PROCEEDINGS OF THE 3RD ANNUAL CONFERENCE OF THE SOCIETY FOR UNDERUTILIZED LEGUMES (SUL)

THEME:

UNRAVELING THE HISTORIC VALUES AND PROMOTION OF UNDERUTILIZED LEGUMES FOR ENHANCED PRODUCTION, NUTRITION AND VALUE ADDITION

INSTITUTE OF AGRICULTURAL RESEARCH AND TRAINING OBAFEMI AWOLOWO UNIVERSITY, MOOR PLANTATION, IBADAN

IBADAN 2019

9TH - 11TH JULY, 2019

Edited by: Prof. S. A. Olakojo, Prof. L. B. Taiwo, Dr. (Mrs) B. Makanjuola and Mrs. O. A. Agbeleye

© 2019 SOCIETY FOR UNDERUTILIZED LEGUMES (SUL) Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

TABLE OF CONTENTS

Page Conference Registration (Non-members) .. .. i - v LOC for the Third Annual Conference of the Society .. vi Forward ...... vii Acknowledgments ...... viii President’s Welcome Address ...... ix - xi Speech delivered by the Chairman LOC .. .. xii - xiii A Keynote Address ...... xiv - xxix Lead Paper Presentation: By Prof. Kehinde Taiwo .. 1 - 24 Lead Paper Presentation: By Prof. M. O. Atayese .. 25 - 32

BIOTECHNOLOGY AND GENETIC IMPROVEMENT 33 Response of Chickpea (Cicer arietinum I).) varieties to different weed management regimes at ringim, Jigawa State, Nigeria. Ali S, Mohammed L., Shehu, S.M. Muhammad A.A., Jahun A.H., Fagam A. S., Aliyu M., Abubakar M.A., and Isyaku, M. S. 34 - 39

Cowpea Wild Relatives: New source for cowpea aphid (Aphis craccivora) Resistance Gene Nwosu D. J., Falusi A. O., Gana A.S., Olayemi I. K., Aladele S.E., Daudu O.A.Y and Olubiyi M. R. 40 - 49

Diversity of Legumes Native to Nigeria Nwankwo O. E and Nnamani C. V. .. .. 50 - 56

Genetic diversity of Bambara Groundnut genotypes (Vigna subterranea (L.) Verdc.) revealed by SSR markers Mohammed S. M. Hussein A. S. and Mark D. L. .. 57 - 72

Bio-Diversity Investigation of Leguminous Plants (Fabaceae) found in Ibadan South East Local Govt. of Oyo State. Hassan A. B., Rapheal O. and Bola Owodunni .. 73 - 83

Screening of cowpea wild relative for drought tolerance at seedling stage Aladele S. E., Olosunde A. A., Afolayan G., Okere A. U., Uthman T. K., Sjo A. K., Ojo A. O., and Olubiyi M. R. 84 - 92

Genetic Estimates and Phenotypic Diversity of some African yam bean (Sphenostylis stenocarpa (Hochst ex. A. Rich) Harms) accessions Adewale B D., and Asonibare, I. B. .. .. 93 - 102

Response of African yam bean (Sphenostylis stenocarpa (Hochst ex. A. Rich) Harms) accessions to varied seed bed preparations. Adewale B. D and Saliu T. S. .. .. 103 - 109 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Page Numerical taxonomic studies on Sphenostylis stenocarpa (Hochst Ex. A Rich) Harms, Variants from South-east Nigeria Nnamani C. V. and Nwefuru M. S. .. .. 110 - 114

Preliminary evaluation of twenty accessions of kidney bean (Phaseolus vulgris L.) using selected agro-morphological traits Agbeleye, O. A., Majolagbe, O.J. and Anjorin, F. B... 115 - 122

SOIL FERTILITY AND AGRONOMY 123 Cajanus cajan (L.) Millsp: An Underexploited Multipurpose Grain Crop for Maximizing from Agroforestry Systems in Nigeria Nwogwugwu J. O. Olomola and Anicet .. 124 - 134

Effects of Lima Bean (Phaseolus lunatus) Production on some Enzymatic activities and Soil Biological Properties Ezaka E., Taiwo L. B., Uthman A.C.O. and Oyedele O. A. 135 - 142

Productivity of Lima ben (Ohaseolus lunatus I.) Cultivars as influenced by NPK fertilization and staking in Northern Guinea and Sudan Savannah Zone, Nigeria Nasidi, Y.A., Shebayan, J.A.Y., Ibrahim U. and Muhammad A. A. 143 -153

POST HARVEST AND UTILIZATION 154 Effect of soaking and frying on the physical, chemical and sensory proper- ties of lima beans snack Abiodun O.A., Ojo, A., Olosunde O. O, Okewuyi O.Y. and Nwosu C. .. .. 155 - 158

Post-harvest losses in bambara groundnut (Vigna subterranca (L.) Verdc.) seeds - a preliminary investigation. John Olayinka Atoyebi and Timothy Oluwafemi Ajiboye 159-162

Evaluation of selected lime bean products for consumer acceptability at Erin-Oke, Osun State, Nigeria Farinde E. O. Oyedokun M. O., Fasoyiro S. B. and Adebayo, A. K. .. .. 163 - 170

Microbial Evaluation of Stored Breakfast Meal Prepared from African Yam Beans (AYB) and Quality Protein Maize (QPM). Ejigbo Elizabeth Abimbola .. .. 171 - 176

Bambar groundnut production and utilization value chain in Ebonyi State Nwanchor K. and Okeke, G. C. .. .. 177 - 186

Physical Cyanide Contents and Functional Properties of African Yam Beans Accessions Ojo A., Abiodun O. A., Olosunde O. O., Amanyunose A.A. Ogundimu M. O. and Nwosu, C. .. .. 187 - 191 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Page

Production of biscuits from two underutilized food crops in Nigeria Olanipekun O. T...... 192 - 200

Determination of Ascorbic acid (vitamin C) content in sprouted brown African yam beans (Sphenostylis stenocrpa) Omenna E. G. and Amadife A. E. .. .. 201 - 206

African yam bean: a review of an unharnessed important source of protein for livestock feed Omodewu I. A. Boladuro B. A. and Harry B. J. .. 207 - 217

The Effects of Bambara groundnut (Vigna subterreanea) Diets on the Haematology and Serum Chemistry of Male Wistar Rats Soetan K. O., Ogheneruona O. and Akinsulie O. C. .. 218 - 222

Medicinal Properties of Some Selected Underutilized Legumes Soetan K. O. .. .. 223 - 236

Crop physiology Varietal response of pigeon pea (Cajanus cajan (I) millsp.) to compost application Ogunjinmi, S. O. Adejumo S. A, Adediran J. A., Togun, A. O. and Olunloyo, A. A. .. .. 237 - 243

Incidence and Severity of Leaf Spot Disease of Mungbean (Vigna radiata) and the Associated Fungl Pathogens Oduwaye O. F and Agbeleye O. A. .. 244 - 250

Incidence, Severity and Serological Detection of Potyvirus in Sprayed and Unsprayed Lima bean plants Kareem, K. T. and Agbeleye, O. A. .. 251 - 256

ECONOMICS AND EXTENSION 257 Economic Analysis of soybean production in Ibarapa zone of Oyo State, Nigeria. Rasaki, W. A., Olojede, M. O., Omotoso A. B. and Sulaimon, I.O. 258 - 267

Assessment of Information Channels for technology adoption among under utilised legumes’ frmers in Oke Ogun are of Oyo State Amusat, A. S...... 268 - 274

COMMUNIQUE ...... 275 - 277 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

SOCIETY FOR UNDERUTILIZED LEGUMES CONFERENCE REGISTRATION

9TH – 11TH JULY, 2019

·AYOOLA, O. T. Prof. (Mrs.), Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08033180464 ·UTHMAN, A. C. O., Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:douluru@outlook Phone No. 08097706113 ·ODUWOYE, O. F. Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08097706113 ·NWOSU, D. J. NACGRAB email:for:[email protected] Phone No. 08034687117 ·OLADIMEJI, A. O. Dr., OSUSTECH email:oladitwo@osustech,edu,com Phone No. 08038625108 ·SOETAN, K. O. Dr., University of Ibadan email: [email protected] Phone No. 07017824679 ·ADENIYI COKER email:[email protected] Phone No. 08056646144 ·OWOLADE, O. F. Dr., Institute of Agricultural Research and Training, Moor Plantation Ibadan - Phone No. 08060244055 ·OGUNJIMI, SAMSON .O., Oyo State College of Agric. Tech. email:[email protected] Phone No. 08038174622 ·OLLA, NOAH. O, Oyo State College of Tech. email:[email protected] Phone No. 08030659348 ·ADEDIRAN, J. A. Prof., email:[email protected] Phone No. 08033546353

I Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

·UDENSI,0. UGORJI, UNICAL email:[email protected] Phone No. 08030813667 ·IHUMA OGECHI, MOUA, Umudike Email:[email protected] Phone No. 07036962764 ·FARINDE ELAZABETH Dr. (Mrs.), Institute of Agricultural Research and Training, Moor plantation Ibadan. email:[email protected] Phone No. 08075454882 ·OLAYINKA BOLANLE, Institute of agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 07030311083 ·ANJORIN, F. B. Dr. (Mrs.), Institute of Agricultural Research and Training, Moor Plantation Ibadan. Phone No. 08030701385 ·AGBELEYE, O. A., Institute of Agricultural research and Training, Moor Plantation Ibadan ·EJIGBO ELIZABETH. A., Institute of Agricultural research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08036222247 ·AMINU A. MUHAMMED, IAR/ABU Zaria. email:[email protected] Phone No. ·NASIDI, YUSUF AHMED, IAR Samaru Zaria. email:[email protected] Phone No. 08061549870 ·PROF. OLUSEYI ADEBOYE AKINLOYE, Biochemistry Department FUNAAB, Ibadan.email:[email protected] ·OLANIPEKUN, O. TAIWO, Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08060330688 ·RICHARD OGUSOLA, FUNAAB, Abeokuta. email:richardogunsola [email protected] Phone No. 08053531009 ·ADEBOYE , MOTUNRAYO F., University of Ibadan. email:[email protected] Phone No. 09055177820

ii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

ADEYEMO, OLABISI J., University of Ibadan email:[email protected] Phone No. 07062669409 ·EZAKA EMMANUEL FUNNAB email:[email protected] TAIWO OMOTOLA, University of Ibadan email:[email protected] Phone No. 08033847092 ·AFOLARIN OLAMIDE, FUOYE Phone No. 08139488737 email:[email protected] ·SUGHNEN, ANGELA, ATBU, Bauchi email:[email protected] Phone No. 07059297871 ·JOHN O. ATOYEBI, NACGRAB email:[email protected] Phone No. 08033824752 ·LAWAL MUHAMMED, Bulyaminu Suleman Hadejo Jigawa State. email:[email protected] Phone No. 08069487486 ·SURAJO ALI, Bulyaminu Suleman Hadejo Jigawa State email:[email protected] Phone No. 08068096811 ·SUBUOLA FASOYIRO Dr. (Mrs.), Institute of Agricultural Research and Training, Moor Plantation Ibadan email:[email protected] Phone No. 08052181883 ·ADEGBITE, A. A. Dr., Institute of Agricultural Research and Training, Moor Plantation Ibadan Phone No. 08055306000 ·OLASOJI, J. O. Dr., Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08037058191 ·AMUSAT, A. S. Dr., Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08023469575 ·OMENNA E. C., Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 080398492 ·ASHAYE, O. A. Prof., Institute of Agricultural research and Training, Moor Plantation Ibadan.

iii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

·ADETAYO, A. O., Institute of Agricultural Research and Training, Moor Plantation Ibadan.

email:[email protected] Phone No. 08058976504 ·AMOSUN J. O. Dr. (Mrs.), Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08033752332 ·MOSOBALAJE MUTIU A. Dr., Oyo State College of Agric. & Tech. Igbo-ora email:[email protected] Phone No. 08034780805 ·RASAKI, W. A., Oyo State College of Agric. & Tech., Igbo-ora. email:[email protected] Phone No. 07065893037 ·BIDMOSI, F. A., Oyo State College of Agric. & Tech., Igbo-ora - 0817862617 ·SULAIMAN, O. I., Oyo State College of Agric. & Tech, Igbo-ora - 08139503766 ·NWAUCHOR KELECHI, Ebonyi State University email:[email protected] Phone No. 07033571288 ·CHIEF GRACE OLUWAYOYE, Life Builders, email:[email protected] Phone No. 08033745604 ·NWANKWO,ONYEBUCHI E., Ebonyi State University, Abakaliki email:[email protected] Phone No. 08063632924 ·OMODEWU, IFEOLUWA A., FUNNAB, Abeokuta & IAR&T., Ibadan email:[email protected] Phone No. 08167330502 ·EUNICE. ANUMELECHI O., IITA/U.I email:[email protected] Phone No. 08168873771 ·OKOYE, PASCAL C., University of Benin email:pascal.okoyelifesci.uniben.edu Phone No. 08064710362 ·MUSA,SAHEED IBRAHIM, Admiralty University of Mg, email:[email protected] Phone No. 07031316686 ·ASONIBARE, I. BLESSING., Federal University Oye Ekiti email:blessingsaint in @gmail.com Phone No. 08164916341

iv Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

·ASHAOLU, GBENGA J., Federal University Oye Ekiti email:[email protected] Phone No. 08144935610 ·OGUNJIMI, OLUWATOYIN F., Obafemi Awolowo University, Ile-Ife email:[email protected] Phone No. 07031950788 ·ETENG HOPE UFOM., University of Calabar, Calabar email:[email protected] Phone No. 07035216373 ·OLUWOLE-BANJO KOLAWOLE., University of Lagos email:[email protected] Phone No. 08023160807 ·NNAMARI, C. V., EBSU email:[email protected] Phone No. 08037786969 ·TAIWO, L. B. Prof., Institute of Agricultural Research and Training Moor Plantation Ibadan email:[email protected] Phone No. 08033860580 ·ADEDIRAN, ARINOLA BECKY, Institute of Agricultural Research and Training, Moor Plantation, Ibadan, email:adediran. [email protected] Phone No. 08039638471 ·MAKANJUOLA, B. A. Dr. (Mrs.), Institute of Agricultural Research and Training, Moor Plantation Ibadan. email:[email protected] Phone No. 08075402181 ·ABBERTON, MICHEAL Prof., IITA - Phone No. ·ADEWALE, B. DANIEL., Federal University Oye-Ekiti - Phone No. 08039228085 ·ADEGBOYEGA, TAOFEEK TOPE., IITA, Ibadan. Phone No. 08034840801 ·NNAMANI, CATHERINE VERA., Ebonyi State University Abakaliki – Phone N0. 08037786269 ·POPOOLA, JACOB OLAGBENRO., Covenant University, Ota Ogun State – Phone No. 08057108566 ·OYATOMI, OLANIYI AJEWOLE., IITA Ibadan. Phone No. 08033784501 ·KAREEM, K. T. Dr. (Mrs.), Institute of Agricultural Research and Training, Moor Plantation Ibadan. ·OLAKOJO, S. A. Prof., Institute of Agricultural Research and Training, Moor Plantation Ibadan. ·DAUDA, TAOFEEK. Dr., Institute of Agricultural Research and Training, Moor Plantation Ibadan. -IITA, STUDENTS/SCIENTISTS

v Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

IAR&T LOC FOR THE THIRD ANNUAL CONFERENCE OF THE SOCIETY FOR UNDERUTILIZED LEGUMES

LOC CHAIRPERSON Prof. L. B. Taiwo LOC SECRETARY Mrs. O. A. Agbeleye

SUB-COMMITTEES FUND RAISING Chair: Prof. O. T. Ayoola Prof. O. A. Ashaye Dr. A. Oyegbami Dr. Remi Ojo Dr. D. J. Ogunniyan

SECURITY/LOGISTICS Chair: Dr. O. F. Owolade Dr. J. O. Amosun Dr. J. O. Olasoji Mr. Uthman Mr. A. O. Adetayo Mr. Jide Ladipo PUBLICITY Chair: Dr. A. S. Amust Dr. E. O. Farinde Dr. F. B. Anjorin Dr. Oyedokun Dr. Dauda Mrs. M. O. Olowolafe Miss Arowosoge EDITORIAL Chair: Prof. S. A. Olakojo Dr. B. Makanjuola Mr. S. T. Akinyosoye Mr. Fademi Ibukunoluwa WELFARE Chair: Mrs. A. O. Oyedele Mr. B. J. Harry Miss A. Adediran Mrs. Olutimi TECHNICAL Chair: Dr. A. A. Adegbite Dr. F. T. Ajayi Dr. K. T. Kareem Mr. Ayo Adelana Mr. E. C. Omenna

vi Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

FORWARD

ociety for Underutilized Legumes (SUL) held her 3rd Annual Conference at the SInstitute of Agricultural Research and Training, Obafemi Awolowo University, Moor plantation, Ibadan on the 9th-11th July 2019. The theme of the conference was 'Unraveling the Historic Values and Promotion of Underutilized Legumes for Enhanced Production, Nutrition and Value Addition'. The choice of the theme of the conference was based on the need to promote the crops which are becoming endangered and neglected. The sub-themes include Improvement strategies of the crop, Crop physiology, soil component, post-harvest handling and value addition as well as extension and economics. The conference extensively discussed the sub-themes. Over a hundred scientists, farmers, policymakers and students attended the conference. Over fourty (40) papers were presented. The papers addressed the current challenges of production, utilization, and extension. Field trip event was undertaken at National Agricultural Genetic Resources and Biotechnology Centre and International Institute of Tropical Agriculture. The participants were shown the genetic resources of the 2 centers. Papers presented were thoroughly reviewed after which the papers that addressed the current issues and challenges were selected for publication in the Conference Proceedings, the first for the society. I am hopeful that the information therein would go a long way in enhancing production, value addition, and economics of the crops. I am also very confident that the document will serve as an information resource for scientists, farmers, policymakers and other stakeholders in the production and utilization of the underutilized legumes.

Prof. Lateef Bamidele Taiwo, LOC Chairman, July 2019

vii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

ACKNOWLEDGMENTS

he Local Organizing Committee (LOC) expresses their appreciation to the Director Tand the entire management of the Institute of Agricultural Research and Training, Obafemi Awolowo University, Ibadan for providing the facilities used for the successful hosting of this conference. The Director particularly provided the seed money and enabling environment for the meeting. We express our sincere gratitude to the Head, Genetic Resources and Bioscience Center and Deputy Director, Research for Development (R4D), West Africa, International Institute of Tropical Agriculture, Ibadan, Prof. Michael Abberton for his support. The center has been a partner to the society and provided funds for the printing of the Book of Abstracts and this proceeding of the 3rd Conference. We are very grateful. The contributions of Chairmen and rapporteurs of the technical sessions are well acknowledged. We thank all the reviewers of the manuscripts for the good works. Likewise, we thank the Chairpersons and members of all the sub-committees for their wonderful contributions to the success of the conference. We are particularly grateful to the Provost, Federal College of Animal Health and Production Technology for providing some of the Audio Virtual tools used in the conference. We appreciate the National Executive Committee of the society under the leadership of Dr. Daniel B. Adewale. The executive committee gave us very strong logistic support. We thank you all.

Local Organizing Committee.

viii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

PRESIDENT’S WELCOME ADDRESS ur name is Society for Journal of Underutilized Legumes OUnderutilized Legumes (SUL), a (JUL) in this year's conference. I am society that is devoted to improving also glad to inform you that a book of awareness, research and utilization of Proceedings (the first by SUL) is also a underutilized legumes in the tropical product from this conference. I am regions of the world. We have come to proud to have the big and focussed be identified with the abandoned, minded Editorial team in SUL, which almost-exiting, endangered, lesser, made JUL a reality today. I am grateful lost, neglected, orphan, stigmatized, to Dr. Ikhajiagbe, B. (JUL Editorial traditional, undervalued, under- Chairman) and Prof. S. A. Olakojo (3rd utilized etc. leguminous species. I Annual Conference Editorial hope you are proud to be; it is great to Chairman) and the teams for making witness the third annual conference the Journal and the Proceeding a amidst significant progress and possibility in this third year Annual achievements. Among our countable Conference. These documents accomplishments are: full registration henceforth become our vehicle to of the society, increased membership reaching global fame; we are just with wider representation in the starting. geographical regions of Nigeria, I am greatly indebted to the ownership and maintenance of a Institute of Agricultural Research and website (www.sulegume.org) etc. Training (IAR&T), Ibadan, Nigeria for The Genetic Resources Centre hosting this year's conference. To the (GRC), International Institute of Chairman, Local Organizing Tropical Agriculture, Ibadan, Nigeria, Committee (LOC), Prof. L. B. Taiwo, has been a partner to SUL since you are greatly appreciated. I am glad inception. The coming to be of SUL to make a list of the different was initiated by a symposium on subcommittees involved in the African yam bean organised by GRC planning for this conference, they are: in 2016. The involvement and Editorial, Fund raising, Publicity, assistance of the Head, GRC has been Security/Logistics, Technical and very prominent to SUL till now. Prof. Welfare whose pertinent efforts Abberton Michael who is fondly brought the success being celebrated called “Angel Michael” has been today; my sincere gratitude to all the indescribably good to us for support chairpersons and members of the and guidance; we owe him so much various subcommittees. I specially that we cannot pay back. I hope he will salute the strong LOC Secretary (Mrs. find our recognition of him as the first Agbeleye, A.) for all her efforts. Thank FELLOW of SUL not too small to you very much. accept. I want to thank every member of We are proud to launch the this society; your presence has made Volume One of our society journal:

ix Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 the existence of this society a dietary shifts and global climate possibility. Without you, there is no change (Waha et al., 2017) have SUL. Please let us keep the union constantly make its attainment continue with renewed commitment difficult. Underutilized crop are and support. Everyone is very climate-smart crops which needs to important and equal. My appeal is return to its rightful place in our meal coming because of the nascent nature for the teeming population to be food of our society; growth and and nutritionally secured. As the development is a gradual process. We historic values of the underutilized are looking forward to attaining an species will be unraveled during this international fame; it is very possible conference, we are to go home with the challenges of how to promote the together with you. awareness of their potentials, discover William and Haq (2003) noted that researchable gaps that can enhance about 1.2 billion people of the world their improved production and do not have enough food to meet their nutritional qualities for renewed daily food requirement while a further attractions into our meals culture. 2 billion people are deficient in one or Dear colleagues, let us harness our more micronutrients. Dietary shift diversity (culture, discipline, which has aided intensive production profession etc.), connect and of few crops and reduced production collaborate to move forward to of the others (the neglected and under- improve lives. Let us make our voice utilized crop species) is the major one to improve awareness and cause of the increasing global food stimulate means to increase crisis and nutritional insecurity. Most production of the neglected pulses. All crop of our dependence are now so the identified inherent limitations improved that they are just next to should become a research problem becoming synthetics. Consumption of needing solution. Let us further healthy foods is the cornerstone of remember that our efforts in promotion efforts to improve diet quality in can contribute significantly to populations. We know that a higher improved health and nutrition, intake of plant foods is associated with livelihoods, household food security lower risk of chronic diseases. We and ecological sustainability. equally are aware that the nutritional Below are the lists of some notable quality being hosted by many underutilized food legumes again: underutilized crop species are Canavalia ensiformis (Jack bean), enormous. The goal for us all who are Canavalia gladiata (Sword bean), here in this conference is to redeem Kerstingiella geocarpa (Ground bean, our meal for better health and longer G e o c a r p a g r o u n d n u t , H a u s a living. groundnut, or Kersting's groundnut), Achieving global food security Lablab purpureus (Hyacinth bean, remains a key challenge for the future lablab-bean, Egyptian kidney bean), but continued population increases, Macrotyloma uniflorum (Horse gram),

x Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Psophocarpus tetragonolobus from us unknown and untapped and (Winged bean), Sphenostylis hence the problem they would have stenocarpa (African yam bean), solved still remain. Pick up the Voandzeia subterranea (Bambara challenge to rescue at least one of such nut) etc. Their present conservation species; even crop species outside the status is unknown but they still exist leguminous domain. (with unknown proportion) in few I appreciate you all for local niches. We are losing the touch presenting yourself to making this with the reality, many taxa have gone third annual conference an event. Thanks and regards with cheers.

Dr. Adewale, B. Daniel National President, SUL.

xi Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

SPEECH DELIVERED BY THE CHAIRMAN, LOCAL ORGANISING COMMITTEE, 3RD ANNUAL CONFERENCE OF THE SOCIETY OF THE UNDERUTILISED LEGUMES HOLDING BETWEEN 9TH AND 11TH JULY, 2019 AT I. A. R.&T., IBADAN, NIGERIA

I have the singular honour and production of various commodities is privilege of welcoming you all to the not enough. Value addition will Institute of Agricultural Research and unarguably lead to more money to the Training, Obafemi Awolowo farmers and of course to all the players University, Moor Plantation, Ibadan in the value chain. Nigeria is endowed for the 3rd edition of the conference of with numerous natural resources but Underutilized Legumes. we have obviously underutilized the As we all know, the society is resources. On Bambara groundnut relatively young and I am delighted to alone, various recipes can be prepared note that the executive and members to improve the nutrition of Nigerians. have exhibited the uncommon zeal to Research results have shown that with build it on a very strong academic and a carbohydrate of over 60%, industrial professional foundation. Modern-day ethanol, as well as biogel for domestic Agriculture laid much emphasis on the cooking can be obtained from complete value chain and marketing Bambara groundnut. This is capable of outlets for farm produce. Some improving the local economy of the commodity societies haven't fully rural poor and lead to the industrial understood this. Optimal agricultural development of the country. Research production can only be sustained if the institutes and universities have concept of a complete value chain is assiduously worked to generate committedly adopted. I see this society technologies but the technologies as one of the many, striving to ensure largely remain on the shelf. For that science is translated into reality. example, in IAR%T, the Product This is quite evident on our Whatsapp Development Programme has recipes platform. Recall that on our E- for virtually all the underutilized Platform created for this crop, some legumes; Lima bean, Cajanus cajan, products from the underutilized etc. The government must harvest and legumes particularly Bambara harness these technologies for groundnut were exhibited. We have industrial purpose. also exhibited Bambara groundnut There is a need for the private milk and Bambara groundnut cake. sector to actively participate in the Some of our colleagues have commercialization process of the documented a number of products technologies on the shelf. This society, from Lima bean and Cajanus cajan in as one of the strong stakeholders in the their publications that are on display production, utilization of the outside. As we all know, the field underutilized legumes must be

xii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 supported to sustain the tempo of sister KT of Obafemi Awolowo activities on the crops. In this University and my very good conference, over fourty papers will be colleague, Prof. M. O. Atayese of the presented. The papers cover crop Federal University of Agriculture improvement and biotechnology, Abeokuta for honouring our production, plant protection and invitation. We initially planned to agronomy, soil improvement, value publish the Book of Proceedings addition and storage and of course before the conference but later economics and marketing. changed that decision based on some T h e p a p e r s a d d r e s s e d technical challenges. The proceedings constraints of field production, will be published soon. processing, packaging, storage, and We thank our Director, Prof. marketing. The research outputs of the Veronica Obatolu for the institutes' participants as evident in the papers financial support. Prof. Aberton of are consistent with the mandate of IITA has been a very strong pillar of IAR&T which has gone a long way to this conference. We want to thank him reinvigorate the inert attributes of the immensely for this support. crops. Further efforts are on to I want to appreciate all the organize training programmes for members of the Local Organising farmers, women and the youths. I Committee (LOC) for their support. hope the governments at all levels will support all these efforts. Thank you and God bless I want to thank the national executive of the society for bringing the conference to IAR&T. I also thank the keynote speaker, Prof. Nnamani of Ebonyi State University and our lead Prof. L. B. Taiwo, paper presenters, Prof. K. A. Taiwo; Chairman, LOC

xiii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Unraveling the (historic) values and promoting underutilized legumes (UL) for enhanced production, nutrition and value addition A keynote address presented by Prof. Henrietta Ene-Obong, FNSN, NAS University of Calabar, Calabar

Introduction: nourishment, malnutrition and The problem of food insecurity, wasting. Globally, the number of hunger, malnutrition and disease are undernourished population has known serious public health problems continued to increase (in 2015, 777m; in Africa, despite her rich biodiversity. in 2016, 816m and 2017, 821m Africa has been referred to as “a land people), but Africa, and particularly of promise with great nutrition Sub-Saharan Africa (SSA) remains the challenges” and “as the home of the region with the highest prevalence of most nutritionally insecure people in undernourished population: affecting the world” (UNDP working paper, 21% and 23.2% of the population, 2012) a paradox. According to the respectively; i.e. between 1 out of 4 World Economic Forum (2015), and 1 out of 5 suffer from chronic hunger can manifest as under- deprivation (FAO et al. 2018).

xiv Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Figure 1: Number and percentage of chronically under-nourished persons in the World since 2005

Malnutrition • Under-nutrition (low weight- This refers to failing health resulting for-age): refers to a composite from dietary intake and practices that index of stunting and wasting do not coincide with nutritional needs. and used to measure over all It can manifest as under-nutrition or under-nutrition over-nutrition. Micronutrient deficiencies (Hidden Under-nutrition hunger) Results from insufficient These are due to insufficient nutrient intake that does not meet body intake, absorption or utilization requirement or needs. of nutrients leading to specific Under-nutrition is characterized by micronutrient deficiencies: iron the following: deficiency anaemia (IDA), • Stunting (low height-for age) iodine deficiency disorders indicates chronic deprivation (IDD), vitamin A deficiency o f a d e q u a t e n u t r i t i o n , (VAD), zinc deficiency, etc. particularly in the first 1000 These micronutrient are of days of life. significant public importance.

Wasting (low weight-for- Over-nutrition • These results from prolonged height) or acute under- nutrition. This is weight loss as consumption of more energy a result of inadequate intake of and nutrients than the body food or a recent episode of needs. illness.

xv Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Signs and symptoms of over- and obesity due to prolonged nutrition: consumption of energy in • These may cause no signs or excess of body requirement. symptoms but in the long run, some nutrient may increase to • Both over-nutrition and under- toxic levels leading to serious nutrition are known to lead to chronic diseases like iron overload diseases (diabetes, hypertension, (causing liver damage/failure), cancers, cardio vascular diseases, etc.) over a life time as a result of metabolic vitamin A toxicity (causing abnormalities induced by genetics, congenital defects). age, sex, lifestyle and environment.

• The most common type of over-nutrition is overweight

Fig. 3. Triple Burden of Malnutrition

xvi Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

xvii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Micronutrient deficiencies m a l n u t r i t i o n a n d t h e i r The 2018 NDHS survey showed that consequences. 62% of urban and 72.5% of rural Food (in) security children aged 6-59 months in Nigeria Food security “exists when all people, are anaemic; 53.6% of urban and at all times, have physical, social & 61.5% of rural women of reproductive economic access to sufficient, safe and age (15-49 years) are anaemic; 66.1% nutritious food that meets their dietary of pregnant women, 59.7% of breast needs and food preferences for an feeding mothers and 56.5% of non- active & healthy life” (FAO, 2009); pregnant-non-lactating women are also anaemic. Food insecurity, on the other hand, is Causes of malnutrition are defined as “limited or uncertain multidimensional and results from availability of nutritionally adequate & from the interaction of four major safe foods or limited or uncertain systems: ability to acquire acceptable foods in i) The Agri-food System socially acceptable ways (without ii) The Environment resorting to emergency food supplies, iii) The Health System scavenging, stealing or other coping iv) The individual and household strategies)”,as cited by Taylor and decision-making system Loopstra (2016). ( H a m m o n d & D u b e , 2012; Gillespie and van den Food security/nutrition security Bold, 2016). • Food security is not Nutrition security since improving food • T h e U N I C E F c o n c e p t nutrition requires more than illustrates this Causes of food (Jones et al. 2013).

UNICEF CONCEPTUAL FRAMEWORK modified by Lancet (2013)

xviii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

• Nutrition security exists when an active and healthy life all people at all times consume coupled with a sanitary food of sufficient quantity and environment, adequate health, quality in terms of variety , education and care (FAO/ diversity , nutrient content and AGN, 2012). safety to meet their dietary needs and food preferences for

Table 1. Severe Food insecurity in Nigeria (2015): a comparison between Nigeria and Ghana

Nigeria Ghana

Undernourished (%) 11.5 9.3 (million) 21.5 1.7 Severe Food insecurity (%) 24.5 7.9 (million) 46.1 2.2

Source: FAO et al., 2018)

xix Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Other factors include climate change, • The World Health Assembly set population growth, nutrition transition six goals for improving due to economic development, maternal and infants and young urbanization, globalization, changes children & nine for the in the food systems, lifestyle and p r e v e n t i o n o f n o n - eating habits, natural and man-made c o m m u n i c a b l e d i s e a s e s disasters bringing about a lot of (NCDs). displaced people vulnerable to • Following the ICN2 the United malnutrition. Nutrition transition has Nations, the “Decade of Action led to the consumption of highly on Nutrition” (2016-2025) was declared by the UN General processed foods that are high in Assembly in 2016 to provide all saturated fats, sugars, salt and low in stakeholders with opportunity fibre. to strengthen efforts and achieve a healthier and more Actions taken so far sustainable future. • Nutrition is now at the top of • It is on record that about 183 development agenda at the countries have national policies national and international that include nutrition goals and levels. actions, while 70 have made This has led to the setting up of efforts to maintain food • security and nutrition in global goals and targets s e c t o r a l p o l i c i e s a n d • The 2000-2015 Millennium investment programmes. Development Goals (MDGs) • In Nigeria, there is the health had nutrition indicators. section National Strategic Plan • There is the 2030 Agenda for of Action for Nutrition Sustainable Development with (NSPAN, 2014-2019) and the 17 targets; Goals 2 & 3 directly Agricultural Sector Food related to nutrition, while the Security and Nutrition Strategy remaining 12 cannot be (2016-2015). reached without actions on nutrition

xx Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

• These National Strategies are in that agriculture is primarily line with the SDGs 2: Zero about using natural resources to Hunger feed people. Sustainable • The global community has development will only happen responded to malnutrition crisis if we manage such resources in by focusing on interventions a sustainable way, building on that have impacted on 90% of local culture, protecting and the global population and strengthening livelihood and largely addresses inadequate ensuring good nutrition” dietary intake, disease burden (Fanzo et al., 2013). and poor child health. • There is also the recent focus These species have been on the first 1000 days of life , described with various names, viewed as a critical window for w h i c h a r e u s e d i n t e r- adequate child development c h a n g e a b l y , n a m e l y : and also linked with the fetal Underutilized, Neglected, origin of adult diseases Orphan, Minor, Promising, (FOAD) Niche, Local, Traditional etc. • These have led to various i n t e r v e n t i o n ( n u t r i t i o n A case for underutilized crops –specific and nutrition- According to FAO (2013) modern sensitive) programmes aim at agriculture cannot depend or rely on solving the nutrition problem. conventional species of plants and animal to alleviate hunger and Agricultural Biodiversity as a malnutrition; also the most commonly solution consumed species are not usually the A quote from Florence Egal most nutritious. Evidence has shown summarizes the need for considering that the most sustainable and efficient biodiversity as an effective option for way to improve nutrient content of diet combating malnutrition is to improve diet diversity (Arimond • “At a time when fortification is and Ruel, 2004; Rah et al., 2010). widely promoted as the most These are agricultural species which affective solution to address are not among the major staple crops micronutrient deficiencie, (it is are often referred to as “neglected and important to note) that nature underutilized species; they are provides an almost infinite marginalized, almost entirely ignored variety of food species which by researchers, breeders and policy are disregarded and therefore makers. pushed into oblivion and These crops can also be referred extinction by the prevailing to as crops that are well established in food production system. It is one country and neglected minor crops urgent to remind policy makers in another (Padulosi et al., 2013).

xxi Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Some of them were once grown more five (5) species (cattle, sheep, chicken widely and intensely but are falling and pigs) are the major animal source into disuse for a variety of agronomic, protein (FAO, 2010; Maxted and Kell, genetic, economic and cultural 2003; FAO, 2013). reasons (IPGRI, 2002). They exist in all foods groups and include species of Underutilized Legumes all forms that provide food from Among the underutilized species, various parts (seeds, leaves, roots, legumes belong to a special class that tubers, flowers, etc.). is worth discussing. Legumes are plants belonging to the Leguminosae Status of underutilized (Fabaceae) family which are grown for crops/species their edible seeds. The family Studies have shown that about Fabaceae consist of a diverse group of 300,000 plant species are available for bean-pod bearing plants ranging from human consumption however, 5,000 small annual shrubs to giant perennial to 10, 000 of these have been used for trees. The family Leguminosae is human consumption since the origin made up of three sub-classes: of agriculture. Thirty of these crops Papilionoideae, Caesalpinioideae and feed the whole world and provide Mimosoideae. Most edible legume about 95% of energy and protein. Only crops are found in the sub-family 3-4 (maize, rice, wheat and potato) Papilionoideae. The majority of the supply 50-60% of human energy Caesalpinioideae and Mimosoideae intake, while in the animal kingdom, are tropical trees and shrubs.

xxii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Importance of legumes carbohydrate including dietary fibre, They are excellent sources of plant and significant amounts of caloric proteins (18-35%) and B-vitamins, value. Their consumption has been contains good amount of lysine but associated with lower risk of poor in S-containing amino acid, developing chronic diseases like hence complement cereal grains which CVD, obesity, type 2 diabetes, are deficient in lysine but rich in s- cancers, etc. Legumes contain a range amino acids, providing meals with of bioactive compounds (phyto- balanced amino acids profile similar to chemicals) that render some protective animal proteins. Legumes contain effects. affordable sources of complex

xxiii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Constraints to production and factors, , although these can be utilization removed with processing. The beany Underexploited, Orphan, or under- flavours, hard-to-cook phenomenon in utilized, legumes are domestica-ted legumes are further constraints. legumes with useful properties, but with less importance than major world Examples of underutilized legumes crops due to use and supply Africa has a vast array of indigenous constraints (Cullis and Kunert, 2017). legumes ranging from large Although underutilized legumes are rainforest trees to small annual herbs. staple food crops in many developing They include: countries, their economic importance • African yam bean in global markets is limited (Naylor et (Sphenostylis stenocarpa) al., 2010) and they are primarily Pigeon pea (Cajanus cajan) grown by traditional farmers to • provide families with food security of • Bambara ground nut (Vigna high nutritional value (Nelson, 2016). subterranea) Underutilized legumes may be Velvet bean (Mucuna widely distributed beyond their • centres of origin but tend to occupy pruriens) special niches in the local production • Mucuna (Mucuna urens) and consumption systems. Although • Local cowpea (Vigna spp) important for the subsistence of local Lima bean (Phaseolus communities, they remain poorly • documented and neglected by the lunatus) mainstream research and development • Jack bean (Canavalia activities. However, owing to their ensiformis) supposed lack of economic importance, underutilized legumes Tree Legumes have been neglected by both the • Brachystegia eurycoma international scientific communities Counter wood tree (Afzelia and industries when compared to • commodities such as rice, corn (Zea africana) mays) and wheat (Foyer et al., 2016). • Tallow tree (Detarium This neglect has also resulted microcarpum) in a lack of genetic improvement, • Prosopsis africana (Okpei) resulting in inferior yield in terms of Pentaclethra macrophylla both quality and quantity. Legumes • also continue several anti-nutritional (Ugba)

xxiv Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

African yam bean (AYB) rated in animal models (Devindra et This is a food security crop. It is a al., 2017). Antioxidant potential of the tuberous legume in which both tuber crop has been shown (Rani et al., 2014; and seed are edible. Special features of Uchegbu and Isiwu, 2015) and control AYB include a better pattern of amino of cholesterol demonstrated (Aga et acid than most conventional legumes; al., 2015). Hypoglycemic, anti cancer, high total dietary fibre of about 19% anti inflammatory, antimicrobial and (Ene-Obong and Carnovale, 1992). hepatoprotective effect of pigeon pea Pharmacological potential demonstra- showed positive effects as reviewed by ted in the management of gout and Talari and Devindra, 2015). arthritis (Eneh et al., 2025); anti diabetic potential (Uchegbu, 2015). Value added products (meals/snacks) made from AYB showed low glycemic index in human subjects (Aburime, 2018)

Pigeon pea (Cajanus cajan) Velvet bean (Mucuna prupriens); Agbara (Ibo); Werepe (Yoruba) Velvet bean is high in protein (33-34% and dietary fibre (18.5-22.3%) Ene- Obong and Carnovale, 1992). It possesses antidiabetic, anti-neoplastic, African yam bean (Sphenostylis anti-microbial, aphrodisiac and stenocarp) Hochst ex. Rich) . Harms learning and memory enhancing Ijiriji/Nsama/Okpodudu/Akpaka/Azima properties (Shama, 2012). Velvet bean has the potential to recover Pigeon pea (Cajanus cajan); spermatogenic loss and therefore Agbugbu/fiofio useful for the extraction of quality Pigeon pea has higher total dietary sperm for use in vitro fertilization fibre (23-25%) than other legumes procedures. The presence of L-DOP is (Ene-Obong & Carnovale, 1992). It said to account for majority of its has been used for the effective activities (Singh et al., 2013). It has management of erythrocyte sickling in also been shown to improve blood Sickle cell anaemia patients in India glucose level (Onyeso et al., 2016). (Verma, 2015) and anaemia in Cote M. Pruriens protein hydrolysate could d'Ivoire (Kone, 2011). Prebiotic be used as a functional ingredient to potential of red gram raffinose prevent blood pressure increase (Chei- oligosaccharide has been demonst- Guerrero et al., 2017).

xxv Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Mucuna urens : Apon (Yoruba); Ukpo (Ibo); Ox-eye bean This is a traditional soup thickener, high in soluble dietary fibre (38. 4g/100g) and so can be used to control blood glucose level, and cholesterol. M. urens is very high in iron; 4.2mg/100g dry weight basis (Ene- Obong & Carnovale, 1992). Akolodo (Yoruba), Achi (Ibo); Brachystegia eurycoma; Family: Caesalpiniaceae A tree legume used as thickening agents in soups. It is high in soluble dietary fibre (51.3g/100g) Ene-Obong & Carnovale, 1992) and shown to improve blood glucose level (Onyeso et al., 2016). It is used as anthelmintic

xxvi Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 in Igboland. It has potential for the Counter wood tree; Akparata (Ibo); m a n a g e m e n t o f g o u t a n d Apa (Yoruba); Afzelia africana hypertension, as well as exhibiting Family: Caesalpiniaceae strong antioxidant and scavenging This is another thickening agent for properties (DPPH & ABTS) (Irondi et traditional soups; High in soluble al., 2017). dietary fibre (24.9g/100g) and fat/lipid(29%) (Ene-Obong & Carnovale, 1992). It has been suggested as a possible alternative source of industrial vegetable oil (Ejikeme et al., 2009). It is usually used as substitute for wheat flour in biscuit and doughnuts in Burkina Faso (Vinceti et al., 2019).

