DOCSLIB.ORG

(± 2.0 Or Higher) to SEGS Values

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(± 2.0 Or Higher) to SEGS Values Table 3. GAS genes with negative or positive Z-scores (± 2.0 or higher) to SEGS values. M5005_gene Gene Description Function Z(SEGS ) NFD(SEGS ) Phase Analysis Probe-set Probe M5005_Spy1423 - Hyaluronoglucosaminidase (EC 3.2.1.35) Phage -5.216330076 0.007485969 acute PPA1&2 SpM12_ChORF299-63_at 16 M5005_Spy0504 pepF Oligoendopeptidase F (EC 3.4.24.-) Amino acid metabolism -4.331206282 0.296785995 acute PPA1&2 SpM1_ChORF0606_s_at 10 M5005_Spy1186 - Phage protein Phage -4.323906633 0.305389038 acute PPA1&2 SpM1_ChORF1456_s_at 15 M5005_Spy0871 - Multidrug resistance ABC transporter ATP-binding and permease protein Membrane transport -4.320521915 0.309459061 acute PPA1&2 SpM1_ChORF1149_s_at 9 M5005_Spy0783 ptsD PTS system, mannose/fructose family IID component Carbohydrate metabolism -4.206162395 0.48212507 acute PPA1&2 SpM1_ChORF1060_s_at 13 M5005_Spy1466 - Phage protein Phage -4.196697521 0.499972759 acute PPA1&2 SpM12_ChORF299-14_at 12 M5005_Spy0868 - Hypothetical protein Unknown -4.1030198 0.714393283 acute PPA1&2 SpM1_ChORF1146_s_at 6 M5005_Spy0027 - IMP CYCLOHYDROLASE (EC 3.5.4.10) Nucleotide metabolism -4.042526536 0.897014541 acute PPA1&2 SpM18_ChORF0030_s_at 1 M5005_Spy1540 endoS Endo-beta-N-acetylglucosaminidase F2 precursor (EC 3.2.1.96) Carbohydrate metabolism -3.933430822 0.328559653 acute PPA3 SpM1_ChORF1813_at M5005_Spy0767 - 4-nitrophenylphosphatase (EC 3.1.3.41) Unknown -3.892686026 1.561207204 acute PPA1&2 SpM1_ChORF1043_s_at 12 M5005_Spy0680 - Two-component response regulator Signal transduction -3.858649146 1.767166565 acute PPA1&2 SpM1_ChORF0874_s_at 11 M5005_Spy1818 cadC Cadmium efflux system accessory protein Membrane transport -3.854956463 1.791005758 acute PPA1&2 SpM1_ChORF2163_s_at 6 M5005_Spy0135 - Hypothetical membrane associated protein Unknown -3.775054045 2.38833708 acute PPA1&2 SpM1_ChORF0159_s_at 4 M5005_Spy0101 adhE tRNA binding domain protein Protein synthesis -3.762426541 0.621439274 acute PPA3 SpM18_ChORF0118_s_at M5005_Spy0517 regR Transcriptional regulator, LacI family Information processing -3.718295416 2.922851942 acute PPA1&2 SpM1_ChORF0627_s_at 12 M5005_Spy0537 aspC Aspartate aminotransferase (EC 2.6.1.1) Amino acid metabolism -3.713735557 2.97039385 acute PPA1&2 SpM1_ChORF0650_s_at 12 M5005_Spy0850 pta putative phosphotransacetylase Cellular processing -3.712057722 2.988071055 acute PPA1&2 SpM1_ChORF1128_s_at 2 M5005_Spy0539 - ATP-binding protein (contains P-loop) Membrane transport -3.706946834 3.042534595 acute PPA1&2 SpM1_ChORF0652_s_at 12 M5005_Spy0061 rpsE SSU ribosomal protein S5P Protein synthesis -3.564877715 4.992516532 acute PPA1&2 SpM1_ChORF0069_s_at 1 M5005_Spy0780 - PTS system, mannose/fructose family IIA component Unknown -3.558956355 5.095166371 acute PPA1&2 SpM1_ChORF1057_s_at 4 M5005_Spy1222 int.2 DNA integration/recombination/invertion protein phi5005.2 int Phage -3.528292626 1.437858399 acute PPA3 SpM1_ChORF1488_s_at M5005_Spy1663 - PTS SYSTEM, IIB COMPONENT (EC 2.7.1.69) Carbohydrate metabolism -3.518197772 1.489487779 acute PPA3 SpM1_ChORF1950_s_at M5005_Spy0868 - Hypothetical protein Unknown -3.498271411 6.268403115 acute PPA1&2 SpM1_ChORF1146_s_at 13 M5005_Spy0681 - Two component system histidine kinase (EC 2.7.3.