DOCSLIB.ORG

The Molecular Role of GTF2IRD1: a Protein Involved in The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Molecular Role of GTF2IRD1: a Protein Involved in The The molecular role of GTF2IRD1: a protein involved in the neurodevelopmental abnormalities of Williams-Beuren syndrome Paulina Carmona-Mora A thesis in fulfilment of the requirements for the degree of Doctor of Philosophy School of Medical Sciences, Faculty of Medicine UNSW Australia Sydney, Australia May 2015 i ii ACKNOWLEDGMENTS I would like to express my gratitude to the people that have been with me in this important stage of my life. First, infinite thanks to my supervisors, Prof. Edna Hardeman and Dr Stephen Palmer, for your continual support throughout these years and for mentoring me. My PhD has been an intense and challenging journey, both at the professional and personal level, but I am thankful I went through this road with you. Both were always there for understanding and encouraging me, but also to enjoy the rewarding results of this experience. I will definitely take with me what I learned from you, Edna; I admire you as a strong, experienced and successful woman in science. Steve, your attitude so sensible and patient has shaped the way I want to do science. The Cellular and Genetic Medicine Unit is an enriching and multicultural environment that made my time here so enjoyable. Thanks to Prof. Peter Gunning, your lively interest in science is pure inspiration. I also want to thank the CGMU supervisors Dr Galina Schevzov and Dr Annemiek Beverdam for their advice and delightful conversations. I am grateful for having great people around me in the lab, first of all Florence Tomasetig, who besides being so important in the project, helped me with the experiments and made our days in the lab so vibrant and pleasant, your friendship is a real gem. I also want to thank you April, Wei, Cecilia, Jeff and Annamaria for being so helpful and cheerful. To my fellow PhD students, Bin, Melissa, Iman, Bassem, Veronica and Nadia, we shared the bitter, the sweet and the celebrations of this experience. I was fortunate to collaborate with great scientists from whom I learned so much. Thanks to Prof. Mark Wilkins and Natalie Twine, from the NSW Systems Biology Initiative, for their help with the microarray experiments. Thanks to Iveta Slapetova and Dr Renee Whan, from the Biomedical Imaging Facility for their excellent training and assistance with the confocal microscopy. And thanks to Dr Mirella Dottori, from the University of Melbourne for sharing her expertise on embryonic stem cells and provide us with human neurospheres. I dedicate my achievements to Cesar, my husband and lab mate, indeed this PhD candidature has been a shared effort, both in the lab and at home; without your understanding and love I would not have been able to finish this work. To my family in Chile, my mom, dad and sisters Emma and Valeria, for their endless support and source iii of strength. To my son, Diego, who without knowing, is my constant motivation for organising and balancing my life and who is my inspiration to go through everything life brings. iv PUBLICATIONS ARISING FROM WORK PRESENTED IN THIS THESIS P. Carmona-Mora, J. Widagdo, F. Tomasetig, CP. Canales, Y. Cha, WS. Lee, A. Alshawaf, M. Dottori, EC. Hardeman, SJ. Palmer (2015) The nuclear localization pattern and interaction partners of GTF2IRD1 demonstrate a role in chromatin regulation. (Submitted to Human Genetics, in production of revised manuscript). In preparation: P. Carmona-Mora, F. Tomasetig, CP. Canales, A. Alshawaf, M. Dottori, JI. Young, L. Hesson, R. Barres, EC. Hardeman, SJ. Palmer (2015) The epigenetic role of GTF2IRD1 as a means to understand features of Williams-Beuren syndrome. Selected conference abstracts P. Carmona-Mora, J. Widagdo, KM. Taylor, R. Tsz-Wai Pang, PW. Gunning, EC. Hardeman, SJ. Palmer (2012) The molecular role of GTF2IRD1, a protein implicated in the neurodevelopmental features of Williams-Beuren syndrome. 