Generation and Validation of Novel Cond...Ng Fibroblast Growth Factor 18 (Fgf18)

Developmental Dynamics

USA

Received: Jun 06, 2019; Inc. 2019Periodicals, © Wiley edited version. temporarily issues, future for articles unedited accepted, are Articles Accepted (M.K.H.; BBL/003406/1) Council Research Sciences Biological and Biotechnology the and (M.L.), Research Cancer for Center and Institute Cancer National Health, of Institutes National the of R01HL111190 Information: Funding 4 3 2 Department Hagan S. Andrew targeting novel of validation and Generation PATTERNS& I Key Words: Key Title: Running Louis, rene rene Department of Neurobiology & Anatomy, University of Utah School of Medicine, Salt Lake City, UT USAUT City, Salt Lake Medicine, of School Utah of University Anatomy, & Neurobiology of Department UK Norwich, Anglia, East of University Sciences, Biological of School and Cancer

H. H.

MOUSA Hung PHENOTYPES s

Developmental Biology Lab, National Cancer Institute, National Institutes of Health, Frederick, MD MD Frederick, Health, of Institutes National Institute, Cancer National Lab, Biology Developmental f FGF signaling, Bone Development, Cre Development, Bone signaling, FGF

of ibroblast ) 4

, the , ,

Validation of novel novel of Validation Renate M.Lewis Renate 1 eeomna Biology Developmental 1 American Heart Association (A.S.H.; 18 (A.S.H.; Association Heart American

Mcal Boylan Michael , Revised: Feb 28, 2019; This work was supported by grants from the National Institutes of Health (D.M.O.; (D.M.O.; Health of Institutes National the from grants by supported was work This

g rowth 5 Fgf18 , Mohammad K. Hajihosseini K. Mohammad f actor 18 2 Cag Smith Craig ,

Accepted:Jun 24, 2019 allele

This article is protected by copyright. Allrights reserved. and s 5 Neurology (

Fgf18 odtoa fo and flox conditional - Lox recombination, knock in mice, reporter gene reporter in mice, knock Loxrecombination, 1 , sea Perez Estela , Washington University School of Medicine, Saint Saint Medicine, of School University Washington , ) PRE34030091

3 , Mark Lewandoski

- Santamarina published online in advance of the final final the of advance in online published ), ), the Intramural Research Program Program Research Intramural the inducible

3 2 Krln Kowalska Karolina ,

and Developmental Dynamics Developmental

DOI10.1002/dvdy.85 DavidM.Ornitz

Cre

alleles

1 3 ,

Developmental Dynamics Email: 3908. 362 (314) Telephone: 63110. MO Louis, St. Avenue, Euclid S. 660 Medicine, of School University Washington Correspondence: [email protected]

ai Ont, et o Dvlpetl ilg, 95 ot Bd. cmu bx 8103), box (campus Bldg. South 3905 Biology, Developmental of Dept. Ornitz, David

This article is protected by copyright. Allrights reserved.

- Developmental Dynamics 2004). 2004). al., et Usui 2002; al., et Ohbayashi 2007; al., et Liu 2002; al., et Liu 2016; al., et Hung 2004; al., et (Hasegawa development, lineage. pathogenic roles in fibrosis in roles pathogenic Fgf18 diaphragm of knockout system, germline nervous central skeleton, palate, bud, limb lung, the including Abstract /- CreER to lower levels in the adult the in levels lower to hntps nld cet palate cleft include phenotypes and Itoh, 2015; Ornitz and Marie, 2015). This family of FGFs activate FGFR4 and the mesenchymal splice splice mesenchymal the and FGF FGFR4 of variants activate FGFs of family This 2015). Marie, and Ornitz 2015; Itoh, and the in is FGF18 FGF18 and factors. FGF17, FGF8, of comprised repair subfamily, FGF8 tissue and homeostatic as function adult the in and development, postnatal hampered by the perinatal lethality of lethality perinatal by the hampered identify to difficult embryonic development embryonic Background points. time postnatal and embryonic at lineages cell specific target to and homeostasis, sites of

mouse. In neonatal rats and mice, and rats neonatal In of knockout germline a containing Mice Results Background The Fibroblast Growth Factor (FGF) family consists of 18 signaling proteins that regulate embryonic and and embryonic regulate that proteins signaling 18 of consists family (FGF) Factor Growth Fibroblast The Conclusion CreERT2 T2 The function of FGF18 in postnatal tissue is poorly understood due to the perinatal lethality of the the of lethality perinatal the to due understood poorly is tissue postnatal in FGF18of function The

Fgf18

knockin We validated the the validated We

Io t l, 08 Lu t l, 02 Obysi t l, 02 Uu e a. 20) Drn embryonic During 2004). al., et Usui 2002; al., et Ohbayashi 2002; al., et Liu 2018; al., et (Ito

: lee i cmiain ih cniinl loecn rpre t cnim known confirm to reporter fluorescent conditional a with combination in allele,

We engineered a floxed allele of of allele floxed a engineered We

expression. Fgf18 R :

: s 1, 2, and allele ( allele These alleles will be useful to investigate FGF18 function during organogenesis and tissue tissue and organogenesis during function FGF18 investigate to useful be will alleles These , Fibroblast Growth Factor 18 (FGF18) functions in the development of several tissues, tissues, several of development the in functions (FGF18) 18 Factor Growth Fibroblast n te ucin f G1 i psntl eeomn ad ise oesai hs been has homeostasis tissue and development postnatal in FGF18 of function the and

primarily signals to mesenchymal tissue in developing bone and cartilage, lung, and brain and lung, cartilage, and bone developing in tissue mesenchymal to signals primarily F , Fgf18 f8 (Fgf18 gf18 result

Fgf18 and (Chai 3 CreERT2 (Ornitz et al., 1996; Zhang et al., 2006) et al., Zhang 1996; al., et (Ornitz ing Fgf18

several types of cancer. The specific cell types that express FGF18 have been been have FGF18 express that types cell specific The cancer. of types several flox lley ,

in similar phenotypes to those observed in in observed those to phenotypes similar in

aclr tg ln immaturity lung stage saccular allele by targeting it targeting by allele ) -

Heu et al., 2005; Franco 2005; al., et Heu -/- that Fgf18 expression increases in the lung during alveologenesis and then returns returns then and alveologenesis during lung the in increases expression de hrl atr it. otaal, G1 i big vlae for evaluated being is FGF18 Postnatally, birth. after shortly die )

This article is protected by copyright. Allrights reserved. allow

null null mice. Fgf18 Fgf18 s the precise identification of cells that express express that cells of identification precise the (

(Fgf18 Fgf18

in mesenchymal tissue mesenchymal in

(Itoh and Ornitz, 2008; Itoh and Ornitz, 2011; Ornitz Ornitz 2011; Ornitz, and Itoh 2008; Ornitz, and (Itoh flox -/- ) - ) Montoya et al., 2011). Cell sorting experiments experiments sorting Cell 2011). al., et Montoya that allow that i soty fe brh Te iey deleterious likely The birth. after shortly die and , . s and conditional gene inactivation and a and inactivation gene conditional abnormal nerve terminals in the the in terminals nerve abnormal Fgf18 ar follicle hair

and primary mesoderm primary and

null mice. null

. ie otiig a containing Mice

n ietf new identify and We also We Fgf18

and their and use

Fgf18 during during

the the -

Developmental Dynamics transiently expressed in neurons in the cerebral cortex and hippocampus (Hoshikawa et al., 2002) al., et (Hoshikawa hippocampus and cortex cerebral the in neurons in expressed transiently plate growth postnatal brain al., et (Mori osteoarthritis against protect and homeostasis cartilage 2013) al., state quiescent a in cells engineered a floxed allele floxed a engineered Fgf18 lcd n rm wt eGFP:CreER with frame in placed Southern blot Southern identification of cells that express express that cells of identification an of Generation that suggest development results in similar phenotypes to those observed in in observed those to phenotypes similar in results development exon 2 exon cassette selection neo gene fusion allele design was modeled after the design used by the International Mouse Phenotyping Consortium (IMPC) (IMPC) CreER with Consortium Phenotyping Mouse International the allele by conditional first” “knockout used design the after modeled was design ( knockout and allele tracing Results &Discussion Results and studiesmice.functional in lineage kno wn To facilitate functional studies of studies functional facilitate To We strategically included included strategically We e eind a designed We h treig etr ein o the for design vector targeting The

, tanycytes

expression is found in inner root sheath cells of the hair follicles where it is thought to maintain stem stem maintain to thought is it where follicles hair the of cells sheath root inner in found is expression Fgf18

and identifynew and (Skarnes et al., 2011) al., et (Skarnes . T2 In adult joint tissue, tissue, joint adult In

(Mugford et al., 2008) al., et (Mugford CreERT2 Fgf18 .

of the 5’ andof the5’ ends 3’

lining the Fgf18 Atvto o furset eotr lee i ebync neonatal embryonic, in alleles reporter fluorescent of Activation .

is expressed in myofibroblasts in expressed is oe mliucinl agtn vco t gnrt a odtoa ( conditional a generate to vector targeting multifunctional novel (

CreER

sitesof Fig. Krpaa e a. 21; aau e a. 2007) al., et Lazarus 2016; al., et (Karuppaiah ventricular

(Blanpain et al., 2004; Kawano 2004; al., et (Blanpain of T2

1A lox) allele from a single gene single a from allele lox) . knockin allele and an Fgf18 Frt The SA sequence is followed by followed is sequence SA The Fgf18 ). ).