-) Signal transduction -3.470882902 6.877391164 acute PPA1&2 SpM1_ChORF0875_s_at 10 M5005_Spy1654 - Hypothetical protein Unknown -3.466760567 1.780738647 acute PPA3 SpM5_ChORF125g-139_at M5005_Spy0058 rpsH SSU ribosomal protein S8P Protein synthesis -3.453323491 7.296659007 acute PPA1&2 SpM1_ChORF0065_s_at 2 M5005_Spy0764 - Hypothetical protein Unknown -3.451868835 7.332449053 acute PPA1&2 SpM1_ChORF1039_s_at 2 M5005_Spy1685 - D-tyrosyl-tRNA(Tyr) deacylase (EC 3.1.-.-) Protein synthesis -3.432458086 7.826096765 acute PPA1&2 SpyM3_1699_at 15 M5005_Spy1412 nusA N utilization substance protein A Cellular processing -3.424128817 8.047355927 acute PPA1&2 SpM1_ChORF1724_s_at 4 M5005_Spy1695 - Ribosomal protein L11 methyltransferase (EC 2.1.1.-) Protein synthesis -3.38737853 2.336928839 acute PPA3 SpM1_ChORF1988_s_at M5005_Spy1184 - Phage protein Phage -3.380925254 9.292393133 acute PPA1&2 SpM1_ChORF1455_s_at 2 M5005_Spy1519 recG ATP-dependent DNA helicase recG (EC 3.6.1.-) Information processing -3.35546511 10.10845036 acute PPA1&2 SpM1_ChORF1785_s_at 4 M5005_Spy1052 int.1 DNA integration/recombination/invertion protein phi5005.1 int Phage -3.338082749 2.760149795 acute PPA3 SpM18_ChORF1309_s_at M5005_Spy0384 - Surface antigen Virulence -3.311211515 11.68868554 acute PPA1&2 SpM1_ChORF0469_s_at 9 M5005_Spy0466 - Hypothetical phage protein Phage -3.303624186 11.98180002 acute PPA1&2 SpM18_ChORF0632_s_at 13 M5005_Spy1083 - Transcription antiterminator, BglG family / PTS system, mannitol (Cryptic)-specific IIA component (EC 2.7.1.69) Information processing -3.287297784 12.63598108 acute PPA1&2 SpM1_ChORF1325_s_at 12 M5005_Spy1331 - Peptidyl-prolyl cis-trans isomerase (EC 5.2.1.8) Unknown -3.285825973 3.286280558 acute PPA3 SpM12_ChORF289-26_at M5005_Spy0834 - Zn-dependent alcohol dehydrogenases and related dehydrogenases Unknown -3.28182996 12.86242904 acute PPA1&2 SpM1_ChORF1111_s_at 14 M5005_Spy0223 - GTPase (EC 3.6.1.-) Unknown -3.275939861 13.11060343 acute PPA1&2 SpM1_ChORF0263_s_at 2 M5005_Spy1245 - RNA binding protein Unknown -3.275245713 3.403597214 acute PPA3 SpM1_ChORF1515_s_at M5005_Spy1117 deaD2 ATP-dependent RNA helicase Stress -3.240898929 14.68188904 acute PPA1&2 SpM1_ChORF1369_s_at 8 M5005_Spy0962 - Hypothetical protein Unknown -3.22528854 15.43697381 acute PPA1&2 SpM1_ChORF1252_s_at 7 M5005_Spy0318 pflC Pyruvate formate-lyase activating enzyme (EC 1.97.1.4) Carbohydrate metabolism -3.193399082 17.09327816 acute PPA1&2 SpM1_ChORF0379_s_at 1 M5005_Spy0066 infA Bacterial Protein Translation Initiation Factor 1 (IF-1) Cellular processing -3.167588232 18.55343013 acute PPA1&2 SpM1_ChORF0075_s_at 3 M5005_Spy0058 rpsH SSU ribosomal protein S8P Protein synthesis -3.166716579 18.60470802 acute PPA1&2 SpM1_ChORF0065_s_at 15 M5005_Spy0587 pheS Phenylalanyl-tRNA synthetase alpha chain (EC 6.1.1.20) Protein synthesis -3.165720561 4.869546395 acute PPA3 SpM1_ChORF0768_s_at M5005_Spy1386 - Hypothetical membrane spanning protein Unknown -3.163061351 4.911525008 acute PPA3 SpM1_ChORF1691_s_at M5005_Spy0121 - Acetyl-CoA:acetoacetyl-CoA transferase beta subunit (EC 2.8.3.