Contribution of Fibroblast Growth Factor 18

Developmental Biology 285 (2005) 496 – 507 www.elsevier.com/locate/ydbio

Glycogen synthase kinase 3 controls endochondral bone development: Contribution of fibroblast growth factor 18

Ravi M. Kapadia, Anyonya R. Guntur, Martina I. Reinhold, Michael C. Naski*

Department of Pathology, University of Texas Health Science Center at San Antonio, 7703 Floyd Curl Dr., San Antonio, TX 78229-3900, USA

Received for publication 4 March 2005, revised 24 June 2005, accepted 25 July 2005 Available online 18 August 2005

Abstract

Glycogen synthase kinase 3 (GSK3) inhibits signaling pathways that are essential for bone development. To study the requirement for GSK activity during endochondral bone development, we inhibited GSK3 in cultured metatarsal bones with pharmacological antagonists. Interestingly, we find that inhibition of GSK3 strongly repressed chondrocyte and perichondrial osteoblast differentiation. Moreover, chondrocyte proliferation was inhibited, whereas perichondrial cell proliferation was stimulated. These results mirror the effects of fibroblast growth factor signaling (FGF), suggesting the FGF expression is induced. Indeed, we showed that (1) FGF18 expression is stimulated following inhibition of GSK3 and (2) GSK3 regulates FGF18 expression through the control of h-catenin levels. Stimulation of cultured metatarsal with FGF18 had similar effects on the differentiation and proliferation of chondrocytes and perichondrial cells as GSK3 repression. This suggests that the regulation of FGF18 expression is a major function of GSK3 during endochondral bone development. Consistent with this, we showed that the effect of GSK3 inhibition on chondrocyte proliferation is repressed in tissues lacking a receptor for FGF18, FGF receptor 3. D 2005 Elsevier Inc. All rights reserved.

Keywords: Glycogen synthase kinase; FGF18; Bone; Cartilage; Chondrocyte; h-catenin

Introduction development. For example, Indian hedgehog is vital for chondrocyte and osteoblast differentiation (Lanske et al., Endochondral bone formation is an exquisitely controlled 1996; St-Jacques et al., 1999; Vortkamp et al., 1996). Also, process requiring both chondrocyte and osteoblast differ- the transcription factor nuclear factor of activated T-cells entiation. During this process, chondrocytes sequentially (NFAT) performs important functions during cartilage gene differentiate through a series of stages to eventually become expression and the differentiation of chondrocyte precursors hypertrophic chondrocytes. Cells in the surrounding peri- (Tomita et al., 2002). Additionally, canonical Wnt signaling chondrium differentiate in step with the chondrocytes and through h-catenin is required for normal chondrocyte and eventually form osteoblasts, which secrete a collar of bone osteoblast differentiation (Akiyama et al., 2004; Guo et al., around the chondrocytes (Ballock and O’Keefe, 2003; 2004; Hu et al., 2005). Significantly, each of these disparate Kronenberg, 2003; van der Eerden et al., 2003). The pathways is regulated by a common kinase, glycogen molecular events that control endochondral bone develop- synthase kinase 3 (GSK3). ment are incompletely understood. However, genetic and GSK3 is a ubiquitously expressed kinase that regulates biochemical studies have defined certain signaling and diverse cellular processes ranging from metabolism to cell transcriptional pathways as essential for endochondral fate specification (Cohen and Frame, 2001). Though first described as the kinase that regulates glycogen synthesis (Hemmings et al., 1981), GSK3 is now recognized to * Corresponding author. Fax: +1 210 567 4819. regulate developmental pathways including Wnt and hedge- E-mail address: [email protected] (M.C. Naski). hog signaling pathways. Hedgehog signals through the

0012-1606/$ - see front matter D 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ydbio.2005.07.029 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 497 smoothed/patched receptor complex and stimulates the from Sigma (St. Louis, MO); FGF18 Peprotech (Rocky activity of the transcription factor cubitus interruptus (Gli Hill, NJ). is the vertebrate ortholog). GSK3 inhibits hedgehog signaling by phosphorylating cubitus interruptus, thereby induc- Metatarsal cultures ing conversion to a transcriptional repressor (Jia et al., 2002; Price and Kalderon, 2002). GSK3 also inhibits the tran- Metatarsals were dissected from 15.5 day C57Bl/6 or scription factor NFAT. Phosphorylation of the amino- FGF receptor 3 null embryos and cultured in serum free terminal regulatory domain by GSK3 results in nuclear alpha MEM (Invitrogen) containing with 0.005 mg/ml export of NFAT (Okamura et al., 2000), thereby inhibiting ascorbic acid, 0.3 mg/ml l-glutamine, 0.05 mg/ml genta- transcriptional activity. Wnt signaling is antagonized by micin, 1 mM h-glycerophosphate and 0.2% bovine serum GSK3 through phosphorylation of h-catenin. h-catenin albumin. The genotyping of FGF receptor 3 mice was done phosphorylation results in ubiquitin-dependent degradation as previously described (Colvin et al., 1996). Tissue through the proteosome. Because each of these signaling explants were grown at 37-C in a humidified 5% CO2 cascades is essential for bone and cartilage differentiation, incubator. To ensure that comparison was made between we hypothesize that GSK3 activity must be tightly regulated samples with equivalent states of differentiation, the tissues during endochondral bone development. were maintained as right and left pairs from a given embryo Unlike many kinases, GSK3 is constitutively active. and cultured in neighboring wells of a 24 well cluster plate. Additionally, while many kinases are activated following All comparisons were made using matched pairs. For stimulus-dependent phosphorylation, GSK3 is inactivated histological analyses, the samples were paraffin embedded following phosphorylation. Several kinases including PKA, following fixation in 4% buffered paraformaldehyde for 1 h p70S6 kinase, AKT and others catalyze phosphorylation of at room temperature. a serine residue near the amino-terminus of GSK3 (Cross et al., 1995; Fang et al., 2000; Stambolic and Woodgett, 1994). Cell culture and transfection This phosphoserine then binds to the active site and strongly inhibits GSK3 (Frame et al., 2001). Wnt signaling through MC3T3E1 (clone 4; Wang et al., 1999) was obtained from disheveled also inhibits GSK3, although the mechanism of the ATCC (Manassas, VA), cultured in a-MEM containing inhibition is not entirely clear. Therefore, a large number of 10% fetal bovine serum (Hyclone), 2 mM l-glutamine, signaling pathways and extracellular ligands all inhibit the penicillin G (100 units/ml) and streptomycin (100 Ag/ml) activity of GSK3. Because GSK3 is a constitutive kinase at 37-C in a humidified 5% CO2 incubator. All cells were that is exclusively regulated through repressor pathways, we transfected in triplicate using a modified calcium phosphate reasoned that we could best understand the function of precipitate and assayed for luciferase or h-galactosidase GSK3 in endochondral development by repressing GSK3 activity as previously described (McEwen et al., 1999; activity. To investigate the requirement for GSK activity Reinhold et al., 2004b). The FGF18 luciferase plasmid during endochondral bone development, we used the phar- contained a 3.4 kb MscI fragment of the mouse FGF18 macological antagonists of GSK3, lithium and SB216763 gene (extending from approximately À3.3 kb relative to (Coghlan et al., 2000; Stambolic et al., 1996). We find that the transcriptional start site) cloned into pGL3basic GSK3 activity is essential for endochondral bone develop- (Promega). ment. Inhibition of GSK3 with SB216763 repressed chondrocyte and osteoblast differentiation in cultured metatarsals Immunofluorescence from mouse embryo. Significantly, GSK3 repression induces fibroblast growth factor 18 (FGF18) expression and in 4 Am paraffin sections were warmed to 70-C for 10 min, turn, FGF18 repressed chondrocyte and osteoblast differ- then deparafinized and re-hydrated with a graded alcohol entiation. These results suggest a pathway whereby GSK series. Antigen retrieval was done for 20 min in 10 mM pH regulates endochondral bone development through the 6.0 citrate buffer heated to 95-C prior to immersion of the control of FGF18 expression. In support of this, we showed slides. Thereafter, the slides were washed with phosphate that effects on GSK3 on chondrocyte proliferation are buffered saline (PBS) and blocked in 1% fraction-V heat absent in metatarsal lacking the FGF18 receptor, fibroblast shock treated bovine serum albumin (Fisher), 5% normal growth factor receptor 3. goat or rabbit serum (Jackson ImmunoResearch Laborato- ries), 0.1% Triton X-100, in PBS. After 1 h, the blocking buffer was removed and replaced with 50 Al of blocking Materials and methods buffer containing the primary antibody (h-catenin Santa Cruz, sc7963 or N-cadherin, Transduction Labs, 610920) at Reagents a 1:200 dilution. Slides remained in the humidified chamber and incubated at 4-C overnight. The slides were Reagents were purchased from suppliers as follows: washed three times with PBS containing 0.1% TX-100 and SB216763 from Tocris (Cookson, MO); lithium chloride then blocked for 1 h at room temperature. Secondary 498 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 antibody was applied (CY3-goat anti-mouse, Jackson an anti-BrdU antibody (Sigma B-2531). The labeling ImmunoResearch Laboratories) for 1 h at room temperature index was calculated by counting the number of BrdU- at a 1:800 dilution. The samples were washed three times in labeled nuclei and divided by the total number of cells PBS and mounted with Pro-Long Anti-fade reagent within a grid drawn using Photoshop (Adobe). Equal (Molecular Probes). Images were obtained with a Zeiss areas of chondrocytes were counted in the control and Axioscope 2 fitted with 40Â (NA 1.3) and 63Â (NA 1.4) treatment groups. For perichondrial cells, the entire objectives. Deconvolution was done using Zeiss Axiovision perichondrium was counted. P values were determined software. using a paired Student’s t test. The null hypothesis was rejected for P < 0.05. BrdU labeling Real time quantitative PCR Tissues were pulse-labeled with 10 AM 5-bromo-2- deoxyuridine (Sigma) for 3 h. Tissues were then washed Total RNA was extracted by homogenizing metatarsals with PBS, paraffin embedded and sectioned to 4 Am. using RNA-Bee (Tel-Test, Inc.) according to the manufac- Slides were deparafinized, hydrated and immersed for 30 turer’s protocol. One microgram of RNA was reverse min in PBS containing 10% methanol and 3% hydrogen transcribed in 25 Alat42-C for 2 h using TaqMan reverse peroxide. After washing with PBS, the tissues were transcription reagents with random hexamers according to digested with 400 Ag/ml pepsin (Sigma) containing 0.01 manufacturer directions (Applied Biosystems). Quantitative N HCl for 30 min at room temperature, neutralized for 10 PCR was performed in the ABI Prism 7000 Sequence min in 0.1 M borate pH 8.5, then rinsed with PBS. BrdU Detection System according to manufacturer’s directions was detected with the Vectastain ABC kit (Vector Labs (Applied Biosystems). 25 Al PCR reactions were made of PK-4002) according to the manufacturer’s protocol using SYBR Green 2Â PCR Master Mix (Applied Biosystems), 5 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 499

Fig. 1. Endochondral bone development in cultured mouse metatarsals. (A) 15.5 day mouse embryo metatarsals undergo development in culture. Left panel shows the tissue at the beginning of the culture period. Middle panel after 4 days in culture. Left panel shows that indirect immunofluorescence for N-cadherin identifies mature osteoblasts at sites of bone formation. Osteoblasts joined by N-cadherin containing adherens junctions develop in concert with chondrocyte hypertrophy. The figure shows the pseudocolored (red) fluorescence signal for N-cadherin overlaid on DIC images. (B) Control samples show the domainof chondrocyte hypertrophy and arrowheads indicate the osteoid bone collar. Right and left panels were obtained with 10Â or 20Â objectives, respectively. (C) Treatment of metatarsal cultures for 48 h with 15 mM lithium chloride repressed chondrocyte hypertrophy. Right and left panels were obtained with 10Â or 20Â objectives, respectively. (D) Chondrocyte hypertrophy is absent in metatarsal cultures treated for 48 h with 20 AM SB216763. Also note the absence of a bone collar. (E) In situ hybridization for collagen type X. Pseudo-colored (green) dark-field images are overlaid bright field images to show repressed chondrocyte hypertrophy in the sample treated with 15 mM lithium chloride. (F) Inhibition of GSK3 represses osteoblast differentiation. Indirect immunofluorescence for N-cadherin highlights osteoblasts at the site of bone collar synthesis adjacent to hypertrophic chondrocytes. N-cadherin linked osteoblasts are absent in the sample treated with 20 AM SB216763. The figure shows the pseudocolored (red) fluorescence signal overlaid on DIC images. (G) In situ hybridization for collagen type I. Pseudo-colored (green) dark-field images are overlaid bright field images to show repressed osteoblast differentiation in the sample treated with 20 AM SB216763. The figures show representative results from 4 independent experiments. pmol of each forward and reverse primer and 3 Al of cDNA. ATTGTGGAGACCGATACTTTTG-3V,5V-GCCGTTGCT- Cycling conditions were 50-C for 2 min, 95-C for 10 min CTTGGCAATT-3V;FGF9-5V-ATCTTCCCCAACGGTAQ followed by 40 cycles of 15 s at 95-C and 60 s at 60-C. CTATCCA-3V;5V-CTCGTTCATGCCGAGGTAGAGT-3V; Primers were designed using PrimerExpress (Applied Bio- FGF10- 5V-AGTGCGGGAAGGCATGTG-3V,5V-CTCCGA- systems). Oligonucleotides used were as follows: FGF1- 5V- TTTCCACTGATGTTATCTC-3V; FGF11- 5V-TCCTTCAC- CGGCTCGCAGACACCAA-3V,5V-ACCAGTTCTTCTCC- CCACTTCAATCTGA-3V,5V-TGAAATGTGGCGAGCTGQ GCATGCT-3V; FGF2- 5V-GGACCCCAAGCGGCTCTA-3V, TACA-3V; FGF12- 5V-AACCCCAGCTGAAAGGGATT-3V, 5V-CCTCTCTCTTCTGCTTGGAGTTGT-3V;FGF3-5V- 5V-GCCACCACACGCAGTCCTA-3V;FGF13-5V-AGGAGA- GTGAACGGCAGCCTTGAGA-3V,5V-CAGGTACCGC- CCAGAGCCTCAGCTT-3V,5V-CGTCTTTGGTGCCATC- CCAGAAAAGA-3V; FGF4- 5V-CGAGGCGTGGTGAGC- AATG-3V;FGF14-5V-GCTCTCGATGGAACCAAGGA-3V, ATCT-3V,5V-CGTTGTAGTTGTTGGGCAGAAGT-3V; 5V-TTGCTATGTACAACCCTGTCTTCAC-3V; FGF18- 5V- FGF7- 5V-TGAAGAACAGCTACAACATCATGGA-3V,5V- ACTGCTGTGCTTCCAGGTTC-3V,5V-CCCAGGACTTG- TCAGTTCTTTGAAGTTGCAATCCT-3V; FGF8- 5V-CTC- AATGTGCTT-3V;FGF20-5V-GGATCACAGTCTCTTCGG- 500 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507