Fgf18 (Skarnes et al., 2011), in which the splice acceptor (SA) LacZ was replaced replaced was LacZ (SA) acceptor splice the which in 2011), al., et (Skarnes and

The SA contains 875 contains SA The ( in Fgf18 Fig. T2

( wall wall to the intron located between between located intron the to Fgf18 . Fgf1

expression. These studies validate these novel alleles of alleles novel these validate studies These expression.

LoxP

nerto o te agtn vco it te eoe a vldtd by validated was genome the into vector targeting the of Integration

is expressed in the articular surface where it is thought to maintain maintain to thought is it where surface articular the in expressed is 1B, C

(Kaminskas et al., et 2019) (Kaminskas Fgf18 and to follow their lineage, we have engineered a knockin CreER knockin a engineered have we lineage, their follow to and This article is protected by copyright. Allrights reserved. 8

f lox in specific tissues and at postnatal and adult time points we have we points time adult and postnatal at and tissues specific in

eobnto sites recombination ) ) . Targeting this allele in mesenchymal tissue during embryonic embryonic during tissue mesenchymal in allele this Targeting . .

eoi lcs lcd slc acpo (SA) acceptor splice a placed locus genomic

of the postnatal lung postnatal the of Fgf18

bp of the of bp f lox

- et al., 2005; Kimura 2005; al., et

targeting event targeting allele.

a T2A sequence and a 15 bp linker sequence sequence linker bp 15 a and sequence T2A a

. n h tree all ( allele targeted the in

Fgf18 Fgf18 En2 Fgf18

2014). 2014). (McGowan and McCoy, 2015). In skin, skin, In 2015). McCoy, and (McGowan intron, the the intron, exons 1B and 1C and 1B exons

-/- . in embryonic stem cells. The allele allele The cells. stem embryonic in

In the postnatal brain, brain, postnatal the In null mice. To allow the precise precise the allow To mice. null Fgf18 - Ueki et al., 2012; Leishman et et Leishman 2012; al., et Ueki En2

, is also expressed in the the in expressed also is eGFP and adult mice confirm confirm mice adult and SA, SA, Fig. , along with a PGK a with along and :

CreER 1D - Fgf18 eGFP ) 40 bp of bp 40

to allow the the allow to and in and T2

:CreER ) lineage lineage ) for future for Fgf18

adult En2

T2 T2 is -

Developmental Dynamics Fgf18 abolishes here described allele floxed the recombination, Cre upon that, suggest data These derived. is palate 2002) were not viable. Analysis of the E18.5 embryos embryos E18.5 the of Analysis viable. not were tamoxifen hntp i de o G1 sgaig usd o the of outside signaling FGF18 to due is phenotype a functional a functional null haah e a. 20) Specifically 2002). al., et Ohbayashi presumably due to absence of of absence to due presumably ( testing oftheFunctional recombinase F expressed germline a either to line mouse parental the crossing by alleles independent two of generation Fgf18 2003) al., et (Yu lineages chondrocyte and osteoblast both to rise giving condensations mesenchymal the appearance (kyphosis) and misshapen limbs misshapen and (kyphosis) appearance mice, mice, ( generate used for lineage tracing. lineage for used revealed similar phenotypic features to to features phenotypic similar revealed suggests that the lethality evident in the exhibit skeletal defects skeletal exhibit rmtv sra ad alu (eatn e a. 2005) al., et (Perantoni tailbud and streak primitive calvaria, calvaria, Ce Fgf18 TCre; and germline Fig. Twist2tm1.1(cre)Dor

the of functionality the tested We o ute eaie h efcs of effects the examine further To

2F,

Ti generate This . -/- activity. Dermo1

mice, mice, d deformities in the ribs, a bend in the radius, and bowing of the tibia ( tibia the of bowing and radius, the in bend a ribs, the in deformities G

inducible eGFP inducible TCre ) flox/

(Hung et al., 2016; Liu et al., 2002; Ohbayashi et al., 2002) al., et Ohbayashi 2002; al., et Liu 2016; al., et (Hung

or a germline expressed Cre recombinase Cre expressed germline a or

conditional knockout conditional Dermo1 Cre -

allele odtoa knockouts conditional Fgf18 ; (Tg(T- ) . d Cre mice to generate generate to mice ( cre)1Lwd) cniinl allele conditional a

f Fgf18 Fig. lox Fgf18 ; Importantly, :CreER /f lox 2F, H

f animals do not have a cleft palate defect (data not shown), suggesting this this suggesting shown), not (data defect palate cleft a have not do animals lox f

lox TCre allele. ; T2 /f s Fgf18

lox , but both were significantly shorter than their littermate controls ( controls littermate their than shorter significantly were both but , allele ). ).

the

ie r nt viable not are mice , Quantification of length of the axis the of length of Quantification

expression in the first and second second and first the in expression

widespread Dermo1 Fgf18 also

flox/

Dermo1 Fgf18 This article is protected by copyright. Allrights reserved. driven by the endogenous endogenous the by driven those , -

Fgf18 ih h ciia eo 1C exon critical the with conditional ( did not have a cleft palate defect (data not shown). This is is This shown). not (data defect palate cleft a have not did -/- CreERT2 Fig.

mice is not not is mice Cre

Cre observed in in observed Fgf18 ; revealed revealed flox

Fgf18 ; 2H, 2H, FGF18 .

allele allele Like Like allele by crossing crossing by allele Dermo1

I mouse mouse ncot mice knockout ; arrows). arrows). ; f Aayi of Analysis . lox f solely solely lox

has Dermo1 Ce Fgf18 TCre; /f inactivation within the embryonic mesoderm, we we mesoderm, embryonic the within inactivation lox /f lox

Cre

Fgf18 exon 1C exon

( ie show mice Fig. odtoa koku mice. knockout conditional

due to due targeted mesenchyme lineage. This further further This lineage. mesenchyme targeted TCre; Fgf18 TCre; Cre 1E -/- Fgf18 Fgf18 ;

lne b lx sts ( sites loxP by flanked . embryos E18.5 E18.5

flox/ a deleted deleted TCre TCre F) F)

. H . cleft palate defect. revealed

pharyngeal promoter

(Farley et al., 2000; Hayashi et al., et Hayashi 2000; al., et (Farley incomplete mice had a distinct hunchbacked hunchbacked distinct a had mice Fgf18 flox/flox eterozygous Fig. Dermo1 agt poeios el in cells progenitors targets flox/ ( and is predicted to behave as as behave to predicted is and

Fig. flox/flox 2B

mice

phenocopied no difference between the between difference no ( -E Fgf18

Cre

arches from which the the which from arches 2A ). ). ,

suture closure closure suture Fgf18 ; Ce Fgf18 TCre;

In contrast to to contrast In mice to to mice ) control mice did not not did mice control CreER (Liu et al., 2002; 2002; al., et (Liu

Dermo1 Fgf18 T2

f lox

) Fgf18 /f that can be can that lox Dermo1 flox Cre

flox/ Fig. embryos )

Fgf18 -/- targets targets - f the of n a and

. Like . mice mice mice mice

3J the LP Cre ). ). -/-

Developmental Dynamics mrig is smt ( somite first emerging 1998) al., recombination (WISH) ( (WISH) endogenous the compared we embryogenesis, perinatal perinatal Fgf18 heterozygous generate to allele Fgf18 suggesting generate generate D 4 expressing cells were found were cells expressing Fgf18 the cells were observed in the somites and and somites the in observed were cells Fgf18 conditionally demonstrates that that demonstrates intercrossed, 4B ( tube neural and forebrain, tailbud, ganglia, root dorsal ganglion, trigeminal pit, otic the in detected were somites, the in detected strongly was mRNA shown). (datanot allantois ). ).

Expression of of Expression To determine the expression of of expression the determine To the whether determine To

At E9.5 E9.5 At characteristic characteristic -F). Clear GFP signal was observed only in the somites, somites, the in only observed was signal GFP Clear - CreERT2 -/- CreERT2 expressing cells and their lineage descendants when mice are exposed to exposed are mice when descendants lineage and their cells expressing

mice including mice Fig. We then crossed the the crossed then We lethality. Phenotypic analysis of analysis Phenotypic lethality. . At this stage, stage, this At . Fgf18 very low low very is Fgf18 activity during embryonic development embryonic during activity

inactivate the inactivate 4 A 4

and homozygous mice were examined at at examined were mice homozygous and a functional null mediated Lineage -C

bend in the ra the in bend Fgf18 expression displayed a more widespread pattern. As reported (Maruoka et al., 1998) al., et (Maruoka reported As pattern. widespread more a displayed expression Fgf18 ) with the GFP fluorescence pattern of the of pattern fluorescence GFP the with ) levels

defects in the jaw, incomplete suture closing of the calvaria, deformities of the ribs, and ribs, the of deformities calvaria, the of closing suture incomplete jaw, the in defects mice, administered administered mice,

Fig. tdTomato fluorescence 24 hr later ( later hr 24 fluorescence tdTomato at E8.0 has been reported in the somites and the presomitic mesoderm (Maruoka et et (Maruoka mesoderm presomitic the and somites the in reported been has E8.0 at CreER weak weak

Fgf18 of expression of

in the somites the in T2 4A

Fgf18 allele

dius behaves as a functional null and suggests it can be crossed to the the to crossed be can it suggests and null functional a as behaves Fgf18 ). ). Fgf18 flox CreER However, the GFP signal in in signal GFP the However,

allele. This self This allele. . (Liu et al., 2002; Liu et al., 2007; Ohbayashi et al., 2002) al., et Ohbayashi 2007; al., et Liu 2002; al., et (Liu CreER

Fgf18 xrsin a osre i te lati ad n fw el with cells few a in and allantois the in observed was expression CreERT2/+ mhb T2 T2 ( Fgf18 This article is protected by copyright. Allrights reserved.