Bambara groundnut (Vigna subterranea); Okpa (Ibo) It is regarded as the third most important crop after cowpea and groundnut yet underutilized. Recently, more people are beginning Tallow tree; Ofo (Ibo); Detarium to consume pudding made from it as a microcarpum important snack. Family: Caesalpiniaceae This is also a soup thickener; high in soluble dietary fibre (50g/100g) (Ene- Obong & Carnovale, 1992). It is used for pastries in Burkina Faso (Vinceti et al., 2019) with demonstrated glycemic control and marked glucose and insulin reduction (Onyechi et al., 1998). It improves blood glucose level, liver function profile, liver enzymes (Onyeso et al., 2016).

xxvii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

• Every effort must be made to reintroduce the underutilized species into the dietary pattern of society to avoid their complete extinction. • Underutilized legumes should be incorporated into Research and Development (R&D) strategies and programmes; Local cowpea (Vigna spp.) varieties; • There is need to create database Akidi (Black); Olaludi (Brown); and repositories of information Apama (mixed colors) on the economic, social, The local cowpea varieties contain nutritional and other benefits of comparable protein content (28%) underutilized legumes to with conventional cowpea (26.7%). always provide the evidence These local genotypes contain high for all these aspects. dietary fibre (23%) compared to • Appropriate technologies need conventional cowpea (11.8%). Ayogu to be developed for processing & Onah (2019) incorporated Apama these legumes into ready to use (Vigna sinensis ) into wheat flour for products and new foods. This cookies fed to school children 6-12 will remove the labourious y e a r s o l d . A l l b i o m a r k e r s processing employed in their (hemoglobin, serum ferritin, zinc and preparation for consumption. vitamin A) improved. • Better varieties that will eliminate many of the anti- nutritional factors, hard-to- cook phenomenon and beany flavour of some of these legumes need to be developed. This will enhance acceptability and promote use. • Agricultural policies should focus on specific underutilized legumes for promotion, What should be done conservation and use. • Intensify and carry out more • The creation of multi- research on underutilized stakeholder group like the legumes to provide the Society for Underutilized evidence of their benefit and Legumes is a step in the right create the needed awareness direction. This society can act among the general population as an advocacy group to and policy makers. promote the production,

xxviii Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

conservation and use of The nutritional benefit of underutilized legume; underutilized legumes made them to • National and international be called “poor man's food”. agencies should advocate for Unfortunately, they are now food for the inclusion of underutilized the rich and beyond the reach of the legumes into nutrition policies and crop diversification poor. Therefore, the production of programmes. traditional/indigenous legumes must be promoted to fill this gap. Conclusions Adequate nutrition is a human The need to increase the food based of right. Access to safe nutritious and the Nigerian population cannot be over sufficient food must be framed as a emphasized. Although all the food human right with priority given to the groups have special contributions to most vulnerable people in the make to improve food and nutrition population. Agricultural research must security, legumes have a special place therefore develop strategies not only because of their significant nutritional, to produce more food from solely from and therapeutic benefits as well as their conventional species but also to ability to stabilize ecosystems. We produce and improve access to need not forget that legumes form the nutritious foods to alleviate hunger and basis for vegetarian diets and was the malnutrition if we hope to attain the food that sustained Daniel and the SDGs. Underutilized species, particularly three Hebrew children in the Bible legumes have key roles to play in this when they rejected the King's “dainty process. food and wine”.

xxix Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

LEAD PAPER PRESENTATION: POST HARVEST AND UTILIZATION OF UNDERUTILIZED LEGUMES

Post Harvest Utilization Of Underutilized Legumes: Value addition to Underutilised legumes

By Prof Kehinde Taiwo, Dept. of Food Science and Technology, Obafemi Awolowo University, Ile-Ife, Nigeria, [email protected], 08035829554

Presented at the 3rd Annual Conference of the Society For Underutilized Legumes (SUL)

Introduction improve the soil for sustainable Legumes, a general name for plants of the agriculture; 6) they diversify cropping family of Papilionaceae of the order systems (provide an alternative to cereal Leguminae. They are important monocropping); 7) they have a wide range constituents in the diets of a very large of uses as food, feed and raw material for number of people, especially in the industrial products; and 8) they are developing countries, and are good attractive to health-conscious consumers sources of protein which help to and medical practitioners. A mainstay of supplement cereal diets, improving their vegetarian diets, legumes play a critical protein nutritive value. Legumes are great role in meeting the protein needs of people sources of fat, protein and carbohydrates. who cannot access animal proteins such Different varieties contain varying as meat and eggs (Baker and Friel, 2016). amounts of these nutrients, with beans, nuts, peas and lentils all having unique Pulses (beans and peas known nutritional profiles. They also provide collectively as pulses when dry) are part substantial quantities of minerals and of a healthy, balanced diet and regular vitamins to the diet. Although most consumption has been linked to disease legumes are consumed as dry grains, prevention, including cancer, diabetes immature green pods or green seeds are and heart disease. These foods are also used as vegetables (FAO, 2016). considered to be nutrient-rich, economical sources of protein, slow- Legumes receive attention for the release of carbohydrates, dietary fibre, following reasons: 1) legumes play a various vitamins and minerals and non- major role in household food security; 2) nutritive components which may have they are the major source of protein, fat, several beneficial health effects. pulses supplemental energy and, more and other legume foods are associated importantly, micronutrients (legumes with longevity. Over 60 percent of pulses complement the cereal diet); 3) they are are utilised for human consumption, with the primary source of protein for the role in human diets varying between vegetarians and resource poor rural and countries with a higher consumption urban people; 4) they provide cash observed in lower income nations. income to rural populations; 5) they help Certain pulses, especially dry peas, are

1 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 also used as feedstuff. About a quarter of whether the lentils are sprouted or not pulses produced are used for feeding of (Caatinga et al., 2018). pigs and poultry. In a society where poor diet habits are one of the largest Underutilized Legumes: There is a wide contributor to the burden of disease, it is range of indigenous underutilized legume vital that we find ways to improve crops. It is essential to investigate the population-level consumption of potential usefulness of these indigenous healthier diets. Vegetables and legumes, species as food, feed, fiber, raw material such as chickpeas, lentils, lupins and for industrial and medicinal products. beans, form a key part of a healthy diet, Bambara groundnut (Vigna subterrance), and regular consumption of these foods Yam bean species (Pachyrhizus), Lupins has been shown to have a positive impact Lupinus species (Vigna umbellate), on improving risk factors for a range of W i n g e d b e a n ( P s o p h o c a r p u s non-communicable diseases (Gilham et tetragonalobus). Adzuki bean (Vigna al, 2018). angularis), Faba bean (Vicia faba), Food Moth bean (Vigna aconitifolia), Food There is a great variety of French bean (Phaseolus vulgaris), legumes, and many of the foods people Vegetable Horse gram (Macrotyloma are used to eating are actually classed as uniflorum), Food Hyacinth bean (Lablab such, even if they are known as something purpureus), Grass pea (Lathyrus sativus), else e.g. peanuts, which the majority of Lima bean (Phaseolus lunatus), Vegetable people believe to be a kind of nut, are Jack bean (Canavalia ensiformis), Sword legumes. Legumes that are classified as bean (Canavalia gladiate), Zombi pea nuts, beans and peas are approximately (Vigna vexillata), Pillipesera (Vigna spherical in shape. With their flat, round trilobata) (Male, 1994; Williams, 1993). shape, lentils differ from this general pattern. Whether yellow, orange, green, brown or black, the nutritional profile of Need For Value Addition lentils does not change with their color. However, sprouted lentils differ from Grain legumes are more difficult to store non-sprouted lentils in their nutritional than cereals and they suffer much greater content. Legume foods can be subdivided d a m a g e f r o m i n s e c t s a n d into four varieties: i) Beans- This is the microorganisms. This not only results in most common variety of legumes-adzuke quantitative losses, but also in qualitative beans, anasazi beans, black beans, reduction of the nutritive value because of chickpeas, fava beans, kidney beans, lima vitamin loss and deterioration of protein beans, and soybeans, ii) Nuts - are edible quality. The milling losses in insect- seeds from legume pods e.g. peanuts, damaged grain are even higher as more carob nuts, and soy nuts. These contain breakage and powdering occur with such high amounts of fat, protein, and grain (Kadam and Salunkhe, 1989). carbohydrate, iii) Peas - The most well- Societal changes and the known is probably the green pea. Others globalisation of the food supply have led are black-eyed peas, snow peas, snap to a shift in the types of food people eat, as peas, and split peas and iv) Lentils - are well as the way they are eaten, with flatter and round in shape. A wide variety consumers increasingly choosing in color is found for the lentils. While the convenient food options that require nutritional value does not change much minimal preparation such as ready-to-eat with color, it does change depending on meals and snack foods. Concurrently, we

2 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 are consuming more discretionary foods blood cholesterol and reduce the risk of (foods which do not form a key part of the heart disease (Tharanathan and diet, such as chips, chocolate and muesli Mahadevamma, 2003, Rehinan et al., bars) and products which have been ultra- 2004). processed. These products tend to be Pulses have a low glycemic index, energy dense and nutrient poor, but are are very high in fibre, containing both typically considered more convenient soluble and insoluble fibres. Regular and palatable compared to fresh, consumption of soluble fibre has shown minimally processed, healthier options. to decrease cholesterol and control blood The modern food environment offers sugar. Insoluble fibre helps with digestion and regular bowel movement (Rehinan et many convenient options. It is important al, 2004). Pulses contain essential that these products contain healthier vitamins and mineral. Key minerals ingredients such as vegetables and include iron, potassium, magnesium, legumes, and the relative nutritional calcium and zinc. Pulses are particularly value of these products (Khatoon and abundant in B vitamins such as folate, Prakash, 2006, Mulei et al., 2011). thiamine and niacin and various essential amino acids, including lysine. Pulses can help lower blood cholesterol and Nutritional Benefits From Eating attenuate blood glucose, which is a key More Legumes. factor against diabetes and cardiovascular All kinds of legumes are an excellent disease. They are helpful in the addition to a weight loss program. They prevention of certain cancers, mainly are relatively low on calories, but their because of their fibre content but also nutritional value is extremely high. They because of their vitamin, mineral and are also rich in fiber, and this combination amino-acid contents. Pulses are included of qualities makes them a perfect food for in all 'food baskets' and dietary guidelines diets. For example, replacing red meat throughout the world. The World Food with a serving of black beans lowers your Programme (WFP) recommends 60 fat intake while boosting your fiber and grams of pulses daily in its typical food protein intakes. Legume crops are a basket (Prodanov et al., 2004, Okpala and versatile and affordable source of protein Okoli, 2011). and other important nutrients. Legumes also are good antioxidants. Therefore, Utilisation of legumes/Value addition they protect the body from the damage Legumes may be utilized alone, milled dealt by free radicals, which weaken the and mixed with cereals, salted or immune system and speed up the process sweetened. Legumes are consumed in of aging. Red beans are the most potent various ways: as immature grain (green, antioxidants among its kind (Codex, roasted, boiled, fried and crushed and 2007). They also provide the body with a cooked); as mature dried grain (boiled, large dose of iron. This is an essential boiled and fried, cooked as dhal, benefit considering the fact that a huge germinated). De-husked splits number of people suffer from its (cotyledones) as dhal/sambar or deficiency. Women are more prone to converted into flour and then used in a developing anemia that strives from this number of preparations. Processes condition, so they will benefit from eating involved in preparation and use of grain red beans on a regular basis more than legumes are soaking, cooking, roasting, men. Kidney beans are considered such puffing, extrusion cooking, germination, an efficient antioxidant that some fermentation, canning and expression and companies make supplements out of expelling. The utilization pattern of them. They help control the levels of legumes can be grouped as follows: Green

3 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 pulses (fresh, boiled and roasted); never soften. Old beans will also have Sprouted and germinated (boiled and declining nutrient levels. Legumes go fried); Puffed and roasted (spiced/salted); through several primary processes- Milled and cooked (steamed, boiled and hulling (husking), puffing, grinding, fried); Fermented products (idli, dosa, dhokla, etc.). Legumes can be processed splitting, etc.-before they are used in into a wide variety of products, depending different food preparations. The primary on your requirements (Kuo et al., 2004, processing methods followed in different Worrel, 1999). countries are summarized below (Divekar et al., 2017). Legume Processing Different operations involved in primary Dehulling of grain legumes processing of legumes are cleaning, Home-scale techniques employed for grading, drying/conditioning, storage and loosening the husk are the following: (a) milling. Each operation has a definite prolonged sun-drying until the husk is purpose to achieve. These operations are loosened; (b) application of small common to most of the legumes quantities of oil, followed by several (Mihailovic et al., 2007) and are briefly hours or even days of sun-drying and described: tempering; (c) soaking in water for several Cleaning: It is done to remove impurities. hours, followed by coating with red-earth Cleaned grains result in best quality end slurry and sun-drying; (d) soaking in products and also minimize the unit cost water for several hours to loosen the husk of operation. before manufacture of food products; or Grading: It helps to get a uniform mass of (e) a combination of these techniques. grains facilitating finer adjustment of There are no standard procedures machines for desirable outputs. It also developed for any specific variety of helps in reducing the cost of operation. legume. Removal of the loosened husks Drying: It is done to condition the grain to from the grain in the dry-milling a desirable moisture content for milling or technique is commonly done in small storage. Storage: It is done to meet the daily machines. Hand-or power-operated domestic and commercial requirements of under-runner disc-shellers or grinders grain legumes till the next crop is with emery or stone contact surfaces are harvested. used. A plate mill with a blunt contact Milling: It is done to transform grain surface is sometimes used both to husk legumes into products which are fit for and split soaked and dried grains. After humans and/or animals. aspirating or winnowing off the husk, the split cotyledons are separated by sieving (Fasoyiro et al., 2019). How to Cook Dried Legumes Dried beans contain up to 100 times less Hulling of legumes on a sodium than canned beans, and are higher commercial scale is generally based on dry-processing techniques. Many of the in vitamins and minerals. Dried beans are operations, particularly husking and also cheaper, taste better, and come in a splitting, are mechanized. The drying is ton of varieties. Beans that have been done in large yards, and is completely stored for over 12 months or in dependent on sunshine. Legumes such as unfavorable conditions (at warm pigeon pea, black gram, and mung bean, temperatures and high humidities) may which are more difficult to husk, require

4 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 more of the oil or water treatments The roasted legume is gently rubbed followed by prolonged sun-drying; (pre- against a coarse surface to separate the milling treatments), while grains such as husk. The puffing expansion of the grain chickpea, lentil, peas, Lathyrus sativus, legumes is low (1.5 times) compared with etc., with more easily removable husks, cereals (8 - 10 times). Exploratory studies require short periods of sun-drying and with the chickpea shows that moisture fewer oil or water treatments. Husking conditioning or moisture addition prior to and splitting are done either in a single heating helps to improve puffing and certain hardening agents such as calcium operation or, more advantageously, as phosphate, egg white, gums, calcium, and independent operations. Moisture sodium caseinate are also effective addition adversely affects husking, but it (Shanmugasundaram and Tsou, 2000). helps to split the grain. Addition of water prior to husking helps to induce simultaneous splitting, but this often Milling for manufacture of gums leaves patches of husk on the split Many grain legumes have a layer of gums cotyledons (dhal) that have to be removed between the husk and the endosperm, and by scouring in polishing machines. these vary in quality and quantity. CFTRI, in India has developed Improved Industrial-grade gums are economically technologies for hulling of grain legumes extracted from some legumes such as (Karlsen et al., 2016, Abbas and Ahmad, guar. Guar bean contains about 40 per cent 2018). gum (45 per cent kernel and 15 percent husk). About 28 - 30 per cent of the gums Wet and dry grinding are extracted by a dry-milling technique. For food purposes, this industrial-grade Whole legumes or husked splits are either gum is further refined to remove the last ground dry into a flour or ground wet into traces of the husk and to give a final gum a batter for a number of sweet and savoury yield of about 25 per cent. A by-product preparations, either alone or in consisting mostly of kernels containing combination with cereal and millet. The 62 per cent protein is used as cattle feed eating quality of many of these products, after detoxification (Fasoyiro et al., particularly the texture, depends on the 2012). composition of the flour, degree of fineness of grinding, relative proportion Dried beans and legumes, with the of particles of different mesh grades, and exceptions of black-eyed peas and lentils, cooking conditions. Chickpea, peas, require soaking in room temperature black gram and cowpea are the common water, a step that rehydrates them for grain legumes ground wet or dry quicker, more even cooking. Dried beans (Srivastava and Srivastava, 2003). may undergo any of the following treatments depending on the type of food to be produced. Puffed grain legumes To soak (or not) – This is more of a Puffing of legumes by subjecting them to personal preference since there are both high temperatures for a short time has pros and cons to soaking. Things to been practiced in Asia, Africa, and Latin consider are: America for many years. On a home- scale, the grain is first heated gently to Cooking time –soaking reduces cooking about 80oC and moistened with 2 per cent time, depending on the type of legume. water, which is allowed to be absorbed Some smaller legumes, such as lentils and overnight. The grain is then toasted with split peas, don't need to be soaked at all. hot sand in a shallow pan at 250 - 300 oC. Other legumes, however, should be The cotyledons expand and split the husk. soaked following one of the two basic

5 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 soaking methods: Overnight soaking – some desirable nutrients (some dark put the legumes in a pot, cover them with pigments). Draining the soak water will water by two inches and let them soak for decrease flatulence and the potency of eight hours or overnight, or Quick anti-nutrients found in legumes. soaking – put the legumes in a pot on the stove, cover with water, and boil them for two minutes. Turn off the heat and let the To Salt (or not) legumes soak for at least an hour. Does adding salt to legumes affect Flatulence – legumes are rich in fiber and cooking time? Add salt or acidic complex sugars; which humans can't ingredients, such as vinegar, tomatoes or digest. Bacteria in the intestines digest juice, near the end of the cooking time, these complex sugars while releasing when the beans are just tender. If these carbon dioxide. Soaking reduces ingredients are added too early, they can flatulence-related substances. make the beans tough and slow the Nutrients – when beans are soaked, some cooking process. Beans are adjudged vitamins and minerals leach into the cooked when they can be easily mashed soaking water. The amount of nutrients between two fingers or with a fork. lost during soaking is pretty negligible though. Interestingly, soaking actually increases the nutritional content of Cooking of legumes protein, fiber, and a few nutrients, such as Put legumes in a pot and cover them with thiamin and calcium. at least 2 inches of water. Bring to a boil Anti-Nutrients – all legumes contain Some of the methods for cooking legumes anti-nutrients (phytates and tannins), include: Stove-top, Slow cooker, Pressure which reduce nutrient availability. cooker and Oven cooking. Friction Soaking – preferably in 113°F water – cooked ground chickpeas can be used to deactivates these anti-nutrients and make instant hummus dips. The Friction significantly improves the amount of Cooker is great for legume processing. magnesium, zinc, and iron you absorb. The unique friction cooking process While the consumer might ingest more allows you to convert various legumes nutrients from unsoaked legumes, he or into a number of different food products in she might not necessarily absorb them. seconds. The legumes also need little preconditioning making the Friction Flavor, Texture. Color –unsoaked beans Cooker one of the fastest ways to process are the most flavorful (with a rich, bean-y them for human consumption. Some taste), cook more evenly (don't fall apart legumes such as split peas and beans can during cooking), and come out deep- expand when cooked. Grains can be colored (as opposed to soaked legumes processed along with the legumes to that come out rather pale). Clearly, for the best tasting and looking beans, do not create expanded, extruded food products. soak. Some of the legumes that can be processed in the friction cooker include Chickpeas, To drain (or not) - Another question is Split Peas, Soybeans, Lentils, Beans whether to discard the soaking water or (Kidney Beans, Red Beans, Black Turtle not. This will not matter if the legumes are Beans etc. Abu et al., 2012). not soaked. Soaking water contains Quick cooking legumes - means elements that are to be eliminated, and they have already been pre-soaked and

6 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

redried and don't need extra soaking. ? Black-eyed peas (also known as Lentils, split peas and black-eyed peas cowpeas): Salads, casseroles, don't need to be soaked. Finally, canned fritters and Southern dishes legumes make quick additions to dishes ?Edamame: Snacks, salads, that don't require long simmering casseroles and rice dishes (Sagronis and Machado, 2007). ?Fava beans (also known as broad Bean-based snacks beans): Stews and side dishes Legumes can make a great base for snack ?Garbanzo beans (also known as foods, particularly chickpeas and beans, chickpeas): Casseroles, hummus, or can be added to other ingredients to add minestrone soup, and Spanish and nutrients, taste, colour and texture to Indian dishes finished products. These products can be ?Lentils: Soups, stews, salads, side flavoured with a huge range of dishes and Indian dishes ingredients, whether you want sweet or savoury snacks. Additionally, there were ?Soy nuts: Snack or garnish for some innovations in the form of chips salads made from beans and rice, snacks made Over 152 legume products are listed by from roasted chickpeas, and muesli bars Wikipedia alphabetically (Wikipedia, with popped chickpeas, crackers, etc. 2017) : (Gilham et al., 2018). Fermented Pigeon A - Acarajé, Aloo mutter, Amanattô, Pea (Cajanus cajan) in Pasta Products Arroz con gandules (Torres et al., 20xx), extrudate-like maize–pigeon pea snacks (Fasoyiro et al., B - Baked beans over scrambled eggs on 2012). toast. Bubur kacang hijau a sweet dessert made from mung beans with coconut Legumes Products milk and palm sugar or cane sugar. Baked beans, Balila (dish), Bandeja paisa, Bap ?Grain legumes, processed and (food), Bean chips, Bean pie, Bean salad, converted into primary products, are Bhadmaas, Bigilla, Bissara, Black peas, further utilized in various ways after B o b c h o r b a , B o d i k o A c h a r, cooking, or are processed to make Bouneschlupp, Bubur kacang hijau, different products in the home or in Burmese tofu commercial catering establishments. Many supermarkets and food stores stock C - Cocido montañés (Highlander stew or a wide variety of legumes — both dried Mountain stew), is a rich hearty bean stew. and canned. Below are several types and Callos, Caparrones, Cassoulet, Chana their typical uses. masala, Chapea, Chili con carne, Chole bhature, Ciceri e Tria, Cocido lebaniego, ?Adzuki beans (also known as field Cocido madrileño, Cocido Montañés, peas or red beans): Soups, sweet Cowboy beans bean paste, and Japanese and Chinese dishes D - Dal makhani. , Dal baati, Dal bhat, Dalcha, Deep-fried peanuts, Dhansak, ?Anasazi beans: Soups and Dhokla, Dilly beans, Doubles (food), Southwestern dishes; can be used Douzhi in recipes that call for pinto beans

7 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

F - vegetarian frijoles negros. Fasolada is Paripu, Pasta e fagioli, Pastizz, Pasulj, a Greek and Cypriot soup of dry white Pea soup, Peanut butter, Pease pudding, beans, olive oil, and vegetables as Pie and peas, Pie floater, Pokhemma, peppers, sometimes called the "national Pork and beans, Porotos con rienda, food of the ". Ful medames is a Middle Purtumute Eastern dish made of whole, or mashed, R - Rajma chawal, Rajma beans served fava beans mixed with lemon juice and with boiled rice. Red bean cake is a type olive oil. Sometimes served with onions, of Asian cake with a sweet red bean paste olives, cumin, chili pepper, or other filling. It is made primarily with azuki condiments. Fabada asturiana, Fabes con beans. Ragda pattice, Rajma, Red bean almejas, Falafel, Farinata, Fasolada, cake, Red bean ice, Red bean paste, , Red Fasole cu cârnaþi, Feijoada, Frijoles beans and rice, Refried beans, Revalenta charros, Frijoles negros, Ful medames arabica, Rice and beans, Rice and peas G - Gallo pinto, Garnache, Ghugni, S - Split pea soup is with variations, a part Gigandes plaki, Githeri, Green bean of the cuisine of many cultures. Sambar, casserole, Guernsey Bean Jar Senate bean soup, Shahan ful, Shiro, H - Hummus is a Middle Eastern and Soup beans, Split pea soup, Succotash Arabic food dip or spread made from T - Tavèe gravèe is a traditional cooked, mashed chickpeas blended with Macedonian dish. Tavèe gravèe, Texas tahini, olive oil, lemon juice, salt and caviar, Tortillitas de camarones garlic. Hoppin' John, Hummus U - Ulava charu, Umngqusho, J - Jidou liangfen, Judd mat V- Vegetarian chili Gaardebounen, Y -Yun dou juan K- Kluklu, Kongbap, Koottu, Kosambari, Nigerian Beans Recipes Kuli-kuli, Kuru fasulye, Kuzhambu, Beans is mostly cooked to make a variety Kwati (soup) of recipes. Sometimes the beans coat is L - Lobio is a family of dishås of various removed in the process of preparing the kinds of prepared beans (cooked or recipe. stewed), containing coriander, walnuts, Beans not peeled: garlic and onion. Lablabi, Laping, Lentil soup, Liangfen, Lobio Beans Porridge - Beans is cooked on its own with added ingredients. Variety is M - Marrowfat peas, Matevž, Mattar achieved by adding Yam, Plantain, sweet paneer, Minestrone, Moro de guandules, potato or baby corn. Moros y Cristianos, Msabbaha, Mujaddara, Murukku, Mushy peas, Rice and Beans - This is one of those recipes that were derived to reduce the N - Nokdumuk flatulence associated with beans. As the O - Olla podrida is a stew made from pork name implies, 2 major staples are used in and beans and an inconsistent, wide cooking this recipe. variety of other meats and vegetables., Olla podrida, - In this recipe, beans is boiled and fried in red palm oil. It has a very traditional P - Pasta e fagioli, meaning "pasta and taste. beans", is a traditional meatless Italian dish. Pabellón criollo, Panelle, Papadum, Frejon is a coconut milk and bean soup

8 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 which is eaten especially during Holy with evening tea. Pigeon pea is primarily Week by mostly Catholics. The frejons used as dhal to go with rice or used to are puddings made of black beans cooked make soups. slowly overnight over a wood or charcoal fire, and then mixed with coconut milk to Mung bean - has diverse uses. It is used form a thick, sweet, smooth pudding. as dhal; to make curries; sweet and salty Frejon is often served with fish stew, soups; Mung bean noodles and breads are peppered snail and Garri Ijebu. also common. Noodles from Pulses chickpea, pigeon pea, black gram, etc. can Recipes that require the peeling of be used to make noodles. Soybean, lablab beans: bean, and horse gram cannot be used for Moi Moi (Moin Moin) - The beans coat is noodles. (Chiang and Chiu, 1988). removed and the beans blended and Mung Bean and Black Gram processing - cooked with ingredients. These days, transparent noodle and starch extraction, some people do not peel the beans before Bean sprouts are processed from mung preparing this meal especially when using beans and black grams. Many colorful brown beans. It can also be prepared with and attractive desserts are prepared from beans flour. mung bean for local consumption. Mung White Moi Moi (Ekuru) - Another bean flour used as stuffing in various version of Moi Moi which is cooked dessert products (Fasoyiro et al., 2012, without any ingredients, usually eaten Williams, 1993). with stew. It is suitable for vegetarians! Akara (Bean Cake/Balls) - beans coat is Soy Products - Full-fat soy flour, milk, removed, the seeds blended and deep paneer (tofu) curd, ice-cream, tempeh, fried to make balls known as bean cakes. sauce, sprouted and roasted snack, It is a very popular breakfast meal. extruded snack foods, soy-fortified bakery and fermented foods. Partially Ewa Agoyin - Also known as Beans & defatted soybean (oil and cake). Soy dhal Stew. (processed soy splits), Soy milk, Soy Gbegiri Soup - peeled beans porridge flakes, Soy paneer (tofu), Soy flour, Soy Food Uses of Groundnut - 80 percent of yogurt, Soy-fortified biscuits, Soy ice- total groundnut production is used for oil cream, Soy-fortified bread, Tempeh, Soy- extraction and the 20-percent for fortified muffins, Soy sattu, Soy-fortified food/snacks as roasted, salted or fried bun, Okara-based burfi and gulabjamun nuts, Peanut butter, groundnut (sweet desert), Soy sauce. The Common cake/defatted meal, Fortified groundnut Uses of Soybean – grouped into three flour (5-10 percent), Protein isolates and categories: 1) fresh; 2) fermented; and 3) composite flour. non-fermented (Mulei et al., 2011).

Chickpea is used to make a variety of Fresh green soybean pods are boiled with preparations, roasted and fried chickpeas a little bit of salt. are used as snack foods. Chickpea flour is Fermented soy-foods include soy sauce, used either alone or in combination with soypaste, tao-si (fermented black-skin rice flour to make a variety of sweet and soybean), thua-nao (natural fermented salty and spicy snacks that are popular soybean), and sufu (fermented curd),

9 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 miso soup, natto, tempeh and fermented Some Recipes for Legume Processing tofu. Soy sauce is a flavor enhancer. (Mulei et al, 2011) Roasted Groundnuts (1 kg raw peanuts Non-fermented soy-foods include soy 2 tsp salt) milk, various kinds of tofu, roasted soybeans are served as a snack. Soybean Preparation: Sort and wash the nuts. protein film called yuba is used in a Place in sufuria to dry and cook for 30 variety of preparations. Other soybean minutes, stirring frequently. Salt to taste. products – soy flour, soy noodles, soy ice Groundnuts may then be either eaten or cream, imitation meat and soy protein ground into a paste by pounding in a isolates – Yuba (Shanmugasundaram and mortar into a fine paste. Tsou, 2000). Microwave instructions: Microwave 2 cups - of groundnuts for two minutes, Tofu - soybeans are soaked overnight in remove from the microwave oven and stir, water. After draining the water, a small then microwave for another 90 seconds. quantity of boiling water is poured, the Allow the groundnuts to cool and salt to beans are pulverized. The mash is ladled taste. Note that cooking times vary with into boiling water, like dumplings, and the size of the groundnuts. allowed to boil gently for about 10 minutes. The resulting slurry is filtered to Soy Crunchies (1 kg dry soybean 500 ml obtain soy milk and the residual material cooking oil, 4 litres water 1 tbsp salt) is called okara. A small amount of either Preparation: Remove any dirt or foreign calcium sulfate (CaSO4) or magnesium materials from dry soybeans and wash chloride (MgCl2) is added to coagulate them. Next, boil the nuts for 30 minutes, soy milk. After the coagulant is drain water from the soybeans and pat dry. introduced, the milk separates into curds Heat cooking oil in a frying pan and and whey. The curds are gently scooped carefully add boiled soybeans and deep off the top of the whey and ladled into a fry until crispy and golden brown. mould lined with cheesecloth. The Remove soybeans, drain excess oil and forming container has many small holes to salt to taste. This recipe may be pan fried allow drainage of the whey. The relatively using less oil but the cooking time is thick soy milk is poured into a shallow pan slightly extended. and heated to evaporate the water. A thin film formed on the surface of soy milk is Curried peanuts (2 cups salted peanuts 2 gently removed and then dried. It is called tsp curry powder) “yuba”. Shimi-tofu is prepared from soy Preparation: Combine the peanuts and protein curd. The curd is cooled to below curry powder in a paper bag and shake 0ºC to form small ice crystals. As ice well. Spread the coated peanuts in a single crystals grow, protein is concentrated and layer in a cooking sheet and bake for 20 close proximity of reactive proteins minutes; shake them once or twice during allows additional linkages. The frozen cooking. Alternatively, the groundnuts curds are thawed to expel excess water, may be roasted in a microwave oven for 2 forming dried compound having sponge- minutes, stirred and cooked another 90 like texture called shimi-tofu (Srivastava seconds. and Srivastava, 2000). Soy Crackers (1 kg sweet potatoes. cup

10 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 sugar, 1/2 tbsp baking powder 1.5 litres samosa and place on a clean surface ready milk or soymilk cup cooking oil, 1 cup to serve. chopped soybeans and 1 cup wheat flour). Soups and sauces Preparation: Soak soybeans overnight, Mwitemania mash soup (2 cups dried boil for 60 minutes, drain, allow to cool mwitemania beans, 1 tsp salt, 1 onion, and chop. Set chopped soybeans aside. medium, sliced 2 tbsp lemon juice, 1 tsp Clean unpeeled sweet potatoes and boil freshly ground pepper 11/2 tsp dry for 45-60 minutes then peel. Mash the mustard, kg fatty meat). peeled sweet potatoes. Add 2 wheat flour and chopped soybeans to the mashed Preparation: Sort, wash and soak beans potatoes and mix well, then add baking overnight in water. Drain the beans powder. Add sugar to the above mixture reserving the soaking liquid, and add and mix thoroughly. Add milk to the enough cold water to the soaking liquid. mixture in small portions while kneading. Put the beans and water in a pot and add Roll out the dough and cut into thin, wide the onion, celery and ham bone. Bring to a strips. Deep fry the strips in. cup cooking boil, lower heat and simmer, partially oil for 3-5 minutes, turning once. Remove covered for 31/2 hours or until beans are from frying pan, allowing oil to drain. soft. Add water to replace any that Salt to taste. Serve with peanut butter or evaporates. Remove the ham bone. Rub other sauces. through in a blender or beat by hand. Add the cooked ham and reheat, season with Soya Samosas (1 medium onion, 1 tbsp mustard, lemon juice, salt and pepper. ginger crushed ,1 cup water, 2 fresh chili 2 tbsp salt 1 litre cooking oil, 1 cup baking Groundnut soup (2 cups crushed flour, 1 cup chopped cooked soybean or groundnuts 2 cups water, cup milk or okara). soymilk, tsp salt)

Preparation: Mix cooked, chopped Preparation soybeans with chopped onion and chili Pound the groundnuts by bringing the and crushed ginger and set aside. Mix thick wooden pestle down into the flour, water, 2 tbsp cooling oil and salt in a wooden bowl rhythmically until bowl, kneed and then roll out into thin thoroughly pulverized. Add 2cups of sheet. Cut the sheet into large triangles for water to 2 cups of groundnuts and salt. wrapping the soybean mixture. Place 1 Simmer in an open pot until thick then thin litre of oil into a frying pan and heat. it to a lighter consistency with milk. Serve Meanwhile stuff the samosas with 1 in bowls. Additional ingredients to the heaping spoonful of mix onto each soup may include chopped onions, triangle, and fold. To seal the samosas, mushrooms, chilis or strings of cooked mix a small amount of flour with warm chicken, beef or pork. water to form thick sticky substance used as “glue” close the folded edges. Slide the Groundnut sauce (1 small onion, diced 1 uncooked samosas one at a time into hot tbsp cooking oil, 1 medium tomato, sliced cooking oil ensuring that the oil covers 2 tsp wheat flour, tsp black pepper, 1 cup the samosa. Cook for 1 minute until it of water, boiling 1 large capsicum pepper, becomes reddishbrown. Remove the 1 cup crushed groundnuts)

11 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Preparation: In a pan, fry onion in then soak them overnight. Boil the beans cooking oil. Add tomato, capsicum, salt for 75 minutes and taste one to see if it is and black pepper, and cook for 10 minutes done. Add salt, stir and drain and reserve until soft. In a bowl, stir crushed the bean liquid. Place the chopped meat groundnuts, water and flour into a smooth and beans in a covered cooking pot, add a paste. Add groundnut mixture to the pan small amount of water and place over a and cook for another 20 minutes. The hot fire. Blend the mustard and jaggery sauce is best served with ugali or cooked with the reserved bean liquid and pour arrow root. over the cooking beans. Cover and boil for 1 hour, stirring occasionally and adding Peanut butter (2 cups unsalted, roasted water as necessary. Uncover and cook for peanuts 1 tbsp cooking oil) another 20 minutes to thicken the sauce. Season as desired with salt and pepper Preparation: Mix the peanuts with oil then serve. and pour crush the mixture using a mortar and pestle until smooth. If available, a Red and white cowpeas (1 cup black-eye food processor results in a smoother peas, 1 cup red cowpeas, 1 medium onion . blend. For chunky peanut butter, set aside tsp salt cups of chopped roasted groundnuts and 1 tbsp butter or margarine) add to the smooth paste. Peanut butter may be used immediately in recipes Preparation: Clean cowpeas, wash, mix requiring groundnut sauce, or stored in a together and soak overnight. Boil sealed container and eaten over a few cowpeas in 1.5 litres (8 cups) salted water days. For a sweeter taste, add 1 tbsp of for 40 minutes, drain. Add butter or sugar and . tsp salt to the groundnuts while margarine and salt and pepper to taste. crushing. Children particularly enjoy this colorful combination of cowpeas. Stews Basic Bean Stew (4 litres water . kg Black-eye stew (2 cups black-eyed peas, beans, 2 medium tomatoes 1 tbsp salt, 1 1 tbsp cooking oil, tsp freshly ground medium onion 100 g fatty beef) black pepper, 1 tbsp salt, 2 tomatoes chopped, water 2 onions, medium, Preparation: Wash the beans. Put them in chopped). the cooking pan containing water and cook for 2 hours. Reserve the bean liquid Preparation: Sort and wash peas; set to be added as needed. Put fat on sufuria, aside. Heat oil in a pan, add onion and add onions, salt, tomatoes and mix while cook until tender. Stir in peas, salt and cooking. Mix at intervals of 5 minutes and pepper. Add 7 cups of water, cover and cover with the lid. Cook for 25 minutes and remove from heat. Serve with rice, simmer for 45 minutes or until peas begin matoke or ugali. to soften. Uncover and cook for 15 minutes or until liquid begins to thicken. Boston style beans (2 cups white beans, 1 Stir in tomatoes, simmer for 10 minutes or tsp salt, kg fatty beef or pork, chopped 2 until peas are tender, stirring occasionally. tsp dry mustard, cup jaggery or unrefined Cowpea and cassava stew (1 cup sugar water). cowpeas 1 sweet cassava tuber 2 tbsp cooking oil, 1 onion, medium, ground tsp freshly ground pepper) Preparation: Clean and wash the beans 12 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Preparation: Sort, wash and soak stirring often. Add the cooked leaves to cowpeas overnight. Boil cowpeas, peel fried mixture and stir until it begins to and wash cassava, cut it into cubes and simmer. Add . liter whole milk, take to a boil. Mix the boiled cassava and cowpeas boil and simmer for 15 minutes. Kunde and mash slightly. Fry the onion in spinach is best eaten with ugali. The same cooking oil until it turns golden , add the ingredients and cooking instructions can mixture of boiled cassava and cowpeas, be used to cook other green vegetables. mix together then add pepper and salt to Add 1 cup mushrooms to the frying taste. mixture for a different taste.

Cream of cowpea (2 bunches cowpea Cowpea leaves in soybean sauce leaves, 1 cup water, 1 medium onion, (3 medium tomatoes, chopped. cup water, chopped, cup cream or fresh milk, 2 tbsp 2 tsp traditional salt/ local ash, 1 medium vegetable oil, 1 tbsp salt, 1 medium onion, 2 bunches kunde, 1 tbsp cooking tomato, chopped). fat, 1 cup soybean paste, 1 tsp salt). Preparation: Pinch the leaves of Preparation: Soak 2 cups of dried soya nightshade from the main stalk while bean overnight, add to salted, water, cook retaining a very small leaf stem. Wash the leaves, drain off water, boil them for about for 60 minutes or until soya beans are soft. 25 minutes, remove from fire and drain Discard the water and mash soya beans excess water. Heat vegetable oil in a pan with a large spoon until paste forms then and add the chopped onions stirring set aside. Wash cowpea leaves and shred occasionally until the onions are soft. Add into small pieces. Melt cooking fat in a pot tomatoes and the boiled nightshade leaves and add the chopped onion, stir then cook for 2 minutes, stirring occasionally and fry until golden brown. occasionally. Add the cream and 1 cup of Add in the tomatoes and continue to stir. water, cover and simmer for 5 minutes. Add kunde, stirring constantly, add water Best served while hot with ugali. An and the traditional salt/ local ash, bring to alternative recipe involves the addition of boil and simmer for 10 minutes. Add the 1 to 2 cups of other traditional green soya bean paste, stirring occasionally and vegetables, particularly spider plant or bring to a slow boil for 10 minutes. Season amaranth, with the nightshade. with salt and serve with ugali.

Kunde western-style (3 onions chopped Kunde with groundnut (1 bundle of and sliced, 2 tbsp cooking fat, 1 tbsp salt, 2 cowpea leaves (kunde), 1 onion, chopped bunches cowpea leaves, 2 cloves garlic, 1/2 cup peanut butter 1 chilli pepper, finely diced 4 tomatoes, chopped, litre chopped 1 tsp salt 1 tbsp oil 1 cup coconut whole milk) or cows milk).

Preparation: Wash kunde in water and Preparation: Wash kunde, boil in 1 liter add to 1 liter of water and tbsp salt in a pot of water and . tbsp salt over medium heat, over medium heat, simmer for 30 minutes, and simmer for 30 minutes stirring stirring occasionally. Set cooked leaves occasionally. Set cooked leaves aside. aside. Heat fat in a pan over mediumheat; Sauté onions and chili pepper in oil until add onion, tomatoes, garlic and . tbsp salt. onion is transparent. Add peanut butter Fry the mixture for 5 minutes until cooked, and coconut milk slowly, stirring

13 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 constantly until it comes to a boil. Add enough cold water to cover. Bring to a boil kunde then add salt to taste. Reduce heat and simmer in a covered pot for 2 hours or and simmer for 15 minutes or until kunde until corn and beans are tender. In the is cooked. finished dish, most of the water should be absorbed, and the corn and beans should Steamed green beans (kg fresh green be tender yet still intact, not mushy. beans, 1 tbsp butter or margarine. tsp Season with salt. Fry onion in oil and add black pepper. tsp salt) tomatoes into a paste then pour in the githeri and mix. Serve hot, alone as a main Preparation: Wash beans removing ends dish or as a side to any other dish. and strings if any. Cut them in diagonal strips or leave them whole. Place 2 liters Fried soybeans (3 cups cooked soybeans of slightly salted water in a covered or kg okara 3 medium tomatoes, 2 large cooking pot, and steam the green beans in rapidly boiling water for about 10-15 onions, chopped . cup cooking oil) minutes until tender but still crunchy. Preparation: Cook soybeans and chop Drain the beans, add butter, salt and into coarse pieces then set aside. Fry pepper to taste. Young pods of cowpeas onions in cooking till golden brown, add may be cooked in the same manner. tomatoes and stir to fine paste. Add chopped soybeans (or okara) and cook for Bean sprouts 10 minutes, stirring often. Preparation and use: Bean sprouts may be prepared from bean, soybean, green Refried mwitemania beans (2 cups gram and many other smaller grain mwitemania beans 5 tbsp cooking fat, legumes, but not butter beans (lima). teaspoon freshly ground pepper 11/2 tsp Wash the beans and remove defective salt). grains. Soak 1 cup of seed in water overnight and place into small tubs with Preparation: Wash and soak beans drainage. The tubs are covered with a overnight in water. Boil and simmer for clean, moist cloth, kept in the dark and about 11/2 hours or until tender, add salt sprinkled with clean water 3 or 4 times a and pepper. Heat the fat in a pan. Drain 1 day. The sprouts are ready when they are 3 cup of beans and put in the pan. Mash to 6 cm in length after 4 or 5 days. Wash thoroughly, adding . cup of the reserved the sprouts in clean water to remove seed liquid then stir and cook for 2 minutes. coats and eat soon afterwards. Bean Add and mash the rest of the beans with sprouts are consumed in salads or cooked more of the reserved liquid gradually until as vegetables. Care must be taken not to all the beans and the liquid have been used overcook sprouts as their vitamins may be and the mixture is creamy. For additional lost. taste, add 1 tbsp of cumin or . cup of dhania after mashing. Adding 1 cup of Mixed and fried foods shredded cheese melted into the beans Githeri (kg maize 1 tbsp salt, 1 kg beans 3 after cooling also improves this dish. medium tomatoes, chopped, 10 liters Pilau ya soya (3 medium potatoes 1 water 1 large onion, chopped). medium cabbage, 3 medium tomatoes 1 tbsp minced garlic, cup cooking oil, 1 Preparation: In a large pot, combine tbsp ginger, 2 medium onions, 1 tbsp pilau washed maize and soaked beans. Add masala spice, 1 kg cooked soybeans or

14 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 okara 2 tsp salt) Soybean and mash patties (3 medium potatoes 2 cups soybean or . kg okara, 1 Preparation: Peel the potatoes and cut tbsp salt 1 small onion, chopped, 1 tbsp into quarters. Peel and pound ginger and chilies (optional) . cup dania (or 1 tbsp garlic together. cumin), cup cooking oil . cup flour, bread Slice the cabbage. Chop the crumbs or ugali) tomatoes and onions. Blanch the potatoes in boiling water for 8 minutes.Heat oil in a Preparation: Soak soybeans overnight. pan and fry the onions until golden brown. Peel potatoes, cut into chunks and boil for Add chopped soybeans, tomatoes and salt about 30 minutes, drain and mash. Boil and cook for 5 minutes. Add the pounded soaked soybean in 6 cups (1. litre) of water garlic and ginger then stir. Add pilau for 1 hour, then remove the boiled masala spice and stir well. Add sliced cabbages and mix well then cook for 10 soybeans, drain and chop. Combine the more minutes. This is a nutritious main mashed potatoes, soybean, salt, chopped dish that is best served with rice. onion, chopped chilies and dania, mix together until a thick mash forms. Form Mashed grain and meat substitutes the mash into small patties and powder the Mashed Beans (3 cups beans 1 tsp salt) outside with flour, bread crumbs or ugali. Fry in hot oil, be sure to thoroughly cook Preparation: Clean and soak beans one side before turning to prevent overnight in excess water. Boil beans for breaking. 1. hour in salted water. Drain beans and save water. Mash the beans adding saved Mashed beans and potatoes (6 medium water to desired consistency. When mash potatoes, 2 cups dried beans (about kg) 6 cools slightly it is ready to serve or to use litres water . tsp salt) in other recipes. Preparation: Clean beans and soak Mashed Bean Stew (1 kg beans 2 tbsp overnight. Peel and wash potatoes. Rinse salt, 4 lts water kg tomatoes, 2 tsp salt . beans and place into a pot containing cup cooking oil, 1 medium onion) salted water. Boil beans for 1 hour in a covered pot. Add potatoes and continue Preparation: Place beans in a dry pot and boiling for 20 more minutes. Add salt, stir for about 15 minutes. Place on a flat remove lid and continue to cook until surface and dry under the sun for 15-30 excess water evaporates. Mash bean and minutes. Grind the beans to a powder potato mixture ready to serve. Ground using a mortar and pestle. Sieve to remove seed coats and dirt then wash in cold cumin or chopped dania may be added for water. Boil bean powder for 30 minutes additional flavor. Cowpeas may be until firm, stirring frequently. Chop substituted for beans, and sweet potato or onions and brown them in a frying pan matoke substituted for potato. Best served with cooking oil. Chop tomatoes, add to with stew. onions and salt to taste. Pour the fried Soy Sausages (cup flour or ugali 2 cups vegetables over the cooked bean powder cooked soybean, 1 tbsp fresh chopped and serve with ugali, matoke or sweet pilipili . 1 cup dania 1 tsp salt, litre cooking potatoes. oil, 1 small onion, 2 tbsp milk)

15 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Preparation: Combine flour, salt and wheat flour, eggs and lemon juice and mix coarsely chopped soybeans in a basin. Add well. Scoop out the mixture with a table onions, pilipili and milk and then mix spoon and roll them out into small balls thoroughly. This should produce stiff using your palms. Heat the cooking oil dough. Mould flattened patties by hand and carefully deep fry the soy balls to a into desired size and powder with flour or golden brown colour, drain off excess oil ugali to reduce stickiness. Heat the and place in an open dish to avoid cooking oil and place the patties into the sogginess. oil, turning until dark brown to assure that flour is well cooked. The soy mixture may Sossi stew (1. cups (90 g) textured also be shaped into spheres to provide soybean pieces. tsp salt, 1 medium onion, vegetarian meatballs for use in spaghetti chopped 1 cup water, 2 tomatoes, and other sauces. chopped, 2 tbsp cooking oil).

Soy-burger (cup ugali or bread crumbs 1 Preparation: Add oil to cooking pan and cup soybean, 1 small onion, chopped . tsp fry onion until clear then add tomato and salt, 1 tbsp cooking oil (to coat pan), 1 egg, salt. Add soybean pieces and allow beaten). softening for 2 minutes while stirring. Add water and simmer for 15 minutes. Preparation: Soak soybeans overnight, Other vegetables and seasoning may be bring them to a boil in a pot with 6 cups added with tomatoes. Note: Sossi is a water and simmer for about 2 . hours until textured soybean product manufactured cooked. Chop soybeans. Mix in other in Kenya, but other pieces of textured soy ingredients in a bowl into a uniform, protein may be used in this recipe as well. slightly sticky mince. Form the mixture into rounded patties and coat with ugali or Sossi in coconut kunde (90 g sossi tasty bread crumbs to reduce stickiness. Patties pieces (I packet) 1 bunch kunde, 5 cloves should not be too thin or they may break garlic, crushed 1 big onion, 1 piece during cooking. Place the patties into a ginger, grated 3 tbsp cooking oil, 3 big greased frying pan and cook for 20 tomatoes, diced 1 cup water, 30 g minutes or until the paddies are brown on desiccated coconut or coconut milk) the outside and cooked throughout. Serve with bread or a toasted bun. Preparation: Fry onions till ready. Add garlic and ginger and stir while cooking. Soy “meatballs” (1kg soy grits or okara Add tomatoes and desiccated coconut. 3medium sized bulb onions, 1bunch Cover the pan for 2 minutes, stir and crush dhania finely chopped, 1 cup wheat flour, the tomatoes against the pan. Add sossi 1 clove garlic peeled and crushed, 1 tsp and stir for 2 minutes while letting absorb salt, 1 ginger peeled and crushed, 1 litre the flavors. Add a cup of water, cover the cooking oil, 2 tbsp freshly squeezed lemon pot and bring to a boil for 4 minutes under juice, 2 eggs). low heat. Add kunde and stir, cover the pot and leave to cook for 5 minutes. If Preparation: mix soy grits with the using coconut milk, add it 2 minutes after onions, garlic and ginger. Add 4 table putting in kunde and let cook for another 3 spoons of oil to pan and fry the mixture for minutes. Serve with ugali or your favorite 5 minutes. Allow to cool then add the starch and vegetables.