-) Carbohydrate metabolism -3.153036204 19.42695837 acute PPA1&2 SpM1_ChORF0142_s_at 1 M5005_Spy0264 - Hydrolase (HAD superfamily) Unknown -3.1418665 20.12321039 acute PPA1&2 SpM1_ChORF0309_s_at 9 M5005_Spy1077 glnQ.2 Glutamine transport ATP-binding protein glnQ Membrane transport -3.139799861 20.25454571 acute PPA1&2 SpM1_ChORF1316_s_at 2 M5005_Spy1140 queA S-adenosylmethionine:tRNA ribosyltransferase-isomerase (EC 5.-.-.-) Protein synthesis -3.136894369 20.44053681 acute PPA1&2 SpM1_ChORF1400_s_at 3 M5005_Spy0057 rpsN SSU ribosomal protein S14P Protein synthesis -3.113849697 21.97284948 acute PPA1&2 SpM1_ChORF0064_s_at 5 M5005_Spy1581 - Transcriptional regulator, MerR family Information processing -3.108428234 22.34849834 acute PPA1&2 SpM1_ChORF1863_s_at 10 M5005_Spy0291 - Acetyltransferase (GNAT) family Unknown -3.093317946 23.42713531 acute PPA1&2 SpM1_ChORF0346_s_at 10 M5005_Spy1162 - Hypothetical protein Unknown -3.065782387 25.51771239 acute PPA1&2 SpM1_ChORF1425_s_at 14 M5005_Spy1442 - Phage transcriptional activator Phage -3.048812964 7.066038664 acute PPA3 SpM12_ChORF299-47_s_at M5005_Spy1163 - Transcriptional regulator, biotin repressor family Information processing -3.045289397 27.18423637 acute PPA1&2 SpM1_ChORF1427_s_at 2 M5005_Spy0399 - Hypothetical membrane associated protein Unknown -3.031029316 7.470938877 acute PPA3 SpM1_ChORF0484_s_at M5005_Spy1753 pbp2A Multimodular transpeptidase-transglycosylase PBP 2A Cell wall metabolism -3.016868338 29.66235776 acute PPA1&2 SpM1_ChORF2059_s_at 10 M5005_Spy0517 regR Transcriptional regulator, LacI family Information processing -3.015397193 7.844402513 acute PPA3 SpM1_ChORF0627_at M5005_Spy0038 - Acyltransferase family Unknown -3.00540974 30.71921048 acute PPA1&2 SpM1_ChORF0041_s_at 9 M5005_Spy1064 malC Maltose transport system permease protein malF Membrane transport -3.002107449 31.03017584 acute PPA1&2 SpM1_ChORF1301_at 10 M5005_Spy1235 - PHOSPHOGLUCOMUTASE (EC 5.4.2.2) / PHOSPHOMANNOMUTASE (EC 5.4.2.8) Carbohydrate metabolism -2.98473965 8.627219281 acute PPA3 SpM1_ChORF1503_s_at M5005_Spy1184 - Phage protein Phage -2.924566748 10.37627195 acute PPA3 SpM3_ChORF1109_x_at M5005_Spy0338 - Arsenate reductase family protein Unknown -2.870606323 12.21526168 acute PPA3 SpM1_ChORF0410_s_at M5005_Spy1000 - Phage protein Phage -2.866123237 12.38072212 acute PPA3 SpM49_ChORF7585-41_at Page 1 of 8 Table 3. GAS genes with negative or positive Z-scores (± 2.0 or higher) to SEGS values. M5005_gene Gene Description Function Z(SEGS ) NFD(SEGS ) Phase Analysis Probe-set Probe M5005_Spy0225 - Thiamin pyrophosphokinase (EC 2.7.6.2) Coenzyme and cofactor metabolism -2.801086386 15.02283823 acute PPA3 SpM1_ChORF0265_s_at M5005_Spy0305 - putative phosphoesterase Unknown -2.796292302 15.23659114 acute PPA3 SpM1_ChORF0363_s_at M5005_Spy0242 - ABC transporter ATP-binding protein Coenzyme and cofactor metabolism -2.792643857 15.40111464 acute PPA3 SpM1_ChORF0285_s_at M5005_Spy0824 folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine pyrophosphokinase (EC 2.7.6.3) Coenzyme and cofactor metabolism -2.790890806 15.48074054 acute PPA3 SpM1_ChORF1100_s_at M5005_Spy0374 rplK LSU ribosomal protein L11P Protein synthesis -2.756988778 17.09613356 acute PPA3 SpM1_ChORF0460_s_at
Load more

Recommended publications
  • Electronic Supplementary Material (ESI) for Analyst. This Journal Is © the Royal Society of Chemistry 2017
