DOCSLIB.ORG

Pyruvate Site of Pyruvate Phosphate Dikinase: Crystal Structure of the Enzyme-Phosphonopyruvate Complex, and Mutant Analysis†,‡ Osnat Herzberg,*,§ Celia C

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Pyruvate Site of Pyruvate Phosphate Dikinase: Crystal Structure of the Enzyme-Phosphonopyruvate Complex, and Mutant Analysis†,‡ Osnat Herzberg,*,§ Celia C 780 Biochemistry 2002, 41, 780-787 Pyruvate Site of Pyruvate Phosphate Dikinase: Crystal Structure of the Enzyme-Phosphonopyruvate Complex, and Mutant Analysis†,‡ Osnat Herzberg,*,§ Celia C. H. Chen,§ Sijiu Liu,§ Aleksandra Tempczyk,§ Andrew Howard,| Min Wei,⊥ Dongmei Ye,⊥ and Debra Dunaway-Mariano⊥ Center for AdVanced Research in Biotechnology, UniVersity of Maryland Biotechnology Institute, 9600 Gudelsky DriVe, RockVille, Maryland 20850, Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico 87131, Illinois Institute of Technology, Chicago, Illinois 60616, and AdVanced Photon Source, Argonne National Laboratory, 9700 South Cass AVenue, Argonne, Illinois 60439 ReceiVed September 17, 2001; ReVised Manuscript ReceiVed NoVember 5, 2001 ABSTRACT: Crystals of pyruvate phosphate dikinase in complex with a substrate analogue inhibitor, 2+ phosphonopyruvate (Ki ) 3 µM), have been obtained in the presence of Mg . The structure has been determined and refined at 2.2 Å resolution, revealing that the Mg2+-bound phosphonopyruvate binds in the R/â-barrel’s central channel, at the C-termini of the â-strands. The mode of binding resembles closely the previously proposed PEP substrate binding mode, inferred by the homology of the structure (but not sequence homology) to pyruvate kinase. Kinetic analysis of site-directed mutants, probing residues involved in inhibitor binding, showed that all mutations resulted in inactivation, confirming the key role that these residues play in catalysis. Comparison between the structure of the PPDK-phosphonopyruvate complex and the structures of two complexes of pyruvate kinase, one with Mg2+-bound phospholactate and the other with Mg2+-oxalate and ATP, revealed that the two enzymes share some key features that facilitate common modes of substrate binding. There are also important structural differences; most notably, the machinery for acid/base catalysis is different. 1 PPDK catalyzes the interconversion of ATP, Pi, and binding site is located within the N-terminal part of the 2+ pyruvate, with AMP, PPi, and PEP, in three Mg -dependent polypeptide chain, whereas the pyruvate/PEP binding site is partial reactions that involve phospho- and pyrophospho- located within the C-terminal part of the chain (4-7). enzyme intermediates (1, 2): The crystal structure of PPDK in the unbound state (8) revealed two remote substrate binding sites, one binding site E-His + ATP f E-His-PP‚AMP (I) for ATP/AMP and Pi/PPi and the second for pyruvate/PEP. - - ‚ + f - - ‚ ‚ E His PP AMP Pi E His P AMP PPi (II) The two binding sites are located 45 Å apart, and each is associated with a different structural domain. The N-terminal E-His-P + pyruvate f E-His + PEP (III) segment of the polypeptide chain contains a 240-residue The above reactions are reversible, and the outcome depends nucleotide binding domain that adopts the fold termed ATP- on the host organism (glycolytic ATP synthesis, or PEP grasp (9). The C-terminal 340-residue pyruvate/PEP binding R synthesis). Enzyme phosphorylation and pyrophosphorylation domain adopts an /â-barrel fold. A third domain contains occur on a histidine residue, His455 (3). The nucleotide the phosphoryl/pyrophosphate group acceptor/donor residue, His455. The locations of the nucleotide binding sites were inferred by analogy to other enzymes with the folds of the † Supported by NSF Grant MCB9813271 (O.H.) and NIH Grant GM36260 (D.D.-M.). Use of the National Synchrotron Light Source ATP-grasp, and the location of the PEP/pyruvate binding was supported by the U.S. Department of Energy, Basic Energy site by analogy to R/â-barrel enzymes. The structure implies Sciences, Office of Science, under Prime Contract DE-AC02- that the phosphohistidine domain undergoes a swivel motion 98CH110886, by the National Science Foundation, and by National Institutes of Health Grant 1P41 RR12408-01A1. Use of the Advanced to shuttle the phosphoryl group between the two remote Photon Source was supported by the U.S. Department of Energy, active sites. Basic Energy Sciences, Office of Science, under Contract W-31-109- The pyruvate/PEP binding site of PPDK may be compared Eng-38. ‡ The coordinates have been deposited in the Protein Data