TATCCT-3V,5V-TTTGTCATTCATCCCAAGGTACAG-3V; the absence of a collar of woven bone surrounding the FGF22- 5V-CTTCTCCTCCACTCACTTTTTCCT-3V;5V-GCC- hypertrophic chondrocytes (compare the right panels of TGAGTACACAGCTTTGATCAC-3V; aggrecan- 5V-ACTG- Figs. 1B and D), the absence of osteoblasts containing N- CAGCGATGACCCTC-3V,5V-GGAATCCCTAGCTGCTTCQ cadherin organized into adherens junctions (Fig. 1F) and G-3V; collagen II- 5V-GAAGGTGGAAAGCAAGGTGA-3V, dramatically reduced expression of type I collagen (Fig. 5V-CATCAGTACCAGGAGTGCCA-3V; conduction- 5V-AA- 1G). Note that scattered chondrocytes contain detectable AACGGATTCAGGTCCTTCAA-3V;5V-GTCAGTGCGTC- levels of N-cadherin following treatment with SB216763. GCTGGATAAC-3V; Indian hedgehog- 5V-CAATCCCGAQ Immature chondroblasts express N-cadherin (Oberlender CATCATCTTCA-3V;5V-GCGGCCCTCATAGTGTAAAG-3V. and Tuan, 1994a,b). The presence of N-cadherin in these cells reflects the strong repression of differentiation and In situ hybridization immature phenotype of these cells. To further characterize the effects of GSK3 on chon- 4 Am sections of paraffin embedded tissues were pro- drocyte differentiation, we performed quantitative RT-PCR cessed, hybridized and washed according to the mRNA with RNA extracted from metatarsals. Corroborating the in locator protocol (Ambion). The FGF18 (gift from D. Ornitz, situ hybridization data of Fig. 1E, inhibition of GSK3 St. Louis, MO) and collagen type X (B. Olson Boston, MA) repressed the expression of type X collagen greater than riboprobes were labeled as previously described (Naski 3000-fold as measured by quantitative real time PCR (data et al., 1998). not shown). Also, other chondrocyte-specific genes were inhibited. The expression of both type II collagen and aggrecan was dramatically repressed following inhibition of Results GSK3 (Fig. 2). Also, the expression of Indian hedgehog and patched, the hedgehog receptor, was repressed in these To understand how GSK3 controls endochondral bone samples. Because patched is both a receptor and transcrip- formation, we studied the differentiation of mouse embryo tional target of Indian hedgehog, these findings suggest that metatarsals in organ culture. This is an established method hedgehog signaling was repressed. Notice that the expres- for investigating the differentiation of chondrocytes and sion of conductin, a transcriptional target of h-catenin (Jho osteoblasts during endochondral bone development (Die- et al., 2002), was induced following inhibition of GSK3. udonne et al., 1994; Serra et al., 1999). Mouse metatarsal To investigate if GSK3 also regulated cell prolifer- bone rudiments were prepared from 15.5 day embryos and ation, we performed bromodeoxyuridine (BrdU) labeling cultured in serum-free medium. At the time of isolation, the experiments. Metatarsal samples were treated with the bone rudiments contain immature chondrocytes surrounded by a sheath of undifferentiated perichondrial cells (Fig. 1A). Osteoblasts and hypertrophic chondrocytes are absent. After 3–4 days in serum-free medium, chondrocyte hypertrophy begins (Fig. 1A). Simultaneously, cells in the perichondrium differentiate into osteoblasts and secrete a collar of woven bone around the hypertrophic chondrocytes. The mature osteoblasts synthesizing the collar of bone are identified by the presence of N-cadherin organized into adherens junctions (Fig. 1A). To investigate how GSK3 regulates endochondral bone formation in metatarsals, we used specific pharmacological antagonists of GSK3. GSK3 is a constitutive kinase that is regulated through repressor pathways. Therefore, we modeled the regulation of GSK3 using the pharmacological inhibitors lithium and SB216763. Interestingly, endochondral bone development was strikingly inhibited following inhibition of GSK3 with either lithium or SB216763 for 48 h. This was evidenced by substantial or complete inhibition Fig. 2. Real time RT-PCR measurement of gene expression in cultured of chondrocyte hypertrophy in the samples treated with the metatarsals. Relative expression determined by quantitative real time PCR GSK3 inhibitors lithium and SB216763 (Figs. 1B–D). And of the aggrecan (agg), type II collagen (col2), Indian hedgehog (Ihh), is further evidenced by the repression of type X collagen patched (ptc) and conductin. RNA harvested from metatarsals cultured 48 h expression, a marker for hypertrophic chondrocytes (Fig. in the presence or absence of 20 AM SB216763 was reverse transcribed with random hexamers. Expression levels were normalized to the 18s rRNA 1E). In addition to the inhibition of chondrocyte differ- internal control. The expression levels for each pair are relative to each entiation, we observed a concomitant inhibition of peri- other with the lesser sample defined as one. The results show representative chondrial osteoblast differentiation. This was evidenced by results of two independent samples. R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 501

GSK3 inhibitor SB216763 and thereafter pulsed with hypertrophic chondrocytes in samples without the GSK3 BrdU for 3 h. Proliferating cells were identified by inhibitor (Fig. 4D). Because inhibition of GSK3 by immunostaining for BrdU. Interestingly, inhibition of SB216763 results in stabilization of h-catenin (hcat) and GSK3 had opposite effects on chondrocyte and perichon- increased levels of hcat protein (data not shown), we drial cell proliferation (Fig. 3). Inhibition of GSK3 hypothesized that hcat is essential for induction of FGF18 repressed chondrocyte proliferation (Fig. 3B), whereas expression. To determine if hcat regulates the transcription of perichondrial cell proliferation was stimulated following FGF18, we performed experiments using the immature inhibition of GSK3 (Fig. 3C). Significantly, these data osteoblast cell line MC3T3E1. Fig. 5A shows that inhibition showing inhibition of chondrocyte differentiation and of GSK3 induces FGF18 in MC3T3E1 cells. To determine if proliferation resemble the effects of FGF signaling in hcat-dependent transcription is activated in response to cartilage (Deng et al., 1996; Kato and Iwamoto, 1990; Li inhibition of GSK3, we used TOPFLASH, a luciferase et al., 1999; Naski et al., 1998) and are similar to results reporter requiring h-catenin/TCF for activation (Korinek et obtained when bone explants are stimulated with FGF al., 1997). We found that TOPFLASH activity is stimulated in (Mancilla et al., 1998). a dose-dependent manner by SB216763 (Fig. 5B). To Because these results suggest augmented FGF signaling, determine if the FGF18 promoter is stimulated by hcat, cells we hypothesized that inhibition of GSK3 stimulates FGF were transfected with a luciferase reporter containing 3.4 kb expression. To test this, we determined FGF expression by of the proximal FGF18 promoter. Significantly, the FGF18 quantitative real time PCR. Interestingly, we observed that promoter was induced when hcat-dependent activity was FGF13 and FGF18 were substantially induced following the stimulated by either inhibition of GSK3 with SB216763 or inhibition of GSK3 (Fig. 4A). The induction of FGF18 is co-transfection of a stabilized form of hcat (Figs. 5C and D). intriguing because FGF18 is an essential regulator of These data support the conclusion that inhibition of GSK3 endochondral bone development (Liu et al., 2002; Ohbaya- induces FGF18 gene expression through upregulation of hcat shi et al., 2002). To further define the effects of GSK3 on levels. FGF expression, we performed in situ hybridization for We showed that inhibition of GSK3 stimulated FGF FGF18. Consistent with the quantitative PCR results, expression and repressed chondrocyte differentiation and FGF18 expression was induced following treatment with proliferation. To determine if these findings may be linked, the GSK3 inhibitor, SB216763 (Figs. 4B and C). Signifi- we investigated whether the effects of FGF18 on metatarsal cantly, FGF18 expression is most abundant in the perichon- rudiments phenocopy the effects of GSK3 inhibition. drial cells. This coincides with perichondrial regions wherein Interestingly, we observed similarities between inhibition h-catenin levels are strongly upregulated adjacent to the of GSK3 and activation of FGF signaling with FGF18.

Fig. 3. Inhibition of GSK3 inhibits chondrocyte proliferation, but augments perichondrial cell proliferation. (A) DIC images of BrdU immunohistochemistry showing labeling of chondrocyte and perichondrial cells from control (left panel) or 20 AM SB216763 (right panel) treated samples following 48 h treatment. (B) Chondrocyte proliferation after treatment with 20 AM SB216763 for 48 h as measured by the fraction of BrdU-labeled chondrocyte nuclei. The null hypothesis was rejected with P = 0.01. (C) Perichondrial cell proliferation after treatment with 20 AM SB216763 for 48 h as measured by the fraction of BrdU- labeled nuclei. The null hypothesis was rejected with P < 0.01. The figures show representative results from 3 independent experiments. 502 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507

Fig. 4. Inhibition of GSK3 stimulates FGF18 expression. (A) Survey of FGF expression by real time quantitative RT-PCR. Relative FGF expression using RNA isolated from samples cultured 48 h in the presence or absence of 20 AM SB216763. FGF expression levels were normalized to the 18s rRNA internal control. Expression levels for each pair (with or without SB216763) are relative to the control sample (defined as one). The results show representative results of two independent samples. (B and C) In situ hybridization for FGF18 in metatarsals cultured in the presence or absence of 20 AM SB216763 for 48 h. Results show the overlay of pseudocolored (green) dark-field images on bright field images. (D) Indirect immunofluorescence of h-catenin. The fluorescence signal for h-catenin is overlaid to the DIC image showing upregulation of beta-catenin in the perichondrial layer. Sample was cultured without SB216763.

