Page 1 of 47 Diabetes
Pancreatic pericytes support beta-cell function in a Tcf7l2-
dependent manner
Lina Sakhneny1, Eleonor Rachi1, Alona Epshtein1, Helen C. Guez1, Shane Wald Altman2, Michal Lisnyansky1, Laura Khalifa Malka1, Adina Hazan3, Daria Baer1, Avi Priel3, Miguel Weil2 and Limor Landsman1*
1Department of Cell and Developmental Biology, Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel 2Department of Cell Research and Immunology, The George S. Wise Faculty of Life Sciences and the Sagol School of Neuroscience, Tel Aviv University, Tel Aviv, Israel 3Institute for Drug Research (IDR), School of Pharmacy, Faculty of Medicine, The Hebrew University of Jerusalem, Jerusalem, Israel
Running title: Pericytic Tcf7l2 in beta cell function
* Address for Correspondence: Limor Landsman, PhD Department of Cell and Developmental Biology Sackler Faculty of Medicine Tel Aviv University Ramat Aviv, Tel Aviv 69978 Israel (T): 972 3 640 6149 (F): 972 3 640 7432 Email: [email protected]
Abstract: 195 words Total word count: 3996 words References: 50 Tables: 0 Figures: 6
Conflict of Interest: The authors have declared that no conflict of interest exists.
1
Diabetes Publish Ahead of Print, published online December 15, 2017 Diabetes Page 2 of 47
Abstract Polymorphism in TCF7L2, a component of the canonical Wnt signaling pathway, has a strong association with β cell dysfunction and type 2 diabetes through a yet to be defined mechanism. β Cells rely on cells in their microenvironment, including pericytes, for their proper function. Here, we show that Tcf7l2 activity in pancreatic pericytes is required for β cell function. Transgenic mice in which Tcf7l2 was selectively inactivated in their pancreatic pericytes exhibited impaired glucose tolerance due to compromised β cell function and glucose stimulated insulin secretion. Inactivation of pericytic Tcf7l2 was associated with impaired expression of genes required for β cell function and maturity in isolated islets. In addition, we identified Tcf7l2 dependent pericytic expression of secreted factors shown to promote β cell function, including BMP4. Finally, we show that exogenous BMP4 is sufficient to rescue the impaired glucose stimulated insulin secretion of transgenic mice, pointing to a potential mechanism through which pericytic Tcf7l2 activity impacts β cells. To conclude, we suggest that pancreatic pericytes produce secreted factors, including BMP4, in a Tcf7l2 dependent manner to support β cell function. Our findings thus propose a potential cellular mechanism through which abnormal TCF7L2 activity predisposes individuals to diabetes, and implicate abnormalities in the islet microenvironment in this disease.
2 Page 3 of 47 Diabetes
Introduction Type 2 diabetes has a strong genetic component, with a number of genetic variations
associated with an increased risk to develop this disease (1,2). In particular, polymorphism
in the TCF7L2 (TCF4) is associated with increased risk to diabetes (3). This gene encodes a
member of TCF/LEF (T cell factor/lymphoid enhancer factor) transcription factors family,
which functions downstream of the canonical Wnt signaling pathway by recruiting β catenin
to target genes (4). Diabetes associated alleles of TCF7L2 (such as the T allele of the
single nucleotide polymorphism (SNP) in rs7903146) are associated with impaired glucose
stimulated insulin secretion (GSIS) and insulin production, but intact hepatic function and
insulin sensitivity (3,5 8). The T allele of rs7903146 variant was predicted to result in an
inactive protein lacking its DNA binding domain (9). However, how TCF7L2 functions to
regulate glucose homeostasis remains an open question.
To date, the use of mouse systems to determine the cellular mechanism(s) through
which abnormal Tcf7l2 activity contributes to β cell dysfunction has produced conflicting
results. As opposed to humans, hepatic phenotypes dominate the abnormal glucose levels
observed upon body wide deregulation of Tcf7l2 expression in mice (10 12). β Cell specific
inference with Tcf7l2 activity using mouse genetic tools yielded discrepant results, with some
studies showing reduced β cell mass and glucose intolerance, while others showing normal
glucose response (12 17). This contradiction could partially stem from the use of different
approaches to interfere with Tcf7l2 activity, i.e., knock down of the endogenous gene
(12,14,15) versus overexpressing a dominant negative (DN) form (13,16). Recently, Tcf7
(Tcf1), a member of the TCF/LEF family with high homology to Tcf7l2, was shown to play a
central role in maintaining β cell mass (18), raising the possibility that over expressing an
DN Tcf7l2 interferes with the activity of other TCF/LEF proteins in β cells. Interestingly, while
β cell selective deletion of Tcf7l2 resulted in their reduced mass (15), selective deletion of
this transcription factor DNA binding domain affected neither β cell function nor mass (12).
3 Diabetes Page 4 of 47
Accordingly, non autonomous roles of Tcf7l2 in regulating β cell function were suggested
(17).
β Cells rely on extrinsic cues, including these provided by cells of the islet microenvironment, for their proper function (19,20). Recently, others and we showed that pericytes, which together with endothelial cells make the dense islet capillary network, support β cell function and glucose homeostasis (21,22). While abnormalities in islet pericytes were implicated in obesity and type 2 diabetes (23), whether impaired pericyte function contributes to β cell dysfunction and disease progression remains an open question.
Profiling pancreatic pericytes’ gene expression revealed the expression of Tcf7l2 in these cells. We hypothesized that Tcf7l2 activity in pancreatic pericytes is required for their ability to properly support β cell function. To test our hypothesis, we selectively expressed an inactive form of this transcription factor in these cells by combining two transgenic mouse lines: Tcf7l2flox, which allows Cre mediated deletion of this transcription factor DNA binding domain (24), and Nkx3.2 Cre (25), which selectively targets mural cells of the pancreas (21).
Our results show an impaired glucose tolerance, but intact insulin sensitivity, in male mice homozygous for mutated Tcf7l2. Our analysis pointed to impaired GSIS and reduced expression of genes required for β cell function and maturity upon inactivation of pericytic
Tcf7l2. Lastly, we linked Tcf7l2 dependent pericytic expression of Bone Morphogenetic
Protein 4 (BMP4) to glucose regulation. To conclude, our results indicate that pericytic
Tcf7l2 activity is required for β cell function and glucose homeostasis. Our findings further point to the contribution of abnormal pericytes activity to diabetes progression.
4 Page 5 of 47 Diabetes
Research Design and Methods Mice
All experiments were performed according to protocols approved by the Committee on
Animal Research at Tel Aviv University. Nkx3.2 Cre (Nkx3–2tm1(cre)Wez)(25) and Tcf7l2flox
(Tcf7l2tm2.1Cle)(24) mice were generous gifts from Warren Zimmer (Texas A&M University,
TX) and Hans Clevers (Hubrecht Institute, Utrecht, The Netherlands), respectively. R26 YFP
(Gt(ROSA)26Sortm1(EYFP)Cos) mice were obtained from The Jackson Laboratory. For diet
induced obesity, mice were placed on a high fat diet (HFD; 60% fat [kCal]; Teklad) at 6
weeks of age. Mice were intraperitoneally injected with dextrose (Sigma), insulin (Lilly), or
mouse recombinant BMP (rBMP4; R&D) when indicated. For analysis of functional
vasculature, fluorescein labeled tomato lectin (Vector) was injected intravenously and
allowed to circulate for 5 minutes before the animal was euthanized.
Flow cytometry
Cell isolation were performed as described (26). Cells were stained with primary antibodies
(Supplementary Table 1) when indicated, and either collected using FACS Aria (BD) or
analyzed using Gallios flow cytometer (Beckman Coulter) and Kaluza software (Beckman
Coulter).
Hormone detection
Islets were isolated according to standard protocols (21). For insulin secretion, following their
overnight culture, isolated islets were incubated in RPMI medium supplemented with
glucose for 1 hour. Pancreas and islet insulin was extracted by overnight incubation in 1.5%
HCl and 70% Ethanol mixture. Hormone levels were determined using mouse Ultrasensitive
Insulin ELISA (Alpco), mouse Proinsulin ELISA (Alpco) and GLP 1 (7 36) Active Elisa kit
(Millipore).
Immunofluorescence
Dissected tissues were fixed in paraformaldehyde (4%), followed by cryo sectioning. Tissue
section were stained with primary antibodies (Supplementary Table 1) followed by
secondary fluorescent antibodies (AlexaFluor, Invitrogen). Following staining with anti Tcf7l2
5 Diabetes Page 6 of 47
antibody, TSA Fluorescein System (PerkinElmer) was used. For TUNEL assay, In Situ Cell
Death Detection Kit (Roche) was used. Images were acquired using Keyence BZ 9000
(Biorevo) and SP8 confocal (Leica) Microscopes.
