‐819.
Wilson,B.G. and Roberts,C.W. (2011). SWI/SNF nucleosome remodellers and cancer. Nat. Rev. Cancer. 11, 481‐492.
Wodnar‐Filipowicz,A. and Moroni,C. (1990). Regulation of interleukin 3 mRNA expression in mast cells occurs at the posttranscriptional level and is mediated by calcium ions. Proc. Natl. Acad. Sci. U. S. A. 87, 777‐781.
Wojciechowski,W., DeSanctis,J., Skamene,E., and Radzioch,D. (1999). Attenuation of MHC class II expression in macrophages infected with Mycobacterium bovis bacillus Calmette‐Guerin involves class II transactivator and depends on the Nramp1 gene. J. Immunol. 163, 2688‐2696.
Wrobel,C.N., Debnath,J., Lin,E., Beausoleil,S., Roussel,M.F., and Brugge,J.S. (2004). Autocrine CSF‐1R activation promotes Src‐dependent disruption of mammary epithelial architecture. J. Cell Biol. 165, 263‐273.
Wyllie,S., Seu,P., and Goss,J.A. (2002). The natural resistance‐associated macrophage protein 1 Slc11a1 (formerly Nramp1) and iron metabolism in macrophages. Microbes. Infect. 4, 351‐359.
Xu,R., Spencer,V.A., and Bissell,M.J. (2007). Extracellular matrix‐regulated gene expression requires cooperation of SWI/SNF and transcription factors. J. Biol. Chem. 282, 14992‐14999.
Xu,Y.Z., Di,M.S., Gallouzi,I., Rola‐Pleszczynski,M., and Radzioch,D. (2005). RNA‐binding protein HuR is required for stabilization of SLC11A1 mRNA and SLC11A1 protein expression. Mol. Cell Biol. 25, 8139‐8149.
262 Xu,Y.Z., Kanagaratham,C., Jancik,S., and Radzioch,D. (2013). Promoter deletion analysis using a dual‐luciferase reporter system. Methods Mol. Biol. 977:79‐93. doi: 10.1007/978‐1‐62703‐284‐1_7., 79‐93.
Xu,Y.Z., Kanagaratham,C., and Radzioch,D. (2012). Exploring Secrets of Nuclear Actin Involvement in the Regulation of Gene Transcription and Genome Organization. In: Current Frontiers and Perspectives in Cell Biology, ed. S.NajmanRijeka: InTech, 181‐ 210.
Xu,Y.Z., Thuraisingam,T., Morais,D.A., Rola‐Pleszczynski,M., and Radzioch,D. (2010). Nuclear translocation of beta‐actin is involved in transcriptional regulation during macrophage differentiation of HL‐60 cells. Mol. Biol. Cell. 21, 811‐820.
Xue,Y., Ren,J., Gao,X., Jin,C., Wen,L., and Yao,X. (2008a). GPS 2.0, a tool to predict kinase‐specific phosphorylation sites in hierarchy. Mol. Cell Proteomics. 7, 1598‐1608.
Xue,Y., Ren,J., Gao,X., Jin,C., Wen,L., and Yao,X. (2008b). GPS 2.0, a tool to predict kinase‐specific phosphorylation sites in hierarchy. Mol. Cell Proteomics. 7, 1598‐1608.
Yaman,I., Fernandez,J., Sarkar,B., Schneider,R.J., Snider,M.D., Nagy,L.E., and Hatzoglou,M. (2002). Nutritional control of mRNA stability is mediated by a conserved AU‐rich element that binds the cytoplasmic shuttling protein HuR. J. Biol. Chem. 277, 41539‐41546.
Yang,Y.S., Kim,S.J., Kim,J.W., and Koh,E.M. (2000). NRAMP1 gene polymorphisms in patients with rheumatoid arthritis in Koreans. J. Korean Med. Sci. 15, 83‐87.
Yen,J.H., Lin,C.H., Tsai,W.C., Ou,T.T., Wu,C.C., Hu,C.J., and Liu,H.W. (2006). Natural resistance‐associated macrophage protein 1 gene polymorphisms in rheumatoid arthritis. Immunol. Lett. 102, 91‐97.
Yeung,I.Y., Phillips,E., Mann,D.A., and Barton,C.H. (2004). Oxidant regulation of the bivalent cation transporter Nramp1. Biochem. Soc. Trans. 32, 1008‐1010.
Yoo,A.S. and Crabtree,G.R. (2009). ATP‐dependent chromatin remodeling in neural development. Curr. Opin. Neurobiol. 19, 120‐126.
Yu,H., Chen,J.K., Feng,S., Dalgarno,D.C., Brauer,A.W., and Schreiber,S.L. (1994). Structural basis for the binding of proline‐rich peptides to SH3 domains. Cell. 76, 933‐ 945.
Zaahl,M.G., Robson,K.J., Warnich,L., and Kotze,M.J. (2004). Expression of the SLC11A1 (NRAMP1) 5'‐(GT)n repeat: opposite effect in the presence of ‐237C‐‐>T. Blood Cells Mol. Dis. 33, 45‐50.
Zaahl,M.G., Warnich,L., Victor,T.C., and Kotze,M.J. (2005). Association of functional polymorphisms of SLC11A1 with risk of esophageal cancer in the South African Colored population. Cancer Genet. Cytogenet. 159, 48‐52.
263 Zhang,B., Chambers,K.J., Faller,D.V., and Wang,S. (2007). Reprogramming of the SWI/SNF complex for co‐activation or co‐repression in prohibitin‐mediated estrogen receptor regulation. Oncogene. 26, 7153‐7157.
Zhang,G., Wu,H., Ross,C.R., Minton,J.E., and Blecha,F. (2000). Cloning of porcine NRAMP1 and its induction by lipopolysaccharide, tumor necrosis factor alpha, and interleukin‐1beta: role of CD14 and mitogen‐activated protein kinases. Infect. Immun. 68, 1086‐1093.
Zhang,J., Ohta,T., Maruyama,A., Hosoya,T., Nishikawa,K., Maher,J.M., Shibahara,S., Itoh,K., and Yamamoto,M. (2006). BRG1 interacts with Nrf2 to selectively mediate HO‐ 1 induction in response to oxidative stress. Mol. Cell Biol. 26, 7942‐7952.
Zhang,W., Shao,L., Weng,X., Hu,Z., Jin,A., Chen,S., Pang,M., and Chen,Z.W. (2005). Variants of the natural resistance‐associated macrophage protein 1 gene (NRAMP1) are associated with severe forms of pulmonary tuberculosis. Clin. Infect. Dis. 40, 1232‐ 1236.
Zhao,K., Wang,W., Rando,O.J., Xue,Y., Swiderek,K., Kuo,A., and Crabtree,G.R. (1998). Rapid and phosphoinositol‐dependent binding of the SWI/SNF‐like BAF complex to chromatin after T lymphocyte receptor signaling. Cell. 95, 625‐636.
Ziegler,S.F., Wilson,C.B., and Perlmutter,R.M. (1988). Augmented expression of a myeloid‐specific protein tyrosine kinase gene (hck) after macrophage activation. J. Exp. Med. 168, 1801‐1810.
Zwilling,B.S., Kuhn,D.E., Wikoff,L., Brown,D., and LaFuse,W. (1999). Role of iron in Nramp1‐mediated inhibition of mycobacterial growth. Infect. Immun. 67, 1386‐1392.
Zwilling,B.S., Vespa,L., and Massie,M. (1987). Regulation of I‐A expression by murine peritoneal macrophages: differences linked to the Bcg gene. J. Immunol. 138, 1372‐ 1376.
264 APPENDIX I
Table S2.3 Beta-actin target genes identified by ChIP-on-chip in HL-60 cells left untreated or treated with PMA for 48 hrs. The mean ratio (R) means hybridization intensities between β-actin enriched DNA and input DNA. A region R (IgG/input ratio) with log2 higher than 1.0 and at the same time, log2 less than 0.5
was considered positive for beta-actin binding.