Bank with the active site of pyruvate kinase, an enzyme that (entries 1KBL and 1KC7). converts PEP to ATP directly, without the involvement of a * To whom correspondence should be addressed. Telephone: (301) phosphoenzyme intermediate. The pyruvate kinase active site 738-6245. Fax: (301) 738-6255. E-mail: [email protected]. R § University of Maryland Biotechnology Institute. also adopts an /â-barrel fold (10). The comparison revealed | Illinois Institute of Technology and Argonne National Laboratory. conservation of several key residues involved in substrate ⊥ University of New Mexico. binding, and similarity in their relative disposition in the 1 Abbreviations: PPDK, pyruvate phosphate dikinase; PEP, phos- active site. Thus, a model has been developed for the phoenolpyruvate; ATP, adenosine 5′-triphosphate; AMP, adenosine 5′- monophosphate; Pi, inorganic phosphate; PPi, inorganic pyrophosphate; pyruvate/PEP binding to PPDK based on the information Hepes, N-(2-hydroxyethyl)piperazine-N′-ethanesulfonic acid. from pyruvate kinase site (8). Binding studies in the 10.1021/bi011799+ CCC: $22.00 © 2002 American Chemical Society Published on Web 12/19/2001 PPDK-Phosphonopyruvate Structure Biochemistry, Vol. 41, No. 3, 2002 781 enzyme-inhibitor complex were transferred to a cryogenic solution comprising 60% saturated ammonium sulfate, 20% glycerol, and 0.1 M Hepes buffer (pH 7.0). In addition, the cryogenic solution for the enzyme-inhibitor complex also contained 40 mM P-pyr and 40 mM MgCl2. After soaking in the cryogenic solution for 2 h, the crystal was flash-cooled in liquid propane cooled by liquid nitrogen. As with the FIGURE 1: Structures of PEP and P-pyr, the substrate and inhibitor crystal of the apoprotein, the space group of the enzyme- of PPDK, respectively. inhibitor crystal was P2, with one monomer in the asym- metric unit. The unit cell dimensions of the unbound protein crystalline state proved to be illusive, probably due to the crystal were as follows: a ) 89.8 Å, b ) 58.7 Å, c ) 102.9 ∼ relatively high Km value of the substrate ( 30 µM), and the Å, and â ) 94.8°. For the enzyme-inhibitor complex crystal, fact that, so far, crystals useful for X-ray work have been the cell dimensions were as follows: a ) 89.2 Å, b ) 58.4 obtained only from solutions containing a high concentration Å, c ) 102.6 Å, and â ) 95.0°. ∼ of ammonium sulfate ( 2 M). The high ionic strength of X-ray intensity data for both apoenzyme and enzyme- the crystallization solution is expected to lead to reduced 2+ inhibitor crystals were collected at 100 K. The native data substrate affinity, as the substrate and Mg cofactor are were collected to 1.9 Å resolution on the X12C beamline of charged. the National Synchrotron Light Source (NSLS, Brookhaven The current work became possible following the discovery National Laboratory, Upton, NY), and the enzyme-inhibitor that phosphonopyruvate (P-pyr), a compound that resembles complex data were collected to 1.73 Å resolution on the PEP (Figure 1), inhibits PPDK activity at micromolar IMCA-CAT 17-ID beamline at the Advanced Photon Source ) concentrations (Ki 3 µM). The crystal structure of the (Argonne National Laboratory). Diffraction data at a wave- - PPDK P-pyr complex, together with site-directed mutagen- length of 1.3 Å at NSLS beamline X12C were recorded on esis data, confirms the location of the pyruvate/PEP binding a 300 mm MAR research image plate, and at the IMCA- sites, and the identity of the residues that play key roles in CAT 17-ID beamline, diffraction data at a wavelength of catalysis. Also reported is the structure of the apoenzyme at 1.0 Å were recorded on a MAR 165 mm charge-coupled 1.94 Å resolution. This is a better resolution than that of device system. For the PPDK-inhibitor complex, several our previously reported structure (8), thus facilitating a more crystals were tested, and they all exhibited high mosaic reliable comparison between the bound and unbound enzyme. spread. For the best diffracting crystal, the estimated mosaic spread was close to 2.5°. This was the crystal used for data MATERIALS AND METHODS acquisition. Data collected on the X12C beamline were Expression, Protein Purification, and Site-Directed Mu- processed with HKL (12). Data collected on the IMCA-CAT tagenesis. Wild-type and mutant PPDK proteins from beamline were processed with the X-GEN package (13). The Clostridium symbiosum were expressed in Escherichia coli statistics of data processing are given in Table 1. Rmerge values and purified as described previously (11). Mutant proteins for the