Stimulation of metatarsals with FGF18 inhibits both chon- in part caused by the induction of FGF expression. To better drocyte proliferation and differentiation. This is demonstra- understand the role of FGF signaling following repression ted by the inhibition of chondrocyte hypertrophy and of GSK3, we performed experiments with metatarsals from inhibition of BrdU labeling (Figs. 6AandB).Also, mice lacking FGF receptor 3 (FGFR3À/À). FGF receptor 3 perichondrial osteoblast differentiation is concomitantly is expressed in cartilage and is the major receptor for inhibited as evidenced by diminished synthesis of a collar FGF18 in cartilage. Therefore, if the induction of FGF18 of woven bone (Fig. 6A), the absence of mature osteoblasts contributes to the inhibition of endochondral development, joined by N-cadherin-containing adherens junctions (Fig. then the inhibition will be diminished in the cartilage of 6C) and strong repression of type I collagen expression (Fig. FGFR3 null mice. Consistent with this, we find that in the 6D). Also, FGF18 stimulated perichondrial cell proliferation absence of FGFR3 chondrocyte proliferation was not (Fig. 6B, right), similar to inhibition of GSK3. repressed when GSK3 is inhibited. Fig. 7A shows that as These findings suggest that the repression of endochon- observed previously chondrocyte proliferation is inhibited dral bone development resulting from inhibition of GSK3 is when GSK3 is inhibited in heterozygous mice. However, R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 503

Fig. 5. Induction of FGF18 expression. (A) Induction of FGF18 expression in MC3T3E1 immature osteoblasts after inhibition of GSK3 with 18 AM SB216763 for the indicated times. Expression levels were determined by real time RT-PCR. (B) Activation of TOPFLASH luciferase in MC3T3E1 osteoblasts after treatment with the indicated concentrations of SB216763 for 24 h. (C) Inhibition of GSK3 stimulates the FGF18 luciferase promoter in MC3T3E1 osteoblasts. MC3T3E1 osteoblasts were transiently transfected with the FGF18 luciferase promoter as indicated above the panel and treated for 24 h with 20 AM SB216763. Luciferase activity was normalized to h-galactosidase activity derived from a constitutive co-transfected plasmid. (D) h-catenin activates the FGF18 promoter. MC3T3E1 osteoblasts were transiently transfected with the FGF18 luciferase promoter and a proteosome resistant form of hcat. Luciferase activity was normalized to h-galactosidase activity derived from a constitutive co-transfected plasmid. Results are representative of three independent experiments. inhibition of GSK3 does not repress chondrocyte prolifer- regulators of endochondral bone development. There are ation in metatarsals from FGFR3À/À mice. many putative substrates for GSK3 (Woodgett, 2001); however, several well-recognized substrates are central regulators of bone development. The hedgehog signaling Discussion pathway activates the transcription factor Gli. Recent data show that the Drosophila ortholog of Gli, cubitus Our data have shown that GSK3 activity is essential for interruptus, is phosphorylated by GSK3 and that this leads endochondral bone development. Inhibition of GSK3 by to the repression of Gli (Jia et al., 2002; Price and either lithium or SB216763 strongly inhibits chondrocyte Kalderon, 2002). Because hedgehog (Indian hedgehog) is and perichondrial osteoblast differentiation. Because these expressed in cartilage, we would predict extra Gli activity agents inhibit GSK3 kinase activity by different mecha- when GSK3 is inhibited. However, our data suggest less nisms yet similarly repress endochondral bone development, rather than more Gli activity. Patched is a transcription we conclude that the effects of these inhibitors are due to target of Gli (Goodrich et al., 1996) and therefore if Gli specific inactivation of GSK3 (Coghlan et al., 2000; Ryves activity is stimulated patched expression should increase and Harwood, 2001). The specificity of SB216763 has been when GSK3 is inhibited. However, we showed that patched validated by evaluation of a large panel of kinases (Coghlan expression is reduced, suggesting reduced rather than et al., 2000). increased Gli activity. Our data showing repression of Ihh Because GSK3 activity is essential for endochondral expression following treatment with the GSK3 inhibitor are bone development, certain substrates of GSK3 are vital consistent with less Gli activity. Therefore, we conclude 504 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 505

Fig. 7. (A) Inhibition of GSK3 does not repress proliferation of FGFR3À/À chondrocytes. Metatarsals were dissected from FGFR3 heterozygous (+/À) or null (À/À) embryos and cultured in the presence of absence of 20 AM SB216763 for 48 h. Thereafter, the samples were pulsed with BrdU and processed for immunohistochemistry. The null hypothesis was rejected for samples from heterozygous, but not null mice. Results are representative of two independent experiments. (B) Working model for the regulation of FGF18 expression. Inhibition of GSK3 through canonical Wnt signaling stimulates FGF18 expression via upregulation of h-catenin. Inhibition of GSK3 also promotes FGF18 expression by maintaining calcineurin-dependent NFAT activity. The induction of FGF18 expression represses chondrocyte proliferation through the action of the principle fibroblast growth factor receptor of cartilage, FGFR3. Simultaneously, perichondrial cell proliferation is stimulated following activation of fibroblast growth factor receptors 1 and 2 (FGFR1). that Gli does not appear to be the dominant substrate of that NFAT may be an important substrate of GSK3 during GSK3 in these experiments. The inhibition Ihh expression endochondral bone development. However, NFAT tran- may contribute to the regulation of osteoblast differ- scriptional activity requires an additional calcium-depend- entiation. Osteoblast differentiation is absent in IhhÀ/À ent stimulus that dephosphorylates NFATs via the protein mice (Chung et al., 2001; St-Jacques et al., 1999), phosphatase calcineurin. We showed that TGFh induces suggesting that the reduction of Ihh expression following FGF18 activation through a calcium-dependent pathway inhibition of GSK3 contributes to the repression of (Reinhold et al., 2004a). In addition, data showing that osteoblast differentiation. TGFh represses chondrocyte differentiation during endo- The transcription factors, nuclear factor of activated T- chondral ossification suggest that a TGFh family member cells are also GSK3 substrates that may regulate may be induced in metatarsal bone rudiments (Bohme et chondrocyte differentiation, given that we previously al., 1995; Dieudonne et al., 1994; Serra et al., 1999). showed that NFAT stimulates chondrogenesis (Tomita et Therefore, we investigated if TGFh expression is induced al., 2002). Because phosphorylation of NFAT by GSK3 by GSK3 inhibition. We did not observe changes in the inhibits NFAT activity (Beals et al., 1997; Neal and expression of TGFh1, 2 or 3 by QPCR (data not shown). Clipstone, 2001), we hypothesize that NFAT activity is However, our analyses of RNA extracted from the entire augmented in metatarsals wherein GSK3 is inhibited. In metatarsal may not detect a significant induction of TGFh published work, we show that FGF18 expression is in a discreet population of cells. Further studies will be induced through NFAT-dependent pathways (Reinhold et required to determine if TGFh or another pathway such as al., 2004a). Significantly, we now show that FGF18 is the Wnt-calcium pathway can stimulate NFAT activity in induced in response to GSK3 inhibition. This suggests developing endochondral bone. Interestingly, NFAT activ-

Fig. 6. Effects of FGF18 on endochondral development. (A) H & E stained sections of metatarsals treated for 48 h with 800 ng/ml FGF18 (bottom panel). (B) Effects of FGF18 on chondrocyte (left panel) and perichondrial cell (right panel) proliferation. Samples were treated with 800 ng/ml FGF18 for 48 h, pulsed with BrdU and then processed for immunohistochemistry. The fraction of labeled nuclei was measured and the null hypothesis was rejected at the indicated P values. (C) Repression of osteoblast differentiation after treatment with 800 ng/ml FGF18. Mature osteoblasts are detected by immunofluorescence for N- cadherin. The control samples (top) show N-cadherin immunofluorescence in cells adjacent to hypertrophic chondrocytes. Left panels show the fluorescence signal. Right panels show the pseudocolored signal overlaid to the DIC image. FGF18 treated samples (bottom) lack N-cadherin signals via immunofluorescence. (D) In situ hybridization for collagen type I. Pseudo-colored (green) dark-field images are overlaid bright field images to show repressed osteoblast differentiation in the sample treated with 800 ng/ml FGF18. 506 R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 ity can be stimulated by Wnt signaling (Saneyoshi et al., increased chondrocyte proliferation (Liu et al., 2002; 2002), therefore, Wnt-calcium signaling is a potential Ohbayashi et al., 2002). These results indicate that NFAT activator. FGF18 inhibits endochondral differentiation. This is hcat is a GSK3 substrate that also has dramatic effects on further evidenced by our results showing that FGF18 bone and cartilage differentiation. Phosphorylation of hcat by repressed chondrocyte and osteoblast differentiation and GSK3 causes degradation by the proteosome. Wnt signaling inhibited chondrocyte proliferation. These data mirror the represses proteolysis of hcat by inhibiting GSK3. Therefore, effects on GSK3 inhibition on cultured metatarsals. Given the inhibition of GSK3 by SB216763 can simulate the effects our data showing that FGF18 is induced following GSK3 of Wnt signaling during endochondral development. The inhibition, we conclude that GSK3 is an essential regulator effects of Wnt signaling on chondrocytes are complex. Both of FGF18 expression and that FGF18 is an important inhibition and stimulation of differentiation have been downstream mediator of the effects of GSK3 in endochon- observed. Forced expression of Wnt-5a in developing dral bone development. We showed that FGF18 expression chicken limbs slowed the maturation of chondrocytes as is induced by hcat, suggesting that canonical Wnt signal- evidenced by diminished expression of type X collagen ing induced FGF18. Interestingly, the induction of FGF (Hartmann and Tabin, 2000). Similar results are obtained expression through Wnt signaling is essential at several when either Wnt5a or Wnt5b is expressed in cartilage of mice steps of skeletal development. For example, the anatomical (Yang et al., 2003). Surprisingly, Wnt5a null mice show the site of limb initiation is determined by a Wnt-FGF same phenotype of delayed chondrocyte differentiation as signaling relay. Wnt2b is expressed in the intermediate mice overexpressing Wnt5a (Yang et al., 2003). Moreover, mesenchyme of the developing embryo and induces Wnt 4 expression accelerates chondrocyte hypertrophy FGF10 expression in the adjacent lateral plate mesen- (Hartmann and Tabin, 2000). These data show that Wnts chyme. This relay determines the site for limb develop- can both inhibit and stimulate endochondral bone development as demonstrated by ectopic limbs that result from ment. Forced expression of Wnt14 in chondrocytes of mice forced expression of Wnt2b (Kawakami et al., 2001). Later caused small, dysplastic skeletons, joint fusions and cartilage during limb development, FGF8 is induced in response to hypertrophy was strongly repressed (Hartmann and Tabin, Wnt3 in the ectoderm of nascent limb buds (Barrow et al., 2001). Similar observations were seen when a stabilized form 2003; Kawakami et al., 2001). This step is critical for both of hcat was overexpressed in cartilage implying that the the formation and stability of the apical ectodermal ridge. inhibition of endochondral bone development is via canon- We propose that the expression of FGF18 in response to ical Wnt signaling (Akiyama et al., 2004; Guo et al., 2004). hcat is another example of a conserved and essential relay Surprisingly, however, cartilage-specific deletion of hcat in whereby Wnt signaling induces FGF expression during chondrocytes also causes formation of a dysplastic skeleton skeletal development. with joint fusions and slowed chondrocyte differentiation (Akiyama et al., 2004; Guo et al., 2004; Hu et al., 2005). While these data indicate that a single simple conclusion Acknowledgments cannot account for all effects of Wnt signaling on endochondral bone development, our results support a model wherein This work was supported by NIH grants AR47070, h the upregulation of cat levels represses chondrocyte differ- AR050024 and the Paul Beeson Physician Faculty Scholars entiation. Also, while this manuscript was under review, other in Aging Research Program. reports provided evidence for inhibitory effects of Wnt signaling on chondrocyte differentiation (Day et al., 2005; Hill et al., 2005). Significantly, we showed that the expression of FGF18 is induced following inhibition of References GSK3. Moreover, we showed that FGF18 is induced through h Akiyama, H., et al., 2004. Interactions between Sox9 and beta-catenin a cat-dependent pathway. Others have similarly found that control chondrocyte differentiation. Genes Dev. 18, 1072–1087. FGF18 is induced by hcat (Shimokawa et al., 2003). Based Ballock, R.T., O’Keefe, R.J., 2003. The biology of the growth plate. J. Bone on these data and our published data showing that FGF18 is Jt. Surg. Am. 85-A, 715–726. induced through calcium-dependent pathways requiring Barrow, J.R., et al., 2003. Ectodermal Wnt3/beta-catenin signaling is calcineurin/NFAT activation, we propose that FGF18 is required for the establishment and maintenance of the apical ectodermal ridge. Genes Dev. 17, 394–409. induced via a bipartite pathway when GSK3 is repressed. Beals, C.R., et al., 1997. Nuclear export of NF-ATc enhanced by glycogen One pathway simulates canonical Wnt signaling whereby synthase kinase-3. Science 275, 1930–1934. FGF18 is induced after upregulation of hcat protein levels. Bohme, K., et al., 1995. Terminal differentiation of chondrocytes in culture The second path stimulates FGF18 through calcineurin/ is a spontaneous process and is arrested by transforming growth factor- NFATactivation. This model and the effects of FGF18 on cell beta 2 and basic fibroblast growth factor in synergy. Exp. Cell Res. 216, 191–198. proliferation in bone rudiments are summarized in Fig. 7B. Chung, U.I., et al., 2001. Indian hedgehog couples chondrogenesis to FGF18À/À mice show features of advanced differ- osteogenesis in endochondral bone development. J. Clin. Invest. 107, entiation including an enlarged hypertrophic region and 295–304. R.M. Kapadia et al. / Developmental Biology 285 (2005) 496–507 507