R GeneBank Gene name and Description log2 accession No. Identified target genes in untreated cells NM_005282 G protein-coupled receptor 4 (GPR4) 1.87 NM_001001690 hypothetical FLJ42133 (FLJ42133) 1.84 NM_001003 ribosomal protein, large, P1 (RPLP1), transcript variant 1 1.81 NM_001257 cadherin 13, H-cadherin (heart) (CDH13) 1.79 NM_031938 beta-carotene dioxygenase 2 (BCDO2), transcript variant 1 1.72 NM_012368 olfactory receptor, family 2, subfamily C, member 1 1.68 (OR2C1) NM_001039615 similar to zinc finger protein 75 (LOC440053) 1.67 NM_000123 excision repair cross-complementing rodent repair 1.64 deficiency, complementation group 5 (xeroderma pigmentosum, complementation group G (Cockayne syndrome)) (ERCC5) NM_139173 CG10806-like (LOC150159) 1.64 NM_006072 chemokine (C-C motif) ligand 26 (CCL26) 1.63 NM_001004697 olfactory receptor, family 2, subfamily T, member 5 1.59 (OR2T5) NM_018109 PAP associated domain containing 1 (PAPD1) 1.56 NM_018199 exonuclease 3'-5' domain-like 2 (EXDL2) 1.56 NM_032575 GLIS family zinc finger 2 (GLIS2) 1.45 NM_177980 cadherin-like 26 (CDH26), transcript variant a 1.38 NM_032505 kelch repeat and BTB (POZ) domain containing 8 1.35 (KBTBD8) NM_022340 zinc finger, FYVE domain containing 20 (ZFYVE20) 1.24 NM_002810 proteasome (prosome, macropain) 26S subunit, non- 1.22 ATPase, 4 (PSMD4), transcript variant 1 NM_213608 IIDS6411 (UNQ6411) 1.22 NM_177417 kinesin light chain 3 (KLC3) 1.15 NM_032251 coiled-coil domain containing 88 (CCDC88) 1.01
265 NM_033643 Homo sapiens ribosomal protein L36 (RPL36), transcript 1 variant 1, mRNA NM_001031 Homo sapiens ribosomal protein S28, mRNA 1 NM_182520 Homo sapiens chromosome 22 open reading frame 15 1 (C22orf15), mRNA NM_013319 Homo sapiens UbiA prenyltransferase domain containing 1 1(UBIAD1),mRNA
Identified target genes in HL-60 cells treated with PMA for 48 hrs NM_000578 solute carrier family 11 (proton-coupled divalent metal ion 4.27 transporters) member 1 (SLC11A1) NM_032330 calpain, small subunit 2 (CAPNS2) 3.75 NM_148962 oxoeicosanoid (OXE) receptor 1 (OXER1) 3.73 NM_005615 ribonuclease, RNase A family, k6 (RNASE6) 3.72 NM_033033 keratin 82 (KRT82) 3.46 NM_177980 cadherin-like 26 (CDH26), transcript variant a 3.33 NM_003314 tetratricopeptide repeat domain 1 (TTC1) 3.29 NM_178502 deltex 3 homolog (Drosophila) (DTX3) 3.28 NM_153443 killer cell immunoglobulin-like receptor, three domains, 3.21 long cytoplasmic tail, 3 (KIR3DL3) NM_013450 bromodomain adjacent to zinc finger domain, 2B (BAZ2B) 3.15 NM_020844 KIAA1456 protein (KIAA1456) 3.06 NM_000933 phospholipase C, beta 4 (PLCB4), transcript variant 1 3.06 NM_207288 AAA1 protein (AAA1),transcript variant VI 2.96 NM_002455 metaxin 1 (MTX1),transcript variant 1 2.93 NM_031941 Usher syndrome 1C binding protein 1 (USHBP1) 2.85 NM_003743 nuclear receptor coactivator 1 (NCOA1),transcript variant 1 2.85 NM_007020 U11/U12 snRNP 35K (U1SNRNPBP),transcript variant 1 2.85 NM_006933 solute carrier family 5 (inositol transporters) member 3 2.82 (SLC5A3) NM_003650 cystatin F (leukocystatin) (CST7) 2.79 NM_031476 cysteine-rich secretory protein LCCL domain containing 2 2.77 (CRISPLD2) NM_022166 xylosyltransferase I (XYLT1) 2.77 NM_001002840 DKFZp434A0131 protein (DKFZP434A0131),transcript 2.75 variant 1 NM_015037 KIAA0913 (KIAA0913) 2.74 NM_001009899 KIAA2018 (KIAA2018) 2.73 NM_012384 glucocorticoid modulatory element binding protein 2 2.72 (GMEB2) NM_000133 coagulation factor IX (plasma thromboplastic component, 2.7 Christmas disease, hemophilia B) (F9)
266 NM_001014 ribosomal protein S10 (RPS10) 2.7 NM_014752 signal peptidase complex subunit 2 homolog (S. cerevisiae) 2.69 (SPCS2) NM_030588 mitochondrial tumor suppressor 1 (MTUS1) nuclear gene 2.65 encoding mitochondrial protein, transcript variant 5 NM_020749 signal peptidase complex subunit 2 homolog (S. cerevisiae) 2.64 (SPCS2) NM_032350 hypothetical protein MGC11257 (MGC11257) 2.6 NM_013974 dimethylarginine dimethylaminohydrolase 2 (DDAH2) 2.57 NM_032856 WD repeat domain 73 (WDR73) 2.57 NM_024556 family with sequence similarity 118, member B 2.54 (FAM118B) NM_139245 protein phosphatase 1 (formerly 2C)-like (PPM1L) 2.53 NM_001568 eukaryotic translation initiation factor 3, subunit 6 48kDa 2.53 (EIF3S6) NM_005511 melan-A (MLANA) 2.48 NM_032266 chromosome 2 open reading frame 16 (C2orf16) 2.48 NM_207328 hypothetical protein LOC150763 (LOC150763) 2.48 NM_005193 caudal type homeobox transcription factor 4 (CDX4) 2.48 NM_203309 hypothetical MGC48595 (MGC48595) 2.46 NM_173618 HIRA interacting protein 3 (HIRIP3) 2.45 NM_024704 chromosome 20 open reading frame 23 (C20orf23) 2.45 NM_020140 ankyrin repeat and sterile alpha motif domain containing 2.44 1B (ANKS1B),transcript variant 3 NM_005949 metallothionein 1F (functional) (MT1F) 2.42 NM_018277 chromosome 21 open reading frame 77 (C21orf77) 2.42 NM_002186 interleukin 9 receptor (IL9R),transcript variant 1 2.4 NM_006638 ribonuclease P 40kDa subunit (RPP40) 2.39 NM_152787 mitogen-activated protein kinase kinase kinase 7 interacting 2.36 protein 3 (MAP3K7IP3) NM_001039503 polyserase 3 (POL3S) 2.35 NM_001018837 HCLS1 associated protein X-1 (HAX1),transcript variant 2 2.35 NM_031290 coiled-coil domain containing 70 (CCDC70) 2.34 NM_021046 keratin associated protein 5-8 (KRTAP5-8) 2.34 NM_016267 vestigial like 1 (Drosophila) (VGLL1) 2.33 NM_133498 sperm acrosome associated 4 (SPACA4) 2.32 NM_004748 cell cycle progression 1 (CCPG1),transcript variant 1 2.3 NM_032222 hypothetical protein FLJ22374 (FLJ22374) 2.3 NM_000113 torsin family 1, member A (torsin A) (TOR1A) 2.3 NM_014058 transmembrane protease, serine 11E (TMPRSS11E) 2.29 NM_002618 peroxisome biogenesis factor 13 (PEX13) 2.29 NM_001218 carbonic anhydrase XII (CA12),transcript variant 1 2.28
267 NM_017540 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N- 2.28 acetylgalactosaminyltransferase 10 (GalNAc-T10) (GALNT10) NM_198540 UDP-GlcNAc:betaGal beta-1,3-N- 2.27 acetylglucosaminyltransferase 8 (B3GNT8) NM_000181 glucuronidase, beta (GUSB) 2.27 NM_003846 peroxisomal biogenesis factor 11B (PEX11B) 2.25 NM_001937 dermatopontin (DPT) 2.25 NM_177417 kinesin light chain 3 (KLC3) 2.25 NM_144676 transmembrane emp24 protein transport domain containing 2.25 6 (TMED6) NM_003951 solute carrier family 25 (mitochondrial carrier, brain) 2.25 member 14 (SLC25A14) nuclear gene encoding mitochondrial protein NM_178173 coiled-coil domain containing 36 (CCDC36) 2.25 NM_033642 fibroblast growth factor 13 (FGF13),transcript variant 1B 2.24 NM_001646 apolipoprotein C-IV (APOC4) 2.24 NM_019059 translocase of outer mitochondrial membrane 7 homolog 2.24 (yeast) (TOMM7) NM_000619 interferon, gamma (IFNG) 2.24 NM_016057 coatomer protein complex, subunit zeta 1 (COPZ1) 2.21 NM_012461 TERF1 (TRF1)-interacting nuclear factor 2 (TINF2) 2.2 NM_001364 discs, large homolog 2, chapsyn-110 (Drosophila) (DLG2) 2.2 NM_005564 lipocalin 2 (oncogene 24p3) (LCN2) 2.19 NM_006471 myosin regulatory light chain MRCL3 (MRCL3) 2.18 NM_001029 ribosomal protein S26 (RPS26) 2.17 NM_004651 ubiquitin specific peptidase 11 (USP11) 2.17 NM_015162 acyl-CoA synthetase bubblegum family member 1 2.17 (ACSBG1) NM_053276 vitrin (VIT) 2.16 NM_206921 chromosome 6 open reading frame 204 2.16 (C6orf204),transcript variant 2 NM_004157 protein kinase, cAMP-dependent, regulatory, type II, alpha 2.16 (PRKAR2A) NM_001033577 zinc finger, HIT type 3 (ZNHIT3),transcript variant 2 2.16 NM_198471 ankyrin repeat domain 47 (ANKRD47) 2.15 NM_001017408 golgi associated PDZ and coiled-coil motif containing 2.15 (GOPC),transcript variant 1 NM_207482 FLJ44048 protein (FLJ44048) 2.15 NM_002803 proteasome (prosome, macropain) 26S subunit, ATPase, 2 2.15 (PSMC2) NM_001783 CD79a molecule, immunoglobulin-associated alpha 2.15 (CD79A),transcript variant 1