Morphometric analysis
Analysis of islet vasculature was performed as described (21). For measurement of β cell mass, immuno stained paraffin embedded tissue sections were counterstained with HCS
CellMask Stain (Invitrogen) to label the whole tissue sections. Sections were automatically imaged using InCell 2000 analyzer (GE) and analyzed by developer software (GE).
Gene expression
RNA was extracted using PureLink RNA micro kit (Invitrogen). For RNA deep sequencing, amplification, cDNA library preparation, sequencing and bioinformatics analysis were performed using commercial services (Otogenetics). Gene expression data have been deposited in ArrayExpress (http://www.ebi.ac.uk/arrayexpress/arrays/E MTAB 5325). For qPCR analysis, Taqman and SYBR green assays (Invitrogen; Supplementary Table 2) were used, normalized to GAPDH and Cyclophilin expression, respectively.
Statistics
Paired data were evaluated using two tailed Student’s t test.
6 Page 7 of 47 Diabetes
Results
Pancreatic pericytes express the transcription factor Tcf7l2
We recently showed that pericytes support β cell function (21). Here, we set to elucidate the
molecular basis of pericyte activity. To this end, we employed the Nkx3.2 Cre mouse line
(25) to manipulate pancreatic mural cells. Nkx3.2 (Bapx1) is expressed in the mesenchymal
compartment of the embryonic gut, stomach and pancreatic buds, as well as in skeletal
somites (27). We recently showed that in the adult pancreas, Nkx3.2 Cre line targets mural
cells, including islet pericytes and vSMCs (vascular smooth muscle cells), but no other
pancreatic cell types (including epithelial and endothelial cells) ((21) and Supplementary Fig.
1). Pericytes (identified by expression of NG2 [Neural/Glial antigen 2] and desmin) in the
exocrine pancreas were also targeted by this Cre, as apparent fluorescent labeling of these
cells in the pancreas of Nkx3.2 Cre;R26 YFP mice (Supplementary Fig. 1). Of note, hepatic
pericytes, which were shown to regulate insulin response (28), are not targeted by this
mouse line (Supplementary Fig. 1). Thus, our analysis indicated that Nkx3.2 Cre line targets
mural cells in both the endocrine and exocrine pancreas.
Next, we characterized pancreatic mural cells by profiling their gene expression. To
this end, cells were sorted from pancreatic tissues of Nkx3.2 Cre;R26 YFP mice based on
their fluorescent labeling (Supplementary Fig. 1). Of note, vast majority of labeled cells
express PDGFRβ (Platelet Derived Growth Factor Receptor β), which is expressed by
pericytes but not vSMCs (Supplementary Fig. 1)(29). RNA was extracted from sorted cells,
and subjected to deep sequencing (Supplementary Table 3). Gene ontology (GO) term
analysis revealed that pancreatic mural cells were enriched with components of Wnt
signaling (Fig. 1A; 126 genes). Interestingly, these cells expressed two of the four
mammalian TCF/LEF transcription factors: Tcf7l1 and Tcf7l2 (Fig. 1B). Considering the
association of polymorphism in TCF7L2 with β cell dysfunction and diabetes, we focused our
analysis on this transcription factor.
7 Diabetes Page 8 of 47
To validate Tcf7l2 expression, we performed qPCR, western blot, and immunofluorescence analyses. Tcf7l2 transcript and protein were detected in purified pancreatic mural cells (Fig. 1C and Supplementary Fig. 2). Notably, Tcf7l2 mRNA levels in mural cells were 5 fold higher than in islets, and 22 fold higher than in bulk pancreatic tissue
(Fig. 1C). Tcf7l2 protein was detected in the nuclei of pancreatic pericytes, including those associated with islets (Fig. 1D, E), but not in the nuclei of vSMCs (identified by expression of
αSMA [α Smooth Muscle Actin] and localization around large blood vessels; Fig. 1F). In agreement with previous studies reporting low Tcf7l2 transcript and protein levels in pancreatic endocrine cells (30 33), we did not detect this transcription factor in β cells and isolated islets (Fig. 1E and Supplementary Fig. 2). To conclude, our analyses revealed the expression of Tcf7l2 by pancreatic pericytes.
Tcf7l2 activity in pancreatic pericytes is required for glucose homeostasis
To test the requirement of pericytic Tcf7l2 for glucose regulation, we set to interfere with this transcription factor activity in these cells. The diabetes associated T allele of rs7903146 variant was predicted to result in an inactive Tcf7l2 protein lacking its DNA binding domain
(9). We therefore employed a previously described transgenic mouse line, Tcf7l2flox, allowing
Cre mediated deletion of the endogenous Tcf7l2 DNA binding domain, rendering it inactive
(24). Of note, all splice variants are present in mice carrying this transgene (24). To selectively inactive this transcription factor in pancreatic pericytes, the Tcf7l2flox transgenic mouse line was crossed with the Nkx3.2 Cre line. To verify recombination of the Tcf7l2 locus, we analyzed its transcript levels by employing primers providing detection of wild type
Tcf7l2, but not its recombined form (12,24). To allow isolation of pancreatic mural cells by flow cytometry (as described in Supplementary Fig. 1), a R26 YFP transgene was included to generate Nkx3.2 Cre;R26 YFP;Tcf7l2flox/+ and Nkx3.2 Cre;R26 YFP;Tcf7l2flox/flox mice, as well as Nkx3.2 Cre;R26 YFP control mice. As shown in Figure 2A, wild type Tcf7l2 was nearly absent from pancreatic mural cells of homozygous mice, and was significantly reduced in cells of heterozygous mice as compared to control mice. Of note, the expression
8 Page 9 of 47 Diabetes
levels of wild type Tcf7l2 in islets isolated from homozygous and heterozygous mice were
comparable to those of controls (Fig. 2B).
To analyze mice glucose response, we performed intraperitoneal glucose tolerance
tests (IPGTT) on three groups of mice: homozygous for the inactive Tcf7l2 allele (Nkx3.2
Cre;Tcf7l2flox/flox), heterozygous for this allele (Nkx3.2 Cre;Tcf7l2flox/+), and non transgenic
controls (Cre negative: Tcf7l2flox/+ or Tcf7l2flox/flox). Of note, mice expressing the Nkx3.2 Cre
transgene by itself (i.e., do not carry the Tcf7l2flox transgene) displayed comparable glucose
response to Cre negative control mice (Supplementary Fig. 3). As shown in Figure 2C, our
analysis revealed that 13 week old homozygous, but not heterozygous male mice, display
an impaired glucose response as compared to littermate controls (Fig. 2C). TCF7L2
rs7903146 T allele was shown to have a modest effect on β cell function, which becomes
more evident when insulin action decreases (34). To test if metabolic stress aggravates
glucose intolerance of transgenic mice, we placed mice on HFD (60% fat) to induce obesity.
Our analysis revealed that heterozygous and homozygous obese animals were glucose
intolerant (Fig. 2D). Thus, our findings indicate that reduced levels of active Tcf7l2 in
pericytes (in heterozygous mice) were sufficient to maintain glucose response in lean, but
not obese, mice, while its complete loss (in homozygous mice) induced glucose intolerance
in both lean and obese animals.
Polymorphism in TCF7L2 is associated with an increased risk of diabetes in both
women and men (8). However, we did not observe differences in glucose response of
transgenic and control female mice (Supplementary Fig. 3). Female and male mice differ in
their glucose metabolism (35). Thus, sex dependent differences may underlie the distinct
phenotype observed in female and male Nkx3.2 Cre;Tcf7l2flox/flox mice.
The Nkx3.2 Cre mouse line has non pancreatic expression in the gastrointestinal
mesenchyme and skeleton (25,27). We therefore analyzed for potential changes in function
of these tissues in Nkx3.2 Cre;Tcf7l2flox/flox and Nkx3.2 Cre;Tcf7l2flox/+ mice that could
contribute to their glucose intolerance. The three analyzed mouse groups show comparable
body weight under both regular chow and HFD, indicating normal food uptake and digestion
9 Diabetes Page 10 of 47
(Supplementary Fig. 4). Next, we analyzed for GLP 1 (Glucagon like peptide 1) production by analyzing gut expression of Pcsk1 and Gcg (encoding prohormone convertases 1/3 and proglucagon, respectively) and measuring serum GLP 1 levels, and found them comparable in Nkx3.2 Cre;Tcf7l2flox/flox and control mice (Supplementary Fig. 4). Finally, insulin sensitivity was comparable between Nkx3.2 Cre;Tcf7l2flox/flox, Nkx3.2 Cre;Tcf7l2flox/+, and control (Cre negative) male mice, on both normal diet and HFD (Supplementary Fig. 4).