Fig. ( /flox allele allele CreERT2 Fig. tamoxifen (

Fig.

mhb lee ih Cre a with allele CreERT2/CreERT2 4D (Fgf18

4G behaves as a functional null allele, heterozygous mice were were mice heterozygous allele, null functional a as behaves

Fgf18 ). ).

and validate its ability to recombine floxed alleles during during alleles floxed recombine to ability its validate and 4H - ad neir rsmtc eoem ( mesoderm presomitic anterior and , ) and in a few cells in cells few a in and ) knockout strategy should effectively inactivate inactivate effectively should strategy knockout After inducing at E7.5 and harvesting at E8.5 at harvesting and E7.5 at inducing After

). Low levels of tdTomato were seen in the forebrain as as forebrain the in seen were tdTomato of levels Low ). CreERT2/flox

t iia ebync ie ons n assayed and points time embryonic similar at

RA atr b whole by pattern mRNA

Fig. 0 ( P0 mhb skeletons displayedskeletons Fgf18 mice )

4G , and and , Fig. - dependent -I Fgf18

). ). 3 driven eGFP:CreER driven , apsm in which which in ). ).

CreERT2/+ the Fgf18 ( mid Fig. ROSA CreERT2/CreERT2

abnormalities tamoxifen - Fgf18 embryos was undetectable, undetectable, was embryos hindbrain junction junction hindbrain

- 4E mount mount tdTomato/+ ). ). CreERT2 Fgf18 T2 apsm n situ in .

fusion protein ( protein fusion

( reporter allele to to allele reporter

mice resulted in in resulted mice Lineage

a b ue to used be can Fig. characteristic of characteristic ). Lower levels levels Lower ).

hybridization hybridization ,

3A Fgf18 expressing expressing Fgf18 ( mhb -D). -D). Fgf18 , n the in Fgf18

) and ) Lineage in all in This

Fig. Fig. for for flox

Developmental Dynamics Fgf18 these cells are maintained. maintained. are cells these interdigit mesenchyme and in tissues in the back of the embryo, consistent with previous with consistent embryo, the of back the in tissues in and mesenchyme interdigit lining the joint space. at chondrocytes cartilage different time points for analysis for points time different signal inthesignalsomites, the articular cartilage, and cells lining the meniscus lining cells and cartilage, articular Fgf18 shown). not (data recombination incomplete cells recombined individual as well rcd no dl animals adult into traced otaa ad dl skeleton adult and postnatal rat articular chondrocyte articular rat Th response. injury for tissue the priming or homeostasis tissue joint maintaining in role a have therefore may and mice adult in tissue this in expressed compared to periosteal expression (data not shown). The lineage of these these of lineage The shown). not (data expression periosteal to compared 02 Lzrs t l, 07 Mr e a. 2014) al., et Mori 2007; al., et Lazarus 2002; protein by native fluorescence is not sensitive enough for lowly expressed tissues or tissues with high high with tissues or tissues expressed lowly for enough sensitive autofluorescence. not is fluorescence native by protein the limbs and digits, in the nascent somites, and the jaw ( jaw the and somites, nascent the in digits, and limbs the eihnra gov o Ranvier of groove the within perichondrial cells in and tissue, synovial joint, synovial the of surface articular the bone, cortical of periosteum faithful eetd n h ftr jw ad n set o te ib ( limbs the of aspects in and jaw, future the in detected These studies showthat These At E12.5, E12.5, At Fgf18

CreERT2 ly expression

eaiuae te noeos xrsin atr, oee dtcin f h eGFP:CreER the of detection however pattern, expression endogenous the recapitulates of adult animals adult of

is expressed in proliferative zone chondrocytes in in chondrocytes zone proliferative in expressed is

lineage during postnatal skeletal development skeletal postnatal during lineage Fgf18 the joint surface and/or it could be secreted into synovial fluid and signal to any of the tissues tissues the of any to signal and fluid synovial into secreted be could it and/or surface joint the

Mroa t l, 98 Mk t l, 04. hs dt sget ht the that suggest data These 2014). al., et Mok 1998; al., et (Maruoka

mRNA was still present in the somites, brain, somites, the in present still was mRNA

s (P56) (P56) , apsm (Mori et al., 2014). Since FGF18 is a secreted growth factor it could act directly on on directly act could it factor growth secreted a is FGF18 Since 2014). al., et (Mori assayed by qPCR by assayed Fgf18 Fgf18 , Fgf18 , the limbs, and the jaw ( jaw the and limbs, the , ( n dslyd smlr atr t te entl animals neonatal the to pattern similar a displayed and . Endosteal Endosteal . Fig. Lineage CreER

in a salt a in Lineage 5 A-C 5

is active in adult articular chondrocytes indicating that the the that indicating chondrocytes articular adult in active is animals induced as adults showed tdTomato showed adults as induced animals ese n This article is protected by copyright. Allrights reserved. eonatal mice were injected with with injected were mice eonatal

). ). -

and expression data expression , Fgf18 In In in situ in ( . Fig. - neonatal pepper pattern pepper o identify To Lineage

5D hybridization

Fig. ). ).

expression was also observed, but less uniformly uniformly less but observed, also was expression mice Fig.

Fig. 4F

are are n situ in

). ). , 4C 1-

Fgf18

4I Fgf18 in the tailbud and future jaw, consistent with with consistent jaw, future and tailbud the in week consistent with immunostaining for FGF18 in FGF18 for immunostaining with consistent ). ). , ). tdT ).

and immunofluorescence and and apsm and

Fgf18 the cells expressing expressing cells the Lineage Lineage - l psntl oet ad in and rodents postnatal old omato CreERT2

expressing cells were found in the the in found were cells expressing expressing cells were extensive in in extensive were cells expressing tamoxifen Fgf18 + . New sites of expression were were expression of sites New .

cells were also present in the in present also were cells

embryos showed weak GFP GFP weak showed embryos Lineage + cells in the in cells n te hretd at harvested then and

expressing cells cells expressing , ly

eosrtn that demonstrating Fgf18 Fgf18

reported sites of of sites reported (Ellsworth et al., al., et (Ellsworth Fgf18 CreERT2 CreERT2 periosteum T2 articular articular

gene is

in the the in fusion fusion allele was ,

Developmental Dynamics aoie co floe b a by followed chow tamoxifen diinl tdTomato additional expressing expressing cells identify Franco 2005; al., et Heu yfbolss dt nt hw, aucit n umsin. xrsin n h lvr n pnra ws more tdTomato with was restricted pancreas and liver the in Expression submission). in manuscript shown, not (data myofibroblasts tdTomato wall ( wall Fgf18 Fgf18 white visceral fat depot were analyzed but did not did but analyzed were depot fat visceral white valve cardiac and kidney, liver, lung, aorta, heart, spleen, the in detected spleen, lung, liver, and pancreas. and liver, lung, spleen, cells lower abundant in cardiac in abundant tamoxifen analyzed but did not display not ( did but analyzed pancreas and liver, lung, spleen, the in detected oncie ise asl ( capsule tissue connective the parenchyma ( parenchyma the liver. liver. cells mesothelial eut suggest results greatest amount of tdTomato of amount greatest

In adult adult In development organ visceral postnatal rodent In sho Fig. - CreERT2 C Fgf18 level expression in the heart, testis, spleen, skeletal muscle, and brain brain and muscle, skeletal spleen, testis, heart, the in expression level reERT2 wed a similar capsule expression expression capsule similar a wed

7C cells were located in located were cells oe fo psntl a 5 P) o P8 to (P5) 5 day postnatal from doses Lineage

Fgf18 murine lineage in adult visceral homeostasis organ visceral adult in lineage lineagein postnatal ). In the heart, lung, heart, the In ).

( that

Fig.

Fig. el wr fud n pre aecya el i ln ad iny tdTomato kidney. and lung in cells parenchyma sparse in found were cells uig visceral during

tissue tissue + valve Fgf18, Fgf18,

el lctd n h per the in located cells

6B 7B, + -

, arrowhead). Cells in the parenchyma were determined to be be to determined were parenchyma the in Cells arrowhead). , Montoya et al., 2011) al., et Montoya Fgf18 cells

D, interstitial cells interstitial Fgf18 Fig.

tdTomato ae o expression, on based + L,

cells

located in perivascular regions, likely smooth muscle cells muscle smooth likely regions, perivascular in located

K the outermost the

visceral organ visceral 1-

uig otaa vsea organogenesis visceral postnatal during

liver, and kidney and liver, expression expression

) week washout before before washout week . The strong The . ra homeostasis organ , arw a wl a sas cls n h prnhm. h ln show lung The parenchyma. the in cells sparse as well as arrow) , located in the single the in located +

cells This article is protected by copyright. Allrights reserved. ( pattern as pattern Fig. . In the spleen, tdTomato spleen, the In .

a been has i mesenchymal derived interstitial cells interstitial derived mesenchymal

aclr ein rud ag vses ( vessels large around region vascular est development

, 7G but its but ,

mesothelial expression was seen in the lung followed by the the by followed lung the in seen was expression mesothelial show any tdTomato any show ). Taken together th together Taken ). tdTomato

Fgf18 has a functional role in postnatal organogenesis of the the of organogenesis postnatal in role functional a has

and collected collected and Fig. observed in observed ,

expression in other organs has not been not has organs other in expression adult reported in the lungs and kidneys at high levels with with levels high at kidneys and lungs the in reported - 6

ise collection. tissue cell mesothelium ( mesothelium cell expression has been observed in the lung the in observed been has expression . h badr kde, n sal netn were intestine small and kidney, bladder, The ).