268 NM_007150 zinc finger protein 185 (LIM domain) (ZNF185) 2.14 NM_015934 nucleolar protein NOP5/NOP58 (NOP5/NOP58) 2.14 NM_016087 wingless-type MMTV integration site family, member 16 2.14 (WNT16),transcript variant 2 NM_007042 ribonuclease P 14kDa subunit (RPP14) 2.13 NM_013422 Rho GTPase activating protein 6 (ARHGAP6),transcript 2.13 variant 5 NM_130459 torsin family 2, member A (TOR2A) 2.13 NM_182608 ankyrin repeat domain 33 (ANKRD33) 2.13 NM_002292 laminin, beta 2 (laminin S) (LAMB2) 2.12 NM_006628 cyclic AMP phosphoprotein, 19 kD (ARPP-19) 2.11 NM_020307 cyclin L1 (CCNL1) 2.1 NM_033206 Hypothetical protein FLJ00060 (FLJ00060) 2.1 NM_001030005 complexin 3 (CPLX3) 2.1 NM_181572 regulator of G-protein signalling like 1 (RGSL1) 2.1 NM_012164 F-box and WD-40 domain protein 2 (FBXW2) 2.1 NM_182511 cerebellin 2 precursor (CBLN2) 2.09 NM_138318 potassium channel, subfamily K, member 10 2.08 (KCNK10),transcript variant 3 NM_001017435 cancer/testis antigen CT45-3 (CT45-3) 2.07 NM_001014977 chromosome 20 open reading frame 179 2.07 (C20orf179),transcript variant 2 NM_080864 relaxin 3 (RLN3) 2.07 NM_207339 P antigen family, member 2 (prostate associated) (PAGE2) 2.06 NM_022096 ankyrin repeat domain 5 (ANKRD5),transcript variant 1 2.06 NM_019037 exosome component 4 (EXOSC4) 2.05 NM_018937 protocadherin beta 3 (PCDHB3) 2.05 NM_002908 v-rel reticuloendotheliosis viral oncogene homolog (avian) 2.05 (REL) NM_016264 zinc finger protein 44 (ZNF44) 2.05 NM_152524 shugoshin-like 2 (S. pombe) (SGOL2) 2.04 NM_016352 carboxypeptidase A4 (CPA4) 2.04 NM_206894 zinc finger protein 790 (ZNF790) 2.04 NM_000355 transcobalamin II; macrocytic anemia (TCN2) 2.03 NM_001153 annexin A4 (ANXA4) 2.02 NM_018244 chromosome 20 open reading frame 44 2.02 (C20orf44),transcript variant 1 NM_002088 glutamate receptor, ionotropic, kainate 5 (GRIK5) 2.01 NM_182503 deaminase domain containing 1 (DEADC1) 2.01 NM_007039 protein tyrosine phosphatase, non-receptor type 21 2.01 (PTPN21)
269 NM_000632 integrin, alpha M (complement component 3 receptor 3 2.01 subunit) (ITGAM) NM_005066 splicing factor proline/glutamine-rich (polypyrimidine tract 2.01 binding protein associated) (SFPQ) NM_001037306 WD repeat domain 16 (WDR16),transcript variant 1 2.01 NM_014773 KIAA0141 (KIAA0141) 2.01 NM_000757 Homo sapiens colony stimulating factor 1 (macrophage) 2.01 (CSF1) NM_024768 coiled-coil domain containing 48 (CCDC48) 2 NM_002560 purinergic receptor P2X, ligand-gated ion channel, 4 2 (P2RX4) NM_031231 amyloid beta (A4) precursor protein-binding, family A, 2 member 2 binding protein (APBA2BP),transcript variant 1 NM_153002 G protein-coupled receptor 156 (GPR156) 2 NM_000174 glycoprotein IX (platelet) (GP9) 1.99 NM_052941 guanylate binding protein 4 (GBP4) 1.99 NM_138969 retinal short chain dehydrogenase reductase isoform 1 1.99 (RDHE2) NM_031407 HECT, UBA and WWE domain containing 1 (HUWE1) 1.98 NM_001900 cystatin D (CST5) 1.98 NM_178499 coiled-coil domain containing 60 (CCDC60) 1.98 NM_000459 TEK tyrosine kinase, endothelial (venous malformations, 1.98 multiple cutaneous and mucosal) (TEK) NM_001031 Homo sapiens ribosomal protein S28, mRNA 1.98 NM_000550 tyrosinase-related protein 1 (TYRP1) 1.97 NM_032735 hypothetical protein MGC13168 (VMD2L3) 1.97 NM_005295 G protein-coupled receptor 22 (GPR22) 1.97 NM_012449 six transmembrane epithelial antigen of the prostate 1 1.97 (STEAP1) NM_003814 ADAM metallopeptidase domain 20 (ADAM20) 1.97 NM_032229 SLIT and NTRK-like family, member 6 (SLITRK6) 1.96 NM_182831 TNT protein (TNT) 1.96 NM_145062 chromosome 6 open reading frame 113 (C6orf113) 1.96 NM_173628 dynein, axonemal, heavy chain like 1 (DNAHL1) 1.96 NM_005538 inhibin, beta C (INHBC) 1.95 NM_001007525 hypothetical protein LOC284434 (LOC284434) 1.95 NM_032040 coiled-coil domain containing 8 (CCDC8) 1.95 NM_013940 olfactory receptor, family 10, subfamily H, member 1 1.95 (OR10H1) NM_020888 KIAA1522 (KIAA1522) 1.94 NM_016615 solute carrier family 6 (neurotransmitter transporter, 1.94 GABA) member 13 (SLC6A13)
270 NM_138338 polymerase (RNA) III (DNA directed) polypeptide H 1.94 (22.9kD) (POLR3H),transcript variant 1 NM_003787 nucleolar protein 4 (NOL4) 1.94 NM_023945 membrane-spanning 4-domains, subfamily A, member 5 1.94 (MS4A5) NM_153235 taxilin beta (TXLNB) 1.94 NM_016237 anaphase promoting complex subunit 5 (ANAPC5) 1.94 NM_005411 surfactant, pulmonary-associated protein A1 (SFTPA1) 1.94 NM_000156 guanidinoacetate N-methyltransferase (GAMT),transcript 1.93 variant 1 NM_004657 serum deprivation response (phosphatidylserine binding 1.93 protein) (SDPR) NM_002227 Janus kinase 1 (a protein tyrosine kinase) (JAK1) 1.93 NM_001004298 chromosome 10 open reading frame 90 (C10orf90) 1.93 NM_022495 chromosome 14 open reading frame 135 (C14orf135) 1.92 NM_001012980 Homo sapiens spermidine/spermine N1-acetyl transferase- 1.92 like 1 (SATL1) NM_003638 integrin, alpha 8 (ITGA8) 1.92 NM_174926 transmembrane protein 136 (TMEM136) 1.92 NM_030978 actin related protein 2/3 complex, subunit 5-like (ARPC5L) 1.92 NM_001001329 protein kinase C substrate 80K-H (PRKCSH),transcript 1.92 variant 2 NM_018463 integrin alpha FG-GAP repeat containing 2 (ITFG2) 1.92 NM_005701 snurportin 1 (SNUPN),transcript variant 1 1.91 NM_001005180 olfactory receptor, family 56, subfamily B, member 1 1.91 (OR56B1) NM_000440 phosphodiesterase 6A, cGMP-specific, rod, alpha (PDE6A) 1.91 NM_015954 2-deoxyribose-5-phosphate aldolase homolog (C. elegans) 1.91 (DERA) NM_002827 protein tyrosine phosphatase, non-receptor type 1 (PTPN1) 1.9 NM_014803 zinc finger protein 518 (ZNF518) 1.9 NM_145294 WD repeat domain 90 (WDR90) 1.9 NM_006662 Snf2-related CBP activator protein (SRCAP) 1.9 NM_032336 GINS complex subunit 4 (Sld5 homolog) (GINS4) 1.9 NM_000989 ribosomal protein L30 (RPL30) 1.9 NM_004967 integrin-binding sialoprotein (bone sialoprotein, bone 1.89 sialoprotein II) (IBSP) NM_018180 DEAH (Asp-Glu-Ala-His) box polypeptide 32 (DHX32) 1.89 NM_015032 androgen-induced proliferation inhibitor (APRIN) 1.89 NM_001013651 hypothetical gene supported by AK128318 (LOC389607) 1.89 NM_152591 coiled-coil domain containing 63 (CCDC63) 1.89 NM_001033658 hypothetical protein LOC283152 (LOC283152) 1.89
271 NM_198275 hypothetical protein LOC196264 (LOC196264) 1.89 NM_000725 calcium channel, voltage-dependent, beta 3 subunit 1.89 (CACNB3) NM_206880 olfactory receptor, family 2, subfamily V, member 2 1.89 (OR2V2) NM_018460 Rho GTPase activating protein 15 (ARHGAP15) 1.89 NM_014066 COMM domain containing 5 (COMMD5) 1.88 NM_147189 chromosome 8 open reading frame 72 (C8orf72) 1.88 NM_001536 protein arginine methyltransferase 1 (PRMT1),transcript 1.88 variant 1 NM_015916 family with sequence similarity 26, member B (FAM26B) 1.88 NM_015695 bromodomain and PHD finger containing, 3 (BRPF3) 1.88 NM_000518 hemoglobin, beta (HBB) 1.88 NM_001002 ribosomal protein, large, P0 (RPLP0),transcript variant 1 1.88 NM_001655 archain 1 (ARCN1) 1.88 NM_002440 mutS homolog 4 (E. coli) (MSH4) 1.88 NM_152338 zymogen granule protein 16 (ZG16) 1.88 NM_020425 chromosome 6 open reading frame 162 1.88 (C6orf162),transcript variant NM_152295 threonyl-tRNA synthetase (TARS) 1.87 NM_001034846 similar to hypothetical protein FLJ36144 (LOC442132) 1.87 NM_031279 alanine-glyoxylate aminotransferase 2-like 1 (AGXT2L1) 1.87 NM_203397 similar to hypothetical protein MGC49416 (LOC255374) 1.87 NM_145738 synaptogyrin 1 (SYNGR1),transcript variant * 1.87 NM_003948 cyclin-dependent kinase-like 2 (CDC2-related kinase) 1.86 (CDKL2) NM_001850 collagen, type VIII, alpha 1 (COL8A1),transcript variant 1 1.86 NM_182556 solute carrier family 25, member 45 (SLC25A45) 1.86 NM_024306 fatty acid 2-hydroxylase (FA2H) 1.86 NM_178559 ATP-binding cassette, sub-family B (MDR/TAP) member 5 1.86 (ABCB5) NM_020980 aquaporin 9 (AQP9) 1.86 NM_017775 tetratricopeptide repeat domain 19 (TTC19) 1.86 NM_003106 SRY (sex determining region Y)-box 2 (SOX2) 1.86 NM_002796 proteasome (prosome, macropain) subunit, beta type, 4 1.86 (PSMB4) NM_207422 TPT1-like protein (FLJ44635) 1.86 NM_003813 ADAM metallopeptidase domain 21 (ADAM21) 1.85 NM_033297 NACHT, leucine rich repeat and PYD containing 12 1.85 (NALP12),transcript variant 1 NM_001002918 olfactory receptor, family 8, subfamily D, member 2 1.85 (OR8D2)