62th Annual Meeting, The American Society of Human Genetics. San Francisco, CA, USA. P. Carmona-Mora, J. Widagdo, KM. Taylor, R. Tsz-Wai Pang, F. Tomasetig, NA. Twine, MR. Wilkins, PW. Gunning, EC. Hardeman, SJ. Palmer (2013) The molecular role of the transcriptional regulator GTF2IR1 in the pathogenesis of Williams-Beuren syndrome. 34th Lorne Genome Conference, Lorne, Vic, Australia. P. Carmona-Mora, J. Widagdo, F. Tomasetig, KM. Taylor, R. Tsz-Wai Pang, NA. Twine, MR. Wilkins, PW. Gunning, EC. Hardeman, SJ. Palmer (2013) A gene v implicated in the neurobehavioural abnormalities of Williams-Beuren syndrome, GTF2IRD1, is a novel epigenetic regulator. Genetics Society of Australasia, Sydney, NSW, Australia. P. Carmona-Mora, J. Widagdo, F. Tomasetig, KM. Taylor, Y. Cha, R. Tsz-Wai Pang, NA. Twine, MR. Wilkins, PW. Gunning, EC. Hardeman, SJ. Palmer. A gene implicated in the neurobehavioural abnormalities of Williams-Beuren syndrome, GTF2IRD1, encodes a novel epigenetic regulator (2013) ComBio, Perth, WA, Australia. (Oral presentation) P. Carmona-Mora, J. Widagdo, F. Tomasetig, KM. Taylor, Y. Cha, R. Tsz-Wai Pang, NA. Twine, MR. Wilkins, PW. Gunning, EC. Hardeman, SJ. Palmer (2013) A gene implicated in the neurobehavioural abnormalities of Williams-Beuren syndrome, GTF2IRD1, encodes a novel epigenetic regulator. 63th Annual Meeting The American Society of Human Genetics, Boston, MA, USA. (Oral presentation) P. Carmona-Mora, F. Tomasetig, CP. Canales, A. Alshawaf, M. Dottori, EC. Hardeman, SJ. Palmer (2014) Unravelling epigenetic complexes associated with GTF2IRD1 to understand the cognitive features of Williams-Beuren syndrome. ComBio, Canberra, ACT, Australia. (Oral presentation) P. Carmona-Mora, F. Tomasetig, CP. Canales, A. Alshawaf, M. Dottori, EC. Hardeman, SJ. Palmer (2014) Defining the presence of GTF2IRD1 in epigenetic complexes as a means to understand features of Williams-Beuren syndrome. 64th Annual Meeting The American Society of Human Genetics, San Diego, CA, USA. vi ABSTRACT Background: GTF2IRD1 is a member of the GTF2I gene family, located on chromosome 7 in a region prone to duplications and deletions in humans. Hemizygous deletions cause Williams-Beuren syndrome (WBS) and duplications cause WBS duplication syndrome. Human mapping data and analyses of mouse knockouts implicate GTF2IRD1 as the prime candidate for the craniofacial abnormalities, mental retardation, visuospatial construction deficits and hypersociability of WBS. Aims: The aim of this work was to study the cellular and molecular role of GTF2IRD1 by investigating: i) the cellular localisation of GTF2IRD1; ii) its protein interacting partners; iii) the gene dysregulation caused by GTF2IRD1 loss; and iv) the presence of GTF2IRD1 in epigenetic complexes regulating gene expression. Results: i) Immunofluorescence analyses in mammalian cell lines and in human ES cell-derived neurons showed endogenous GTF2IRD1 as a nuclear speckle protein. The comparison of this punctate pattern with markers of nuclear sub-compartments and chromatin marks supports an association with developmentally regulated silent chromatin. ii) To define functional relationships, yeast two-hybrid screenings were used to isolate novel interaction partners. Most of the nuclear-localised interactions were validated in mammalian cells, being predominantly proteins involved in chromatin modification and transcriptional regulation. The sites of interaction in GTF2IRD1 were mapped to specific domains. iii) To identify transcriptional changes arising from GTF2IRD1 loss, microarray studies were conducted in siRNA-treated HeLa cells and brain tissue from Gtf2ird1 knockout mice. In the corpus