Fgf18 cells were found, to differing degrees, in in degrees, differing to found, were cells

the postnatal animal ( animal postnatal the Lineage n P9 on + +

ese

cells were seen in the sub the in seen were cells cells

mice mice , . (

Fgf18 results indicate that that indicate results Fgf18 Fgf18 Fig. Fig. . In the spl the In . (Hu et (Hu were 7

6B Lineage Lineage Lineage ). The pancreas, testis, and and testis, pancreas, The ).

(adventitia) , arrow) and many cells in in cells many and arrow) , al., 1998) al.,

induced

Fig.

een mice were given daily daily given were mice predominantly Fig. xrsig el were cells expressing xrsig cells expressing (

Fig. Fgf18 7A’

7A)

. for To identify cells identify To

). In the aorta, aorta, the In ).

of the vascular vascular the of 6C , Fgf18 Lineage but exhibited but + reported. reported. 1- -

, D , mesothelial mesothelial el were cells week with with week

(Chailley

CreERT2 ). These These ).

alveolar alveolar visceral labeled

s were were the the To To

is is -

Developmental Dynamics tanycytes and the ependymal lining of the dorsal third third dorsal the of lining ependymal the and tanycytes confirmed confirmed Fgf18 Conclusion Fgf18 fate the define to work Future conditions. homeostatic under organs adult multiple in types cell diverse mark to able Fgf18 additionally were collection. Tissue from multiple bregma coordinates bregma multiple from Tissue collection. as as Fgf18 will be useful for the investigation of the tissue specific function of the gene ( gene the of function specific tissue the of investigation the for useful be will olcin result collection Alvarez- ( stream migratory rostral the via OB the to supply neuronal of reminiscent evident, expressing cells ( cells expressing distribution of distribution descendants their hindbrain recess ( recess ( anteriorly into the olfactory bulbs, where where bulbs, olfactory the into anteriorly acutely harvested Fgf18 brain i. C D 8C, Fig. Fgf18 This study demonstrates the generation and validation of two novel alleles alleles novel two of validation and generation the demonstrates study This expression the into insight better gain To

and . These tools will be useful to investigate FGF18 function during organogenesis and organogenesis during function FGF18 investigate to useful be will tools These .

-/- Lineage Lineage CreERT2 expression originating from the mesenchymal compartment. Using Using compartment. mesenchymal the from originating expression

4V anim Buylla, 2019) Buylla, function of these cells during injury response response during injury cells these of function Lineage

junction in known and identified in new sites new in identified and known in

) ( )

mice were induced for two weeks with tamoxifen chow followed by a 1 a by followed chow tamoxifen with weeks two for induced were mice

) xrsig cells expressing lineage in ; l, nldn dfriis f h clai, is hnlm, for hindlimb, ribs, calvaria, the of deformities including als, Fig. 8E, H 8E, Fig.

h cood plexus choroid the Fgf18 expressing cells cells expressing ed detected in a subset of cortical pial astrocytes ( astrocytes pial cortical of subset a in detected Fgf18

te otaa ad ueie kltn in skeleton; juvenile and postnatal the ; (Kaminskas et al., et 2019) (Kaminskas

n the in at the time of harvest. This conclusion is supported by a more restricted number number restricted more a by supported is conclusion This harvest. of time the at Lineage . the In these mice these In CreERT2 ); ); pial astrocytes ( astrocytes pial labeled

Fgf18 adult brain adult

ee lo on i te al o te aea vnrce. hs cud e followed be could These ventricles. lateral the of walls the in found also were ). ). Using Using (Tomato Lineage , cells in the hypothalamus of animals pulsed animals of hypothalamus the in cells n eedml iig f h dra tid vent third dorsal the of lining ependymal and ,

xrsig el icuig both including cells expressing Fgf18 it

is likely the long period between initial tamoxifen treatment and tissue tissue and treatment tamoxifen initial between period long the likely is + ) ( ) Fig. 8G Fig. This article is protected by copyright. Allrights reserved. . Fig. 8 Fig. Fgf18 flox , it was confirmed that the majority of the skeletal phenotypes of phenotypes skeletal the of majority the that confirmed was it , in th in

) ); ); Lineage of . Fgf18 e embryo in mu in embryo e

septum ( septum

Fgf18 was should

expressing

Lineage ventricle immunolabeled to detect astrocytes (GFAP astrocytes detect to immunolabeled

n cls eie fo them from derived cells and postnatal Fig. 8J Fig. be informative. be

expressing cells were detected in hypothalamic hypothalamic in detected were cells expressing Fig. 8B 3) ( (3V)

l tiple organs including the somites and mid and somites the including organs tiple ), ), olfactory bulb (OB) neurons were clearly clearly were neurons (OB) bulb olfactory

and amygdala (not shown (not amygdala and cells expressing expressing cells and adult visceral organs; and in adult adult in and organs; visceral adult and ); ); i. 8F Fig. Fgf18 in rare neurons in the cerebral cortex cortex the cerebral in neurons rare in e ib ad xs ae eedn on dependent are axis, and limb,

more CreERT2 Fgf18 ). ). targeting the the targeting r - icle (3V) and and (3V) icle Fgf18 week washout before tissue tissue before washout week Fig. 8J, L 8J, Fig.

briefly with tamoxifen with briefly , expression of of expression , flox ) and the lineage of of lineage the and ) Fgf18 Lineage

tissue homeostasis tissue n h brain the in -O CreERT2

Fgf18 expressing cells cells expressing ) ). ). (Obernier and and (Obernier forth Interestingly, Interestingly,

s el as well as Fgf18 locus that locus

+ ) ventricle ventricle as well as adult ,

was was and and and its - ,

Developmental Dynamics the day thevaginal plug wasfoundin timed et al., 2003) al., et described previously Experimental Procedures Experimental mediated recombination, we recombination, mediated The C57BL/6J x 129X1/SvJ or or 129X1/SvJ x C57BL/6J 1 Proposal: Study (Animal (NIH) the by approved protocol a under Health of Natio Institutes the of Animals Laboratory of Use and Care for Guide the in recommendations the with accordance or 20160013) No. (Approval Louis St. in University Washington at Care Animal Institutional the by approved eeae xeietl itr. hs rs ws sd o ses oh F sga ad Cre and signal GFP both assess to used was cross recombination. This litters. experimental generate Blot Southern crosses Genetic Animals cell lineages specific target to and Fgf18

n gnrtd y C apiiain Poe : For A: (Probe amplification PCR by generated and et al., 2002) et al., house. cacaggtgggtagcagatgcagcatgatac). Genomic DNA digested with NdeI was screen by DNA analysis with probes probes with by analysis DNA screen was NdeI with digested DNA Genomic cacaggtgggtagcagatgcagcatgatac).

Genomic DNA digested with SpeI was screen by DNA analysis with probes probes with analysis DNA by screen was SpeI with digested DNA Genomic generate To pathogen in housed were animals All All other mouse strains, including, including, strains, mouse other All TCre flox

Fgf18 /flox

line has been described previously described been has line

females were crossed to crossed were females . . Postnatal day 0 (P0) was assigned as the day of birth. of day the as assigned was (P0) day0 Postnatal -

allele

Fgf18

was generated by recombining the the recombining by generated was

C (Farley et al., 2000; Hayashi et al., 2002; Madisen et al., 2010; Perantoni et al., 2005; Yu Yu 2005; al., et Perantoni 2010; al., et Madisen 2002; al., et Hayashi 2000; al., et (Farley reERT2/+ -/-

fetuses,

outbred ; ROSA ; generated generated 7- TCre at 069)

tdTomato/+ TCre various embryonic and postnatal time points. postnatal and embryonic various genetic genetic +/+ . Mice of both sexes were utilized. Mice were maintained on a mixed mixed a on maintained were Mice utilized. were sexes both of Mice . Fgf18 ; Fgf18 ; ROSA +/+ This article is protected by copyright. Allrights reserved. - re are facilit barrier free -

; Fgf18 ; mating experiments. Adult mice were 8 weeks of age age older. or of weeks 8 were mice Adult experiments. mating when exposed to to exposed when back C

(Perantoni et al., 2005) al., et (Perantoni reERT2/+ tdTomato - /+

mice were intercrossed. To generate generate To intercrossed. were mice ground. ground. - /+

; R ; males. Mice were maintained on an outbred an on maintained were Mice males. ,

Dermo1 OSA nml ae n Uae omte o NCI of Committee Usage and Care Animal Fgf18 Fgf18 ies tdTomato/tdTomato ward tamoxifen flox . All studies were performed under a protocol protocol a under performed were studies All . Cre

CreERT2 allele in the germline the in allele , gctgaatatgttcagatcttggctctgtgc ,

Embryonic day 0.5 (E0.5) was assigned as as assigned was (E0.5) 0.5 day Embryonic TCre .