16 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Crispy Sossi (90 g sossi pieces (1 packet) sugar, 1 cup maize flour) 2 medium tomatoes, 1 large green pepper (hoho), 1 big onion, 4 tbsp cooking oil,1 Preparation: Boil water, mix the cup of water). ingredients then pour them into the boiled water and stir. Cook for 10 minutes with Preparation: Heat cooking oil in a pan till constant stirring to avoid lumps Add hot. Add onions and empty the sossi sugar, stir and cook for 2 more minutes. pieces in the pan. Stir until the onion This porridge has a strong taste because of becomes tender/golden brown. Add the fish but is richer in protein and tomatoes and stir until sauce forms. Add minerals than other porridges. water to the mixture and let boil for 10 minutes, more water can be added to Soya cake (1. cup baking wheat flour, 2 make the required thickness. Garnish with eggs, 1 tbsp baking powder, 1 cup milk or green pepper and remove from heat. soy milk, cup soybean flour. cup sugar, kg Serve with ugali and vegetables. margarine or shortening. tsp salt).

Flour and baked foods Preparation: Combine the dry Fortified finger-millet porridge (1 cup ingredients: wheat flour, soy flour, baking finger millet flour (wimbi), 1 litre water, 1 powder and salt. In a separate bowl, cup sugar, 1 cup soybean flour) combine milk, eggs, sugar and margarine. Pour the wet ingredients into the dry ones Preparation: Bring water to boil. Add and stir thoroughly to form a loose batter. wimbi and soybean flour, stirring Place batter into a greased baking pan and frequently. Boil for 6 minutes while bake in medium oven for 30 minutes or breaking any lumps.- Add water or milk until golden brown. The cake may also be until desired consistency is attained then prepared over a fire: add sugar and stir. This porridge has higher protein, vitamin and mineral Prepare 2 liters of clean sand and light a content hence more nutritious than wimbi cooking fire. After a bed of coals is alone. formed, place sand on fire and allow to heat for 10 minutes. Place dough in a Soy and maize porridge (cup soybean clean, greased sufuria; sprinkle some flour, cup sugar, 1 cup maize flour, 1 litre additional baking powder on top of the water) dough. Cover and insert the sufuria into the sand and coals transferring some of the Preparation: Bring water to boil. Mix coals to the lid of the sufuria. If necessary, maize and soybean flour in a bowl. Add build the fire around the sides of the this flour into the boiling water with near sufuria. Bake for 30 minutes. Check constant stirring to avoid lumps. Cook for interior of the cake with a knife to assure 20 minutes. Add more water or milk to that the dough is thoroughly cooked. desired consistency then add sugar and Allow the cake to cool for 1 hour before stir. serving.

Fish and groundnut porridge (cup Soy Ugali (cup composite soy-maize small dried fish (about 100 g), 1 litre flour, 3 cups water) water, 1 cup crushed groundnuts, 4 tbsp 17 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Preparation: Boil water for 10 minutes. into covered bowl to keep warm until Add flour while mixing till it thickens and serving. becomes hard in small portions. Turn the mixture throughout the whole process Soy pancakes (1 cup soy flour, 3 cups while leaving for 2 minutes per interval to wheat flour, 3 tsp baking powder, 3 tbsp cook. Cook for 10 minutes and remove honey or sugar, tsp salt, 3 cups milk or from fire. It can be served with liseveve. soymilk, 6 tbsp cooking oil, cup butter)

Soy chapatti (1 cup soy flour 3 cups Preparation: Mix all the ingredients wheat flour, tbsp salt 3 cups water, 2 tbsp starting with the dry ones. Preheat oiled cooking oil) cooking pan and place . cup of butter into Preparation: Boil water and mix the hot pan, cooking both sides until golden. flours with warm water to obtain dough Serve with syrup or fruit preserves. with desired consistency. Cut the dough into small pieces and roll it as you apply Soy puffs (1 cup soy flour, 4 cups wheat oil. Recoil and roll gain. Cook on flat, dry flour, 1 tbsp baking yeast, 2 tbsp sugar, tsp frying pan for 3 minutes, turning once. As salt, 1 cup milk or soymilk, 1. cup warm each chapatti is cooked, place on a plate water, 6 tbsp cooking oil). covered with a clean cloth to keep warm. Preparation: Place flour into dry bowl Okara chapatti (1 cup okara, 3 cups and add salt and half of the sugar. Cream wheat flour, tsp salt, 1 cup water, 2 tbsp the yeast with remaining sugar and mix cooking oil) with warm milk. Make a well in the centre of the dry ingredients in the bowl and pour Preparation in the liquid mixture. Mix together with Prepare dough using warm water by the warm water and beat very well until mixing the ingredients. Roll while adding smooth. Cover mixture with a clean cloth partially full spoon of cooking oil then and put in a warm place to rise (about 2 recoil. Roll again and start baking. hrs). Heat the oil and fry the mixture in Average time for cooking each chapatti is spoonfuls until golden brown. 3 minutes. Soy dairy products Soy mandazi (2 cups wheat flour, tsp salt, Fresh Soy Milk (1. kg soy beans (6 cups), 2 cups soya flour, 1 cup water, 3 tbsp 10 litres water) sugar, 1 tsp baking powder, 2 cups cooking oil). Preparation: Clean and soak the soy beans overnight in 8 litres water. Drain the Preparation: Mix the flours with warm soaked soybeans, rinse twice and pour water and baking powder. Add sugar, salt them onto a tray. Grind soybeans using a and water and mix thoroughly to make mincer in small portions. Repeat grinding consistent dough. Stand for 15 minutes. to obtain finer particles. Add 2 litres of Form the dough into small balls. Place clean water to soybeans (or two cups of cooking oil in pan and heat. Deep fry 6 clean water per cup of ground soybeans) balls at a time in the hot oil, turning and mix thoroughly. Pour the soya mix frequently for 2 minutes and remove after into a clean sack and squeeze over a tray to they turn golden brown. Place mandazi recover soya milk. The cake remaining in

18 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 the sack is referred to as okara. Sieve the mold to put pressure on the curds and milk to remove large particles then repeat drain away excess liquid for 20 minutes. the above procedures on the remaining The tofu will set into a single block. okara (press cake) and sieve. Take the soy Empty it into a tub of clean, cool. The tofu milk to a rolling boil for 10-15 minutes, is ready immediately or may be stored for stir while boiling. Serve it while hot or one day without refrigeration. When cold or prepare for tea. Procedure yields refrigerating, store tofu in clean water. about 3 liters of soy milk. Spicy fried tofu (kg tofu 1 tsp ginger, 1 Soy yoghurt (3 litres soy milk, 1 tbsp tsp curry powder, 1 clove garlic, minced, 1 vanilla essence, 1 cup sugar yoghurt small onion, chopped, 2 tbsp cooking oil) starter) Preparation: Drain tofu, pat dry, and cut Preparation into . inch cubes. Heat oil and sauté tofu Cool the recently boiled soy milk to for 5 minutes. Add onion, garlic, ginger almost body temperature in a water bath and curry powder. Fry until golden brown. to enable the yoghurt to culture. Add Serve with mashed beans, rice or ugali. yoghurt starter culture to soy milk and mix well with a clean cooking stick. Add Soya beverage (2 kg soya bean, 11/2 tbsp hot water in the bath as needed to sugar) maintain stable temperature (about 42°c) for yoghurt to culture for 5-6 hours. Add sugar and vanilla essence to the soy milk Preparation: Clean and roast soybeans in and stir well. When mixture thickens, a heated sufuria for 30 to 45 minutes, transfer to a clean container(s) and place stirring occasionally until beans darken in a cool area until ready for use. Amount and have a full aroma. Transfer the roasted of yoghurt produced is 3 litres.. beans to a mortar in batches and grind them into powder. Sieve the powder to Soybean cheese (tofu) (2.litres of soy- remove coarser particles and regrind as milk, 2.tsp calcium sulphate) needed. Add sugar to powder and mix. Pack 3 tablespoons of soy ground into Preparation: Soybean cheese, also small polythene bags then seal. To prepare known as tofu, may be prepared from soy beverage, add one packet to 2 cups of milk. Tofu is prepared by curdling boiling water. Serve hot or allow to cool. soymilk with salts, usually calcium Note that finely powdered soya beverages sulphate. About 2. liters of soymilk are commercially available. makes . kg of tofu. Boil soymilk for 5 minutes and cool to 70oC. Dissolve 2. Candies and Desserts teaspoons calcium sulfate in one cup of Sweet Mwitemania (cup granulated boiled, warm water. Pour the solution sugar. cup butter, 1 cup brown sugar 1 slowly into the soya milk, stir and allow unbaked pie shell, 1 cup cooked and the mixture to stand for 20 minutes. The mashed mwitemania beans 2 eggs, soymilk separates into small white curds beaten). and an amber liquid. Transfer to a mold lined with cheese Preparation: Beat the granulated sugar, cloth. Place a weight on the lid of the brown sugar, eggs and butter until creamy. Add cooked mwitemania beans and blend 19 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 well. Pour into unbaked pie shell and bake chopped groundnuts. Arrange them on a at 375 oC for 20 minutes. serving dish or alternatively bake in the Reduce heat and bake for an extra 25 oven for 15 minutes at 190oC, and then minutes, insert a knife at the centre; if it serve. comes out clean, it is ready. Serve with a scoop of ice cream. Peanut butter cookies (1 cup shortening, 1 teaspoon vanilla, 2 cups sugar, 2 eggs, Bean fudge (cup milk, 2 tbsp powdered beaten, 1 cup peanut butter, 3 cups flour, sugar, 1 block cooking chocolate, 6 tbsp teaspoon salt, 2 teaspoons baking soda) butter or margarine, 1 cup cooked, mashed mwitemania beans) Preparation: Preheat oven to 190oC and grease a cookie pan. Mix shortening, Preparation: Stir beans and milk together vanilla and sugar, add eggs and beat in a large bowl adding enough milk to thoroughly. Stir in peanut butter. Mix resemble mashed potatoes then stir in together the dry ingredients, flour, salt and vanilla. Melt chocolate and butter and stir baking soda, and then combine with the in the bean mixture. Gradually stir in powdered sugar. Knead with hands to get moist mixture, again mixing thoroughly. it well blended. Spread into lightly Form the mixture into small balls, place buttered 9-inch baking dish or form into onto the cookie pan, press flat with a fork 11/2 inch rolls. Allow to set or chill for 1-2 and bake for 8 to 12 minutes, until firm hours. and brown.

Glazed groundnuts (1 cup raw Weights and Measures groundnuts or soybean crunchies, cup pinch = about. Teaspoon; 3 teaspoons sugar, 2 tbsp butter or margarine) (tsp) = 1 tablespoon (tbsp); 1 tablespoon = ounce = 15 ml; 2 tablespoons = 1 ounce = Preparation: In a heavy pan, combine 30 ml (liquid) = 30 g (dry); 4 tablespoons nuts, sugar, and butter or margarine. Cook = cup; 16 tablespoons = 1 cup; 1 cup = 8 over medium heat, stirring constantly for ounces = 240 ml; 2 cups = 1 pint; 4 cups = 7 minutes or until sugar is melted and 2 pints = 1 quart; 1 quart = 950 ml ˜ 1 litre; golden in color and nuts are roasted. 4 quarts = 1 gallon Spread nuts on aluminum foil; separate into clusters. Sprinkle lightly with salt and Storage of Legumes cool. Grain legumes can remain in edible Crunchy groundnut banana (1 cup condition for several years if properly roasted, peeled & chopped groundnuts, stored. However, they are susceptible to cup butter or margarine 8 bananas, infestation, both in the field and during peeled) storage, by weevils, which are prolific, breed rapidly, and cause serious Preparation: Steam bananas in a large deterioration in the nutritive value of the saucepan for 30 seconds being careful not grain. Damage ranging from 30 to 70 per to overcook. Drain bananas and roll first cent of the grain has been reported in in melted butter or margarine and then in various publications.

20 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Obstacles to legume consumption production in the Brazilian a) B e a n s a n d F l a t u l e n c e / Northeast region. The tolerance of Indigestion / Bloating genotypes to drought is an alternative to decrease the Flatulence, indigestion and bloating are negative effects of stresses on the limiting factors for the consumption cowpea production. of beans. This has made beans so unpopular and caused a lot of people to abandon many nutritious beans recipes. e) Presence of weevils due to poor Beans contain oligosaccharides, the sugar storage systems - When buying molecule that requires special anti- beans, it is best to look out for the oligosaccharide enzymes which is absent onset of weevil attack. Small in the human digestive track to properly holes on the beans seeds is a good digest it. The incomplete digestion indication of this. Also, you will therefore produces gas which causes notice that the grains are dusty as a discomfort and flatulence. Some cooking result of the weevils boring into methods and practices that can help the seeds. reduce these sugar molecules in beans are detailed in. Here are several ways to reduce the flatulence-inducing quality of f) Anti-Nutritional Factors – this can legumes: i) Change the water several be treated by any of the following times during soaking. Don't use the methods i) addition of Acids and soaking water to cook the beans. The Bases - which changes the water will have absorbed some of the gas- electrostatic interactions within producing indigestible carbohydrate, ii) the protein structure and therefore Try using canned beans — the canning affects the orientation of the process breaks down some of the gas- structure; ii) germination - The producing carbohydrates into digestible early stage of germination is form and iii) Simmer beans slowly until where proteases (enzymes that they are tender (Karlsen et al., 2016). This break down peptide bonds) break also makes them easier to digest. down proteins into free amino acids; iii) Fermentation - b) Legume Allergy Symptoms: - Fermentation generally improves I n d i g e s t i o n , L e t h a r g y , the nutritional quality of the Anaphylactic shock, Trouble l e g u m e b y i n c r e a s i n g breathing, Fever, Excessive bioavailability. Bacterial and sweating, Diarrhea, Abdominal yeast fermentation involve pain, Nausea, Dizziness, Itching proteolysis which improves in the mouth, Hives or eczema amino acid bioavailability and iv) c) Long cooking time – soak at a variety of thermal processes are elevated temperature autoclaving, boiling, cooking, microwaving, and roasting. Other d) The low use of technologies by physical processes that have been farmers and the occurrence of used to reduce ANF in legumes biotic and abiotic stresses are include: Extrusion, Ultrafiltra- limiting factors for cowpea tion, Ultrasound, High Hydro-

21 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

static Pressure, Instant Controlled cajan) starch blends, Journal of Food Pressure Drop, Radiation, Science and Technology, (May–June) Soaking (Abu et al., 2012, Baker 49(3):349–355 DOI 10.1007/s13197- and Friel, 2016). 011-0287-2 Conclusion 3. Baker, P. and Friel, S. (2016) Food There is a long list of products that can be systems transformations, ultra- derived from legumes but not all legumes processed food markets and the are suitable for all products. Therefore, nutrition transition in Asia. Global legumes should receive appropriate Health, https://doi.org/10.1186/ emphasis in research and extension s12992-016-0223-3. projects because of their importance as 4. Caatinga, R., Rodrigues, E., protein supplements to cereals and root Damasceno-Silva, K.J., Rocha, M. crops. In many of the developing and Santos, A. D. (2018) Grain countries where the major energy foods Legume Processing Handbook: Value are cereals and tubers, adequate emphasis Addition to Bean, Cowpea, should be placed on the research, Groundnut and Soybean by Small- production, and extension of leguminous Scale African Farmers Putting crops). nitrogen fixation to work for To ensure household “nutritional” smallholder farmers in Africa security, governments and international agencies should provide a positive policy 5. Codex Alimentarius (2007) Cereals, environment and financial support for the pulses, legumes and vegetable development of legume products in the proteins. Rome: World Health region. Food production in developing O r g a n i z a t i o n & F o o d a n d countries is in the hands of millions of Agricultural Organization of the small-scale farmers there is a need to United Nations, 2007. develop efficient and continuous food 6. Divekar, M.T., Karunakaran, C., production systems for the range of Lahlali, R., Kumar, S., Chelladurai, commodities needed for balanced diets. V., Liu, X., Borondics, F., There is a need to give priority to Shanmugasundaram, S. and Jayas diversification of food production in D.S. (2017) Effect of microwave different ecological zones. treatment on the cooking and macronutrient qualities of pulses, References International Journal of Food 1. Abbas, Y. and Ahmad, A. (2018) Properties, 20:2, 409-422, DOI: Impact of processing on nutritional 10.1080/10942912.2016.1163578 and antinutritional factors of 7. Fasoyiro S. B., Farinde E.O., Chete legumes: A Review, Annals of Food O.B., Ajani A.O. (2019) Knowledge Science and Technology, 19(2), 20, assessment, training and consumer 199-212. acceptability on cassava – pigeon pea 2. Abu, J.O. Enyinnaya, C. C. and processing at Akufo, Oyo state), Okeleke, E. (2012) Quality Greener Journal of Agricultural evaluation of stiff porridges prepared Sciences, 9(1), 32-36, ISSN: 2276- from Irish potato (Solanum 7770 DOI Link: http://doi.org tuberosum) and pigeon pea (Cajanus /10.15580/GJAS.2019.1.011619016

22 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

8. Fasoyiro, O, Yudi, W. and Taiwo, conditions on the contents of free K.A. (2012) Processing and protein and non-protein amino acids Utilization of Legumes in the Tropics of commercial legumes. Food - In book: Trends in Vital Food and Chemistry, 86:537–545 Control Engineering. Book edited by 15. Male, B. (1994) Underutilized Grain Ayman Hafiz, ISBN 978-953-51- Legumes and Pseudo-cereals – Their 0449-0, Published: April 5,2012 Potentials in Asia, FAO RAPA, under CC BY 3.0 license. InTech - Bangkok, 162 p. Open Access Publisher – 04/2012; 16. Mihailoviæ, V., Mikiæ, A., and Æupina ISBN: 978-953-51-0449-0. B. (2007) Potential of annual legumes for utilisation in animal feeding, 9. Food and Agricultural Organization Biotechnology in Animal Husbandry, of the United Nations. (2016) About 23 (5-6), 573 - 581, Publisher: the International Year of Pulses Institute for Animal Husbandry, Rome, Italy, Available from: FAO. Belgrade-Zemun, ISSN 1450-9156 2016. 2016. http://iyp2016.org UDC 633.31 10. Gilham, B., Hall, R. and Woods, J. L. 17. Mulei, W.M., Imbumi, M. and (2018) Vegetables and legumes in Woomer, PL, (2011) Grain Legume new Australasian food launches: how Processing Handbook: Value are they being used and are they a Addition to Bean, Cowpea, healthy choice?, Nutrition Journal, Groundnut and Soybean by Small- 17:104 https://doi.org/10.1186/ Scale African Farmers. January 2011, s12937-018-0414-2 Publisher: Tropical Soil Biology and 11. Kadam, S.S. and Salunkhe, D.K. Fertility Institute of the International (1989) Production, distribution and Centre for Tropical Agriculture consumption. In: Salunkhe DK, (TSBF-CIAT), Project: Tropical Kadam SS (eds) CRC handbook of Legumes world food legumes: nutritional 18. Okpala, L. C. and Okoli, E. C. (2011) chemistry, processing technology Nutritional evaluation of cookies and utilization. CRC Press Inc, Boca produced from pigeon pea, cocoyam Ratan, pp 5–23 and sorghum flour blends, African Journal of Biotechnology, 10(3), 433- 12. Karlsen, M.C., Ellmore, G.S. and 438, McKeown, N. (2016) Seeds - health benefits, barriers to incorporation and 19. Prodanov, M., Sierra, I. and Vidal- strategies for practitioners in Valverde, C. (2004) Influence of supporting consumption among soaking and cooking on the thiamine, consumers. Nutrition Today, 3 56-59. riboflavin and niacin contents of l e g u m e s . F o o d C h e m i s t r y, 13. Khatoon, N. and Prakash, J. (2006) 84(2):271–277 Nutrient retention in microwave 20. Rehinan, Z., Rashid, M. and Shah, cooked germinated legumes. Food W.H. (2004) Insoluble dietary fibre Chemistry, 97:115–121 components of food legumes as 14. Kuo, Y-H., Rozan, P., Lambein, F., affected by soaking and cooking Frias, J., Vidal-Valverde, C. (2004) processes. Food Chemistry, Effects of different germination 85:245–249

23 21.Rehman, Z, (2006) Domestic 25.Tharanathan, R.N. and Mahadevamma, S. processing effects on available (2003) Grain legumes a boon to human carbohydrate content and starch digestibility of black grams (Vigna nutrition. Trends Food Science and mungo) and chickpeas (Cicer Technology, 14:507–518 arietinum). Food Chemistry, 89:231- 26. Torres, A., Frias, J., Granito, M. and 234 Vidal-Valverde, C. (2006) Fermented 22.Sangronis, E. and Machado, C.J. Pigeon Pea (Cajanus cajan) (2007). Influence of germination on Ingredients in Pasta Products, Journal the nutritional quality of Phaseolus of. Agricultural Food Chemistry, 54, vulgaris and Cajanus cajan. LWT, 6685- 6691 6685 40:126–120 23. Shanmugasundaram, S. and Tsou, S. 27. Williams, J. T., (1993) Underutilized C. S. (2000) Quality Traits of Crops – Pules and Vegetables, Soybean for Food Use in Expanding Chapman Hall, London, 247 p. Its Utilization in Asia, in Proceedings 28. Worrel, C., (1999). The Use of Soy- of the Third International Soybean foods and Soy-based Ingredients in P r o c e s s i n g a n d U t i l i z a t i o n Conference, p. 583-586, Korin Functional Foods, in Proceedings of Publishers, Ltd., Japan. World Soybean Research Conference VI, pp. 372-379, compiled by Harold 24. Srivastava, R.P. and Srivastava, G.K. (2003) Nutritional value of pulses. E. Kauffman, University of Illinois, Indian Journal of Agricultural Urbana-Champaign. Biochemistry, 16(2):57–65 2 https://en.wikipedia.org/wiki/Legume

24 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

LEAD PAPER PRESENTATION: Agronomy of Neglected and Underutilized Legumes

By

M. O. Atayese Department of Plant Physiology and Crop Production, College of Plant Science, Federal University of Agriculture, Abeokuta. Summary USA have been utilizing its already- A number of crops have been neglected available food resources. However, in by modern agricultural systems due to Africa, a number of crops that could have cultivation of a very limited number of tackled the problems of malnutrition, crop species. There are a number of hunger, and rural poverty has been neglected and underutilized legume crops neglected and underutilized. This problem (NULC) such as Bambara groundnut, could be worsen by the ongoing increase pigeon pea, African yam bean etc. in in population, demand for energy, climate Africa. The adverse climatic conditions change and soil degradation, and could associated with climate change and compromise food production, including population pressure require innovative the sustainability of existing farming strategies to address food insecurity and systems. Agricultural diversity has been undernourishment. Current research reported to be fundamental for sustainable efforts have identified NULC as having agricultural production in the attainment potential to reduce food and nutrition of food and nutritional security (Thrupp, insecurity, particularly for resource poor 2000; Chappell and LaValle, 2011). households in sub-Saharan Africa (SSA). Diverse farming systems are said to be Their rich nutritional profiles, high more resilient under biotic and abiotic adaptability to low input agricultural stresses and in enhancing food and systems and adverse climatic conditions, nutrition security. Despite this, only few and ability to grow in poor soils are highly crops are majorly grown and utilized for advantageous for sustainable agriculture. food production throughout the world However, what is required to promote (Padulosi et al., 2001). In Africa, a number NULC is scientific research that of legume crops such as bambara promotes their cultivation and identifies groundnut, lima bean, jack bean, African their characteristics with potential in SSA yam bean and pigeon pea, and lupin that including agronomy, breeding, post- were previously used as an important harvest handling and value addition, and source of proteins, edible fats, fiber, linking farmers to markets. minerals, and other nutritional components are on the verge of becoming Introduction scarce (NRC, 2006). They have huge Globally, food insecurity and low supply potential to become sustainable foods or in many areas of the world are threatening feed resources for the future due to their the increasing human population and adaptability to the climate and their survival in many parts of the world. Most richness in nutrition. However, due to the developed countries such as Europe and lack of agronomic, genetic, and food

25 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 research on these potentially important In order to meet the global food demands, crops they are in danger of becoming focus should be on promoting the scarce (NRC, 2006). Keeping in mind cultivation and utilization of other crops their climatic adaptability and richness in which have been neglected and nutrition, serious attention is required to underexploited but have the potential to move these crops out of obscurity. enhance food and nutrition security A review of global food security indicates especially in the developing countries of re-strategizing crop genetic improvement sub-Saharan Africa. With the recent and production agronomy toward grain negative impact of climate change being legumes to identify climate-resilient experienced globally, Africa is the most species and varieties with enhanced grain affected as a region that depends on rain- features (FAO, 2018; Turner and Frey, fed agriculture. The effect of increased 2018). Current research efforts have drought on agricultural crops has led to identified legumes as having potential to yield reductions at harvest, death of reduce food and nutrition insecurity, livestock, and loss of income and jobs in particularly for resource poor some parts of Africa. This has drastically households. Agricultural diversification increased the level of malnutrition and must include legumes that can help food insecurity. Most of the staple crops diversify the world's food systems are unable to withstand the harsh beyond just the world's major crops such environmental changes currently taking as rice, maize and wheat. Legumes have a place. Nevertheless, underutilized grain long history in sub-Saharan Africa due to legumes are more advantageous over the their multiple benefits. This is highly conventional staple crops. These desirable considering the significant roles underutilized legumes are often linked to that grain legumes play in the food the cultural heritage of their places of cultures around the world as veritable origin, well adapted to precise agro- sources of quality protein, natural ecological areas, harsh environments, and medicine, animal fodder, natural marginal lands. They also perform well in fertilizers, and environmental restoration traditional production systems with little products, alongside the well-established or no external inputs (GEM, 2018; Low et soil enrichment property of symbiosis al., 2018). with nitrogen-fixing bacteria (Han et al., 2018). Neglected and Underutilized Legume Crops (NULC): What are they? Currently, there is a lack of a consensus definition for neglected and underutilized crop species. They are being referred to with different names such orphan crops, neglected crops, underutilized crops, forgotten crops, minor crops etc. However, underutilized crops are not extensively traded globally, have low production levels and are under- researched according to Stamp et al., Figure 1: Projected number of undernourished (2012) and Varshney et al., (2012), people by region (FAO data and projection) despite their cultural and regional

26 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 importance as food and income for rural indigenous knowledge systems by local poor populations in developing countries farmers, both of which are unavailable to of Africa, Asia and South America a greater audience. (Padulosi et al., 2013). They are often identified based on their local usefulness, Brief description on some selected localized domestication, adaptation underutilized legumes coupled with general abandonment by Prominent among grain legumes defined mainstream agricultural researchers, as 'underutilized', are bambara groundnut, extension services, plant breeders, lima bean, jack bean, African yam bean donors, technology providers, policy- and and pigeon pea, and lupin (Cullis and decision-makers, as well as consumers Kunert, 2017,Padulosi et al., 2013). (Turner and Frey 2018). They are classically identified based on certain Bambara groundnut (Vigna criteria, which include the following: subterranea) 1. Poor documentation of distribution, Bambara groundnut originated in North cultivation and uses Africa and migrated to Africa. Despite its 2. Adaptation to marginal land and low nutritional and health benefits, it is less yield cultivated in many parts of Africa 3. Weak seed supply systems or (Padulosi and Hoeschle, 2004). It is an difficulties in seed procurement annual legume with a strong well- 4. Existence as landraces rather than developed tap root system. Traditionally, varieties bambara groundnut is cultivated, mainly 5. Low market demand without access to inorganic fertilizers and 6. Lack of technical information in with little guidance on improved production systems agronomic practices. However, due to the 7. Receive little attention from national expansion of groundnut (Arachis research, extension services, policy hypogea) production, bambara groundnut and decision makers, donors, has been neglected and underutilized in technology providers and consumers agricultural farming systems. As such, its 8. Lack of national policy for supporting germplasm improvement and agronomic research and development for management practices have mainly relied improving production. on local experience and resources. Bambara groundnut is resistant to There is currently limited reports on the drought, withstands stress, contains growth, development and agronomic higher nutrients than other legumes, and is performance of NULC. Promotion of known to produce good yield even when NULC in agriculture will depend, largely grown on poor soils (Mabhaudhi et al., on availability of information describing 2017). It is mainly cultivated for the their agronomy, constraints and potentials sustenance of family. It plays an important for food and nutritional security. role as a protein source (16%–25%), However, limited information describing which is comparable to other legumes, basic aspects of their genetic potential, and in some instances, superior to other agronomy, water requirements and established legumes. It also replenishes nutrition remains a hindrance to their nitrogen in the soil through nitrogen development and promotion. Such fixation, an ability that may be of information may be available in importance to resource-constrained

27 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 farmers who may otherwise not be able to Jack bean is the most economically afford inorganic nitrogen fertilizers. It important species in the genus Canavalia, gets about 51–67% of their N nutrition with enormous potentials to serve as food from symbiotic fixation; hence the crop for both humans and livestock (Kirse and could serve as high-protein forage for Karklina, 2019). It is widely distributed in livestock (Padulosi and Hoeschle, 2004). Africa, Asia, and America. It is rich in protein and thrives well in poor and acidic soils. Jack bean is mainly grown for its nutritious pods, seeds, and as fodder. It is a forage crop with high green manure capacity to enrich the soils and also to control soil erosion. The crop tolerates adverse environment, drought, heat, and leached soils; also it resists pest attacks (Khan et al., 2007). The leaf of jack bean African yam bean (Sphenostylis stenocarpa Ex. contains crude proteins and fiber A. Rich Harms) comparable to other legumes (Khan et al., The African yam bean (Sphenostylis 2007). Jack bean possesses deep root stenocarpa) is a dicotyledonous species. system which enables the plant to AYB is an important food crop in tropical penetrate deeply into the soil which Africa with great medicinal values and enables it to withstand very dry pesticidal potential. AYB contains conditions. approximately 29 and 19% crude protein in its grain and tuber, respectively, though Pigeon pea (Cajanus cajan L. Millsp) lower than that of soybean (38%) (Pintail Pigeon pea is an erect, perennial shrub, or et al., 2015). The seeds are edible like the woody plant widely grown in the tropical common beans and cowpea (Vigna regions. Pigeon pea is mainly cultivated unguiculata), and the tubers are richer in for its edible seed grains as well as feed, protein than Irish potatoes and 10 times forage, and fuel. Most farmers depend on the amount in cassava tubers (Campbell et al., 2016; Challinor et al., 2014). Valuable it as alternative source of protein diversities that can be explored for diverse (20–22%) and is quite rich in vitamins utilization purposes have also been such as vitamin B and minerals which can reported in AYB (Mannersa and Etten, promote health (Afiukwa et al., 2011). 2018). The plant grows well in areas with low rainfall and varying climatic conditions, and it is a drought-tolerant crop capable of withstanding poor soil and abiotic stress (Monteiro et al., 2017). Diversity exists in seed coat color, size, texture, and taste. The leaves are source of medicine to treat malaria and typhoid fever and the dried Jack bean (Canavalia ensiformis L.) stem is used as firewood for cooking.

28 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

3. They could help in diversifying income generating opportunities for farmers.

Promotion and sustainability of underutilized legumes The demands and expectations of modern farming systems have made farmers to Potentials of underutilized legumes concentrate on few major crops such as Neglected and underutilized legume rice, maize, wheat and soybean, which has crops are often well–adapted to local resulted in neglecting and underutilization growing conditions (Padulosi, 1999), of other important agricultural crops. This which are often marginal and harsh, thus may results in loss of strategic offering sustainable food production underutilized crop resources necessary for (Idowu, 2009). Several findings have the wellbeing of millions of people. The established that underutilized legumes are underutilization of legumes through drought tolerant, endure and thrive under extinction and genetic erosion is harsh environments, highly adaptable to accelerating in many parts of the world as varying agro-ecological settings, and the result of drought, pest and diseases and withstand or mitigate conditions such as lack of incentives for farmers to those heat, drought, diseases, frost, cold, and crops. Thus, for NULC to play a insect pest attack. These qualities could significant role as future crops, there is a be scientifically explored for crop need to promote their sustainability to improvement and sustainable utilization. ensure food security and agricultural Apart from these good qualities, they also diversification. Extension services to have the following potentials; promote the legumes by supporting 1. They could promote access to farmer experimentation and participatory better nutrition due to their high- approaches through active learning approach and flexible technologies should quality proteins and micro- be encouraged. Additionally, there is need nutrients, which are comparable for concerted efforts to promote on-farm to those found in major legumes. genetic resource conservation of the Therefore, improved food NULC. Collection of landraces and security by reducing our diverse germplasm is necessary to dependency on only major crops enhance local variation in genetic for food and non-food uses. resource options that can support farmer 2. They are also indispensable in experimentation. However, while crop rotation strategies to fertilize conservation of genetic resources in agricultural soils. They could help important for the sustainability of NULC, in optimizing land resources breeding efforts are needed so at to through integrating farming improve the competitiveness of the systems that rely primarily on different crop species and to make them biological processes that are adaptable to different farming systems. f u n d a m e n t a l f o r a g r o - NULC have been neglected in breeding e c o l o g i c a l l y - b a s e d f o o d programs, Breeding programs should production. focus on improving NULC and make

29 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 them more adaptable to the changing drought and nutrient stress. In addition to climate (Padulosi et al, 1999). Research their adaptation to diverse ecological on characterization of the diversity, and niches, most NULC are highly nutritious on improvements in grain quality and and in some cases to have medicinal yield attributes, are important priorities properties Therefore, it is necessary to for greater acceptance of these minor promote and implement appropriate legumes. Research efforts should be policies, and increase investment in encouraged, and be in close conjunction research and development, and extension with investments in participatory plant services, focusing on legume-based breeding and seed systems, to broaden cropping systems that includes access to farmer-preferred and improved underutilized legumes crops. Available germplasm. This will lead to develop- neglected underutilized legumes need to ment of viable and good quality seed be tracked and evaluated using modern systems, which include breeding of new agronomic techniques such as crop cultivars, availability of high quality, modelling, breeding of new cultivars, seeds in seed packets, creation and fertilization etc. which allow for rapid coordination of formal seed systems and evaluation of production scenarios. To seed storage improvement. In addition, improve the nutritional quality of people There is a need to promote the utilization based on more diverse and high quality of Neglected Underutilized Legume diets, orientation is urgently needed about Crops (NULC) and develop value chains the role of legumes in family nutrition. of different NULC from the input side and the marketing of the produce. The post- References production practices, storage and Afiukwa C.A, Igwenyi I.O, Ogah O, utilization should be given attention in a Offor C.E, Ugwu O.O (2011). holistic manner. This will ensure Variations in seed phytic and oxalic commercial products that can be traded acid contents among Nigerian not only on the local market, but also cowpea accessions and their i n t e r n a t i o n a l l y. C o n s e q u e n t l y, relationship with grain yield. sustainability of NULC requires Continental Journal of Food Science concerted efforts to improve utilization of and Technology.5:40-48 the produce coupled with conservation of Camphell B.M, Vermeulen A, Aggarwal the genetic resource base, its genetic P, Corner-Dolloff C, Girvetz E, improvement and value chain Guerrero A.M.L, (2016). Reducing development. risks to food security from climate change. Global Food Security.11:34- Conclusions and Recommendations 43.DOI: 10.1016/j.gfs.2016.06.002 The combination of climate change and Challinor A.J, Watson J, Lobell D.B, increasing population has painted a Howden S.M, Smith D.R, Chhetri N. gloomy picture of future global food A (2014). Meta-analysis of crop yield security. The key to future food and under climate change and adaptation. nutrition security may lie in the untapped Nature Climate Change. 7:287-291. potential of neglected and underutilized DOI: 10.1038/nclimate2153 legume crops. (NULC) have evolved to Chappell M.J., LaValle L.A. (2011). Food b e c o m e a d a p t e d t o a d v e r s e security and biodiversity: Can we environmental conditions such as have both? An agroecological

30 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

analysis. Agric. Human Values. Mabhaudhi T, Chimonyo V, Chibarabada 28:3–26. doi: 10.1007/s10460-009- T, Modi A.(2017). Developing a 9251-4. roadmap for improving neglected and Food and Agriculture Organization underutilized crops: A case study of (FAO) (2018). The State of Food South Africa. Frontiers In Plant Security and Nutrition in the World: Science:8. DOI:10.3389/fpls Bulding Climate Resilience for Food 2017.02143 Security and Nutrition. Rome; p. 202 Mannersa R, Etten J.V. Are, (2018); Gale Encyclopedia of Medicine (GEM). agricultural researchers working on (2018).Vitamin A Deficiency. The the right crops to enable food and Gale Group, Inc. Available from: nutrition security under future hppts://medical-dictionary the climates? Global Environmental freedictionary.com/vitamin+ Change. 53:182-194. DOI: 10.1016/j. A+deficiency. gloenvcha.2018.09.010. Han S, Kondo N, Ogawa Y, Suzuki T, Monteiro Júnior J, Valadares N, Pereira H, Fukushima M, Kohama N, (2017) Dyszy F, da Costa Filho A, Uchôa Classification of vitamin A deficiency levels by ocular changes in Japanese A,(2017). Expression in Escherichia black cattle. Biosystems Engineering. coli of cysteine protease inhibitors 2018;173:71-78. DOI: 10.1016/j. from cowpea (Vigna unguiculata): biosystemseng.11.011 T h e c r y s t a l s t r u c t u r e o f a Idowu O. ISHS Acta Horticulturae 806: singledomain cystatin gives insights International Symposium on on its thermal and pH stability. Underutilized Plants for Food International Journal of Biological Security, Nutrition, Income and Macromolecules.102:29-41 Sustainable Development. ISHS National Research Council (2006). Lost ( I n t e r n a t i o n a l S o c i e t y f o r crops of Africa. Volume II: Horticultural Science); Leuven, Vegetables. Washington, DC: The Belgium: 2009. Contribution of National Academies Press. neglected and underutilized crops to Padulosi S, Hoeschle-Zeledon I. (2004). household food security and health Underutilized plant species: What are among rural dwellers in Oyo State, they. Leica Magazien. 5-6 Nigeria Padulosi S., Eyzaquirre P., Hodgkin T. Khan A.R, Alam S, Ali S, Bibi S, Khalil (1999). Challenges and Strategies in I.A. Dietary (2007). Fiber profile of Promoting Conservation and Use of food legumes. Sarhad Journal of Neglected and Underutilized Crop Agriculture. 23:763-766 Species. Perspectives on New Crops Kirse A, Karklina D. (2015); Integrated and New Uses. ASHS Press; evaluation of cowpea (Vigna Alexandria, VA, USA: pp. 140–145. unguiculata (L.) Walp.) and maple Padulosi S., Hodgkin T., Williams J.T., pea (Pisum sativum var. arvense L.) Haq N. (2001). Underutilized crops: spreads. Agronomy Research.13:956- Trends, challenges and opportunities 968 in the 21st century. In: Engels J.M.M., Low J, Mwanga R, Andrade M, Carey E, Ramanatha Rao V., Brown A.H.D., Ball A (2018). Tackling vitamin A Jackson M.T., editors. Managing deficiency with biofortified sweet- Plant Genetic Diversity. Bioversity potato in sub-Saharan Africa. International; Maccarese, Italy: . pp.

31 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

323–338. Chapter 30. 10.1111/1468-2346.00133. Thrupp L.A. (2000). Linking Turner J, Frey R.J. (2018).Vitamin A. agricultural biodiversity and food Gale encyclopedia of alternative security: The valuable role of m e d i c i n e . Av a i l a b l e f r o m : agrobiodiversity for sustainable Encyclopedia.com agriculture. Int. Aff. 76:283–297.doi:

32 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

BIOTECHNOLOGY AND GENETIC IMPROVEMENT

33 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Response of Chickpea (Cicer arietinum l.) Varieties to Different Weed Management Regimes at Ringim, Jigawa State, Nigeria

*1Ali S, Mohammed L, Shehu, S. M. 2Muhammad, A. A 1Jahun, A. H 3Fagam, A. S 3Aliyu, M, 3Abubakar, M. A and 4Isyaku, M. S 1Department of Crop Production Bunyaminu Usman Polytechnic, Hadejia Jigawa State 2Department of Agronomy, Ahmadu Bello University, Zaria 3Faculty of Agriculture and Agricultural Technology, ATBU Bauchi, Nigeria 4Department of Crop Science, Federal University, Dutse, Jigawa State

*Correspondence author e-mail [email protected]

Abstract Field experiment was conducted at Ringim in Jigawa State during the 2015 and 2016 dry sessions to determine the response of chickpea varieties under different weed managements. The treatments consists of two varieties of chickpea (ICCV 93954 and ICCV95423) and four weed managements (pre-emergence application of Chlorocetanilide as Beta- force at 1.5 litres per ha, post emergence application of Chlorocetanilide as Meta-force 35 days after emergence (DAE) at 1.5litres per ha, hoe weeding at 45 DAE and weedy check) laid out in a Randomized Complete Block Design (RCBD) replicated three times. Results revealed that variety ICCV 93954 produced higher numbers of branches and pods per plant than ICCV 95423 in both years. It attained 50% flowers earlier and out-yielded ICCV 95423 which was taller. Application of either herbicide resulted in similar but higher plant height than weedy check. Pre emergence application of Beta force recorded more branches with heavier pods than post emergence application of Meta force. However, it took fewer days to flower but produced more pods per plant than other weed control treatments. Herbicide applied plots recorded similar grain yield with hoe weeded treatment. In conclusion, chickpea variety ICCV 93954 out-performed ICCV 95423 and application of beta force recoded better growth and yield of chickpea than other weed control treatments. Variety ICCV 93954 and pre emergence application of Beta force for weed control is recommended to farmers for production of chickpea. introduction Sudan are major producers (FAOSTAT, Chickpea (Cicer arietinum L.) is a widely 2015). In Nigeria, it is cultivated on a cultivated pulse crop by small scale minor scale in parts of Jigawa, Kano, Yobe farmers in semi-arid tropics (Anbessa and and Bauchi states (Anonymous, 1988; Bejiga, 2002). It is cultivated as a food, Muhammad, 1998). Its haulm can be used feed and fodder (Erman et al., 2011). In as a ruminant feed (Bampidis et al., 2011) 2010, the crop was grown on about 11.98 and contains higher nutritive value than million hectares worldwide and its annual cereal straws and more palatability than production was 10.89 million tons wheat straw (Ei bordeny et al., 2010 and (FAOSTAT, 2012). India alone accounts Kafilza and Maleki, 2011). In addition to for 68.5% of the total chickpea growing having high protein content (20-22%), the area and 68.7% of incomplete sentence crop is rich in fiber (Gaur et al., 2010) and total world production followed by vitamins (AAFC, 2006; Mohammadi et Pakistan (8%), Turkey (6%) (FAOSTAT, al, 2005). Additional health benefits 2012). In Africa, Ethiopia, Egypt and include low allergenic properties and high

34 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 protein digestibility (Wood et al., 2007). Materials and Methods Chickpeas are low in fat (Bampidis et al., An experiment was conducted during 2011). Fresh green pods are consumed as 2015 and 2016 dry seasons at Jigawa State vegetable and the pulse seeds can be eaten Horticultural Farm, Ringim (latitude 12o roasted or boiled. In Nigeria, “moi moi” 07'N and 12o 09'N; longitude of 09o 10' and “akara” have successfully been and 09o 38' E and 392m above sea level) to prepared with chickpea (Muhammad. study the response of chickpea varieties 1998). The straw and dried roots of under different weed managements. The chickpea are used as fuel for cooking. As treatments consisted of two varieties of a legume, chickpea returns a large chickpea (ICCV 93954 and ICCV95423) amount of residual nitrogen (68 – 138 kg -1 and four weed managements (pre- N ha ) to the soil and adds organic matter e m e r g e n c e a p p l i c a t i o n o f which accounts for 4 - 85% of its N requirement through symbiotic N Chlorocetanilide as Beta- force at 1.5 2 litres per ha, post emergence application fixation with effective and compatible of Chlorocetanilide as Meta-force 35 days Rhizobium strain (Chemining and Vessey, 2006; Fatima et al.,2008). Hence after emergence (DAE) at 1.5litres per ha, it is often used to restore soil fertility hoe weeding at 45 DAE and weedy check) before cereal or oilseed crops cultivation. which was laid out in a Randomized Seed germination is optimum at 200C Complete Block Design (RCBD) 0 o replicated three times. The gross plot size while growth requires 5 C to 15 C. 2 Chickpeas are normally grown in areas was 1.5 m x 1.5 m (2.25 m ). Seeds were with an annual rainfall of between 650- sown at 40cm x 10cm inter and intra row 750 mm although they can be grown spacing respectively. Two chickpea successfully in areas with a rainfall of varieties used were sourced from a b o u t 1 0 0 0 m m / a n n u m International Crops Research Institute for (Parameshwarapp et al., 2012). Semi-Arid Tropics (ICRISAT). The site Chickpeas can be grown on a wide range was cleared ploughed and harrowed to a of soils but prefers clayey soils with good fine tilth. Plots were laid out in form of drainage. It is moderately tolerant to basins with borders at 1.5 m by 1.5 m. Soil drought conditions but cannot withstand samples were collected randomly from water logging. Chickpea yield losses due experimental site before sowing. Samples to weed competition have been estimated were taken at a depth of 15-30cm within to range between 40 and 87% depending the Chickpea root zone using tabular on weed species and density (Bhan and auger after ploughing and harrow before Kukula, 1987; Gul et al., 2013). Although fertilizer application. Composite samples a lot of work has been carried out on were analyzed for physical and chemical growth and yield performance of properties using standard procedures. different chickpea varieties in many parts Two seeds were sown per hole at 40 cm of the world, results varied with inter row spacing and 10 cm intra row ecological conditions (Gaur et al., 2012; spacing, at a depth of 10 cm. Seeds were Egesel and Kahriman, 2013). Little treatmented before sowing. All the plots research if any on weed management in were sown manually. All plots received a chickpea in Nigeria has not been uniform basal application of nitrogen documented. This study was conducted to -1 evaluate growth and yield of two varieties fertilizer at 20 kg N ha using Urea (46%N) as a starter dose and 50 kg P2O5 of chickpea (ICCV 93954 and ICCV -1 95423) and weed control treatments ha was incorporated into the soil at under irrigation. sowing. Weed treatments were applied.