To conclude, our results implicate that Tcf7l2 activity in pancreatic pericytes is required for glucose regulation in vivo, without affecting insulin sensitivity. Furthermore, our analysis suggests that the requirement of pericytic Tcf7l2 activity for glucose regulation is more evident upon metabolic stress.
Functional islet vasculature in Nkx3.2-Cre;Tcf7l2flox/flox transgenic mice
Pericytes support endothelial cell function and blood flow (29). We therefore set to analyze whether Tcf7l2 inactivation in pancreatic pericytes interferes with islet vascularization. To this end, Nkx3.2 Cre;Tcf7l2flox/flox and control mice were intravenously injected with tomato lectin to label functional vessels. Our analysis revealed intact Islet vascularization distribution and density in transgenic mice (Fig. 3A and B). In agreement, expression levels of the hypoxia gene Hif1a was comparable in islets isolated from the two mouse groups (Fig.
3C). Thus, our analysis indicates that loss of pericytic Tcf7l2 activity did not interfere with functionality of islet vasculature.
βββ-Cell dysfunction upon pericytic Tcf7l2 inactivation
We previously showed that islet pericytes support β cell function (21). We therefore set to determine if β cell dysfunction underlies the observed glucose intolerance upon loss of
Tcf7l2 activity in pancreatic pericytes. To test if the impaired glucose response is associated with insufficient GSIS, we measured glucose stimulated serum insulin levels and found them to be lower in Nkx3.2 Cre;Tcf7l2flox/flox mice (Fig. 4A). Next, we analyze if β cell mass and/or function are affected in Tcf7l2 deficient mice. Our analysis indicated normal islet morphology
10 Page 11 of 47 Diabetes
and comparable pancreatic and β cell mass in transgenic mice (Fig. 4B D). In agreement
with these findings, we observed neither β cell death nor expression of genes associated
with β cell stress in islets of transgenic mice (i.e., Chop, Atf4; Supplementary Fig. 5). To test
for potential changes in β cell function we analyzed GSIS of isolated islets, and found that
those of transgenic mice secrete less insulin in response to high glucose levels, as
compared to control islets (Fig. 4E). Thus, our analysis points to β cell dysfunction upon
inactivation of pericytic Tcf7l2.
Next, we measured insulin content in isolated islets and pancreatic tissues from
Nkx3.2 Cre;Tcf7l2flox/flox and control animals, and found them to be significantly reduced in
homozygous animals (Fig. 4F and G). While gene expression analysis indicated that the
levels of Ins1 and Ins2 transcripts, encoding insulin, were on average lower in transgenic
islets, this reduction was not statistically significant (Fig. 4H). While we detected a
statistically significant reduction in expression levels of Pcsk1, required for post translational
processing of insulin, in Nkx3.2 Cre;Tcf7l2flox/flox islets (Fig. 4H), the ratio between proinsulin
and insulin levels were comparable in transgenic and control islets (Fig. 4I). In addition, Gcg
levels were comparable in Nkx3.2 Cre;Tcf7l2flox/flox and control islets (Fig. 4J). To conclude,
we observed reduced islet and pancreatic insulin content upon inactivation of pericytic
Tcf7l2.
Nkx3.2 Cre;Tcf7l2flox/flox islets secrete a smaller portion of their insulin content in
response to glucose challenge, indicating an impaired GSIS independent of abrogated
insulin production (Fig. 4E’). To analyze if the observed impaired GSIS in Nkx3.2
Cre;Tcf7l2flox/flox islets is associated with changes in expression levels of genes required for
glucose sensing and insulin secretion, we analyzed islets for expression of Glut2, Kir6.2 and
Sur1. As shown in Figure 4K, all three genes were expressed at lower levels in Nkx3.2
Cre;Tcf7l2flox/flox islets as compared to control. In contrast, expression of Glpr1, encoding the
GLP 1 receptor, was comparable in transgenic and control islets (Fig. 4L). β Cell function
and gene expression have been shown to depend on transcription factors, including MafA,
11 Diabetes Page 12 of 47
Pdx1 and NeuroD1 (2). We observed reduced transcripts level of all three in islets from
Nkx3.2 Cre;Tcf7l2flox/flox mice as compared to control (Fig. 4M). Thus, inactivation of pericytic
Tcfl72 is associated with impaired expression of β cell genes.
To conclude, our findings indicate that while β cell mass was unaffected in Tcf7l2 transgenic mice, their functionality was impaired. Furthermore, our analysis suggests that normal expression of β cell genes associated with their function and maturity is dependent on Tcf7l2 activity in pancreatic pericytes.
Tcf7l2 regulates pericytic expression of ligands shown to support βββ-cell function
Our findings point to a Tcf7l2 dependent activity of pancreatic pericytes in supporting β cell function and gene expression. We therefore set to analyze potential changes in pancreatic pericytes upon inactivation of Tcf7l2. Our immunofluorescence analysis revealed that pericytes are localized in proximity to endothelial cells in both control and transgenic islets
(Fig. 5A). However, morphometric analysis revealed that pericyte coverage was mildly reduced in islets of Nkx3.2 Cre;Tcf7l2flox/flox mice as compared to control (by 7%; Fig. 5B).
Next, we analyzed whether loss of Tcf7l2 activity affect their gene expression. To this end, pancreatic mural cells were purified by flow cytometry (as described in Supplementary
Fig. 1) from Nkx3.2 Cre;R26 YFP;Tcf7l2flox/flox and control Nkx3.2 Cre;R26 YFP mice, and islets were isolated from non transgenic mice, and their RNA was extracted and sequenced.
We hypothesized that pericytes secrete factors to support β cells under normal conditions, and the expression of some of these factors is Tcf7l2 dependent. We thus focused our analysis on genes that encode secreted ligands that are expressed by non transgenic pancreatic mural cells, but not by isolated islets (Supplementary Table 4). The expression levels of seven of these genes were significantly lower in Tcf7l2 transgenic pancreatic mural cells (Fig. 5C and Supplementary Table 5): Bmp4, Ccl2, Ccl7, C7, Il6, Fam150b and Nmb.
Tcf7l2 was previously shown to directly regulate the expression of first three genes (36 38).
Importantly, β cells were shown to express the receptors for BMP4, Neuromedin B, and IL 6
12 Page 13 of 47 Diabetes
(encoded by Bmp4, Nmb, and Il6, respectively), and these three factors were implicated in
β cell function (39 41).
To conclude, our analysis showed that lack of Tcf7l2 activity in pancreatic pericytes
lead to mildly reduced islet pericyte density, and further resulted in impaired expression of
secreted ligands by these cells, some of which were implicated in β cell function.
Impaired glucose response in Tcfl72-deficient mice is rescued by exogenous
BMP4
β Cells were shown to depend on the activity of the BMP4 receptor, BMPR1A, for their
proper function in vivo (40). In addition, elevating BMP4 levels in vivo (by pancreatic
expression of a Bmp4 transgene or systemic administration of rBMP4) improved mice
glucose response and promoted the mature β cell phenotype (40). Importantly, Tcf7l2 was
shown to directly promote Bmp4 expression through its identified binding sites on this gene
promotor (36,42). We therefore hypothesized that BMP4 produced by pericytes in Tcf7l2
dependent manner supports β cell function. To test our hypothesis, we first validated
pericytic Bmp4 expression by qPCR analysis, which revealed reduced transcript levels in
Tcf7l2 deficient mural cells to a third of the level found in control cells (Fig. 6A).
To study the contribution of reduced BMP4 production by pericytes to the observed
phenotype in Nkx3.2 Cre;Tcf7l2flox/flox mice, we intraperitoneally injected rBMP4 to
homozygous mice (40). As shown in Figure 6, glucose tolerance and GSIS of rBMP4 treated
animals were significantly improved as compared to untreated transgenic animals.
Importantly, glucose response and insulin secretion of rBMP4 treated Nkx3.2
Cre;Tcf7l2flox/flox mice were comparable to that of non transgenic control animals (Fig. 6B and
C).
To analyze if the improved GSIS upon rBMP4 treatment of Nkx3.2 Cre;Tcf7l2flox/flox
mice is associated with improvement in their β cell mature phenotype, we cultured isolated
islets in the presence or absence of this recombinant protein. Treating Nkx3.2
Cre;Tcf7l2flox/flox islets with rBMP4 for 24 hours promoted the expression of Pdx1 and MafA,
13 Diabetes Page 14 of 47
encoding transcription factors associated with mature β cell phenotype (Fig. 6D). Of note, in agreement with previous studies (43,44), we could not observe changes in the genes expression levels in similarly treated wild type islets (Supplementary Fig. 6).
To conclude, our analysis showed that extrinsic BMP4 was sufficient to rescue glucose response, GSIS and mature β cell gene expression in mice deficient of pericytic
Tcf7l2. Thus, our findings suggest that pericytes support β cell function through Tcf7l2 depedent production of BMP4.