striatum, qPCR validation indicated up-regulation of genes involved in neuronal development and immediate-early response genes that may explain some of the observed neurobehavioural phenotypes. iv) vii GTF2IRD1 was found to be involved in chromatin modifying complexes by direct associations with histone deacetylases and can affect their enzymatic activity. Conclusions: The results of this thesis indicate that GTF2IRD1 forms complexes with DNA-binding and chromatin modifying proteins to regulate gene expression through epigenetic mechanisms that are controlled in a tissue specific manner. The sites of protein interactions indicate key features regarding the evolution of GTF2IRD1 and integration with tight post-translational regulation, fitting well with the concept of human disease states caused by copy number variation. viii ABBREVIATIONS Ade adenine ADHD attention deficit hyperactive disorder ASD autism spectrum disorder BCA bicinchoninic acid assay BSA bovine serum albumin ChIP chromatin immunoprecipitation Co-IP coimmunoprecipitation CNV copy number variation DDO double dropout DMEM Dulbecco’s modified Eagle’s medium DNA deoxyribonucleic acid DNAse deoxyribonuclease ECL enhanced chemiluminescence GFP green fluorescent protein GUR GTF2IRD1 upstream region HDAC histone deacetylase His Histidine IgG immunoglobulin G IP immunoprecipitation LCR low copy repeat Leu leucine Lys lysine LZ leucine zipper NAHR non-allelic homologous recombination NLS nuclear localisation signal OMIM online mendelian inheritance in man ORF open reading frame PBS phosphate-buffered saline PCR polymerase chain reaction ix PFA paraformaldehyde PLA proximity ligation assay QDO quadruple dropout qRT-PCR quantitative real time PCR RD repeat domain RNA ribonucleic acid SDS-PAGE sodium dodecyl sulphate polyacrylamide gel electrophoresis SEM standard error of the mean SUMO small ubiquitin-like modifier SVAS supravalvular aortic stenosis TAE tris-acetate-EDTA buffer Trp tryptophan UV ultra violet WBS Williams-Beuren syndrome WSCP Williams syndrome cognitive profile WBSCR
Load more

Recommended publications
  • Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in A
    Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in a novel member of the chromodomain gene family cause CHARGE syndrome. L.E.L.M. Vissers1, C.M.A. van Ravenswaaij1, R. Admiraal2, J.A. Hurst3, B.B.A. de Vries1, I.M. Janssen1, W.A. van der Vliet1, E.H.L.P.G. Huys1, P.J. de Jong4, B.C.J. Hamel1, E.F.P.M. Schoenmakers1, H.G. Brunner1, A. Geurts van Kessel1, J.A. Veltman1. 1) Dept Human Genetics, UMC Nijmegen, Nijmegen, Netherlands; 2) Dept Otorhinolaryngology, UMC Nijmegen, Nijmegen, Netherlands; 3) Dept Clinical Genetics, The Churchill Hospital, Oxford, United Kingdom; 4) Children's Hospital Oakland Research Institute, BACPAC Resources, Oakland, CA. CHARGE association denotes the non-random occurrence of ocular coloboma, heart defects, choanal atresia, retarded growth and development, genital hypoplasia, ear anomalies and deafness (OMIM #214800). Almost all patients with CHARGE association are sporadic and its cause was unknown. We and others hypothesized that CHARGE association is due to a genomic microdeletion or to a mutation in a gene affecting early embryonic development. In this study array- based comparative genomic hybridization (array CGH) was used to screen patients with CHARGE association for submicroscopic DNA copy number alterations. De novo overlapping microdeletions in 8q12 were identified in two patients on a genome-wide 1 Mb resolution BAC array. A 2.3 Mb region of deletion overlap was defined using a tiling resolution chromosome 8 microarray. Sequence analysis of genes residing within this critical region revealed mutations in the CHD7 gene in 10 of the 17 CHARGE patients without microdeletions, including 7 heterozygous stop-codon mutations.