    Electronic Supplementary Material (ESI) for Analyst. This journal is © The Royal Society of Chemistry 2017 Supplemental Table 2. Proteins Increased in Either Blood or Horizon media Table 2A. Proteins Increased in Spores Produced on Horizon Soil Over Spores Produced on Blood Medium quasi.fdr Protein Protein Class/Name KEGG Pathway Names or Function (if ID Pathways found in KEGG) Amino Acid Metabolism bat00250, bat00280, Alanine, aspartate and glutamate metabolism, bat00410, Valine, leucine and isoleucine degradation, bat00640, beta-Alanine metabolism to acetyl CoA, 4.50E-07 BAS0310 4-aminobutyrate aminotransferase bat00650 Propanoate metabolism, Butanoate metabolism bat00270, bat00330, Cysteine and methionine metabolism, Arginine bat00410, and proline metabolism, beta-Alanine 3.84E-10 BAS5060 spermidine synthase bat00480 metabolism, Glutathione metabolism bat00270, bat00330, Cysteine and methionine metabolism, Arginine bat00410, and proline metabolism, beta-Alanine 2.30E-09 BAS5219 spermidine synthase bat00480 metabolism, Glutathione metabolism bat00250, Alanine, aspartate and glutamate metabolism, 6.94E-07 BAS0561 alanine dehydrogenase bat00430 Taurine and hypotaurine metabolism bat00250, Alanine, aspartate and glutamate metabolism, 5.23E-07 BAS4521 alanine dehydrogenase bat00430 Taurine and hypotaurine metabolism 0.005627 BAS5218 agmatinase, putative bat00330 Arginine and proline metabolism 2,3,4,5-tetrahydropyridine-2- carboxylate N-succinyltransferase, 1.40E-10 BAS3891 putative bat00300 Lysine biosynthesis bat00010, bat00020, Glycolysis
    [Show full text]
  • Crystal Structure of the Targeting Endonuclease of the Human LINE-1 Retrotransposon
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Structure, Vol. 12, 975–986, June, 2004, 2004 Elsevier Ltd. All rights reserved. DOI 10.1016/j.str.2004.04.011 Crystal Structure of the Targeting Endonuclease of the Human LINE-1 Retrotransposon Oliver Weichenrieder,1,* Kostas Repanas,1 transcriptase. Depending on the DNA integration mech- and Anastassis Perrakis* anism, two classes of retrotransposons are distin- The Netherlands Cancer Institute guished. The first class contains long terminal repeat Department of Molecular Carcinogenesis-H2 (LTR) retrotransposons and retroviruses. These retroele- Plesmanlaan 121 ments use an integrase that recognizes the LTRs of the 1066 CX Amsterdam double-stranded DNA copy. The second, much larger, The Netherlands and more ancient class includes all non-LTR retro- transposons. Those are thought to integrate via target- primed reverse transcription (TPRT), a process in which Summary reverse transcription and integration are coupled (Eick- bush and Malik, 2002; Kazazian, 2004). An endonuclease The human L1 endonuclease (L1-EN) is encoded by that is part of the same polypeptide chain as the reverse the non-LTR retrotransposon LINE-1 (L1). L1 is re- transcriptase nicks the genomic DNA and hands over sponsible for more than 1.5 million retrotransposition the resulting ribose 3Ј-hydroxyl end as a primer for re- events in the history of the human genome, contribut- verse transcription of associated template RNA (Cost ing more than a quarter to human genomic DNA (L1 et al., 2002; Luan et al., 1993). and Alu elements). L1-EN is related to the well-under- Most non-LTR retrotransposons encode an endonu- stood human DNA repair endonuclease APE1, and its clease located N-terminally of the reverse transcriptase.