PPDK-inhibitor data indicate poor quality beyond were prepared from the plasmid pACYC184-D12 using a ∼1.9 Å resolution, which is attributed to the high mosaic PCR-based procedure analogous to that described in ref 5. spread of the crystal. Although refinement commenced using Primers for mutagenesis, 18-22 base pairs in length, were all data up to 1.8 Å resolution, it was ultimately completed synthesized by Gibco BRL Life Science. KpnI and BstXI at a truncated resolution of 2.2 Å. restriction sites were employed in the construction of the Structure Determination and Refinement. The starting E745Q, D769A, N768A, D620N, R617K, R561K, and model for refinement was that of the room-temperature wild- C831A mutants. The sequences of the isolated mutant genes type apo-PPDK structure refined at 2.3 Å resolution (PDB were determined by the Center for Agricultural Biotechnol- entry 1DIK), excluding solvent molecules. The structures ogy at the University of Maryland (College Park, MD). The were refined with the program CNS (14). Two cycles of mutant genes were expressed in E. coli JM101 cells as simulated annealing at 2500 K were followed by positional described in ref 5.
Load more

Recommended publications
  • Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1
    [CANCER RESEARCH 34, 1439-1446, June 1974] Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1 Francis A. Farina,2 Jennie B. Shatton, Harold P. Morris, and Sidney Weinhouse The Fels Research Institute and the Department of Biochemistry, Temple University School oj Medicine, Philadelphia. Pennsylvania IV140 (F. A. F., J. B. S.. S. W.\, and the Department of Biochemistry. Howard University School of Medicine. Washington. D. C. 20001 [H. P. M .\ SUMMARY 23, 32, 41, 57). These alterations involve the replacement of those isozymes that are under dietary and hormonal control Pyruvate kinase (PK) (EC 2.7.1.40) isozymes were assayed by the host, and that have important metabolic functions in in normal rat liver and a series of transplantable rat the adult differentiated liver by other isozymes which are hepatomas ranging widely in growth rate and degree of normally either low in, or absent from, the adult tissue. As differentiation, with the use of gradient elution by chloride part of an ongoing study of this phenomenon, we have ion from columns of DEAE-cellulose. In agreement with examined the alteration of PK3 (EC 2.7.1.40) isozymes in other studies, three noninterconvertible forms were found in the Morris hepatomas (30. 31), a series of chemically rat tissues: isozyme I, the major form in adult rat liver: induced, transplantable rat hepatomas ranging widely in isozyme II, the sole form in heart and skeletal muscle: and growth rate and degree of differentiation. This enzyme isozyme III, the sole form in poorly differentiated hepato occupies a key position in the metabolism of cells and, as we mas, the major form in normal kidney and lung, and the pointed out previously (27, 28.
    [Show full text]
  • Pyruvate Kinase: Function, Regulation and Role in Cancer
    Pyruvate kinase: Function, regulation and role in cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Israelsen, William J., and Matthew G. Vander Heiden. “Pyruvate Kinase: Function, Regulation and Role in Cancer.” Seminars in Cell & Developmental Biology 43 (2015): 43–51. As Published http://dx.doi.org/10.1016/j.semcdb.2015.08.004 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/105833 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptSemin Cell Author Manuscript Dev Biol. Author Author Manuscript manuscript; available in PMC 2016 August 13. Published in final edited form as: Semin Cell Dev Biol. 2015 July ; 43: 43–51. doi:10.1016/j.semcdb.2015.08.004. Pyruvate kinase: function, regulation and role in cancer William J. Israelsena,1,* and Matthew G. Vander Heidena,b,* aKoch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA bDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA Abstract Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate and ADP to pyruvate and ATP in glycolysis and plays a role in regulating cell metabolism. There are four mammalian pyruvate kinase isoforms with unique tissue expression patterns and regulatory properties. The M2 isoform of pyruvate kinase (PKM2) supports anabolic metabolism and is expressed both in cancer and normal tissue. The enzymatic activity of PKM2 is allosterically regulated by both intracellular signaling pathways and metabolites; PKM2 thus integrates signaling and metabolic inputs to modulate glucose metabolism according to the needs of the cell.