14 Page 15 of 47 Diabetes
Discussion Here, we show that pericytes support β cell function and glucose response in a Tcf7l2
dependent manner. To analyze the requirement of this transcription factor for pericyte
function, we selectively expressed a mutated form of Tcf7l2, lacking its DNA binding domain,
in pancreatic pericytes. Loss of pericytic Tcf7l2 activity interfered with mice glucose
regulation due to impaired β cell function (Fig. 2 and 4). Our analysis further indicated
Tcf7l2 dependent pericytic expression of secreted factors implicated in β cell function,
including BMP4 (Fig. 5). Finally, we showed that treatment of Tcf7l2 deficient mice with
exogenous rBMP4 was sufficient to rescue their glucose intolerance and impaired GSIS
phenotype (Fig. 6). Thus, we suggest that pancreatic pericytes express secreted factors in a
Tcf7l2 dependent manner to support β cell function and glucose response. Our findings
propose that impaired pericytic activity perturbs β cell function, thus potentially contributing
to disrupted glucose regulation and diabetes progression.
Abnormalities in islet pericytes were implicated in obesity and diabetes (23). Others
and we showed that pericytes directly support β cell function and glucose regulation (21,22).
Interestingly, SORCS1, a type 2 diabetes associated gene that encodes a PDGF binding
protein, was suggested to regulate pericyte function (23,45). However, whether impaired
pericyte activity contributes to diabetes progression remains an open question. The findings
of this study suggest that diabetes associated changes in pancreatic pericytes lead to
impaired glucose regulation. This raises the possibility that abnormalities in the islet
microenvironment in individuals with diabetes contribute to β cell dysfunction and loss of
glucose regulation.
Our analysis revealed that pericytes produce BMP4 in Tcf7l2 dependent manner to
support glucose response (Fig. 5 and 6). Treatment of Nkx3.2 Cre;Tcf7l2flox/flox mice with
rBMP4 was sufficient to rescue their glucose tolerance, strengthening the importance of this
factor in supporting proper β cell function. While the BMP4 BMPR1A pathway was shown to
promote β cell function and gene expression in vivo (40), treating isolated islets with rBMP4
15 Diabetes Page 16 of 47
either did not affect β cells or impaired their survival and function (43,44), pointing to the requirement of regulated BMP4 levels for proper β cell function. Loss of BMPR1A function in
β cells resulted in a more severe glucose intolerance phenotype than the one observed by us upon loss of pericytic Tcf7l2 (compare Reference (40) and Fig. 2). These differences might reflect the presence of residual pericytic BMP4 in transgenic mice and/or additional pancreatic BMP4 sources, as suggested (40).
Loss of pericytic Tcf7l2 activity was associated with a reduction in pancreatic and islet insulin content (by 50 and 38%, respectively; Fig. 4). Together with the unaffected insulin / proinsulin ratio, this observation indicates an impaired insulin biosynthesis in
Nkx3.2 Cre;Tcf7l2flox/flox mice. While Ins1 and Ins2 transcript levels were on average lower in transgenic islets (by 39 and 33%, respectively; Fig. 4), this reduction was not statistical significant. Thus, reduced insulin content accompanying the loss of pericytic Tcf7l2 could potentially result from an impaired post transcriptional regulation of insulin biosynthesis, such as compromised proinsulin translation (46).
Tcf7l2 was proposed to support β cell function in a cell autonomous manner (14,15).
However, whether impaired Tcf7l2 activity in β cells is sufficient to drive diabetes progression remains controversial (12,17,47,48). Accordingly, Tcf7l2 was suggested to regulate β cell function in a non autonomous manner (12,17). For example, pancreatic and non pancreatic incretin production was recently shown to depend on this transcription factor
(49,50). Our findings provide additional evidence for a non autonomous role of Tcf7l2 in β cell function, through regulation the pericyte/β cell axis.
Polymorphism in TCF7L2 has a strong correlation to type 2 diabetes in humans
(3,5,6). In particular, the T allele of rs7903146 was shown by multiple studies to increase the risk of developing this disease (by 30%)(5). Individuals harboring one or two copies of this allele display reduced basal and glucose stimulated insulin secretion, but maintain hepatic function (6,7,34). As shown in this study, while mice lacking Tcf7l2 activity in their pancreatic pericytes were glucose intolerant, they did not develop diabetes, even when
16 Page 17 of 47 Diabetes
subjected to a HFD (Fig. 2). These discrepancies could reflect the evident difference in
physiologies of humans and mice. Alternatively, TCF7L2 may act in multiple cell types to
regulate glucose homeostasis, and loss of its activity in a single cell type is insufficient to
drive diabetes progression. Lastly, while impaired TCF7L2 activity increases the risk of
developing diabetes, additional genetic and environmental factors contribute to disease
progression (1). Nevertheless, impaired β cell function upon loss of pericytic TCF7L2 activity
proposes a cellular mechanism through which mutations in this transcription factor
predispose individuals to diabetes.
17 Diabetes Page 18 of 47
Acknowledgments We thank Maya Avraham and Shani Mizrachi (Tel Aviv University) for technical assistance.
This work was supported by European Research Council starting grant (336204; to L.L.).
This work was carried out in partial fulfillment of the requirements for a Ph.D. degree for L.S. from the Sackler Faculty of Medicine, Tel Aviv University, Tel Aviv, Israel.
Duality of Interest No potential conflicts of interest relevant to this article were reported.
Author contributions L.S. conducted experiments, acquired and analyzed data, and wrote the manuscript, E.R.,
A.E, and H.C.G conducted experiments, acquired and analyzed data, S.W. A. analyzed data, M.L., L.M. K., A.H., and D.B. conducted experiments and acquired data, A.P. and
M.W. provided reagents, and L.L. designed and supervised research, analyzed data, and wrote the manuscript. L.L. is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.
Prior Presentation This study was presented at the 2nd Joint Meeting of the European Association for the
Study of Diabetes (EASD) Islet Study Group and Beta Cell Workshop, Dresden, Germany,
7 11 May 2017 and the American Diabetes Association (ADA) 77th Scientific Session, San
Diego, CA, 9 13 June 2017.
18 Page 19 of 47 Diabetes
References
1. McCarthy MI. Genomics, type 2 diabetes, and obesity. N Engl J Med. 2010 Dec 9;363(24):2339–50.
2. Doria A, Patti M E, Kahn CR. The emerging genetic architecture of type 2 diabetes. Cell Metabolism. 2008 Sep;8(3):186–200.
3. Grant SFA, Thorleifsson G, Reynisdottir I, Benediktsson R, Manolescu A, Sainz J, et al. Variant of transcription factor 7 like 2 (TCF7L2) gene confers risk of type 2 diabetes. Nat Genet. 2006 Mar;38(3):320–3.
4. Nusse R, Clevers H. Wnt/β Catenin Signaling, Disease, and Emerging Therapeutic Modalities. Cell. 2017 Jun 1;169(6):985–99.
5. Helgason A, Pálsson S, Thorleifsson G, Grant SFA, Emilsson V, Gunnarsdottir S, et al. Refining the impact of TCF7L2 gene variants on type 2 diabetes and adaptive evolution. Nat Genet. 2007 Feb;39(2):218–25.
6. Lyssenko V, Lupi R, Marchetti P, Del Guerra S, Orho Melander M, Almgren P, et al. Mechanisms by which common variants in the TCF7L2 gene increase risk of type 2 diabetes. Journal of Clinical Investigation. 2007 Aug;117(8):2155–63.
7. Varghese RT, Viegas I, Barosa C, Marques C, Shah M, Rizza RA, et al. Diabetes Associated Variation in TCF7L2 Is Not Associated With Hepatic or Extrahepatic Insulin Resistance. Diabetes. 2016 Apr;65(4):887–92.
8. Zhang C, Qi L, Hunter DJ, Meigs JB, Manson JE, van Dam RM, et al. Variant of Transcription Factor 7 Like 2 (TCF7L2) Gene and the Risk of Type 2 Diabetes in Large Cohorts of U.S. Women and Men. Diabetes. 2006 Sep 1;55(9):2645–8.
9. Locke JM, da Silva Xavier G, Rutter GA, Harries LW. An alternative polyadenylation signal in TCF7L2 generates isoforms that inhibit T cell factor/lymphoid enhancer factor (TCF/LEF) dependent target genes. Diabetologia. 2011;54(12):3078–82.
10. Savic D, Ye H, Aneas I, Park S Y, Bell GI, Nobrega MA. Alterations in TCF7L2 expression define its role as a key regulator of glucose metabolism. Genome Res. 2011 Sep;21(9):1417–25.