Coghlan, M.P., et al., 2000. Selective small molecule inhibitors of glycogen McEwen, D.G., et al., 1999. Fibroblast growth factor receptor 3 gene synthase kinase-3 modulate glycogen metabolism and gene tran- transcription is suppressed by cyclic adenosine 3V,5V-monophosphate: scription. Chem. Biol. 7, 793–803. identification of a chondrocytic regulatory element. J. Biol. Chem. 274, Cohen, P., Frame, S., 2001. The renaissance of GSK3. Nat. Rev., Mol. Cell 30934–30942. Biol. 2, 769–776. Naski, M.C., et al., 1998. Repression of hedgehog signaling and BMP4 Colvin, J.S., et al., 1996. Skeletal overgrowth and deafness in mice lacking expression by fibroblast growth factor receptor 3 in growth plate fibroblast growth factor receptor 3. Nat. Genet. 12, 390–397. cartilage of transgenic mice. Development 125, 4977–4988. Cross, D.A., et al., 1995. Inhibition of glycogen synthase kinase-3 by Neal, J.W., Clipstone, N.A., 2001. Glycogen synthase kinase-3 inhibits the insulin mediated by protein kinase B. Nature 378, 785–789. DNA binding activity of NFATc. J. Biol. Chem. 276, 3666–3673. Day, T.F., et al., 2005. Wnt/beta-catenin signaling in mesenchymal Oberlender, S.A., Tuan, R.S., 1994a. Expression and functional involve- progenitors controls osteoblast and chondrocyte differentiation during ment of N-cadherin in embryonic limb chondrogenesis. Development vertebrate skeletogenesis. Dev. Cell 8, 739–750. 120, 177–187. Deng, C., et al., 1996. Fibroblast growth factor receptor 3 is a negative Oberlender, S.A., Tuan, R.S., 1994b. Spatiotemporal profile of N-cadherin regulator of bone growth. Cell 84, 911–921. expression in the developing limb mesenchyme. Cell Adhes. Commun. Dieudonne, S.C., et al., 1994. Opposite effects of osteogenic protein and 2, 521–537. transforming growth factor beta on chondrogenesis in cultured long Ohbayashi, N., et al., 2002. FGF18 is required for normal cell proliferation bone rudiments. J. Bone Miner. Res. 9, 771–780. and differentiation during osteogenesis and chondrogenesis. Genes Dev. Fang, X., et al., 2000. Phosphorylation and inactivation of glycogen 16, 870–879. synthase kinase 3 by protein kinase A. Proc. Natl. Acad. Sci. U. S. A. Okamura, H., 2000. Concerted dephosphorylation of the transcription factor 97, 11960–11965. NFAT1 induces a conformational switch that regulates transcriptional Frame, S., et al., 2001. A common phosphate binding site explains the activity. Mol. Cell 6, 539–550. unique substrate specificity of GSK3 and its inactivation by phospho- Price, M.A., Kalderon, D., 2002. Proteolysis of the Hedgehog signaling rylation. Molecular Cell 7, 1321–1327. effector Cubitus interruptus requires phosphorylation by glycogen Goodrich, L.V., 1996. Conservation of the hedgehog/patched signaling synthase kinase 3 and casein kinase 1. Cell 108, 823–835. pathway from flies to mice: induction of a mouse patched gene by Reinhold, M.I., et al., 2004a. FGF18 represses noggin expression and is Hedgehog. Genes Dev. 10, 301–312. induced by calcineurin. J. Biol. Chem. 279, 38209–380219. Guo, X., et al., 2004. Wnt/beta-catenin signaling is sufficient and necessary Reinhold, M.I., et al., 2004b. Fibroblast growth factor receptor 3 gene: for synovial joint formation. Genes Dev. 18, 2404–2417. regulation by serum response factor. Mol. Endocrinol. 18, 241–251. Hartmann, C., Tabin, C.J., 2000. Dual roles of Wnt signaling during Ryves, W.J., Harwood, A.J., 2001. Lithium inhibits glycogen synthase chondrogenesis in the chicken limb. Development 127, 3141–3159. kinase-3 by competition for magnesium. Biochem. Biophys. Res. Hartmann, C., Tabin, C.J., 2001. Wnt-14 plays a pivotal role in inducing Commun. 280, 720–725. synovial joint formation in the developing appendicular skeleton. Cell Saneyoshi, T., et al., 2002. The Wnt/calcium pathway activates NF-AT and 104, 341–351. promotes ventral cell fate in Xenopus embryos. Nature 417, 295–299. Hemmings, B.A., et al., 1981. Purification of glycogen synthase kinase 3 Serra, R., et al., 1999. Parathyroid hormone-related peptide (PTHrP)- from rabbit skeletal muscle. Copurification with the activating factor dependent and -independent effects of transforming growth factor (FA) of the (Mg-ATP) dependent protein phosphatase. Eur. J. Biochem. beta (TGF-beta) on endochondral bone formation. J. Cell Biol. 145, 119, 443–451. 783–794. Hill, T.P., et al., 2005. Canonical Wnt/beta-catenin signaling prevents osteo- Shimokawa, T., et al., 2003. Involvement of the FGF18 gene in colorectal blasts from differentiating into chondrocytes. Dev. Cell 8, 727–738. carcinogenesis, as a novel downstream target of the beta-catenin/T-cell Hu, H., et al., 2005. Sequential roles of Hedgehog and Wnt signaling in factor complex. Cancer Res. 63, 6116–6120. osteoblast development. Development 132, 49–60. Stambolic, V., Woodgett, J.R., 1994. Mitogen inactivation of glycogen Jho, E.H., et al., 2002. Wnt/beta-catenin/Tcf signaling induces the tran- synthase kinase-3 beta in intact cells via serine 9 phosphorylation. scription of Axin2, a negative regulator of the signaling pathway. Mol. Biochem. J. 303, 701–704. Cell. Biol. 22, 1172–1183. Stambolic, V., et al., 1996. Lithium inhibits glycogen synthase kinase-3 Jia, J., et al., 2002. Shaggy/GSK3 antagonizes Hedgehog signalling by activity and mimics wingless signalling in intact cells. Curr. Biol. 6, regulating Cubitus interruptus. Nature 416, 548–552. 1664–1668. Kato, Y., Iwamoto, M., 1990. Fibroblast growth factor is an inhibitor of St-Jacques, B., et al., 1999. Indian hedgehog signaling regulates prolifer- chondrocyte terminal differentiation. J. Biol. Chem. 265, 5903–5909. ation and differentiation of chondrocytes and is essential for bone Kawakami, Y., et al., 2001. WNT signals control FGF-dependent limb formation. Genes Dev. 13, 2072–2086. initiation and AER induction in the chick embryo. Cell 104, 891–900. Tomita, M., et al., 2002. Calcineurin and NFAT4 induce chondrogenesis. Korinek, V., et al., 1997. Constitutive transcriptional activation by a beta- J. Biol. Chem. 277, 42214–42218. catenin-Tcf complex in APCÀ/À colon carcinoma. Science 275, van der Eerden, B.C., et al., 2003. Systemic and local regulation of the 1784–1787. growth plate. Endocr. Rev. 24, 782–801. Kronenberg, H.M., 2003. Developmental regulation of the growth plate. Vortkamp, A., et al., 1996. Regulation of rate of cartilage differentiation by Nature 423, 332–336. Indian hedgehog and PTH-related protein. Science 273, 613–622. Lanske, B., et al., 1996. PTH/PTHrP receptor in early development and Wang, D., et al., 1999. Isolation and characterization of MC3T3-E1 Indian hedgehog-regulated bone growth. Science 273, 663–666. preosteoblast subclones with distinct in vitro and in vivo Li, C.L., et al., 1999. A Lys644Glu substitution in fibroblast growth factor differentiation/mineralization potential. J. Bone Miner. Res. 14, receptor 3 (FGFR3) causes dwarfism in mice by activation of STATs 893–903. and ink4 cell cycle inhibitors. Hum. Mol. Genet. 8, 35–44. Woodgett, J.R., 2001. Judging a protein by more than its name: GSK-3. Sci. Liu, Z., et al., 2002. Coordination of chondrogenesis and osteogenesis by Signal Transduct. Knowl. Environ. 2001, RE12. fibroblast growth factor 18. Genes Dev. 16, 859–869. Yang, Y., et al., 2003. Wnt5a and Wnt5b exhibit distinct activities in Mancilla, E.E., et al., 1998. Effects of fibroblast growth factor-2 on coordinating chondrocyte proliferation and differentiation. Develop- longitudinal bone growth. Endocrinology 139, 2900–2904. ment 130, 1003–1015. Supplemental Material can be found at: http://www.jbc.org/content/suppl/2006/12/12/M608995200.DC1.html

Direct Interactions of Runx2 and Canonical Wnt Signaling Induce FGF18*□S Received for publication, September 21, 2006, and in revised form, December 4, 2006 Published, JBC Papers in Press, December 11, 2006, DOI 10.1074/jbc.M608995200 Martina I. Reinhold‡ and Michael C. Naski‡§1 From the Departments of ‡Pathology and §Biochemistry, University of Texas Health Science Center, San Antonio, Texas 78229

Canonical Wnt signaling is clearly required for skeletal devel- (␤cat). Within the cytosol ␤cat resides in a multisubunit com- opment and bone formation. However, the targets of Wnt sig- plex that includes the proteins axin, APC, glycogen-synthase naling that convert this signal into bone are unclear. Identifica- kinase 3 (GSK3) as well as others (5). In the absence of Wnt, tion of these targets will yield insight into normal bone GSK3 phosphorylates specific residues near the amino termi- physiology and suggest new therapeutics for treatment of bone nus of ␤cat, leading to its recognition and degradation by a disease. Here we show that an essential regulator of bone devel- ␤TrCP-dependent proteosome pathway. When Wnt engages opment, FGF18, is a direct target of canonical Wnt signaling. A its receptor-coreceptor complex, the protein disheveled is single DNA binding site for the Wnt-dependent transcription recruited to the membrane, phosphorylated, and directed to factors TCF/Lef accounted for the stimulation of the fgf18 pro- the APC-AXIN-GSK-␤cat complex where it represses GSK3 ␤ moter in response to Wnt signaling. Additionally, targeted dis- activity. Inhibition of GSK3 leads to accumulation of cat and Downloaded from ruption of ␤cat blocked fgf18 expression in vivo. Partially over- migration to the nucleus. Within the nucleus ␤cat interacts lapping the TCF/Lef binding site is a Runx2 binding site and with specific DNA binding transcription factors, most notably experiments showed that Runx2 and TCF/Lef work coopera- the TCF/Lef family of transcription factors (6). When associ- tively to induce fgf18 expression. RNA interference knockdown ated with TCF/Lef, ␤cat recruits other transcription cofactors of Runx2 inhibited and Runx2 forced expression augmented the and stimulates the expression of Wnt target genes. induction of fgf18 by canonical Wnt signaling. Significantly, The TCF/Lef transcription factors are a family of 4 proteins www.jbc.org Runx2 formed a complex with Lef1 or TCF4 and this complex that bind to DNA through a conserved high mobility group bound the composite binding site in the fgf18 promoter. These domain (7). TCF/Lef proteins transduce cWnt signals into results demonstrate that two transcription pathways that are changes in gene expression. In the absence of Wnt, ␤cat levels by guest, on May 16, 2011 essential for bone, physically and functionally converge at the are low and TCF/Lef proteins act as transcription repressors by fgf18 promoter. recruiting the general transcription inhibitors Groucho/TLE and histone deacetylases (8, 9). Accumulation of ␤cat in the nucleus leads to direct displacement of Groucho/TLE through The signaling cascade initiated by the Wnt family of polypep- the competitive binding of ␤cat to TCF/Lef (10). ␤cat activates tides controls normal and abnormal development in a variety of gene expression by recruiting coactivators like p300/CBP (11) tissues (1–3). Wnt signaling is initiated by the binding of the and the Mediator complex (12). extracellular ligand (Wnt) to a seven-transmembrane spanning cWnt signaling has profound effects on normal cell and tis- receptor and coreceptor. The receptor complex is comprised of sue development and directly contributes to pathological con- frizzled, a multiple membrane spanning protein and an low ditions like neoplasia. During bone formation and remodeling, density lipoprotein-related coreceptor, LRP5 or LRP6. The Wnt signaling is indispensable. Studies of genetically modified receptor-ligand complex initiates a complex cascade of events. mice have contributed much to our understanding of the many Signals downstream of the Wnt receptor complex are separated functions of Wnt signaling in the skeleton. Gene knockouts of into canonical and noncanonical pathways (4). Canonical Wnt individual Wnts have shown requirements for Wnt10b (13), (cWnt)2 signaling regulates the protein levels of ␤-catenin Wnt5a, -5b (14), and others during normal skeletal development. To study cWnt signaling during bone growth and remodeling, ␤cat has been conditionally inactivated in several studies. * This work was supported by National Institutes of Health Grant AR050024 and the Paul Beeson Physician Faculty Scholars in Aging Research Pro- These studies have proven that Wnt signaling is required at gram. The costs of publication of this article were defrayed in part by the several steps during osteoblast differentiation. Inactivation of payment of page charges. This article must therefore be hereby marked ␤cat at early steps of osteoblast formation using cre recombi- “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. nase expressed from the Dermo1, type I collagen, and Prx1 □S The on-line version of this article (available at http://www.jbc.org) contains promoters caused aborted osteoblast differentiation (15–17). supplemental Fig. S1. Early osteoblasts expressing the osteoblast transcription factor 1 To whom correspondence should be addressed: 7703 Floyd Curl Dr., San Runx2 were present, but mature osteoblasts and synthesis of Antonio, TX 78229-3900. Tel.: 210-567-4126; Fax: 210-567-4819; E-mail: [email protected]. bone matrix was absent. Other studies showed ␤cat require- 2 The abbreviations used are: cWNT, canonical Wnt; ␤cat, ␤-catenin; GSK3, ments at later stages of osteoblastogenesis (18, 19); mature glycogen-synthase kinase 3; shRNA, short hairpin RNA; Pipes, 1,4-pipera- osteoblasts failed to develop when ␤cat was deleted at a stage zinediethanesulfonic acid; HA, hemagglutinin; EMSA, electrophoretic mobility shift assay; CBF␤, core binding factor ␤; HEK, human embryonic when the transcription factor osterix is expressed, indicating a kidney. requirement for cWnt downstream of or coinciding with