    [Show full text]
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of
    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
    [Show full text]
  • Restriction Endonucleases
    Molecular Biology Problem Solver: A Laboratory Guide. Edited by Alan S. Gerstein Copyright © 2001 by Wiley-Liss, Inc. ISBNs: 0-471-37972-7 (Paper); 0-471-22390-5 (Electronic) 9 Restriction Endonucleases Derek Robinson, Paul R. Walsh, and Joseph A. Bonventre Background Information . 226 Which Restriction Enzymes Are Commercially Available? . 226 Why Are Some Enzymes More Expensive Than Others? . 227 What Can You Do to Reduce the Cost of Working with Restriction Enzymes? . 228 If You Could Select among Several Restriction Enzymes for Your Application, What Criteria Should You Consider to Make the Most Appropriate Choice? . 229 What Are the General Properties of Restriction Endonucleases? . 232 What Insight Is Provided by a Restriction Enzyme’s Quality Control Data? . 233 How Stable Are Restriction Enzymes? . 236 How Stable Are Diluted Restriction Enzymes? . 236 Simple Digests . 236 How Should You Set up a Simple Restriction Digest? . 236 Is It Wise to Modify the Suggested Reaction Conditions? . 237 Complex Restriction Digestions . 239 How Can a Substrate Affect the Restriction Digest? . 239 Should You Alter the Reaction Volume and DNA Concentration? . 241 Double Digests: Simultaneous or Sequential? . 242 225 Genomic Digests . 244 When Preparing Genomic DNA for Southern Blotting, How Can You Determine If Complete Digestion Has Been Obtained? . 244 What Are Your Options If You Must Create Additional Rare or Unique Restriction Sites? . 247 Troubleshooting . 255 What Can Cause a Simple Restriction Digest to Fail? . 255 The Volume of Enzyme in the Vial Appears Very Low. Did Leakage Occur during Shipment? . 259 The Enzyme Shipment Sat on the Shipping Dock for Two Days.
    [Show full text]
  • Phosphate Steering by Flap Endonuclease 1 Promotes 50-flap Specificity and Incision to Prevent Genome Instability
    ARTICLE Received 18 Jan 2017 | Accepted 5 May 2017 | Published 27 Jun 2017 DOI: 10.1038/ncomms15855 OPEN Phosphate steering by Flap Endonuclease 1 promotes 50-flap specificity and incision to prevent genome instability Susan E. Tsutakawa1,*, Mark J. Thompson2,*, Andrew S. Arvai3,*, Alexander J. Neil4,*, Steven J. Shaw2, Sana I. Algasaier2, Jane C. Kim4, L. David Finger2, Emma Jardine2, Victoria J.B. Gotham2, Altaf H. Sarker5, Mai Z. Her1, Fahad Rashid6, Samir M. Hamdan6, Sergei M. Mirkin4, Jane A. Grasby2 & John A. Tainer1,7 DNA replication and repair enzyme Flap Endonuclease 1 (FEN1) is vital for genome integrity, and FEN1 mutations arise in multiple cancers. FEN1 precisely cleaves single-stranded (ss) 50-flaps one nucleotide into duplex (ds) DNA. Yet, how FEN1 selects for but does not incise the ss 50-flap was enigmatic. Here we combine crystallographic, biochemical and genetic analyses to show that two dsDNA binding sites set the 50polarity and to reveal unexpected control of the DNA phosphodiester backbone by electrostatic interactions. Via ‘phosphate steering’, basic residues energetically steer an inverted ss 50-flap through a gateway over FEN1’s active site and shift dsDNA for catalysis. Mutations of these residues cause an 18,000-fold reduction in catalytic rate in vitro and large-scale trinucleotide (GAA)n repeat expansions in vivo, implying failed phosphate-steering promotes an unanticipated lagging-strand template-switch mechanism during replication. Thus, phosphate steering is an unappreciated FEN1 function that enforces 50-flap specificity and catalysis, preventing genomic instability. 1 Molecular Biophysics and Integrated Bioimaging, Lawrence Berkeley National Laboratory, Berkeley, California 94720, USA.