11. Oh K J, Park J, Kim SS, Oh H, Choi CS, Koo S H. TCF7L2 modulates glucose homeostasis by regulating CREB and FoxO1 dependent transcriptional pathway in the liver. PLoS Genet. 2012 Sep;8(9):e1002986.
12. Boj SF, Van Es JH, Huch M, Li VSW, José A, Hatzis P, et al. Diabetes Risk Gene and Wnt Effector Tcf7l2/TCF4 Controls Hepatic Response to Perinatal and Adult Metabolic Demand. Cell. 2012 Dec 21;151(7):1595–607.
13. Takamoto I, Kubota N, Nakaya K, Kumagai K, Hashimoto S, Kubota T, et al. TCF7L2 in mouse pancreatic beta cells plays a crucial role in glucose homeostasis by regulating beta cell mass. Diabetologia. 2014 Mar;57(3):542–53.
14. da Silva Xavier G, Mondragon A, Sun G, Chen L, McGinty JA, French PM, et al. Abnormal glucose tolerance and insulin secretion in pancreas specific Tcf7l2 null mice. Diabetologia. 2012 Oct;55(10):2667–76.
19 Diabetes Page 20 of 47
15. Mitchell RK, Mondragon A, Chen L, McGinty JA, French PM, Ferrer J, et al. Selective disruption of Tcf7l2 in the pancreatic β cell impairs secretory function and lowers β cell mass. Hum Mol Genet. 2015 Mar 1;24(5):1390–9.
16. Shao W, Xiong X, Ip W, Xu F, Song Z, Zeng K, et al. The expression of dominant negative TCF7L2 in pancreatic beta cells during the embryonic stage causes impaired glucose homeostasis. Molecular Metabolism. 2015 Apr 1;4(4):344–52.
17. Bailey KA, Savic D, Zielinski M, Park S Y, Wang L J, Witkowski P, et al. Evidence of non pancreatic beta cell dependent roles of Tcf7l2 in the regulation of glucose metabolism in mice. Hum Mol Genet. 2015 Mar 15;24(6):1646–54.
18. Campbell JE, Ussher JR, Mulvihill EE, Kolic J. TCF1 links GIPR signaling to the control of beta cell function and survival. Nat Med. 2015;22(1):84–90.
19. Eberhard D, Lammert E. The pancreatic beta cell in the islet and organ community. Curr Opin Genet Dev. 2009 Oct;19(5):469–75.
20. Brissova M, Aamodt K, Brahmachary P, Prasad N, Hong J Y, Dai C, et al. Islet microenvironment, modulated by vascular endothelial growth factor A signaling, promotes β cell regeneration. Cell Metabolism. 2014 Mar 4;19(3):498–511.
21. Sasson A, Rachi E, Sakhneny L, Baer D, Lisnyansky M, Epshtein A, et al. Islet Pericytes Are Required for β Cell Maturity. Diabetes. 2016 Oct;65(10):3008–14.
22. Houtz J, Borden P, Ceasrine A, Minichiello L, Kuruvilla R. Neurotrophin Signaling Is Required for Glucose Induced Insulin Secretion. Dev Cell. 2016 Nov 7;39(3):329–45.
23. Richards OC, Raines SM, Attie AD. The role of blood vessels, endothelial cells, and vascular pericytes in insulin secretion and peripheral insulin action. Endocr Rev. 2010 Jun;31(3):343–63.
24. Van Es JH, Haegebarth A, Kujala P, Itzkovitz S, Koo B K, Boj SF, et al. A critical role for the Wnt effector Tcf4 in adult intestinal homeostatic self renewal. Mol Cell Biol. 2012 May;32(10):1918–27.
25. Verzi MP, Stanfel MN, Moses KA, Kim B M, Zhang Y, Schwartz RJ, et al. Role of the homeodomain transcription factor Bapx1 in mouse distal stomach development. Gastroenterology. 2009 May;136(5):1701–10.
26. Epshtein A, Sakhneny L, Landsman L. Isolating and Analyzing Cells of the Pancreas Mesenchyme by Flow Cytometry. JoVE. 2017 Jan 28;(119):e55344–4.
27. Tribioli C, Lufkin T. Molecular cloning, chromosomal mapping and developmental expression of BAPX1, a novel human homeobox containing gene homologous to Drosophila bagpipe. Gene. 1997 Dec 12;203(2):225–33.
28. Raines SM, Richards OC, Schneider LR, Schueler KL, Rabaglia ME, Oler AT, et al. Loss of PDGF B activity increases hepatic vascular permeability and enhances insulin sensitivity. Am J Physiol Endocrinol Metab. 2011 Sep;301(3):E517–26.
29. Armulik A, Genové G, Betsholtz C. Pericytes: developmental, physiological, and pathological perspectives, problems, and promises. Dev Cell. 2011 Aug 16;21(2):193–215.
20 Page 21 of 47 Diabetes
30. Segerstolpe Å, Palasantza A, Eliasson P, Andersson E M, Andréasson A C, Sun X, et al. Single Cell Transcriptome Profiling of Human Pancreatic Islets in Health and Type 2 Diabetes. Cell Metabolism. 2016 Oct 11;24(4):593–607.
31. Xin Y, Kim J, Okamoto H, Ni M, Wei Y, Adler C, et al. RNA Sequencing of Single Human Islet Cells Reveals Type 2 Diabetes Genes. Cell Metabolism. 2016 Oct 11;24(4):608–15.
32. Columbus J, Chiang Y, Shao W, Zhang N, Wang D, Gaisano HY, et al. Insulin treatment and high fat diet feeding reduces the expression of three Tcf genes in rodent pancreas. Journal of Endocrinology. 2010 Oct;207(1):77–86.
33. Pujadas G, Cervantes S, Tutusaus A, Ejarque M, Sanchez L, García A, et al. Wnt9a deficiency discloses a repressive role of Tcf7l2 on endocrine differentiation in the embryonic pancreas. Sci Rep. 2016;6:19223.
34. Shah M, Varghese RT, Miles JM, Piccinini F, Dalla Man C, Cobelli C, et al. TCF7L2 Genotype and α Cell Function in Humans Without Diabetes. Diabetes. 2016 Feb;65(2):371–80.
35. Macotela Y, Boucher J, Tran TT, Kahn CR. Sex and depot differences in adipocyte insulin sensitivity and glucose metabolism. Diabetes. 2009 Apr;58(4):803–12.
36. van de Wetering M, Sancho E, Verweij C, de Lau W, Oving I, Hurlstone A, et al. The beta catenin/TCF 4 complex imposes a crypt progenitor phenotype on colorectal cancer cells. Cell. 2002 Oct 18;111(2):241–50.
37. Mestdagt M, Polette M, Buttice G, Noël A, Ueda A, Foidart J M, et al. Transactivation of MCP 1/CCL2 by beta catenin/TCF 4 in human breast cancer cells. Int J Cancer. 2006 Jan 1;118(1):35–42.
38. Fujita M, Furukawa Y, Nagasawa Y, Ogawa M, Nakamura Y. Down Regulation of Monocyte Chemotactic Protein 3 by Activated β Catenin. Cancer Res. 2000 Dec 1;60(23):6683–7.
39. Ellingsgaard H, Hauselmann I, Schuler B, Habib AM, Baggio LL, Meier DT, et al. Interleukin 6 enhances insulin secretion by increasing glucagon like peptide 1 secretion from L cells and alpha cells. Nat Med. 2011 Oct 30;17(11):1481–9.
40. Goulley J, Dahl U, Baeza N, Mishina Y, Edlund H. BMP4 BMPR1A signaling in beta cells is required for and augments glucose stimulated insulin secretion. Cell Metabolism. 2007 Mar;5(3):207–19.
41. Paula GSM, Souza LL, Bressane NOS, Maravalhas R, Wilieman M, Bento Bernardes T, et al. Mice with Deletion of Neuromedin B Receptor Exhibit Decreased Oral Glucose Stimulated Insulin Release. Horm Metab Res. 2016 Dec;48(12):854–61.
42. Whissell G, Montagni E, Martinelli P, Hernando Momblona X, Sevillano M, Jung P, et al. The transcription factor GATA6 enables self renewal of colon adenoma stem cells by repressing BMP gene expression. Nat Cell Biol. 2014 Jun 22;16(7):695–707.
43. Christensen GL, Jacobsen MLB, Wendt A, Mollet IG, Friberg J, Frederiksen KS, et al. Bone morphogenetic protein 4 inhibits insulin secretion from rodent beta cells through regulation of calbindin1 expression and reduced voltage dependent calcium currents. Diabetologia. 2015 Jun;58(6):1282–90.
21 Diabetes Page 22 of 47
44. Brown ML, Kimura F, Bonomi LM, Ungerleider NA, Schneyer AL. Differential synthesis and action of TGFβ superfamily ligands in mouse and rat islets. Islets. 2011 Nov 1;3(6):367–75.