    [Show full text]
  • Prevalence of Pyruvate Kinase Deficiency
    P3513 Prevalence of Red Cell Pyruvate Kinase Deficiency: A Systematic Literature Review Mike Storm1, Matthew H Secrest2*, Courtney Carrington2, Deb Casso2, Keely Gilroy1, Leanne Pladson1, Audra N Boscoe1 1Agios Pharmaceuticals Inc., Cambridge, MA, USA; 2IQVIA Epidemiology & Drug Safety, Seattle, WA and Cambridge, MA, USA; *Affiliation at the time research was conducted BACKGROUND METHODS (continued) RESULTS (continued) RESULTS (continued) • Pyruvate Kinase (PK) deficiency is a rare congenital hemolytic anemia Exclusion Criteria The remaining 34 studies were grouped based on methods and study Among these 4 studies, an important distinction was made between studies characterized by diminished activity of the PK enzyme in red blood population (Table 1). reporting diagnosed prevalence (n=3) and overall disease prevalence cells (RBC).1 • Non-human studies; (diagnosed and undiagnosed PK deficiency; n=1). Table 1. Distribution of extracted studies by type of study (n=34) • Low PK enzyme activity can lead to lifelong chronic hemolysis with • Publications that were not the primary report of the data • Two studies estimated diagnosed PK deficiency prevalence as 3.2 per associated symptoms and complications such as anemia, jaundice, (e.g., literature reviews); Type of study Number million4 and 8.5 per million5 by identifying diagnosed PK deficiency cases of studies gallstones, splenectomy and associated thrombosis, iron overload, and • Studies of PK deficiency prevalence/incidence conducted within a source from source populations of known size. liver cirrhosis.2 Population-based prevalence 2 population of patients with symptoms of PK deficiency such as anemia • We estimated the prevalence of diagnosed PK deficiency in a general • PK deficiency is caused by compound heterozygosity or homozygosity for or jaundice; Molecular PKLR screening in a general population 5 population to be 6.5 per million6 using data from another high-quality study 3 one or more of the >300 known mutations to the PKLR gene.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pyruvate Kinase, Rbc
    Lab Dept: Chemistry Test Name: PYRUVATE KINASE, RBC General Information Lab Order Codes: PYKI Synonyms: Pyruvate Kinase, Erythrocytes CPT Codes: 84220 – Pyruvate kinase Test Includes: Pyruvate kinase RBC level reported in U/g Hb. Logistics Test Indications: Useful for the workup of cases of nonspherocytic hemolytic anemia, for a family workup to determine inheritance pattern (pyruvate kinase deficiency is autosomal recessive), and for genetic counseling. Lab Testing Sections: Chemistry - Sendouts Referred to: Mayo Medical Laboratories (MML Test: PK) Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: Daily, 24 hours Turnaround Time: 1 - 4 days, test set up Monday - Saturday Special Instructions: N/A Specimen Specimen Type: Whole blood Container: Yellow top (ACD- Solution B) tube Alternate tube: Lavender (EDTA) top tube Draw Volume: 6 mL (Minimum: 1 mL) blood Processed Volume: Same as Draw Volume Collection: Routine blood collection Special Processing: Lab Staff: Do Not centrifuge. Send whole blood refrigerated in original collection container. Do Not transfer blood to other containers. Store and ship at refrigerated temperatures. Forward promptly. Patient Preparation: None Sample Rejection: Specimen cannot be frozen; mislabeled or unlabeled specimens; gross hemolysis Interpretive Reference Range: ≥12 months: 6.7 – 14.3 U/g Hb Reference values have not been established for patients <12 months of age. Interpretation: Most hemolytic anemias due to pyruvate kinase (PK) deficiency are associated with activity levels less than 40% of mean normal. However, some patients with clinically significant hemolysis can have normal or only mildly decreased PK enzyme activity, which paradoxically may occur in individuals with most severe symptoms.