    [Show full text]
  • Guanylate Kinase (Ec 2.7.4.8)
    Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) PRINCIPLE: Guanylate Kinase GMP + ATP > GDP + ADP Pyruvate Kinase ADP + PEP > ATP + Pyruvate Pyruvate Kinase GDP + PEP > GTP + Pyruvate Lactic Dehydrogenase 2 Pyruvate + 2 ß-NADH > 2 Lactate + 2 ß-NAD Abbreviations used: GMP = Guanosine 5'-Monophosphate ATP = Adenosine 5'-Triphosphate GDP = Guanosine 5'-Diphosphate ADP = Adenosine 5'-Diphosphate PEP = Phospho(enol)phosphate ß-NADH = ß-Nicotinamide Adenine Dinucleotide, Reduced Form ß-NAD = ß-Nicotinamide Adenine Dinucleotide, Oxidized Form CONDITIONS: T = 30°C, pH = 7.5, A340nm, Light path = 1 cm METHOD: Continuous Spectrophotometric Rate Determination REAGENTS: A. 200 mM Tris HCl Buffer, pH 7.5 at 30°C (Prepare 50 ml in deionized water using Trizma Base, Sigma Prod. No. T-1503. Adjust to pH 7.5 at 30°C with 1 M HCl.) B. 1 M Potassium Chloride Solution (KCl) (Prepare 10 ml in deionized water using Potassium Chloride, Sigma Prod. No. P-4504.) C. 60 mM Magnesium Sulfate Solution (MgSO4) (Prepare 20 ml in deionized water using Magnesium Sulfate, Heptahydrate, Sigma Prod. No. M-1880.) D. 40 mM Phospho(enol)pyruvate Solution (PEP) (Prepare 50 ml in deionized water using Phospho(enol)Pyruvate, Trisodium Salt, Hydrate, Sigma Prod. No. P-7002. PREPARE FRESH.) Revised: 03/10/94 Page 1 of 4 Enzymatic Assay of GUANYLATE KINASE (EC 2.7.4.8) REAGENTS: (continued) E. 100 mM Ethylenediaminetetraacetic Acid Solution (EDTA) (Prepare 10 ml in deionized water using Ethylenediaminetetraacetic Acid, Tetrasodium Salt, Hydrate, Sigma Stock No. ED4SS.) F. 3.8 mM ß-Nicotinamide Adenine Dinucleotide, Reduced Form (ß-NADH) (Prepare 2 ml in deionized water using ß-Nicotinamide Adenine Dinucleotide, Reduced Form, Dipotassium Salt, Sigma Prod.
    [Show full text]
  • WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2013/180584 Al 5 December 2013 (05.12.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/21 (2006.01) C12N 15/74 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/52 (2006.01) C12P 5/02 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12N 15/63 (2006.01) HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KN, KP, KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/NZ20 13/000095 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, (22) International Filing Date: SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 4 June 2013 (04.06.2013) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 61/654,412 1 June 2012 (01 .06.2012) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, (71) Applicant: LANZATECH NEW ZEALAND LIMITED MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, [NZ/NZ]; 24 Balfour Road, Parnell, Auckland, 1052 (NZ).