To investigate the effectiveness of Cre of effectiveness the investigate To mice and and mice are referred to as as to referred are Sox2 ,

males and mated them to females to females to them mated and males - Cre,

designed Fgf18

and with Sox2 with TCre f lox

Fgf18

FLPeR

ee eeae in generated were against the 5’ end 5’ the against + ; Fgf18 ; Lineage - Cre

background. background. ; have been been have - -

Frederick Frederick flox mediated mice. Rev (Hayashi (Hayashi /-

mice, mice,

erse

nal nal in ,

Developmental Dynamics in Vectashield® antifade mounting medium with DAPI (ThermoFisher, NC9524612), sealed with nail polish, polish, imaged. at 4°Cuntil stored and nail with sealed NC9524612), (ThermoFisher, DAPI with medium mounting antifade Vectashield® in X Triton 0.5% + PBS in permeabilized at stored and temperature, room at dried cryostat, a with µm 6 at cut were sections Frozen ice. dry on frozen and Organs were patted dry, equilibrated in Tissue in equilibrated dry, patted were Organs agitation gentle with 4°C at overnight PBS washed were Samples agitation. gentle with 4°C at overnight rprtos ftss ee kne ad vseae, tie wt aiai rd ad lin le (12 blue glycerol. alcian in and stored glycerol, 1%KOH/20% in cleared and S red alizarin with stained eviscerated, and skinned were fetuses preparations, 12 for 74240) Sigma, organs visceral preparation: Sample Skeleton Preparation: Sample tgtgagtattctgaatgactgtggtcccac designed added 5 ml of 50 mg/ml progesterone mg/ml 50 of ml 5 added intraperitoneally (VWR formalin buffered neutral 10% xylazine, KOH 2% in cleared P0

aoie ( tamoxifen H cm 20 of pressure a at inflation intratracheal Tamoxifen administration Tamoxifen - skeletal preparations, carcasses were skinned and eviscerated, and then soaked in acetone for 12 for acetone in soaked then and eviscerated, and skinned were carcasses preparations, skeletal 0C ni ue Sie wr wre for warmed were Slides use. until 80°C

o ebync xeiet tmxfn 8 mg/kg (80 tamoxifen experiments embryonic For and ketamine containing cocktail a of overdose an with sacrificed were mice times, collection designated At previously described as prepared were Skeletons

perfused with PBS through the right ventricle, and indicated organs were fixed with submersion in in submersion with fixed were organs indicated and ventricle, right the through PBS with perfused Millipore gis te ’ n ad eeae b PR mlfcto (rb B For B: (Probe amplification PCR by generated and end 3’ the against (IP) (IP) - (12– im, 54) a dsovd n 5 in dissolved was T5648) Sigma, no rgat dams pregnant into – 24 h, cleared in 1% KOH/20% glycerol, and stored in glycerol. For embryo skeleton skeleton embryo For glycerol. in stored and glycerol, KOH/20% 1% in cleared h, 24 24 h), stained with alizarin red S (Millipore S red alizarin with stained h), 24

;

Rev erse

100 (Sigma, X (Sigma, 100 dissolved in sesame oil sesame in dissolved

International , gacagccagctcatgtgctcatgatgtc This article is protected by copyright. Allrights reserved.

24 hours hours 24 ,

10 min at room temperature and washed in PBS before being being before PBS in washed and temperature room at min 10 n te 3% urs oengt t ° wt gnl agitation. gentle with 4°C at overnight sucrose 30% then and - Tek® O.C.T. Tek® 2 o 10% of O , -

100) for 15 min. Slides were washed 3x in PBS, mounted mounted PBS, 3x in washed were Slides min. 15 for 100) (Colvin et al., 1996; Nagy et al., 2003). For postnatal day postnatal For 2003). al., et Nagy 1996; al., et (Colvin eoe collection before anr Pennsylvania; Radnor,

l f on i ( oil corn of ml ) n poetrn (0 mg/kg (40 progesterone and compound

(Watson Pharma Inc. Pharma (Watson twice twice neutral buffered formalin. Organs were fixed fixed were Organs formalin. buffered neutral - Sigma, 58005) and alcian blue (Millipore blue alcian and 58005) Sigma, in PBS in tg

Millipore f embryos of ). ). (VWR, 4583) for 20 min, embedded, min, 20 for 4583) (VWR, , cryoprotected in 15% sucrose in in sucrose 15% in cryoprotected

89370). Lungs were fixed via via fixed were Lungs 89370). - Sigma . , Parsippany, New Jersey; Jersey; New Parsippany, o prepare, To

86) o hc was which to C8267) wr co were )

100 mg of of mg 100 - – injected – 4 h 24 24 h 24 ward r), r), r - , ,

Developmental Dynamics C Whole software. Germany) Oberkochen, AG, Zeiss ( Library methods of tamoxifen administration were not directly assessed. assessed. directly not were administration tamoxifen of methods two the between efficiency recombination in Differences experiments. neonatal and embryonic in unavoidable unnecessary avoid to experiments adult and juvenile (adult days (400 oil seed sunflower or Tamoxifen (P5). 5 day postnatal at beginning using were sections Immunolabelled antibodies (GFAP) Imaging using transcribed In situ experiments neonatal 0591 NDC (Excelitas immuno and generated were analysis, brain For mice. 2 least at of representative are Images 1993) embryos. orporation, Tokyo, Japan) Tokyo, orporation, loecn mcocp o sie ws efre uig ihr es LSM Zeiss either using performed was slides of microscopy Fluorescent With the exception of adult brain analysis, eGFP and tdTomato were detected by native fluorescence. fluorescence. native by detected were tdTomato and eGFP analysis, brain adult of exception the With mount Whole

mg/kg tamoxifen citrate tamoxifen mg/kg an .

- hybridization mount brightfield images were performed using an Olympus SZX12 Stereozoom microscope Stereozoom SZX12 Olympus an using performed were images brightfield mount

The

http://www.mbl.org/mbl_main/atlas.html

Samples at E9.5 and E12.5 were cleared in 50% glycerol:PBS for several days prior to imaging. prior days several for 50% glycerol:PBS in cleared were E12.5 and E9.5 at Samples Differential interference contrast microscopy of slides was performed using Zeiss Axio Imager M2 Imager Axio Zeiss using performed was slides of microscopy contrast interference Differential Olympus MVX10 MVX10 Olympus - Technologies Corp, Waltham, Massachusetts) at 475 nm and 575 nm wavelen nm 575 and nm 475 at Massachusetts) Waltham, Corp, Technologies

3128 visceral organs visceral Fgf18 - 79 SP6 polymerase SP6 in situ in

). ). rb ws eeae from generated was probe performed according to published protocols published to according performed

, This was then sterilized through a 0.22 a through sterilized then was This o injection for tamoxifen was administered by administered was tamoxifen

hybridization was was hybridization )

, or 14 days (adult skeleton) (adult days 14 or , or Olympus MVX10 Olympus or microscope microscope ) ( ) l abe Envigo, counterstained .

le (Xu et al.,2000)et(Xu

For juvenile and adult experiments tamoxifen was administered by chow chow by administered was tamoxifen experiments adult and juvenile For wt anti with d snl pae ad or and plane) (single

Huntingdon, United Kingdom; United Huntingdon, xie uig n X an using excited This article is protected by copyright. Allrights reserved. performed

was prepared at a concentration of 20 of concentration a at prepared was

- ih Hoechst with (Williams, 2000) (Williams, microscope

oao se a wl a anti as well as dsred Tomato peiul published previously a . Prolonged development of the stain was required for E8.0 E8.0 for required was stain the of development Prolonged

according to published protocols (Wilkinson and Nieto, and (Wilkinson protocols published to according IP

injections .

injection at a dose of 150 µg on four sequential days days sequential four on µg 150 of dose a at injection Tamoxifen was administered by chow in longer in chow by administered was Tamoxifen

n Zis xo mgr M2 Imager Axio Zeiss a on . µ Whole mount fluorescent images were performed performed were images fluorescent mount Whole

- ie ub XT600 Turbo Cite stain m filter and stored at 4 at stored and filter m .

serial (Haan et al., 2013; Kaminskas et al., 2019) al., et Kaminskas 2013; al., et (Haan

(Whitfield et al., 2015). IP injections were were injections IP 2015). al., et (Whitfield . ta iae ae from are images Atlas

TD.130860) for 10 for TD.130860)

60 60

plasmid linearized with SacII and and SacII with linearized plasmid m t - hick coronal vibratome sections sections vibratome coronal hick 0 Cnoa Microscope Confocal 700 - Glial Fibrillary Acidic Protein Protein Acidic Fibrillary Glial -T -T

loecne ih source light fluorescence µg/µl dissolved in corn oil oil corn in dissolved µg/µl C before use. before C - ih respective with 14 days (juvenile) days 14 g

ths. the

Images were were Images Mouse Brain Brain Mouse

(Olympus (Olympus For early early For

term term ZEN Carl , 7 . .

Developmental Dynamics Measurements GFX) X (Canvas Canvas either using processed We thank W.We thank Lewis Acknowledgements Dieg San Software, Prism(GraphPad 7 in generated were Plots X. Canvas in made were figures 0.05. < p *indicates deviation. ±standard mean as represented are Data animals. of the number represents distributed Conceptualization, Contributions Author a using by calculated K.K., K.K., rgnl Draft Original The authors declare no competing interests no competing declare authors The interests Competing information Additional Acquisition Funding D.M.O.; egh f h axis the of Length M.K.H.

y Shapiro a by ; Investigation, A.S.H., M.B., A.S.H., Investigation, ; , A.S.H., A.S.H., , , Statistical Analysis, and Plotting Plotting and Analysis, Statistical ,

I.H.H., and and Truffer E.

unpaired t unpaired was .. M.L., M.B.,

- Wilk test. Significant differences in mean values between two sets of data were were data of sets two between values mean in differences Significant test. Wilk D.M.O

, esrd rm h als o h tp f h tail the of tip the to atlas the from measured D.M.O. - .

Methodology ; test. test. for animal caretaking animal for

D.M.O. , M.L. A P value of less than 0.05 was considered significant. Sample size (n) (n) size Sample significant. considered was 0.05 than less of value P A

E.P.S., K.K., E.P.S., This article is protected by copyright. Allrights reserved.