    [Show full text]
  • Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde by ANTONI R
    Biochem. J. (1976) 153, 613-619 613 Printed in Great Britain Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde By ANTONI R. SLABAS and DAVID A. WALKER Department ofBotany, University ofSheffield, Sheffield S1O 2TN, U.K. (Received 10 September 1975) Spinach chloroplast phosphoribulokinase is inhibited by DL-glyceraldehyde. The in- hibition is non-competitive with respect to ribulose 5-phosphate (Ki 19mM) and ATP (Ki 20mM). The inhibition is discussed in relation to a previously reported inhibition of CO2 assimilation in intact and envelope-free chloroplasts by DL-glyceraldehyde. It is concluded that the inhibition of phosphoribulokinase is insufficient to account for the inhibition, by DL-glyceraldehyde, of 02 evolution with ribose 5-phosphate as substrate and that a further site of inhibition is also present in this system. DL-Glyceraldehyde inhibits photosynthetic carbon glycylglycine buffer, pH7.4, in a total volume of assiniilation by intact chloroplasts and by the re- 13 ml. The reaction was terminated by the addition constituted chloroplast system (Stokes & Walker, of 2ml of 50 % (w/v) trichloroacetic acid and the pH 1972). The inhibition is most pronounced with intact was adjusted to pH8.0 with KOH. After the addition chloroplasts, a concentration of 1OmM being sufficient of Sml of 1.OM-barium acetate the solution was to suppress 02 evolution completely. It is important centrifuged and the precipitate discarded after because DL-glyceraldehyde is the only known inhibi- washing with Sml of water. Cold ethanol (4vol.) was tor of photosynthesis that is entirely without detect- added to the combined supernatants (total volume able effect on photophosphorylation or photo- 25.4ml); the new precipitate was recovered by synthetic electron transport.
    [Show full text]
  • Structure-Function Studies of Enzymes from Ribose Metabolism
    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 939 Structure-Function Studies of Enzymes from Ribose Metabolism BY C. EVALENA ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004 !"" #$"" % & % % ' ( ) * + &( , +( !""( - . - % + / % 0 ( , ( 1#1( ( ( 2-3 1. 45 ." 2 * & & * % * &( , % . * % % ( ) % / ( 0 6 / % ,)' & % % & ( )* % 6 % 6 * ( 0 6 * * % ( - % & 7 % & % & && ( ' && ,)' % /( 2 8 * ,)' & ,'.'' ( ) * % / % * 6 & & / 6 ( 0 . . . ( - * & * % %% & ( 9 * 6 / %% % ( -: % & * . & . , /( , & % * /( ) % / % & % ( ! 6 . . & / 6 % " # $ % # %& '()# %$# # *+',-. # ; ( + , !"" 2--3 ".!#!< 2-3 1. 45 ." $ $$$ .#111 = $>> (6(> ? @ $ $$$ .#111A List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I Andersson, C. E. & Mowbray, S. L. (2002). Activation of ribokinase by monovalent cations. J. Mol. Biol. 315, 409-19 II Zhang, R., Andersson, C. E., Savchenko,
    [Show full text]
  • Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J
    Biochemistry 2007, 46, 14845-14853 14845 Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J. Read,| Celia C. H. Chen,§ Aleksandra Tempczyk,§ Min Wei,⊥ Dongmei Ye,⊥ Chun Wu,⊥ Debra Dunaway-Mariano,⊥ and Osnat Herzberg*,§ Center for AdVanced Research in Biotechnology, UniVersity of Maryland Biotechnology Institute, RockVille, Maryland 20850, Department of Haematology, Cambridge Institute for Medical Research, UniVersity of Cambridge, Cambridge, United Kingdom, and Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico ReceiVed September 10, 2007; ReVised Manuscript ReceiVed October 17, 2007 ABSTRACT: Pyruvate phosphate dikinase (PPDK) catalyzes the reversible conversion of phosphoenolpyruvate (PEP), AMP, and Pi to pyruvate and ATP. The enzyme contains two remotely located reaction centers: the nucleotide partial reaction takes place at the N-terminal domain, and the PEP/pyruvate partial reaction takes place at the C-terminal domain. A central domain, tethered to the N- and C-terminal domains by two closely associated linkers, contains a phosphorylatable histidine residue (His455). The molecular architecture suggests a swiveling domain mechanism that shuttles a phosphoryl group between the two reaction centers. In an early structure of PPDK from Clostridium symbiosum, the His445-containing domain (His domain) was positioned close to the nucleotide binding domain and did not contact the PEP/pyruvate- binding domain. Here, we present the crystal structure of a second conformational state of C. symbiosum PPDK with the His domain adjacent to the PEP-binding domain. The structure was obtained by producing a three-residue mutant protein (R219E/E271R/S262D) that introduces repulsion between the His and nucleotide-binding domains but preserves viable interactions with the PEP/pyruvate-binding domain.