272 NM_138698 prematurely terminated decay factor-like (LOC91431) 1.85 NM_024918 chromosome 20 open reading frame 172 (C20orf172) 1.85 NM_016206 vestigial like 3 (Drosophila) (VGLL3) 1.85 NM_001005218 olfactory receptor, family 5, subfamily B, member 21 1.85 (OR5B21) NM_020165 RAD18 homolog (S. cerevisiae) (RAD18) 1.84 NM_003511 histone 1, H2al (HIST1H2AL) 1.84 NM_007190 SEC23 interacting protein (SEC23IP) 1.84 NM_181791 G protein-coupled receptor 141 (GPR141) 1.84 NM_175852 taxilin alpha (TXLNA) 1.84 NM_001005490 olfactory receptor, family 6, subfamily C, member 74 1.84 (OR6C74) NM_001917 D-amino-acid oxidase (DAO) 1.84 NM_001024683 zinc finger protein 688 (ZNF688),transcript variant 1.84 NM_006397 ribonuclease H2, subunit A (RNASEH2A) 1.84 NM_002397 MADS box transcription enhancer factor 2, polypeptide C 1.83 (myocyte enhancer factor 2C) (MEF2C) NM_001031708 coiled-coil domain containing 25 (CCDC25) 1.83 NM_001033018 beta-defensin 137 (DEFB137) 1.83 NM_145174 DnaJ (Hsp40) homolog, subfamily B, member 7 (DNAJB7) 1.83 NM_021148 zinc finger protein 273 (ZNF273),transcript variant 1 1.83 NM_022459 exportin 4 (XPO4) 1.83 NM_032857 lactamase, beta (LACTB) nuclear gene encoding 1.83 mitochondrial protein, transcript variant 1 NM_016118 negative regulator of ubiquitin-like proteins 1 (NUB1) 1.83 NM_000603 Homo sapiens nitric oxide synthase 3 (endothelial cell) 1.83 (NOS3) NM_001014796 discoidin domain receptor family, member 2 1.83 (DDR2),transcript variant 1 NM_002938 ring finger protein 4 (RNF4) 1.82 NM_153022 chromosome 12 open reading frame 59 (C12orf59) 1.82 NM_001733 complement component 1, r subcomponent (C1R) 1.82 NM_198506 FLJ44691 protein (FLJ44691) 1.82 NM_002730 protein kinase, cAMP-dependent, catalytic, alpha 1.82 (PRKACA),transcript variant 1 NM_001005165 olfactory receptor, family 52, subfamily E, member 4 1.82 (OR52E4) NM_001001916 olfactory receptor, family 52, subfamily J, member 3 1.81 (OR52J3) NM_005800 ubiquitin specific peptidase like 1 (USPL1) 1.81 NM_002000 Fc fragment of IgA, receptor for (FCAR),transcript variant 1.81 NM_001385 dihydropyrimidinase (DPYS) 1.81
273 NM_194277 FERM domain containing 7 (FRMD7) 1.81 NM_198464 tryptophan/serine protease (UNQ9391) 1.81 NM_000707 arginine vasopressin receptor 1B (AVPR1B) 1.81 NM_181708 hypothetical protein LOC144233 (LOC144233) 1.81 NM_014728 FERM and PDZ domain containing 4 (FRMPD4) 1.8 NM_030627 cytoplasmic polyadenylation element binding protein 4 1.8 (CPEB4) NM_145256 leucine rich repeat containing 25 (LRRC25) 1.8 NM_013377 PDZ domain containing RING finger 4 (PDZRN4) 1.8 NM_003170 suppressor of Ty 6 homolog (S. cerevisiae) (SUPT6H) 1.8 NM_133455 EMI domain containing 1 (EMID1) 1.8 NM_178818 CKLF-like MARVEL transmembrane domain containing 4 1.8 (CMTM4),transcript variant 1 NM_001010976 hypothetical LOC149950 (LOC149950) 1.8 NM_138806 CD200 receptor 1 (CD200R1),transcript variant 1 1.8 NM_001001656 olfactory receptor, family 9, subfamily A, member 4 1.8 (OR9A4) NM_152460 chromosome 17 open reading frame 77 (C17orf77) 1.8 NM_001039165 MAS-related GPR, member E (MRGPRE) 1.79 NM_002064 glutaredoxin (thioltransferase) (GLRX) 1.79 NM_003176 synaptonemal complex protein 1 (SYCP1) 1.79 NM_207345 C-type lectin domain family 9, member A (CLEC9A) 1.79 NM_031302 glycosyltransferase 8 domain containing 2 (GLT8D2) 1.79 NM_006072 chemokine (C-C motif) ligand 26 (CCL26) 1.79 NM_003320 tubby homolog (mouse) (TUB),transcript variant 1 1.79 NM_003922 hect (homologous to the E6-AP (UBE3A) carboxyl 1.79 terminus) domain and RCC1 (CHC1)-like domain (RLD) 1 (HERC1) NM_000896 cytochrome P450, family 4, subfamily F, polypeptide 3 1.79 (CYP4F3) NM_147196 transmembrane inner ear (TMIE) 1.79 NM_005638 synaptobrevin-like 1 (SYBL1) 1.79 NM_001014763 electron-transfer-flavoprotein, beta polypeptide 1.79 (ETFB),transcript variant NM_001522 guanylate cyclase 2F, retinal (GUCY2F) 1.79 NM_006391 importin 7 (IPO7) 1.79 NM_022112 p53-regulated apoptosis-inducing protein 1 (P53AIP1) 1.79 NM_176824 Bardet-Biedl syndrome 7 (BBS7),transcript variant 1 1.78 NM_001343 disabled homolog 2, mitogen-responsive phosphoprotein 1.78 (Drosophila) (DAB2) NM_181269 CKLF-like MARVEL transmembrane domain containing 1 1.78 (CMTM1),transcript variant 1
274 NM_014004 protocadherin gamma subfamily A, 8 1.78 (PCDHGA8),transcript variant NM_000200 histatin 3 (HTN3) 1.78 NM_018262 methyl-CpG binding domain protein 4 (MBD4) 1.78 NM_001033602 KIAA0774 (KIAA0774),transcript variant 1 1.78 NM_005124 nucleoporin 153kDa (NUP153) 1.78 NM_198182 grainyhead-like 1 (Drosophila) (GRHL1),transcript variant 1.78 * NM_016093 ribosomal protein L26-like 1 (RPL26L1) 1.78 NM_181619 keratin associated protein 21-1 (KRTAP21-1) 1.78 NM_080718 T-box 5 (TBX5),transcript variant 1.77 NM_144651 peroxidasin homolog-like (Drosophila) (PXDNL) 1.77 NM_018337 zinc finger protein 444 (ZNF444) 1.77 NM_018984 slingshot homolog 1 (Drosophila) (SSH1) 1.77 NM_021093 katanin p60 subunit A-like 1 (KATNAL1),transcript variant 1.77 1 NM_001014380 katanin p60 subunit A-like 1 (KATNAL1),transcript variant 1.77 2 NM_017662 transient receptor potential cation channel, subfamily M, 1.77 member 6 (TRPM6) NM_017925 DENN/MADD domain containing 4C (DENND4C) 1.77 NM_019082 DEAD (Asp-Glu-Ala-Asp) box polypeptide 56 (DDX56) 1.77 NM_007364 transmembrane emp24 protein transport domain containing 1.77 3 (TMED3) NM_033139 caldesmon 1 (CALD1),transcript variant * 1.77 NM_201383 plectin 1, intermediate filament binding protein 500kDa 1.77 (PLEC1),transcript variant 7 NM_014346 TBC1 domain family, member 22A (TBC1D22A) 1.77 NM_030784 G protein-coupled receptor 63 (GPR63) 1.76 NM_017678 family with sequence similarity 55, member D (FAM55D) 1.76 NM_006032 copine VI (neuronal) (CPNE6) 1.76 NM_001015882 DnaJ-like protein (bA16L21.2.1) 1.76 NM_001001674 olfactory receptor, family 4, subfamily F, member 15 1.76 (OR4F15) NM_032884 chromosome 1 open reading frame 94 (C1orf94) 1.76 NM_001004466 olfactory receptor, family 10, subfamily H, member 5 1.76 (OR10H5) NM_007366 phospholipase A2 receptor 1, 180kDa (PLA2R1),transcript 1.76 variant 1 NM_173497 HECT domain containing 2 (HECTD2),transcript variant * 1.76 NM_000045 arginase, liver (ARG1) 1.76 NM_000432 myosin, light polypeptide 2, regulatory, cardiac, slow 1.76 (MYL2)
275 NM_015088 trinucleotide repeat containing 6B (TNRC6B),transcript 1.75 variant 1 NM_006496 guanine nucleotide binding protein (G protein) alpha 1.75 inhibiting activity polypeptide 3 (GNAI3) NM_024086 methyltransferase 10 domain containing (METT10D) 1.75 NM_014554 SUMO1/sentrin specific peptidase 1 (SENP1) 1.75 NM_020665 transmembrane protein 27 (TMEM27) 1.75 NM_182615 hypothetical protein MGC40069 (MGC40069) 1.75 NM_173516 poly(A)-specific ribonuclease (PARN)-like domain 1.75 containing 1 (PNLDC1) NM_007007 cleavage and polyadenylation specific factor 6, 68kDa 1.75 (CPSF6) NM_018150 chromosome 1 open reading frame 164 (C1orf164) 1.75 NM_006010 arginine-rich, mutated in early stage tumors (ARMET) 1.75 NM_001114 adenylate cyclase 7 (ADCY7) 1.74 NM_000164 gastric inhibitory polypeptide receptor (GIPR) 1.74 NM_021239 RNA binding motif protein 25 (RBM25) 1.74 NM_004231 ATPase, H+ transporting, lysosomal 14kDa, V1 subunit F 1.74 (ATP6V1F) NM_021948 brevican (BCAN),transcript variant 1 1.74 NM_006582 glucocorticoid modulatory element binding protein 1 1.74 (GMEB1),transcript variant 1 NM_015015 jumonji domain containing 2B (JMJD2B) 1.74 NM_006085 3'(2') 5'-bisphosphate nucleotidase 1 (BPNT1) 1.74 NM_022037 TIA1 cytotoxic granule-associated RNA binding protein 1.73 (TIA1),transcript variant 1 NM_003770 keratin 37 (KRT37) 1.73 NM_014897 zinc finger protein 652 (ZNF652) 1.73 NM_001649 shroom family member 2 (SHROOM2) 1.73 NM_152470 ring finger protein 165 (RNF165) 1.73 NM_002392 Mdm2, transformed 3T3 cell double minute 2, p53 binding 1.73 protein (mouse) (MDM2),transcript variant MDM2e NM_006631 zinc finger protein 266 (ZNF266) 1.73 NM_001010 ribosomal protein S6 (RPS6) * 1.73 NM_020242 kinesin family member 15 (KIF15) 1.73 NM_139161 crumbs homolog 3 (Drosophila) (CRB3),transcript variant 1.73 2 NM_013249 zinc finger protein 214 (ZNF214) 1.73 NM_024619 zinc finger protein 214 (ZNF214) 1.72 NM_030626 leucine rich repeat containing 27 (LRRC27) 1.72 NM_006782 zinc finger protein-like 1 (ZFPL1) 1.72 NM_001032377 sulfotransferase SULT6B1 (SULT6B1) 1.72