FEBRUARY 9, 2007•VOLUME 282•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3653 Runx2 and Wnt Induce FGF18 osterix. In addition, cessation of cWnt signaling is required for cloned into pGL2basic rather than pGL3basic. The released osteoblast maturation (18). Finally, cWnt signaling also regu- fragment was gel purified and cloned into the SacI site of lates bone osteoclast differentiation and bone resorption by pGL3basic. MluI digestion of the Ϫ3.3-kb pGL2basic reporter regulating osteoprotegerin expression (20). resulted in a DNA fragment that was cloned into the MluI site Naturally occurring mutations in humans have proven the of pGL3basic. To produce the trimeric repeats, gel purified oli- relevance of Wnt signaling during osteoblast development and gonucleotides or 415-bp fragments having BamHI or BglII sites for controlling bone mass. A syndromic form of osteoporosis is at opposite ends were kinased, ligated, and fractionated by aga- caused by loss of function mutations in the Wnt coreceptor rose gel electrophoresis. The trimer was excised from the gel LPR5 (21), and a high bone mass phenotype results from muta- and cloned into the BglII site of pGL3 TATA, a TATA box tions in LRP5 that diminish its affinity for Dkk1, an antagonist containing luciferase reporter. pGL3 TATA was created by of Wnt (22, 23). Thus, in accord with the animal studies, Wnt cloning the oligonucleotide AGATCTGGGTATATAAG- signals are anabolic for bone and decreased Wnt signaling GATCCGGTAAAGCTT and the reverse complement into result in clinically significant bone deficiencies. the BglII/HindIII sites of pGL3basic. Lef1 was cloned into These findings have proven the significance of cWnt signal- the StuI site of pCS2ϩ following MluI/HindIII digestion and ing during osteoblast differentiation. Moreover, these studies Klenow fill-in of the image clone 6054813. Runx2 (form II) suggest that careful stimulation of cWnt signaling or antago- was PCR amplified from a mouse cDNA library using the nism of ␤cat decay will promote bone formation. Identification primers CCGGTACCACCATGCTTCATTCGCCTCA- of the Wnt target genes that are required for osteoblasts forma- CAAA and TCTAGATCAATATGGCCGCCAAACAGAC- tion in response to cWnt signaling will also signify important TCATCCATTCTGCCGCTAGAATTCAA and cloned into

pathways that can be modulated for therapeutic benefit of bone pcDNA3.1 (Invitrogen). Downloaded from disease. In this report we show that the fibroblast growth factor Site-directed Mutagenesis—Mutations of the TCF binding Ϫ 18 gene (fgf18) is a downstream target of cWnt signaling. FGF18 site were introduced into the 1.1-kb and (415)3 reporter plas- is expressed in a tissue domain that coincides with (i) sites of mids via QuikChange site-directed mutagenesis following the osteoblast development and (ii) regions where ␤cat levels (and manufacturer’s instructions (Stratagene, La Jolla, CA). The therefore Wnt signaling) are increased. This implied that fgf18 mutations were verified by DNA sequencing. The sequence of is a candidate for a Wnt target gene that translates cWnt sig- the mutagenesis primers is available on request. www.jbc.org naling into osteoblast differentiation. We find that fgf18 is Metatarsal Cultures—Metatarsal were dissected from E15.5 directly induced by cWnt signaling. TCF/Lef proteins bind to a day C57Bl/6 embryos and cultured in serum-free medium as consensus target sequence of the fgf18 promoter and when described previously (24). When treated with Wnt3a, the by guest, on May 16, 2011 stimulated by ␤cat induce fgf18 expression. Remarkably, the medium was exchanged with conditioned medium (with or expression of fgf18 is directly coupled to another essential without Wnt3a) and the samples were harvested after 24 h. osteoblast transcription factor, Runx2. Partially overlapping In Situ Hybridization—4-␮m sections of paraffin-embedded the TCF/Lef site of the FGF18 promoter is a recognition motif tissues were processed and hybridized with riboprobes as for Runx2. Experiments showed that Runx2 interacts with described previously (25). The FGF18 riboprobe plasmid was a TCF/Lef and forms a ternary complex at the FGF18 promoter. gift from D. Ornitz (St. Louis, MO). RNA interference experiments showed that Runx2 is necessary Immunofluorescence—4-␮m paraffin sections were prepared for stimulation of FGF18 expression by Wnt, demonstrating as previously described (24). Primary antibodies were used at a that Wnt signaling and Runx2 are both physically and function- 1:200 dilution (␤-catenin, Santa Cruz sc7963; and FGF18, Santa ally linked. These findings reveal exquisite control of fgf18 Cruz sc16830). expression by two essential osteoblast transcription factors that Cell Culture and Transfections—MC3T3E1 (clone 14; Ref. combine to determine tissue specificity and stimulus depend- 47) and HEK293 were obtained from the ATCC and main- ence. These findings suggest that FGF18 may function as an tained subconfluent in ␣-minimal essential medium or Dulbec- essential component of the Wnt-dependent steps of osteoblas- co’s modified Eagle’s medium (Invitrogen) containing 10% fetal togenesis that are genetically downstream of Runx2. bovine serum (Hyclone), 2 mM glutamine, penicillin G (100 units/ml), and streptomycin (100 ␮g/ml) at 37 °C in a humidi- MATERIALS AND METHODS fied 5% CO2 incubator. Cells were transfected in triplicate using Reagents—SB216763 was from Tocris (Cookson, MO). a modified calcium phosphate precipitation and assayed for Wnt3a conditioned medium was prepared from Wnt3a luciferase and ␤-galactosidase activity (26, 27). Luciferase activ- expressing L-cells according to the suppliers instructions ity was normalized to ␤-galactosidase to control for transfec- (ATCC, Manassas, VA). Conditioned medium without Wnt3a tion efficiency. was made using L-cells. Real Time Quantitative-PCR—Total RNA was prepared Plasmids—To create the Ϫ3.3-kb fgf18 reporter plasmid a from cells using RNeasy according to the manufacturer’s 3.4-kb MscI fragment of BAC clone RPI 23323L8 was blunt-end instructions (Qiagen). One ␮g of total RNA was reverse tran- cloned into the SmaI restriction site of pGL3basic (Promega, scribed as described (28). Real time PCR was done using a SYBR Madison, WI). For the Ϫ1.1-kb reporter plasmid a PvuII/KpnI Green PCR mixture (Applied Biosystems) in an ABI 7000 fragment was excised from the Ϫ3.3-kb plasmid and blunt-end sequence detection system (Applied Biosystems). The ligated into the SmaI site of pGL3basic. The Ϫ0.8-kb reporter sequence of the primers were as reported (28). Ubiquitin was was prepared by SacI digestion of the Ϫ3.3-kb reporter that was used as the normalizer.

3654 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282•NUMBER 6•FEBRUARY 9, 2007 Runx2 and Wnt Induce FGF18

the shRNA and BamHI and EcoRI overhangs was cloned into the corresponding sites of RNAi-Ready pSIREN-Shuttle vector. The con- struct was verified by sequencing. MC3T3E1 cells were transiently transfected with shRNA plasmids using Nucleofection (Amaxa Inc., Gaithersburg, MD). 106 cells were resuspended in 100 ␮l of Nucleofec- tor solution T and transfected with 5 ␮g of DNA using Program T-20. Transfection efficiency using these conditions was shown to be Ͼ80%. RNA was prepared 24 h post-transfection from cells using an RNeasy (Qiagen) kit according to the manufacturer’s instructions. Chromatin Immunoprecipita-

tion—MC3T3 cells at about 80% Downloaded from confluence were stimulated for 4 h with 20 ␮M SB216763. Thereafter, protein-DNA complexes were cross-linked with 1% formaldehyde for 10 min at room temperature and cross-linking was stopped by the www.jbc.org addition of glycine to a final concentration of 0.125 M. Cells were washed with phosphate-buffered by guest, on May 16, 2011 saline containing 1 mM phenyl- methylsulfonyl fluoride, pelleted at 1200 rpm, and solubilized in swell- ing buffer (5 mM Pipes, pH 8.0, 85 mM KCl, 0.5% Nonidet P-40, protease inhibitor mixture), incubated on ice for 20 min, and then Dounce homogenized. The nuclei were col- lected by microcentrifugation and then resuspended in sonication buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl, pH 8.1, 0.5 mM phen- ylmethylsulfonyl fluoride, and pro- FIGURE 1. FGF18 expression is regulated by canonical Wnt signaling. A, indirect immunofluorescence (IF) showing ␤cat protein in the perichondrium adjacent to hypertrophic chondrocytes at sites of osteoblast tease inhibitor mixture) and incu- development. Right panel, IF; left panel, DIC bright field. B, indirect immunofluorescence showing the FGF18 bated on ice for 10 min. The samples protein. Note the presence of FGF18 in the perichondrium at sites where ␤cat is increased. C, in situ hybridiza- were sonicated on ice with a Bran- tion for fgf18 expression in metatarsals cultured for 24 h in either control (C) or Wnt3a conditioned medium (D). Right panel represent dark field, left panel is bright field. CЈ and DЈ show higher magnification of the bright and son Digital Sonifier at 50% ampli- dark field images. E, quantitative real time PCR determination of fgf18 expression in MC3T3E1 cells following tude for three 10-s pulses to an aver- stimulation with Wnt3a conditioned medium. F and G, in situ hybridization showing fgf18 expression in the ϳ proximal ulna from a 15.5-day mouse embryos, wild type (F)or␤cat null (G). ␤cat null animals result from age length of 1,000 bp and then conditional deletion of the floxed alleles with Dermo-1cre. This deletes the ␤cat gene in the condensing microcentrifuged. The sonicated mesenchyme of developing bones. cell supernatant was diluted 4-fold with RIPA buffer (0.1% SDS, 0.1% RNA Interference—The small interfering RNA oligonucleo- sodium deoxycholate, 1 mM EDTA, 0.5 mM EGTA, 140 mM tide against mouse Runx2 was targeted to GTCCTATGAC- NaCl, 10 mM Tris, pH 8) and precleared for2hat4°Cwith 2 CAGTCTTAC. A negative control shRNA oligonucleotide mg/ml salmon sperm DNA, 10 mg/ml bovine serum albumin, directed against TTCTCCGAACGTGTCACGT, unrelated to and 30 ␮l of Protein G-Sepharose. Prior to use, Protein Runx2, was used. The BD Knock-out RNAi System (BD Bio- G-Sepharose was blocked with 0.2 mg/ml of sheared salmon science) was used for generating small interfering RNAs. sperm DNA and 1 mg/ml of bovine serum albumin for at least Briefly, a double-stranded DNA oligonucleotide containing 4 h at 4 °C. Precleared chromatin was incubated with antibody

FEBRUARY 9, 2007•VOLUME 282•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3655 Runx2 and Wnt Induce FGF18 Downloaded from www.jbc.org by guest, on May 16, 2011

FIGURE 2. Regulation of the FGF18 promoter. A, luciferase assays of FGF18 reporter constructs containing the indicated lengths of the proximal promoter cotransfected into HEK293 cells with an expression plasmid for a stabilized form of ␤cat. Relative light units represent the ratio of luciferase to ␤-galactosidase activity. ␤-Galactosidase activity is derived from a cotransfected plasmid that has a constitutive promoter. B, luciferase reporter assays for the indicated FGF18 reporter plasmids transfected into MC3T3E1 cells and stimulated for 16 h with conditioned medium with or without Wnt3a. C, results of luciferase reporter assays from HEK293 cells transfected with the indicated plasmids. (415)3 represents a head to tail trimer of the 415-base pair motif cloned into a plasmid containing a TATA box minimal promoter (vector ϭ pGL3TATA). Assays were performed in triplicate, and the error bars represent Ϯ S.E. The figures show data representative of three independent experiments. D, sequence of the 415-bp motif that is regulated by cWnt signaling. The putative TCF/Lef binding sites are enclosed by rectangles. E, sequence of the oligonucleotides used in luciferase reporter plasmids or EMSA binding experiments. The TCF/Lef site is bold type. The Runx2 site is italic. Mutations are indicated by lowercase text. and rotated at 4 °C for ϳ12–16 h. Antibodies used included GCT-3Ј and 5Ј-GGCTGGGTGCGCCGCGCCCACATC-3Ј anti-␤ catenin (sc-7963, Santa Cruz), anti-Runx C19 (sc-8566, for 34 cycles (94 °C for 45 s; 69 °C for 45 s; 72 °C for 45 s). Santa Cruz), and anti-HA (H6908, Sigma). Chromatin-anti- Immunoprecipitation—HEK293 cells were transfected with body complexes were recovered using 45 ␮l of Protein expression plasmids using a modified calcium phosphate pre- G-Sepharose slurry. The bound complexes were washed with 1) cipitation method (26, 27). 48 h after transfection the cells were RIPA lysis buffer (3 times), 2) RIPA lysis buffer plus 0.5 M NaCl lysed with 1% deoxycholate and 1% Triton X-100, 50 mM Tris, (3 times); 3) LiCl buffer (0.25 M LiCl, 1% Nonidet P-40, 1% pH 8.0, 0.15 M NaCl, 2 mM EDTA, and 50 ␮g/ml phenylmeth- deoxycholate, 1 mM EDTA, 10 mM Tris (pH 8) (2 times); and 4) ylsulfonyl fluoride (Sigma), 0.25 mM orthovanadate (Sigma), TE buffer (2 times). The samples were then eluted with 1% SDS, and protease inhibitor mixture (Sigma). Clarified lysates were