    [Show full text]
  • Posttranslational Regulation of Pyruvate, Orthophosphate Dikinase in Developing Rice (Oryza Sativa) Seeds
    Planta (2006) DOI 10.1007/s00425-006-0259-3 ORIGINAL ARTICLE Chris J. Chastain Æ Jarrod W. Heck Thomas A. Colquhoun Æ Dylan G. Voge Xing-You Gu Posttranslational regulation of pyruvate, orthophosphate dikinase in developing rice (Oryza sativa) seeds Received: 16 January 2006 / Accepted: 25 February 2006 Ó Springer-Verlag 2006 Abstract Pyruvate, orthophosphate dikinase (PPDK; (PPDK inactivation) and protein degradation. Immu- E.C.2.7.9.1) is most well known as a photosynthetic noblot analysis of separated seed tissue fractions enzyme in C4 plants. The enzyme is also ubiquitous in (pericarp, embryo + aleurone, seed embryo) revealed C3 plant tissues, although a precise non-photosynthetic that regulatory phosphorylation of PPDK occurs in the C3 function(s) is yet to be validated, owing largely to its non-green seed embryo and green outer pericarp layer, low abundance in most C3 organs. The single C3 organ but not in the endosperm + aleurone layer. The type where PPDK is in high abundance, and, therefore, modestly abundant pool of inactive PPDK (phosphor- where its function is most amenable to elucidation, are ylated + dephosphorylated) that was found to persist the developing seeds of graminaceous cereals. In this in mature rice seeds was shown to remain largely un- report, we suggest a non-photosynthetic function for C3 changed (inactive) upon seed germination, suggesting PPDK by characterizing its abundance and posttrans- that PPDK in rice seeds function in developmental lational regulation in developing Oryza sativa (rice) rather than in post-developmental processes. These and seeds. Using primarily an immunoblot-based approach, related observations lead us to postulate a putative we show that PPDK is a massively expressed protein function for the enzyme that aligns its PEP to pyruvate- during the early syncitial-endosperm/-cellularization forming reaction with biosynthetic processes that are stage of seed development.
    [Show full text]
  • Glucokinase September 15, 2005
    Glucokinase September 15, 2005 Summary Glucokinase phosphorylates glucose into glucose 6-phosphate using ATP as the phosphate group donor, according to the reaction glucose + ATP Æ glucose 6-phosphate + ADP This protocol describes an indirect assay to determine the activity of glucokinase. Glucose 6- phosphate formed by glucokinase is measured by the formation of NADPH in presence of glucose 6-phosphate dehydrogenase. Solutions Required 1. 100 mM tris HCl pH 7.4 Stock solution could be used 2. 100 mM MgSO4·7H2O Stock solution could be used 3. 10 mM glucose Must be prepared fresh 4. 20 mM ATP Must be prepared fresh 5. 10 mM NADP Must be prepared fresh 6. a solution containing 10 U of glucose 6-phosphate dehydrogenase per 50 μL in tris HCl pH 7.4 buffer. This solution is prepared by mixing 40 μL of a 5000 U/mL solution (Sigma G8529) with 960 μL tris buffer. Preparation of Cell Extract Follow general protocol described in Preparation of Cell Extract. The cell extract should be suspended in tris buffer after pelletization. Spectrophotometer Turn on the ultraviolet bulb on the spectrophotometer (Beckman DU50) and wait 10 minutes for warm-up. Select the kinetics-time window on the instrument. Load the method "A:/nadh" ". These methods each have a run-time of 120 s, a temperature of 37°C, a wavelength of 340 nm and use 2 autosamplers. Procedure 1. For each assay, prepare the two cocktails shown in the following table into two separate quartz cuvettes. Keep them on ice. Volume (μL) added to: Solution Control Experimental tris 500 500 DI H2O 200 100 MgSO4 100 100 glucose 0 100 ATP 50 50 NADP 50 50 G6P dehydrogenase 50 50 2.