276 NM_005628 solute carrier family 1 (neutral amino acid transporter) 1.72 member 5 (SLC1A5) NM_006755 transaldolase 1 (TALDO1) 1.72 NM_030754 serum amyloid A2 (SAA2) 1.72 NM_001013735 forkhead box B2 (FOXB2) 1.72 NM_198152 urotensin 2 domain containing (UTS2D) 1.72 NM_001005171 olfactory receptor, family 52, subfamily K, member 1 1.72 (OR52K1) NM_001012981 zinc finger protein 694 (ZNF694) 1.71 NM_016954 T-box 22 (TBX22) 1.71 NM_001012 ribosomal protein S8 (RPS8) 1.71 NM_031886 potassium voltage-gated channel, shaker-related subfamily, 1.71 member 7 (KCNA7) NM_021081 growth hormone releasing hormone (GHRH) 1.71 NM_004080 diacylglycerol kinase, beta 90kDa (DGKB),transcript 1.71 variant 1 NM_175901 hypothetical protein LOC283932 (LOC283932) 1.71 NM_182560 chromosome 14 open reading frame 177 (C14orf177) 1.71 NM_002266 karyopherin alpha 2 (RAG cohort 1, importin alpha 1) 1.71 (KPNA2) NM_020468 sorting nexin 14 (SNX14),transcript variant 2 1.71 NM_012467 tryptase gamma 1 (TPSG1) 1.71 NM_021153 cadherin 19, type 2 (CDH19) 1.71 NM_198085 ring finger protein 148 (RNF148) 1.71 NM_020547 anti-Mullerian hormone receptor, type II (AMHR2) 1.71 NM_001010856 hypothetical protein LOC147804 ( LOC147804) 1.71 NM_000229 lecithin-cholesterol acyltransferase (LCAT) 1.71 NM_003063 sarcolipin (SLN) 1.71 NM_002799 proteasome (prosome, macropain) subunit, beta type, 7 1.71 (PSMB7) NM_145276 zinc finger protein 563 (ZNF563) 1.7 NM_001039905 hypothetical protein LOC644809 (FLJ38596) 1.7 NM_006256 protein kinase N2 (PKN2) 1.7 NM_001539 DnaJ (Hsp40) homolog, subfamily A, member 1 1.7 (DNAJA1) NM_172004 dendritic cell-associated lectin-1 (DCAL1) 1.7 NM_020463 KIAA1387 protein (SMEK2) 1.7 NM_006079 Cbp/p300-interacting transactivator, with Glu/Asp-rich 1.7 carboxy-terminal domain, 2 (CITED2) NM_005246 fer (fps/fes related) tyrosine kinase (phosphoprotein 1.7 NCP94) (FER) NM_005744 ariadne homolog, ubiquitin-conjugating enzyme E2 binding 1.7 protein, 1 (Drosophila) (ARIH1)
277 NM_031945 tetraspanin 10 (TSPAN10) 1.7 NM_005966 NGFI-A binding protein 1 (EGR1 binding protein 1) 1.7 (NAB1) NM_006372 synaptotagmin binding, cytoplasmic RNA interacting 1.7 protein (SYNCRIP) NM_016052 CGI-115 protein (CGI-115) 1.7 NM_005598 nescient helix loop helix 1 (NHLH1) 1.7 NM_001032731 2'-5'-oligoadenylate synthetase 2, 69/71kDa 1.7 (OAS2),transcript variant 3 NM_001005338 olfactory receptor, family 5, subfamily H, member 1 1.7 (OR5H1) NM_144693 zinc finger protein 558 (ZNF558) 1.7 NM_005128 dopey family member 2 (DOPEY2) 1.7 NM_023923 phosphatase and actin regulator 4 (PHACTR4),transcript 1.7 variant 2 NM_203347 MSFL2541 (UNQ2541) 1.7 NM_001381 docking protein 1, 62kDa (downstream of tyrosine kinase 1.7 1) (DOK1) NM_016481 chromosome 9 open reading frame 156 (C9orf156) 1.7 NM_013258 PYD and CARD domain containing (PYCARD),transcript 1.7 variant 1 NM_031304 deoxyhypusine hydroxylase/monooxygenase (DOHH) 1.7 NM_001031615 aldehyde dehydrogenase 3 family, member B2 1.7 (ALDH3B2),transcript variant 2 NM_152729 5'-nucleotidase domain containing 1 (NT5DC1) 1.69 NM_000488 serpin peptidase inhibitor, clade C (antithrombin) member 1.69 1 (SERPINC1) NM_144772 apolipoprotein A-I binding protein (APOA1BP) 1.69 NM_018327 chromosome 20 open reading frame 38 (C20orf38) 1.69 NM_001017930 WD repeat domain 42B (WDR42B) 1.69 NM_000616 CD4 molecule (CD4) 1.69 NM_177986 desmoglein 4 (DSG4) 1.69 NM_003216 thyrotrophic embryonic factor (TEF) 1.69 NM_012323 v-maf musculoaponeurotic fibrosarcoma oncogene 1.69 homolog F (avian) (MAFF),transcript variant 1 NM_003760 Eukaryotic translation initiation factor 4 gamma 3 (EIF4G3) 1.69 NM_080610 cystatin 9-like (mouse) (CST9L) 1.68 NM_174929 hypothetical protein DKFZp761I2123 1.68 (DKFZp761I2123),transcript variant 2 NM_031952 spermatogenesis associated 9 (SPATA9),transcript variant 1.68 1 NM_012106 ADP-ribosylation factor-like 2 binding protein (ARL2BP) 1.68 NM_031281 Fc receptor-like 5 (FCRL5) 1.68
278 NM_032705 chromosome 1 open reading frame 97 (C1orf97) 1.68 NM_001010868 chromosome 6 open reading frame 163 (C6orf163) 1.68 NM_001008568 tRNA 5-methylaminomethyl-2-thiouridylate 1.68 methyltransferase (TRMU) nuclear gene encoding mitochondrial protein, transcript variant 1 NM_152589 chromosome 12 open reading frame 50 (C12orf50) 1.68 NM_014309 RNA binding motif protein 9 (RBM9),transcript variant 2 1.68 NM_006774 indolethylamine N-methyltransferase (INMT) 1.68 NM_001005200 olfactory receptor, family 8, subfamily H, member 2 1.68 (OR8H2) NM_020895 GRAM domain containing 1A (GRAMD1A) 1.68 NM_001585 metallophosphoesterase domain containing 1 (MPPED1) 1.68 NM_001001732 chromosome 10 open reading frame 130 (C10orf130) 1.68 NM_024345 WD repeat domain 32 (WDR32) 1.67 NM_152491 hypothetical protein FLJ32569 (FLJ32569) 1.67 NM_001030015 opsin 4 (melanopsin) (OPN4),transcript variant 2 1.67 NM_001106 activin A receptor, type IIB (ACVR2B) 1.67 NM_001033504 transmembrane protein 98 (TMEM98),transcript variant 2 1.67 NM_001014972 zinc finger protein 638 (ZNF638),transcript variant 2 1.67 NM_006630 zinc finger protein 234 (ZNF234) 1.67 NM_020820 phosphatidylinositol 3,4,5-trisphosphate-dependent RAC 1.67 exchanger 1 (PREX1) NM_000956 prostaglandin E receptor 2 (subtype EP2) 53kDa (PTGER2) 1.67 NM_001004714 olfactory receptor, family 4, subfamily K, member 13 1.67 (OR4K13) NM_020344 solute carrier family 24 (sodium/potassium/calcium 1.67 exchanger) member 2 (SLC24A2) NM_018028 sterile alpha motif domain containing 4B (SAMD4B) 1.67 NM_012087 general transcription factor IIIC, polypeptide 5, 63kDa 1.67 (GTF3C5) NM_178868 CKLF-like MARVEL transmembrane domain containing 8 1.67 (CMTM8) NM_152444 zinc binding alcohol dehydrogenase, domain containing 1 1.67 (ZADH1) NM_021960 myeloid cell leukemia sequence 1 (BCL2-related) 1.67 (MCL1),transcript variant 1 NM_001004744 olfactory receptor, family 5, subfamily R, member 1 1.67 (OR5R1) NM_002106 H2A histone family, member Z (H2AFZ) 1.67 NM_020952 transient receptor potential cation channel, subfamily M, 1.67 member 3 (TRPM3),transcript variant 1 NM_002900 retinol binding protein 3, interstitial (RBP3) 1.67
279 NM_017550 mesoderm induction early response 1, family member 2 1.66 (MIER2) NM_004458 acyl-CoA synthetase long-chain family member 4 1.66 (ACSL4),transcript variant 1 NM_173602 DIP2 disco-interacting protein 2 homolog B (Drosophila) 1.66 (DIP2B) NM_198479 tetra-peptide repeat homeobox 1 (TPRX1) 1.66 NM_007268 V-set and immunoglobulin domain containing 4 (VSIG4) 1.66 NM_018364 round spermatid basic protein 1 (RSBN1) 1.66 NM_001035005 putative NFkB activating protein (LOC497661) 1.66 NM_181503 exosome component 8 (EXOSC8) 1.66 NM_020944 glucosidase, beta (bile acid) 2 (GBA2) 1.66 NM_005102 fasciculation and elongation protein zeta 2 (zygin II) 1.66 (FEZ2),transcript variant 1 NM_013286 RNA binding motif protein 15B (RBM15B) 1.66 NM_017920 up-regulated gene 4 (URG4) 1.66 NM_000848 glutathione S-transferase M2 (muscle) (GSTM2) 1.66 NM_001005487 olfactory receptor, family 13, subfamily G, member 1 1.65 (OR13G1) NM_014669 nucleoporin 93kDa (NUP93) 1.65 NM_032967 protocadherin 11 X-linked (PCDH11X),transcript variant * 1.65 NM_015078 MCF.2 cell line derived transforming sequence-like 2 1.65 (MCF2L2) NM_006798 UDP glucuronosyltransferase 2 family, polypeptide A1 1.65 (UGT2A1) NM_175929 fibroblast growth factor 14 (FGF14),transcript variant 2 1.65 NM_001633 alpha-1-microglobulin/bikunin precursor (AMBP) 1.65 NM_001025 ribosomal protein S23 (RPS23) 1.65 NM_012279 zinc finger protein 346 (ZNF346) 1.65 NM_006524 zinc finger protein 138 (ZNF138) 1.65 NM_001004688 olfactory receptor, family 2, subfamily M, member 2 1.65 (OR2M2) NM_005406 Rho-associated, coiled-coil containing protein kinase 1 1.65 (ROCK1) NM_005672 prostate stem cell antigen (PSCA) 1.65 NM_001004474 olfactory receptor, family 10, subfamily S, member 1 1.65 (OR10S1) NM_001530 hypoxia-inducible factor 1, alpha subunit (basic helix-loop- 1.65 helix transcription factor) (HIF1A),transcript variant 1 NM_001881 cAMP responsive element modulator (CREM),transcript 1.65 variant 22 NM_005897 intracisternal A particle-promoted polypeptide (IPP) 1.65 NM_004667 hect domain and RLD 2 (HERC2) 1.64