0.1 M NaHCO3 and cross-links were reversed at 65 °C for4hto precleared with Protein G-Sepharose (Amersham Biosciences), overnight. The samples were than treated for1hat45°Cin200 and then immunoprecipitated with anti-Lef1 (Santa Cruz; mM NaCl, 10 mM EDTA, 40 mM Tris, pH 6.8 and 30 ␮g/ml sc8591), anti-␤cat (Santa Cruz; sc7199), or anti-hemagglutinin Proteinase K. DNA was recovered by phenol/chloroform (Sigma; H6908) absorbed to protein G-Sepharose (Amersham extraction and ethanol precipitation. PCR was performed using Biosciences). Proteins were fractionated by SDS-PAGE and FGF18 gene primers: 5Ј-CATTCTTTGGGAACCCCGCCT- transferred to polyvinylidene difluoride membranes (Milli-

3656 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282•NUMBER 6•FEBRUARY 9, 2007 Runx2 and Wnt Induce FGF18 pore). Blots were probed with anti-Runx2 (Santa Cruz; sc8566) and detected by chemiluminescence with the West Dura Extended substrate (Pierce). Nuclear Extracts and EMSAs—Nuclear extracts were prepared as previously described (26, 27). The protein concentration of extracts was estimated using the BCA protein assay reagent (Pierce). All oligonucleotides encompassing the desired binding site sequences were gel-purified and subsequently annealed. Binding reactions were performed at room temperature for 20 min in a 20-␮l total volume, which consisted of 0.1 pmol of probe (25,000 cpm), 3 ␮g of bovine serum albumin (Promega), 1.25 ␮g of poly(dI-dC) (Amersham Biosciences), 2–4 ␮g of nuclear protein extract, and buffer D (20 mM HEPES, pH 7.9 (4 °C), 25% glycerol, 420 mM NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM phenylmethanesulfonyl fluoride, 0.5 mM dithiothreitol). Duplex oligonucleotide competitors (specific and nonspecific) were preincubated with the nuclear extract for 5–10 min at room temperature for competition assays. For supershift assays, antibodies were added to nuclear extract and

incubated on ice for 20 min, followed by incubation at room FIGURE 3. Identification of a TCF/Lef site in the FGF18 promoter required Downloaded from temperature for 20 min. The resulting complexes were resolved for stimulation by Wnt3a and ␤cat. A, EMSA binding assay to determine the interaction of the TCF4 DNA binding domain with putative binding sites in as described (26). Anti-Runx2 (sc8566X) was obtained from the fgf18 promoter. Competition (comp) was done with a 100-fold molar Santa Cruz. excess of unlabeled oligonucleotide. B, luciferase assays of trimeric repeats of Animals—The Dermo-1cre deleter strain has been described the indicated oligonucleotides cloned into a TATA box containing minimal reporter. Cotransfections were done in HEK293 cells with ␤cat and/or a dom- (29) and mice carrying a floxed allele of ␤cat (30) were obtained inant negative form of TCF4 (⌬TCF4). Assays were performed in triplicate and from The Jackson Laboratory (Bar Harbor, ME). The animals the error bars represent Ϯ S.E. C, luciferase assays of the indicated FGF18 www.jbc.org reporters transfected into MC3T3E1 cells. Mutations (mut) were introduced were maintained in accordance with protocols approved by the into the TCF binding site. Bars represent the ratio of the Wnt3a stimulated Animal Care and Use Committee at University of Texas Health activity to the activity in conditioned medium without Wnt3a. Assays were Science Center, San Antonio. performed in triplicate and the error bars represent Ϯ S.E. D, PCR results for fgf18 following chromatin immunoprecipitation of ␤cat (top panel) from by guest, on May 16, 2011 MC3T3E1 cells stimulated for 4 h with (ϩ) or without (Ϫ)20␮M SB216763. RESULTS Input represents amplification of the starting material prior to immunopre- We examined by indirect immunofluorescence the presence cipitation. The bottom panel shows chromatin immunoprecipitation of HA- tagged TCF4 that was transfected into HEK293 cells. IgG indicates PCR of FGF18 and ␤cat in metatarsal bone rudiments isolated from amplificaton following immunoprecipitation using purified rabbit immu- E15.5 mouse embryos. The rudiments were cultured in serum- noglobulin. The figures show data representative of two or three inde- free medium and differentiated spontaneously. Interestingly, pendent experiments. FGF18 protein was found at sites in the perichondrium that coincide with sites of osteoblast differentiation and increased and Ϫ0.5 kb is stimulated by ␤cat or Wnt3a (Fig. 2, A and B). levels of ␤cat (Fig. 1, A and B, and color micrographs in supple- This 415-bp sequence was sufficient to respond to ␤cat when mentary data Fig. S1). We previously determined that FGF18 cloned into a TATA box containing minimal promoter (Fig. expression is induced following inhibition of GSK3 (24). We 2C). Stimulation of this sequence by ␤cat was enhanced when therefore reasoned that FGF18 is induced by cWnt signaling. In the Wnt-dependent transcription factor, TCF4, was cotrans- accord with this, fgf18 expression was induced in the perichon- fected (Fig. 2C). These data indicate that the 415-bp motif is drum of metatarsals cultured in medium containing Wnt3a stimulated by cWnt signaling; therefore, we examined this (Fig. 1, C and D) and in cultured cells (Fig. 1E). To further sequence for putative TCF/Lef recognition sites (Fig. 2D). characterize the regulation of fgf18 by canonical Wnt signaling, Three potential binding sites (A, B, and C) were identified. To we examined fgf18 expression in bones devoid of ␤cat. ␤cat test the function of these we designed oligonucleotides span- was conditionally inactivated in the developing bones by ning these sites and determined if 1) the DNA sequence asso- crossing mice with floxed alleles of ␤cat (30) to the cre- ciates with the DNA binding domain of TCF4, and 2) ␤cat-de- deleter strain Dermo1-cre (29). Consistent with the view pendent transcriptional activity is apparent in a transient that canonical Wnt signaling directly induces FGF18 expres- transfection assay. Only site A interacted specifically with the sion, FGF18 transcripts were absent in the perichondrium of DNA binding domain of TCF4 and showed transcriptional bones lacking ␤cat (Fig. 1, F and G). activity when cloned as a trimeric repeat in a luciferase reporter To identify the specific targets of Wnt signaling in the fgf18 containing a TATA box minimal promoter (Fig. 3, A and B). gene we cloned various portions of the fgf18 promoter into a Moreover the activation of this sequence by ␤cat was blocked luciferase reporter vector. Transient transfection of these by a form of TCF4 lacking the amino-terminal domain required reporter constructs together with a proteosome-resistant form for interaction with ␤cat (Fig. 3B). We then mutated the TCF/ of ␤cat or following stimulation of the transfected cells with Lef site to test its significance. Mutation of the consensus site Wnt3a demonstrated that a 415-base pair motif between Ϫ0.8 completely abolished activation by Wnt3a (Fig. 3C) and ␤cat

FEBRUARY 9, 2007•VOLUME 282•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3657 Runx2 and Wnt Induce FGF18 Downloaded from www.jbc.org by guest, on May 16, 2011

3658 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282•NUMBER 6•FEBRUARY 9, 2007 Runx2 and Wnt Induce FGF18

We identified a sequence that regulates the expression of fgf18 in response to Wnt. However, Wnts are widely expressed, yet fgf18 expression is much more restricted. This suggested that additional transcription regulators contribute to the expression of fgf18, and that these regulators may functionally cooperate with ␤cat and TCF/Lef to induce fgf18 expression. Signifi- cantly, fgf18 expression is greatest in the perichondrium. We then ques- tioned if transactivators expressed in perichondrial cells also regulate fgf18 expression. We searched for clues concerning fgf18 expression by examining the DNA sequence surrounding the TCF/Lef site.

Interestingly, a putative Runx2 Downloaded from binding site (TGTGG) partially overlaps the TCF/Lef site (Fig. 2E). FIGURE 5. Requirement for a Runx2 binding site in the fgf18 promoter. A, luciferase assays of the trimeric oligonucleotide A cotransfected in HEK293 cells with the indicated expression plasmids (␤cat, 0.05 ␮g; Runx2, Notably, Runx2 is expressed in the 0.3 ␮g). B, luciferase assays of the Topflash reporter cotransfected in HEK293 cells with the indicated plasmids perichondrium, and therefore is a (␤cat, 0.05 ␮g; Runx2, 0.3 ␮g). C, luciferase reporter assay of the trimer of the A oligonucleotide with a mutation ␤ ␮ good candidate for a bone cell- of the Runx2 binding site. HEK293 cells were cotransfected with or without cat (0.05 g) and Runx2 (0.05, 0.1, www.jbc.org or 0.3 ␮g). Relative light units are the ratio of luciferase to ␤-galactosidase activity. ␤-Galactosidase activity is specific transactivator that may derived from a cotransfected plasmid with constitutive expression. Assays were performed in triplicate, and restrict fgf18 expression to the Ϯ the error bars represent S.E. D, PCR for the fgf18 promoter sequence following chromatin immunoprecipita- perichondrium. To examine tion of Runx2 from MC3T3E1 cells stimulated for 4 h with 20 ␮M SB216763. Input represents a positive control using the starting material prior to immunoprecipitation. IgG represents immunoprecipitation using purified effects of Runx2 on fgf18 expres- by guest, on May 16, 2011 rabbit immunoglobulin. sion during Wnt activation, we transfected MC3T3E1 osteoblasts (data not shown), both of a trimer of the oligonucleotide con- with Runx2 and simulated cWnt signaling by inhibiting taining site A, as well as a trimer of the entire 415-bp motif. GSK3 with the pharmacological antagonist SB216763. We To determine whether site A can account for activation of chose a concentration of SB216763 that produced submaximal the endogenous fgf18 promoter, we introduced the same induction of fgf18. Significantly, the combination of Runx2 and mutation into the TCF/Lef binding site of the 1.1-kb fgf18 SB216763 induced fgf18 to a greater degree (9-fold) than Runx2 promoter. This mutation also completely abolished the stim- in the absence of SB216763 (2.8-fold; Fig. 4A). Similar results ulation of the FGF18 promoter by Wnt3a (Fig. 3C), support- were obtained with Wnt3a (Fig. 4A, right). Fig. 4B shows that ing the view that this site is fully responsible for the activa- Runx2 did not stimulate the expression of Axin2, a gene that is tion of the fgf18 gene by Wnt. To determine whether TCF4 strongly induced by canonical Wnt signaling (31). These data and ␤cat interact with the FGF18 promoter in vivo we performed chromatin immunoprecipitation. Following stimula- therefore suggest a cooperative relationship between Runx2 tion of MC3T3E1 cells with or without the GSK3 antagonist and TCF/Lef at the FGF18 promoter. This cooperation does SB216763 to mimic cWnt signaling, chromatin immunopre- not, however, extend to all Wnt-regulated genes, as evidenced cipitation showed ␤cat associated with the FGF18 promoter by the absence of an effect on Axin2. In fact as shown in Fig. 4B, (Fig. 3D, upper). Similarly, TCF4 were associated with the Runx2 may repress Wnt-dependent induction of Axin2. To fur- FGF18 promoter in HEK293 cells transfected with ther analyze the interaction of Wnt-dependent transcription HA-tagged TCF4 (Fig. 3D, lower). and Runx2, we diminished Runx2 protein levels by RNA inter-

FIGURE 4. Regulation of FGF18 expression by Runx2. A, quantitative real time PCR measurement of fgf18 or Axin2 (B) expression in MC3T3E1 cells nucleofected with a Runx2 expression plasmid or plasmid vector. Data shown in the left panels were obtained from cells stimulated with vehicle (Ϫ)or10␮M SB216763 (ϩ) for 8 h. Data of the right side panels were obtained from cells stimulated 8 h with Wnt3a (ϩ) or control conditioned medium. C, quantitative real time PCR measurement of fgf18 or Axin2 (D) expression in MC3T3E1 cells nucleofected with the indicated shRNA plasmids. Cells were stimulated with 10 ␮M SB216763 or Wnt3a-conditioned medium for 8 h. The data are expressed as -fold increase in fgf18 or Axin2 expression. This represents the ratio of the expression observed in stimulated cells relative to unstimulated or vehicle-treated cells. E, luciferase assays of the indicated FGF18 reporter plasmids without or with (F) 0.05 ␮gof cotransfected ␤cat expression plasmid in HEK293 cells. Relative light units represent the ratio of luciferase to ␤-galactosidase activity. ␤-Galactosidase activity is derived from a cotransfected plasmid with constitutive expression. Assays were performed in triplicate and the error bars represent Ϯ S.E. G, luciferase reporter assays of the indicated reporter plasmid without or with (H) a mutation in the TCF/Lef binding site. ␤cat was cotransfected at 0.05 ␮g and Runx2 was cotransfected as indicated. ␤-Galactosidase activity is derived from a cotransfected plasmid with constitutive expression. Assays were performed in triplicate, and the error bars represent ϮS.E. The figures show data representative of three independent experiments.