    [Show full text]
  • Oxidative Stress-Responsive Microrna-320 Regulates Glycolysis in Diverse Biological Systems
    The FASEB Journal • Research Communication Oxidative stress-responsive microRNA-320 regulates glycolysis in diverse biological systems ʈ ʈ ʈ ʈ Huibin Tang,*, Myung Lee,*, Orr Sharpe,†,‡, Louis Salamone,† Emily J. Noonan,§, ʈ ʈ Chuong D. Hoang,*, Sanford Levine,¶ William H. Robinson,†,‡, ʈ and Joseph B. Shrager*, ,1 *Division of Thoracic Surgery, Department of Cardiothoracic Surgery, †Department of Surgery, and ‡Division of Immunology and Rheumatology and §Division of Hematology; Department of Medicine, ʈ Stanford University School of Medicine, Stanford, California, USA; Veterans Affairs Palo Alto Healthcare System, Palo Alto, California, USA; and ¶Department of Surgery, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA ABSTRACT Glycolysis is the initial step of glucose glycolysis in diverse biological systems. FASEB J. 26, catabolism and is up-regulated in cancer cells (the 4710–4721 (2012). www.fasebj.org Warburg Effect). Such shifts toward a glycolytic phenotype have not been explored widely in other Key Words: phosphofructokinase ⅐ muscle ⅐ diaphragm ⅐ biological systems, and the molecular mechanisms mechanical ventilation ⅐ Warburg effect ⅐ Ets underlying the shifts remain unknown. With pro- teomics, we observed increased glycolysis in disused Cells use glucose to generate the energy [adeno- human diaphragm muscle. In disused muscle, lung sine triphosphate (ATP)] that fuels all cellular pro- cancer, and H O -treated myotubes, we show up- 2 2 cesses. Glycolysis is the initial step in glucose catabo- regulation of the rate-limiting glycolytic enzyme mus- lism, and its end products, in most tissues under most cle-type phosphofructokinase (PFKm, >2 fold, circumstances, are fed into mitochondrial oxidative P<0.05) and accumulation of lactate (>150%, phosphorylation.
    [Show full text]
  • Mechanisms of Mycobacterium Tuberculosis Serine/Threonine Protein Kinase Activation by Christina Elizabeth Baer a Dissertation S
    Mechanisms of Mycobacterium tuberculosis Serine/Threonine Protein Kinase Activation by Christina Elizabeth Baer A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Biophysics in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Tom Alber, Chair Professor Carolyn Bertozzi Professor Ehud Isacoff Professor Bryan Krantz Fall 2010 Mechanisms of Mycobacterium tuberculosis Serine/Threonine Protein Kinase Activation © 2010 Christina Elizabeth Baer Abstract Mechanisms of Mycobacterium tuberculosis Serine/Threonine Protein Kinase Activation by Christina Elizabeth Baer Doctor of Philosophy in Biophysics University of California, Berkeley Professor Tom Alber, Chair Mycobacterium tuberculosis (Mtb) coordinates a wide variety of metabolic and cellular responses to changing external environments throughout the multiple stages of infection. Signaling kinases are critical for these responses. The Mtb genome encodes 11 Serine/Threonine Protein Kinases (STPKs) that function as important nodes of this sensing and response network, but the chemical and structural changes that mediate kinase activation have not been elucidated. Autophosphorylation activates several of the Mtb STPKs, and kinase dimerization can activate receptor kinases for autophosphorylation through an allosteric dimer interface. Inter- kinase phosphorylation has been reported, but the function and specificity of these interactions remain unknown. In this study, a biochemical approach was used to comprehensively map the cross-kinase trans-phosphorylation activity of the Mtb STPKs. The results reveal a pattern of kinase interactions that suggests each protein plays a distinct regulatory role in controlling cellular processes by phosphorylating other kinases. The PknB and PknH STPKs act in vitro as master regulators that are activated only through autophosphorylation and also phosphorylate other STPKs.
    [Show full text]