    [Show full text]
  • Gene Expression Is Related to Parental Origin and Regional Coordinate Control
    Journal of Human Genetics (2009) 54, 193–198 & 2009 The Japan Society of Human Genetics All rights reserved 1434-5161/09 $32.00 www.nature.com/jhg ORIGINAL ARTICLE William’s syndrome: gene expression is related to parental origin and regional coordinate control Jeremy C Collette1, Xiao-Ning Chen1, Debra L Mills2, Albert M Galaburda3, Allan L Reiss4, Ursula Bellugi5 and Julie R Korenberg1,6 William’s syndrome (WS) features a spectrum of neurocognitive and behavioral abnormalities due to a rare 1.5 MB deletion that includes about 24–28 genes on chromosome band 7q11.23. Study of the expression of these genes from the single normal copy provides an opportunity to elucidate the genetic and epigenetic controls on these genes as well as their roles in both WS and normal brain development and function. We used quantitative RT-PCR to determine the transcriptional level of 14 WS gene markers in a cohort of 77 persons with WS and 48 normal controls. Results reported here: (1) show that the expression of the genes deleted in WS is decreased in some but not all cases, (2) demonstrate that the parental origin of the deletion contributes to the level of expression of GTF2I independently of age and gender and (3) indicate that the correlation of expression between GTF2I and some other genes in the WS region differs in WS subjects and normal controls, which in turn points toward a regulatory role for this gene. Interspecies comparisons suggest GTF2I may play a key role in normal brain development. Journal of Human Genetics (2009) 54, 193–198; doi:10.1038/jhg.2009.5; published online 13 March 2009 Keywords: William’s syndrome; gene expression; RT-PCR; parental origin; GTF2I INTRODUCTION As an approach toward understanding the role of the deleted genes William’s syndrome (WS) is a neurogenetic disorder affecting human in WS, we have characterized WS subjects according to genetic, social/ development and adult cognition.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • The Nuclear Localization Pattern and Interaction Partners of GTF2IRD1 Demonstrate a Role in Chromatin Regulation
    Hum Genet DOI 10.1007/s00439-015-1591-0 ORIGINAL INVESTIGATION The nuclear localization pattern and interaction partners of GTF2IRD1 demonstrate a role in chromatin regulation Paulina Carmona‑Mora1 · Jocelyn Widagdo2 · Florence Tomasetig1 · Cesar P. Canales1 · Yeojoon Cha1 · Wei Lee1 · Abdullah Alshawaf3 · Mirella Dottori3 · Renee M. Whan4 · Edna C. Hardeman1 · Stephen J. Palmer1 Received: 11 February 2015 / Accepted: 4 August 2015 © Springer-Verlag Berlin Heidelberg 2015 Abstract GTF2IRD1 is one of the three members of the mostly involved in chromatin modification and transcrip- GTF2I gene family, clustered on chromosome 7 within a tional regulation, whilst others indicate an unexpected role 1.8 Mb region that is prone to duplications and deletions in connection with the primary cilium. Mapping of the sites in humans. Hemizygous deletions cause Williams–Beuren of protein interaction also indicates key features regarding syndrome (WBS) and duplications cause WBS duplica- the evolution of the GTF2IRD1 protein. These data provide tion syndrome. These copy number variations disturb a a visual and molecular basis for GTF2IRD1 nuclear func- variety of developmental systems and neurological func- tion that will lead to an understanding of its role in brain, tions. Human mapping data and analyses of knockout mice behaviour and human disease. show that GTF2IRD1 and GTF2I underpin the craniofacial abnormalities, mental retardation, visuospatial deficits and Abbreviations hypersociability of WBS. However, the cellular role of the hESC Human embryonic stem cells GTF2IRD1 protein is poorly understood due to its very PLA Proximity ligation assay low abundance and a paucity of reagents. Here, for the first STED Stimulated emission depletion time, we show that endogenous GTF2IRD1 has a punctate WBS Williams–Beuren syndrome pattern in the nuclei of cultured human cell lines and neu- Y2H Yeast two-hybrid rons.