45. Clee SM, Yandell BS, Schueler KM, Rabaglia ME, Richards OC, Raines SM, et al. Positional cloning of Sorcs1, a type 2 diabetes quantitative trait locus. Nat Genet. 2006 Jun;38(6):688–93.
46. Wicksteed B, Alarcon C, Briaud I, Lingohr MK, Rhodes CJ. Glucose induced translational control of proinsulin biosynthesis is proportional to preproinsulin mRNA levels in islet beta cells but not regulated via a positive feedback of secreted insulin. J Biol Chem. 2003 Oct 24;278(43):42080–90.
47. Nobrega MA. TCF7L2 and Glucose Metabolism: Time to Look Beyond the Pancreas. Diabetes. 2013 Mar 1;62(3):706–8.
48. McCarthy MI, Rorsman P, Gloyn AL. TCF7L2 and diabetes: a tale of two tissues, and of two species. Cell Metabolism. 2013 Feb 5;17(2):157–9.
49. Shao W, Wang D, Chiang Y T, Ip W, Zhu L, Xu F, et al. The Wnt Signaling Pathway Effector TCF7L2 Controls Gut and Brain Proglucagon Gene Expression and Glucose Homeostasis. Diabetes. 2013 Mar 1;62(3):789–800.
50. da Silva Xavier G, Mondragon A, Mourougavelou V, Cruciani Guglielmacci C, Denom J, Herrera PL, et al. Pancreatic alpha cell selective deletion of Tcf7l2 impairs glucagon secretion and counter regulatory responses to hypoglycaemia in mice. Diabetologia. 2017 Mar 25;14(Pt 3):551.
22 Page 23 of 47 Diabetes
Figure legends Figure 1: Expression of Tcf7l2 gene and protein by pancreatic pericytes
A) Bar diagram shows number of genes (x axis) clustered to Gene Ontology (GO) terms (y
axis) enriched in RNA sequencing analysis of purified pancreatic mural cells, FACS sorted
from Nkx3.2 Cre;R26 EYFP pancreatic tissue based on their yellow fluorescent labeling (as
shown in Supplementary Fig. 1). N = 3.
B) Heat map shows expression levels (as fragments per kilobase of exon per million aligned
fragments [FPKM]) of TCF/LEF family members in RNA sequencing analysis of pancreatic
mural cells, as described in A’.
C) Box and whisker plots showing relative levels of Tcf7l2 transcript by qPCR analysis. RNA
was extracted from bulk pancreatic tissue (left; ‘Pancreas’), isolated islets (middle; ‘Islets’;
average was set to ‘1’) and purified pancreatic mural cells (right) and gene expression level
was analyzed. N = 4 5. ***, p<0.005.
(D F) Immunofluorescence analysis of pancreatic tissue sections from adult wild type
mouse. (D) Sections were stained for NG2 (red) to label mural cells and Tcf7l2 (green), and
were counterstained with DAPI (blue). Middle and right panels, higher magnification of the
area framed in the white box in left panel. Note the presence of nuclear Tcf7l2 in pericytes.
(E) Sections were stained for insulin (white), NG2 (red) and Tcf7l2 (green). Right panel,
higher magnification of the area framed in the white box in left panel. Note the presence of
nuclear Tcf7l2 in islet associated pericytes. (F) Sections were stained for αSMA (white) to
label vSMCs, PECAM1 (red) to label endothelial cells and Tcf7l2 (green). Note Tcf7l2 is
absent from nuclei of vSMCs. Shown are representative fields.
23 Diabetes Page 24 of 47
Figure 2: Male mice with a disrupted pericytic Tcf7l2 activity are glucose intolerant
A) Bar diagram showing relative levels of wild type Tcf7l2 transcript in mural cells by qPCR analysis. RNA was extracted from purified pancreatic mural cells (as described in Fig. 2a) of
Nkx3.2 Cre;R26 EYFP;Tcf7l2flox/flox (red), Nkx3.2 Cre;R26 EYFP;Tcf7l2flox/+ (orange) and
Nkx3.2 Cre;R26 EYFP (gray; set to ‘1’) mice and gene expression was analyzed. N = 3 4.
***, p<0.005, as compared to Nkx3.2 Cre;R26 EYFP control mice.
B) Bar diagram showing relative levels of wild type Tcf7l2 transcript in islets by qPCR analysis. RNA was extracted from isolated islets of Nkx3.2 Cre;Tcf7l2flox/flox (red), Nkx3.2
Cre;Tcf7l2flox/+ (orange) and non transgenic (Cre negative; ‘non tg’; gray; set to ‘1’) mice and gene expression was analyzed. N=4.
C,D) Intraperitoneal Glucose tolerance test (IPGTT) on Nkx3.2 Cre;Tcf7l2flox/flox (red circles),
Nkx3.2 Cre;Tcf7l2flox/+ (orange triangles) and non transgenic littermate (Cre negative; ‘non tg’; gray squares) male mice at 13 weeks of age. Mice were fed either regular chow (C; N =
8 12) or high fat diet (HFD)(D; N = 6 9), when these fed HFD and reaching a body weight of
>32 grams at 13 weeks of age were considered obese and used for analysis. After overnight fasting, mice were intraperitoneally injected with dextrose (2 mg/g body weight) and tail vein blood glucose levels were measured at indicated time points. Left and middle, shown are mean (± SEM) blood glucose levels. Right, Box and whisker plot showing area under the curve (AUC) of glucose responses shown in left and middle panels. *, p<0.05, ***, p<0.005,
NS = not significant, as compared to non transgenic control.
24 Page 25 of 47 Diabetes
Figure 3: Functional islet vasculature upon inactivation of pericytic Tcf7l2
Nkx3.2 Cre;Tcf7l2flox/flox transgenic (red bars and right panels) and non transgenic control
(Cre negative, ‘non tg’; gray bars and left panel) mice were analyzed.
A,B) Mice were intravenously injected with tomato lectin (1 mg/ml; red) to label function
vessels. Pancreas was harvested from treated mice, and tissue sections were stained for
insulin (blue). A) Images showing representative islets. Upper panels: shown are lectin
labeling and anti insulin staining. Lower panels: shown is lectin labeling alone. White lines
demark the outer border of Insulin+ area, as shown in upper panels. B) Bar diagrams (mean
± SD) showing quantification of intra islet vascular density. The relative ratio of lectin+ and
insulin+ area per each islet was calculated. 30 islets per mouse, from sections at least 100
m apart, were analyzed. N = 3. NS = not significant, as compared to non transgenic
control.
C) Box and whisker plot showing gene expression analysis of the hypoxic marker Hif1a in
isolated islets. RNA was extracted and gene expression was analyzed by qPCR, when
average levels in non transgenic islets were set to ‘1’. N = 5.
25 Diabetes Page 26 of 47
Figure 4: Impaired βββ-cell function and gene expression in Nkx3.2-Cre;Tcf7l2flox/flox mice
Nkx3.2 Cre;Tcf7l2flox/flox transgenic (red) and non transgenic control (Cre negative, ‘non tg’; gray) 13 week old mice were analyzed.
A) Glucose stimulated serum insulin levels. After overnight fast, dextrose (2 mg/g body weight) was intraperitoneally injected, and tail vein blood was collected at indicated time points from transgenic (red circles) and control (gray squares) mice. Shown are mean (±
SEM) blood insulin levels. N = 4 5. B) Pancreatic tissues of transgenic (left) and non transgenic (right) mice were stained for insulin (green) and glucagon (red). Shown are representative islets.
C) Bar diagrams (mean ± SD) showing pancreatic weight. N = 3. D) Bar diagrams (mean ±
SD) showing estimated β cell mass. For each analyzed mouse, Insulin+ and pancreatic
(labeled by HCS CellMask Stain) areas were measured in sections at least 100 m apart from each other, representing 20% of pancreatic area. For each analyzed mouse, Insulin+ area was divided by pancreatic area and multiplied by pancreatic weight. N = 3. E, E’) Bar diagram (mean ± SD) shows impaired glucose stimulated insulin secretion by transgenic islets. Isolated islets from transgenic and control mice (N = 4) were incubated with either low
(1.67 mM) or high (16.7 mM) glucose, and supernatant was collected and analyzed by
ELISA. For each mouse, three groups of 10 islets were analyzed for each condition. Shown are secreted insulin levels either normalized to islets insulin content (E’) or not normalized
(E).
F, G, I) Bar diagrams (mean ± SD) showing reduced insulin content in pancreatic tissues (F) and isolated islets (G) of transgenic mice, but comparable islet proinsulin/insulin ratio (I).
Insulin and proinsulin content of isolated islets were analyzed after their overnight culture.
Pancreatic insulin content was normalized to total pancreatic protein content. N = 4.