. ; Writing Writing ; , ImageJ ,

, .. DMO; oml Analysis, Formal D.M.O.; M.L., –

C.S.

eiw Editing & Review and M. Brown for technical assistance technical and for M.Brown , or Photoshop (Adobe Inc., San Jose, California) Jose, San Inc., (Adobe Photoshop or , , M.K.H . ; Resources ;

A.S.H. , . Data Data , I.H.H., D.M.O , A.S.H. ee on t be to found were

M.L. M.L. MB, C.S. M.B., , Supervision ; D.M.O.; Writing Writing D.M.O.; . o, CA). o,

, E.P.S., E.P.S., , normally normally

, M.L., M.L., . All All – Developmental Dynamics Self 2004. E. L, Fuchs Polak A, Geoghegan LowryC, WE, Blanpain References Itoh N, Ornitz DM. 2008. Functional evolutionary history of the mouse Fgf gene family. family. gene Fgf mouse the of history evolutionary Functional DM. 2008. Ornitz N, Itoh in development, roles to evolution frommolecular growth factors: Fibroblast DM. 2011. Ornitz N, Itoh H, Kiyama S, Imagama A, Masuda H, Konishi K, M,Ota Tsushima H, Nakashima H, Yagi B, Ohkawara K, Ito mutant Fgf18 Fgf9 and of series combined A DM. 2016. M,Ornitz GC, Lewandoski Schoenwolf IH, Hung MC Hu mice in deafness and overgrowth Skeletal 1996. DM. Ornitz DG, McEwen GW, Harding BA, Bohne JS, Colvin Chailley Hoshikawa Hoshikawa a using epiblast mouse in modulation gene Efficient 2002. AP. McMahon Pevny P, L, Lewis S, Hayashi M,Suzuki Takamatsu S, Ashigaki H, Hasegawa FLPeR using expression recombinase Widespread SM.2000. Dymecki LS, Steffen P, Soriano FW, Farley EE, Moore KD, MS,Lum Holdren S, Holderman A, Feldhaus J, Claus T, Bukowski BerryJL, J, Ellsworth Kaminskas B, Goodman T, Hagan A, Bellusci S, Ornitz DM, Hajihosseini MK. 2019. Characterization of of Characterization MK.2019. DM, Hajihosseini Ornitz S, Bellusci A, Hagan T, Goodman B, Kaminskas Haan N, Goodman T, Najdi T, Goodman N, Haan Franco - - alleles identifies unique and redundant roles in skeletal development. development. in skeletal roles redundant and unique identifies alleles Proliferation. and Intestinal Hepatic T, Danilenko DM.FGF 1998. Niche. Cell Stem Epithelial an within Populations Cell Two of lacking fibroblast growth factor receptor 3. 3. receptor growth factor fibroblast lacking 51. inmyofibroblasts. elastogenesis enhances and lung Dynamics disease. and metabolism http://www.nature.com/articles/s41598 clusters. receptor acetylcholine reduced with junction neuromuscular Ishi development. early postnatal during brain rat in the expressed Sox2Cre transgenic mouse strain. mousestrain. Sox2Cretransgenic Signaling. Factor Growth Fibroblast Coordinated Neocortexby Temporally Developing the in Patterning Laminar 2004. Adult Hypothalamus. and Postnatal the Fgf10 mice. (Flipper) progenitors. their factor growth Fibroblast 2002. SD. Hughes EyreDR, RJ, Fernandes L, Yao K, Waggie DL, Thompson H, Storey C, Sprecher P, Shea H, Ren F, Raymond https://onlinelibrary.wiley.com/doi/abs/10.1111/jne.12750. energy Factor Growth Fibroblast in players endogenous development. alveolar for relevance possible lung: mouse postnatal the ofin FGF18 genes target Profiling T, Qiu WR, Wang Y, Hill D, Ring BD, Scully S, Bolon B, DeRose M, Luethy R, Simonet WS, Arakawa Arakawa WS, Simonet R, M,Luethy DeRose B, Bolon S, Scully BD, Ring D, Hill Y, Wang WR, Qiu T, Montoya M Montoya - Heu B, Boucherat O,Barlier Boucherat B, Heu

guro N, Ohno K. 2018. Lack of Fgf18 causes abnormal clustering of motor nerve terminals at the the at terminals ofnerve motor clustering abnormal causes of Fgf18 Lack N, 2018. K. guro Ohno M, Yonamine A, Konishi M, Itoh N. 2002. FGF 2002. N. M, Itoh Konishi A, M,Yonamine

- Expressing Tanycytes Add New Neurons to the Appetite/Energy the to Neurons New TanycytesAdd Expressing - balance nuclei. balance

237:18 - L, Boucherat O, Thibault C, Chailley O,Thibault Boucherat L, Physiol Genomics Physiol genesis – Osteoarthritis and and Cartilage Osteoarthritis J. Neurosci. J. 27. - Samiei A, Stratford CM, Rice R, Agha EE, Bellusci S, Hajihosseini MK. 2013. MK.2013. Hajihosseini S, Bellusci EE, Agha R, CM, Rice Stratford A, Samiei

Journal of Neuroendocrinol of Journal 28 Journal of of Biochemistry Journal :106 - -

18, a Novel Member of the Fibroblast Growth Factor Family, Stimulates Stimulates Family, Factor Growth Fibroblast the of Member Novel a 18, 24:8711 MurA – 110.

43:1226 This article is protected by copyright. Allrights reserved. Mechanisms of Development of Mechanisms Molecular and Cellular Biology Cellular and Molecular

- M, Bourbon JR. 2005. FGF 2005. JR. Bourbon M, - – 017 8719. J. Neurosci. J. - – Migishima R, Ohbayashi N, Itoh N, Takada S, Tanabe Y. Y. Tanabe S, Takada N, Itoh N, Ohbayashi R, Migishima 1240. Nature Genetics Nature - 18753

10:308

- - regulated functions of hypothalamic tanycytes and and tanycytes hypothalamic of functions regulated Heu B, Incitti R, Delacourt C, Bourbon JR. 2011. 2011. JR. Bourbon R,C, Delacourt Incitti B, Heu

149:121 - - ogy 5. 18 is a neuron a is 18

33:6170 Am. J. Physiol. Lung Cell Mol. Physiol. Mol. LungCell Physiol. Am. J.

- – 18 is a trophic factor for mature chondrocytes and and chondrocytes mature for factor a trophic is 18 320. .

–

130. 12 - – Renewal, Multipotency, and the Existence Existence the and Multipotency, Renewal, Cell 6180. :390. Molecular Research Brain Molecular

- 119:S97 18 is upregulated in the postnatal rat the postnatal in upregulated is 18

- 118:635 derived glial cell growth factor growth factor cell glial derived

18:6063

Scientific Reports Scientific Dev. Biol. Dev. - Balan – – S101. – 648. 6074. ce Regulating Centers of of Centers Regulating ce Developmental Developmental

411:72

8 – 84.

. 105:60

288:L43 – 66. -

Developmental Dynamics Kimura- Komi M, Kawano osteoprogenitor the in signaling FGF DM. 2016. Ornitz F, Long C, J, Smith Chen J, Lim K, Yu K, Karuppaiah McGowan SE, McCoy DM. 2015. Fibroblast growth factor signaling in myofibroblasts differs from lipofibroblasts lipofibroblasts from differs myofibroblasts in signaling factor growth Fibroblast 2015. DM. McCoy SE, McGowan of expression the of Comparison 1998. Y. Furuta BLM, Hogan N, M,Itoh Hoshikawa N, Ohbayashi Y, Maruoka Jones MJ, RD,Hawrylycz Palmiter LL, Ng GuH, HA, Zariwala SM,OhSW, Sunkin TA, Zwingman L, Madisen by fibroblast osteogenesis and chondrogenesis of Coordination DM. 2002. Ornitz JS, Colvin Xu Z, J, Liu hypertrophy proliferation, chondrocyte early for required is FGF18 2007. DM. Ornitz IH, Hung KJ, Lavine Z, Liu maintains Foxp1 2013. H. Nguyen H, Tucker JD, Dekker AT, Q,Ku Miao GE, Garcia JM, Howard E, Leishman the in expression factor growth Fibroblast 2007. J. O,Baron Nilsson AC, Andrade A, JE, Hegde Lazarus Mok GF, Cardenas R, Anderton H, Campbell KHS, Sweetman D. 2014. Interactions between FGF18 and and FGF18 between Interactions 2014. D. Sweetman KHS, Campbell H, Anderton R, Cardenas GF, Mok Mugford JW, Sipilä P, McMahon JA, McMahon AP. 2008. Osr1 expression demarcates a multi a demarcates expression Osr1 2008. AP. McMahon JA, McMahon P, Sipilä JW, Mugford Identification 2014. H. Kawaguchi U, Chung H, CH,Guehring Ladel H, Kobayashi SH, Chang T, Saito Y, Mori Ornitz DM, Marie PJ. 2015. Fibroblast growth factor signaling in skeletal development and disease. disease. and development skeletal in signaling factor growth Fibroblast 2015. PJ. Marie DM, Ornitz Embryo:Laboratory A the Mouse Manipulating 2003. R. Behringer M,K, Vintersten Gertsenstein Nagy A, Ornitz DM, Itoh N. 2015. The Fibroblast Growth Factor signaling pathway. pathway. signaling Factor Growth Fibroblast The 2015. N. DM, Itoh Ornitz for required is FGF18 S. 2002. Takada N, Itoh T, M,Fujimori Imanishi Y, M,Kurotaki Shibayama N, Ohbayashi Alvarez K, Obernier Inducing Anagen from Telogen Stage Hair Follicles. Follicles. Hair Stage Telogen from Anagen Inducing of and Capable Hair Follicles in Expressed Highly Is FGF18 in Skin: FGFRExpression and FGF of 132:1338 Signaling. FGF18 Epithelial by Cyclic Regulated Is Phase Resting Development lineage non hair follicle stem cell quiescence through regulation of Fgf18. of regulation through quiescence stem cell follicle hair growthpostnatal plate. during alveolar septation in mice. mice. in septation alveolar during 74:175 embryo. mouse the in Fgf18, Fgf17and Fgf8, genes, related highly three brain. mouse whole the for high and robust A 2010. H. Zeng ES, Lein AR, 18. factor growth plate. growth of the invasion vascular and Profiling. Profiling. Factor Growth Fibroblast of 223. myoblasts. embryo limb of chick differentiation acid regulate retinoic nephron progenitor compartment within the mammalian kidney. kidney. mammalian the within compartment progenitor nephron Osr1 an to restriction progressive undergoes that mesoderm of intermediate population Dev. 4 Press. Laboratory Harbor Spring Cold Michigan: of University ed. 3rd Manual 16:870 chondrogenesis. and osteogenesis during differentiation and proliferation cell normal brain. mammalian Ueki M, Oda Y, Oki J, Komi J, Oki Y, M,Oda Ueki :215