35 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Growth data were collected from five The varietal differences in growth and tagged plants in middle row in each plot. yield characters are logical and confirm Plant height, number of branches per the description of ICCV 95423 as high plant were taken at 12 weeks after sowing yielding than ICCV 95423 (ICRISAT, (WAS), days to 50% flowering was 1999), Muhammad (1998) also reported counted and recorded as number of days significant varietal differences in from sowing to date when half of` plants chickpea growth and yield characters. The in net plots had produced flowers. effect of weed control treatments was also Harvesting was done at maturity as significant except on plant height in 2016. indicated by pod drying and leaf senescence. The plants were cut with Pre-emergence application of Beta force pods and sun-dried before pods were recorded comparable plant height. (2015) picked, threshed and winnowed and pod weight (2016), branch no and manually. Number of pods per plant was days to 50% flowering, post-emergence counted from 10 randomly tagged plants application of either Meta force or hoe- from each net plot and the means were weeded treatment. However, pre- recorded. Pod yield per plot (g) was emergence application of Beta force recorded at harvest as weight of total pods recorded higher more branches than post- from each plot while 100- seed weight (g) emergence application of Meta force and was determined as weight of 100 seeds this trend was reversed for days to 50% from three sets of selected seeds from flower in 2015. Pre-emergence each net plot. Grain yield was determined application of Beta force recorded higher by weighing threshed grains from net plot pod numbers followed by post-emergence and value obtained converted to kilogram -1 application of Meta force while hoe- per hectare (kg ha ). Data collected were weeded and weedy check treatments subjected to analysis of variance recorded similar but fewer pod number (ANOVA) as prescribed by Gomez and per plant. Beta force treatment produced Gomez (1984). Treatment means were separated at 5% level of significance heavier pods followed by Meta force and using Least Significant Different (LSD). hoe-weeded treatments. However, application of either herbicide produced Results and Discussion similar grain yield as hoe-weeded Table 1 presents effect of weed control treatment. Treatment interaction was not treatment on some growth and yield significant on any parameter. Pre characters of chickpea varieties in 2015 emergence application of Beta force was and 2016 dry seasons at Ringim, more effective in controlling weeds than northwest Nigeria. Varietal variations other methods. Differences due to weed were significant on parameters assessed control treatments is also expected as except plant height (2015), branch chickpea has a slow rate of growth and pre number and days to 50% flowering and emergence herbicide provides season pod weight in both seasons. Variety long weed control during chickpea's ICCV 93954 recorded shorter plants and initial critical growth stages. took fewer days to 50% flowering than ICCV 95423. However, it produced Conclusion higher numbers of branches and pods per Chickpea variety ICCV 93954 out- plant as well as out-yielded ICCV 95423. performed ICCV 95423 and application of betaforce recoded better growth and

36 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Growth and yield parameters of chickpea varieties as influenced by weed management at Ringim, Northwest Nigeria during 2015 and 2016 dry seasons

Treatment Rate (kg Plant height (cm) @ 12 Branches number Days to 50% flower (days) a.i ha-1) WAS plant -1 @ 4WAS 2015 2016 2015 2016 2015 2016 Variety ICCV 93954 46.75 46.50b 7.75a 7.67 40.42b 39.17 ICCV 95423 46.33 44.33a 7.17b 8.08 42.17a 40.08

SE ± 0.37 0.71 0.12 0.39 0.19 0.62 Significance NS * ** NS ** NS

Weed Management Weedy check 42.67a 43.00 6.00d 6.50b 43.00a 41.17a

Beta- force 1.5litres 49.00b 46.83 8.83a 8.83a 39.83d 37.50b per ha Meta- force 1.5litres 47.33b 45.50 8.33b 8.33ab 40.67c 39.67ab per ha Hoe weeding 47.17b 46.33 6.67c 7.83ab 41.67b 40.17ab SE ± 0.52 1.00 0.16 0.56 0.28 0.88

Significance NS NS ** * * * Interaction VxW NS NS NS NS NS NS

Means followed by same letter(s) within a treatment column are statistically similar using LSD. NS = Not significant, * and ** = Significant at 5% and 1% probability level respectively

Table 2: Growth and yield parameters of chickpea varieties as influenced by weed management at Ringim, Northwest Nigeria during 2015 and 2016 dry seasons

Treatment Rate (kg Pod number plant-1 Pod weight plot-1 (g) Grain yield (kg ha -1) a.i ha-1) 2015 2016 2015 2016 2015 2016 Variety ICCV 93954 14.67a 15.83a 22.58 24.58 3248.4a 3213.1a ICCV 95423 7.25b 8.09b 23.75 24.98 2560.9b 2549.6b SE ± 0.23 0.51 0.60 0.67 25.75 46.46 Significance ** ** NS NS ** ** Weed management Weedy check 8.67c 10.67 17.00c 20.50c 2700.67c 2681.50b

Beta- force 1.5litres 13.67a 13.00 27.50a 29.33a 3092.2a 2973.5a per ha Meta- force 1.5litres 12.00b 12.83 24.50b 24.00b 3092.2a 2973.5a per ha Hoe weeding 9.50c 11.33 23.67b 24.50b 2882.8b 2950.0a SE ± 0.32 0.72 0.85 0.95 36.42 65.71 Significance ** ** ** ** ** * Interaction VxW NS NS NS NS NS NS

Means followed by same letter(s) within a treatment column are statistically similar using LSD. NS = Not significant, * and ** = Significant at 5% and 1% probability level respectively 37 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 yield of chickpea than other weed control Journal of Animal and Poultry treatments. Variety ICCV 93954 and pre Production., 1:677-689. emergence application of Beta force for Erman M., Demir S., Ocak E., Tufenkci weed control is recommended to farmers S., Oguz F., Akkopru A. (2011). for production of chickpea. Effects of Rhizobium, Arbuscular mycorrhiza and applications on some References properties in chickpea (Cicer AAFC (Agriculture and Agri-Food arietinum L.) under irrigated and Canada). (2006). Chickpea: Situation rainfed conditions: Yield, yield and outlook. Bi-weekly Bulletin 19. components, nodulation and AMF Retrieved 14 November, 2015, from colonization. Field Crops Research, 122 (1): 14-24. http://www.agr.gc.ca. FAOSTAT (2012). (Food and Agriculture Anbessa Y. and Geletu B. (2002). Organization of the United Nations- Evaluation of Ethiopian chickpea Statistics Division). Retrieved 18 landraces for tolerance to drought. N o v e m b e r , 2 0 1 5 , f r o m Genetic Resources and Crop http://faostat.fao.org/Food and Evolution, 49 (6):557-564. Agricultural Organization of the Anonymous, (1988). Dry season agric. United Nations. Adoptive research reports Kano state FAOSTAT (2015). (Food and Agricultural agricultural and rural development Organization of the United Nations). authority Kano. unpublished Retrieved 11 December, 2015, from: Bampidis, V. and Christodoulou V. h t t p : / / f a o s t a t . f a o . o r g / (2011). Chickpea (Cicer-arietinum site/339/default.aspx. Accessed on L.) straw in animal nutrition: A June 12. review. Animal Feed Science and Fatima, Z., Aslam, M. and Bano, A. Technology. 168:1-20. (2008). Chickpea Nitrogen Fixation Bhan, V. and S. Kukula.(1987). Weeds Increases Production of Subsequent and their control in chickpeas. Pages Wheat in rain fed System. Pakistan, 319-328 The Gresham Press, Old Journal of Botany. 40 (1), 369 – 376. Working, Surrey, U. K.. Gaur, P., Tripathi, S. Gowda, C., Ranga Chemining wa, G. and Vessey J. (2006). Rao G., Sharma H., Pande, S. and The abundance and efficacy of Sharma, M. (2010). Chickpea Seed Rhizobium leguminosarum bv. viciae Production Manual. Patancheru 502 in cultivated soils of eastern Canadian 324, Andhra Pradesh, India: p r a i r i e . S o i l B i o l o g y a n d International Crops Research Institute Biochemistry, 38: 294-302. for the Semi-Arid Tropics. 28pp. Egesel, C. and Kahriman, F. (2013). Gaur P., Jukanti, A. K. and Varshney R. K. Interrelationship of some Agronomic (2012): Impact of genomic Traits with Grain Yield in Winter technologies on chickpea breeding Bread Wheat and their Alteration by strategies. Agronomy Journal, 2:199- Climatologic Effects. Romanian 221. Agricultural Research, 30: Available: Gomez, K., and Gomez A., (1984). Retrieved 13 December, 2015, from: Statistical Procedures for Agricultural www.incda-fundulea.ro Research. Second edition. John Wily Ei-bordeny, N. and Ebtehag, I. Abou- and Sons, New York. E l e n i n , ( 2 0 1 0 ) . N u t r i t i o n a l Gul, R., Khan, H, Bibi, M., Ain, U. and evaluations of some crop residuals as Imran, B. (2013). Genetic Analysis a roughage sources for feeding lambs. and Interrelationship of Yield

38 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Attributing of Traits in Chickpea Muhammad, A. (1998). Effect of variety, (Cicer arietinum L.). The Journal of irrigation interval and phosphorus Animal and Plant Sciences. 23 (2), level on growth and yield of chickpea 521 – 526. (Cicer arietinum L.) Unpublished ICRISAT, (1999) Chickpea(Cicer M.Sc. Thesis. Department of arietinum). International Cereals A g r o n o m y , A B U Z a r i a . Research Institute for Semi Arid Tropics. http://www.icrisat. org/crop- Parameshwarapp, S.G., Salimath, chickpea.htm. P.M, Upadhyaya, H.D., Patil, S. S. and Kafilzadwh, F.; and E. Maleki. (2011). Kajjidoni, S.T. (2012). Genetic Chemical composition, in vitro Variability Studies in Minicore digestibility and gas production of Collection of Chickpea (Cicer straws from different varieties and arietinum L.) under different accessions of chickpea. Journal of Environments, Kamatak Journal of animal physiology and animal Agricultural Science. 25 (3), 305 – nutrition. 96:111-118. 308. Khan, M.A (2002). Production Efficiency Upadhyaya H, Kumar S, Gowda C, and of Chickpea (Cicer arietinum L.) as Singh S. (2006). Two major genes for affected by inoculation, phosphorus seed size in chickpea (Cicer arietinum l e v e l s a n d i n t e r c r o p p i n g . L.), Euphytica, 147(3): 311- 315. Unpublished PhD Thesis Faculty of (SCI). A g r i c u l t u r e , U n i v e r s i t y o f Wood, J. and M. Grusak, (2007). Agriculture. Faisalabar Pakistan. Nutritional value of chickpea. Pp. Khan, R.,Farhatullah and Khan, H. 101-142. In: S.S. Yadav, S.S., N. (2011).Dissection of Genetic Variability and Heritability Estimates Longnecker, F. Dusnuceli, B. Geletu, of Chickpea Germplasm for various M. Yadav, A.H. Rizvi, M. Manohar, Morphological Markers and A.A. Reddy, Z. Xaxiao and W. Chen, Quantitative Traits. Sarhad Journal of (2007). Uses, consumption and Agriculture, 27 (1), 67–72. utilization. Pp. 71-100. In: S.S. Yadav, Mohammadi, G., Javanshir, F., Khooie, R. Redden, W. Chen and B. Sharma S., Mohammadi, and S. Zehtab (eds.) Chickpea Breeding and Salmasi. (2005). Critical period of Management. CAB, Wallingford, weed interference in chickpea. Weed UK. Research. 45:57–63.

39 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Cowpea Wild Relatives: New Source For Cowpea Aphid (Aphis craccivora) Resistance Gene

1*Nwosu, D. J., 2Falusi, A. O., 2Gana, A. S., 2Olayemi, I. K., 1Aladele, S. E., Daudu, O.A.Y.2 and Olubiyi, M.R.1 1 National Centre for Genetic Resources and Biotechnology (NACGRAB), P.M.B. 5382, Moor Plantation Ibadan, Nigeria 2 Federal University of Technology (FUT), P.M.B. Minna, Nigeria. * Correspondent author email: [email protected], +2347069739901

Abstract Cowpea aphid (Aphis craccivora Koch.) is an important insect pest of cowpea worldwide, especially in the tropical sub-Sahara region. Cowpea yield loses due to infestation by this pest could be up to 80% in severe cases. Host plant resistance to this insect pest is a more effective, economically viable and eco-friendly option in mitigating damage by cowpea aphids. Based on this, experiments were carried out to find new sources for cowpea aphid resistance gene in cowpea wild relatives. One hundred and ten cowpea wild relatives accessions obtained from the genebank at National Centre for Genetic Resources and Biotechnology, Ibadan, Nigeria, alongside ten landraces and cultivated varieties were used in this study. Five adult aphids were placed on each seedling seven days after sowing. These were maintained in a mesh house for 21 days, at NACGRAB, North Central Zone, Badeggi, Nigeria. At the expiration of 21 days, accessions with completely dead plants were regarded as susceptible while those with living plants were classified as resistant/tolerant. In the second experiment, seeds of surviving plants and controls were planted in wooded trays placed in smaller insect proof cages within the mesh house. These were infested with aphids. Results showed that 21 DAI, the cowpea wild relatives, NGB001178 and NGB001055 supported less number of aphids (13.33 and 17.77), had least aphid damage scores (1.33 and 1.33) and highest seedling survival percentages (100% and 94%) respectively. These accessions are recommended to be used in cowpea breeding programmes for aphid resistance.

Keywords: Cowpea, Wild relatives, Aphids, Resistance, Introduction to infestation and damage by various Cowpea is a major staple food crop for insect pests. Cowpea aphid (Aphis people in rural and urban areas relied on craccivora Koch.) is considered to be the by over 200 million people in Africa most important pest of cowpea (Anan et (Degri et al., 2012; FAO, 2014). The crop al., 2000). Adult and nymphs of aphids is highly adapted to poor soils and feed on cowpea plants by sucking fluid drought conditions making a very from the stem terminal shoots, petioles, important food source in this age of flowers and pods (Ofuya, 1997; Asiwe et climate unpredictability. It is rich in al., 2005). A. craccivora also transmits protein, with a protein content of 23.4% cowpea aphid – borne mosaic virus when dry and 3.4% when green or fresh resulting in yield loss (Jackai et al., 200; (Nimoh and Asuming-Brempong, 2012). Lamari et al., 2008). Several cowpea Providing much needed protein for the varieties cultivated by farmers in Nigeria poorest of especially sub-Saharan Africa, are susceptible to cowpea aphids and cowpea is often referred to as the poor require several sprays of pesticides from man's meat (Laphale et al., 2012). Insects early vegetation stages through flowering attack is probably the biggest challenge to to pod formation stages. Several sprays of both small and large scale cowpea pesticides to control aphid increases cost growers. This is because cowpea is prone of cowpea production in Nigeria.

40 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Adoption of chemical control has its of the ten were promising. Additional attendant problems of availability, cost of screening in the mesh house and under inputs and the required changes in natural field conditions is being done to cropping strategy. Furthermore, the ascertain the level of resistance/tolerance health risks of environmental pollution, of these genotypes to cowpea aphids. pest resurgence, pest resistance to insecticides and lethal effects on non- Results target organisms caused by the excessive Percentage surviving plants of 100 use of pesticides cannot be over- accessions after 21 Days of cowpea emphasized. Aphid infestation There are reports that some There were significant (P < 0.05) cowpea varieties with resistance to differences among the 120 accessions cowpea aphids are losing their resistance studied for number of surviving plants at (Ekeuro, et al, 2017). Aliyu and Ishiyaku 13, 17 and 21 days after infestation (DAI) (2013) reported that IT84S-2246 hitherto (Table 1). Percentage surviving plants known to be resistant to aphids and lines infested with cowpea aphids in Table 4.1 derived from it showed susceptibility shows that 16% to 34% of the accessions reactions to aphids at IAR, Zaria. This began to die at 13 days after infestation. may be as a result of production of new The plants were first characterized by aphid biotype adapted to overcoming the yellowing of leaves, stunted growth and host plant resistance mechanism. general weakness of the stem. At 17 days Moreover, screening of wild relatives of after infestation more of susceptible cowpea for aphid resistance gene is a new plants die leaving only 14-46% of plants area of interest yet to be fully explored. several of which have become severely Therefore, search for new sources for weakened. IT97K-556-4 (74%), IT90K- aphid resistance gene from cowpea wild 76 (86%), TVU3346 (86%), TVNu-2141 relatives have never been more necessary. ( 1 0 0 % ) , N G B 0 0 1 0 5 5 ( 8 6 % ) , This study is aimed at screening several NGB001014 (54), NGB001035 (50%), cowpea wild relatives for presence of NGB001067 (86%), NGB001080 (60%), aphid resistance traits. NGB001086 (54%), NGB001995 (60%), NGB001118 (60%), NGB001128 (60%), Materials and Methods NGB001176 (54%), NGB001105 (60%) The experiments were carried out at where the accessions with at least 50% National Centre for Genetic Resources surviving seedlings at the close of the and Biotechnology (NACGRAB), north experiment 21 days after infestation with central zone research field and mesh aphids. TVNu-2141 and NGB001055 house at Badeggi, Niger State. The site is were the only accessions with 100 percent o located 95m above sea level at 9 04'02” N surviving seedlings at 21days after o and 6 05'31” E. infestation (Table 1). One hundred and twenty cowpea Twelve wild cowpea relatives wild relatives collected from different having high percentage (by interpretation areas in Nigeria and kept in the National most number) of surviving plants were gene bank at NACGRAB, Ibadan were selected. Cultivated varieties with screened in a mesh house for aphid resistance to cowpea aphids and farmers resistance / tolerance. The screening preferred varieties that are susceptible involved two phases. An initial screening were used in the second mesh house

41 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Percentage survival of cowpea seedlings 5, 9, 13, 17 and 21 after infestation (DAI) with cowpea aphids in 2016 Mesh house experiment.

S/No Accession No of surviving plants 5DAI 9DAI 13DAI 17DAI 21DAI 1 IAR-48 100 100 80 14 6 2 IT97K-499-10 100 100 66 26 0 3 Early white 100 100 74 26 6 4 NGB001178 100 100 100 100 100 5 Sokoto beans 100 100 74 14 0 6 Bob Marley 100 100 74 26 0 7 IT97K-556-4 100 100 100 80 74 8 IT90K-76 100 100 80 94 86 9 TVU 3346 100 100 100 86 86 10 TVU 2845 100 100 80 46 20 11 NGB 000942 100 100 66 14 0 12 NGB 000998 100 100 86 34 0 13 NGB 001055 100 100 100 100 86 14 NGB 001013 100 100 80 34 0 15 NGB 001014 100 100 86 66 54 16 NGB 001016 100 100 80 34 6 17 NGB 001020 100 100 66 20 0 18 NGB 001021 100 100 74 26 6 19 NGB 001023 100 100 86 20 0 20 NGB 001024 100 100 86 34 0 21 NGB 001028 100 100 80 20 0 22 NGB 001035 100 100 100 54 26 23 NGB 001059 100 100 86 20 0 24 NGB 001060 100 100 80 40 0 25 NGB 001061 100 100 74 26 6 26 NGB 001066 100 100 54 0 0 27 NGB 001067 100 100 94 86 86 28 NGB 001068 100 100 74 6 0 29 NGB 001069 100 100 86 34 0 30 NGB 001070 100 100 94 40 34 31 NGB 001071 100 100 80 20 0 32 NGB 001074 100 100 86 26 0 33 NGB 001078 100 100 100 46 26 34 NGB 001080 100 100 94 60 60 35 NGB 001085 100 100 74 46 26 36 NGB 001086 100 100 94 60 54 37 NGB 001090 100 100 86 54 40 38 NGB 001091 100 100 94 26 0 39 NGB 001093 100 100 86 46 26 40 NGB 001094 100 100 86 46 0

42 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1 Continued S/No Accession No of surviving plants 5DAI 9DAI 13DAI 17DAI 21DAI 41 NGB 001095 100 100 100 40 26 42 NGB 001096 100 100 86 54 34 43 NGB 001099 100 100 94 60 60 44 NGB 001100 100 100 100 54 34 45 NGB 001102 100 100 80 26 0 46 NGB 001179 100 100 60 14 0 47 NGB 001106 100 100 80 54 20 48 NGB 001107 100 100 86 40 34 49 NGB 001052 100 100 80 40 0 50 NGB 001114 100 100 100 46 34 51 NGB 001115 100 100 66 0 0 52 NGB 001116 100 100 86 26 6 53 NGB 001117 100 100 80 6 0 54 NGB 001118 100 100 86 60 60 55 NGB 001122 100 100 86 40 14 56 NGB 001123 100 100 74 34 26 57 NGB 001126 100 100 80 34 0 58 NGB 001127 100 100 74 0 0 59 NGB 001128 100 100 86 60 60 60 NGB 001130 100 100 66 20 6 61 NGB 001134 100 100 74 20 20 62 NGB 001135 100 100 60 26 0 63 NGB 001136 100 100 86 46 26 64 NGB 001138 100 100 66 0 0 65 NGB 001142 100 100 66 14 0 66 NGB 001143 100 100 80 40 34 67 NGB 001056 100 100 86 20 0 68 NGB 001147 100 100 80 14 0 69 NGB 001148 100 100 74 20 6 70 NGB 001151 100 100 74 14 0 71 NGB 001152 100 100 86 14 0 72 NGB 001153 100 100 86 40 26 73 NGB 001156 100 100 86 46 34 74 NGB 001157 100 100 80 20 0 75 NGB 001164 100 100 86 34 26 76 NGB 001159 100 100 74 20 0 77 NGB 001160 100 100 74 26 0 78 NGB 001162 100 100 74 34 0 79 NGB 001163 100 100 100 46 20 80 NGB 001163 100 100 86 46 34 81 NGB 001166 100 100 100 26 6 82 NGB 001157 100 100 100 54 6 83 NGB 001168 100 100 100 54 14 84 NGB 001170 100 100 74 20 0 85 NGB 001171 100 100 86 46 14 86 NGB 001172 100 100 66 0 0

43 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1 Continued S/No Accession No of surviving plants 5DAI 9DAI 13DAI 17DAI 21DAI 87 NGB 001173 100 100 80 20 6 88 NGB 001174 100 100 86 54 54 89 NGB 001175 100 100 86 20 0 90 NGB 001176 100 100 86 54 54 91 NGB 001092 100 100 86 40 34 92 NGB 001098 100 100 80 20 0 93 NGB 001101 100 100 74 0 0 94 NGB 001104 100 100 74 54 6 95 NGB 001105 100 100 100 60 60 96 NGB 001108 100 100 86 40 26 97 NGB 001120 100 100 86 54 34 98 NGB 001121 100 100 86 54 34 99 NGB 001124 100 100 74 14 0 100 NGB 001125 100 100 80 34 14 101 NGB 00169 100 100 80 14 6 102 NGB 000992 100 100 66 26 0 103 NGB 000994 100 100 74 26 6 104 NGB 001000 100 100 66 26 0 105 NGB 001006 100 100 74 14 0 106 NGB 001027 100 100 74 26 0 107 NGB 001032 100 100 86 34 26 108 NGB 001033 100 100 74 20 0 109 NGB 001034 100 100 86 46 34 110 NGB 001055 100 100 80 20 0 111 NGB 001130 100 100 74 34 0 112 NGB 001137 100 100 66 26 0 113 NGB 001140 100 100 74 14 0 114 NGB 001141 100 100 74 26 0 115 NGB 001146 100 100 86 34 26 116 NGB 001156 100 100 86 46 34 117 NGB 001158 100 100 80 20 0 118 NGB 001177 100 100 74 20 0 119 NGB 001061 100 100 86 46 34 120 NGB 001145 100 100 66 26 0 experiment for aphid resistance. These start to show yellowing of leaves were also evaluated for aphid resistance weakness of hypocotyl and death (Table 3). C o w p e a w i l d r e l a t i v e s NGB001143 (80%) NGB001014 (86%) NGB001118 (86%) and NGB001128 (86%) had the lowest percentage of surviving seedlings at 13DAI with cowpea aphids while NGB001178, N G B 0 0 1 0 5 5 , N G B 0 0 1 0 3 5 a n d NGB001105 all had perfect 100 percent survival at 13DAI. These were higher than those among the cultivated varieties (Table 3). The cultivated varieties 1T97K- 499-10, Early white and Bob Marley at 13DAI with aphids had 66%, 74% and

44 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 2: Number of aphids per cowpea seedling from 5 to 21 days after infestation with cowpea aphids

S. No Code Accessions Number of aphids per plant 5DAI 9DAI 13DAI 17DAI 21DAI Wild Vigna 1 4 NGB001178 6.75c 13.93e 11.20d 16.92h 13.33 2 13 NGB 001055 7.75c 26.15de 36.10cd 20.56g 17.43 3 15 NGB 001014 9.00c 35.67c-e 81.90b-d 60.48c 54.33 4 22 NGB 001035 20.87bc 84.33a-e 72.50b-d 60.00c - 5 27 NGB 001067 23.67bc 28.50c-e 68.53b-d 55.68d 47.43 6 34 NGB 001080 79.10a 43.97b-e 65.53b-d - - 7 36 NGB 001086 45.47a-c 58.27b-e 54.43b-d - - 8 43 NGB 001099 19.20bc 119.00a-c 96.33b-d - - 9 54 NGB 001118 21.12bc 101.37a-e 100.10b-d - - 10 59 NGB 001128 20.17bc 81.33a-e 61.73b-d - - 11 66 NGB 001143 40.52abc 45.83b-e 54.03b-d - - 12 95 NGB 001105 24.50bc 92.13a-e 89.70b-d - - Mean 26.51 60.87 66.01 35.65f 85.09 Cultivated cowpea 13 1 IAR-48 47.53a-c 115.67a-d 176.93ab - - 14 2 IT97K-499-10 28.48bc 111.43a-d 167.57abc - - 15 3 Early white 57.80ab 115.80a-d 100.57bcd - - 16 6 Bob Marley 79.10a 159.20a 266.77a - - 17 7 IT97K-556-4 45.47abc 103.87a-e 84.60bcd 71.03b 54.00 18 8 IT90K-76 27.33bc 30.33c-e 36.40cd 27.44e 26.90 19 9 TVU 3346 37.53bc 28.50c-e 37.90cd 27.87e 24.87 20 10 TVU 2845 41.62a-c 131.35ab 125.57b-d 100.43a 80.00 Mean 45.61 99.52 124.54 226.77 105.77 Means followed by similar letters in same column are not significantly different (P = 0.05) probability level, DMRT

74% of seedling surviving respectively. Aphid population build-up Seedlings survival percentages recorded Aphid population build-up at 5, 9, 13, 17 f o r 5 4 % f o r N G B 0 0 1 0 3 5 a n d and 21 days after infestation shown in NGB001143 were the lowest among the Table 4 reveal significant difference (P < wild relatives while 26% a piece recorded 0.05) among the genotypes studied. The for 1T97K-499-10, Early white and Bob values ranged from 1.0 (NGB001178, Marley was the lowest among the NGB001055 and NGB001014) to 3.33 cultivated varieties at 17 days after (Bob Marley) at 5 days after infestation; infestation with cowpea aphids (Table 1.0 (NGB001178) to 4.33 (NGB001099, 3).Twenty one days after infestation only NGB001118, IAR-48, Bob Marley and three wild accessions and three cultivated TVU 2845) at 9 DAI.NGB001178 had the varieties still had plants infested with least aphid population build-up of 1.0, aphids. All other nine wild accessions and 1.33, 1.0, 1.33 at 9, 13, 17 and 21 DAI five cultivated varieties have all their respectively. This was followed by plants dead due to aphid feeding NGB001055 with 2.0., 2.0,. 1.67 and 1.33 activities. By implication, these at 9, 13, 17 and 21 DAI respectively. The accessions have survived aphid attack by genotypes with the highest aphid pressure varying degrees. at 9 and 13 DAI are IAR-48 (4.33) and Bob Marley (4.67) respectively (Table 4).

45 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 3: Percentage survival of cultivated cowpea seedlings from 5 to 21 days after infestation with cowpea aphids

S. No Code Accessions Percentages of surviving plants 5DAI 9DAI 13DAI 17DAI 21DAI Wild Vigna 1 4 NGB001178 100 100 100 100 100 2 13 NGB 001055 100 100 100 94 94 3 15 NGB 001014 100 100 86 66 54 4 22 NGB 001035 100 100 100 34 0 5 27 NGB 001067 100 100 94 66 56 6 34 NGB 001080 100 100 94 40 0 7 36 NGB 001086 100 100 94 40 0 8 43 NGB 001099 100 100 94 40 0 9 54 NGB 001118 100 100 86 40 0 10 59 NGB 001128 100 100 86 40 0 11 66 NGB 001143 100 100 80 34 0 12 95 NGB 001105 100 100 100 40 0 Mean (%) 100 100 92.8 52.82 25.33 Cultivated cowpea 13 1 IAR-48 100 100 80 0 0 14 2 IT97K-499-10 100 100 66 0 0 15 3 Early white 100 100 74 0 0 16 6 Bob Marley 100 100 74 0 0 17 7 IT97K-556-4 100 100 100 80 74 18 8 IT90K-76 100 100 80 94 86 19 9 TVU 3346 100 100 100 86 86 20 10 TVU 2845 100 100 80 46 20 Mean (%) 100 100 81.8 38.25 33.25

NGB001080, NGB001086, NGB001099, NGB001118, NGB001128, NGB001143, Discussion NGB001105 wild accessions had no The aphid susceptible plants were seedlings at 17 and 21 DAI, while characterized by yellowing of leaves, NGB001035 also had no surviving stunted growth and general weakness of seedlings at 21 DAI. Similarly, the the stem. These symptoms result from the cultivated genotypes IAR-48, IT97K- feeding of aphids leading to loss of 499, Early white and Bob Marley had no essential food needed by the plants to seedlings alive at 17 and 21 DAI. Among support itself. Similar yellowing of leaves the genotypes having seedlings at 17 and and stunted growth resulting from aphid 21 DAI, TVU2845 (3.67) had the highest infestation of cowpea plants have been aphid population pressure at 17DAI while reported by Potarot and Nualsri (2011); NGB001014 had the highest at 21 DAI. Omoigui et al. (2017). Generally, the mean aphid The effect of aphid multiplication population build-up was lower in the on both tolerant and susceptible cowpea wild relatives at 5, 9, 13, 17 and accessions seemed to set in at 13 days 21 DAI (2.03, 2.94, 3.36, 2.53 and 2.25) after infestation. This means that rapid respectively compared to values (2.50, multiplication and the colonization of the 3.35. 3.58, 2.75 and 2.58) respectively plants by the aphids occurred between 7-9 recorded for the cultivated genotypes days after infestation. This is in line with (Table 4) the findings of Souleymane et al. (2013)

46 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 who reported rapid multiplication of aphids per plant recorded in NG001178 between 7 to 10 days after infestation. The and NG001055 is an indication of their accessions with completely dead plants resistance to cowpea aphids. This result (0% survival) were taken to be agrees with the reports by Suleymane et susceptible to cowpea aphids and those al. (2013) and Ekeuro et al. (2017) of having 50% to 100% surviving plants fewer numbers of aphids per plant in classed to have resistance or tolerance to resistant varieties compared to cowpea aphids. Souleymane et al. (2013) susceptible varieties usually high aphid in their screening of 100 cowpea populations. Low number of aphids per accessions also opined that dead plants plant in these varieties in combination were susceptible and those still alive and with low aphid population pressure is an developing first trifoliate leaves were indication of their resistance to cowpea resistant. The high mortality rate recorded aphids. Babura and Mustapha (2012) in in most accessions' seedlings indicated by screening 52 cowpea varieties reported low survival percentage was due to very few aphids on seedlings in resistant excessive feeding on the seedlings varieties. Similarly, the IT90K-76 and leading to yellowing of leaf, stunted TVU 3346 varieties were resistant among growth and eventual death. This is an the cultivated varieties with significantly evidence of high susceptibility of these lower aphid populations. accessions. Similar results have been Aphid population pressure is an reported by Ekuero et al. (2017). indication of the degree of aphid The consistently lowest numbers Table 4: Aphid population build-up (pressure) at 5, 9, 13, 17 and 21 days DAI with cowpea aphids in 2016 mesh house experiment.

S. No Code Accessions Aphid population build-up 5DAI 9DAI 13DAI 17DAI 21DAI Wild Vigna 1 4 NGB001178 1.00c 1.0e 1.33f 1.0c 1.33e 2 13 NGB 001055 1.00c 2.0de 2.00ef 1.67b 1.33e 3 15 NGB 001014 1.00c 2.33c-e 3.0b-e 3.33a 3.67a 4 22 NGB 001035 2.00abc 3.33a-d 4.0a-c 3.33a - 5 27 NGB 001067 2.33abc 2.33c-e 3.67a-d 3.33a 2.67c 6 34 NGB 001080 3.33a 2.67b-d 3.67a-d - - 7 36 NGB 001086 2.67ab 3.33a-d 3.33a-d - - 8 43 NGB 001099 1.67bc 4.33a 4.0a-c - - 9 54 NGB 001118 2.00abc 4.33a 4.0a-c - - 10 59 NGB 001128 2.33abc 3.33a-d 4.0a-c - - 11 66 NGB 001143 2.67ab 2.67b-d 3.67a-d - - 12 95 NGB 001105 2.33abc 3.67a-c 3.67a-d - - Mean 2.03 2.94 3.36 2.53 2.25 Cultivated cowpea 13 1 IAR-48 2.67ab 4.33a 4.67a - - 14 2 IT97K-499-10 1.67bc 4.00ab 4.33ab - - 15 3 Early white 3.00ab 4.00ab 4.00a-c - - 16 6 Bob Marley 3.33a 4.33a 4.67a - - 17 7 IT97K-556-4 2.33abc 2.33c-e 2.67c-e 3.00a 3.0bc 18 8 IT90K-76 2.00abc 2.00de 2.33d-f 2.00b 2.0d 19 9 TVU 3346 2.33abc 2.00de 2.00ef 2.33b 2.0d 20 10 TVU 2845 2.67ab 4.33a 4.00a-c 3.67a 3.33ab Mean 2.50 3.50 3.58 2.75 2.58 Means followed by similar letters in same column are not significantly different (P = 0.05) probability level, DMRT

47 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 infestation on the cowpea plant. Aphid yield of cowpea (Vigna unguiculata population pressure on the cowpea (L.) Walp.) in Maiduguri, semi-arid genotypes were varied depending on the zone of Nigeria. Journal of Biology genotype. Lesser aphid pressure on two Agriculture and Healthcare, 2(3), cowpea wild relatives and two cultivated 46-56. varieties makes them good sources of Aliyu, H. & Ishiyaku, M.F. (2013). resistant genes for cowpea improvement Identification of novel resistance gene programmes. Different accessions of sources to cowpea aphids (Aphis cowpea responded in varying ways to the craccivora Koch) in cowpea (Vigna aphids attack. This indicates difference in unguiculata L). Pakistan Journal the mechanism of resistance of the of Biological Sciences, 16(15), 743- cowpea plants. Laamari et al. (2008) 746. reported similar results and described Asiwe, J.A.N., Nokoe, S., Jackai, L.E.N. three forms of resistance as tolerance, & Ewete, F.K. (2005). Does varying antibiosis, and antixenotic. Conclusively, cowpea spacing provide better the cowpea wild relatives NG001178 and protection against cowpea pests. Crop NG001055 could be used as donor Protection, 24(5), 461 – 471. parents in the breeding for cowpea aphid Ekeuro, G.C., Omoigui, L.O., Bello, L.L., resistance. Timko, M.P., Ogunwolu, G.O., Danmaigona, C.C., Ugbaa, M.S. & Conclusion Iyorkaa, N. (2017). Identifying new The results from this work have revealed sources of aphids (Aphis craccivora two highly promising cowpea wild (Koch) resistance in cowpea relatives accessions with genes for germplasm using phenotypic and cowpea aphid resistance. These molecular marker approaches. Pp accessions can be integrated into cowpea 257-267, Genetics and National breeding programmes for aphid Economic Revival (Vange, T. and resistance in Nigeria and beyond. M.S. Ugbaa, Eds.) Proceedings of However, further molecular evaluation 41stGenetics Society of Nigeria will be done to .corroborate the results of Annual Conference held 15-19 the morphological screening. October, 2017 at Federal University of Agriculture Makurdi. Acknowledgment Food and Agricultural Organization The authors are grateful for the supports (FAO) (2014). FAOSTAT. FAO, UN, received from Rural Development Rome, Italy. www.fao3.org. Acessed Administration (RDA), Republic of January 11, 2019. Korea through Korea-Africa Food and Jackai, L.E.N., Gaudon, C., Asiwe, J.A.N. Agriculture Cooperative Initiative & Tayo, B. O. (2001). Integrated ( K A FA C I ) f u n d e d p r o j e c t o n control of the cowpea aphid using Improvement of Technology on seed dressing and varietal resistance. Conservation of Genetic Resources. Samaru Journal of Research. 17, 13-23. References Laamari, M., Khelfa, L. & Coeur d'Acier, Degri, M.M., Maina, Y.T. & Richard, B.I. A. (2008). Resistance source to (2012). Effect of plant extracts on cowpea aphid (Aphis craccivora post flowering insect pests and grain Koch) in broad bean (Vicia faba L.)

48 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Algerian landrace collection. African Journal of Biotechnology, 7, 2486- 2490. Lephale, S., Addo-Bediako, A. & Ayodele, V. (2012), “Susceptibility of seven cowpea cultivars (Vigna unguiculata) to cowpea beetle (Callosobruchus maculates)”, Agricultural Science Research Journal, 2(2), 65-69. Nimoh, F. & Asuming-Brempong, S. (2012). Resource use efficiency for cowpea production in Akatsi District of Ghana. Asian Journal of Agriculture and Rural Development Economic and Financial Review, 2(1), 55-61. Ofuya, T. I. (1993). Evaluation of selected cowpea varieties for resistance to Aphis craccivora Koch (Homoptera: Aphididae) at the seedling and podding phase. Annals of Applied Biology, 123(1), 19 – 23. Omoigui, L.O. Ekeuro, G.C., Kamara, A.Y., Bello, L.L., Timko, M.P. & Ogunwolu, G.O. ( 2 0 1 7 . N e w sources of aphids [Aphis craccivora (Koch)] resistance in cowpea germplasm using phenotypic and molecular marker approaches, Euphytica, (2017), 213: 178. Potarot, S. & Nualsri, C. (2011). Inheritance of resistance to cowpea aphid (Aphis Craccivora Koch.) in IT82E-16. Proceedings of the 7th IMT-GT UNINET and the 3rd International PSU-UNS Conferences on Bioscience, Prince of Songkla University, pp. 35-39.

49 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Diversity of Legumes Native to Nigeria

*Nwankwo, O. E. and *Nnamani, C. V. *Herbarium Research Unit, Department of Applied Biology, Faculty of Science, Ebonyi State University, Abakaliki Nigeria. Corresponding author: +2348063632924; [email protected]

Abstract Paucity of information on diversity of legumes (Fabaceae) of high economic value, native to Nigeria is a serious limiting factor to researchers interested in the taxon. Researches in Fabaceae have repeatedly concentrated on few common species in contrary to numerous legumes native to the country. The aim of this review was to highlight the wealth of species of Fabaceae native to Nigeria to increase knowledge of researchers on the less known members of this family, to equally spur robust research on those species. The review was based on major checklists of vascular plants globally, in Africa and Nigeria in particular plus online database including International Union for Conservation of Nature (IUCN). A total of 98 species of this family were recorded. Out of which 48 species are trees, 21 are shrubs, 11 herbs, 3 vines and 5 species are lianes. Two species which are Berlinia coriacea and Anthonotha obanensis were reported to be endemic in Nigeria. The species are of high economic values ranging from food to timber but only few of these species have been researched on. This review points to the critical need for researchers on the less known species for more sustainable use of the taxa and conservation policy.

Keywords: Variety, less known, Fabaceae, Indigenous, Nigeria

Introduction cholesterol except Arachis hypogaea, Legumes are plants in the family Cicer arietinum L. and Glycine max (L.) Fabaceae (Leguminosae). They are either Merr. Besides. They are highly cultivated or found growing wild in all economical because of their nutritional, habitats. There are about 751 genera and physiological and medicinal roles owing 19,400 species of herbs, shrubs, trees, and to the presence of beneficial bioactive compounds (Maphosa and Jideani, 2017). climber in the family Fabaceae; these Sprent et al (2010) reported that full made the family the third largest plant potential of African indigenous legumes family after Orchidaceae and Asteraceae has not yet been realized and Nigeria is (Christenhusz and Byng, 2016; Patel et seen as a valuable source of legumes for al., 2014). According to the report of UN possible agricultural use. Food and Agriculture Organization The present review attempts to (2018), India was the largest producer of strengthen the data regarding the list of legume (pulses) in 2017 with about 23% less known endemic legumes in Nigeria, of the world total produce. Other major their habit, conservation status and producers were Poland, United Kingdom common names. This information may and Mozambique. leads to some valuable research in the Legumes are grown worldwide field on these species together with their for different purposes such as: food, conservation policy. medicine, industrial use and ornaments. They are nutritionally valuable, providing Materials and Methods carbohydrates, amino acids and dietary The review was based on major checklists fibre; Legumes are low in fat with no of vascular plants globally, in Africa and

50 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Nigeria in particular plus online database materials were Aigbokhan (2014), including International Union for Borokini, (2018) and Lewis et al. (2005). Conservation of Nature (IUCN) Red List For the IUCN state their website. List the of threatened species. These reference data base links as well as their sources.

51 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

S/no Species Synonyms English/Common Habit/ Status Name Form 2 3 Aubrevillea kerstingii Aubrevillea Tree ▼ (Harms) Pelle gr 24 Baphia nitid a Lodd . Camwood Shrub ● 25 Baphia pubescen s Hook .f. Benin camwood Shrub ● 26 Berlinia coriace a Keay _ Tree ? ● 27 Berlinia grandiflor a (vahl) Berlinia Tree Hutch and Dalziel 28 Bobyunnia fistulo ides J.H. Swartzia _ Tree ? Kirbr and Wiersema fistuloides harms). 29 Brachystegia eurycoma Naga Tree ● Harms 30 Brac hystegia leonensis Bush mahogany Tre e ▼ Hutch and burtt Davy 31 Brachystegia nigeric a Hoyle Okwen Tre e ? and A.P.D Jones 32 Brachystegia s piciformis Msasa Tree ▼ Benth 33 Caesalpinia benthamiana Mezonevron Thorny caesalpinea Liane ▼

(Baill) Herend and Zarucchi benthamianum Baill. 34 Senna occidentalis (L) Link Cassia Septicweed Shr ub ▼ occide ntalis L. 35 Senna rotundifoli a Pers Chamaecrista Roundleaf sen sitive pea Shrub ▼ rotundifolia (Pers.) Greene 36 Crotolaria retusa L. Rattlebox Her b ▼ 37 Dalbergia ecastaphyllum Coinvine Shrub ▼ (L) Taub. 38 Dalbergia lactea Vatke _ Shrub ▼ 39 Dalberg ia melanoxylon African blackwood Shrub ▼ Guill and Perr. 40 Dalbergia welw itchii (B ak) W e s t af rican Liane ? Bakf. blackwood 41 Daniella ogea (Harms) Gum-copal Liane ? Rolfe ex Holland 42 Da niella oliveri (Rolfe) Balsam tree Tre e ▼ Hutch & Da lziel 43 Daniella thurife ra Benn. Frankincense tree Tre e ? 44 Desmodium adscendens Beggar lice Herb ▼ (Sw.) DC 45 Desmodium hirtu m Guil l Ticktrefoil Herb ▼ and Perr.

46 Dialium guineense Willd Black tamarind Tree ▼ 47 Detarium microcarpum Tallow tree Tree. ? Guill a nd Perr. 48 Dichrostachys cinerea (L.) Aroma Tree. ▼ Wight and Arn

52

Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

S/no Species Synonyms English/Common Habit/ Status

Name Form

4 9 Dioclea reflexa Hook .f. Ojo Liane ▼ 50 Distemonan thus Nigerian satinwood Tre e. ▼ benthamianus Baill 51 Drepanocarpus lu natus Machaerium Chinese ea rring Shrub ▼ (L.F.) G. Mey lunatus (L.F. ) Ducke 52 Eriosema laurentii De Wild Eriosema Sandpea Herb ▼ glomeratum (guill and Perr.) Hook f. 53 Er iosema psoraleoides Canary pea Herb ▼ (Lam) G. Don 54 Erythrinia senegalensis A. Flame tree Tree ▼

DC. 55 Erthrophleum suaveolens Erythr ophleum Ordeal tree Tree ▼ (Guill and Perr.) Bren an guineensis G. Don 56 Erthrophleum ivorens e A. O r d e a l tr ee Tree ● chev 57 Fillaeopsis discophora _ Tree ● Harms 58 Goss weilerodendron White mahogany Tree ? balsamiferum (vermoesen) Harms

59 Griffonia simplicifolia (Vahl Griffonia Liane ▼

ex DC.) Baill 60 Haplormosia m onophylla _ Tree ● (Harms) Harms 61 Indigofera hirsut a L. Common indigo Herb ● 62 Indigofera spicata Forssk Indigofera Creeping indigo Her b ● hende caphylla Jacg) 63 Indigofera tincto ria L. Dye indigo Shrub 64 Labl ab purpureus (L.) Bonavist-bean Cli mber ● Sweet 65 Lonchocarpus cya nescens Philenopter a African indigo Shr ub ● (Schumach) Benth cyanescens (Schumach)

Rorberty 66 Lonchiocarpus sericeu s Liliac shrub Shrub ▼ (Poir) Kunth ex D C 67 Milletia thonning ii Milletia Tree ▼ (Schumach and Thonn) Bak er

53 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

S/no Species Synonyms English/Comm on Habit/ Status Name Form 68 Mimosa pigra L. Thorny sensitive plant Tree ▼ 69 Mucun a flagellipes Hook .f. Shrub ● 70 Mucuna pruriens var. utilis Cow-itch Climber ▼ (L) DC. 71 Mucuna sloan ei Fawc and Horseeye-bean Climber ▼ Rendle 72 Neorautanenia mitis (A. _ Clim ber ▼ Rich) Verdc. 73 Pachyelasma te ssmannii Tree ▼ (Harms) Harms _ 74 Parkia bico lor A. chev African-locust-bean Tree ▼ 75 Parkia biglobosa (Jacg) Parkia African-locust-bean Tree ▼ R.Br ex. Don clappertononia Keay 76 Pentaclethra macroph ylla African-oil-bean Tree ▼ Benth 77 Philenoptera laxiflora (Guill Lonchocarpus Monkey’s indigo Shrub ▼ and Perr) Roberty laxiflor us Guill & Per. 78 Physos tigma venenosum Calabar bean Vine ▼ Balf .f. 79 Piliostigma reticulatum Camel’s foot Shrub ▼ (DC) Hochst 80 Piptadeniastrum africanum African greenheart Tree ▼ (Hook .f.) Brenan 81 Pterocarpus erinaceus Poir West african rosewood Tree ▼ 82 Pterocarpus mildbraedii African rosewood Tree ▼ Harms 83 Pterocarpus osun Craib Camwood Tree ▼ 84 Pterocarpus santalinoides Winged fruit tree Tree ▼ L’ Her’ ex DC 85 Pterocarpus soyauxii Taub African padauk Tree ▼ 86 Schrankia leptocarpa DC Mimosa Sensitive plant Shrub ? guadrivalvis L. var leptocarpa (DC) Barneby) 87 Sesbania sesban (L.) Merr. Sesban Shrub ▼ 88 Sphenostylis steno car pa African yam bean Climber ▼ (Hochst ex A.R.) Harms

89 Stylosanthes erecta P. Nigerian stylo Her b ▼ Beauv 90 Styloanthes fruitico sa (Retz) Sytlosanthes Shrubby pencil flo wer Herb ? Alston mucronata Wild 91 Swartzi a fistuloides Harms Bobgunnia Pao rosa Tree ▼ fistuloid es (Harms) J.H. Kirbr. & Wiersema 92 Tephrosia bracteolata Guill. _ Shrub ● & Perr.