    [Show full text]
  • Placenta-Derived Exosomes Continuously Increase in Maternal
    Sarker et al. Journal of Translational Medicine 2014, 12:204 http://www.translational-medicine.com/content/12/1/204 RESEARCH Open Access Placenta-derived exosomes continuously increase in maternal circulation over the first trimester of pregnancy Suchismita Sarker1, Katherin Scholz-Romero1, Alejandra Perez2, Sebastian E Illanes1,2,3, Murray D Mitchell1, Gregory E Rice1,2 and Carlos Salomon1,2* Abstract Background: Human placenta releases specific nanovesicles (i.e. exosomes) into the maternal circulation during pregnancy, however, the presence of placenta-derived exosomes in maternal blood during early pregnancy remains to be established. The aim of this study was to characterise gestational age related changes in the concentration of placenta-derived exosomes during the first trimester of pregnancy (i.e. from 6 to 12 weeks) in plasma from women with normal pregnancies. Methods: A time-series experimental design was used to establish pregnancy-associated changes in maternal plasma exosome concentrations during the first trimester. A series of plasma were collected from normal healthy women (10 patients) at 6, 7, 8, 9, 10, 11 and 12 weeks of gestation (n = 70). We measured the stability of these vesicles by quantifying and observing their protein and miRNA contents after the freeze/thawing processes. Exosomes were isolated by differential and buoyant density centrifugation using a sucrose continuous gradient and characterised by their size distribution and morphology using the nanoparticles tracking analysis (NTA; Nanosight™) and electron microscopy (EM), respectively. The total number of exosomes and placenta-derived exosomes were determined by quantifying the immunoreactive exosomal marker, CD63 and a placenta-specific marker (Placental Alkaline Phosphatase PLAP).
    [Show full text]
  • GTF2IRD1 Rabbit Polyclonal Antibody – AP06760PU-N | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for AP06760PU-N GTF2IRD1 Rabbit Polyclonal Antibody Product data: Product Type: Primary Antibodies Applications: WB Recommended Dilution: Western blot: 1/500-1/1000. Reactivity: Human, Mouse, Rat Host: Rabbit Clonality: Polyclonal Immunogen: Synthetic peptide, corresponding to amino acids 63-112 of Human WBSCR11. Specificity: This antibody detects endogenous levels of WBSCR11 protein. (region surrounding Lys94) Formulation: Phosphate buffered saline (PBS), pH~7.2 State: Aff - Purified State: Liquid purified Ig fraction (> 95% pure by SDS-PAGE) Preservative: 0.05% Sodium Azide Concentration: 1.0 mg/ml Purification: Affinity Chromatography using epitope-specific immunogen Conjugation: Unconjugated Storage: Store undiluted at 2-8°C for one month or (in aliquots) at -20°C for longer. Avoid repeated freezing and thawing. Stability: Shelf life: one year from despatch. Predicted Protein Size: ~106 kDa Database Link: Entrez Gene 9569 Human Q9UHL9 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 GTF2IRD1 Rabbit Polyclonal Antibody – AP06760PU-N Background: Williams-Beuren syndrome (WBS) is a developmental disorder caused by the hemizygous microdeletion on chromosome 7q11.23. WBS is an autosomal dominant genetic condition that is characterized by physical, cognitive and behavioral traits. The physical traits associated with WBS include facial dysmorphology, vascular stenoses, growth deficiencies, dental anomalies and neurologic and musculoskeletal abnormalities.