    [Show full text]
  • Supplementary Table S1. Table 1. List of Bacterial Strains Used in This Study Suppl
    Supplementary Material Supplementary Tables: Supplementary Table S1. Table 1. List of bacterial strains used in this study Supplementary Table S2. List of plasmids used in this study Supplementary Table 3. List of primers used for mutagenesis of P. intermedia Supplementary Table 4. List of primers used for qRT-PCR analysis in P. intermedia Supplementary Table 5. List of the most highly upregulated genes in P. intermedia OxyR mutant Supplementary Table 6. List of the most highly downregulated genes in P. intermedia OxyR mutant Supplementary Table 7. List of the most highly upregulated genes in P. intermedia grown in iron-deplete conditions Supplementary Table 8. List of the most highly downregulated genes in P. intermedia grown in iron-deplete conditions Supplementary Figures: Supplementary Figure 1. Comparison of the genomic loci encoding OxyR in Prevotella species. Supplementary Figure 2. Distribution of SOD and glutathione peroxidase genes within the genus Prevotella. Supplementary Table S1. Bacterial strains Strain Description Source or reference P. intermedia V3147 Wild type OMA14 isolated from the (1) periodontal pocket of a Japanese patient with periodontitis V3203 OMA14 PIOMA14_I_0073(oxyR)::ermF This study E. coli XL-1 Blue Host strain for cloning Stratagene S17-1 RP-4-2-Tc::Mu aph::Tn7 recA, Smr (2) 1 Supplementary Table S2. Plasmids Plasmid Relevant property Source or reference pUC118 Takara pBSSK pNDR-Dual Clonetech pTCB Apr Tcr, E. coli-Bacteroides shuttle vector (3) plasmid pKD954 Contains the Porpyromonas gulae catalase (4)
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Supporting Information
    Supporting Information Lee et al. 10.1073/pnas.0903619106 SI Materials and Methods The tobramycin sensitivities for strains expressing the rmtD Plasmids. Plasmid p(amgRSϩ) was constructed by inserting a 2.4 ribosomal methylase gene were determined by a 2-fold broth kb PCR fragment carrying the region from 206 bp upstream of dilution test. Inocula were prepared by growing cells at 37 °C for the amgR start codon to 60 bp downstream of the amgS 16 h in LB lacking NaCl. Cells were diluted to approximately ϫ 6 termination codon into a derivative of pUCP19 (1). Plasmid 3.3 10 cells/ml based on OD600. After a 90 min incubation at 37 °C, 10 ␮l aliquots were distributed to wells (in 96-well format) pRmtD was constructed by inserting the 2.3 kb HindIII-XbaI ␮ fragment carrying rmtD from pPA95B1 (2) into a derivative of containing 125 l LB buffered with 0.1 M MOPS at pH 7.6 pUCP19 (1). Plasmids used for complementation studies (Table containing different concentrations of tobramycin. MICs were 1) were constructed in pUCP19 derivatives by inserting PCR determined after incubation for 24 h at 37 °C. fragments corresponding to the genes tested. Plasmid pIbsC was Transcriptional Profiling. MPAO1 and ⌬amgRS transcriptomes constructed by inserting a 1.8 kb PCR fragment carrying the were compared under tobramycin-treated and -untreated con- arabinose-inducible ibsC construct (P -ibsC) from pAZ3-ibsC bad ditions. Samples were prepared in duplicate from independent (3) into a derivative of pUCP19 (4), resulting in pIbsC. The cultures grown in 15 ml LB lacking NaCl.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Structure and Function of Nucleases in DNA Repair: Shape, Grip and Blade of the DNA Scissors
    Oncogene (2002) 21, 9022 – 9032 ª 2002 Nature Publishing Group All rights reserved 0950 – 9232/02 $25.00 www.nature.com/onc Structure and function of nucleases in DNA repair: shape, grip and blade of the DNA scissors Tatsuya Nishino1 and Kosuke Morikawa*,1 1Department of Structural Biology, Biomolecular Engineering Research Institute (BERI), 6-2-3 Furuedai, Suita, Osaka 565-0874, Japan DNA nucleases catalyze the cleavage of phosphodiester mismatched nucleotides. They also recognize the bonds. These enzymes play crucial roles in various DNA replication or recombination intermediates to facilitate repair processes, which involve DNA replication, base the following reaction steps through the cleavage of excision repair, nucleotide excision repair, mismatch DNA strands (Table 1). repair, and double strand break repair. In recent years, Nucleases can be regarded as molecular scissors, new nucleases involved in various DNA repair processes which cleave phosphodiester bonds between the sugars have been reported, including the Mus81 : Mms4 (Eme1) and the phosphate moieties of DNA. They contain complex, which functions during the meiotic phase and conserved minimal motifs, which usually consist of the Artemis : DNA-PK complex, which processes a V(D)J acidic and basic residues forming the active site. recombination intermediate. Defects of these nucleases These active site residues coordinate catalytically cause genetic instability or severe immunodeficiency. essential divalent cations, such as magnesium, Thus, structural biology on various nuclease actions is calcium, manganese or zinc, as a cofactor. However, essential for the elucidation of the molecular mechanism the requirements for actual cleavage, such as the types of complex DNA repair machinery. Three-dimensional and the numbers of metals, are very complicated, but structural information of nucleases is also rapidly are not common among the nucleases.
    [Show full text]