54

Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

S/no Species Synonyms English/Common Habit/ Status Name Form 9 3 Tephrosia nana Sc hwein. f. Hoarypea Shrub ▼ 94 Tephrosia purpurea (L ) Pers Wild indigo Shrub ▼ 95 Tephrosia vogelli H ook .f. Vogel’s tephrosia Shrub. ▼ 96 Tetrapleura tetraptera Aridan Tree. ▼ (Schumach) Taub. ▼ 97 Vigna subterranean (L .) Voandzeia Hogpeanut Herb Verde subterranean (L.) thouars ex DC.

98 Vigna unguiculata (L.) Cowpea Vine ▼ Walp

(Aigbokhan, 2014; Borokini, 2018) Legend: ?Threatened; ▼Not threatened; ●Not well known Table 2: Status of the species This review points to the critical Number of species % need for researchers on the less known species for more sustainable use of the 15 14.70 Threatened taxa and conservation policy. 19 18.62 Not threatened References 64 62.72 Not well known Aigbokhan, E. I. (2014). Annotated 98 96.4 checklist of Vascular Plants of Total Southern Nigeria - a quick reference guide to the Vascular plants of Discussion southern Nigeria; Systematic A total of 98 species of this family were approach. Uniben Press, Benin City, recorded. Out of these, 48 species are Nigeria, 346 Pp. trees, 21 shrubs, 11 herbs, 3 vines and 5 Borokini, T. I. (2018). A systematic species are lianes. Two species which are compilation of IUCN Red-listed Berlinia coriacea and Anthonotha threatened plant species in Nigeria, obanensis were reported to be endemic in I n t e r n a t i o n a l J o u r n a l o f Nigeria. The species are of high economic Environmental Sciences, 3(3):104 – values ranging from food to timber but 133 only few of these species have been Christenhusz, J. M and Byng, J. W. researched on. Threats to some of the (2016). The number of known plants species were as a result of logging, species in the world and its annual deforestation, mining, road construction increase. Phytotaxa, 261 (3): and extensive conversion of land to 201–217 agriculture in the surrounding areas Maphosa, Y. and Jideani, V. A (2017). The (Borokini, 2018). Table 2 with the Pie Role of Legumes in Human Nutrition. chart above made it clearer that 14.70 % DOI: 105772/intechopen 69127 was threatened, 18.62 % status was not Patel, S. S., Shah, D. B. and Panchal, H. J. known while 62.72 % was not under (2014). Evolutionary studies in sub- threat. 55 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

families of leguminosae f a m i l y under-utilized resource. Journal of based on matK gene, Plant Gene and E x p e r i m e n t a l B o t a n y, 6 1 : Trait, 5 (7) doi:10.5376/pgt. 1257–1265. 2014.05.0007 UN Food and Agriculture Organization Sprent, J. I., Odee, D. W., Dakora, F. D. (2018) https://en.wikipedia.org/wiki/ (2010) African legumes: a vital but Legume#cite_ref-22

56 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Genetic diversity of Bambara Groundnut genotypes (Vigna subterranea [L.] Verdc.) revealed by SSR markers

Mohammed S. Mohammed1, 2,*, Hussein A. Shimelis1 and Mark D. Laing, 1 1School of Agricultural, Earth and Environmental Sciences, African Center for Crop Improvement, University of KwaZulu-Natal, South Africa 2Department of Plant Science, Institute for Agricultural Research Samaru Ahmadu Bello University Zaria, Nigeria *Corresponding author email: [email protected]

Abstract Bambara groundnut is an under-utilized legume of African origin with the potential to alleviating food security issues in Africa. There is limited research output on genetic diversity, selection and breeding of the crop, especially using genomic tools. Landraces were mostly being characterized using morphological markers whose expression is heavily influenced by environmental factors. Molecular markers provide a better choice for genetic diversity studies, because crop species are not affected by environmental factors. SSR markers have been found to be most convenient for genetic analysis, especially that they are multiallelic, co-dominant and evenly dispersed throughout the genome. The objective of the study was to genotype 50 Bambara groundnut lines from single plant selection that were obtained from seven geographical regions across Africa using five polymorphic SSR markers. The analyses detected a total of 53 alleles, with a mean of 10.6 alleles per locus, while genetic distance measured by polymorphic information content ranged from 0.0 to 3.8, with a mean of 0.76. The neighbor-joining analysis generated seven major genetic groups, clustered irrespective of geographic origin.

Keywords: Bambara groundnut, Cluster, Genetic distance, Microsatellite markers, Neighbor-joining analysis. Introduction been developed by farmers through Bambara groundnut (Vigna subterranea selection and maintenance as local [L.] Verdc. 2n=2x=22) is an African varieties for production, which may be legume which bears its origin from West distinguishable by their names, seed coat Africa (Hepper, 1963). The crop is colour, growing locations, or markets primarily grown by resource-limited where found (Massawe et al., 2002). farmers as a source of cheap protein Therefore, one landrace may bear several (Massawe et al., 2005). Seeds of Bambara names due to the movement of seeds from groundnut are consumed in fresh form as one region to another. Presently, more vegetable, while in dry form the seeds are than 2000 accessions have been collected processed into flour to prepare other kind and preserved by International Institute of of foods as snacks. This makes Bambara Tropical Agriculture (IITA) in Ibadan, groundnut a complement to cereal-based Nigeria (Olukolu et al., 2012), with little diet (Olukolu et al., 2012), hence this crop or no attention to genetic improvement has the potential of reducing food activities. A major limitation to large scale insecurity in Africa (Shegro et al., 2013). production of Bambara groundnut in Bambara groundnut is one of the most Africa is its low yield which is estimated popular, but under-utilized grain legumes, to be as low as 68.5-159.9 kg ha-1 with limited research interest by the (Collinson et al., 2000). This has been scientific community (Amadou et al., attributed to lack of improved varieties 2001). Most frequently landraces have (Mayes et al., 2008) and poor production

57 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 technologies. Genetic enhancement of groundnut SSRs markers used in this this valuable crop is essential to its study, mBam2Co80 and mBam2Co33 productivity in the region. Genetic had higher alleles score (8 and 12) per variation is the basis for breeding of this locus and PIC estimates (0.8 and 0.88) important crop. than seven others (Basu et al., 2007a). For effective breeding in Bambara Sequences of the SSRs are presented in groundnut, characterization of any Table 2. available germplasm/landraces becomes Biochemical and molecular imperative. Both morphological and analyses of genetic diversity between and molecular diversity analysis can be within Bambara groundnut landraces employed for genetic diversity studies for were reported, including amplified subsequent breeding and release of fragment length polymorphism (AFLP) varieties with desirable qualities (Massawe et al., 2002; Ntundu et al., including increased yield, resistance to 2004), randomly amplified polymorphic pests and diseases, abiotic stress tolerance DNA (RAPD) (Amadou et al., 2001, and and seed quality. Molecular markers offer SDS-polyacrylamide electrophoresis greater power for detecting diversity that technique (Odeigah and Osanyinpeju, exceeds that of traditional methods 1998). The RAPD and AFLP markers (Gupta and Varshney, 2000), because they showed high levels of polymorphism are not environmentally dependent. DNA among Bambara groundnut landraces markers including SSRs that are linked to (Massawe et al., 2002). RADPs identified agronomic traits could increase the significant polymorphism among efficiency of classical breeding by Bambara groundnut varieties grown in significantly reducing the number of Namibia (Mukakalisa et al., 2013) with a backcross generations required and by range from 63.2 to 88.2% and a mean of reducing expensive, tedious, phenotypic 73.1% at Nottingham, UK (Massawe et selection as well as germplasm al., 2003). SSR markers also known as conservation. They also have the benefit microsatellites have been found to be of being efficient, regardless of the markers of choice for diversity studies. developmental stage of the plant under Being PCR-based, SSRs are technically investigation (Mondini et al., 2009). It is simple to deploy and are amenable to high therefore clear that molecular markers throughput assays (Mansfield et al., can be used for tracing the origin of 1994), as well as being easy to score and genotypes and as well, be employed requiring small amount of DNA for b r e e d i n g p r o g r a m f o r g e n e t i c analysis (Somta et al., 2011). In recent improvement (Mayes et al., 2015). years, the application of SSRs has been Somta et al. (2011) compared PIC estimates among derived SSRs markers established in early generation selections from three legumes including cowpea, among breeding populations (Gupta and adzuki bean and Bambara groundnut that Varshney, 2000). SSR markers displayed revealed mean PIC estimates of 0.43, 0.61 sufficient diversity among Bambara and 0.78 for cowpea, adzuki bean and groundnut landraces (Basu et al., 2007b; Bambara groundnut accessions, Somta et al., 2011). respectively. Means for allelic richness There is scanty information on the were 2.80, 2.90 and 3.75, respectively, for use of SSRs in Bambara groundnut the same species. Among the Bambara genetic diversity studies. A recent study

58 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 found SSRs to be the markers of choice fluorescently labeled and separated by for Bambara groundnut genetic diversity capillary electrophoresis on an ABI 3130 studies (Somta et al., 2011). Somta et al. a u t o m a t i c s e q u e n c e r ( A p p l i e d (2011) employed SSRs markers tested on Biosystems, Johannesburg, South other legumes belonging to the Bambara Africa). Five SSR markers (Table 2) groundnut genus', the 'Vigna cultigens' specific for Bambara groundnut (Basu et including adzuki bean (Vigna angularis al., 2007a; Somta et al., 2011) were used [Willd.]) and mungbean. These markers to perform the PCR reactions and analysis identified sufficient variability among the for genetic diversity among the Bambara assessed Bambara groundnut landraces. groundnut genotypes. The SSR primers Bambara groundnut is a prominent used in this study were selected based on member of the genus Vigna; hence its their high PIC and amplified alleles, and genetics may be similar or closely related that they were developed being specific to members of the same genus. SSRs for Bambara groundnut (Basu et al., markers were also employed by Basu et 2007a; Somta et al., 2011). An automated al. (2007a) to assess the genetic diversity genetic analysis was employed to screen of Bambara groundnut genotypes. the SSR markers, using an automated The objective of this study was to gene sequencer (an ABI 3130 from genotype 50 contrasting Bambara Applied Biosystems, Johannesburg, groundnut lines obtained from seven South Africa). The analysis comprises the use of electrophoresis for amplification, geographical regions across Africa using wherein SSR loci that comprise of more five selected polymorphic SSR markers than two base pairs may not be determined developed for Bambara groundnut. on agarose gel electrophoresis and nucleotides composed of up to 200bp Materials and Method (Sibov et al., 2003). Plant materials Fifty (50) Bambara groundnut genotypes Data analysis from seven geographical locations were Analysis was performed using used in the study (Table 1). All genotypes GeneMapper 4.1. The program GGT 2.0 were pure breeding lines of single plants (van Berloo, 2008) was used to calculate selected from a morphological diversity the Euclidian and Jaccard distances study of within and between Bambara between bulked samples, and the matrix groundnut landraces (Mohammed et al., of the genetic distances was used to create 2016a). Selection of the accessions was a UPGMA and Neighbour Joining (NJ) based on distinct features of seed and dendrogram of the results. p l a n t m o r p h o l o g i c a l d i v e r s i t y (Mohammed et al., 2016b). Results and Discussion Marker characterization DNA extraction and genotyping The SSRs markers detected a total of 53 Seeds were used for genomic DNA alleles with a mean of 10.6 (Table 3). A extraction. All samples were used in minimum number of six alleles were bulked amplification using DNA detected by the SSR marker, mBamC039, extracted from 7 coleoptiles per sample while mBam2C033 detected the most following the CTAB extraction procedure alleles which as 17. The mean alleles (CIMMYT, 2005). PCR products were observed in this study was higher than

59 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1 List of the Bambara groundnut genotypes used and their origins in the study

S/No. Genotype Origin Seed coat colour S/No. Genotype Origin Seed coat colour 1 211-77 CAPS Cream 26 211-75 CAPS Cream 2 211-87 CAPS Black 27 211-46-3 CAPS Red 3 211-55 CAPS Red 28 211-83-2 CAPS Cream 4 32-1-1 ZM Light brown 29 712-4 ZM Tan 5 45-2 ZM Tan 30 N211-1 KNG Cream 6 211-55-1 CAPS Red 31 KB 05 ARC Cream 7 TV-79-1 IITA (Kenya)* Cream 32 211-68 CAPS Cream 8 211-90 CAPS Black 33 101-2 ZM Cream stripe 9 211-51 CAPS Red 34 KB 08 ARC Cream RBF** 10 211-91 CAPS Light brown 35 M12-1 ZIM Cream 11 42-2-3 ZM Light brown 36 712-7 ZM Tan 12 84-2 ZM Red 37 211-45 CAPS Red 13 N211K KNG Cream 38 101-2-1 ZM Cream stripe 14 73-3 ZM Red 39 42-2 ZM Light brown 15 211-76 CAPS Cream 40 M01-8 ZIM Cream RBF 16 25-1 ZM Light brown 41 TV-93 IITA (Kenya) Cream 17 B71-2 ARC Cream 42 M02-3 ZIM Cream RBF 18 M09-4 ZIM Cream 43 B71-1 ARC Cream 19 N212-5 KNG Brown 44 73-2 ZM Red 20 TV-27 IITA (Nigeria) Dark brown speckle 45 211-88 CAPS Black 21 M09-3-1 ZIM Cream 46 N212-4 KNG Brown Dark brown 22 011-7 PMB Cream stripe 47 TV-39 IITA Sudan) speckle 23 N212-8 KNG Brown 48 211-69 CAPS Cream 24 211-57 CAPS Red 49 M09-3 ZIM Cream 25 42-1 ZM Light brown 50 TV-14 IITA Ghana) Cream Legend on seed sources: ZIM =Department of Research and Specialist Services, Zimbabwe; ZM =The National Plant Genetic Resources Centre, Zambia; ARC =Agricultural Research Council, Republic of South Africa; PMB =Farmer collection from Pietermaritzburg in South Africa; KNG =Farmers’ collection from Kano, Nigeria; IITA =International Institute of Tropical Agriculture, Ibadan in Nigeria; CAPS =Capstone Seed Company, Howick, South Africa; RBF=Red butterfly eye

Table 2 Description of the SSRs markers used in this study Marker name Forward primer Reverse primer Source mBamCo17 AACCTGAGAGAAGCGCGTAGAGAA GGCTCCCTTCTAAGCAGCAGAACT (Somta et al., 2011) mBam3Co39 CAGTAGCCATAATTTGCTATGAACA CACATCAATCAAAAATCTCGGTAG (Basu et al., 2007b) mBam2Co33 ATGTTCCTTCGTCCTTTTCTCAGC AAAACAATCTCTGCCCCAAAAAGA (Somta et al., 2011) mBam3Co07 GGGTTAGTGATAATAAATGGGTGTG GTCATAGGAAAGGACCAGTTTCTC (Somta et al., 2011) mBam2Co80 GAGTCCAATAACTGCTCCCGTTTG ACGGCAAGCCCTAACTCTTCATTT (Basu et al., 2007b)

Table 3 Information of the SSR loci repeat type, bin location, number of alleles, PIC values and heterozygosity (He) for five SSR markers that were applied on fifty Bambara groundnut genotypes

SSR locus Repeat type No. of alleles PIC value He mBam3C07 (CT)22 9 0.7641 0.7940 mBamC017 (GA)12 11 0.8486 0.8634 mBam2C033 (CT)12N47(CT)16(CA)9 17 0.8118 0.8322 mBam3C039 (GT)9(GA)4 6 0.5576 0.6261 mBam2C080 (TG)17(GA)13 10 0.7948 0.8170 Total 53 3.7769 3.9327 Mean 10.6 0.7554 0.7865

60 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

7.59 (Somta et al., 2011) and 5.20 (Basu et single plant selection which were pure al., 2007) who also used the SSR markers lines. As such it is probable that the used in this study. selected plants used for the analysis in the The PIC observed in this study varied previous study were from heterogeneous from 0.5576 to 0.8486, with a mean of mixtures of landrace seeds. Somta et al. 0.7554, as revealed by mBam3C039 and (2013) employed a cross-species mBamC017 markers, respectively. A amplification of SSRs on 34 Bambara mean PIC of 0.58 was previously groundnut accessions which detected generated by 22 polymorphic SSRs between 2 and 8 alleles per marker, and a markers in a diversity study among PIC estimate of 0.16 to 0.73, while none Bambara groundnut accessions from o f t h e m a r k e r s r e v e a l e d a n y diverse origins (Somta et al., 2011) with heterozygosity among the accessions. range of 0.10 to 0.91 and a higher PIC of This underlines the detection power of the 0.70 which also revealed 166 alleles from markers that were used in this study for the same materials. Use of SSRs used on effective genetic grouping of the 50 some legumes (mungbean and Bambara groundnut genotypes. The SSR blackgram) were reported in which PICs markers which were developed for generated were 7.3 and 4.1, respectively Bambara groundnut (Basu et al., 2007a), (Danzmann et al., 2009). The have generally revealed high correlations polymorphic information content (PIC) between the PIC and He estimates. They describes the usefulness of SSR markers also match with the allelic detection by in identifying genetic similarities and the corresponding markers, with differences among the pure lines, in this mBamC017 and mBamCo33 markers case, of the Bambara groundnut presenting higher correlation between genotypes. It also, confirms the validity of PIC values of 0.8486 and 0.8118, and He using specific maker(s) in the values 0.8634 and 0.8322, respectively. construction of genetic linkage maps for These means, they were higher than those the crop (Massawe et al., 2002). This reported by Basu et al. (2007a) and Somta maximizes selection of genetically et al. (2011) using SSRs including those distinct parents that can be used for the used in this study. High PIC estimates genetic enhancement of the crop describe the strength of the molecular (Amadou et al., 2001; Massawe et al., markers, especially SSRs that have the 2002). advantage of being co-dominant and The allelic diversity, as explained multiallelic (Gupta et al., 2003), to by heterozygosity (He), varied between distinguish any variability among species, 0.6261 and 0.8634 for mBam3C039 and which is resolved by the number and mBamC017 markers, respectively. This frequency of alleles discovered (Somta et range is higher than the scores of 0.54 and al., 2011). The results explained the 0.77 reported for the same markers by homogeneity status of the genotypes used Basu et al. (2007a). Somta et al. (2011) in this study as sourced from single plant reported the highest mean PIC and He of selection, i.e. pure lines. Findings in this 0.70 and 0.552, respectively. Bambara study suggest that these SSR markers groundnut being self-fertilizing, the could be used in any Bambara groundnut findings in this study compared genetic diversity study and genetic map favourably with previous reports, construction. because, the genotypes used were from

61 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

62 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

63 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

64 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

65 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 4 Continued

Genotypes M01-8 M02-3 M09-3-1 M09-3 M09-4 M12-1 TV-14 TV-27 TV-39 M02-3 2.7

M09-3-1 1.8 2.1

M09-3 1.1 2.3 1.4

M09-4 2.9 1.1 2.8 2.4

M12-1 1.1 2.1 1.7 1.0 2.2

TV-14 1.4 2.5 1.5 0.5 2.7 1.5

TV-27 1.9 2.9 1.5 1.1 3.0 2.1 0.7

TV-39 1.2 2.3 1.1 0.5 2.5 1.1 0.7 1.0

TV-79-1 1.2 2.5 1.1 1.1 2.9 1.5 1.2 1.2 0.7

66 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

0.12

0.29 011-7 0.27 0.06 M09-4 0.13 0.01 0.11 211-46-3 0.07 0.11 211-45 0.18 0.02 M02-3 0.30 211-91 0.05 0.01 0.30 0.01 M12-1 0.20 0.09 211-69 0.20 211-75 0.29 211-55 0.01 0.34 25-1 0.31 0.08 73-2 0.08 0.10 0.19 KB05 0.03 0.10 KB08 0.05 0.42 211-88 0.30 0.11 42-1 0.30 0.12 42-2 0.32 0.09 712-4 0.28 0.01 712-7 0.22 32-1-1 0.07 0.00 0.11 211-55-1 0.00 0.08 211-57 0.02 0.29 N212-5 0.41 0.02 0.06 42-2-3 0.19 N211-1 0.00 0.03 0.25 211-87 0.31 0.02 TV-27 0.03 0.29 211-77 0.19 0.07 101-2-1 0.21 0.07 101-2 0.33 211-76 0.27 M01-8 0.10 0.11 0.16 N211K 0.13 TV-14 0.40 211-68 0.01 0.24 211-51 0.15 0.20 0.06 211-83-2 0.20 M09-3 0.17 0.07 45-2 0.23 0.08 TV-39 0.23 0.04 M09-3-1 0.20 211-90 0.12 0.17 0.20 B71-1 0.03 0.01 B71-2 0.22 84-2 0.17 0.00 0.18 TV-93 0.00 0.02 TV-79-1 0.21 73-3 0.14 0.09 0.09 N212-4 0.11 N212-8

Fig. 1: The Jaccard Neighbor-joining dendrogram illustrating genetic diversity and relationships among 50 Bambara groundnut genotypes used in the study 50 Bambara groundnut genotypes used in the study

67 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Genetic distance 211-91, and that between TV-93 and TV-

The genetic distance (DA) among the 50 79-1, reflected the extreme similarity Bambara groundnut genotypes from the between the two pairs, suggesting that seven geographical locations are these two pairs may be the same presented in Table 4, with a minimum of genotypes, probably considering their

0.0 to a maximum DA 3.8 among 11 pairs common source (IITA). This DA of 0.0 of genotypes. This difference in the DA of emphasizes the capacity of the SSR (0.00 to 3.8) observed in this study is markers to discriminate among the lower than the values 0.28 and 0.27 and Bambara groundnut genotypes, even 0.53 and 0.53 the minimum and the between those that have close maximum distances among Bambara relationships. Similarly, it was observed groundnut landraces from two extreme that most of these genotypes, including geographical locations of Togo (Africa) M09-3, 211-68, 211-51 and 211-83-2, and Thailand (Asia) (Somta et al., 2011). were grouped in the same cluster on the The extent of variation among the Jaccard Neighbor-joining (Jaccard NJ) landraces used in the previous study was dendrogram (Fig.1). Furthermore, close higher than that observed in the current and similar associations with a DA of 3.6 genetic analysis. The findings in the were detected between KB 05 from ARC current study revealed that the Bambara in South Africa and 211-551and 211-57 groundnut genotype 211-68 from CAPS from CAPS and KB 08 from the ARC in

(South Africa) correlated at a DA of 0.0 South Africa and 211-55-1 and 211-57 each with 211-83-2 also from CAPS, as from CAPS. These relationships may be well as N211K and M09-3, which explained by the fact that CAPS is a seed originated from Kano in Nigeria and company that sells Bambara groundnut Zimbabwe, respectively. N211K had a landraces composed of seed mixtures. It is close association with two genotypes, based in South Africa where we have the 211-51 and 211-83-2, which originated ARC. We propose that the genotypes have from CAPS. These correlations link common origins. Interestingly, KB 05 genotypes from the two distinct and KB 08 on one hand, and 211-55-1 and geographical locations, Kano in Nigeria 211-57 were grouped on the same, but and CAPS in South Africa which separate 'leaves' (simplicifolious) on the suggested that the genotypes involved Jaccard Neighbor-joining (Jaccard NJ) may have a common origin. Meaning that dendrogram in the II and III clusters, seeds may have been moved from one respectively. Hence, this result also location to another across the African showed the ability of the SSR markers to continent. In addition, the genotypes 101- distinguish between genotypes that are 2 and 101-2-1 from Zambia displayed distinct, similar or closely related. In their genetic diversity study using RAPD similar relationship with DA at 0.0; M12-1 from Zimbabwe is related to 211-91 from Massawe et al. (2003) found a similar CAPS, and 211-57 and 211-55-1 suggests trend of association, and proposed that similar origin. TV-93 and TV-79-1 have a such close associations between Bambara close association. groundnut landraces could mean that they The distance of 0.30 on the were related or that they were the same Jaccard Neighbor-joining (Jaccard NJ) genotypes. Similar suggestions were dendrogram (Fig. 1) between M12-1 and made by Ntundu et al. (2006) in a morphological diversity study among

68 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Bambara groundnut landraces in landraces that were related to Tanzania. These authors proposed that geographical origin using RAPDs and unorganized collection and grouping of AFLP, respectively. The findings in this Bambara groundnut landraces would study demonstrated the ability of SSR result in a single genotype bearing several markers to portion the genotypes into names (Massawe et al., 2003). closer genetic groupings than other

The highest DA of 3.8 was marker systems. The pattern was similar observed between two pairs of Bambara to that obtained in a morphological groundnut genotypes, M02-3 and 211-51- diversity study presented in the previous 1, and M02-3 and 211-57 (Table 4). chapter. However, these two pairs were not grouped in the same cluster (Fig. 1). The largest among the seven Amadou et al. (2001) used RAPD clusters was Cluster III which consisted of markers and found that Bambara 12 genotypes emanating from four groundnut accessions from Zambia and geographical sources (Fig. 1). Five of Zimbabwe were grouped in the same these genotypes originate from CAPS, cluster, suggesting that the same seed three from Zambia, two from Kano and material may have been taken from one of one from IITA (Table 5). Two genotypes, the location to the other. The DA observed 101-2 and 101-2-1, were positioned in this study revealed low minimum and closely in this cluster, with the latter being maximum values, when compared with a selection from the former, suggesting reports of other genetic studies based on that they possess similar genes. Cluster I SSRs (Somta et al., 2011), AFLP (Ntundu followed with ten genotypes, of which six et al., 2004) and RAPD (Amadou et al., originated from CAPS, while three were 2001; Massawe et al., 2003). These sourced from Zimbabwe, and one variations may be due to the nature the genotype was obtained from a farmers' germplasm used in this study, which collection in Pietermaritzburg that consisted of pure lines from single plant appeared as an outlier. selection, compared to the use of Capstone seed company is a landraces composed of mixtures of a few company in South Africa that buys and to several seed morpho-types. sells Bambara groundnut seeds composed of mixtures of different morpho-types. Genetic relationship The seed lots vary in seed coat colour and The levels of similarities and divergence eye pattern. Hence there is the possibility among the 50 Bambara groundnut that CAPS may have secured Bambara genotypes are presented in Fig. 1 and groundnut seed landraces from Table 4 using the Jaccard Neighbor- Zimbabwe and other neighboring joining analysis. The analyses revealed countries hence the grouping pattern. the presence of significant genetic Cluster II comprised of nine diversity among the tested genotypes. The genotypes collectively originating from genotypes were conveniently grouped CAPS, Zambia and ARC in South Africa. into seven definite clusters, independent In this cluster, two pairs of genotypes KB of geographical origin (Table 4). 05 and KB 08 from ARC in South Africa, Conversely, Amadou et al. (2001) and and 42-1 and 42-2 from Zambia, had Ntundu et al. (2004) collectively reported strong similarities. However, the two genomic grouping of Bambara groundnut pairs varied in seed coat colour: while 42- 69 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

1 was light brown, 42-2-2 was cream. The revealed in the present study: 6 to 17 per smallest cluster was Cluster IV which had locus with a mean of 10.6. Also, the SSR only three genotypes, M01-8, which analysis exhibited a comparable pattern originated from Zimbabwe, while N211K between morphological diversity of the and TV-14 originated from Kano and same genotypes. For genetic distance Ghana, respectively, reflecting a close analysis, the Bambara groundnut genetic relationship, despite their distant genotypes were grouped into seven origins. clusters, consisting of combination of Pasquet et al. (1999) compared genotypes from different geographical the genetic diversity between wild and origin. domesticated Bambara groundnut Therefore, this study confirmed accessions using isozyme markers and that the homogeneity of the genotypes reported a close relationship between the used in this study was because they were two species suggesting that the former is sourced from single plant selections, i.e. the progenitor of the latter. However, pure lines; and that SSR markers were Ntundu et al. (2004) discussed isozymes as having limited use for genetic analysis highly effective at discriminating between due to their low levels of polymorphism. the Bambara groundnut genotypes. The findings in this study confirmed the detection power of the References Amadou H, Bebeli P and Kaltsikes P SSRs to resolve the genetic diversity of (2001) Genetic diversity in Bambara the Bambara groundnut genotypes into groundnut (Vigna subterranea L.) their similarity and divergent groups with germplasm revealed by RAPD great precision, while each genotype was markers. Genome 44: 995-999. derived from single plant selection that Basu S, Mayes S, Davey M, Roberts JA, was presumed to be genetically uniform. Azam-Ali SN, Mithen R and Pasquet R S ( 2 0 0 7 a ) I n h e r i t a n c e o f Conclusion domestication traits in Bambara The genetic analysis using the SSR groundnut (Vigna subterranea [L.] makers revealed the extent of similarity Verdc.). Euphytica 157: 59-68. and differences among the 50 Bambara Basu S, Roberts J, Azam-Ali SN and groundnut genotypes used in this study, Mayes S (2007b) Development of which compared favourably with the microsatellite markers for Bambara results obtained in similar studies using groundnut (Vigna subterranea [L.] SSRs which include those adopted in this Verdc.): an underutilized African study. In this study, PIC estimates varied legume crop species. Molecular from 0.5576 to 0.8486 with a mean of Ecology Notes 7: 1326-1328. CIMMYT (2005). Laboratory Protocols. 0.7554, while heterozygosity (He) varied Applied Molecular Genetics between 0.6261 and 0.8634 with a mean Laboratory. of 0.7865. These measurements were Collinson S.T, Sibuga K.P, Tarimo AJP higher than the ranges of 0.70 and 0.552, and Azam-Ali S.N (2000) Influence and 0.54 and 0.77 of PIC and He found by of sowing date on the growth and Basu et al. (2007b) and Somta et al. yield of Bambara groundnut (2011), respectively. There were also landraces in Tanzania. Experimental fewer alleles in other studies than those Agriculture 36: 1-13.

70 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Danzmann R, Gupta S and Gopalakrishna Resources and Crop Evolution 50: T (2009) Genetic diversity analysis in 737-741. blackgram (Vigna mungo [L.] Massawe F, Dickinson M, Roberts J and Hepper) using AFLP and transferable Azam-Ali SN (2002). Genetic microsatellite markers from adzuki diversity in Bambara groundnut bean (Vigna angularis (Willd.) Ohwi (Vigna subterranea [L.] Verdc.) & Ohashi). Genome 52: 120-129. landraces revealed by AFLP markers. Gupta P, Rustgi S, Sharma S, Singh R, Genome 45: 1175-1180. Kumar N and Balyan H (2003) Mayes S, Ho WK, Kendabie P, Chai PH, Transferable EST-SSR markers for Aliyu S, Feldman A, Razlin Azman the study of polymorphism and Halimi RA, Massawe F and Azam-Ali genetic diversity in bread wheat. S.N (2015) Applying molecular Molecular Genetics and Genomics genetics to underutilised species – 270: 315-323. Problems and Opportunities. Malays Gupta P and Varshney R (2000). The d e v e l o p m e n t a n d u s e o f Applied Biology 44 (4): 1-9 microsatellite markers for genetic Mayes S, Basu S, Murchie E, Roberts J, analysis and plant breeding with Azam-Ali SN, Stadler F, Mohler V, emphasis on bread wheat. Euphytica Wenzel G, Massawe F and Kilian A 113: 163-185. ( 2 0 0 8 ) B A M L I N K - a C r o s s Hepper F (1963) Plants of the 1957-58, Disciplinary Programme to Enhance West African Expedition: II. The the Role of Bambara Groundnut Bambara groundnut (Voandzeia (Vigna subterranea [L.] Verdc.) for subterranea) and Kersting's Food Security in Africa and India. groundnut (Kerstingiella geocarpa) International Symposium on Wild in West Africa. Kew Bulletin 16: Underutilized Plants for Food 395-407. Security, Nutrition, Income and Mansfield DC, Brown AF, Green DK, Sustainable Development, Acta Hort. Carothers AD, Morris SW, Evans HJ 806 International Society for and Wright AF (1994) Automation of Horticultural Science, 2009, pp. 137- genetic-linkage analysis using 150. fluorescent microsatellite markers. Mondini L, Noorani A and Pagnotta MA Genomics 24: 225-233. (2009) Assessing plant genetic Massawe F, Mwale S, Azam-Ali SN and diversity by molecular tools. Diversity Roberts J (2005) Breeding in 1: 19-35. Bambara g r o u n d n u t ( Vi g n a Mohammed M.S, Shimelis H.A and Laing s u b t e r r a n e a [ L . ] Ve r d c . ) : M D ( 2 0 1 6 a ) P r e l i m i n a r y strategic considerations. African Investigation on Some Agronomic Journal of Biotechnology 4: and Morphological Variations of 463-4 7 1 . Within and Between Bambara Massawe F, Roberts J, Azam-Ali SN Groundnut (Vigna subterranea [L.] and Davey M. (2003) Genetic Verdc.) Landraces. Journal of diversity in Bambara groundnut Agricultural Science and Technology, (Vigna subterranea [L.] Verdc) 18: 1909-1920 landraces assessed by Random Mohammed MS, Shimelis HA and Laing Amplified Polymorphic DNA M D ( 2 0 1 6 b ) P h e n o t y p i c ( R A P D ) m a r k e r s . G e n e t i c characterization of diverse Bambara

71 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

groundnut (Vigna subterranea [L.] analysis. Genetic Resources and Crop Verdc.) germplasm collections Evolution 59: 347-358. through seed morphology. Genetic Pasquet RS, Schwedes S and Gepts P Resources and Crop Evolution, (1999) Isozyme diversity in Bambara 63:889–899. DOI: 10.1007/s10722- groundnut. Crop Science 39: 1228- 016-0374-3. 1236. Mukakalisa C, Kandawa-Schulz M and Shegro A, van Rensburg W and Adebola P Mapaure I (2013) Genetic Diversity in (2013) Assessment of genetic Landraces of Bambara Groundnut variability in Bambara groundnut Found in Namibia Using RAPD Markers, II International Symposium (Vigna subterrenea [L.] Verdc.) using on Underutilized Plant Species: Crops morphological quantitative traits. for the Future-Beyond Food Security Academic Journal of Agricultural Acta Hort. 979 International Society Research 1: 45-51. for Horticultural Science, pp. 683-687 Sibov ST, De Souza J, Lopes C, Garcia Ntundu WH, Shillah S, Marandu W and AA, Silva A.R, Garcia A, Mangolin C h r i s t i a n s e n J . L ( 2 0 0 6 ) C.A, Benchimol LL and De Souza AP Morphological diversity of Bambara (2003) Molecular mapping in tropical groundnut ([Vigna subterranea [L.] maize (Zea mays L.) using Verdc.) landraces in Tanzania. m i c r o s a t e l l i t e m a r k e r s . 2 . Genetic Resources and Crop Quantitative trait loci (QTL) for grain Evolution 53: 367-378. yield, plant height, ear height and Ntundu WH, Bach IC, Christiansen JL grain moisture. Hereditas 139: 107- and Andersen SB (2004) Analysis of 115. genetic diversity in Bambara Somta P, Chankaew S, Srinives P, and Rungnoi O (2013) Cross-species groundnut (Vigna subterranea [L.] amplification of microsatellite Verdc.) landraces using amplified markers in Bambara groundnut fragment length polymorphism (Vigna subterranea) and their (AFLP) markers. African Journal of application in diversity study. In Biotechnology 3: 220-225. International Symposium on Odeigah P and Osanyinpeju A (1998) Underutilized Plant Species: Crops Evaluating the genetic biodiversity of for the Future-Beyond Food Security. Bambara groundnut accessions from I n t e r n a t i o n a l S o c i e t y f o r Nigeria using SDS-polyacrylamide Horticultural Science Acta Hort. 979: gel electrophoresis. Genetic 431-435. Resources and Crop Evolution 45: Somta P, Chankaew S, Rungnoi O, 451-458. Srinives P, and Scoles G (2011) Olukolu BA, Mayes S, Stadler F, Ng NQ, Genetic diversity of the Bambara Fawole I, Dominique D, Azam-Ali groundnut (Vigna subterranea [L.] SN, Abbott AG and Kole C (2012) Verdc.) as assessed by SSR markers. Genetic diversity in Bambara Genome 54: 898-910. van Berloo R (2008) GGT 2.0: Versatile groundnut (Vigna subterranea [L.] software for visualization and Verdc.) as revealed by phenotypic analysis of genetic data. Journal of descriptors and DArT marker Heredity 99: 232-236.

72 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Bio – Diversity Investigation of Leguminous Plants (Fabaceae) Found in Ibadan South East Local Govt. of Oyo State

Hassan A.B.1, Rapheal Onyema and Bola Owodunni 1.Department of Science Lab. Tech. School of Science and Technology Polytechnic, Ibadan South East, Oyo, Oyo State [email protected] , [email protected] 08034269002

Abstract Diversity study was conducted and the information of leguminous plant (Fabaceae) in Ibadan south east Local Government area of oyo State was documented. Field work was carried out to collect the plant parts. A voucher specimen was prepared for all the plants collected and deposited in the herbarium (Parkiabiglibos (Jacq.), Tamarindusindica (L.), Acacia nilotica (L.), Indigoferaastragalina (Mill.), Acacia siebariana (D.C), Bauhinia reticulata (L.), Sennasingueana (L.), Sennaoccidentalis (L.), Sennaobtusifolia (L.) Crotalaria spp. (L.), Vignavexillata (L.), Arachishypogaea (L.), Glycine max (L.), Phaeolus vulgaris (L.), Vignasubterranea (L.)). This research work identifies, document and classifies the various leguminous taxa found according to their growth patterns and economic uses. Suggestions were offered on cultivation of leguminous plants because of their economic value.

Introduction plant species (Judd, et al., 2002). The Fabaceae or Leguminosae, common- Fabaceae is the most common family ly known as the legume, pea, or bean found in tropical rainforests and in dry family, are a large and economically forests in the America and Africa important family of flowering plants. It (Burnham and Johnson, 2004). includes trees, shrubs, and perennial or Farmed legumes can belong to annual herbaceous plants, which are many agricultural classes, including easily recognized by their fruit (legume) forage, grain, blooms, pharmaceutical/ and their compound, stipulated leaves. industrial, fallow/green manure, and Many legumes have characteristic timber species. Most commercially flowers and fruits. The family, is widely farmed species fill two or more roles distributed, and is the third largest land simultaneously, depending upon their plant in terms of number of species, degree of maturity when harvested. Grain behind only the Orchidaceae and legumes are cultivated for their seeds. The Asteraceae, with about 751 genera and seeds are used for human and animal s o m e 1 9 , 0 0 0 k n o w n s p e c i e s consumption or for the production of oils (Christenhusz and Byng, 2016). The five for industrial uses. Grain legumes include largest of the genera are Astralagus (over beans, lentils, lupins, peas, and peanuts 3,000 species), Acacia (over 1000 (Kurlovich and Repyev, 2005). species), Indigofera (around 700 species), Legumes are a significant source Crotalaria (around 700 species) and of protein, dietary fiber, carbohydrates Mimosa (around 500 species), which and dietary minerals; for example, a 100g constitute about a quarter of all legume serving of cooked chickpeas contains 18 species. The 19,000 known legume percent of the Daily Value (DV) for species amount to about 7% of flowering protein, 30 percent DV for dietary fiber, 73 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

43 percent DV for foliate and 52 percent in ecosystems (Knops et al., 2002). The DV for manganese. Like other plant- presence of legumes often has a positive based foods, pulses contain no cholesterol effect on ecosystem nitrogen pools which and little fat or sodium (Conde, 2014). can significantly increase above-ground The Leguminosae have a wide biomass (Spehn et al., 2002). In addition, variety of growth forms including trees, nitrogen-fixing leguminous trees (Sprent, shrubs or herbaceous plants or even vines 2009) are key invaders on several or lianas. The herbaceous plants can be continents (Lewis et al., 2009) and annuals, biennials, or perennials, without oceanic islands (Caetano et al., 2012), basal or terminal leaf aggregations. Many having strong impacts on savanna and grassland ecosystems (Chaneton et al., legumes have tendrils. They are upright 2004). On the other hand, there are many plants, epiphytes or vines. The latter Fabaceae trees that grow slowly and support themselves by means of shoots produce very heavy wood such as that twist around a support or through Dalbergia L. f. Such heavy wood has slow cauline or foliar tendrils. Plants can be decomposition rate and contributes to heliophytes, mesophytes or xerophytes carbon storage in ecosystems (Weedon et (Watson and Dallwitz, 2007). al., 2009).