280 NM_178520 transmembrane protein 105 (TMEM105) 1.64 NM_016060 mediator of RNA polymerase II transcription, subunit 31 1.64 homolog (S. cerevisiae) (MED31) NM_175886 phosphoribosyl pyrophosphate synthetase 1-like 1 1.64 (PRPS1L1) NM_201574 solute carrier family 4, anion exchanger, member 3 1.64 (SLC4A3),transcript variant 2 NM_020662 MRS2-like, magnesium homeostasis factor (S. cerevisiae) 1.64 (MRS2L) NM_016196 RNA binding motif protein 19 (RBM19) 1.64 NM_001030059 phosphatidic acid phosphatase type 2 domain containing 1.64 1A (PPAPDC1A) NM_177996 erythrocyte membrane protein band 4.1-like 1 1.64 (EPB41L1),transcript variant 2 NM_015869 peroxisome proliferative activated receptor, gamma 1.64 (PPARG),transcript variant 2 NM_207337 hypothetical protein LOC196394 (LOC196394) 1.64 NM_000601 hepatocyte growth factor (hepapoietin A; scatter factor) 1.64 (HGF),transcript variant 5 NM_016188 actin-like 6B (ACTL6B) 1.63 NM_032175 UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. 1.63 cerevisiae) (UTP15) NM_002463 myxovirus (influenza virus) resistance 2 (mouse) (MX2) 1.63 NM_145308 chromosome 11 open reading frame 76 (C11orf76) 1.63 NM_005541 inositol polyphosphate-5-phosphatase, 145kDa 1.63 (INPP5D),transcript variant 2 NM_198835 acetyl-Coenzyme A carboxylase alpha (ACACA) 1.63 NM_003177 spleen tyrosine kinase (SYK) 1.63 NM_016621 PHD finger protein 21A (PHF21A) 1.63 NM_001024372 brain and acute leukemia, cytoplasmic (BAALC),transcript 1.63 variant NM_004267 carbohydrate (N-acetylglucosamine-6-O) sulfotransferase 2 1.63 (CHST2) NM_003632 contactin associated protein 1 (CNTNAP1) 1.63 NM_080658 aspartoacylase (aminocyclase) 3 (ACY3) 1.63 NM_016449 hypothetical protein LOC51233 (LOC51233) 1.63 NM_174931 coiled-coil domain containing 75 (CCDC75) 1.63 NM_032575 GLIS family zinc finger 2 (GLIS2) 1.63 NM_175054 histone 4, H4 (HIST4H4) 1.63 NM_144695 chromosome 1 open reading frame 58 (C1orf58) 1.63 NM_005127 C-type lectin domain family 2, member B (CLEC2B) 1.63 NM_199345 similar to phosphatidylinositol 4-kinase alpha 1.63 (LOC375133) NM_207478 FLJ44385 protein (FLJ44385) 1.63
281 NM_003566 early endosome antigen 1, 162kD (EEA1) 1.63 NM_012478 WW domain binding protein 2 (WBP2) 1.63 NM_001004355 FLJ31132 protein (RP11-308D16.4) 1.63 NM_002170 interferon, alpha 8 (IFNA8) 1.63 NM_001005207 tripartite motif-containing 37 (TRIM37),transcript variant 1.62 NM_006704 SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae) 1.62 (SUGT1) NM_178471 G protein-coupled receptor 119 (GPR119) 1.62 NM_020449 THO complex 2 (THOC2) 1.62 NM_001025194 carboxylesterase 1 (monocyte/macrophage serine esterase 1.62 1) (CES1),transcript variant NM_001002799 structural maintenance of chromosomes 4 1.62 (SMC4),transcript variant NM_004367 chemokine (C-C motif) receptor 6 (CCR6),transcript 1.62 variant 1 NM_000522 homeobox A13 (HOXA13) 1.62 NM_152403 EGF-like, fibronectin type III and laminin G domains 1.62 (EGFLAM),transcript variant 1 NM_017763 ring finger protein 43 (RNF43) 1.62 NM_032782 hepatitis A virus cellular receptor 2 (HAVCR2) 1.62 NM_031948 protease, serine 27 (PRSS27) 1.62 NM_174886 TGFB-induced factor (TALE family homeobox) 1.62 (TGIF),transcript variant NM_001007537 similar to hypothetical protein MGC48915 (LOC387911) 1.61 NM_003521 histone 1, H2bm (HIST1H2BM) 1.61 NM_018086 fidgetin (FIGN) 1.61 NM_207317 zinc finger protein 474 (ZNF474) 1.61 NM_004190 lipase, gastric (LIPF) 1.61 NM_001030003 hepatocyte nuclear factor 4, alpha (HNF4A),transcript 1.61 variant NM_030568 chromosome 6 open reading frame 148 (C6orf148) 1.61 NM_014306 chromosome 22 open reading frame 28 (C22orf28) 1.61 NM_017980 LIM and senescent cell antigen-like domains 2 (LIMS2) 1.61 NM_005857 zinc metallopeptidase (STE24 homolog, yeast) 1.61 (ZMPSTE24) NM_003805 CASP2 and RIPK1 domain containing adaptor with death 1.61 domain (CRADD) NM_032217 ankyrin repeat domain 17 (ANKRD17),transcript variant 1 1.61 NM_002735 protein kinase, cAMP-dependent, regulatory, type I, beta 1.61 (PRKAR1B) NM_001018009 SH3-domain binding protein 5 (BTK-associated) 1.61 (SH3BP5),transcript variant
282 NM_173728 Rho guanine nucleotide exchange factor (GEF) 15 1.61 (ARHGEF15) NM_020349 ankyrin repeat domain 2 (stretch responsive muscle) 1.61 (ANKRD2) NM_080831 defensin, beta 129 (DEFB129) 1.6 NM_173538 cyclic nucleotide binding domain containing 1 (CNBD1) 1.6 NM_001459 fms-related tyrosine kinase 3 ligand (FLT3LG) 1.6 NM_001017987 hypothetical LOC51149 (LOC51149),transcript variant 1 1.6 NM_001002916 H2B histone family, member W, testis-specific (H2BFWT) 1.6 NM_173616 hypothetical protein FLJ35894 (FLJ35894) 1.6 NM_001001555 growth factor receptor-bound protein 10 1.6 (GRB10),transcript variant NM_147191 matrix metallopeptidase 21 (MMP21) 1.6 NM_015353 potassium channel tetramerisation domain containing 2 1.6 (KCTD2) NM_032881 LSM10, U7 small nuclear RNA associated (LSM10) 1.6 NM_001722 polymerase (RNA) III (DNA directed) polypeptide D, 1.6 44kDa (POLR3D) NM_012456 translocase of inner mitochondrial membrane 10 homolog 1.6 (yeast) (TIMM10) NM_024557 resistance to inhibitors of cholinesterase 3 homolog (C. 1.6 elegans) (RIC3) NM_031905 Homo sapiens armadillo repeat containing 10 (ARMC10) 1.6 NM_145032 Homo sapiens F-box and leucine-rich repeat protein 13 1.6 (FBXL13), transcript variant 1 NM_005894 Homo sapiens CD5 molecule-like (CD5L) 1.6 NM_001008211 optineurin (OPTN),transcript variant * 1.59 NM_001647 apolipoprotein D (APOD) 1.59 NM_001007090 chromosome 1 open reading frame 26 (C1orf26) 1.59 NM_017673 chromosome 1 open reading frame 25 (C1orf25) 1.59 NM_002552 origin recognition complex, subunit 4-like (yeast) 1.59 (ORC4L),transcript variant * NM_024011 cell division cycle 2-like 1 (PITSLRE proteins) 1.59 (CDC2L1),transcript variant * NM_001005175 olfactory receptor, family 52, subfamily N, member 4 1.59 (OR52N4) NM_145251 serine/threonine/tyrosine interacting protein (STYX) 1.59 NM_153215 chromosome 3 open reading frame 45 (C3orf45) 1.59 NM_178127 angiopoietin-like 5 (ANGPTL5) 1.59 NM_001025604 arrestin domain containing 2 (ARRDC2),transcript variant 1.59 * NM_031427 dynein, axonemal, light chain 1 (DNAL1) 1.59 NM_022142 epididymal sperm binding protein 1 (ELSPBP1) 1.59
283 NM_003754 eukaryotic translation initiation factor 3, subunit 5 epsilon, 1.59 47kDa (EIF3S5) NM_001701 bile acid Coenzyme A: amino acid N-acyltransferase 1.59 (glycine N-choloyltransferase) (BAAT) NM_052933 testis specific, 13 (TSGA13) 1.59 NM_001024610 hypothetical protein LOC286076 (LOC286076) 1.59 NM_006847 leukocyte immunoglobulin-like receptor, subfamily B (with 1.59 TM and ITIM domains) member 4 (LILRB4) NM_181334 PRR5-ARHGAP8 fusion (LOC553158) 1.59 NM_032383 Hermansky-Pudlak syndrome 3 (HPS3) 1.59 NM_031433 membrane frizzled-related protein (MFRP) 1.59 NM_000259 myosin VA (heavy polypeptide 12, myoxin) (MYO5A) 1.59 NM_001005468 olfactory receptor, family 8, subfamily B, member 2 1.59 (OR8B2) NM_000927 ATP-binding cassette, sub-family B (MDR/TAP) member 1 1.58 (ABCB1) NM_182798 EGF-like, fibronectin type III and laminin G domains 1.58 (EGFLAM),transcript variant NM_033401 contactin associated protein-like 4 (CNTNAP4),transcript 1.58 variant 1 NM_002194 inositol polyphosphate-1-phosphatase (INPP1) 1.58 NM_173524 WDFY family member 4 (WDFY4) 1.58 NM_002171 interferon, alpha 10 (IFNA10) 1.58 NM_000481 aminomethyltransferase (AMT) 1.58 NM_004280 eukaryotic translation elongation factor 1 epsilon 1 1.58 (EEF1E1) NM_003717 neuropeptide FF-amide peptide precursor (NPFF) 1.58 NM_198578 leucine-rich repeat kinase 2 (LRRK2) 1.58 NM_033507 glucokinase (hexokinase 4, maturity onset diabetes of the 1.58 young 2) (GCK),transcript variant NM_013301 coiled-coil domain containing 106 (CCDC106) 1.58 NM_024780 transmembrane channel-like 5 (TMC5) 1.58 NM_002704 pro-platelet basic protein (chemokine (C-X-C motif) ligand 1.58 7) (PPBP) NM_018553 chromosome 17 open reading frame 85 (C17orf85) 1.58 NM_031911 C1q and tumor necrosis factor related protein 7 1.58 (C1QTNF7) NM_001012506 coiled-coil domain containing 66 (CCDC66) 1.58 NM_178453 hypothetical protein MGC52282 (MGC52282) 1.58 NM_152620 tripartite motif-containing 60 (TRIM60) 1.58 NM_004951 Epstein-Barr virus induced gene 2 (lymphocyte-specific G 1.57 protein-coupled receptor) (EBI2) NM_016257 hippocalcin like 4 (HPCAL4) 1.57