29:1463 – – 266. – 177. 879. – J. Biol. Chem. J. Biol. - Kuramochi A, Asada M, Suzuki M, Oki J, Jiang J, Imamura T. 2005. Comprehensive Analysis Analysis Comprehensive 2005. T. Imamura J, Jiang J, M,Oki M,Suzuki Asada A, Kuramochi 1345.

- - autonomously regulates postnatal chondrocyte proliferation and skeletal gr and skeletal proliferation chondrocyte postnatal regulates autonomously

Buylla A. 2019. Neural stem cells: origin, heterogeneity and regulation in the adult the adult in regulation and origin, heterogeneity cells: stem 2019. Neural A. Buylla

– 143:1811 1486.

Genes Dev. Genes Development

– Bone

289:10192 1822. Nature Neuroscienc Nature - - 18 as a 18 as

Kuramochi A, Honda E, Asada M, Suzuki M, Imamura T. 2012. Hair Cycle Cycle Hair 2012. T. M,Imamura M,Suzuki Asada E, Honda A, Kuramochi 40:577

16:859

146:dev156059. Am. J. Physiol. Lung Cell Mol. Physiol. Mol. Cell Lung Physiol. Am.J. This article is protected by copyright. Allrights reserved. –

10200. Molecule to Protect Adult Articular Cartilage by Gene Expression Expression by Gene Cartilage Articular Adult to Protect Molecule – – 586. 869.

Developmental Biology Developmental

- throughput Cre reporting and characterization system characterization and reporting Cre throughput e

13:133 Journal of Investigative Dermatology Investigative of Journal – 140. Development

Developmental Biology Developmental

302 Journal of Investigative Dermatology Investigative of Journal Wiley Interdiscip Rev Biol Rev Dev Interdiscip Wiley Developmental Biology Developmental :80

309:L463 – Mechanisms of Development of Mechanisms 91.

140:3809

- 474. – Genes Dev. Genes 3818. - - owth.

potent 324:88 dependent

124:877

Genes Genes 396:214 – 98.

– 885.

–

Developmental Dynamics Receptor M.1996. G,Goldfarb Gao F, Coulier CA, DG, MacArthur McEwen JS, Colvin Xu DM,J, Ornitz Whitfield J, Littlewood T, Soucek L. 2015. Tamoxifen administration to mice. mice. to administration Tamoxifen L. 2015. T, Soucek J, Littlewood Whitfield lung embryonic for required is Fgf18 2004. ItohN. S, M,Takada Konishi N, M,Ohbayashi Shibayama H, Usui T, Cox J, M,Harrow AO,Thomas Mujica IyerV, W, M,Bushell Koutsourakis AP, West B, WC, Rosen Skarnes Pajni C, Richman F, O,Naillat AO,Timofeeva Perantoni Zhang X, Ibrahimi OA, Olsen SK, Umemori H, Mohammadi M, Ornitz DM. 2006. Receptor specificity of the the of specificity Receptor 2006. DM. Ornitz M, Mohammadi H, Umemori SK, OA,Olsen X, Ibrahimi Zhang FGF of inactivation Conditional DM. 2003. Ornitz DA, Towler EN, Olson J, Shao D, Sosic Z, Liu Xu J, K, Yu and proliferation regulate and Fgf17 Fgf8 of gradients spatial and Temporal 2000. DM. Ornitz Z, Liu Xu J, approach. genetic quantitative a development: brain mouse thatmodulate genes Mapping R. 2000. Williams sections tissue to hybridization Situ in RNA by of messenger [22] Detection 1993. MA. DG, Nieto Wilkinson

Specific Press development. alveolar 342. conditiona A 2011. A. Bradley AF, PJ, Stewart Jong de M, J, Nefedov Fu P, Biggs J, Severin D, Jackson development. kidney in role essential an reveals mesoderm early of in FGF8 Inactivation M.2005. Lewandoski fibroblast growth factor family. The complete mammalian FGF family. family. FGF mammalian complete The family. growth factor fibroblast growth. and bone function of osteoblast the regulation in role signaling FGF for essential an reveals 2 receptor structures. cerebellar midline of differentiation In: . http://www.sciencedirect.com/science/article/pii/007668799325025W. 361 225, pp. Vol. Development, and whole

Mouse Brain Development (Goffinet AF, Rakic P, eds) P, Rakic AF, (Goffinet Development Brain Mouse . ity of the Fibroblast Growth Factor Family. Family. Factor Growth Fibroblast ofity the Development

l knockout resource for the genome for resource lknockout mounts. In: . . In: mounts. Development

130:3063

Biochemical and Biophysical Research C Research Biophysical and Biochemical Methods in Enzymology in Methods

132:3859 – – 3074. 373. This article is protected by copyright. Allrights reserved. –

3871.

- Development wide study of mouse gene function. . Academic Press. Guide to Techniques in Mouse in Techniques to Guide Press. Academic .

- Underwood S, Wilson C, Vainio S, Dove LF, Dove LF, S, Vainio C, Wilson S, Underwood J. Biol. Chem. Biol. J. . Springer, New York, pp. 21 pp. NewYork, . Springer,

127:1833 ommunications

271:15292 Cold Spring Harbor Laboratory Laboratory Harbor Spring Cold

J. Biol. Chem. Biol. J. – 1843. –

15297.

322:887 Nature

281:15694 – – 49. 892.

474:337

– 15700. –

Developmental Dynamics ipaig eeain f cniinl lee ( allele conditional a of generation displaying regions. indicated from PCR by amplified were Probes animals. het and WT in (right) NdeI or (left) SpeI with digested DNA with Dermo1 hindlimb zeugopods hindlimb SA- indicate bars Green sites; FRT indicate bars Red sites; LoxP indicate arrows Pink respectively. recombinase, skeleton ( and ribs, lee ( allele design and insertion into insertion and design that Validation 3 Figure of removal upon phenotypes skeletal known of Recapitulation 2 Figure the of validation and Generation 1 Figure Figure legends lin le stain blue Alcian TCre hindlimb. knockouts.

Fgf18 specific ( TCre GFP:CreERT2 ; ; flox/+ Fgf18

Fgf18 Fgf18

Cre

nciain of inactivation of of , and , Arrows indicate a characteristic bend in the radius radius the in bend characteristic a indicate Arrows D ( ) P0 P0

-/- A-E - CreER limbs kltl eet are defects Skeletal /+ ) , n=3( , TCre Fgf18 Fgf18 TCre

) or or ) T2 ed . -p , Arrow indicates indicates Arrow D: ;

. A cassette; Blue bars indicate PGK indicate Bluebars cassette; A TCre

F ; CreERT2 CreERT2/CreERT2 hl seeo o E85 mice E18.5 of skeleton whole Fgf18

J: J: TCre ) by crossing crossing by ) Fgf18

Scheme of the successfully inserted intermediate targeted allele. allele. targeted intermediate inserted successfully the of Scheme Quantification of the length of the axial skeleton skeleton axial the of length the of Quantification Fgf18 ; the

(

Fgf18 flox behaves as a functional a as behaves flox/ F-I /- Fgf18 (

+ animals. ) , respectively), , TCre . flox/+ Fgf18

A-E and control ( control and en in seen a

), n=6 ( n=6 ), genomic locus. locus. genomic ; the characteristic

: Fgf18 CreERT2

Top, Student’s t Student’s targeted allele to germline expressed FLP recombinase and CRE CRE and recombinase FLP expressed germline to allele targeted This article is protected by copyright. Allrights reserved. ( TCre

flox A

Fgf18 and G: ) /- Fgf18 Fgf18 ) hl seeo, ( skeleton, whole Arw idct kpoi, ed n h radius, the in bend kyphosis, indicate Arrows . ;

Fgf18 homozygous Fgf18 -

flox/flox bend radius. bend in the test, * test, null CreERT2 B, flox

following

; flox/

- C:

flox

neo allele E controls p -

) ). /+ mouse lines. lines. mouse

Southern blot analysis of the the of analysis blot Southern < 0.05. Error bars, mean ± SD. ± mean bars, Error 0.05. < ) n a tamoxifen a and - pA cassette pA mice mice . and A-D

Fgf18 Fgf18 eecye specific mesenchyme ;

B showing defects in ( in defects showing bowed hindlimb zeugopods hindlimb bowed Bottom, , ) Alizarin red and Alcian blue stain blue Alcian and red Alizarin

using the using knockout calvaria

A: . in WT=wild type; Het=

TCre Scheme displaying targeting vector targeting displaying Scheme Dermo1 - ( , nuil eGFP: inducible ( Fgf18 C TCre ; Fgf18 ribs ) Cre ; flox

Fgf18 Fgf18 ; A ( , - Fgf18

/+ allele ) jaw, ( jaw, ) , Fgf18 D TCre

n=5 ( n=5 frlm, n ( and forelimb, ) -/-

), . Fgf18 CreER f nciain with inactivation lox/ .