Scientific classification of legumes Statement of the problem Legumes are flowering plants (class Despite the abundance and diversification Angiospermae) that belong to the family of legumes, there is little or no clue that Leguminosae or Fabaceae in the order shows the distribution or the diversity of Fabales. There are three major leguminous plant in the study area (Ibadan subfamilies: (Angiosperm Phylogeny South East, Oyo, Oyo State). Many plant Group, 2009). Mimosoideae (Acacia species diversity are also being lost, but it subfamily), Caesalpinoideae (Pride-of- remains uncertain at what rate we are Barbados subfamily), and Papilionoideae losing plant species diversity (Yahara et (Bean subfamily) A fourth subfamily, al., 2012). These leads, to view about the Krameriodeae, with a single genus is also understanding of the diversity of the recognized by plant taxonomists. leguminous plant in Ibadan South East, Oyo State. Ecosystem Functions of Legumes. Some common legume species Fabaceae is a dominant family in terms of have seeds that are smaller than grass species-richness and biomass in many seeds and so, must be carefully planted forests of the Neotropics and Africa and seeding rates will vary greatly. (including Madagascar). For example, TerSteege et al., (2006) demonstrate the Forage and grain legumes dominance of legumes in the Amazon rain Forage legumes play an important role in forest (Du Puy et al., 2002), and legumes dairy and meat production being sources are the most species-rich family in both of protein, fibre and energy. They are Neotropical dry forests and savannas usually richer in protein, calcium, and (Ratter et al., 2006). Legume abundance phosphorus than other non legume is a significant factor that influences the forages, such as grass. They include rate of carbon and nitrogen accumulation alfalfa (Medicago sativa), clover

74 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

(Trifolium spp.), birdsfoot trefoil (Lotus Ibadan South East, Oyo Local corniculatus) and vetch (Vicia spp.) Government Area of Oyo State and the among others. Alfalfa is one of the most fresh voucher specimens (leaf, flower and important forage crops. In 2006, the fruit) of plants considered to be legumes worldwide production was around 436 was collected and brought to the Biology million tons. U.S. is the largest alfalfa Laboratory Department of Science producer, with 15 million Ha planted in Laboratory Technology for preservation. 2010. Canada, Argentina (primarily grazed), Southern Europe, Australia, Method of preservation South Africa, and the Middle East have The fresh voucher specimens collected also considerable production. was preserved by putting it in between the Grain legumes are also called sheets of a newspaper and using a plant pulses, which according to FAO (Food press to compress it. The newspaper and Agriculture Organization) are crops absorbs the moisture content from the harvested exclusively for the dry seeds, specimen with the specimen retaining its play an important role in the nutrition of morphology and physiology. But, many people due to their high protein depending upon the material, some were content in seeds. They represent a major stored in boxes and other preservatives. source of protein in many developing countries, especially among the poorest M e t h o d o f c l a s s i f i c a t i o n a n d population, and are rich in essential identification a m i n o a c i d s s u c h a s l y s i n e , The various species collected were supplementing thus the nutritional value identified as legumes by their fruit (pods) of cereal and tuber diets (Graham and and their compound, stipulated leaves. Vance, 2003). They were classified according to their subfamilies and genera. Materials and Methods Brief description of study area Preparation of the herbarium The study area is Ibadan South East, Oyo Cardboard sheet was cut into A4 size. State. Ibadan South East, Local The voucher specimens were dried by Government Area in Oyo State, Nigeria. putting it in between the sheets of a Its headquarters is in the town of Ibadan newspaper and using a plant press to press South East, Oyo, home to the Polytechnic the newspaper. The sheets were changed Ibadan South East, Oyo. It has an area of at intervals to allow proper drying of the 868km2 and a population of 281,367 at the specimen. 2006 census. Its coordinates are After been dried, the voucher 12036'0”N 6035'23”E. It is characterized specimens were mounted on the cut by Sudan Savanna vegetation. cardboard sheets by the use of glue. At the bottom right corner of each sheet, a Materials and equipments used label was made containing information Cardboard paper, knife, newspaper, gum, such as: Name of Collector, Date of plant press, camera, biro, notebook, box, Collection, Taxon names etc for each alcohol. leguminous species. The voucher specimens were documented Method of plant collection for further studies. A field survey was conducted around the

75 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Size of the study -Taxonomy and Nomenclature The size of the study was the leguminous Famil: Fabaceae, species available in Ibadan South East, Subfamily: Faboideae Oyo State at the time of the study. Common Name: Groundnut Hausa Name: Gyada Method of the study The method used in the study was: -Botanical Description (i) Identification Groundnut is an annual herbaceous plant (ii) Documentation growing 30-50cm (1.0-1.6ft) tall. As a (iii) Classification legume, it belongs to the botanical family Fabaceae (also known as the -identification: This involves the method Leguminosae or bean family). Like most used in identifying and authenticating the other legumes, peanuts harbor symbiotic species collected as legumes by the nitrogen-fixing bacteria in their root characteristic features they possess – nodules. pods, compound leaf, and root nodules. Flowering and Fruiting habit -documentation: This method involves The flowers are 1.0-1.5cm (0.4-0.6in) putting down the relevant information of across, and yellowish orange with reddish each leguminous species collected in veining. They are borne in axillary typed form and keeping it for reference clusters on the stems above ground and purposes; this method also covers the last for just one day. Groundnut pods preparation of the herbarium. develop underground, an unusual feature known as geocarpy. -classification: This involves the method of placing the leguminous species into Uses. different taxa according to their growth Its seed (groundnut) is used in the pattern and economic use. production of groundnut oil which is often used in cooking, because it has a Result and presentation mild flavor and a relatively high smoke Result of the study point. It is also used in making peanut The Leguminous species collected during butter, peanut flour, boiled peanuts, dry- roasted peanuts which is mostly used as this study was 15 from different locations snacks in the study area (Ibadan South East, Oyo, . Oyo State). -Taxonomy and Nomenclature Family: Fabaceae, Presentation of the result Subfamily: Faboideae The leguminous species collected are Common Name: Zombi pea, wild cowpea presented below with their coloured p h o t o g r a p h s , t a x o n o m y a n d Hausa Name: Waken damo nomenclature, botanical description, -Botanical Description distribution and habit, flowering and It is a strong twiner with fusiform, fruiting habit. tuberous roots. Its stems are usually clothed with brownish silky hairs, or trichomes. Its leaflets come in three,

76 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 which are oval-shaped and pointed at the eyes. tip, with the terminal leaflet being 7.5- 15cm (3.0-5.9in) long. -Taxonomy and Nomenclature Family: Fabaceae; -Distribution and Habit Subfamily: Caesalpinioideae It thrives in a wide range of conditions, Common Name: Coffee senna mostly in grasslands and in the disturbed Hausa Name: Tafasar masar areas, as well as a weed. In India, the plant flourishes from 1,200-1,500m in altitude -Uses in the foothills of the Himalayas and in the In Jamaica, the seeds are roasted, brew hills of Eastern and North-eastern India. and serve as tea to treat Diuretic, -Uses hemorrhoids, gout, laxative, rheumatism, Its use has spread beyond its native range diabetes, rheumatism. Mogdad coffee and the plant is now sometimes cultivated seeds can be roasted and used as a for its edible tubers. It is also grown as a substitute for coffee. They have also been green manure and ground cover crop used as an adulterant for coffee. especially in soils. The root is also -Botanical Description consumed raw or cooked. It is an annual undershrub, subglabrous, foetid, few feet high. Its leaves are -Taxonomy and Nomenclature alternate, compound, paipinnate; rachis Family: Fabaceae; channeled presence of a gland at the base of the rachis; stipulate stipule obliquely Subfamily: Caesalpinoideae cordate. Common Name: Chinese senna or sickle pod Fruit and Flower description Hausa Name: Tafasa Its flower is complete, bisexual, slightly irregular, zygomorphic, pentamerous, -Distribution and Habit hypogynous, pedicelate; bractate, bracts It grows wild in North, Central and South white with pinkish tinge, thin, ovate- America, Asia, Africa, and Oceania, and acuminate, caduceus; yellow. Its pod is is considered a particularly serious weed dehiscent, woody, 12.5cm x 0.7cm, in many places. It has a long- standing glaburous, recurved, subcompressed, history of confusion with Sennatora and distinctly torulose, 23-30 seeded. that taxon in many sources actually refers to the present species. -Taxonomy and Nomenclature Family: Fabaceae; -Uses Sub-family: Mimosoideae The green leaves of the plant are Common Name: African locust bean fermented to produce a high- protein food Hausa Name: Dorowa product called “Kawal” which is eaten by many people in Sudan as a meat -Distribution and habit substitute. Its leaves, seeds, and root are Geographically, Parkia biglobosa can be also used in folk medicine primarily in found in a belt stretching from the atlantic Asia. It is believed to possess a laxative coast in Senegal to Southern Sudan and effect, as well as to be beneficial for the Northern Uganda. The tree currently 77 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 exists within a wide range of natural wide, five-petalled, borne in small communities but is most abundant in racemes, and yellow with orange or red anthropic communities (Agroforest Tree streaks. Buds are pink as the four sepals Database, 2013). are pink and are lost when the flower blooms. The fruit is an indehiscent Botanical Description legume, sometimes called a pod, 12-15cm It is a deciduous perennial that grows to in length, with a hard, brown shell. between 7-20 metres high, in some cases up to 30 metres (Ntui, et al., 2012). The -Uses tree is a fire resistant heliophyte Tamarind lumber is used to make characterized by a thick dark gray-brown furniture, carvings, turned objects such as bark. The pods of the tree, commonly mortars and pestles, chopping blocks, and referred to as locust beans, are pink in the other small specialty wood items. The beginning and turn dark brown when fruit exhibit laxative effects due to its high fully matured. quantities of malic acid, tartaric acid, and potassium bitartrate. -Uses The yellow pulp, which contains the seed, Acacia nilotica (L.) P.J.H. Hurter & Mabb. is naturally sweet and is processed into a valuable carbohydrate food known as daddawa among Hausa. The fruit pulp, the leaves and the seeds are also used to feed livestock and poultry.

-Taxonomy and Nomenclature Family: Fabaceae; Subfamily: Detarioideae Common Name: Tamarind Hausa Name: Tsamiya Fig. 1: Photograph of Gum Arabic tree Acacia nilotica (L.) -Botanical Description Source: Field Survey conducted 2018 The tamarind is a long-lived, medium- -Taxonomy and Nomenclature growth tree, which attains a maximum Family: Fabaceae; crown height of 12-18 meters (39-59ft). Subfamily: Mimosoideae The crown has an irregular, vase-shaped Common Name: Gum Arabic tree outline of dense foliage. It prefers clay, Hausa Name: Bagaruwa loam, sandy and acidic soil types, with a -Botanical Description high resistance to drought and aerosol Acacia nilotica is a tree 5-20m high with a salt. dense spheric crown, stems and branches usually dark to black coloured, fissured bark, -Flowering and fruiting habit grey-pinkish slash, exuding a reddish low The tamarind flowers (although quality gum. The tree has thin; straight, light, grey spines in axillary pairs, usually in 3-12 inconspicuously), with red and yellow pairs, 5-7.5cm long in young trees, mature elongated flowers. Flowers are 2.5cm trees commonly without thorns.

78 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

emerges. It occurs within the first 48 hours under ideal growing conditions. The first true leaves develop as a pair of single blades. Subsequent to this first pair, mature nodes form compound leaves with three blades

-Flowering and fruiting habit Soybeans form inconspicuous, self-fertile flowers which are borne in the axil of the Fig. 2: Photograph of Soybeans Glycine leaf and are white, pink or purple. max (L.) Depending of the soybean variety, node Source: Field Survey conducted 2018 growth may cease once flowering begins. The fruit is a hairy pod that grows in -Distribution and Habit It is native from Egypt, across the Maghreb clusters of three to five; each pod is 3-8cm and Sahel, South to Mozambique and long. KwaZulu-Natal, South Africa, and east through Arabian Peninsula to Pakistan, India -Uses and Burna. It has become widely naturalized Soybeans are a globally important crop, outside its native range including Zanzibar providing oil and protein. In the United and Autralia. It is spread by livestock. States, the bulk of the harvest is solvent- extracted with hexane, and the toasted -Uses defatted soy meal (50% protein) then Its pods are used as a supplement to poultry ratios. Dried pods are particularly sought out makes possible the raising of farm by animals or rangelands. The tender twig of animals (e.g. chicken, hog, turkey) on a this plant is used as a tooth brush in South- large industrial scale. Soybean products East Africa, Pakistan and India. The exudates are used in a large variety of processed gum of this tree is known as gum Arabic and foods. has been collected from the pharaonic times for the manufacture of medicines, dyes and -Taxonomy and Nomenclature paints. Family: Fabaceae; Glycine max (L.) Merr. Subfamily: Papilionoideae, Common Name: Beans -Taxonomy and Nomenclature Hausa Name: Waken Family: Fabaceae; Subfamily: Faboideae -Botanical Description Common Name: Soybean The common bean is a highly variable Hausa Name: Waken soya species with a long history. Bush varieties -Botanical Description form erect bushes 20–60 cm (8–20 in) tall, Like most plants, soybeans grow in while pole or running varieties form vines distinct morphological stages as they 2–3 m (7–10 ft) long. All varieties bear alternate, green or purple leaves, which develop from seed into fully mature are divided into three oval, smooth-edged plants. The first stage of growth is leaflets, each 6–15 cm (2–6 in) long and germination, a method which first 3–11 cm (1–4 in) wide. becomes apparent as a seed radical 79 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

-Distribution and Habit depressions and along edges of swamps Beans are grown in every continent and rivers, but also in deciduous bush except Antarctica. Brazil and India are land, roadsides and fields. the largest producers of dry beans, while Family: Fabaceae; China produces, by far, the largest Subfamily: Mimosoideae quantity of green beans. Worldwide, 23 Common Name: Paper bark acacia million tonnes of dry common beans and Hausa Name: Farar kaya 17.1 million tonnes of green beans were grown in 2010.The wild P. vulgaris is -Botanical Description native to the Americas. It was originally The tree varies from 3 to 25 m in height, believed that it had been domesticated with a trunk diameter of 0.6 to 1.8 m. It is separately in Mesoamerica and in the not listed as being a threatened species. It southern Andes region. is characterized by thorns.

-Uses -Uses Similar to other beans, the common bean Acacia sieberiana is valued largely as a is consumed for its high source of starch, source of forage, medicine and wood. The protein, and dietary fibre, and is an inner bark is a source of fibre purposes excellent source of iron, potassium, such as stringing beads. The gum is edible selenium, molybdenum, thiamine, and both livestock and game animals vitamin B6, and foliates. browse the tree and feed on the dropped pods, spreading viable seeds in their dung. -Taxonomy and Nomenclature The flowers of the tree make good forage Family: Fabaceae; for bees and bee hives are put directly in Subfamily: Faboideae the trees to exploit the resource. Common Name: Rattlepods Hausa Name: Gyada awaki -Taxonomy and Nomenclature Family: Fabaceae; -Uses Subfamily: Faboideae Several species of Crotalaria are Common Name: Silky cultivated as crops to be consumed by Hausa Name: Kai kai human populations throughout the world. To ensure the survival and optimal -Botanical Description cultivation of these plants, they are often Species of Indigofera are mostly shrubs, selected for resistance to diseases, yield, though some are small trees or herbaceous and nutritional quality. The flowers and perennials or annuals. Most have pinnate pods of Crotalaria tetragona are eaten as leaves. Racemes of flowers grow in the vegetables, the flowers and buds are used leaf axils, in hues of red, but there are a as garnishing, and the seeds are eaten as few white- and yellow-flowered species. pulse. The fruit is a legume pod of varying size and shape. -Distribution and Habit Africa is the continent with the majority -Uses of Crotalaria species (approximately 400 Several species, especially Indigofera species), which are mainly found in damp tinctoria and Indigofera suffruticosa, are grassland, especially in floodplains, used to produce the dye indigo. Several

80 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 species of this group are used to alleviate Common Name: Senna pain. The herbs are generally regarded as Hausa Name: Runhu an analgesic with anti-inflammatory activity, rather than an anodyne. -Botanical Description Senna includes herbs, shrubs, and trees. -Distribution and Habit The leaves are pinnate with opposite They are widely distributed throughout paired leaflets. The inflorescences are the tropical and subtropical regions of the racemes at the ends of branches or world. emerging from the leaf axils. The flower has five sepals and five usually yellow -Taxonomy and Nomenclature petals. There are ten straight stamens. The Family: Fabaceae; stamens may be different sizes, and some Subfamily: Cercidoideae are staminodes. The fruit is a legume pod Common Name: Mountain ebony containing several seeds. Hausa Name: Kalgo Uses -Botanical Description Some Senna species are used as Bauhinia trees typically reach a height of ornamental plants in landscaping. Cassia 6–12 m and their branches spread 3–6 m gum, an extract of the seeds of Chinese outwards. The lobed leaves usually are senna (S. obtusifolia), is used as a 10–15 cm across. thickening agent. Senna is considered to be a bowel stimulant on the myenteric -Flowering and fruiting Habit plexus of the colon to induce peristaltic The five-petaled flowers are 7.5–12.5 cm contractions and decrease water diameter, generally in shades of red, pink, absorption from inside the colon, effects purple, orange, or yellow, and are often that would provide relief from fragrant. The tree begins flowering in late constipation. winter and often continues to flower into early summer. Depending on the species, Distribution and Habit Bauhinia flowers are usually in magenta, This diverse genus is native throughout mauve, pink or white hues with crimson the tropics, with a small number of species highlights. intemperate regions. The number of species is estimated to be from about 260 -Distribution and Habit to 350. It has a pan tropical distribution; many species are widely planted in the tropics Taxonomy and Nomenclature as orchid trees, particularly in India, Sri Family: Fabaceae. Lanka, Vietnam and southeastern China. Subfamily: Faboideae Other common names include mountain Common Name: Bambara nut ebony and kachnar (India and Pakistan). Hausa Name: Kwa ruru

Source: Field Survey Conducted 2018. Distribution and Habit The origin of the Bambara groundnut is -Taxonomy and Nomenclature West Africa and the region of cultivation Family: Fabaceae; is Sub-Saharan Africa's warm tropics. Subfamily: Caesalpinioideae Bambara nut grows well any where

81 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 groundnut (peanut) grows and so is vastly recommended that: present from Kwara state and throughout Further study should be carried the northern parts of Nigeria. out in the study area to discover more leguminous species, as well as their Uses distribution. The seeds are used for food and beverage Conservation agricultural because of their high protein content and practices should be put in place to avoid for digestive system applications. The extinction of the available species. entire plant is known for soil Leguminous plants should be improvement because of nitrogen cultivated because of the large economic fixation. In West Africa, the nuts are eaten value derived from its species – nitrogen as a snack, roasted and salted, processed fixation, forage, cover-cropping and food into cake, or as a meal, boiled similar to for man and livestock etc. other beans. Just like Groundnut Cake More research should be carried (Kulikuli cake), the Bambara nut is out to discover the economic value which processed to Kangu cake starting from can be derived from the leguminous Kwara through northern Nigeria, Chad species considered to be weed. and Niger. During the rainy season in many parts of central Nigeria like Jos, the References fresh bambara beans are cooked with Angiosperm Phylogeny Group (2009). their shells still on them. The beans are "An update of the Angiosperm then eaten as a snack just like boiled Phylogeny Group classification for groundnuts. the orders and families of flowering plants: APG III" (PDF). Botanical Conclusion and Recommendation Journal of the Linnean Society . 161 The result of this study identifies the (2): 105–121. doi :10.1111/j.1095- leguminous species discovered in the 8339.2009.00996.x . Retrieved 4 study area during the course of this study. February 2014. It is evident that the objectives of the Burnham, R. J.and Johnson, K. R. (2004). study have met to an extent the diversity "South American palaeobotany and study of leguminous plants in the study the origins of neotropical rainforests". area (Ibadan South East, Oyo, Oyo State). Philosophical Transactions of the It can also be deduced from the result that Royal Society B: Biological Sciences. the legumes family (Fabaceae) have 359 (1450): 1595–1610. doi diversed species with many unidentified. :10.1098/ rstb.2004.1531 . PMC This study has shown therefore that there 169343 . PMID 15519975. are a lot of leguminous species distributed Caetano, S., Currat, M., Pennington, R. in the study area and a wide range of T., Prado, D.E., Excoffier, L. and economic use derived from its species. Naciri, Y. (2012). Recent coloniza- tion of the Galapagos by the tree Recommendation G e o f f r o e a s p i n o s a J a c q . Due to the diversity of legumes and (Leguminosae). Molec. Ecology. inadequate information on the 21:2743–2760. http://dx.doi. distribution or the diversity of o r g / 1 0 . 1 1 1 1 / j . 1 3 6 5 - 2 9 4 X . leguminous plant in the study area 2012.05562.x (Ibadan South East, Oyo, Oyo State). It is

82 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Chaneton, E.J., Mazia, C.N., Machera, Chickpeas (garbanzo beans, bengal M., Uchitel, A. and Ghersa, C.M. gram), mature seeds, cooked, boiled, (2004). Establishment of Honey without salt, 100 g, USDA Nutrient Locust (Gleditsia triacanthos) in Database, version SR-21" . Retrieved burned Pampean grasslands. Weed 15 January 2015. Te c h n o l o g y. 1 8 : 1 3 2 5 – 1 3 2 9 . Du Puy, D.J., Labat, J.N., Rabevohitra, http://dx.doi.org/10.1614/0890037X R., Villiers, J.F., Bosser, J. and (2004)018[1325:EOHLGT]2.0.CO; Moat, J. 2002. The Leguminosae of 2 Madagascar. Richmond, U.K.: Royal Christenhusz, M. J. M. and Byng, J. W. Botanic Gardens, Kew. (2016). "The number of known Graham, P.H. and Vance, C.P. (2003). plants species in the world and its L e g u m e s : I m p o r t a n c e a n d annual increase". Phytotaxa. Constraints to greater use. Plant Magnolia Press. 261 (3): 201–217. P h y s i o l o g y 1 3 1 : 8 7 2 – 8 7 7 . doi :10.11646/ phytotaxa. 261.3.1 http://dx.doi.org/10.1104/pp. Conde N. (2014) "Nutrition facts for 017004.

83 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Screening of cowpea wild relative for drought tolerance at seedling stage

Aladele S.E1*., Olosunde A.A1., Afolayan G1., Okere A.U1., Uthman T.K1., Sajo A.K1., Ojo A.O1., and Olubiyi M.R1. 1 National Center for Genetic Resources and Biotechnology (NACGRAB), P.M.B 5382 Moor Plantation, Ibadan *Corresponding Author: [email protected]; Phone: +2348038074937

Abstract Response of one hundred and sixty two wild Vigna lines (comprising 62 F3 lines and 100 genebank accessions) to drought stress imposed at seedling growth stage was investigated in a screen house experiment in 2018. The experiment was arranged in a completely randomized block design with three replications. Two healthy seeds were planted per hole and later thinned to one seedling per stand a week after seedling emergence. Drought was imposed at 14 days after sowing to resumed at the point of wilting of most lines. During the period of drought imposition, data taken at the interval of three days includes: plant height (PH), leaf senescence score (LSS), Plant number of (PN) and Trifoliate leaf number (TN) while data were also recorded on the number of plants recovered (Recov) after the resumption of irrigation. The results of analysis of variance revealed highly significant variation (P < 0.01) for most traits except plant number. The leaf senescence score, plant height and plant number of plant were significantly correlated to the number of plants recovered. Twelve F3 lines and 56 genebank accessions were selected to be drought tolerant at seedling stage based on the number of plants recovered. This shows that cowpea wild relatives harbors drought tolerant gene and could be used in cowpea breeding programs to develop new drought tolerant varieties that will help to ensure food security most especially in the face of a changing climate.

Keywords: Drought tolerance, cowpea wild relative Introduction Sanda and Maina, 2013). It leads to leaf Cowpea [Vigna unguiculata. (L.) Walp.] expansion often caused by the sensitivity is a crop with significant economic of cell growth when exposed to water benefit in the arid and semi-arid regions of stress (Hsaio, 1973). Senescence and Africa, Asia, Latin America and to some abscission is also promoted by water levels in the southeastern United States stress thereby reducing leaf production, (Ehlers and Hall 1997). Cowpea is hence, resulting in small total leaf area per superior in drought tolerance than most plant (Karamanos, 1980). Consequently, other legume crops (Ehlers and Hall reduction in leaf area leads to reduction in 1997). There is significant variation crop growth, biomass production and seed between cowpea genotypes for drought production (Rawson and Turner, 1982). tolerance (Watanabe et al., 1997) even The problem of drought stress can be with their natural ability to survive addressed in various ways with the use of various levels of drought that could cause irrigation techniques and breeding. high reduction in crop productivity Irrigation is not affordable by small scale (Ewansiha and Singh, 2006). farmers in Africa due to cost of water Drought stress has a considerable availability throughout the growing effect on many aspects of plant growth season of cowpea, and technical and about 50 - 67% loss in yield of maintanance. A large capital outlay is cowpea grains (Fatokun et al., 2012; often required. A more sustainable option

84 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 of managing drought that will be that have this phenotypic trait will affordable by farmers is to develop maintain green leaf area under drought varieties that are drought tolerant from stress, thereby exhibiting faster recovery available drought tolerant accessions. when there is rain and continuing The genetic improvement for drought carbohydrate formation during drought tolerance and grain yield in crop has are characterized by maintenance of proved to be slow and difficult a process. green leaf area under drought stress. It is Hence, breeding for these traits is believed that the maintenance of green complex due to the minor genes involved leaf area contributes to continued the effect of the interaction with the carbohydrate formation during drought environment. physiological as well as (Borrell et al., 2000). Therefore, selection biochemical characters of the crop for delayed leaf senescence in cowpea (Fatokun et al., 2012; Mir et al., 2012). ) genotypes allows more photosynthates to recast. It was reported that there was be synthesized and distributed leading to positive significant correlation between production of higher yields. drought tolerance at the seedling stage Considerable progress has been and drought tolerance in the field when made with respect to the development of wooden boxes placed in the green house genomic tools and the development of were used in shoot tolerance study molecular markers to assist cowpea (Ewansiha and Singh, 2006; Muchero et breeding (Ehlers et al. 2010). The genetic al., 2010). resources centre (GRC) of IITA holds Although little attention has been more than 15000 accessions of cowpea given to seedling stage drought in landraces and varieties from more than cowpea, Mai-Kodomi et al. (1999), in 100 countries. It also holds more than their early research described the seedling 1500 accessions of wild cowpea. The drought tolerance in cowpea and former has been extensively evaluated explained that there are significant and well utilized in variety development. genotypic differences in ability to survive However, progress in utilizing wild vegetative stage drought stress. Also, a relatives has been more limited despite screening technique for the seedling stage the potential gains. The objective of this drought survival has been developed by study was to screen 162 accessions of using boxes with shallow layer of soil wild cowpea for drought tolerance in (Singh and Matsui, 2002). This method controlled conditions. did not put in place the effect of the root system and drought tolerance but Materials and Methods considers the non-destructive visual One hundred and sixty two accessions of identification of shoot dehydration wild cowpea sourced from the genetic tolerance (Singh et al., 1999a and b). resources centre (GRC) of IITA were used Important criteria to show seedling stage for the study. Gutter sand and top soil drought tolerance in cowpea is the were collected and air dried for 5days to maintenance of green stem (Muchero et reduce soil moisture content. The dried al., 2008). The use of greenhouse soil was sieved using a 2 mm sieve to protocols to screen for delayed leaf remove large particles including gravels senescence at seedling stage in cowpeas and plant roots. The sieved soil was mixed has been studied recently (Mai-Kodomi thoroughly at a ratio of 3:1 using a shovel et al., 1999; Muchero et al., 2008). Plants to ensure uniformity of soil mixture. The 85 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 mixed soil was put into the wooden boxes between the row plots in each box without by leaving 2 cm at the top to allow damaging the seedling roots. The soil irrigation of cowpea seedlings. The size samples was labelled and their fresh of the wooden boxes were 100 cm length, weights were recorded immediately from 50 cm breadth and 10 cm depth using 1.5 the last day irrigation (day of drought – 2.0 cm thick planks. The bottom of the imposition). The soil samples were oven- boxes were perforated to enable excess dried at 70 °C for 2 days their dry weights water drain out of the boxes. The boxes were then recorded. This measurement were kept on raised platforms in a screen was repeated every 5 days to calculate the house. Boxes were irrigated to field soil temporal moisture content. capacity and allowed to stand for 24 The following plant parameters hours. In each box, 10 straight and were captured every 3 days from drought parallel rows of approximately 10 cm initiation (14 DAS) to re-irrigation to apart were drawn along the boxes width evaluate cowpea plants recovery for eight and 8 shallow holes equidistant of periods. approximately 5 cm on each of the 10 Plant Number = Number of plants parallel rows were made. Cowpea seeds (seedlings) alive per plot (0 to 4) were scarified using sandpaper and pretreated well with a fungicide to Trifoliate Number = Number of trifoliate prevent soil-borne disease that can affect per plant (0 to 5 or more if any). the germination and seedlings growth. Two healthy seeds were sown per hole Plant Height = Plant height from the soil and thinned to one seed per hole a week level to the youngest trifoliate insertion after seedling emergence. On each row, point on main branch or stem (cm) . two entries (accessions) were planted, each one with 4 hills equidistant of Leaf Senescence Score = Visual score of approximately 5 cm, making a total of leaf senescence due to water deficit stress twenty (20) entries per box so eighty (80) = (1 to 5) with 1: Green and fresh leaves; individual plants per box. The experiment 2: Green and slightly wilted leaves; 3: laid in a completely randomized block Green-yellow and moderately wilted design with three replications. After leaves; Yellow-green and severely wilted planting, the boxes were slightly irrigated leaves to 5: Yellow to brown leaves. twice every day (morning and evening time) until full germination and seedlings Recovery = Number of plants recovered emergence. (with development of new leaves) after re- Irrigation was withheld at watering. approximately 14 days after planting Analysis of variance (ANOVA) when majority of seedlings have at least was carried out for the data collected in the one trifoliate. Daily air temperature and screen house. Generalized Linear Model relative humidity of the experimental Procedure (PROC GLM) of Statistical environment throughout the trial period Analysis System (SAS, 1990) package was recorded using a sensor. Soil samples was collected was used. Data were log transformed to randomly at 0-4 cm and 4-8 cm depth ensure conformity to normality and using a small auger in 5 different points subjected to ANOVA. However, since

86 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Analysis of variance for number of plant recovered (recovery) and other secondary traits of cowpea wild relative accessions evaluated in NACGRAB,Moor Plantation Ibadan

Source of Variation DF Recovery LSS5 PH5 PN5 TN5 Replication 2 2.46** 14.07*** 1296.23*** 16.28*** 3.08*** Lines 161 2.46*** 0.79*** 200.08*** 0.86ns 0.20*** Error 320 0.58 0.42 36.43 0.75 0.12 Total 482 1.17 0.60 96.24 0.85 0.16 CV 30.31 17.76 20.42 25.38 16.74 R2 0.66 0.54 0.75 0.41 0.49 Mean 2.52 3.64 29.56 3.42 2.09

Table 2: Mean performance of the cowpea wild relative accessions for number of plants recovered (Recovery), percentage recovered (%Recovery) and secondary traits of top ten drought tolerant and ten least tolerant F3 lines obtained from IITA

L ine Recovery %Recovery LSS5 PH5 PN5 T N5 Top 10 ITK07K-290-10xTVUN42 0 4.00 100.00 3.50 31.00 - 2.38 KVx309-6GxTVNu13 6 4.00 100.00 4.00 34.25 3.67 2 .33

KVx309-6GxTVNu695 4.00 100.00 3.00 32.46 2.33 1.92

T TILIGRExTVNu9 79 N 4.00 100.00 4.00 34.25 3.00 1 .83 IT07k-318-33xTVNU420 A 3.86 96.61 - 36.38 3.33 - R IT07K-290-10xTVNu257 E 3.67 91.67 3.67 54.46 4.00 3.00 L

NAFIxTVNu1771 O 3.67 91.67 4.50 35.19 4.00 2.75 IT97K-499-35x TVNu420 T 3.00 75.00 4.33 41.79 3.33 2 .58 IT97K-499-35xTVNu69 5 3.00 75.00 4.00 35.84 4.00 2 .25 IT99K-573-1-1xTVNu4 14 3.00 75.00 3.50 25.25 1.67 2 .50 Bottom 10 IT07K-3 18-33xTVNu257 1.00 2 5.00 4. 00 38 .60 2.3 3 1.83 IT07K-318-33xTVNu41 4 1.00 25.00 4.00 32.94 3.00 2 .63

IT9*K-499-35xTVNu136 E 1.00 25.00 5.00 36.17 3.00 2.31

L

IT90K-372-1-2xTVNu 414 B 1.00 25.00 4.67 31.38 4.00 2.06 I

IT97K-499-35xTVNu403 T 1.00 25.00 4.33 42.08 4.00 1.75

P

IT99K-573-1-1xTVNu136 E 1.00 25.00 4.50 38.38 3.33 2.17

C

IT99K-573-1-1xTVNu701 S 1.00 25.00 4.50 34.29 3.33 2.00

U

KVx309-6GxTVNu257 S 1.00 25.00 5.00 32.19 3.00 1.88 NAFIxTVNu428 1.00 25.00 4.00 41.63 4.00 1 .92 TILIGRExTVNu257 1.00 25.00 4.33 33.78 3.67 2 .00 Mean 2.52 63.00 3.64 32.91 3.42 2 .09 LSD (0.05) 1.33 1.33 1.04 1.46 0 .70

87

Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

ANOVA did not detect any significant drought stress. Responses to drought- difference between transformed and stress seen were basically linked to the untransformed values, untransformed ability of the cowpea plants to tolerate and values were presented for plant height, recover from seedling stage drought plant number and trifoliate number while stress. transformed values were presented for other parameters. Leaf senescence in this study was a result of wilting due to drought stress Results and the rate of leaf senescence increases There were significant differences (P < as the intensity of drought increased. 0.01 and 0.001) in the 162 cowpea wild Some researchers (Muchero at al., 2008; relative lines evaluated (Table 1) for Ajayi et al., 2018) have reported wilting at number of plants recovered (recovery), the early week of drought imposition and leaf senescence score (LSS5), plant height a progressive increase as drought stress (PH5) and trifoliate number (TN5). No intensifies. many of the lines used in this significant difference was observed in the study had there leaf senesced to a great lines for plant number (Pn5). extent The tolerant lines were able to develop new leaves at the resumption of Lines were classified into two distinct irrigation which is a sign of recovery. classes: tolerant or susceptible (Tables 2 The percentage of number of and 3). Amidst the F3 lines obtained from plants recovered was a good trait used to IITA, top ten classified as tolerant to discriminate lines for their ability to seedling stage drought based on the withstand drought at the seedling stage. average percentage recovery are listed in Variation within the line screened, Table 2 and the bottom ten with only one corroborates the report of Watanabe at al., plant recovered out of four were classified as susceptible (bottom ten, Table 2). Also (1997), that in cowpea it is normal to have presented in Table 3 are the mean extensive variation in response to drought performance of top 10 most tolerant lines stress even under controlled environment. and bottom ten susceptible lines obtained According to Mwale et al., (2017), from National Centre for Genetic recovery after stress is a process relating R e s o u r c e s a n d B i o t e c h n o l o g y to the reorganization of several metabolic (NACGRAB) genebank. pathways to repair damages induced by drought and to resume plant growth. Discussion In our study, there was significant Genetic variability is vital for the setting variation for the number of plants up of breeding program in crops. Our recovered among lines which was also in results confirmed that cowpea wild agreement with the results of Mwale et al., relative exhibits significant genetic (2017) and Anyia & Herzog (2004). variation in response to seedling stage According to Mwale et al 2017, under

88 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 3: Table 2: Mean performance of the cowpea wild relative accessions for number of plants recovered (Recovery), percentage recovered (%Recovery) and secondary traits of top ten drought tolerant and ten least tolerant F3 lines obtained from NACGRAB

Line Recovery %Recovery LSS5 PH 5 PN 5 TN 5 Top 10

NGB001027 4.00 100.00 4.00 29.13 3.00 2.00 NGB001032 4.00 100.00 4.00 2 8.26 3.6 7 1.7 8 NGB001071 4.00 100.00 3.00 2 8.43 2.6 7 1.6 7 T NGB001078 4.00 100.00 3.00 2 5.49 3.6 7 1.8 9 N

NGB001095 A 4.00 100.00 4.00 2 3.19 4.0 0 2.0 0 R

NGB001145 E 4.00 100.00 4.00 1 6.55 4.0 0 2.0 0 L

NGB001160 O 4.00 100.00 4.00 2 0.38 3.0 0 2.0 0 T NGB00991 4.00 100.00 3.33 2 2.68 3.0 0 2.0 0 NGT00199 4.00 100.00 3.50 1 2.22 2.6 7 1.6 7 NGT00200 4.00 100.00 3.00 1 6.25 2.6 7 1.5 0 Bottom 10 NGB001127 1.6 7 41.6 7 3.67 18.97 3.00 1.81 NGB001128 1.67 41.67 3.33 18.00 2.33 2.00

NGB001143 E 1.67 41.67 2.67 34.50 3.00 1.92

L

NGB001157 B 1.67 41.67 3.67 20.62 3.67 1.80

I NGB00993 T 1.67 41.67 4.00 20.30 3.33 2.08 P

NGB001146 E 1.33 33.33 3.67 3 1.90 3.0 0 1.6 7 C

NGB001020 S 1.00 25.00 4.33 3 1.86 4.0 0 2.0 0 U

NGB001066 S 1.00 25.00 3.00 2 2.39 2.3 3 2.3 3 NGB001123 1.00 25.00 4.00 2 9.52 3.0 0 2.0 0 NGB001172 1.00 25.00 3.00 1 6.03 3.0 0 1.5 8 Mean 2.52 63.00 3.64 3 2.91 3.4 2 2.0 9 LSD (0,05) 1.33 1.33 1.04 - 1.4 6 0.7 0

89 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 drought stress conditions, genotypes that Ajayi, A. T., Olumekun, V. O and possesses high chlorophyll tends to Gbadamosi A. E., (2018) Estimates of Genetic Variation among Drought exhibit a superior capacity to recover Tolerant Traits of Cowpea at from stress. Seedling Stage. International journal In this research, negative of plant research, 7(2): 48-57. correlation was observed between leaf Anyia, A.O. and Herzog, H. (2004) senescence score (LSS5) and recovery. Genotypic Variability in Drought This corroborates the result obtained by Performance and Recovery in Ajayi et al., (2017) in which wilting parameters were seen to be highly and C o w p e a u n d e r C o n t r o l l e d negatively correlated with recovery Environment. Journal of Agronomy parameters. Thus suggesting the and Crop Science, 190, 151-159. difficulty of most susceptible cowpea Badu A. B., Oyekunle, M., Akinwale, R. seedlings recovering. Although high leaf O., Lum, A. F. (2011). Combining senescence score was also observed in ability of early-maturing white maize most of the lines selected to be tolerant to inbreds under stress and nonstress seedling stage drought. However, these environments. Agronomy Journal, lines were able to maintain stem 103: 544-557 greenness throughout the period of Borrell, A. K., Hammer, G. L., & drought making it possible for such lines Douglas, A. C. (2000). Does to recover at the termination of drought. maintaining green leaf area in This was also in line with the results sorghum improve yield under obtained by Ajayi et al., 2017 and the drought? I. Leaf growth and conclusion made of Muchero et al., senescence. Crop Science, 40(4): (2008) that the maintainance of stem 1026-1037. greenness is an important trait in Ehlers JD, Hall AE (1997) Cowpea screening for drought tolerance in cowpea. (Vigna unguiculata L. Walp.). Field In this study, lines screened Crops Research 53:187–204. reacted differently to seedling stage water stress indicating the existence of genetic Ehlers, J. D., Roberts, P. A., Close, T. J., variability for drought tolerance amongst Visser, R. G. F. & van der Linden, C. the screened germplasm. This therefore G. (2010). Identification of markers indicates that improvement can be associated with bacterial blight attained using such germplasm. resistance loci in cowpea [Vigna unguiculata (L.) Walp.]. Euphytica, References 175: 215-226. Ajayi A. T., A. E. Gbadamosi, V. O. Ewansiha, S.U. & Singh, B.B. (2006) Olumekun (2018) Screening for Relative drought tolerance of Drought Tolerance in Cowpea (Vigna important herbaceous legumes and unguiculata L. Walp) at Seedling cereals in the moist and semi-arid Stage under Screen House Condition. regions of West Africa. Journal of International Journal of BioSciences Food, Agriculture and Environment, and Technology 11, Issue (1), 4: 188–190 P. 1 – 19.

90 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Fatokun, C. A., Boukar, O., & Muranaka, tolerance in cowpea (Vigna S. (2012). Evaluation of cowpea unguiculata (L.) Walp). Theoretical (Vigna unguiculata (L.) Walp.) and Applied Genetics, 120: 509 – 518. germplasm lines for tolerance to Muchero, W., Roberts, P.A., Diop, N.N., drought. Plant Genetic Resources, Drabo, I., Cisse, N., Close, T.J., 10(3): 171 – 176. Muranaka, S., Boukar, O. & Ehlers, Hall, A.E., Cisse, N., Thiaw, S., Elawad, J.D. (2013). Genetic architecture of H.O.A., Ehlers, J.D., Ismail, A., Fery, delayed senescence, biomass and R., Roberts, P., Kitch, L.W., grain yield under drought stress in Murdock, L.L., Boukar, O., Phillips, cowpea. PloS one, 8(7): 1-10 R.D., & McWatters, K.H. (2003). Rawson, H. M. & Turner, N. C. (1982). Hamidou, F., Zombre, G. & Braconnier, Recovery from water stress in five S. (2007). Physiological and sunflower (Helianthus annus L.) biochemical response of cowpea cultivars. I. Effect of timing of water genotypes to water stress under application on leaf area and seed glasshouse and field condition, production. Australia Journal of Journal of Agronomic Crop Science, Plant Physiology, 9: 437-448 193: 229-239. Sanda, A. R., & Maina, I. M. (2013). Hsaio, T. C. (1973). Plant responses to Effect of drought on the yields of water stress. Annual Review of Plant different cowpea cultivars and their Physiolology, 24: 519-570. response to time of planting in Kano Kararnanos, A, S. (1980). Water stress State, Nigeria. International Journal and leaf growth of field beans (Vicia of Environment and Bioenergy, 6(3): faba) in the field: leaf number and 171-176 total area. Annals of Botany, 32: 1393 Singh, B.B., Mai-Kodomi, Y. & Terao, T. – 1402 (1999a). A simple screening method Mai-Kodomi, Y., Singh, B.B., Myers, O., for drought tolerance in cowpea. Yopp, J.H., Gibson, P.J. & Terao, T. Indian Journal of Genetics, 59: 211- (1999). Two mechanisms of drought 220. tolerance in cowpea. Indian Journal Singh, B.B., Mai-Kodomi, Y. & Terao, T. of Genetics, 59(3): 309-316. (1999b). Relative drought tolerance of major rainfed crops of semi-arid Mir, R. R., Zaman-Allah, M., tropic. Indian Journal of Genetics, Sreenivasulvu,N., Trethowan, R. & 59(4): 437-477. Varshney, R.K. (2012) Singh B. B., Matsui T. (2002). “Cowpea Muchero W., Ehlers J. D., Roberts P. A. varieties for drought tolerance,” in (2008). Seedling stage drought- Challenges and Opportunities for induced phenotypes and drought- Enhancing Sustainable Cowpea responsive genes in diverse cowpea Production, eds Fatokun C. A., g e n o t y p e s . C ro p S c i . 4 8 , Tarawali S. A., Singh B. B., Kormawa 541–55210.2135/cropsci2007.07.03 P. M., Tamò M., editors. (Ibadan: 97 IITA; ), 287–300 Muchero, W., Ehlers, J. D. & Roberts, P. Singh, B.B., Ajeigbe, H.A., Tarawali, A. (2010). Restriction site S.A., Fernandez-Rivera, S., & polymorphism – based candidate Abubakar, M. (2003). Improving the gene mapping for seedling drought production and utilization of cowpea

91 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

as food and fodder. Field Crops Stress in Uganda. American Journal Research, 84:169- 177 of Plant Sciences, 8, 720-733. Mwale, S.E., Ochwo-Semakula, M., Watanabe, S., S. Hakoyama, T. Terao, and Sadik, K., Achola, E., Okul, V., B.B. Singh. (1997). Evaluation Gibson, P., Edema, R., Singini, W. methods for drought tolerance of and Rubaihayo, P. (2017) Response cowpea. p. 87–97. In B.B. Singh et al. of Cowpea Genotypes to Drought (ed.) Advances in cowpea research. IITA, Ibadan, Nigeria.

92 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Genetic Estimates and Phenotypic Diversity of some African yam bean (Sphenostylis stenocarpa (Hochst ex. A. Rich) Harms) accessions

Adewale*, B. Daniel and Asonibare, I. Blessing Department of Crop Science and Horticulture, Federal University Oye-Ekiti, Ikole-Ekiti Campus, Ekiti state, Nigeria *Corresponding Author:[email protected], +234 803 9228 085

Abstract An experiment was carried out to investigate genetic estimates and phenotypic diversity of fourteen African yam bean (AYB) accessions at the Teaching and Research farm of Federal University Oye-Ekiti (FUOYE), Ikole-Ekiti Campus, Ekiti state, Nigeria. The 14 AYB genetic resources included: eight accessions from Genetic Resources Centre, International Institute of Tropical Agriculture (IITA), Ibadan, Nigeria, six landraces from farmers and two F1 hybrids from a breeding programme at FUOYE. The field experiment was laid out in a randomized complete block design (RCBD) with three replications. Data were collected on morphological and agronomic traits. Data for each trait was subjected to analysis of variance (ANOVA). Moreover, from the components of the ANOVA, the phenotypic and genotypic coefficient of variation (PCV and GCV) and broad sense heritability were estimated. Significant (P= 0.05) variation existed among the 14 accessions for most of the morpho-agronomic traits. The 14accessions were grouped into three clusters based on their similarities for ten most significant (P=0.05) discriminatory phenotypic traits. The six accessions in cluster I had the highest seed weight per plant and per plot. The only accession in cluster II had longest hypocotyl length, leave numbers and the highest grain yield per hectare. The seven accessions in Cluster III were prominent for the longest seed length. The observed variations among the 14 accessions for the morpho-agronomic traits seem to depict unique inherent genetic potential within the tested population. The uniqueness of DSs6 (a landrace) seem to reveal that useful germplasm of African yam bean are still locking in farmers' hands. The observed intraspecific variation in this study could provide basis for selection and improvement of the crop for yield and yield related parameters.