284 NM_030916 poliovirus receptor-related 4 (PVRL4) 1.57 NM_018688 bridging integrator 3 (BIN3) 1.57 NM_138300 pygopus homolog 2 (Drosophila) (PYGO2) 1.57 NM_018430 translin-associated factor X interacting protein 1 1.57 (TSNAXIP1) NM_000589 interleukin 4 (IL4),transcript variant 1 1.57 NM_002272 keratin 4 (KRT4) 1.57 NM_001004705 olfactory receptor, family 4, subfamily D, member 10 1.57 (OR4D10) NM_181536 polycystic kidney disease 1-like 3 (PKD1L3) 1.57 NM_015873 villin-like (VILL) 1.57 NM_001109 ADAM metallopeptidase domain 8 (ADAM8) 1.57 NM_024804 zinc finger protein 669 (ZNF669) 1.57 NM_001402 eukaryotic translation elongation factor 1 alpha 1 1.57 (EEF1A1) NM_138357 coiled-coil domain containing 109A (CCDC109A) 1.57 NM_003553 olfactory receptor, family 1, subfamily E, member 1 1.57 (OR1E1) NM_178422 progestin and adipoQ receptor family member VII 1.57 (PAQR7) NM_020061 opsin 1 (cone pigments) long-wave-sensitive (color 1.57 blindness, protan) (OPN1LW) NM_001725 bactericidal/permeability-increasing protein (BPI) 1.57 NM_152603 zinc finger protein 567 (ZNF567) 1.57 NM_004998 myosin IE (MYO1E) 1.57 NM_030793 F-box protein 38 (FBXO38),transcript variant 1 1.57 NM_032557 ubiquitin specific peptidase 38 (USP38) 1.56 NM_004736 xenotropic and polytropic retrovirus receptor (XPR1) 1.56 NM_207420 solute carrier family 2 (facilitated glucose transporter) 1.56 member 7 (SLC2A7) NM_003801 glycosylphosphatidylinositol anchor attachment protein 1 1.56 homolog (yeast) (GPAA1) NM_007171 protein-O-mannosyltransferase 1 (POMT1) 1.56 NM_001013251 solute carrier family 3 (activators of dibasic and neutral 1.56 amino acid transport) member 2 (SLC3A2),transcript variant NM_001008703 chromosome 6 open reading frame 1 (C6orf1),transcript 1.56 variant NM_016573 GEM interacting protein (GMIP) 1.56 NM_004921 chloride channel, calcium activated, family member 3 1.56 (CLCA3) NM_000833 glutamate receptor, ionotropic, N-methyl D-aspartate 2A 1.56 (GRIN2A) NM_005570 lectin, mannose-binding, 1 (LMAN1) 1.56
285 NM_021073 bone morphogenetic protein 5 (BMP5) 1.56 NM_022152 transmembrane BAX inhibitor motif containing 1 1.56 (TMBIM1) NM_014349 Homo sapiens apolipoprotein L, 3 (APOL3), transcript 1.56 variant alpha/a NM_001039763 hypothetical protein LOC642986 (FLJ43080) 1.56 NM_175769 transcription factor 23 (TCF23) 1.56 NM_002790 proteasome (prosome, macropain) subunit, alpha type, 5 1.56 (PSMA5) NM_003954 mitogen-activated protein kinase kinase kinase 14 1.55 (MAP3K14) NM_032579 resistin like beta (RETNLB) 1.55 NM_002094 G1 to S phase transition 1 (GSPT1) 1.55 NM_000670 alcohol dehydrogenase 4 (class II) pi polypeptide (ADH4) 1.55 NM_015163 tripartite motif-containing 9 (TRIM9),transcript variant 1 1.55 NM_014594 zinc finger protein 354C (ZNF354C) 1.55 NM_002778 prosaposin (variant *transcript variant 1 1.55 NM_001001676 lipocalin 9 (LCN9) 1.55 NM_173813 chromosome 12 open reading frame 51 (C12orf51) 1.55 NM_006174 neuropeptide Y receptor Y5 (NPY5R) 1.55 NM_005029 paired-like homeodomain transcription factor 3 (PITX3) 1.55 NM_000165 gap junction protein, alpha 1, 43kDa (connexin 43) (GJA1) 1.55 NM_178566 zinc finger, DHHC-type containing 21 (ZDHHC21) 1.54 NM_001005471 olfactory receptor, family 2, subfamily T, member 6 1.54 (OR2T6) NM_015180 spectrin repeat containing, nuclear envelope 2 1.54 (SYNE2),transcript variant 1 NM_001281 cytoskeleton associated protein 1 (CKAP1) 1.54 NM_025205 mediator of RNA polymerase II transcription, subunit 28 1.54 homolog (S. cerevisiae) (MED28) NM_032041 neurocalcin delta (NCALD),transcript variant 1.54 NM_022340 zinc finger, FYVE domain containing 20 (ZFYVE20) 1.54 NM_016246 dehydrogenase/reductase (SDR family) member 10 1.54 (DHRS10) NM_005049 PWP2 periodic tryptophan protein homolog (yeast) 1.54 (PWP2H) NM_014681 DEAH (Asp-Glu-Ala-His) box polypeptide 34 1.54 (DHX34),transcript variant 1 NM_005412 serine hydroxymethyltransferase 2 (mitochondrial) 1.54 (SHMT2) NM_152996 ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)- 1.53 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 (ST6GALNAC3)
286 NM_020314 esophageal cancer associated protein (MGC16824) 1.53 NM_001805 CCAAT/enhancer binding protein (C/EBP) epsilon 1.53 (CEBPE) NM_130800 multiple endocrine neoplasia I (MEN1),transcript variant 1.53 NM_024046 CaM kinase-like vesicle-associated (CAMKV) 1.53 NM_205850 solute carrier family 24, member 5 (SLC24A5) 1.53 NM_015690 serine/threonine kinase 36 (fused homolog, Drosophila) 1.53 (STK36) NM_153214 hypothetical protein FLJ37440 (FLJ37440) 1.53 NM_012235 SREBP cleavage-activating protein (SCAP) 1.53 NM_004671 protein inhibitor of activated STAT, 2 (PIAS2),transcript 1.53 variant NM_032873 Cbl-interacting protein Sts-1 (STS-1) 1.53 NM_001007245 interferon-related developmental regulator 1 1.52 (IFRD1),transcript variant NM_080869 WAP four-disulfide core domain 12 (WFDC12) 1.52 NM_017545 hydroxyacid oxidase (glycolate oxidase) 1 (HAO1) 1.52 NM_020202 nitrilase family, member 2 (NIT2) 1.52 NM_020123 transmembrane 9 superfamily member 3 (TM9SF3) 1.52 NM_178134 cytochrome P450, family 4, subfamily Z, polypeptide 1 1.52 (CYP4Z1) NM_001008708 ChaC, cation transport regulator homolog 2 (E. coli) 1.52 (CHAC2) NM_003469 secretogranin II (chromogranin C) (SCG2) 1.52 NM_006175 nebulin-related anchoring protein (NRAP),transcript variant 1.51 1 NM_004120 guanylate binding protein 2, interferon-inducible (GBP2) 1.51 NM_006685 submaxillary gland androgen regulated protein 3 homolog 1.5 B (mouse) (SMR3B) NM_004369 collagen, type VI, alpha 3 (COL6A3),transcript variant 1.5 NM_004849 ATG5 autophagy related 5 homolog (S. cerevisiae) (ATG5) 1.5 NM_004382 corticotropin releasing hormone receptor 1 (CRHR1) 1.5 NM_000296 polycystic kidney disease 1 (autosomal dominant) 1.5 (PKD1),transcript variant NM_001008784 CD200 cell surface glycoprotein receptor isoform 2 1.5 (CD200R2) NM_001008226 hypothetical protein DKFZp666G057 (DKFZp666G057) 1.5 NM_005533 interferon-induced protein 35 (IFI35) 1.49 NM_033450 ATP-binding cassette, sub-family C (CFTR/MRP) member 1.49 10 (ABCC10) NM_005156 ROD1 regulator of differentiation 1 (S. pombe) (ROD1) 1.49 NM_013939 olfactory receptor, family 10, subfamily H, member 2 1.49 (OR10H2)
287 NM_001004346 methylenetetrahydrofolate dehydrogenase (NADP+ 1.49 dependent) 2-like (MTHFD2L) NM_015272 KIAA1005 protein (KIAA1005) 1.49 NM_133374 zinc finger protein 618 (ZNF618) 1.48 NM_019011 TRIAD3 protein 1.48 NM_016025 methyltransferase like 9 (METTL9) 1.48 NM_032623 ovary-specific acidic protein (OSAP) 1.48 NM_024056 transmembrane protein 106C (TMEM106C) 1.48 NM_001005366 F-box and leucine-rich repeat protein 10 1.45 (FBXL10),transcript variant NM_001001789 chromosome 21 open reading frame 24 (C21orf24) 1.45 NM_001449 four and a half LIM domains 1 (FHL1) 1.45 NM_031424 chromosome 20 open reading frame 55 1.44 (C20orf55),transcript variant 1 NM_002538 occludin (OCLN) 1.44 NM_003739 aldo-keto reductase family 1, member C3 (3-alpha 1.44 hydroxysteroid dehydrogenase, type II) (AKR1C3) NM_018222 parvin, alpha (PARVA) 1.44 NM_004488 glycoprotein V (platelet) (GP5) 1.44 NM_177924 N-acylsphingosine amidohydrolase (acid ceramidase) 1 1.43 (ASAH1),transcript variant 1 NM_017825 ADP-ribosylhydrolase like 2 (ADPRHL2) 1.41 NM_002955 ras responsive element binding protein 1 1.41 (RREB1),transcript variant NM_001566 inositol polyphosphate-4-phosphatase, type I, 107kDa 1.4 (INPP4A),transcript variant NM_002420 transient receptor potential cation channel, subfamily M, 1.4 member 1 (TRPM1) NM_025134 chromodomain helicase DNA binding protein 9 (CHD9) 1.38 NM_004599 sterol regulatory element binding transcription factor 2 1.38 (SREBF2) NM_001032998 kynureninase (L-kynurenine hydrolase) (KYNU),transcript 1.38 variant NM_012236 sex comb on midleg homolog 1 (Drosophila) 1.37 (SCMH1),transcript variant NM_080631 vacuolar protein sorting 41 (yeast) (VPS41),transcript 1.37 variant NM_000624 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, 1.37 antitrypsin) member 5 (SERPINA5) NM_004226 serine/threonine kinase 17b (apoptosis-inducing) (STK17B) 1.37 NM_013271 proprotein convertase subtilisin/kexin type 1 inhibitor 1.37 (PCSK1N) NM_018490 leucine-rich repeat-containing G protein-coupled receptor 4 1.37 (LGR4)