H, J-M) Box and whisker plots showing impaired gene expression in Nkx3.2 Cre;Tcf7l2flox/flox islets. RNA was extracted from islets isolated from transgenic and control mice (N = 4 5) and expression of indicated genes was analyzed by qPCR, when average levels in non
26 Page 27 of 47 Diabetes
transgenic islets were set to ‘1’. *, p<0.05; **, p<0.01; ***, p<0.005; NS = non significant, as
compared to non transgenic control.
27 Diabetes Page 28 of 47
Figure 5: Reduced expression of pericytic secreted ligands upon Tcf7l2 inactivation.
A, B) Islet pericyte density in mildly reduced upon loss of Tcf7l2 activity. Pancreatic tissues of Nkx3.2 Cre;Tcf7l2flox/flox transgenic (red bars and right panel) and non transgenic control mice (Cre negative, non tg; gray bars; left panel) were stained for NG2 (red) to label pericytes, PECAM1 (green) to label endothelial cells, and insulin to label β cells. A) Images of representative islets showing normal distribution of pericytes in transgenic islets. White lines demark the outer border of Insulin+ area. B) Bar diagrams (mean ± SD) showing morphometric analysis of intra islet pericyte density. Pancreatic tissues were stained as described, and the relative ratio of NG2+ and Insulin+ area per each islet was calculated. 50 islets per mouse, from sections at least 100 m apart, were analyzed. N = 3. *, p < 0.05, as compared to non transgenic control.
C, D) Analysis of Tcf7l2 dependent expression of secreted factors by pancreatic mural cell.
Mural cells were isolated from pancreatic tissues of 10 week old Nkx3.2 Cre;R26R EYFP
(non tg; middle panel) and Nkx3.2 Cre;R26R EYFP;Tcf7l2flox/flox (‘Tcf7l2f/f’; right panel), as described in Supplementary Fig. 1. RNA was extracted from pancreatic mural cells and islets isolated from age matched non transgenic mice (left panels) and subjected to deep sequencing. Heat map shows levels of indicated transcripts in FPKM.
*, p<0.05; ***, p<0.005; NS = non significant, as compared to non transgenic control.
28 Page 29 of 47 Diabetes
Figure 6: Exogenous BMP4 rescues glucose intolerance of Tcf7l2-deficient mice
A) Analysis of Tcf7l2 dependent expression of Bmp4 by pancreatic mural cells. Nkx3.2/YFP+
mural cells were isolated by flow cytometry from pancreatic tissues of 10 week old Nkx3.2
Cre;R26R EYFP (control; gray) and Nkx3.2 Cre;R26R EYFP;Tcf7l2flox/flox (red). RNA was
extracted and gene expression was analyzed by qPCR, when average levels in control
samples were set to ‘1’. N = 4. *, p<0.05, as compared to control.
B, C) IPGTT and GSIS after treatment of homozygous mice with exogenous BMP4. Nkx3.2
Cre;Tcf7l2flox/flox mice were intraperitoneally injected twice daily with either PBS or
recombinant BMP4 (rBMP4; 20 ng/g body weight) for three consecutive days, and a final
treatment 30 min before analysis. rBMP4 treated Nkx3.2 Cre;Tcf7l2flox/flox (empty red circles,
broken red lines and striped boxes, N = 3 4), PBS treated Nkx3.2 Cre;Tcf7l2flox/flox (full red
circles and boxes, and continuous red lines, N = 5 6), and non transgenic littermate (non tg;
gray squares, lines and boxes, N = 5 8) male mice at 13 weeks of age were analyzed. After
overnight fasting, mice were intraperitoneally injected with dextrose (2 mg/g body weight)
and tail vein blood glucose and insulin levels were measured at indicated time points. B)
IPGTT. Left, shown are mean (± SEM) blood glucose levels. Right, Box and whisker plot
showing area under the curve (AUC) of glucose responses, as shown in left panel. *, p<0.05,
**, p<0.01, ***, p<0.005, NS = not significant; Left panel, as compared to untreated
transgenic controls; Right panel, as indicated by horizontal bars. C) GSIS. Insulin levels
were measured by ELISA. *, p<0.05, ***, p<0.005, as compared to untreated transgenic
controls.
D) Box and whisker plot showing expression of β cell genes upon treatment of transgenic
islets with rBMP4 ex vivo. Islets isolated from untreated Nkx3.2 Cre;Tcf7l2flox/flox mice were
cultured in media supplemented with 6 ng/ml rBMP4 (‘+rBMP4’; striped red boxes) or
unsupplemented media (red boxes) for 24 hours. RNA was extracted and expression levels
of indicated genes were analyzed by qPCR, when average levels in untreated islets were set
29 Diabetes Page 30 of 47
to ‘1’. *, p<0.05, ***, p<0.005, as compared to untreated control. N=6. Representative of three independent experiments.
30 Page 31 of 47 Diabetes
Figure 1: Expression of Tcf7l2 gene and protein by pancreatic pericytes
180x87mm (300 x 300 DPI)
Diabetes Page 32 of 47
Figure 2: Male mice with a disrupted pericytic Tcf7l2 activity are glucose intolerant
177x123mm (300 x 300 DPI)
Page 33 of 47 Diabetes
Figure 3: Functional islet vasculature upon inactivation of pericytic Tcf7l2
89x103mm (300 x 300 DPI)
Diabetes Page 34 of 47
Figure 4: Impaired β cell function and gene expression in Nkx3.2 Cre;Tcf7l2flox/flox mice
174x154mm (300 x 300 DPI)
Page 35 of 47 Diabetes
Figure 5: Reduced expression of pericytic secreted ligands upon Tcf7l2 inactivation
74x122mm (300 x 300 DPI)
Diabetes Page 36 of 47
Figure 6: Exogenous BMP4 rescues glucose intolerance of Tcf7l2-deficient mice
179x83mm (300 x 300 DPI)
Page 37 of 47 Diabetes
Supplemental Information
Pancreatic pericytes support beta-cell function in a Tcf7l2 dependent manner
Lina Sakhneny, Eleonor Rachi, Alona Epshtein, Helen C. Guez, Shane Wald-Altman, Michal Lisnyansky, Laura Khalifa-Malka, Adina Hazan, Daria Baer, Avi Priel, Miguel Weil and Limor Landsman
Diabetes Page 38 of 47
Sakhneny et al.
Supplementary Figure 1: Nkx3.2-Cre mouse line drives gene expression in pancreatic mural cells. (A) Tissue sections from adult Nkx3.2-Cre;R26-YFP mice were stained for YFP (green), NG2 (red) and insulin (white) and were counterstained with DAPI (blue). Right panels, higher magnification of the areas framed in white boxes in left panels, when ‘*’, ‘#’ and ‘@’ mark the different boxes, corresponding to islets, exocrine pancreas and pancreatic large blood vessels, respectively. Note the presence of YFP+ mural cells in all three pancreatic areas. ‘i’ = islet; ‘v’=blood vessel. Shown is a representative field. B, C) Tissue sections from adult Nkx3.2-Cre;R26-YFP mice were stained for YFP (green) and NG2 (red; B) or desmin (red; C). Right panel, green channel of the field shown in left panel. Note YFP+ cells express the mural cell markers NG2 and desmin. Shown is a representative field. D) Hepatic tissues from adult Nkx3.2-Cre;R26-YFP mice were analyzed. Tissue sections were stained for YFP (green) and NG2 (red) and counterstained with DAPI. Right panel, higher
2 Page 39 of 47 Diabetes
Sakhneny et al.
magnification of the area framed in a white box in left panel, when only the red and green channels are shown. Note NG2+ cells are not marked with YFP. Shown is a representative field. E) Flow cytometry analysis of digested pancreatic tissue from adult Nkx3.2-Cre;R26-YFP mice. Left, dotplot showing the presence of yellow fluorescent cell population (gated cells) in Nkx3.2-Cre;R26-YFP pancreas. Right, green histograms (‘+Primary antibody’) showing staining of YFP+ cells (as gated in left panel) for the pericytic marker PDGFRb. Gray histogram showing Nkx3.2/YFP+ cells without addition of primary antibody (‘Staining control’). Number represents the percentage of PDGFRb-stained cells out of YFP+ cell population (as indicated by horizontal line). Note that majority of YFP+ cells express the pericyte marker PDGFRb.
3 Diabetes Page 40 of 47
Sakhneny et al.
mTcf7l2-transfected HEK293
Mural cells
Islets Blank
82 Tcf7l2 64 kDa Actin
Supplementary Figure 2: Western blot analysis detects Tcf7l2 protein in pancreatic mural cells Protein extract from purified pancreatic mural cells (3 µg), isolated islets (20 µg) and mouse Tcf7l2 (mTcf7l2) transfected HEK293 cells (3 µg) were analyzed using antibodies against Tcf7l2 (upper panels) and pan-actin (lower panels). Pancreatic mural cells were FACS sorted from Nkx3.2-Cre;R26-EYFP pancreatic tissue based on their yellow fluorescent labeling (as shown in Supplementary Fig. 1). Islets were isolated from wild type mice. HEK293 cells were transfected with 1 µg plasmid containing mTcf7l2 gene for 48 hours prior to analysis. Note the presence of multiple Tcf7l2 alternative splicing products in pancreatic mural cells.