    [Show full text]
  • Curcumin Alters Gene Expression-Associated DNA Damage, Cell Cycle, Cell Survival and Cell Migration and Invasion in NCI-H460 Human Lung Cancer Cells in Vitro
    ONCOLOGY REPORTS 34: 1853-1874, 2015 Curcumin alters gene expression-associated DNA damage, cell cycle, cell survival and cell migration and invasion in NCI-H460 human lung cancer cells in vitro I-TSANG CHIANG1,2, WEI-SHU WANG3, HSIN-CHUNG LIU4, SU-TSO YANG5, NOU-YING TANG6 and JING-GUNG CHUNG4,7 1Department of Radiation Oncology, National Yang‑Ming University Hospital, Yilan 260; 2Department of Radiological Technology, Central Taiwan University of Science and Technology, Taichung 40601; 3Department of Internal Medicine, National Yang‑Ming University Hospital, Yilan 260; 4Department of Biological Science and Technology, China Medical University, Taichung 404; 5Department of Radiology, China Medical University Hospital, Taichung 404; 6Graduate Institute of Chinese Medicine, China Medical University, Taichung 404; 7Department of Biotechnology, Asia University, Taichung 404, Taiwan, R.O.C. Received March 31, 2015; Accepted June 26, 2015 DOI: 10.3892/or.2015.4159 Abstract. Lung cancer is the most common cause of cancer CARD6, ID1 and ID2 genes, associated with cell survival and mortality and new cases are on the increase worldwide. the BRMS1L, associated with cell migration and invasion. However, the treatment of lung cancer remains unsatisfactory. Additionally, 59 downregulated genes exhibited a >4-fold Curcumin has been shown to induce cell death in many human change, including the DDIT3 gene, associated with DNA cancer cells, including human lung cancer cells. However, the damage; while 97 genes had a >3- to 4-fold change including the effects of curcumin on genetic mechanisms associated with DDIT4 gene, associated with DNA damage; the CCPG1 gene, these actions remain unclear. Curcumin (2 µM) was added associated with cell cycle and 321 genes with a >2- to 3-fold to NCI-H460 human lung cancer cells and the cells were including the GADD45A and CGREF1 genes, associated with incubated for 24 h.
    [Show full text]
  • Looking for Missing Proteins in the Proteome Of
    Looking for Missing Proteins in the Proteome of Human Spermatozoa: An Update Yves Vandenbrouck, Lydie Lane, Christine Carapito, Paula Duek, Karine Rondel, Christophe Bruley, Charlotte Macron, Anne Gonzalez de Peredo, Yohann Coute, Karima Chaoui, et al. To cite this version: Yves Vandenbrouck, Lydie Lane, Christine Carapito, Paula Duek, Karine Rondel, et al.. Looking for Missing Proteins in the Proteome of Human Spermatozoa: An Update. Journal of Proteome Research, American Chemical Society, 2016, 15 (11), pp.3998-4019. 10.1021/acs.jproteome.6b00400. hal-02191502 HAL Id: hal-02191502 https://hal.archives-ouvertes.fr/hal-02191502 Submitted on 19 Mar 2021 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Journal of Proteome Research 1 2 3 Looking for missing proteins in the proteome of human spermatozoa: an 4 update 5 6 Yves Vandenbrouck1,2,3,#,§, Lydie Lane4,5,#, Christine Carapito6, Paula Duek5, Karine Rondel7, 7 Christophe Bruley1,2,3, Charlotte Macron6, Anne Gonzalez de Peredo8, Yohann Couté1,2,3, 8 Karima Chaoui8, Emmanuelle Com7, Alain Gateau5, AnneMarie Hesse1,2,3, Marlene 9 Marcellin8, Loren Méar7, Emmanuelle MoutonBarbosa8, Thibault Robin9, Odile Burlet- 10 Schiltz8, Sarah Cianferani6, Myriam Ferro1,2,3, Thomas Fréour10,11, Cecilia Lindskog12,Jérôme 11 1,2,3 7,§ 12 Garin , Charles Pineau .
    [Show full text]
  • LIONS: Analysis Suite for Detecting and Quantifying Transposable Element Initiated
    bioRxiv preprint doi: https://doi.org/10.1101/149864; this version posted June 14, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. LIONS: Analysis Suite for Detecting and Quantifying Transposable Element Initiated Transcription from RNA-seq Artem Babaian1,2, Jake Lever2,3, Liane Gagnier1,2, and Dixie L. Mager1,2 5 1Terry Fox Laboratory, BC Cancer Agency, Vancouver, BC, Canada. 2Dept. of Medical Genetics, University of British Columbia, Vancouver, BC, Canada. 3Canada’s Michael Smith Genome Sciences Centre, Vancouver, BC, Canada. 10 15 Dixie L. Mager Terry Fox Laboratory BC Cancer Agency 20 675 West 10th Avenue Vancouver, BC, V5Z1L3, Canada Email: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/149864; this version posted June 14, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Abstract Transposable Elements (TEs), which comprise almost half of the human genome, can contribute 25 to the evolution of novel transcriptional circuitry. Specific and biologically meaningful interpretation of TE-initiated transcripts has been marred by computational and methodological deficiencies. We developed the software suite LIONS (www.github.com/ababaian/LIONS) to analyze paired-end RNA- seq data for detecting and quantifying significant TE-contributions to a transcriptome.