FEBRUARY 9, 2007•VOLUME 282•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3659 Runx2 and Wnt Induce FGF18 ference knockdown. Knockdown of Runx2 suppressed induction of FGF18 by the GSK3 antagonist and Wnt3a (Fig. 4C). In contrast, the induction of Axin2 was only modestly effected (Fig. 4D). These data support a functional interdependence of Runx2 and Wnt-dependent transcription at certain target loci like fgf18. The proximity of the TCF/Lef and Runx2 sites of the fgf18 promoter suggests that these transcription factors may interact directly. To examine this more closely we asked if Runx2 stimulates the FGF18 luciferase reporter plasmids. Fig. 4E shows that Runx2 alone did not stimulate the 3.3-kb FGF18 luciferase reporter (nor fragments thereof; data not show). However, expression of Runx2 together with ␤cat led to dose- dependent stimulation of the 3.3-kb fgf18 promoter (Fig. 4F). At submaximal levels of ␤cat the 3.3-kb FGF18 reporter was stimulated 5.3-fold, whereas ␤cat plus Runx2 stimulated the promoter to 16.6-fold. The 1.1-kb FGF18 reporter was similarly induced by the combination of ␤cat and Runx2 (Fig. 4G). The costimulation by ␤cat and Runx2 required an intact TCF/Lef site. Mutation of this site abolished stimulation by the combi- ␤ nation of Runx2 and cat (Fig. 4H). The trimer of the A oligo- Downloaded from nucleotide and the 417-bp motif (Fig. 5A and data not shown) ␤ FIGURE 6. Runx2 associates with TCF and Lef1. A, immunoprecipitation of were also coactivated by cat and Runx2. Fig. 5A shows that ␤cat followed by Runx2 immunoblotting. Lysates prepared from HEK293 cells whereas Runx2 alone did not stimulate the reporter, Runx2 transfected with the indicated plasmids were immunoprecipitated (IP) with combined with ␤cat caused a 40-fold activation. This compares anti-␤cat. Lysate and Runx2 immunoprecipitation demonstrate the mobility ␤ and immunodetection of Runx2. The lower band in the immunoprecipitated with a 9.8-fold stimulation by the indicated amount of cat. samples represents Ig heavy chain. B, immunoprecipitation with anti-Lef1 Significantly, a TCF/Lef binding site was insufficient for co- followed by Runx2 immunoblotting. Lysates prepared from HEK293 cells www.jbc.org activation by Runx2 and ␤cat. In fact, the Topflash reporter, transfected with the indicated plasmids were immunoprecipitated with anti-LEF1 antibody. Note that Runx2 is co-immunoprecipitated with Lef1. which contains repeats of an optimum TCF/Lef binding site The lower band in the immunoprecipitated samples represents Ig heavy was inhibited rather than activated by the combination of ␤cat chain. C, immunoprecipitation of Runx2 with TCF4. Immunoprecipitation with anti-HA followed by Runx2 immunoblot. Lysates were prepared from by guest, on May 16, 2011 and Runx2 (Fig. 5B). These data predict that Runx2 interacts HEK293 cells transfected with the indicated plasmids. Note that Runx2 is specifically with the sequence of fgf18. To examine this, we con- co-immunoprecipitated with HA-TCF4. The lower band in the immunopre- structed a reporter wherein the potential Runx2 binding site cipitated samples represents Ig heavy chain. was mutated (A_Runxmut, see Fig. 2E). Supporting a direct interaction with the Runx2 site, the mutated reporter was not tide A and in vitro transcribed and translated Runx2, ␤cat, and stimulated by Runx2, yet remained inducible by ␤cat, albeit less Lef1. Fig. 7A shows that Runx2, ␤cat, or combined Runx2 and so (Fig. 5C). Chromatin immunoprecipitation yields additional ␤cat did not form complexes with radiolabeled oligonucleotide evidence that Runx2 interacts with fgf18. Fig. 5D shows that A. As expected, Lef1 bound significantly to oligonucleotide A. Runx2 is immunoprecipitated with the endogenous fgf18 pro- The combination of ␤cat and Lef1 showed complexes consist- moter at the expected site. ent with Lef1 and Lef1-␤cat. Addition of Runx2 to these com- These data (Runx2 overexpression, Runx2 shRNA, cotrans- ponents led to DNA complexes consistent with Lef1-Runx2 fection of Runx2 and ␤cat) demonstrate a close functional rela- and Lef1-Runx2-␤cat (Fig. 7, A and B). Addition of an unlabeled tionship of Runx2 and the TCF/Lef transcription factors on oligonucleotide competitor showed these complexes were fgf18. Because the TCF/Lef and Runx2 sites partially overlap, specific, given that a wild-type DNA sequence was an effec- the respective transcription factors may physically interact to tive competitor, but an oligonucleotide with a mutation of regulate the expression of FGF18. To examine this we per- the TCF/Lef site was not (Fig. 7A). Therefore these data are formed co-immunoprecipitation experiments. First, we exam- consistent with the formation of a complex containing: ined if ␤cat interacts with Runx2. If ␤cat binds to Runx2, this Runx2-␤cat-Lef1-DNA. could explain our finding that ␤cat is required for stimulation of Runx2 did not appear to bind to the DNA sequence of oligo A the fgf18 reporters by Runx2. HEK293 cells were transfected in the absence of Lef1. Therefore it was not clear if the affinity of with Runx2 or Runx2 and ␤cat. ␤cat was immunoprecipitated Runx2 for DNA was augmented through an association with and immunoblots for Runx2 were done. The results did not Lef1 or if Runx2 assembled in a DNA-containing complex reveal interactions of ␤cat and Runx2 (Fig. 6A). However, solely through protein-protein interactions with Lef1. To Runx2 binds to both Lef1 and TCF4. Fig. 6, B and C, shows that determine whether Runx2 binds to oligonucleotide A we did Runx2 was co-immunoprecipitated with either Lef1 or HA- additional competition experiments. For these experiments we tagged TCF4. These results demonstrated association of TCF4 prepared nuclear extracts from cells transfected with vector or Lef1 with Runx2 in the absence of DNA binding. We next DNA or an expression clone for Runx2. These extracts were asked whether the proteins also assemble on DNA from the incubated with a radiolabeled oligonucleotide containing the fgf18 gene. EMSA experiments were done using oligonucleo- Runx2 binding site of the osteocalcin promoter, OSE (32). Addi-

3660 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282•NUMBER 6•FEBRUARY 9, 2007 Runx2 and Wnt Induce FGF18

actions of TCF/Lef and Runx2 at a composite binding site for both transcription factors in the FGF18 promoter. We found that Runx2 and TCF4 or Lef1 form a complex in the absence of DNA and that this complex promotes the binding of Runx2 to its recognition motif in the FGF18 promoter. It is likely that TCF/Lef induces a conformational change in Runx2 that allosterically activates Runx2 DNA binding activity. This is analogous to the interactions of Runx1 and core binding factor ␤ (CBF␤). Binding studies of the runt domain of Runx1 and CBF␤ showed a 5-fold decrease in the Runx1-DNA dissociation con- stant when Runx1 is bound to ␤ CBF . NMR studies demonstrated Downloaded from changes in the amide bond back- bone of Runx1 upon binding to CBF␤ and the crystal structure show that Runx-CBF␤ has stabilized loop conformations at the site of DNA contact. CBF␤ interacts www.jbc.org with the runt domain of Runx1 principally through two surface domains that are opposite the DNA by guest, on May 16, 2011 binding interface. This same surface may interact with non-DNA binding domains of TCF4 or Lef1. The DNA bending induced by Lef1 and FIGURE 7. Assembly of a Lef1-Runx2-␤cat-DNA complex. A, EMSA with radiolabeled oligonucleotide A. The TCF4 at its recognition site may indicated in vitro transcribed and translated proteins were incubated with labeled oligonucleotide and then fractionated on a non-denaturing gel. Where indicated a 100-fold molar excess of unlabeled competitor was permit simultaneous protein-pro- added. B, EMSA showing distinct Lef1/Runx2 and Lef1-␤cat-Runx2 complexes. C, EMSA using nuclear extract tein and DNA-protein interactions, prepared from cells transfected with Runx2 or a control plasmid and radiolabeled OSE oligonucleotide from and enhanced affinity of Runx2 for the osteocalcin promoter. Where indicated, anti-Runx2 antibody was included to produce supershifted complexes. Where indicated, a 100-fold excess of unlabeled competitor oligonucleotide was added. DNA. Whether the high mobility group domain of TCF/Lef and the runt domain of Runx2 are sufficient tionally, in the indicated samples we included an anti-Runx2 for this complex is unclear. The amino-terminal glutamine/ antibody that produced slower migrating complexes that were alanine-rich region of Runx2 appears to prevent interactions more evident on the nondenaturing gels. Fig. 7C shows that with the Runx1 binding partner, CBF␤ (33). Perhaps in addition oligo A competed for the binding of Runx2 to OSE; both super- to altering affinity for CBF␤, this domain may selectively con- shifted and nonsupershifted species were disrupted. Competi- tribute to binding with TCF/Lef proteins. tion required an intact Runx2 binding site, as an oligonucleo- After a Runx2-TCF/Lef complex is bound to DNA how does tide containing a mutation in the Runx2 binding site this complex stimulate the expression of FGF18? Clearly, ␤cat ␤ (A_Runxmut) did not interfere with binding of Runx2 to OSE. is a key coactivator. The interactions of cat with TCF/Lef are Additional control lanes show that unlabeled OSE, but not OSE well recognized and in this way histone acetyltransferases like with a mutated Runx2 site acted as an effective competitor. p300 (11) are recruited to the promoter. If ␤cat binds to Runx2, These data show that Runx2 binds directly to DNA at the then the activator properties of Runx2 at the FGF18 promoter FGF18 promoter and support the view that interactions with could be explained by the additional binding energy for ␤cat Lef1 facilitate Runx2 binding to DNA. that is contributed by Runx2. However, ␤cat did not interact with Runx2 by coimmunoprecipitation and gel-shift experi- DISCUSSION ments did not demonstrate disproportionate binding of ␤cat to We showed that the expression of fgf18 is regulated by the Lef1-Runx2 complexes. Therefore, we speculate that Runx2 combined actions of Wnt-dependent transcription factors activates the FGF18 promoter through mechanisms distinct TCF/Lef and Runx2. This reflects functional and physical inter- from the recruitment of ␤cat. Runx2 may activate expression