288 NM_144621 Zinc finger and BTB domain containing 8 (ZBTB8) 1.37 NM_005189 chromobox homolog 2 (Pc class homolog, Drosophila) 1.37 (CBX2),transcript variant 1 NM_004223 ubiquitin-conjugating enzyme E2L 6 (UBE2L6),transcript 1.37 variant 1 NM_005007 nuclear factor of kappa light polypeptide gene enhancer in 1.37 B-cells inhibitor-like 1 (NFKBIL1) NM_006293 TYRO3 protein tyrosine kinase (TYRO3) 1.37 NM_031308 epiplakin 1 (EPPK1) 1.37 NM_018297 N-glycanase 1 (NGLY1) 1.37 NM_014744 TBC1 domain family, member 5 (TBC1D5) 1.36 NM_080655 chromosome 9 open reading frame 30 (C9orf30) 1.36 NM_130775 X antigen family, member 5 (XAGE5) 1.36 NM_000315 parathyroid hormone (PTH) 1.36 NM_033066 membrane protein, palmitoylated 4 (MAGUK p55 1.36 subfamily member 4) (MPP4) NM_003793 cathepsin F (CTSF) 1.34 NM_012253 transketolase-like 1 (TKTL1) 1.34 NM_001006627 cholinergic receptor, muscarinic 2 (CHRM2),transcript 1.33 variant NM_001008749 GTP-binding protein RAB19B (RAB19B) 1.33 NM_003636 potassium voltage-gated channel, shaker-related subfamily, 1.33 beta member 2 (KCNAB2),transcript variant 1 NM_001711 biglycan (BGN) 1.33 NM_182607 V-set and immunoglobulin domain containing 1 (VSIG1) 1.33 NM_023915 G protein-coupled receptor 87 (GPR87) 1.33 NM_019886 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 7 1.33 (CHST7) NM_016144 COMM domain containing 10 (COMMD10) 1.33 NM_203402 similar to CG10671-like (LOC161247) 1.33 NM_006401 acidic (leucine-rich) nuclear phosphoprotein 32 family, 1.33 member B (ANP32B) NM_033542 chromosome 20 open reading frame 169 (C20orf169) 1.33 NM_032526 5'-nucleotidase, cytosolic IA (NT5C1A) 1.33 NM_018214 leucine rich repeat containing 1 (LRRC1) 1.33 NM_002572 platelet-activating factor acetylhydrolase, isoform Ib, beta 1.32 subunit 30kDa (PAFAH1B2) NM_000936 pancreatic lipase (PNLIP) 1.32 NM_001005183 olfactory receptor, family 6, subfamily C, member 76 1.32 (OR6C76) NM_005230 ELK3, ETS-domain protein (SRF accessory protein 2) 1.32 (ELK3) NM_006143 G protein-coupled receptor 19 (GPR19) 1.32
289 NM_032307 chromosome 9 open reading frame 64 (C9orf64) 1.32 NM_002801 proteasome (prosome, macropain) subunit, beta type, 10 1.32 (PSMB10) NM_016378 variable charge, X-linked 2 (VCX2) 1.31 NM_001004481 olfactory receptor, family 13, subfamily C, member 2 1.31 (OR13C2) NM_006996 solute carrier family 19 (thiamine transporter) member 2 1.31 (SLC19A2) NM_012161 F-box and leucine-rich repeat protein 5 (FBXL5),transcript 1.25 variant 1 NM_181646 hypothetical protein FLJ32110 (FLJ32110) 1.25 NM_002415 macrophage migration inhibitory factor (glycosylation- 1.25 inhibiting factor) (MIF) NM_152495 cornichon homolog 3 (Drosophila) (CNIH3) 1.25 NM_001014439 chromosome 8 open reading frame 16 (C8orf16) 1.25 NM_005735 ARP1 actin-related protein 1 homolog B, centractin beta 1.24 (yeast) (ACTR1B) NM_147184 tumor protein p53 inducible protein 3 (TP53I3),transcript 1.24 variant NM_004604 syntaxin 4 (STX4) 1.24 NM_173571 hypothetical protein LOC255313 (LOC255313) 1.24 NM_032483 phosphatidic acid phosphatase type 2 domain containing 1B 1.24 (PPAPDC1B) NM_032029 Fc receptor, IgA, IgM, high affinity (FCAMR) 1.24 NM_031938 beta-carotene dioxygenase 2 (BCDO2),transcript variant 1 1.24 NM_001013693 low density lipoprotein receptor class A domain containing 1.24 2 (LDLRAD2) NM_001033523 glucuronidase, beta-like 1 (GUSBL1) 1.24 NM_153003 orofacial cleft 1 candidate 1 (OFCC1) 1.24 NM_021268 interferon, alpha 17 (IFNA17) 1.24 NM_000198 hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid 1.23 delta-isomerase 2 (HSD3B2) NM_001004335 FLJ42842 protein (FLJ42842) 1.23 NM_016061 yippee-like 5 (Drosophila) (YPEL5) 1.23 NM_001183 ATPase, H+ transporting, lysosomal accessory protein 1 1.23 (ATP6AP1) NM_198230 regulator of G-protein signalling 12 (RGS12) 1.23 NM_014495 angiopoietin-like 3 (ANGPTL3) 1.22 NM_016243 cytochrome b5 reductase 1 (CYB5R1) 1.22 NM_001943 desmoglein 2 (DSG2) 1.22 NM_000495 collagen, type IV, alpha 6 (COL4A6),transcript variant 1.22 NM_000815 gamma-aminobutyric acid (GABA) A receptor, delta 1.22 (GABRD)
290 NM_173523 melanoma antigen family B, 6 (MAGEB6) 1.22 NM_025212 Homo sapiens CXXC finger 4 (CXXC4) 1.21 NM_016075 vacuolar protein sorting 36 (yeast) (VPS36) 1.21 NM_199327 sprouty homolog 1, antagonist of FGF signaling 1.21 (Drosophila) (SPRY1),transcript variant NM_001005217 FSHD region gene 2 protein (FRG2) 1.21 NM_018116 misato homolog 1 (Drosophila) (MSTO1) 1.21 NM_001891 casein beta (CSN2) 1.21 NM_001025489 hypothetical LOC441178 (LOC441178) 1.21 NM_007369 G protein-coupled receptor 161 (GPR161),transcript variant 1.12 1 NM_002494 NADH dehydrogenase (ubiquinone) 1, subcomplex 1.12 unknown, 1, 6kDa (NDUFC1) NM_001001394 HCG3 gene (HCG3) 1.11 NM_032505 kelch repeat and BTB (POZ) domain containing 8 1.11 (KBTBD8) NM_022101 chromosome X open reading frame 56 (CXorf56) 1.11 NM_173848 hypothetical protein LOC138046 (LOC138046) 1.11 NM_004431 EPH receptor A2 (EPHA2) 1.11 NM_152477 zinc finger protein 565 (ZNF565),transcript variant 1.11 NM_004792 peptidylprolyl isomerase G (cyclophilin G) (PPIG) 1.1 NM_144701 interleukin 23 receptor (IL23R) 1.1 NM_138705 calmodulin-like 6 (CALML6) 1.1 NM_024623 2-oxoglutarate and iron-dependent oxygenase domain 1.09 containing 2 (OGFOD2) NM_001036645 ankyrin repeat domain 13C (ANKRD13C) 1.09 NM_004087 discs, large homolog 1 (Drosophila) (DLG1) 1.09 NM_177452 trafficking protein particle complex 6B (TRAPPC6B) 1.09 NM_004576 protein phosphatase 2 (formerly 2A) regulatory subunit B 1.08 (PR 52) beta isoform (PPP2R2B),transcript variant 1 NM_001004475 olfactory receptor, family 10, subfamily T, member 2 1.08 (OR10T2) NM_025222 transmembrane protein 113 (TMEM113) 1.07 NM_153648 solute carrier family 24 (sodium/potassium/calcium 1.07 exchanger) member 4 (SLC24A4),transcript variant NM_138569 chromosome 6 open reading frame 142 (C6orf142) 1.07 NM_198546 spermatogenesis associated 21 (SPATA21) 1.06 NM_014187 leucine rich repeat containing 29 (LRRC29),transcript 1.06 variant NM_000288 peroxisomal biogenesis factor 7 (PEX7) 1.05 NM_014573 transmembrane protein 97 (TMEM97) 1.05 NM_198795 tudor domain containing 1 (TDRD1) 1.05
291 NM_178523 zinc finger protein 616 (ZNF616) 1.05 NM_001013660 ferric-chelate reductase 1 (FRRS1) 1 NM_003798 catenin (cadherin-associated protein) alpha-like 1 1 (CTNNAL1) NM_181756 zinc finger protein 233 (ZNF233) 1 NM_001005522 olfactory receptor, family 2, subfamily T, member 8 1 (OR2T8) NM_173351 olfactory receptor, family 6, subfamily B, member 3 1 (OR6B3) NM_001025160 CD97 molecule (CD97),transcript variant 1
292 APPENDIX II
List of other published papers and book chapters
1. Xu,Y.Z., Kanagaratham, C., and Radzioch, D. (2013). Chromatin Remodelling During Host‐Bacterial Pathogen Interaction. In: Chromatin Remodelling, ed. D. Radzioch: InTech, 173‐198
2. Xu,Y.Z., Kanagaratham, C., Jancik, S., and Radzioch, D. (2013). Promoter deletion analysis using a dual‐luciferase reporter system. Methods Mol. Biol. 977, 79‐93.
3. Xu,Y.Z., Kanagaratham,C., and Radzioch,D. (2012). Exploring Secrets of Nuclear Actin Involvement in the Regulation of Gene Transcription and Genome Organization. In: Current Frontiers and Perspectives in Cell Biology, ed. S.NajmanRijeka: InTech, 181‐210.
4. Jancik, S., Drabek, J., Berkovcova, J., Xu, Y.Z., Stankova, M., Klein. J., Kolek. V., Skarda. J., Tichy, T., Grygarkova, I., Radzioch, D., Hajduch, M. (2012). A comparison of Direct sequencing, Pyrosequencing, High resolution melting analysis, TheraScreen DxS, and the K‐ras StripAssay for detecting KRAS mutations in non small cell lung carcinomas. J. Exp. Clin. Cancer Res. 31:79
5. Marino, R., Thuraisingam, T., Camateros, P., Kanagaratham, C., Xu, Y.Z., Henri, J., Yang, J., He, G., Ding, A., and Radzioch, D. (2011). Secretory leukocyte protease inhibitor plays an important role in the regulation of allergic asthma in mice. J. Immunol. 186, 4433‐4442
6. Xu, Y.Z., Heravi, M., Thuraisingam, T., Di Marco, S., Muanza, T., and Radzioch, D. (2010). Brg‐1 mediates the constitutive and fenretinide‐ induced expression of SPARC in mammary carcinoma cells via its interaction with transcription factor Sp1. Mol. Cancer. 9:210
293 7. Thuraisingam, T., Xu, Y.Z., Eadie, K., Heravi, M., Guiot, M.C., Greemberg, R., Gaestel, M., and Radzioch, D. (2010). MAPKAPK‐2 signaling is critical for cutaneous wound healing. J. Invest. Dermatol. 130,278‐286
8. Thuraisingam, T., Xu, Y.Z., Moisan, J., Lachance, C., Garnon, J., Di Marco, S., Gaestel, M., and Radzioch, D. (2007). Distinct role of MAPKAPK‐2 in the regulation of TNF gene expression by Toll‐like receptor 7 and 9 ligands. Mol. Immunol. 44, 3482‐3491
9. Xu, Y.Z., Di Marco, S., Gallouzi, I., Rola‐Pleszczynski, M., and Radzioch, D. (2005). RNA‐binding protein HuR is required for stabilization of SLC11A1 mRNA and SLC11A1 protein expression. Mol. Cell. Biol. 25, 8139‐8149
294