    [Show full text]
  • Supplemental Table S1. Primers for Sybrgreen Quantitative RT-PCR Assays
    Supplemental Table S1. Primers for SYBRGreen quantitative RT-PCR assays. Gene Accession Primer Sequence Length Start Stop Tm GC% GAPDH NM_002046.3 GAPDH F TCCTGTTCGACAGTCAGCCGCA 22 39 60 60.43 59.09 GAPDH R GCGCCCAATACGACCAAATCCGT 23 150 128 60.12 56.52 Exon junction 131/132 (reverse primer) on template NM_002046.3 DNAH6 NM_001370.1 DNAH6 F GGGCCTGGTGCTGCTTTGATGA 22 4690 4711 59.66 59.09% DNAH6 R TAGAGAGCTTTGCCGCTTTGGCG 23 4797 4775 60.06 56.52% Exon junction 4790/4791 (reverse primer) on template NM_001370.1 DNAH7 NM_018897.2 DNAH7 F TGCTGCATGAGCGGGCGATTA 21 9973 9993 59.25 57.14% DNAH7 R AGGAAGCCATGTACAAAGGTTGGCA 25 10073 10049 58.85 48.00% Exon junction 9989/9990 (forward primer) on template NM_018897.2 DNAI1 NM_012144.2 DNAI1 F AACAGATGTGCCTGCAGCTGGG 22 673 694 59.67 59.09 DNAI1 R TCTCGATCCCGGACAGGGTTGT 22 822 801 59.07 59.09 Exon junction 814/815 (reverse primer) on template NM_012144.2 RPGRIP1L NM_015272.2 RPGRIP1L F TCCCAAGGTTTCACAAGAAGGCAGT 25 3118 3142 58.5 48.00% RPGRIP1L R TGCCAAGCTTTGTTCTGCAAGCTGA 25 3238 3214 60.06 48.00% Exon junction 3124/3125 (forward primer) on template NM_015272.2 Supplemental Table S2. Transcripts that differentiate IPF/UIP from controls at 5%FDR Fold- p-value Change Transcript Gene p-value p-value p-value (IPF/UIP (IPF/UIP Cluster ID RefSeq Symbol gene_assignment (Age) (Gender) (Smoking) vs. C) vs. C) NM_001178008 // CBS // cystathionine-beta- 8070632 NM_001178008 CBS synthase // 21q22.3 // 875 /// NM_0000 0.456642 0.314761 0.418564 4.83E-36 -2.23 NM_003013 // SFRP2 // secreted frizzled- 8103254 NM_003013
    [Show full text]
  • Serum APOA4 Pharmacodynamically Represents Administered Recombinant Human Hepatocyte Growth Factor (E3112)
    International Journal of Molecular Sciences Article Serum APOA4 Pharmacodynamically Represents Administered Recombinant Human Hepatocyte Growth Factor (E3112) Sotaro Motoi 1,2, Mai Uesugi 3, Takashi Obara 3, Katsuhiro Moriya 2, Yoshihisa Arita 2, Hideaki Ogasawara 2, Motohiro Soejima 1,2, Toshio Imai 2 and Tetsu Kawano 2,* 1 Eisai Product Creation Systems, KAN Product Creation Unit, Eisai Co., Ltd., 5-1-3 Tokodai, Tsukuba, Ibaraki 3002635, Japan; [email protected] (S.M.); [email protected] (M.S.) 2 KAN Research Institute, Inc., 6-8-2 Minatojima-Minamimachi, Chuo-Ku, Kobe, Hyogo 6500047, Japan; [email protected] (K.M.); [email protected] (Y.A.); [email protected] (H.O.); [email protected] (T.I.) 3 Medicine Creation, Neurology Business Group, Translational Medicine Department, Eisai Co., Ltd., 5-1-3 Tokodai, Tsukuba, Ibaraki 3002635, Japan; [email protected] (M.U.); [email protected] (T.O.) * Correspondence: [email protected]; Tel.: +81-78-306-5910; Fax: +81-78-306-5920 Abstract: Background: Hepatocyte growth factor (HGF) is an endogenously induced bioactive molecule that has strong anti-apoptotic and tissue repair activities. In this research, we identified APOA4 as a novel pharmacodynamic (PD) marker of the recombinant human HGF (rh-HGF), E3112. Methods: rh-HGF was administered to mice, and their livers were investigated for the PD marker. Candidates were identified from soluble proteins and validated by using human hepatocytes in vitro and an animal disease model in vivo, in which its c-Met dependency was also ensured.