Keywords: accessions, agronomic traits, diversity, genetic estimates, similarities

Introduction West Africa. While the pulse is more African yam bean, a Fabaceae of the common in use compare to the tubers genus Sphenostylis has protein content especially in West Africa, the utility of the that is higher than what could be obtained tubers as a meal was only reported in in: cowpea, soybean, Bambara groundnut Central Africa (Potter, 1992). and other pulses (Uguru and Madukaife, The domestication, cultivation, 2001).The plant is an obligate climber and distribution of African yam bean which produces small underground (AYB) is very evident in the tropics of tubers of various sizes and shapes Africa (Okigbo, 1973; Potter, 1992), (Adewale and Dumet, 2011). The white where it had been reported to exhibit very fleshed and watery tubers (Kay, 1987) are high diversity. AYB tolerates wide very similar to the tubers of sweet geographical, climatic and edaphic potatoes (Ipomea batatas).The pulse are ecologies. The stretch of the environment exceptionally nutritious pulse (Rachie, where it thrives lie within the latitudes of 1973), mostly valued as a relish among 15º North to 15º south and the longitudes the elderly, rural and farming populace in of 15º West to 40º East of Africa (Adewale

93 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 et al., 2008). There is no record of the turn brown when matured. Pods may have origin and diversity of the crop in any flat or raised margin on both side. Most other continent except Africa (Potter and dried pods do dehisce along the dorsal and Doyle, 1992; 1994). the ventral suture causing shattering and It is noteworthy that African yam loss of seeds; but Adewale (2011) bean (Sphenostylis stenocarpa (Hochst. observed variation in the shattering Ex. A. Rich) Harms) is grossly tendencies of AYB. Each pod can yield up underutilized. Research update on the to twenty seeds which may be rounded, genetic resources status of the crop is not oval, oblong or truncated (Milne-Redhead available, but speculations abound (Klu et and Polhill, 1971; Adewale et al., al., 2001; Adewale and Odoh, 2013) that 2012).The mat or shiny seeds can be the germplasm currently being hosted in mono-colored or mosaic, but the the various centers of the crop's diversity prominent basal colours in AYB includes: (i.e. West and Central Africa) would have white, grey, cream, light or dark brown, being dwindling owing to the level of the purple and black. neglect of the crop in the culture and the Some landraces of AYB were meals of the Africans. Furthermore, the obtained directly from farmers at Owo, knowledge about the crop (nutrition, Ondo state, Nigeria. The phenotypic medicinal values etc.) has being in the assessment of these new collections, two custody of the few aged farmers in the F1 from a breeding programme at the remote communities. Access to the Federal University Oye-Ekiti, and some cultural values of this crop is germplasm from the Genetic Resources unfortunately disappearing; the identified Centre, International Institute of Tropical inherent limitations in AYB have also Agriculture (IITA), Ibadan, Nigeria was made its preference (compared with other the interest of this study; with the aim of food legumes) very low among the young understanding their morpho-agronomic farmers and consumers. potentials. Phenotypic responses of Many phenotypic and genomic genotypes to the same environment do assessments of AYB have unraveled great vary and that provides a measure for their and exploitable genetic potentials within potential.The present study therefore seek the species. The vigorously clockwise- to understand the differences among the climbing herbaceous vine plant may or fourteen accessions and reveal their may not be pigmented; significant individual potential for selection and variations equally exist on pigmentation further breeding. intensity (Adewale et al., 2012). The vegetative growing stage is noted with Materials and Methods profound production of trifoliate leaves, A field experiment was carried out at the whose terminal leaflet length and width Teaching and Research Farm, Faculty of displays wide quantitative metric range Agriculture, Federal University, Oye- (Milne-Redhead and Polhill, 1971; Ekiti, Ikole-Ekiti Campus (Longitude 70 Adewale and Dumet, 2011). The brightly 471N and Latitude 50311E), Ekiti state, coloured purple flowers which are held by Nigeria. The site was ploughed and peduncles seem to exhibit self- harrowed before flat beds were made with pollination. A peduncle can hold up to hoes. The land was partitioned into 3 three or more pods to maturity. The blocks with each containing 14 beds/plots. usually linear and long unicarpel pods Inter-block distance of 1m was

94 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 maintained. The fourteen treatments were variability (PCV) and broad sense allotted randomly into the fourteen plots heritability (h2b) were generated of each block, hence the experimental following the adapted formulas from design was Randomized Complete Block Singh and Chaudhary, (1985) as follows: Design (RCBD). Two seeds were planted per hole at a spacing of 1 meter by 1metre PCV = Vp x 100...... Eq.1 apart. The seeds were dipped into Apron X plus solution with active ingredients GCV = Vg x 100...... Eq.2 (20% w/w Thiamethoxam, 20% w/w X sg metalaxyl-M, 2% w/w difenoconazole) Hb = x 100%...... Eq.3 sp before planting. A total of ten stands were established per plot. The crop management practices carried out on this Where: Vg = [Mean Square Genotype – study included: weeding with hoes, Mean Square Error/r], Vp = [Mean Square individual staking of the plants per hill, Genotype/r], Ve = [Mean Square Error/r], stem training during the vegetative phase r is the number of replications, X = the of crop development and application of mean, sg = Genotypic variance, sp = an insectide, kombat (a.i. Lambda Phenotypic variance. Cyhalothrin (2.5g/L)) at the floral phase to control the flower and pod pests. Results Agronomic characteristics were Significant (P= 0.05) variation existed measured following the developed among the 14 AYB germplasm for sixteen descriptor for African yam bean by out of the twenty-one phenotypic Adewale and Dumet (2011). variables (Table 2). This informs that, D a t a c o l l e c t e d f o r a l l number of leaves 6 weeks after planting, morphological and agronomic characters days to 50% flowering, seeds per pod, were summarized. The mean values per seed weight per pod and shelling plot were calculated and subjected to percentage could not distinguish the Analysis of Variance (ANOVA) using the fourteen genotypes. The mean and General Linear Model (PROC GLM) in coefficient of variation of the 14 SAS (version 9.4). Mean of the treatment genotypes for the 21 variables also were separated using Honestly appeared in Table 2. The coefficient of Significant Difference Test (HSD) of variations of the 21 variables ranged Tukey in SAS. For Gower genetic between 2.1 (seed weight per plant) and distance, Principal component and 44.48 (pod weight per pod). Only four clustering analysis, means were variables (pod weight per plot, seed generated across the three replications for weight per plot, seed weight per plant and each accession for all the quantitative grain yield per hectare) have coefficient of traits. The accession by trait matrix was variation higher than 20%. submitted to SAS, leading to the The mean square for the generation of: Gower genetic distance in phenotypic, genotypic and error was pairs for the 14 accessions, eigenvalues presented in Table 3. The phenotypic eigenvectors and the dendrogram. From variance was higher than genotypic and the ANOVA components estimates of error variance values for the 21 variables. genotypic coefficient of variability Moreover, within Table 3, the genotypic (GCV), phenotypic coefficient of coefficient of variation was lower than the

95 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: List and sources of the fourteen African yam bean genotypes used in the study

S/N Accessions/Landraces/Genotypes SOURCE 1 TSs 1 Genetic Resources Centre, IITA, Ibadan 2 TSs 11 Genetic Resources Centre, IITA, Ibadan 3 TSs 33 Genetic Resources Centre, IITA, Ibadan 4 TSs 69 Genetic Resources Centre, IITA, Ibadan 5 TSs 116 Genetic Resources Centre, IITA, Ibadan 6 TSs 111 Genetic Resources Centre, IITA, Ibadan 7 TSs 11×1 F1 from AYB breeding programme at FUOYE 8 TSs 69×11 F1 from AYB breeding programme at FUOYE 9 DSs 1 Owo, Ondo state 10 DSs 2 Owo, Ondo state 11 DSs 3 Owo, Ondo state 12 DSs 4 Owo, Ondo state 13 DSs 5 Owo, Ondo state 14 DSs 6 Owo, Ondo state FUOYE – Federal University Oye-Ekiti

Table 2: Variance and Descriptive characteristics of the twenty-one phenotypic variables Mean Squares Mean CV (%) Genotypes Rep Error

Degrees of Freedom Variables 13 2 26 - - HYPL 91.71*** 4.31 4.76 23.41 9.32 NOL4 37.46*** 23.01*** 0.82 5.69 15.93 NOL6 13.97 7.89 6.98 17.66 14.96 NOL8 181.89** 104.55 53.02 36.46 19.97 TLL 2.45* 0.28 1.08 10.89 9.54 TLW 1.72*** 0.12 0.2 4.72 9.57 DFF50 11.59 66.26** 11.22 86.4 3.88 PL 0.99** 1.42* 0.3 5.32 10.31 PPP 1.22** 0.29 0.41 3.18 20.09 NOPP 605.25*** 6.52 31.06 37.03 15.05 PWPP 1429006.01*** 190385.23 265430.42 363.13 44.84 PdLNT 3.68* 2.53 1.40 22.34 5.30 PW 2.04*** 0.43 0.49 4.19 16.79 SDPP 4.48 5.73 2.28 15.61 9.69 WSPP 0.31 1.57* 0.47 3.26 20.97 SWPP 3986.03*** 155.29 221.46 77.05 19.31 SL 0.86*** 0.12 0.07 7.91 3.24 SW 0.11*** 0.05 0.02 6.53 2.1 SWPPT 4569351.83*** 478466.67 771382.05 2198.81 39.94 SHLP 130.77 313.49* 86.05 61.06 15.19 Yldkg/ha 679365.27*** 233831.46 78978.29 1074.47 26.16 †DF= degree of freedom, CV=coefficient of variation, HYPL= Hypocotyl length, NOL= Number of leaves at 4, 6 and 8weeks, TLL= terminal leaf length, TLW= terminal leaf width, DFF50= Days to 50%flowering, PL= petiole length, PPP= pods per peduncle, NOPP= no of pods per plant, PWPP= pod weight per plot, PdLNT= pod length, PW= pod weight per plant, SL= seed length, SW= seed width, SHLP= shelling percentage, SDPP=Number of Seeds per pod, WSPP= Weight of seeds per pod, SWPP= Seed weight per plot SWPPT= seed weight per plant, Yldkg/ha= yield per hectare based on kilogram rate. †*, **, *** - Significance of the probability levels at P = 0.05, 0.01 and 0.001 respectively

96 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 3: Derived genetic estimates for the twenty-one variables from the components of the ANOVA

ANOVA components Genetic Estimates Genetic Genotypic Phenotypic Error Broad sense Estimates variance variance Variance PCV GCV Heritability HYPL(cm) 91.71 96.47 1.59 41.95 40.91 0.98 NOL4 37.46 37.74 0.27 108.00 107.62 0.98 NOL6 13.97 20.95 2.33 25.92 21.17 0.86 NOL8 181.89 234.91 181.89 42.04 36.99 0.91 TLL(cm) 2.45 3.53 0.36 17.25 14.78 0.87 TLW(cm) 1.72 1.92 0.07 29.40 27.80 0.96 HYPL(cm) 91.71 96.47 1.59 41.95 40.91 0.98 NOL4 37.46 37.74 0.27 108.00 107.62 0.98 NOL6 13.97 20.95 2.33 25.92 21.17 0.86 NOL8 181.89 234.91 181.89 42.04 36.99 0.91 TLL(cm) 2.45 3.53 0.36 17.25 14.78 0.87 TLW(cm) 1.72 1.92 0.07 29.40 27.80 0.96 SDPP 13.57 6.77 0.76 16.67 13.57 0.85 WSPP 17.15 0.78 0.16 27.08 17.15 0.67 SWPP 81.94 4207.46 73.82 84.19 81.94 0.98 SL 11.73 0.93 0.02 12.17 11.72 0.98 SW 5.07 0.129 0.01 5.49 5.07 0.95 SWPPT 4569352 5340734 257127.4 105.10 97.22 0.95 SHLP 18.73 216.82 28.68 24.12 18.73 0.82 Yld/ha 63572.71 776343 26326 82.00 76.71 0.96 †HYPL= Hypocotyl length, NOL= Number of leaves at 4, 6 and 8weeks, TLL= terminal leaf length, TLW= terminal leaf width, DFF50= Days to flowering at 50%, PL= petiole length, PPP= pods per peduncle, NOPP= no of pods per plant, PWPP= pod weight per plot, PdLNT= pod length, PW= pod weight per plant, SL= seed length, SW= seed width, SHLP= shelling percentage, SDPP=Number of Seeds per plot, WSPP= Weight of seeds per pod, SWPP= Seed weight per plot, SWPPT= seed weight per plant, Yldkg/ha= yield per hectare based on kilogram rate.

Table 4: Trait selection by step disc Analysis Steps Traits selected in sequence F Value Probability Partial R-Square

1 NOPP 20.65 <.0001 0.9056 2 SWPP 19.77 <.0001 0.9049

3 HYPL 18.41 <.0001 0.9020

4 NOL4 10.79 <.0001 0.8487 5 SL 8.28 <.0001 0.8177

6 NOL8 5.10 0.0003 0.7423

7 SW 5.77 0.0002 0.7732 8 YldKg_ha 2.58 0.0258 0.6151

9 TLW 4.13 0.0023 0.7284

10 SWPPT 2.77 0.0215 0.6547 †NOPP = Number of pods per plant, HYPL= Hypocotyl length, SWPP= Seed weight per pod, NOL4 = Number of leaves at 4weeks, NOL8 = Number of leaves at 8weeks, SL= seed length, SW= seed width, TLW= terminal leaf width, SWPPT= seed weight per plant,Yldkg/ha= yield per hectare based on kilogram rate.

97 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 5: Eigenvalues, proportion of variance and the eigenvectors of ten phenotypic traits in firstfive principal component axes

Principal Component Principal Components Properties PC1 PC2 PC3 PC4 PC5 Eigenvalues 3.25 2.28 1.32 1.18 0.88 Proportion (%) 32.55 22.84 13.23 11.84 8.79 Cumulative (%) 32.55 55.39 68.62 80.46 89.26 Variables Eigenvectors HYPL 0.359 0.126 0.236 0.533 0.019 NOL4 0.209 0.525 -0.244 0.226 0.035 NOL8 0.014 0.174 -0.745 0.204 0.263 TLW -0.008 0.61 0.118 -0.117 0.038 NOPP 0.329 0.153 0.051 -0.646 0.246 SWPP 0.27 -0.394 -0.18 -0.064 0.523 SL -0.422 0.252 0.269 0.032 0.130 SW -0.277 0.047 0.305 0.173 0.758 SWPPT 0.436 -0.151 0.284 0.333 0.004 Yld(Kg/ha) 0.448 0.198 0.187 -0.215 0.052 †PC = Principal components, HYPL= Hypocotyl length, NOL4 = Number of leaves at 4 weeks, NOL8 = Number of leaves at 8weeks, TLW= terminal leaf width, NOPP= no of pods per plant, SWPP= Seed weight per plot, SL= seed length, SW = seed width, SWPPT = seed weight per plant, Yldkg/ha= yield per hectare based on kilogram rate. phenotypic coefficient of variation for the proportion was much above 10%, such 21 variables. The broad sense heritability that the total variance from them was ranged from 0.67 to 0.98 (Table 3). 81%. Each of the ten variables had very Among the 21 variables presented for strong (eigenvector > 0.20) contribution significant discriminatory testing, only to the variance in the first three PC axes. 10 were found most suitable for the Seed length and width whose eigenvector characterization assessment of the were negative in PC axis 1 had strong and fourteen African yam bean accessions by positive contribution to the variance in PC the STEP DISC trait selection procedure axes 2 and 3. Table 6 showed the in SAS. They are presented in Table 4. similarity coefficients of each pair of Among the 10, the most significant genotypes. The most similar (similarity variable was number of pods per plant coefficient = 0.88) genotypes were TSs11 with F-value and partial R-square value and TSs33 and TSs11 and DSs5 (Table 6). of 20.65 and 0.9056 respectively (Table Similarity between the two F hybrids was 4). Seed weight per plant had the least 1 probability (0.0215) for discriminatory 0.81. Genotypes with the least similarity significance (Table 4). (0.43) were TSs69 and DSs6. Among the From Table 5, result of the first landraces, DSs2 and DSs3 were most five principal components was presented. similar (0.82), DSs3 and DSs4, then DSs2 The eigenvalues of the first four PC axes and DSs6 had the least similarity of 0.51 were above 1.0 and their variance (Table 6). Generally among the fourteen

98 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Figure 1: A WARD dendogram showing the grouping of the fourteen AYB genotypes

Table 6: Similarities among the 14 accessions as revealed by Gower genetic distance

Genotypes DSs1 DSs2 DSs3 DSs4 DSs5 DSs6 TSs1 TSs11 TSs11x1 TSs111 TSs116 TSs33 TSs69 DSs2 0.75 DSs3 0.77 0.82 DSs4 0.58 0.60 0.51 DSs5 0.76 0.67 0.59 0.66 DSs6 0.58 0.51 0.54 0.61 0.52 TSs1 0.71 0.72 0.66 0.68 0.74 0.65 TSs11 0.74 0.65 0.55 0.65 0.88 0.58 0.77 TSs11x1 0.77 0.76 0.64 0.78 0.81 0.62 0.75 0.82 TSs111 0.66 0.73 0.72 0.59 0.63 0.58 0.68 0.68 0.74 TSs116 0.66 0.77 0.66 0.66 0.62 0.55 0.77 0.65 0.72 0.75 TSs33 0.64 0.57 0.50 0.67 0.81 0.55 0.69 0.88 0.76 0.66 0.59 TSs69 0.66 0.64 0.54 0.61 0.80 0.43 0.71 0.83 0.73 0.64 0.64 0.85 TSs69x11 0.69 0.65 0.59 0.70 0.79 0.51 0.67 0.82 0.81 0.70 0.63 0.87 0.86 accessions, the mean similarity was 0.71 seed length. DSs6, the only genotype in and mean dissimilarity was 0.29. cluster II was prominent with the highest Clustering method (Figure 1) values for: hypocotyl length, number of assembled genotypes into groups based leaves at the 4th and the 8th weeks, terminal on their similarities (i.e. low genetic leave width, number of pods per plant and distances). Three clusters meaningfully grain yield per hectare. described the clustering of the 14 accessions. Cluster I had six genotypes as Discussion members. Only one genotype (DSs 6) The identified significant variation among featured in Cluster II. Cluster III had the the fourteen genotypes for the various highest membership of seven AYB vegetative, floral, pod, yield and yield genotypes (Fig. 1). The genotypes within component observed in the present study cluster I were prominent for highest seed signifies that the studied genotypes have weight per pod and per plant while unique genetic identity. Adewale et al. genotypes in cluster III had the longest (2012) made similar report among 79 99 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

African yam bean genotypes. Variation classification of genotypes without among genotypes for different phenotypic initial selection (based on their traits provides a justification platform for discriminatory potentials) may lead to selection of traits and genotype the employment of redundant traits population for subsequent breeding whose effect could mask reliable program (Adebo et al., 2016). The classification, thus leading to misleading continuous increase in size and number of conclusion. the measured vegetative traits from four to The employment of selected eight weeks after planting shows changes significant traits enhanced the clustering in growth indices characteristics which pattern of the fourteen genotypes indicate the presence of ontogenetic drift. involved in this study. The methods This is because vascular plants increases assembled the genotypes into groups in both size and complexity during based on high similarities (low distances) vegetative growth and reproductive among the genotypes. DSs6 distinguished development. The moderately low itself among others, and had the longest coefficient of variation observed for most hypocotyl length, number of leaves, of the traits makes the present result very highest grain yield, etc. The highly reliable for trait-based genotype selection vigorous vegetation property of the for breeding as it is obvious that the landrace may have contributed to its high reliability of a trait to be selected for yield per hectare. The genotype may have breeding programme among other factors efficient assimilate partitioning property is dependent on the magnitude of its as implicated in a study by Adewale et al. coefficient of variation. Seed-related (2012). There is poor awareness on the traits have been reported to be very genetic potentials of landraces, the important in delimiting the generic and significant productive capacity of DSs6 taxonomic relationships of many crops seem to provide a hint on the need to (Maiti et al. 1994; Gonzalez Andres and Ortiz, 1995) including legumes further explore genetic resources of (Obiagwu, 1997). For African yam bean African yam bean from the cultural or seeds, Adewale et al. (2010) identified farm setting niches. A recent report on three metric measurements (length, Tomato (Lycopersicon esculentum) by width, and thickness) and their ratios to be Adewale and Adebo (2018) affirmed that very significant discriminatory many rich plant genetic resources are still phenotypic characteristics for African intact and untapped in many demographic yam bean seeds. Seed length and width niches. DSs 6 proved prominent in this was equally observed among the fourteen study, a further study on its stability may genotypes as important distinguishing be necessary to confirm consistence of characteristics for the fourteen genotypes performance before recommendation to and larger within populations. farmers. The selection and recommenda- Selection of ten out of the 21 tion of such accessions is a simple way to phenotypic traits presented to the generate improved genetic materials STEPDISC procedure in SAS revealed (Chheda and Fatokun, 1982). that each trait have different Within cluster I, the six genotypes discriminatory ability for a set of had the highest mean for seed weight per genotypes meant for classification. plot while genotypes in cluster III According to Adebo et al., 2016, the use exhibited the longest seed length, this of many phenotypic traits for information provides platform for 100 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 subsequent selection protocol for yield A. E., and Franco, J. (2012). and seed size improve of African yam Morphological diversity analysis of bean. Variability exist within clusters I African yam bean and prospects for and III. Selection of individual genotypes utilization in germplasm conservation from these two extreme clusters (i.e. I and and breeding. Genetic Resources and III) for a hybridization programme could Crop Evolution, 59(5), 927-936. lead to raising progenies with different Adewale, B. D., Kehinde, O. B., Odu, B. genetic constitution. Moreover, O. and Dumet, D. J. (2008). The hybridization between genotypes from potentials of African yam bean distinct clusters could be advanced for the (Sphenostylis stenocarpaHochst.ex. improvement of agronomic traits if this A. Rich) Harms in Nigeria: character represents different heterotic groups and distribution and genetic diversity. In: the gene(s) controlling the basic Smart, J. &Haq, N. (Eds.). New Crops economic traits can therefore be and Uses: Their role in a rapidly understood using segregating progenies changing world. Centre for from a cross between two genotypes from Underutilized Crops. (pp. 265-276). different clusters. Adewale, B.D. and Odoh, N.C. 2013. A review on Genetic resources, References diversity and agronomy of African Adebo G.U., Adewale B.D. and Akoroda yam bean (Sphenostylis stenocarpa M.O. (2016). American Journal of (Hochst. ex A. Rich.) Harms): A Experimental Agriculture, 12(5), 1- potential future food crop. 11 Sustainable Agriculture Research Adewale B. D. and Adebo G.U. (2018). 2:32-43 Phenotypic identity, similarity and Adewale, D. and Dumet, D. (2011). stability for selection of tomatoes Descriptors for African yam bean, (Lycopersicon esculentum L.) Sphenostylis stenocarpa (Hochst ex. cultivars in South-western Nigeria. A. Rich.) Harms (online) Scientia Horticulturae. 235: Chheda, H.R. and Fatokun, C.A. (1982) 264–269. Numerical taxonomy of variation Adewale, B.D., Okonji, C., Oyekanmi, pattern in okra (Abelmoschus A.A., Akintobi, D.A.C. and Aremu, esculentus (L.) Moench). Bot Gaz C.O. (2010) Genotypic variability 143:253–261 and stability of some grain yield Gonzalez-Andres F. and Ortiz JM (1995) components of Cowpea. African Seed morphology of Cytisopyllum, Journal of Agricultural Research 5(9): Cytisus, Chamaecytisus and Genista 874-880 (Fabaceae: Genisteae) species for Adewale, B. D. (2011). Genetic Diversity, characterization. Seed Sci Tech Stability and Reproductive Biology 23:289–300 of African yam bean, Sphenostylis Kay, D. E. (revised by Gooding, E. G. B.). stenocarpa (Hochst. ex A. Rich.) (1987). Crop and Product Digest No. 2 Harms. PhD Thesis, University of – Root Crops. Tropical Development Agriculture, Abeokuta, Nigeria. pp. and Research Institute, London. 203. Klu, G. Y. P., Amoatey, H. M., Bansa, D. Adewale, B. D., Dumet, D. J., Vroh-Bi, I., and Kumaga, F. K. (2001). Cultivation Kehinde, O. B., Ojo, D. K., Adegbite, and Uses of African yam bean

101 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

(Sphenostylis stenocarpa) in the Volta from morphology, isozymes, Region of Ghana. The Journal of Food chloroplast DNA and Linguistics. Eco Technology in Africa, 6, 74-77. Bot 46:276–292. Maiti, R.K, Hernandez-Pineiro, J.L. and Potter, D and Doyle, J.J. (1994) Valdez-Marroquin, M. (1994) Seed Phylogeny and systematics of ultra-structure and germination of Sphenostylis and Nesphostylis some species of Cactaceae. Fiton (Leguminoseae: Phaseoleae) based on 55:97–105. morphological and chloroplast DNA Milne-Redhead, E. and Polhill, R. M. data. Syst Bot 19:389–406 (1971). Flora of Tropical East Africa. Potter D. 1992. Economic botany of (pp. 670-674) Crown Agents for Sphenostylis (Leguminosae). O v e r s e a G o v e r n m e n t s a n d Economic Botany 46: 262-275. Administrations., Millbank, London Rachie, K.O. (1973). Highlight of Grain Obiagwu C.J. (1997) Screening process Legume Improvement at IITA 1970- for ideal food legume cover crops in 73. In: Proceedings of the first IITA the tropical ecosystem: (II) Grain Legume Improvement Application of selection method for Workshop, held at IITA, Ibadan, grain legume crops of the Benue river Nigeria. 29 Oct – 2 Nov, 1973 pp 1-14. basins of Nigeria (BRBN). J Sustain Singh, R.K. and Chaudhary, B.D. (1985). Agric. 10:15–31 Biometrical methods in quantitative Okigbo, B. N. (1973). Introducing the genetic analysis. New Delhi: Kalyan yam bean (Sphenostylis stenocarpa) Publishers p. 318. (Hochst ex. A. Rich.) Harms. Uguru, M. I. and Madukaife, S. O. (2001). Proceedings of the first IITA Grain Studies on the variability in Legume Improvement Workshop 29 a g r o n o m i c a n d n u t r i t i v e October-2 November 1973, Ibadan. Nigeria. pp. 224-238. characteristics of African yam bean Potter D, Doyle JJ (1992) Origin of (Sphenostylis stenocarpa Hochst ex. African yam bean (Sphenostylis A. Rich. Harms). Plant Production and stenocarpa, Leguminosae): evidence Research Journal 6:10-19.

102 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Response of African yam bean (Sphenostylis stenocarpa (Hochst ex. A. Rich) Harms) accessions to varied seed bed preparations

Adewale*, B. Daniel and Saliu T. Suleiman Department of Crop Science and Horticulture, Federal University Oye-Ekiti, Ikole-Ekiti Campus, Nigeria. *Correspondence Email: [email protected]

Abstract An investigation was conducted to identify the more supportive seed bed preparation for grain yield of African yam bean (AYB). Two factors: seed bed preparation types (ridged and flat) and five accessions of AYB were arranged in a split plot design of three replications on the field at the Teaching and Research Farm of the Federal University Oye-Ekiti, Ikole-Ekiti Campus, Ekiti State, Nigeria. Data on yield and yield components were collected and subjected to analysis of variance (ANOVA) using SAS (version 9.4). Means of the main effects were separated using least significant differences. ANOVA revealed significant (P<0.05) variation for most of the measured characters at the main (seed bed preparations) and the sub (accessions) plots. The seed bed by accession interaction significantly (P<0.05) affected some yield and yield components traits. For most of the characters evaluated, genotypes grown on the ridge performed significantly better than those on the flat. Moreover, significant (P<0.05) differences were observed for some grain yield and yield components of the five AYB accessions. TSs1 had the highest number of pods/plant (84) and grain yield/plant of 700g followed by DSs1 with the grain yield/plant of 699g. Seed yield/plant significantly (P<0.05) differed between the ridged (700.87g) and the flat (685.86g) seed bed condition. The accessions involved in this study responded to the same seed bed conditions differently, implying that the two seed bed conditions are two distinct environments. Ridge making significantly supported higher grain yield in AYB.

Keywords: African yam bean, Grain yield, Ridges, Seed bed, Split plot design

Introduction the protein of African yam bean (AYB) African Yam Bean (Sphenostylis seed is well over 32%, with lysine and stenocarpa (Hochst ex. A. Rich) Harms) leucine being predominant (Onyenekwe is an annual legume which is usually et al., 2000). In addition, the amino acid grown as a companion crop with yam spectrum indicated that most of the (Dioscorea spp) for the edible protein- essential amino acids especially lysine rich pulse and the starch-rich tubers. The and methionine levels in AYB are higher increased production of other leguminous than those obtainable in other legumes crops such as cowpea, groundnut and including Soybean (NRC, 1979; Evans soybean has greatly affected the and Haismer, 1979; Ihekoronye and cultivation and productivity of African Ngoddy, 1985; Kay, 1987; Abbey and yam bean such that its status still remain: Berezi, 1988). The protein in the tuber of neglected and underutilized species. The AYB is more than twice that in Sweet dual edible products from the crop makes (Ipomea batatas) or Irish (Solanum it to have comparative advantage over tuberosum) potatoes (NRC, 1979) and other tropical legumes. Furthermore, the much higher than those in yam and nutrient composition in both products are cassava (Amoatey et al., 2000). The very high too. From reports, the economic potential of AYB has been proportion of the essential amino acid in recognized, especially in reducing

103 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 malnutrition among Africans (Adewale, The experimental area was divided into 2011). three blocks. Each block was further AYB tolerates a wide range of divided to two main plots: one was environmental conditions. The crops manually ridged and the other was thrives on deep, loose sandy and loamy prepared a flat. The two factors in the soils with high organic matter content and experiment were: Seed bed preparation - good drainage (Schippers, 2000). ridged and flat and five accessions of Moreover, genotypes vary in their African yam bean. The five accessions response to the same environment. The (See list in Table 1) was randomly allotted multi-locational trial of 30 accessions of into each of the main plot in each block. AYB evaluated by Adewale et al. (2017) The experimental design was Split plot at the spacing of 1m x 1m gave a grain design. Data were collected for each of the yield range of 248.00 - 4,130.46 kg/ha. treatments on grain yield and yield The soil which play host to genotypes' components. The data were subjected to cultivation is a very important Analysis of Variance (ANOVA) using determinant of the phenotypic characters PROC ANOVA in SAS (version 9.4). of genotypes. Within the soil moreover, Treatment means for the two factors were the tillage status has been implicated to separated by Least Significant Difference directly affect genotypes' performances. method. Variables with significant The present study was necessitated Genotype x Seedbed interaction were because there is paucity of information on further partitioned using the “which-won- the supportive role of seed bed where” option of the GGE biplot in GEA- preparation or none to grain yield and its R (Pacheco et al., 2016). components in African yam bean genotypes. In Nigeria and Ghana, AYB Results has being mostly involved in mixed The sources of variation in the analysis of cropping. Report on sole cropping is rare variance for the split plot design for six and the right cultivation practices that can grain yield related variables is presented best support high grain yield of the crop in Table 2. Significant (P=0.05) variation have not been attempted. Since increased existed for the levels of the two main yield of crops provide a means to food effects (the seedbed and accessions) for security, the present study was proposed the six phenotypic variables (Table 2), to assess the response of different however, number of pods per peduncle genotypes of AYB to different soil did not vary significantly among the preparation methods to be able to identify genotypes. Significant (P=0.05) genotype the more supportive seed bed preparation by seedbed interaction was only method for grain yield of different significant for seed weight per plant, 100 genotypes of African yam bean. seed weight, pod weight per plant and number of pods per plant (Table 2). The Materials and Methods means of the different levels of factor A The experiment was carried out on the (seedbed) and factor B (genotypes) are Teaching and Research farm, Faculty of presented in Table 3. The ridged seed bed Agriculture, Federal University Oye enhanced higher and significant (P=0.05) Ekiti, Ikole-Ekiti campus, Ikole-Ekiti, mean compared with the flat all the Ekiti state, Nigeria. The land area was variables except the number of pods per prepared by ploughing and harrowing. plant (Table 3). Furthermore, the means of

104 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: List of accessions used in the experiment and their sources

Genotypes Codes Source DSs1 1 Owo, Ondo State. DSs2 2 Owo, Ondo State. DSs3 3 Owo, Ondo State. TSs1 4 Genetic Resources Centre, IITA, Ibadan. TSs11 5 Genetic Resources Centre, IITA, Ibadan.

Table 2: Summary of the Analysis of Variance for some grain yield components of African

Sources of Degree of Mean Square Variation Freedom SWPP 100 Seed wt. PWP PL NoPP Podpcle Rep 2 10.88 2.32 15633.32 0.32 4.23 0.004 Seedbed 1 1690.65*** 68.91*** 100722.89** 2.82* 480.00** 0.59** Error(a) 2 27.42 1.14 11079.7449 1.37 57.10 0.17 Genotypes 4 246.36** 17.17** 34728.06* 0.84 307.71** 0.12 Seedbed*Genotypes 4 267.90**** 15.01** 111532.38*** 0.39 549.75** 0.034 Error(b) 16 32.44 2.52 10316.07 0.53 46.20 0.06 SWPP – Seed weight/plant, PWP – Pod weight /plant, PL – Pod length, NoPP – Number of pods/plant, Podpcle – Number of pods/peduncle yam bean

Table 3: Mean performances of the levels of the two main effects for grain yield components

Seedbed PL (cm) Pods/plant Pods/peduncle Seed wt./plant(g) 100 Seed wt. (g) Pod weight/plant (g) Ridged 28.04a 70.27b 2.39a 700.87a 26.87a 1161.87a Flat 27.43b 78.27a 2.11b 685.86b 23.84b 1045.99b Genotypes PL (cm) Pods/plant Pods/peduncle Seed wt./plant (g) 100 Seed wt. (g) Pod weight/plant (g) DSs1 28.40a 76.50ab 2.17ab 698.90a 24.00bc 1221.54a DSs2 27.51a 70.33bc 2.25ab 693.18ab 27.78a 1129.17ab DSs3 27.59a 75.00b 2.18ab 689.02bc 25.56b 1054.54b TSs1 27.56a 84.33a 2.14b 700.42a 23.52c 1087.84b TSs11 27.60a 65.17c 2.49a 685.30c 25.91ab 1026.57b Means with the same alphabet are not significantly different from each other. Mean comparison is along the column.

105 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 the different genotypes varied for all the variables except pod length (Table 3). TSs1 had the highest significant (P=0.05) mean for number of pods/plant and seed weight/plant, DSs1 had the highest (1221.54g) and significant (P= 0.05) mean for pod weight/plant, TSs11 significantly led other genotypes for the number of pods/peduncle while the highest (27.78g) weight for 100 seed was from DSs2 (Table 3). The proportion of variance explained by the two axes in Figure 1 added to 100% to explain the genotype by seedbed interaction variance for seed Figure 2: The polygon view of the genotype by weight per plant. The polygonal view of seedbed interaction for 100 seed weight “which-won-where” in Figure 1 was a from the ridge environments with trapezium with four sectors. The ridge genotype 5 and 1 as the vertices' genotype and the flat were in the same sector with for the flat and the ridge environments genotypes 1 and 5 as vertices genotypes. respectively (Figure 2). The genotype by The two environments, ridge or flat were seedbed interaction for pod weight/plant not distinguished by the biplot for seed is presented in Figure 3. The trapezium weight per plant (Fig. 1). Moreover, the had four sectors, one contained the ridge contributory proportion of the two axes and the other had the flat as different (Factor 1 and Factor 2) to the biplot in environments. Genotype 1 was best Figure 2 was 100%. The polygonal view (genotype at the vertex) for the ridged of the genotype by seedbed interaction in environment while genotype 3 was best Figure 2 was a pentagon. The pentagon for the flat environment (Table 3). The with five sectors distinguished the flat “which-won-where” polygonal view for

Figure1: The polygon view of the genotype by Figure 3: The polygon view of the genotype by seedbed interaction for seed weight per plant seedbed interaction for Pod weight/plant

106 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 the interaction between genotypes and genotypes under the flat seed bed seedbed for the number of pods/plant in condition may be due to soil compaction Figure 4 was a triangle. Two of the three which reduces water infiltration, sectors identified the ridge and the flat as enhances erosion, loss of plant nutrients different seed bed environments, and consequently poor root growth and selecting genotype 3 and 4 as the best development (Goedert, 2004). genotype for the flat and the ridge In relation to yield and yield environments' respectively (Fig. 4). components of the genotypes, the best performing genotype for seed weight/ha Discussion was TSs1 with a yield of 720.01 kg/ha The significant differences among the under the ridged seedbed preparation response of different genotypes of African condition. This was followed by DSs3, yam bean to varied seedbed preparations with the yield of 703.99 kg/ha, under the are indications that the productivity of the flat seedbed preparation condition. The heterogeneous soil can be enhanced by least performing genotype was TSs11 tillage. The impact of tillage on the soil which had 648.63 kg/ha under the flat (i.e. which gave better performance for the no-tillage) seedbed preparation condition, different genotypes for yield and yield for the same character. These yields are components is in this study is significant; comparable with the yield in the range of: such that the genotypes planted on the 248 – 4310.46 kg/ha recorded by Adewale ridges performed better than those on flat and Kehinde (2016). seedbeds (no-tillage). Our result From our results, significant corroborated the opinion of Lipeic and variations occurred among the five Stepniewski, (1995) that tillage is a means African yam bean genotypes and the two to improving the physical and hence seed bed preparation methods. Each of the nutrient properties of soils. They noted tested genotypes responded significantly that tillage broke up massive structures, well under the ridged environment thereby increased soil pore space and compared to the un-ridge surface, this consequently allowed water to infiltrate justified the two seedbed conditions as and plant roots to penetrate through the distinct environments (Yan and Kang, soil profile. Amezquita et al. (1999) in 2003). Significance of the interactions agreement with the above further added between the two factors equally led to that good tillage practices stimulate root specific significant performances of the growth and could also contribute to better various combinations of their levels. soil condition. Through tillage, soil clods Adewale et al. (2017) had remarked that are broken and compact soil are loosed to geographical locations were distinct enhance mineralization and nutrient testing environments; the present study availability crop utilization. The present identified improvement or non- study noted that yield and yield related improvement of soil around the crop as characteristics of the five African yam distinct environments. This can be bean genotypes were much favoured by attributed to the improvement of the soil the ridged condition. Lower yield of crops properties which may have enabled could be due to soil compaction in no- proper development of roots and tillage conditions (Unger and Kaspar, improves the microbial activities in the 1994; Kozlowski, 1999). The poor edaphic environment for the crop. We performances observed for all the therefore inferred that ridges can be made

107 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 to enhance the growth and development African Journal of Applied Ecology, environment of African yam bean for 1, 53-60. increased grain yield. Evans, I. D. and Haismer, D. R. (1979) Rheology of gelatinized starch References suspension, J Text Stud, 10:347 -370. Abbey, B. W. and Berezi, P. E. (1988). Goedert W. J. (1983). Management of the Influence of processing on the Cerrado soils of Brazil: a review. J. digestibility of African yam bean Soil Sci. 34, 405-428. Harms, H. (Sphenostylis stenocarpa (Hoechst (1899). Leguminosae Africanae II. Ex. A. Rich.)Harms) flour. Bot. Jahrb., 26, 308-310. Nutritional Report International, 37, Ihekoronye, A.I. and Ngoddy, P.O. (1985) 819-827. Integrated food science and Adewale, B. D. (2011). Genetic technology for the tropics. Macmillan Diversity, Stability and Reproductive Publishers, London Jim, C.Y. 1993. Biology of African yam bean, Soil compaction as a constraint to tree Sphenostylis stenocarpa (Hochst. ex growth in tropical & subtropical urban A. Rich.) Harms. PhD Thesis, habitats. Environ. Conserv. 20:35–49. University of Agriculture, Abeokuta, Kay, D. E. (revised by Gooding, E. G. B.). Nigeria. pp. 203. (1987). Crop and Product Digest No. Adewale, B. D. and Kehinde O. B. 2–Root Crops. Tropical Development (2016). Inheritance and stability of and Research Institute, London. some agronomic traits of African yam Kozlowski, T.T. (1999). Soil compaction bean (Sphenostylis stenocarpa and growth of woody plants. Scand. J. (Hochst ex. A. Rich) Harms). Ekin For. Res. 14:596–619. Journal 2(2):76-86 Lipiec, J. and Stepniewski, W. (1995). Adewale, B.D., Ojo, D.K. and Abberton, Effects of soil compaction and tillage M. (2017). GGE Biplot application systems on uptake and losses of for adaptability of African yam bean nutrients. Soil Tillage Res. 35:37–52. grain yield to four agro-ecologies in National Research Council (1979). Nigeria. African Crop Science Tropical Legumes: Resources for the Journal 25:333 – 347. Future. Washington, DC: National Amézquita E., Barrios E., Rao I. M., Thomas R. J., Sanz J. I., Hoyos P. and Academy of Sciences, p.246. Molina D. L. (1999). Soil Physical Onyenekwe, P.C., Njoku, G.C. and Ameh, conditions under different tillage and D.A. (2000). Effect of cowpea management systems to construct an processing methods on flatus causing arable layer. In: PE 2 Staff (Eds.), PE oligosaccharides, Nutri Res, 20:349 – 2 Annual Report 1999, International 358 Centre for Tropical Agriculture, Cali, Pacheco, A., Vargas, M., Alvarado, G., pp 53-55. Rodríguez, F., López, M., Crossa, J. Amoatey, H. M., Klu, G. Y. P., Bansa, D., and Burgueño, J. (2016). GEA-R Kumaga, F. K., Aboagye, L. M., (Genotype x Environment Analysis Benett, S. O. and Gamedoagbao, D. whit R for Windows.) Version 4.1. K. (2000). African yam bean http://hdl.handle.net/11529/10203. (Sphenostylis stenocarpa) A International Maize and Wheat neglected crop in Ghana. West Improvement Center.

108 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Schippers, R. R. (2000). African Yan, W. and Kang, M.S. (2003). GGE Indigenous vegetables: An overview Biplot Analysis: A graphical tool for of the cultivated speciess. Chatham., b r e e d e r s , g e n e t i c i s t s a n d UK. 89 – 98. Agronomists, CRC Press., Florida. Unger, P.W. and Kaspar, T.C. (1994). Soil pp.271. compaction and root growth—A review. Agron. J. 86:759–766.

109 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Numerical taxonomic studies on Sphenostylis stenocarpa (Hochst Ex. A Rich) Harms. Variants from South-East Nigeria

Nnamani1, C.V and Nwefuru1, M.S 1Department of Applied Biology, Ebonyi State University, Abakaliki, Nigeria. *Corresponding Author: [email protected]; +234 806 353 8703

Abstract Sphenostylis stenocarpa (Hochst ex. a Rich) Harms. is an underutilized legume in the family Fabaceace. It produces both seeds and tubers which are highly proteinous, used as topical remedy for many diseases, and for land restoration among others. This study aimed at assessing the similarities and differences in six variants of the crop using numerical taxonomic attributes from their foliar epidermal characters. Samples were collected from farmer seed bank and seed vendors in major markets in five South Eastern States and coded to facilitate easy identification. The analysis of foliar epidermal features was done using standard procedure of leaf acidification and data obtained from various parameters were considered using mean, standard deviation and single linkage cluster analysis (SLCA)). Results showed that the six variants have crystals except DBW. Paracytic stomata types were common among the variants with dumbbell shaped guard cell. The length of the stomata ranged from 12.15 (um) to 14.85 (um) in adaxial, while in abaxial, it ranged from 10.80 (um) to 13.50(um). The length of stomata, length of the guard cells, number of crystal per slide, number of subsidiary cells and the total number of stomata in slide revealed also that all the variants were closely related except BGW and SGW which are more distant from other. Inspite of various colour variants the accession were the same based on the various similarities possess by all.

Keywords: African Yam Bean, Variant, Similarity and Difference

Introduction the leaves of plants are attributes of Sphenostylis stenocarpa is a group of potential taxonomic significance both at flowering plants in the family- Fabaceae, genus, species and sub- species levels. belonging to the subfamily Faboideae, The morphology of the stomata and which can either be prostrate, erect or surrounding epidermal cells on the leaves climbing (Adewale and Odoh, 2013). have long been regarded as useful tools in Three species of Sphenostylis are of high identification (Cutler, 1984; Stace, 1984). food security and medicinal values in Also, different shapes of epidermal cells, Africa, including the under-exploited type and arrangement of stomata, size, Sphenostylis stenocarpa commonly shape of trichomes and number of known as African Yam Bean, Numerical vascular bundles are all vital in systematic Taxonomy was developed in the late botany (Nwachukwu and Mbagwu, 2006, 1950s and had been successfully utilized Nnamani and Nwosu, 2012). in solving taxonomic ambiguity, mainly Notable works have been carried in identification of the species, variants, out in AYB by many researchers and land races (Soladoye et al., 2010). It scholars on genetic diversity (Adewale underpins the utilization of several and Odoh, 2013), nutritional diversity characters and character states which (Omeire, 2012, Nnamani et al., 2018) and evaluate the similarity and differences in on the agronomy (Uguru and Madukaife, organisms based on mathematical 2001). However, there is complete lack of analysis. Epidermal characters found on information on the pollen and foliar

110 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 features of S. stenocarpa using numerical appropriately and examined under the taxonomy. The aim of this work was to light microscope. access the similarities and differences in six variants of African Yam Bean with Microscopy systematic implications based on their Both qualitative and quantitative micro characters and character states of their morphological foliar characters were foliar epidermal markers. observed using Olympus binocular light Microscope (LM), fitted with 650 IS Materials and Method Cannon Digital Camera. Four slides were Sample Collection prepared for each of these samples. The The area of study is South–East Nigeria, epidermal features considered include that is situated within latitudes 6°19'29” types of stomata types and various N and longitudes 8° 4'54”E. It has a land stomata dimensions. mass of about 35,488 km2 (Madu, 2005) and with a total number of 16,381,729 (National Bureau of Statistical, 2018) It has a tropical climate with regional variances. Temperatures are high throughout the year, averaging from 24° to 32°C. It can get up to 34°C to 38°C during April and May periods. Rainfall variations occur widely from year to year while vegetation also varies in relation to climate, soil, elevation, and human Fig 1: Sample collection sites for Sphenostylis impact on the environment like stenocarpa in South-east Nigeria. Source, Nnamani et agriculture, industrialisation and even al., 2018. infrastructural development that tends to reduce the trees within the environment Statistical Analysis were based on and expose it global warming (Ofomata, measurement of ten features per slide for 1985). four slides for a sample. Difference in the same parameters measured for different Sample Collection: variants were evaluated using one way A total of 6 accessions of AYB variants analysis of variance and value were were collected from five South-East considered significant at P< 0.05. Cluster States of Ebonyi, Enugu, Anambra, Imo analysis was used to determine the and Abia, from local farmer's seed bank relatedness of the variants. All statistical and vendors of AYB in some major analysis package were carried out using markets. The study was carried out Statistical Package for Social Science between January to May, 2018 . (SPSS) Version. 20.0

Foliar Epidermal Studies Results and Discussion Leaves for epidermal studies were Foliar epidermal characters of the six collected fresh from samples growing in variants of S. stenocarpa examined have the green house and prepared using remarkable features which can be used for methods of Ayodele and Olowokudejo taxonomic decisions. The qualitative (1997). The slides were labelled characters of foliar epidermal features

111 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 have shown similarities among the adaxial variable. The breadths of the variants studied. All the variants had guard cells for both adaxial and abaxial crystals except DBW, paracytic stoma variable were of equal measurement for and dumb bell shaped guard cells. These all the variants and this in agreement with features can be used for taxonomic the work of (Cutler, 1984; Stace, 1984) identification. This agreed with the report that the morphology of the stomata and of (Dickison, 2000) Edeoga (1991) and epidermal cells of the leaf long been Mbagwu and Edeoga (2006), Nnamani regarded as useful tools. and Nwosu, 2012) on that foliar The similarities of the variants epidermal characters are used in occurred mostly in the qualitative features identification and classification of plants. in all the variants. The relationship on the The quantitative feature of foliar qualitative characters of foliar epidermal epidermal of the six variants studied were based on the possession of paracytic showed that in the adaxial variable, Total stomata, the presence of guard cells, number of stomata per slide tends have presence the of subsidiary cells and the the highest number concentration of presence of crystals by all the variants stomata in the variants ZW and the lowest except the variant DBW which do not in SGW. have, were in agreement with Jemilata et The length of the stomata of the al. (2009). The differences that occurred variants BBW and DBW have the highest in study were observed mainly in and the lowest were found in SBW in quantitative features which showed the

Table 1: Mean and Standard deviation of the data generated from quantitative characters of Foliar Epidermal of Adaxial.