FEBRUARY 9, 2007•VOLUME 282•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3661 Runx2 and Wnt Induce FGF18 through actions such as recruitment of histone acetyltrans- development. It is notable that normal osteogenesis is dis- ferases like MOZ and MORF (34) or binding to other transcrip- rupted in fgf18 null embryos (40, 41). If fgf18 is responsible for tion factors like AP-1 or Smad (35, 36). Alternatively, Runx2 the action of Wnt in bone, then based on our understanding of may stimulate fgf18 expression through pathways not yet Wnt signaling in bone fgf18 must both stimulate and suppress described. osteoblast differentiation at different stages of development. Significantly, a previous report showed that the human How this is achieved will require further investigation; how- FGF18 promoter is stimulated by a ␤cat-TCF complex (37) and ever, expansion of an early osteoblast population through stim- that FGF18 contributed to colon cancer cell growth. The ulation of cell proliferation will almost certainly be a key attrib- sequence of the mouse and human promoters at the TCF/Lef ute of FGF18. binding site is 100% conserved supporting the significance of What other genes are induced by the Runx2-TCF/Lef com- this site for FGF18 gene expression. This implies that FGF18 bination? These genes are likely to have both TCF/Lef sites and expression is normally targeted to sites where cWnt signaling Runx2 within the promoter; however, given the substantial and Runx2 (and perhaps other members of the Runx family) DNA bending that is induced by the high mobility group coincide. We have shown that ␤cat is required for the expres- domain of Lef (42), we predict that these binding sites need not sion of fgf18 in the perichondrium of long bones during skeletal be directly adjacent or overlapping. The dramatic change in development. This suggests that both Runx2 and cWnt signal- DNA conformation caused by Lef1 can bring a distant Runx2 ing are required for fgf18 expression under normal physiologi- site into close spatial proximity. We predict that certain of these cal states; the absence of either may result in the loss of expres- genes have expression patterns that match closely that of sion. That is, the physical coupling of TCF/Lef and Runx2 and FGF18. Interestingly, Dkk1, tcf1, and Runx2 are induced by Wnt

the juxtaposition of the DNA binding sites specify a cooperative signaling (43–45) and are expressed in the perichondrium sim- Downloaded from partnership for fgf18 expression. Accordingly, recent data show ilar to FGF18. Moreover, Dkk1 and tcf1 expression is lost in that Runx2 is essential for fgf18 expression and that Runx2 Runx2 null embryos at sites where Runx2 and Dkk1 or tcf1 are directly regulates the FGF18 promoter (38). During pathologi- normally coexpressed (46). Whether these and other genes are cal conditions like colon cancer, fgf18 may be expressed abnor- coactivated by Runx2 and Wnt-dependent transcription mally and independently of Runx2 as a consequence of excess demands further investigation. These genes will surely be vital levels of ␤cat. during osteoblastogenesis and bone formation given that they www.jbc.org The interactions of Runx2 and TCF/Lef do not augment the lay at the convergence of stimulus-dependent and osteoblast- expression of all Wnt target genes. For example, Axin2 is specific transcription pathways that are anabolic for bone. strongly induced by canonical Wnt signaling, yet its expression by guest, on May 16, 2011 is not stimulated by Runx2 (Fig. 4B). Also, the prototypic Wnt- Acknowledgments—We gratefully acknowledge receipt of the follow- dependent reporter plasmid, Topflash, is repressed rather than ing plasmids: pcDNA S45A ␤cat (D. Rimm, New Haven, CT); pTOP- stimulated by the combination of Runx2 and ␤cat (Fig. 5B). flash and GST-TCF4 DNA binding domain (B. Vogelstein, Baltimore, Kahler and Westendorf (39) also showed that Runx2 binds to MD); pCS2ϩTCF4-HA (A. Hecht, Freiburg, Germany); FGF18-ribo- Lef1 and this association represses the osteocalcin promoter. probe (D. Ornitz, St. Louis, MO). We thank R. Kapadia and Z. Liao for Therefore, it is likely that a set of genes are repressed as a con- excellent technical assistance. sequence of Runx2-TCF/Lef interactions and a different set of genes including fgf18 are induced by the combination. The out- REFERENCES come will be determined by protein-nucleic acid interactions 1. Logan, C. Y., and Nusse, R. (2004) Annu. Rev. Cell Dev. Biol. 20, 781–810 that are promoter-specific. Given the pivotal importance of 2. Nusse, R. (2005) Cell Res. 15, 28–32 Runx2 and Wnt-dependent transcription during osteoblast dif- 3. Moon, R. T., Kohn, A. D., De Ferrari, G. V., and Kaykas, A. (2004) Nat. Rev. ferentiation, the decision to repress or induce gene expression Genet. 5, 691–701 in response to their combined actions will be paramount for 4. Veeman, M. T., Axelrod, J. D., and Moon, R. T. (2003) Dev. Cell 5, 367–377 temporal and spatial regulation of osteoblast differentiation. 5. Fodde, R., Smits, R., and Clevers, H. (2001) Nat. Rev. Cancer 1, 55–67 6. van Noort, M., and Clevers, H. (2002) Dev. Biol. 244, 1–8 For example, recent data show that cessation of Wnt/␤cat 7. Roose, J., and Clevers, H. (1999) Biochim. Biophys. Acta 1424, M23–M37 activity is required for full maturation of osteoblasts into osteo- 8. Chen, G., Fernandez, J., Mische, S., and Courey, A. J. (1999) Genes Dev. 13, calcin expressing cells (18). Coactivation of FGF18 expression 2218–2230 by Runx2 and Wnt signaling may support early osteoblast dif- 9. Cavallo, R. A., Cox, R. T., Moline, M. M., Roose, J., Polevoy, G. A., Clevers, ferentiation, but suppress later events. In support of this, we H., Peifer, M., and Bejsovec, A. (1998) Nature 395, 604–608 have shown that FGF18 can suppress osteoblast differentiation 10. Daniels, D. L., and Weis, W. I. (2005) Nat. Struct. Mol. Biol. 12, 364–371 11. Hecht, A., Vleminckx, K., Stemmler, M. P., van Roy, F., and Kemler, R. in cultured metatarsals (24). Alternatively, strong Wnt signal- (2000) EMBO J. 19, 1839–1850 ing may induce TCF1 and/or Lef1 expression that lead to 12. Kim, S., Xu, X., Hecht, A., and Boyer, T. G. (2006) J. Biol. Chem. 281, dimerization with Runx2 and dissociation from Runx2- 14066–14075 dependent promoters like osteocalcin (39). In either case, these 13. Bennett, C. N., Longo, K. A., Wright, W. S., Suva, L. J., Lane, T. F., Han- possibilities imply that a Runx2-TCF/Lef complex will act deci- kenson, K. D., and MacDougald, O. A. (2005) Proc. Natl. Acad. Sci. U. S. A. sively at specific points during osteoblast differentiation. 102, 3324–3329 14. Yang, Y., Topol, L., Lee, H., and Wu, J. (2003) Development 130, We showed that fgf18 is induced via an osteoblast-specific, 1003–1015 Wnt-dependent pathway. Thus, fgf18 is a Wnt-target gene that 15. Hill, T. P., Spater, D., Taketo, M. M., Birchmeier, W., and Hartmann, C. may be essential for translating Wnt signaling into osteoblast (2005) Dev. Cell 8, 727–738

3662 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 282•NUMBER 6•FEBRUARY 9, 2007 Runx2 and Wnt Induce FGF18

16. Day, T. F., Guo, X., Garrett-Beal, L., and Yang, Y. (2005) Dev. Cell 8, Ornitz, D. M. (2003) Development 130, 3063–3074 739–750 30. Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, 17. Hu, H., Hilton, M. J., Tu, X., Yu, K., Ornitz, D. M., and Long, F. (2005) A. P., Sommer, L., Boussadia, O., and Kemler, R. (2001) Development 128, Development 132, 49–60 1253–1264 18. Rodda, S. J., and McMahon, A. P. (2006) Development 133, 3231–3244 31. Jho, E. H., Zhang, T., Domon, C., Joo, C. K., Freund, J. N., and Costantini, 19. Mak, K. K., Chen, M.-H., Day, T. F., Chuang, P.-T., and Yang, Y. (2006) F. (2002) Mol. Cell. Biol. 22, 1172–1183 Development 133, 3695–3707 32. Ducy, P., and Karsenty, G. (1995) Mol. Cell. Biol. 15, 1858–1869 20. Glass, D. A., 2nd, Bialek, P., Ahn, J. D., Starbuck, M., Patel, M. S., Clevers, 33. Thirunavukkarasu, K., Mahajan, M., McLarren, K. W., Stifani, S., and H., Taketo, M. M., Long, F., McMahon, A. P., Lang, R. A., and Karsenty, G. Karsenty, G. (1998) Mol. Cell. Biol. 18, 4197–4208 (2005) Dev. Cell 8, 751–764 34. Pelletier, N., Champagne, N., Stifani, S., and Yang, X. J. (2002) Oncogene 21. Gong, Y., Slee, R. B., Fukai, N., Rawadi, G., Roman-Roman, S., Reginato, 21, 2729–2740 A. M., Wang, H., Cundy, T., Glorieux, F. H., Lev, D., Zacharin, M., Oexle, 35. Hanai, J., Chen, L. F., Kanno, T., Ohtani-Fujita, N., Kim, W. Y., Guo, W. H., K., Marcelino, J., Suwairi, W., Heeger, S., Sabatakos, G., Apte, S., Adkins, Imamura, T., Ishidou, Y., Fukuchi, M., Shi, M. J., Stavnezer, J., Kawabata, W. N., Allgrove, J., Arslan-Kirchner, M., Batch, J. A., Beighton, P., Black, M., Miyazono, K., and Ito, Y. (1999) J. Biol. Chem. 274, 31577–31582 G. C., Boles, R. G., Boon, L. M., Borrone, C., Brunner, H. G., Carle, G. F., 36. D’Alonzo, R. C., Selvamurugan, N., Karsenty, G., and Partridge, N. C. Dallapiccola, B., De Paepe, A., Floege, B., Halfhide, M. L., Hall, B., Hen- (2002) J. Biol. Chem. 277, 816–822 nekam, R. C., Hirose, T., Jans, A., Juppner, H., Kim, C. A., Keppler-Noreuil, 37. Shimokawa, T., Furukawa, Y., Sakai, M., Li, M., Miwa, N., Lin, Y. M., and K., Kohlschuetter, A., LaCombe, D., Lambert, M., Lemyre, E., Letteboer, Nakamura, Y. (2003) Cancer Res. 63, 6116–6120 T., Peltonen, L., Ramesar, R. S., Romanengo, M., Somer, H., Steichen- 38. Hinoi, E., Bialek, P., Chen, Y.-T., Rached, M. T., Groner, Y., Behringer, Gersdorf, E., Steinmann, B., Sullivan, B., Superti-Furga, A., Swoboda, W., R. R., Ornitz, D. M., and Karsenty, G. (2006) Genes Dev. 20, 2937–2942 van den Boogaard, M. J., Van Hul, W., Vikkula, M., Votruba, M., Zabel, B., 39. Kahler, R. A., and Westendorf, J. J. (2003) J. Biol. Chem. 278, 11937–11944 Garcia, T., Baron, R., Olsen, B. R., Warman, M. L., and Osteoporosis- 40. Ohbayashi, N., Shibayama, M., Kurotaki, Y., Imanishi, M., Fujimori, T., Pseudoglioma Syndrome Collaborative, G. (2001) Cell 107, 513–523

Itoh, N., and Takada, S. (2002) Genes Dev. 16, 870–879 Downloaded from 22. Van Wesenbeeck, L., Cleiren, E., Gram, J., Beals, R. K., Benichou, O., Scop- 16, elliti, D., Key, L., Renton, T., Bartels, C., Gong, Y., Warman, M. L., De 41. Liu, Z., Xu, J., Colvin, J. S., and Ornitz, D. M. (2002) Genes Dev. Vernejoul, M. C., Bollerslev, J., and Van Hul, W. (2003) Am. J. Hum. Gen. 859–869 72, 763–771 42. Giese, K., Kingsley, C., Kirshner, J. R., and Grosschedl, R. (1995) Genes Dev. 23. Boyden, L. M., Mao, J., Belsky, J., Mitzner, L., Farhi, A., Mitnick, M. A., Wu, 9, 995–1008 D., Insogna, K., and Lifton, R. P. (2002) N. Engl. J. Med. 346, 1513–1521 43. Niida, A., Hiroko, T., Kasai, M., Furukawa, Y., Nakamura, Y., Suzuki, Y., Sugano, S., and Akiyama, T. (2004) Oncogene 23, 8520–8526 24. Kapadia, R. M., Guntur, A. R., Reinhold, M. I., and Naski, M. C. (2005) Dev. www.jbc.org Biol. 285, 496–507 44. Roose, J., Huls, G., van Beest, M., Moerer, P., van der Horn, K., Gold- 25. Naski, M. C., Colvin, J. S., Coffin, J. D., and Ornitz, D. M. (1998) Develop- schmeding, R., Logtenberg, T., and Clevers, H. (1999) Science 285, ment 125, 4977–4988 1923–1926 26. McEwen, D. G., Green, R. P., Naski, M. C., Towler, D. A., and Ornitz, D. M. 45. Gaur, T., Lenger, C. J., Hoyhannisyan, H., Bhat, R. A., Bodine, P. V., Komm, by guest, on May 16, 2011 (1999) J. Biol. Chem. 274, 30934–30942 B. S., Javed, A., van Wijnen, A. J., Stein, J. L., Stein, G. S., and Lian, J. B. 27. Reinhold, M. I., McEwen, D. G., and Naski, M. C. (2004) Mol. Endocrinol. (2005) J. Biol. Chem. 280, 33132–33140 18, 241–251 46. James, M. J., Jarvinen, E., Wang, X. P., and Thesleff, I. (2006) J. Bone Miner. 28. Reinhold, M. I., Abe, M., Kapadia, R. M., Liao, Z., and Naski, M. C. (2004) Res. 21, 1034–1044 J. Biol. Chem. 279, 38209–38219 47. Wang, D., Christensen, K., Chawla, K., Xiao, G., Krebsbach, P. H., and 29. Yu, K., Xu, J., Liu, Z., Sosic, D., Shao, J., Olson, E. N., Towler, D. A., and Franceschi, R. T. (1999) J. Bone Miner. Res. 14, 893–903

FEBRUARY 9, 2007•VOLUME 282•NUMBER 6 JOURNAL OF BIOLOGICAL CHEMISTRY 3663