    [Show full text]
  • Optimizing a Male Reproductive Aging Mouse Model by D-Galactose Injection
    Int. J. Mol. Sci. 2016, 17, 98; doi:10.3390/ijms17010098 S1 of S4 Supplementary Information: Optimizing a Male Reproductive Aging Mouse Model by D-Galactose Injection Chun-Hou Liao, Bing-Huei Chen, Han-Sun Chiang, Chiu-Wei Chen, Mei-Feng Chen, Chih-Chun Ke, Ya-Yun Wang, Wei-Ning Lin, Chi-Chung Wang and Ying-Hung Lin Table S1. List of expressional changes of up- regulated and down-regulated genes from D-gal-injected mice. Gene Full Name Fold Up-regulated genes Gpx3 Glutathione peroxidase 3 13.1 C3 Complement component 3 8.5 H2-Aa Histocompatibility 2, class II antigen A, α 6.9 Ctss Cathepsin S 6.3 Cylc2 Cylicin, basic protein of sperm head cytoskeleton 2 5.6 H2-Eb1 Histocompatibility 2, class II antigen E β 5.2 Psmb7 Proteasome (prosome, macropain) subunit, β type 7 4.3 Frg1 FSHD region gene 1 4.2 Safb2 Scaffold attachment factor B2 4.1 Gbp2 Guanylate binding protein 2 4 B2m β-2 microglobulin 4 Tbx3 T-box 3 3.8 Snrpa Small nuclear ribonucleoprotein polypeptide A 3.7 SWI/SNF related, matrix associated, actin dependent regulator of Smarca2 3.7 Chromatin, subfamily a, member 2 Gm13237 Predicted gene 13237 3.6 Cep85l Centrosomal protein 85-like 3.5 Dcn Decorin 3.2 Nme8 NME/NM23 family member 8 3.2 Dhx9 DEAH (Asp-Glu-Ala-His) box polypeptide 9 3.2 Dnajb11 DnaJ (Hsp40) homolog, subfamily B, member 11 3.2 Sltm SAFB-like, transcription modulator 3.1 Fus Fused in sarcoma 3.1 Anxa1 Annexin A1 3.1 Ly86 Lymphocyte antigen 86 3 Hpgd Hydroxyprostaglandin dehydrogenase 15 (NAD) 3 Ccdc112 Coiled-coil domain containing 112 3 Efcab2 EF-hand calcium binding domain 2 3 C1qc Complement component 1, q subcomponent, C chain 3 Dnajc21 DnaJ (Hsp40) homolog, subfamily C, member 21 2.9 Ccl8 Chemokine (C–C motif) ligand 8 2.9 Ccdc186 Coiled-coil domain containing 186 2.9 Plagl1 Pleomorphic adenoma gene-like 1 2.8 Amy1 Amylase 1, salivary 2.8 Cdkl2 Cyclin-dependent kinase-like 2 (CDC2-related kinase) 2.8 Nucb2 Nucleobindin 2 2.8 Ifitm2 Interferon induced transmembrane protein 2 2.8 Int.
    [Show full text]