Western blot analysis: Immunoblotting was performed by homogenizing cells in RIPA buffer. Protein samples were separated on 10% SDS/PAGE gel (Invitrogen) and transferred to a nitrocellulose membrane (Invitrogen). Membrane was stained with primary antibodies (Supplementary Table 1), followed by incubation with HRP-conjugated secondary antibodies (Abcam). Signal was detected using ECL reagents (SignalFire Elite; Cell Signaling).
4 Page 41 of 47 Diabetes
Sakhneny et al.
A B IPGTT, Males Wild type IPGTT, Females Non tg 400 Nkx3.2-Cre 400 Nkx3.2-Cre;Tcf7l2f/+ 300 300 Nkx3.2-Cre;Tcf7l2f/f
200 200
100 100
0 0 Blood glucose (mg/dL) 0 30 60 90 120 Blood glucose (mg/dL) 0 30 60 90 120 Time (min) Time (min)
Supplementary Figure 3: Intact glucose tolerance in Nkx3.2-Cre male mice and Tcf7l2 transgenic female mice A) Intraperitoneal Glucose tolerance test (IPGTT) on Nkx3.2-Cre (gray squares) and wild type (black circles) age-matched male mice. After overnight fasting, mice were intraperitoneally injected with dextrose (2 mg/g body weight) and tail vein blood glucose levels were measured at indicated time points. N = 5-7 B) IPGTT on 13-weeks old Nkx3.2-Cre;Tcf7l2flox/flox (red circles), Nkx3.2-Cre;Tcf7l2flox/+ (orange triangles) and non-transgenic littermate (‘non tg’; gray squares) female mice. After overnight fasting, mice were intraperitoneally injected with dextrose (2 mg/g body weight) and tail vein blood glucose levels were measured at indicated time points. N = 9
5 Diabetes Page 42 of 47
Sakhneny et al.
Supplementary Figure 4: Body weight, GLP-1 production and insulin sensitivity are maintained in Nkx3.2-Cre;Tcf7l2flox/flox mice Nkx3.2-Cre;Tcf7l2flox/flox (red circles), Nkx3.2-Cre;Tcf7l2flox/+ (orange triangles) and non- transgenic littermate (Cre-negative; ‘non tg’; gray squares) mice were analyzed. A,B) Box-and-whisker plots show body weight in 13-weeks males. Mice were fed either regular chow (B; N = 8-12) or high-fat diet (HFD)(C; N = 6-9), when these fed HFD and reaching a body weight of >32 grams at 13 weeks of age were considered obese and used for analysis. C,D) Bar diagrams (mean ± SD) show relative expression of Gcg (D) and Pcsk1 (E) in gut of transgenic and control mice. RNA was extracted from indicated regions of the gut, and gene expression was analyzed by qPCR, when average levels in non-transgenic tissues were set to ‘1’. N = 3. E) Bar diagrams (mean ± SD) show levels of serum GLP-1. After an overnight fast, blood was collected from mouse tails, and GLP-1 levels were analyzed by ELISA. N = 4. F,G) Intraperitoneal insulin tolerance test (ITT). Insulin (0.75 U/kg body weight) was intraperitoneally injected after a 6-hour fast to 13-weeks male mice, and tail vein blood glucose levels (mean ± SEM) were analyzed at indicated time points. N = 6 - 9.
6 Page 43 of 47 Diabetes
Sakhneny et al.
Supplementary Figure 5: Loss of pericytic Tcf7l2 does not result in b-cell apoptosis Nkx3.2-Cre;Tcf7l2flox/flox (red) and non-transgenic littermate (‘non tg’; gray) mice were analyzed at 13 weeks of age. A) Left and middle panels, pancreatic tissues of transgenic (middle panel) and non-transgenic (left panel) mice were subjected to TUNEL assay (green) to identify dying cells, and were stained for insulin (red) to identify b-cells. Right panel, non-transgenic pancreatic tissue pre- treated with DNase to induce DNA breaks, which served as a positive control of the TUNEL assay (‘staining control’). Shown are representative fields. B) Box-and-whisker plot showing gene expression analysis of isolated islets. RNA was extracted and expression of the b-cell stress genes Chop and Atf4 was analyzed by qPCR, when average levels in non-transgenic islets were set to ‘1’. N = 5.
7 Diabetes Page 44 of 47
Sakhneny et al.
2 untreated +rBMP4 NS NS Cultured islets, wild type
1
Relative expression 0 MafA Pdx1
Supplementary Figure 6: Culturing wild type islets in the presence of rBMP4 does not affect expression of b-cell genes Islets isolated from wild type mice were cultured in media supplemented with 6 ng/ml recombinant BMP4 (‘+rBMP4’; striped bars) or unsupplemented media (untreated; gray bars) for 24 hours. RNA was extracted and expression levels of indicated genes were analyzed by qPCR, when average levels in untreated islets were set to ‘1’. NS = non-significant, as compared to untreated control. N=4. Representative of two independent experiments.
8 Page 45 of 47 Diabetes
Sakhneny et al.
Supplementary Table 1: List of primary antibodies
Host Catalog Antigen Manufacturer Application species number Actin Mouse Millipore MAB1501 Western blot αSMA Mouse Sigma-Aldrich A5228 Immunofluorescence Desmin Mouse Sigma-Aldrich D1033 Immunofluorescence Glucagon Rabbit Millipore AB932 Immunofluorescence GFP / YFP Chicken Abcam AB13970 Immunofluorescence Insulin Guinea pig Dako A0564 Immunofluorescence NG2 Mouse Millipore MAB5384 Immunofluorescence NG2 Rabbit Millipore AB5320 Immunofluorescence PDGFRβ, Rat Affymetrix 13-1402 Flow cytometry biotinylated PECAM1 Rat BD 553370 Immunofluorescence Immunofluorescence, Tcf7l2 Rabbit Cell Signaling 2569 Western blot
9 Diabetes Page 46 of 47
Sakhneny et al.
Supplementary Table 2: List of qPCR probes
Gene Method Primers Atf4 Taqman Applied Biosystem expression assay Bmp4 Taqman Applied Biosystem expression assay Chop Taqman Applied Biosystem expression assay TGCCGCCAGTGCCATT Cyclophilin SYBR green TCACAGAATTATTCCAGGATT TGCACCACCAACTGCTTAG Gapdh Taqman GGATGCAGGGATGATGTTC Probe: CAGAAGACTGTGGATGGCCCCTC Gcg Taqman Applied Biosystem expression assay Glpr1 Taqman Applied Biosystem expression assay Glut2 Taqman Applied Biosystem expression assay Hif1a Taqman Applied Biosystem expression assay GGGTCGAGGTGGGCC Ins1 SYBR green CTGCTGGCCTCGCTTGC GGCTGCGTAGTGGTGGGTCTA Ins2 SYBR green CCTGCTCGCCCTGCTCTT Kir6.2 Taqman Applied Biosystem expression assay GCTGGTATCCATGTCCGTGC MafA SYBR green TGTTTCAGTCGGATGACCTCC NeuroD1 Taqman Applied Biosystem expression assay Pcsk1 Taqman Applied Biosystem expression assay Pdx1 Taqman Applied Biosystem expression assay Sur1 Taqman Applied Biosystem expression assay GCCATCAACCAGATTCTC Tcf7l2 SYBR green TTCTTCTTCCCATAGTTATCC
10 Page 47 of 47 Diabetes
Sakhneny et al.
Supplementary Table 3: RNA sequencing data To characterize gene expression of pancreatic mural cells, cells were purified by flow- cytometry (as described in Supplementary Fig. 1) from pancreatic tissue of Nkx3.2- Cre;R26-YFP 10-week old mice (N = 3). To characterize Tcf7l2-dependent gene expression of pancreatic mural cells, cells were further purified by flow-cytometry (as described in Supplementary Fig. 1) from pancreatic tissue of Nkx3.2-Cre;R26- YFP;Tcf7l2flox/flox 10-week old mice (N = 3) and islets were isolated from age-matched non-transgenic mice (N= 3). RNA was extracted from isolated cells and subjected to RNA sequencing to obtain 1.5-2 x 107 reads from each sample. Gene expression data have been deposited in ArrayExpress, and files can be accessed at: http://www.ebi.ac.uk/arrayexpress/experiments/E-MTAB-5325
11