Alizarin

E, F: F: E, ; B I targeted allele, allele, targeted : F TCre Fgf18 f ) calvaria, ( calvaria, ) lox mesenchyme mesenchyme , H ,

and bowed bowed and Targetedallele/+ conditional : T2 ; ed controls, controls,

-/- Scheme Scheme Fgf18 red and red lineage ,

whole whole TCre C - E /+ ) )

; ,

Developmental Dynamics tb ( Limb paddle condensation; paddle Limb mesoderm; presomitic capsule (arrow); ( (arrow); capsule

( sb, subchondral bone; s, synovium; tb, trabecular bone. * indicates groove of Ranvier. of groove *indicates bone. trabecular tb, s, synovium; bone; subchondral sb, periosteum; p, muscle; mu, meniscus; m, plate; growth gp, bone; cortical ct, marrow; bone bm, chondrocytes; Fgf18 6 Figure Fgf18 5 Figure Fgf18 4 Figure tdTomato tamoxifen f h sae indicated. stage the of ek o ae o 1 dy ad olce a 1 wes f g. doao pfursec ad DIC and epifluorescence tdTomato age. of weeks 12 at collected microscopy and days 14 for age of weeks upstream of upstream tamoxifen

( mRNA tdTomato epifluorescence and and epifluorescence tdTomato groove of Ranvier of groove periosteum the in observed was epifluorescence D D G , ) ) ) E9.5 , tailbud; tailbud; , E , pancreas perivascular perivascular pancreas CreERT2 CreERT2 CreER 10.5

E ( + T2

( daily from P5 to P8 and were collected were and P8 to P5 from daily al fo P t P ad ee olce a P. tdTomato P9. at collected were and P8 to P5 from daily tg E cells in the periosteum. Arrowhead indicates tdTomato indicates Arrowhead periosteum. the in cells 8.0

CreER H expression in postnatal visceral organs. organs. visceral postnatal in expression expression in skeletal tissue. tissue. skeletal in expression ) expression in during embryogenesis. embryogenesis. during in expression showing , ad E12.5 and , ) trigeminal ganglion. trigeminal , and E1 and , ( A ) B ( , E , T2 ) pulmonary mesothelial mesothelial pulmonary ) B’, B’, .

9.5 G- tdTomato 3 dc asterisk) .5 (

I: , ( B Arrows Arrows (

cells digit condensation; digit Whole mount tdTomato tdTomato mount Whole ) I F lj ) , and E12.5 and , , ) in lower jaw; jaw; lower Fgf18 (arrows). . Fgf18 + itlg uig ifrnil nefrne otat (DIC) contrast interference differential using histology

n brackets and el i te periosteum the in cells : Fgf18 CreERT2/+ CreERT2/+ ( mhb Bd, bile duct; pv, portal vein. Dapi (Blue) Dapi vein. pv,portal duct; bile Bd, C This article is protected by copyright. Allrights reserved. CreERT2/+ ) A-

cells wild type type wild embryos. ; ROSA ; , C: dr mid

, Fgf18 ; ROSA ; ( niae oaie expression. localized indicate (arrow) and alveolar mesenchyme (arrowhead); ( (arrowhead); mesenchyme alveolar and (arrow) digit ray; digit - A, B, C B, A, fluorescence fluorescence

hindbrain; nt hindbrain; A- at P9 at A- tdTomato/+

C: embryos. CreERT2/+ Note: The The Note: D:

tdTomato/+ ( Whole

) Fgf18 drg, drg, A- ( , articular surface articular ,

embryos A’’ D ROSA ; ) dorsal root ganglion; ganglion; root dorsal , - D- )

of mice induced 24 hr before collection at E at collection before hr 24 induced mice of mount mount CreERT2/+ , P2 , lineage neural tube; tube; neural n atclr surface articular and Fgf18 F: +

cells at the articular surface. articular the at cells 1 ( 1 Whole mountWhole . tdTomato/+ All embryos are shown laterally and are and laterally shown are embryos All +

; ROSA ; n situ in CreERT2 B xrsig el icue ( include: cells expressing mice were given tamoxifen chow at 8 8 at chow tamoxifen given were mice , B’ , (

) op

, or ,

lineage lineage A’, C’ A’, lee otis a contains allele yrdzto ( hybridization tdTomato/+ , a, .

otic pit; pit; otic P56 Scale bar Scale e ) GFP fb lati; apsm allantois; , meniscus ,

Scale bar Scale mice were injected with with injected were mice ( ,

( mice were injected with with injected were mice forebrain; fe forebrain; microscopy C

D’ s, , C’ , fluorescence ) , 100 , somite or somites; somites; or somite . Arrow indicates indicates Arrow . ) and imaged for for imaged and ) WISH , 100 n (

µm.

A’’ eGFP fused fused eGFP ac, articular articular ac, C ) . , A ) liver )

), and the and ), , tdTomato tdTomato µm. for femur; femur;

) splenic splenic )

anterior anterior in E in (

Fgf18

grey

and and 8 8.0 lc .5 ) ,

Developmental Dynamics yohlmc ayye ad pre pnya cls f h tid ventricle third the of cells ependymal sparse and tanycytes hypothalamic ( habenula L’,: and G A’ visualization. regional aid to atlases brain from Photomicrographs weeks two for age of weeks 9 at chow tamoxifen given were mice Fgf18 8 Figure Fgf18 7 Figure chow at 8 w 8 at chow srcts ( astrocytes and their neurite trajectory neurite their and include: GFAP include: (arrowhead) cells interstitial neurons in the anterior olfactory cortex ( cortex olfactory anterior the in neurons J’ ( recess tubule cells (arrowhead); ( (arrowhead); cells tubule

D ) slnc asl (ro) n prvsua (roha) el; ( cells; (arrowhead) perivascular and (arrow) capsule splenic ) ); ); son n eieto; neir latr bls ( bulbs olfactory anterior hemisection; in shown , ventricular ependymal cells, adjacent to the medial habenula ( habenula medial the to adjacent cells, ependymal ventricular CreERT2 CreER H

. ), near the cerebellum; the near ),

T2 Atlas images Atlas 25 25

G- ; ( ee expression in adult visceral organs. organs. visceral adult in expression express µ E G’’ + ks of age for 7 days and collected at 10 w 10 at collected and days 7 for age of ks m in G’ and M and G’ in m ) in astroc hepatic mesothelial cells mesothelialhepatic cells ; tog n seii epeso i te cho the in expression specific and strong ); h vsua wl (ro) ( (arrow); wall vascular the n cls n ter uaie ecnat in descendants putative their and cells ing y tes of tes are G . Lines indicate structures. Scale bars: 100 100 bars: Scale structures. indicate Lines ) cardiac valve interstitial cells. Dapi (Blue) cells. valve interstitial cardiac ) from

- the O. O.

the v Glia limit Glia medial and lateral walls of the lateral lateral the of walls lateral and medial , ventricle; h, hippocampus; cp, choroid plexus; m plexus; choroid cp, hippocampus; h, ventricle; ,

Mouse Brain Library ( Library Brain Mouse M-O This article is protected by copyright. Allrights reserved. (arrow); ( (arrow); ans ( ans ) . Arrows . D B- ) pulmonary mesothelial (arrow) and alveolar interstitial cells cells interstitial alveolar and (arrow) mesothelial pulmonary ) A- B’’’ F G: ) ); rare non rare ); kidney

Fgf18 , L’ L, and arrow heads arrow and

ee http://www.mbl.org/mbl_main/atlas.html ks of age. of ks ), near rostral migratory stream cells; scattered scattered cells; stream migratory rostral near ),

CreERT2/+ mesothelial cells mesothelial ro -

pyramidal ( pyramidal id plexus of the forth ventricle’s ventricle’s forth the of plexus id h aut brain. adult the B E ; ROSA ; and collected at 12 weeks of age. of weeks 12 at collected and s ) ), with no expression in the hippocampus; hippocampus; the in expression no with ), B- µ .

m in B, C, D, E, F, J and L; 50 50 L; and J F, E, D, C, B, in m elect epicardial epicardial elect tdTomato , , L J, H, Scale bar Scale

ventricles in (M, in tdTomato/+

C (3v)

) and pyramidal cortical neurons cortical pyramidal and ) (arrow) and and (arrow) -

O: N) +

al ( wall expressing cells include: ( include: cells expressing 100 Fgf18 and rare septal neurons ( neurons septal rare and indicate tdTomato indicate tdTomato

mice were were mice .e.

µm. , median eminence; hb, eminence; median , cells F CreERT2/+ ; ar f GFAP of pair );

occasional epithelial occasional + arw; ( (arrow);

expressing cells cells expressing given ROSA ; ).

(4v)

tamoxifen tamoxifen +

µ C

neurons neurons m in B’, B’, in m A, I, K: K: I, A, tdTomato/+ ) lateral lateral + aorta aorta

pial A J, J, ,

AcceptedDevelopmental DynamicsArticle

This article is protected by copyright.

AcceptedDevelopmental DynamicsArticle

This article is protected by copyright.