Character States States

1 TNSS for AD 60 - 110=9, 111 - 160=5, 161- 210=10 3 2 TNSS for AB 60 - 110=4, 111- 160=9, 161 - 210=10, 211 - 260=1 4 3 Number of guard cells in AD 1 - 2= 24 1 4 Number of guard cells in AB 1 - 2= 24 1 5 Length of stomata in AD 10.5 - 12.5=3, 12.6 - 14.5=16, 14.6 - 16.5=5 3 6 Length of stomata in AB 10.5 - 12.5=8, 12.6 - 14.5=16 2 7 Width of stomata in AD 7.5 - 8.5= 24 1 8 Width of stomata in AB 7.5 - 8.5= 24 1 9 Breadth of guard cells in AD 7.5 - 8.5=22, 8.6 - 9.5=22 2 10 Breadth of guard cells in AB 7.5 - 8.5=24 1 11 Length of guard cells in AD 10.5 -12.5=4, 12.6 -14.5=13, 14.6 - 16.5=6, 16.6-18.5=1 4 12 Length of guard cells in AB 7.5 - 8.5=7, 12.6 - 14.5=9, 14.6- 16.5=8 3 13 Number crystals per slide in AD 8-14=15, 15-19=9, 20-24=1,25-30=2 4 14 Number crystals per slide in AB 8- 14=13, 15-19=7, 20-24=1,25-30=1 4 15 Number of subsidiary cells in AD 1-5=8, 6-10=12,11-15=4 3 16 Number of subsidiary cells in AB 1-5=5, 6-16=12,11-15=3 3

112 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

different among the variants based on the length of the stoma, the length of guard cells in the variants, number of crystals per slide and number of subsidiary cell . The dendrogram showed that BBW and SBW were more related, it were followed by ZW variant, while the variant BGW and DBW were from the same ancestoral stock, SGW have a character that are also present in BGW and DBW. Finally, the result of the studies showed that all the variants were the same Fig. 1: Dendrogram of the Foliar Epidermal in which the performance of variants in Characters of the six variants of S. stenocarpa different type of soil is likely going to be based on cluster analysis in adaxial. the same. In conclusion, the type of stomata, crystals and the presence of guard cells are of great significant in the taxonomic similarity of the variants of Sphenostylis stenocarpa.

Recommendation The result obtained shows that all the variants features are closely related to each other but varies due to environmental factors. In order words, I recommend further studies in the same variants from the same area using phylogenetic relationship with PCR method and its equivalent markers. Legends: Big Grey with White Eye Colors (BGW), Big Brown with White Eye Colors (BBW), Small Grey with White Eye Colors References (SGW), Zebra with White Eye Colors (ZW), Adewale, B.D.and Odoh, N. C. (2013). A Small Brown with White Eye Colors (SBW) and Review on Genetic Resources, Dark Brown with White Eye Colors (DBW). Diversity and Agronomy of African Yam Bean (Sphenostylis stenocarpa (Hochst. Ex A. Rich.) Harms): A Potential Future Food Crop. Sustainable Agriculture Research, 2,1 : 32-43. Ayodele, A.E. and Olowokudejo, J. D. (1997). Systematics importance of leaf and Epidermal Characters in West African species of family Myrtaceae. Botanical Society 2, 68:35-7. Plate: 2; Showed Photomicrograph of foliar epidermal variants.

113 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Cutler, D. F. (1984). Anatomy and Igwe, D.O. and Akinwale, R.O. Embryology. In: Heywood, V. H. & (2018).Update on Nutritional Moore, D. M. (Eds), Current Diversity in Sphenostylis stenocarpa Concepts in Plant Taxonomy. 107- (Hoechst ex. A. Rich.) Harms., for 133.Pp. Food Secruity and Conservation. Edeoga, H. O. (1991). Comparative America Journal of Agricultural and morphology of the leaf epidermis of Biological Sciences.13 : 38-49. Costusafer – C. lucansianus NnamMadu. I.A. (2005).“Population and (Costaceae) complex and its system settlement constraints to sustainable importance. Natural Science.,24: 1- 243. agricultural land use in southeastern Dickison, H. M. (2000). The Useful Nigeria,” in Okoko, E. Adekunle, ani , Plants of West Tropical Africa. vol.2. C.V. and Nwosu, M.O. (2012). Pollen Families E-I. Royal Botanic Garden, Morphology of Some Members of Kew. 605Pp. Nigerian Clusiaceae and Its T Jemilat, A.I., Ayodele, A.E., Okhale, S.E., axonomi significane; International Jegede, I.A. and Kunle, O.F. Journal of Pharmacy and Biological (2009).The Taxonomic Significance Science 3: 14 – 19. of the Micro- morphology and Omeire, G.C.(2012). Amino acid profile Phytochemistry of Agelanthus of raw and extruded blends of African dodoneifolium (Dc) Polh and Wiensc yam bean (Sphenostylis stenocarpa) in relation to its host, Nigerian and cassava flour. American Journal Journal of Botany, 22(1):89-101. Food Nutrition.2:65–68. Mbagwu, F. N. and Edeoga, H. O. (2006). Ofomata, G. E. K. (1985). Nigeria in Observations on the vegetative and Maps. Eastern States, Ethiope floral morphology of some Vigna Publishing House, Benin City, s p e c i e s ( L e g u m i n o s a e - Nigeria, 186, pp. Papilionoideae). Pakistan Journal of Stace, C. A. (1984). The Taxonomic Biological Sciences 9(9): 1754-1758. Importance of the Leaf Surface. In: V.A.J and Adeduntan, S.A. (eds). Heywood, V. H. and Moore, D. M. Environmental Sustainability and (eds) Current Concepts in Plant Conservation in Nigeria. Environ- Taxonomy, London. 67-105 Pp. mental Conservation and Research Team, Federal University of Soladoye, M. O., Robbin, T.J. and Lewis, Technology, Akure Nigeria . 163-171 G. P.(2010). A checklist of the Pp. Nigerian Legumes.Centre for National Bureau of Statistics . (2018). environmental research and Develop- South eastern population online ment, Ibadan, 141pp www.population of south east SAS Institute Inc. (2000). Statistical (20th Dec 2018.). Analysis System. Version 20.0. SAS Nwachukwu, C. U. and Mbagwu, F. N. Institute Inc. Cary. N.C, USA.100Pp. (2006). Morphological features in Uguru, M. I. and Madukaife, S.O. (2001). some species of Indigofera L. Studies on the variability in (Leguminosae Papilionoideae). agronomic and nutritive characteris- Journal of Fish and International.,1: tics of African yam bean (Sphenostylis 50-54. stenocarpa Hochst ex. A. Rich. Nnamani, C. V., Ajayi, S. A., Oselebe, Harms). Plant Production Resoures H.O., Atkinson, C.J., Adewale, D.B., Journal., 6, 10–19.

114 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Preliminary evaluation of twenty accessions of kidney bean (Phaseolus vulgaris L.) using selected agro-morphological traits

Agbeleye, O. A.1*, Majolagbe, O. J.2 and Anjorin, F. B.1 1Grain Legumes Improvement Programme, Institute of Agricultural Research and Training, Obafemi Awolowo University, Moor Plantation, Ibadan, Nigeria 2Federal College of Agriculture, Moor Plantation, Ibadan. *Corresponding author's email: [email protected] , +234 803 362 1670

Abstract Twenty kidney bean accessions were evaluated for agro-morphological traits to identify promising genotypes with yield potentials. The pot experiment was set up using a completely randomized design at the screen house of the Institute of Agricultural Research and Training (IAR&T) during 2018 cropping season. Data collected on five quantitative and four qualitative traits were subjected to analysis of variance. Data analysis revealed highly significant differences (p=0.001) for 50% flowering, pod length and number of seeds per pod of the crop. Days to seedling emergence and root length were similar among the accessions. Longest pod length (5 cm) was observed in TPv 873 while highest number of seeds/pod (3) was observed in TPv 778. Longest root length (6.95 cm) was observed in TPv 880. Days to 50% flowering significantly and positively correlated with pod length and number of seeds/pod. The first three principal components explained 87% of the observed variation and the accessions clustered into four distinct groups. White flower was prevalent except in TPv 903 which had purple flowers. All the accessions except TPv 694 were highly susceptible to viral diseases. An accession with high tolerance of disease, high number of pods per plant and seeds per pod were suggested for use in breeding high yielding kidney bean varieties.

Keywords: Kidney beans, Breeding, Preliminary evaluation Introduction Food security remains a topical issue of discussion in the 21st century. Food security refers to a state whereby all people at all (Beebe et al., 2013). Kidney bean is rich times have physical, social and economic in nutrients with high capability to access to sufficient, safe and nutritious improve soil fertility (Gereziher et al., food that meets their dietary needs and 2017). This important legume has been food preferences for an active and healthy relied on to provide up to 15% of total life (FAO, 1996). Women and children daily calories and 36% of the total daily under five years of age are particularly protein in several parts of Africa and the vulnerable to malnutrition and hidden Americas (Schmutz et al., 2014). Kidney hunger caused by food insecurity. The bean is a dual purpose crop used in human situation is aggravated by reliance on a nutrition and livestock feed. Certain few cereals and grain legumes. Use of kidney bean genotypes have been pulses in human diet is one of the ways to reported to possess traits for high seed arrest malnutrition and hidden hunger. yield and relatively high post-harvest One of the important pulses that can be crop residues that are valuable for used to achieve this purpose is kidney ruminant feedstuffs (Denjene et al., beans. 2018). Similarly, drought tolerant types Kidney beans (Phaseolus vulgaris have been identified and this shows the L.) is an annual crop. It is a very important adaptability of the crop to climate change legume in Eastern and Southern Africa (Darkwa et al., 2016). Unlike in the Latin

115 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

America and some other places, kidney to control insect pests. bean is not usually eaten as a sole dish in Nigeria. It is used mainly for garnishing Data collection and analysis salads and various rice recipes. Despite Data were collected on days to seedling the nutrition and utilization potentials of emergence, days to 50% flowering, pod kidney bean, research on the crop is length, number of seeds/plant and root limited in Nigeria. Hence, the main length (cm). Virus incidence on the plant, objective of this research is to access the plant architecture, flower colour and plant genetic variability among 20 accessions part pigmentation were visually observed. of kidney beans using their agro- Data were subjected to analysis of morphological traits. This will aid variance and correlation analysis using identification of promising accessions Statistical Tools for Agricultural Research that could be popularized and used as (STAR version 2.0.1) while Principal parents in kidney bean breeding and Component and Cluster analysis were improvement programmes. performed in PAST statistical software version 2.15. Significant means were Materials and Methods separated using Tukey's Honest Genetic Materials Significance Difference Test (TSD). Twenty accessions of kidney bean (Phaseolus vulgaris L.) were obtained Results and Discussions from the Genetic Resources Centre, Qualitative traits International Institute for Tropical White flower colour was predominant in Agriculture (IITA), Ibadan, Nigeria. the accessions (Table 1) while purple colour was observed in TPv 903 only Location and design of study (Plate 1). Variation in floral colouration in The experiment was carried out at the kidney bean had been ealier reported by Screen house of the Institute of Stoilova et al. (2005). All the accessions Agricultural Research and Training, used in the study were susceptible to viral Obafemi Awolowo University, Ibadan infection as the leaves turned chlorotic during the 2018 cropping season. The and shrunk. Aphids were observed on the experiment was laid out in a completely plants and are suggested as the vectors of randomized design replicated three times. viruses in the studied accessions. Top soil was collected from the research Mwaipopo et al. (2017) had also reported field and filled into 15L plastic pots with that several pathogenic and non- draining holes at the bottom. Two seeds of pathogenic viruses affect kidney bean. each accession were planted per pot and There is, therefore, a need to identify later thinned down to one at seedling viruses of kidney bean in Nigeria to emergence. Stakes were provided two inform management strategies for weeks after emergence. A combination of increased production and development of 5 ml of Lambda cyalothrin in 5 L neem virus-tolerant kidney bean varieties for extract produced by soaking 500 g of agro ecologies in Nigeria. Twelve (60%) pulped neem leaves in 5 L of water for 12 out of the twenty accessions were hours (modified protocol of Nahak and climbers while the remaining eight (40%) Sahu, 2014) was used to spray the plants were erect shrubs. These characteristics in at the vegetative stage and once at kidney beans have also been reported by flowering and pod initiation, respectively Stoilova et al. (2005).

116 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Qualitative characteristics of kidney bean accessions used in the study

Genotypes Vine Flower Virus Climbing pigmentation colour incidence ability TPv 667 NO WHITE YES YES TPv 694 NO WHITE NO YES TPv 765 NO WHITE YES NO TPv 778 NO WHITE YES YES TPv 780 NO WHITE YES NO TPv 797 NO WHITE YES NO TPv 799 NO WHITE YES YES TPv 802 NO WHITE YES YES TPv 810 NO WHITE YES NO TPv 830 NO WHITE YES NO TPv 833 NO WHITE YES YES TPv 847 NO WHITE YES NO TPv 856 NO WHITE YES YES TPv 867 NO WHITE YES YES TPv 873 NO WHITE YES YES TPv 874 NO WHITE YES NO TPv 880 NO WHITE YES YES TPv 903 YES PURPLE YES YES TPv 968 NO WHITE YES NO TPv 980 NO WHITE YES YES

Table 2. Analysis of variance for five agronomic traits of 20 kidney bean accessions evaluated at Institute of Agricultural Research and Training, Ibadan in 2018

Source of DF Seedling Days to Pod Number Root variation emergence 50% Length of length flowering (cm) seeds/pod (cm)

Genotype 19 1.50NS 394.38*** 3.72*** 2.86*** 1.60 NS Error 40 0.82 3.16 0.25 0.13 1.04

DF: Degrees of freedom, ***:p =0.001, NS: not significant

117 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

existence of genetic variability in the accessions studied. Seedling emergence and root length were similar among the accessions. Rafi and Nath, 2004, Sofi et al., 2011 and Ali et al., 2016 have reported similar genetic variability for days to 50% flowering and number of pods/plant. Mean performances for each trait studied is presented in Table 3. Seedling emergence ranged between 4 and 6 days with earliest emergence of 4 days observed in 40% of the accessions (Table 3). Accession TPv 567 took the longest number of days for seedling emergence (6 days). Seedling emergence in the range of 3.4 to 5.3 days has been reported by Khan Plate 1: Purple flower and vine pigmentation in TPv 903 et al. (2015). Two accessions (TPv 567 and TPv 694 did not reach flowering as Quantitative traits the plants died due to disease infestation. Analysis of variance revealed highly The earliest accessions to attain 50% significant differences (P=0.001) among flowering are TPv 765, TPv 767, TPv 810 the accessions for days to 50% flowering, and TPv856 (33 days). The longest days pod length and number of pods/plant to flowering was observed in TPv 799 (42 (Table 2). The result suggests the days). Lima et al. (2005) have reported

Table 3. Mean performance for five agro-morphological traits in twenty accessions of kidney bean evaluated in Ibadan during the 2018 cropping season

Accession Seedling Days to Pod length Number of Root length emergence 50% (cm) seeds/pod (cm) flowering TPv 667 6.00 0.00e 0.00d 0.00d 5.02 TPv 694 5.67 0.00e 0.00d 0.00d 5.13 TPv 765 4.33 33.00d 1.67bc 2.00bc 5.67 TPv 778 4.00 40.50ab 1.67bc 3.33a 5.12 TPv 780 6.33 36.00bcd 2.00bc 2.00bc 6.50 TPv 797 4.00 33.00d 1.00cd 3.00ab 5.47 TPv 799 4.67 42.00a 1.00cd 2.00bc 6.82 TPv 802 5.00 38.00abcd 1.00cd 0.00d 5.95 TPv 810 4.67 33.00d 1.00cd 2.50ab 5.43 TPv 830 5.00 36.00bcd 2.50bc 3.00ab 5.55 TPv 833 4.00 37.00abcd 1.00cd 2.00bc 5.17 TPv 847 4.00 36.35bcd 1.83bc 2.00ab 5.05 TPv 856 5.00 34.00d 2.00bc 2.50ab 4.83 TPv 867 4.33 39.67ab 3.00b 2.00bc 6.38 TPv 873 4.00 36.00bcd 5.00a 2.40ab 5.08 TPv 874 4.67 37.00abcd 2.50bc 2.89ab 5.90 TPv 880 5..33 37.00abcd 2.00bc 2.00bc 6.95 TPv 903 4.67 36.00bcd 2.50bc 2.00cd 5.38 TPv 968 4.00 34.33cd 1.00cd 1.00cd 6.42 TPv 980 5.33 37.00bcd 2.00bc 2.00bc 4.08 Means followed by the same letters are not significantly different at p=0.05

118 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 that days to flowering in P. vulgaris Correlation and Principal Component ranges between 26 to 40 days. This is analyses similar to the results obtained in this Seedling emergence was negatively study. Number of days to attain 50% associated with all quantitative traits flowering is important as early flowering studied (Table 4). The association of has been described as a trigger for early seedling emergence and the quantitative pod set and early maturity (Or et al., traits was not significant except with days 1999). Hence, the early flowering to days to 50% flowering. The negative accessions are suggested for breeding correlation implies that the earlier the early maturing kidney beans. days to emerge, the longer the number of Pod length ranged between 1.00 days to attain flowering. This observation cm and 5.00 cm. The longest pod was needs further clarification although it may observed in TPv 873 while six out of the be due to the fact that accessions that are 20 accessions had the shortest pods length late in emergence coincided with (Table 3). Root lengths were similar favourable photoperiod and flowered. among the accessions studied with White and Liang (1989) reported that 60% longest root (6.95 cm) and shortest root out of 4000 common bean genotypes length (4.80 cm) in TPv 880 and TPv 980, screened at the International Center for respectively. Root length has been Tropical Agriculture were photoperiod implicated in the ability of kidney bean to sensitive. Number of days to 50% adapt to drought conditions Sponchiado flowering positively and significantly et al., 1989) and this opens up a gap for associated with pod length and number of physiologists to understand the seeds per pod but its association with root mechanisms f or tolerating drought at the length was not significant. Highly enzyme level which is more desirable significant positive association existed than phenotypic selections. Also, root between pod length and number of seeds architecture has been described as an per pod. This association is common in important trait for drought tolerant crop most legumes as these traits are yield- selection and improvement. Extensive related (Nakawuka and Adipala, 1999; root growth is closely associated with Meena et al., 2015). Hence, these traits drought tolerance in crop grown under can be used for indirect selection for yield. field conditions. Effective and efficient The first three principal components root system allows plants to access water based on the correlation matrix explained and nutrients at deeper soil levels and 87% of observed variation (Table 5). The over large areas (Chaves et al., 2003; high value of PC1 indicates great Lynch, 2007). contribution to the observed variation

Table 4. Correlation among five quantitative traits in 20 accessions of kidney bean evaluated at IAR&T, Ibadan during the 2018 cropping season

FF PODLT SEED/POD ROOTLT Seedling emergence -0.35*** -0.11 -0.28 -0.0005 50 % flowering 0.50*** 0.62*** 0.23 Pod Length 0.49*** 0.004 No. of seeds/pod -0.02 EMG: Seedling emergence; FF: 50% flowering; PODLT: Pod length; Seed/pod: number of seeds per pod; ROOTLT: root length

119 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 5. Principal component analysis of five quantitative traits in 20 kidney beans bean evaluated at IAR&T, Ibadan during the 2018 cropping season

Principal Component Eigen value % variance 1 2.50 50.04 2 1.15 23.01 3 0.71 14.15 4 0.44 8.79 5 0.20 4.01

EMG: seedling emergence; FFLO: 50% flowering; POD/PLT: number of pods/plant; seed/pod: number of seeds/pod; RTLT: root length Fig. 1. Factors loading the first principal component in Fig. 2. Cluster grouping of twenty accessions of twenty kidney bean accessions evaluated at kidney beans I.A.R.&T. among the genotypes studied. Days to pod length and number of seeds/pod 50% flowering, number of pods/plant and hence, these traits could be used for number of seeds/pod greatly loaded PCI indirect selection for early maturing and (Fig. 1). This suggests that the traits high yielding kidney bean genotypes. loading the first principal component are Genotypes in Cluster III are suggested for adequate to explain the observed breeding early maturing kidney bean variation. varieties. Further studies to identify stable genotypes across agro-ecologies in Cluster analysis Nigeria are also recommended. The ward's method of clustering grouped the 20 accessions into four clusters (Fig. References 2). There were 2, 3, 9 and 6 genotypes in Ali, A., Khan, S. A., Ali, N., Ali, S., groups I, II, III and IV respectively. The first group contains two accessions which Hussain, I., Fazlullah, Raza, H., were highly susceptible to disease and Ahmad, F., Saleem, M. and Attaullah. died off without attaining flowering. Late (2016). Evaluations of locally flowering genotypes clustered into group collected germplasm of common II while early flowering accessions bean (P. vulgaris L.) for variability in clustered into groups III and IV. morphological and yield characters in Clustering of genotypes provides Swat valley. Pure and Applied information on their relative divergence Biology 5(3):573-577

120 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Beebe, S.E., Rao, I.M., Blair, M. W.and J. the size of sown seed on the growth A. Acosta-Galleyos. (2013). ans yield of common bean cultivars of Phenotyping common beans for different seed sizes. Brazilian Journal adaptation to drought. Frontiers in of Plant Physiology 17: 273-281 P h y s i o l o g y d o i : 1 0 . 3 3 8 9 / Lynch, J. P. (2007). Roots of the second fphy.2013.00035 green revolution. Australian Journal Chaves, M. M., Maroco, J. P. and J. S. of Botany 55:493-512 Pereira. (2003). Understanding plant Meena, H. K., Krishna, K. R. and B. responses to drought: from genes to Singh. (2015). Character associations whole plant. Functional Plant between seed yield and its Biology 30:239-264 components traits in cowpea [Vigna D a r k w a , K . , A m b w a c h e w, D . , unguiculata (L.) Walp.]. Indian Mohammed, H., Asfaw, A. and A. W. Journal of Agricultural Research 49 Blair. (2016). Evaluation of common (6): 567-570 bean (Phaseolus vulgaris L.) Mwaipopo, B., Nchimbi-Msolla, S., Njau, genotypes for drought stress P., Tairo, F., William, M., Binagwa, P., adaptation in Ethiopia. The Crop Kweka, E., Kilango, M. and D. journal 4: 367-376 Mbanzibwa. 2017. Viruses infecting Denjene, M., Dixon, R. M., Duncan, A. J., common bean (Phaseolus vulgaris L.) Wolde-meskel, E., Walsh, K. B. and in Tanzania: A review on molecular D. McNeill. (2018). Variations in seed characterization, detection and and post-harvest residue yields and disease management options. Journal residues quality of common bean of Agricultural Research 12(18): (Phaseolus vulgaris L.). Animal 1486-1500 Feed Science 244: 42-55 Nahak, G. and R. K. Sahu. (2014). Bio- Food and Agriculture Organisation efficiency of leaf extract of Neem (FAO). (1996). Declaration on World (Azadirachta indica A. Juss) on food security. World Food Summit, growth parameters, wilt and leafspot FAO, Rome. diseases of Brinjal. Research Journal Gereziher T., Seid E. and B. Getachew. of Medicinal Plants 8:269-276 (2017). Performance evaluation of Nakawuka, C. K. and E. Adipala. (1999). common bean (Phaseolus vulgaris A path coefficient analysis of some L.) varieties in Raya Valley, Northern yield components interactions in Ethiopia. African Journal of Plant cowpea. African Crop Science Science 11: 1-5 Journal 7: 4, 327-331 Khan, M., Muhammad, A., Ahamad, N., Or, E., R. Hovav and S. Abbo. (1999). A Khan, K. Khan, S. U. and Z. Chaudry. major gene for flowering in chickpea. (2015). Variability of vigour and Crop Science 39:315-322 variability of viability of various Panchbhaiya, A., Singh, D. K., Verma, P., varieties of common bean (Phaseolus Jatav, V. and A. K. Maurya. (2017). vulgaris L.) landraces. American- Genetic analysis of French bean Eurasian Journal of Agriculture and (Phaseolus vulgaris L.) germplasm Environmental Science 15(5):957- through principal component analysis 961 and D 2 cluster analysis. Journal of Lima, E. R., Santiago, A. S., Araujo, A. P. Pharmacognosy and Phytochemistry and m. G. Texeira. (2005). Effects of 6(3):537-542

121 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Rafi, S. A. and U. K. Nath. (2004). Sofi, P. A., Zargar, M. Y., Debouck, D. and Variability, heritability, genetic A. Graner. (2011). Evaluation of advance and relationships of yield common bean (Phaseolus vulgaris L) and yield contributing characters in germplasm under temperate dry bean (Phaseolus vulgaris L). conditions of Kashmir Valley. Journal Journal of Biological Sciences 4(2): of Phytology 3(8): 47-52. 157-159. Sponchiado, B. N., White, J. W., Castillo, Schmutz J., McClean P. E., Mamidi, S., J. A. and P. G. Jones. (1989). Root Wu, A. G., Cannon, B. S., Grimwood, growth of four common bean cultivars J., Jenkins, J., Shu, S., Song, Q., in relation to drought tolerance in Chavarro, C., Torres-Torres, M., Geffroy, V., Moghaddam, M. S., Gao, environments with contrasting soil D., Abernathy, B., Barry, K., Blair, types. Experimental Agriculture M., Brick, A. M., Chovatia, M., 25:249-257. Gepts, P., Goodstien, M. D., Stoilova, T., Peteira, G., De Sousa, M. M. Gonzales, M., Hellsten, U., Hyten, D., T. and V. Carnide. (2005). Diversity in Jia, G., Kelly, D. J., Kudrna, D., Lee, common bean landraces (Phaseolus R., Richard, S.M., Miklas, N.P., vulgaris L.) from Bulgaria and Osorno, M. J., Rodrigues, J., Thareau, Portugal. Journal of Central V., Urrea, A. C., Wang, M., Yu, Y., European Agriculture 6:443-448. Zhang, M., Wing, A. R., Cregan, B.P., White, J. W. and D. R. Laing. (1989). Rokhsar, S.D and A. J. Scott. (2014). Photoperiod response of flowering in A reference genome for common bean diverse genotypes of common bean and genome-wide analysis of dual (Phaseolus vulgaris). Field Crop domestications. Nature Genetics. 46 Research 22(2): 113-128. (7): 707-713.

122 Soil Fertility and Agronomy

123 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Cajanus cajan (L.) Millsp:An Underexploited Multipurpose Grain Crop for Maximizing Benefits from Agroforestry Systems in Nigeria

J. O. Nwogwugwu1, D.B. Olomola2and B.Anicet3 Corresponding author: [email protected], 08034337114 1Department of Forest Conservation and Protection, Forestry Research Institute of Nigeria, Ibadan, Nigeria. 2Department of Bioscience, Forestry Research Institute of Nigeria, Ibadan, Nigeria. 3Faculty of Agriculture and Environmental Sciences, Catholic University of West Africa Cotonou, Benin.

Abstract Cajanus cajan, a leguminous woody grain shrub species that grows from the Rainforest zone to the Sahel zone, has numerous qualities that have remained untapped in developing different agroforestry systems in

Nigeria is highlighted. Whilethe roots fix N2, they also excrete chemicals that aid the release of bound soil P, K, Na and Mg and kill soil borne crop nematodes. The species has deep root system which makes it free from competing with companion crops in mixed cropping systems. The grain yield can be high, depending on agronomic treatments and the grains have high protein and mineral contents. The leaves and green pods can boost soil nutrients status as green manure, or used to feed livestock. The leaves and roots are similarly used as herbs for healing ailments such as measles, dysentery, small pox, incontinence of urinating in males, veneral diseases, management of cancer and for quickening delivery of women in labour. The plant is also used in sericulture, as windbreaks, fuel wood, beekeeping, thatchery and basketry. So far, no agroforestry woody species in Nigeria can be identified as matching pigeon pea in providing the array of benefits it offers. In this paper, the methods of incorporating the species into different agroforestry practices in Nigeria are suggested, to fully harness its potentials.

Keywords: Agroforestry, Cajanus cajan, Fuelwood, Medicinal, Pest Control.

Introduction countries with the most successful Agro forestry is a composite term used to examples of agro forestry trials in the describe all land management practices tropics. where woody perennials are intentionally The most commonly practiced cultivated on the same land units with Agro forestry systems in Nigeria are; crops and/or livestock rearing in a spatial or temporal sequence. It is therefore a (a) Homesteads Gardens dynamic, ecologically based natural These are compound farms in which resources management system for multipurpose mixed farming is practiced. integration of trees in farmland and or It is similar to what is obtained under rangeland, results in diversification and shifting cultivation, except that more food sustenance of production for increased crops and in some cases, more woody social, economic and environmental perennial species, especially fruit trees are benefits for land users at all levels of found in the compound and fodder, production (ICRAF, 1997). Nao (1978) ruminants, poultry and piggery may be has described Nigeria as one of the integrated into the farming system. 124 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

(b) Scattered Farm Trees/Crop Produc- alleys between rows of hedges of fast- tion growing leguminous (N2- fixing) trees or In this system when the farmland is shrubs. The leguminous tree species are initially opened up, some trees species of lopped and the herbage is worked into the food, fodder or medicinal values such as soil as green manure and together with the

Parkia biglobosa(fruits), Chrysophyllum N2-fixing abilities of the roots, soil albidum (fruits), Dacroydes edulis nutrient is enhanced and maintained for (fruits), Sterculia africana (fruits), crop production without addition of Adansonia digitata (vegetables), mineral fertilizers. Pterocarpus spp.(vegetable), Vitellaria paradoxa (shea butter), oil palm (fodder, (e) Cropping in between Shelterbelts ropes, oil, roofing materials), Faidherbia Shelterbelts were established in Nigeria albida (fodder, soil nutrient enrichment). in the 1970s in the arid and semi-and areas are intentionally left on the land (Mize et of Sudan and Sahel Savanna Zones of al., 2008). Thus, the system provides a Nigeria for controlling sand drift and traditional means of conservation of the protecting agricultural lands. They indigenous tree species of economic consisted mostly of mixed plantings of value. Maize, guinea corn, and some vegetables are grown while the tree Cassia saimea, Acacia nilotica, species replenish soil nutrients and some Azadirachta indica and Eucalypts in two of the leaves can be used for feeding to three parallel belts with wild gaps in- livestock. between for cropping. The cropping lands are thereby protected, the sands are © Taungya System stabilized, retained, thus making it This originated in 1862 in Myanmar, possible for crops to be grown. formerly known as Burma (Tufour 1981) It has been found that shelterbelts from where it was introduced into Nigeria increase yields of crops, but their in 1928 in a silvicultural trail at Sapoba, influences vary with type of crops, the Edo State (Izekor and Ajobi, 2016). It is year of cropping, site, etc. (Mize et al., essentially an adaptation of the traditional 2008). shifting whereby, the farmers are able to raise food crops in between seedlings for (f) Silvopastoralism about 3 years in parts of a forestland This is the practice of raising plantations where plantations of timber species have of tree species along with cultivation of been established. When the tree species fodder crops as the undergrowth. In well close canopy, cropping is discontinued managed agrosilvopastoral farms, the tree (Odewale et al., 2017). Thus, bumper components are usually multipurpose harvests are obtained using the nutrients fodder species, while the fodder crops can built up under parts of previously be grasses and legumes.These standing forests. components are harvested rationally for feeding the livestocks. The wooden (d) Alley Farming System components of the tree prunings are used This is also called Alley Cropping and was developed by scientists at the for firewood. International Institute of Tropical Other components of the practice Agriculture (IITA) at Ibadan, Nigeria. In are: grazing under coconut and oil palm this system food crops like upland rice, plantations and in plantations of timber yam, cassava, cow pea are planted in species.

125 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

(g) Agrosilvopastoralism agroforestry systems in Nigeria. Genera- This practice is similar to silvopastora- lly, the woody perennial components in lism except that food crops are grown and agroforestry systems provide many the tree components are fodder tree benefits that boost the yield of component species. When food crops (mostly crops and livestock. They also provide the cereals and beans) are harvested, the farmers with food, firewood and stover and the loppings are fed to the vegetables, construction materials, extra livestock. income etc. Cajanus cajan (Pigeon pea), has (h) Shifting cultivation been identified as having many important This is the oldest agro forestry practice values to man (Seleman et al., 2016). suitable under low population density These can be harnessed for maximizing (25 – 30 inhabitants km-2) and is widely benefits derivable from agrorforestry practiced in the humid and sub-humid systems in Nigeria. This paper highlights (rain forest and derived savanna zones) of these benefits showing how the species Africa over centuries. Several staple can be incorporated unto different crops like yam, cocoyam, cassava, maize, agroforestry systems to maximize its plantain and vegetables are grown in potentials. freshly cleared matured forestland for Observation and Discussion about three years and when yields start Potentials of Pigeon Pea in Boosting the dropping, the farms are abandoned and Benefits Derivable From Agroforestry left fallow for some years, while new Systems forests are cleared for fresh farming Pigeon pea is a woody perennial activities. Farmers return to the fallowed shrub belonging to the family Fabaceae, lands when nutrients would have built up subfamily Papilionaceae. It is believed from the decayed forest litter. Usually, to be of Indian and African origin and was some multipurpose fruits trees are spared cultivated in ancient Egypt, Africa and when the lands are being opened up for Asia (Fiacre et al., 2018). It can be grown farming. from seeds and also vegetatively using The variation in ecological zone/ seedling petioles (Emefiene 2014). It can vegetation types, from the Sahel, Sudan, grow up to 4m tall with deep tap root that the Northern Guinea and Southern can grow up to 2m deep (Emefiene et al., Guinea Savannas to the lowland 2014). It is heat tolerant and can grow at rainforest, freshwater swamps, the temperatures up to 350C, if the soil is mangrove and coastal vegetation, moist (Sheahan, 2012). It is one of the determine the intensity of the most drought resistant legume crops, with agroforestry variant practiced in these a wide range of tolerance to rainfall, but ecological zones. does better in areas with more than Staple crops such as yam, 625mm of rainfall andelevations cassava, maize, plantain, banana, exceeding 2,000m above sea level cocoyam, millet, sorghum, tomatoes, (Tegegne et al., 2012). Sheahan (2012), okro and various vegetables as well as observed that it tolerates wide range of small holder livestock production such as soils, from sands to heavy black clays, but goats, sheep, chicken and donkeys, have prefers soils with pH range of 5.0 – 7.0. been successfully raised annually to serve Thus, it can be grown from the lowland farmers' family food needs in different rainforest to the Sahel in Nigeria.

126 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Agronomy The species has the ability to fix C. cajan is generally sown at the up to 235kg of nitrogen (N) per hectare beginning of the raining season in Nigeria (Sharma et al., 2011) and produces more and plant density per hectare is unknown, N2 per unit area from plant biomass than as it is intercropped with other staples like most other legumes (Damaris, 2007). In yam and maize (Ayenan et al., 2017). Tanzania, Myaka, et al., (2006), showed Most leguminous crops like Vigna that the yield of unfertilized maize unguiculata and C.cajan are not grown intercropped with pigeon pea, generally with fertilizer in Nigeria. In India and equaled that of moderately fertilized sole Nepal, it has been reported that plant maize. When used as green manure, it density can be up to 100,000 plants ha-1 offers the benefit of improving soil (Mashood, 2009, Sharma et al., 2011). fertility and quality on long term basis Phosphorus is the most important (Onim, et al., 1990), in alley cropping fertilizer nutrient for tropical pulses, (Mapa and Gunasena, 1995) or as cover since they obtain most of their nitrogen crop (Bodner et al., 2007). In West Africa, requirements through symbiotic N2 - Sogbeji et al., (2006), reported that when fixation (Fiacre et al., 2018). Pigeon pea used as cover crop it increased maize yield has been reported to be more efficient in P by up to 32.1%. uptake when grown in low P soils It has also the ability of reducing containing Aluminum; it can easily the level of rootsk not nematodes in the access insoluble P present in the soils succeeding crop when used as green (Emefiene et al., 2014). manure (Abuzar and Haseeb 2009) Also, Table 1: The dietary nutrients of pigeon pea

Constituents Green seed M ature seed Dhal Protein (%) 21.0 18.8 24.6 Protein digestability (%) 66.8 58.5 60.5 Trypsin inhibitor (unitsmg-1) 2.8 9.9 13.5 Starch (%( 48.4 53.0 57.6 Starch digestability (%) 53.0 36.2 - Amylase inhibitor (units mg-1) 17.3 26.9 - Soluble sugars (%) 5.1 3.1 5.2 Flatulence factors (g 100 g- 1 10.3 53.5 - soluble sugar) Crude fibre (%) 8.2 6.6 1.2 Fat (%) 2.3 1.9 1.6 Minerals and t race elements (mg 100-1 g dry matter) Calcium 94.6 120.8 16.3 Magnesium 113.7 122.0 78.9 Copper 1.4 1.3 1.3 Iron 4.6 3.9 2.9 Zinc 2.5 2.3 3.0 Vitamins (mg 100- 1 g fresh weight of edible portion) Carotene (Vit A 100- 1 g) 469.0 Thiamin (Vit B1) 0.3 Riboflavin (Vit B2) 0.3 Niacin 3.0 Ascorbic acid (Vit C) 25.0 (Source: Faris et al. 1987) 127 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 under rotation with pigeon pea in striga exchangeable cations of magnesium, infected soils, it has been found in western potassium and sodium than in Kenya that it has a remarkable ability to uncultivated soils and that total decrease striga infestation in maize exchangeable bases and moisture intercropped with pigeon pea (Oswalld contents were also higher. Similarly, in and Ransom, 2001) studies carried out in Benin Republic on root interactions under various Grain and Fodder Yield and Soil Nutrient intercropping systems, Lose (2003), Accretion observed that when cassava was The grain yield of Pigeon pea can intercropped with C. cajan, it had higher reach up to 10 tons ha-1 of shelled grains in values of accumulated root length, the wetter region, but in the Sahel savanna compared to other intercropped systems. the yield is much lower (600-1200kg of Sharma et al., (2011) reported that Pigeon beans/ha/yr) (Akinola and Whiteman, pea's N2-fixing ability can be as high as

1972). According to Arif et al., 2016, 100-120kg N2/ha/yr/7,000 plants. Its pigeon pea contains 22% - 27% crude choice as a candidate crop in agroforestry protein, 7.3% - 10% crude fibre, 61.2% can be an option for increasing nutrient nitrogen-free extract, 1.7% – 2.1% ether use efficiency. Fiacre et al., (2018), extract, 3.1% - 4.2% ash and 7.59% reported that pigeon peas as multipurpose lysine. It is also a good source of soluble species can be used both as food grain and vitamins like thiamin, riboflavin, niacin green manure crops for soil fertility and choline (Arif et al., 2016, Faris et al., amelioration in cropping systems. 1987). Nwogwugwu et al., (2009), Fodder yields may reach 25t DM similarly observed that C. cajan can be /ha/yr, without fertilization, but up to 38t used to control the population of with 100kg of N2 and P application per nematodes in infested soils, suggesting hectare (Duke, 1981). Pigeon pea leaves that this quality could be harnessed for remain on the plant throughout the dry reducing nematode infestation levels in season. It yields high quality fodder (10- rotations or intercropping systems with 15% crude protein), especially when the nematode-susceptible crops like seed pods are developing and are lopped tomatoes, egg plant, yam, potatoes etc. with the leaves (Duke, 1981). Medicinal Values of Pigeon Pea Soil Nutrient Accretion In Nigeria, boiled leaves are used Pigeon pea has been used to improve soil to bath and heal patients suffering from fertility in West Africa. For example its measles attack, while it is speculated that root exudates contain phenolic when the liquid is dropped into the eyes to compounds (e.g. piscidic acid), which prevent blindness that can arise from the chelates Fe to release P from iron bound P, attack. Fresh seeds are used to stop thus improving crop growth and yield incontinence of urination in males, while (ICRISAT, 1999). Pigeon pea root immature fruits are of use in relieving exudates dissolve phosphate-containing liver and kidney ailments (Duke, 1981). rocks e.g. rock phosphate making it According to Morton (1976), young available for crop use (Ae et al., 1990). leaves are used to heal sores, while Yeboah et al. (2004) observed that soils powdered leaves help to expel bladder cultivated with C. cajan had higher

128 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 stones. He also stated that salted leaf juice Nigeria (Ashidi et al., 2004). C.cajan has is taken to heal jaundice, whereas floral also been found to possess antimicrobial decoctions are used for bronchitis, coughs activities against Staphylococcus aureus, and pneumonia and that dried roots are Pseudomonas aeruginosa, Escherichia also used as alexeritic, antihelmintic, coli and Candida albicans (Ezeifeka et expectorant, sedature and vulnerary. al., 2004). Aqueous extracts of the seeds Leaves are similarly used for treating of pigeon-pea has been used in managing sickle-cell disease in Nigeria (Osuagwu, toothache, sore gums and dysentery and 2010, Osuagwu and Mbeyi, 2007). for treating malaria in Nigeria (Aiyeloja and Bello, 2006) and also to quicken child Other Uses of Pigeon Pea delivery (Duke, 1981, Parrotta 2001). Pigeon pea plant is also used for Hutchinson and Dalziel (1954), also apiculture, while the leaves are also used observed that the pulverized seeds is used in sericulture (silk production). Tall as a cicatrizant of smallpox pustoles. varieties can be used as live fences According to Ashidi et al., (2004), (Phatak, et al., 1993) and windbreaks and cytotoxic stillbenes extracted from C. for soil conservation in the savanna areas cajan leaves was found to exhibit in vitro of Nigeria. The ease of establishment and citotoxic activity against human grain production for food, makes the amelanotic melanoma, C32 human B species very suited for agroforestry in breast adenocarcinoma MCF -7 and Africa (Kwesiga et al.,2003). Thus, they human large cell lung carcinoma, COR can be used as fuelwood, roofing and –L23cell lines. This explains the rational basket-weaving in villages when for inclusion of Cajanus cajan in harvested. Hueze et al., 2016 wrote that traditional herbal medicine used for the species has been used severally in treatment of cancer in South-Western animal feeds.

Table 2: Medicinal uses of Pigeon pea

Parts used Forms used Mode of Name of disease administration Leaves The leaves boiling Drinking of the Malaria with some other filtrate or plant leaves or used to bathe scrubbed together and then filtrate Leaves Scrubbed together Drinking of the Fever and then filtrate or Filtrate used to bathe (Source: Esan and Ojemola, 2018)

Table 3:Utilities of Pigeon pea.

Parts used Utilities Leaves It serves as compost for soil fertility Stems and roots For cooking in the farm and at home Leaves and barks As feed for livestock (Source: Esan and Ojemola, 2018)

129 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Conclusion and Recommendations for would either be incorporated into the soil Benefits from Pigeon Pea in Agro- for enhancing nutrient status and for forestry System feeding livestock. The livestock The following cropping sequences and droppings emanating from the system in methods are suggested for maximizing addition, would later be used to fertilize the benefits from pigeon pea: the other crop components. The species In agroforestry farms whose soils have could also be planted as hedgerows been impoverished by continuous lengthwise on the farm and crops would cropping, Pigeon pea should be planted up be grown in- between the rows. The as sole crop along with the tree species hedgerows can be lopped and utilized as components for about 2 years. Thereafter, recommended for the boundary marker. about 70% of these should be harvested, By so doing; the farm's nutrient status leaving the 30% scattered all over the would be maintained with minimal farmland. The cut pigeon pea leaves mineral fertilizer inputs. The peas would would be incorporated into the soil as yield grains, herbal medicine, nodulate green manure. In-between the pea plants, the soil and yield fuelwood. When the staple crops like yams, cassava, maize and yields of the peas start falling, they should millet would be grown. The firewood be clearfelled and new plantings emanating from the pea stems would established in the spaces previously used serve form of the family's energy needs. as alleys. In that rotation, the soil is In irrigated tomatoes and egg maintained rich, thus, establishing the plant farms, Pigeon pea should be grown sustainable low input farming objective as companion crops to boost soil nutrient of agroforestry. status through nodulation and leaf litter Beekeeping could be practised on buid-up. The Pigeon peas would help also Pigeon pea hedge plants or live fences by in controlling nematode population in the mounting hives on the hedges of live soil and improve fruitsyield of the fences, thus broadening the benefits tomatoes and egg plants. derivable from the species as the crops Pigeon pea should form part of the would yield grains for food, fuelwood, various arable crops like yams, cocoyams, fodder for livestock, and protect other okra, fluited pumpkin, pepper, egg plant, crops growing within the farm. Amaranthus , maize, etc that are grown in Pigeon pea could be utilized in the H o m e s t e a d G a r d e n s w i t h t r e e aforementioned ways to foster the components like Dacroydes edulis, benefits derivable from other Treculia africana, Dennetia tripetala, agroforestry systems like cropping Parkia biglobosa, Pentaclethra inbetween belts in shelterbelts; macrophylla, Pterocarpus,Citrus. The silvopastoralism; and agrosilvo- Pigeon pea component would provide all pastoralism as well as improved fallows other benefits highlighted above to restore soil fertility in the fallow especially, in taking care of some system. healthcare needs of the family members. In the Scattered Farm Tree model, References where larger acreages of farms are usually Abuzar S. and Haseeb a. (2009). Bio- cropped, Pigeon pea could be planted as Management of Plant-Parasitic hedges as boundary markers round the Nematodes in Pigeon Pea Field Crop farm holdings. Loppings from the hedges Using Neem-Based Products and

130 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Manurial Treatments World Applied tion under semi–arid conditions, using Sciences Journal 7 (7): 881-884, 2009 FAO dual crop coefficient method I S S N 1 8 1 8 - 4 9 5 2 © I D O S I with water stress compensation. Publications. Ae, N.; Arihara, J.; Agricultural Water Management Okada, k.; Yoshihara, T.; Johnson, C. 10:1016 – 1026. (1990). Phosphorous uptake by Duke, J.A. (1981) Handbook of Legumes pigeon pea and its role in cropping of World Economic Importance. systems of the Indian subcontinent Plenum Press, New York. Pp33-37. science, 248: 477 – 480. Duke, J.A. (1983) Handbook of Energy Aiyeloja, A.A and Bello, O.A. (2006). Crops. Centre for New Crops & Plant Ethnobothanical potentials of Products. Purdue University common herbs in Nigeria: A case (published via internet) 118pp. study of Enugu State. Educational Emefiene, M. E., Joshua V.I., Nwadike C., Research and Review1:16 – 22. Yaroson, A.Y., Zwalnan, N. D. Akinola, J. O. and Whiteman, P. C. E.(2018). Profitability Analysis of (1972). A numerical classification of Pigeon Pea (Cajanus Cajan) Cajanus cajan(L)Millsp. accessions Production in Riyom Lga of Plateau based on morphological and State. Academic Journal of Interdisciplinary Studies, Vol 3 No 7, agronomic attributes. Australian MCSER Publishing, Rome-Italy, E- Journal of Agricultural Research ISSN 2281-4612, ISSN 2281-3993, 2 6 ( 1 ) 5 7 - 6 6 d o i : 1 0 . 1 0 7 1 / A R G Doi:10.5901/ajis.2014.v3n7p44. 9750057. Esan V.I and Ojemola O. I. (2018). Arif, M, Rehman, A., Saeed, M, El-Hack, Evaluation of Production Systems, M.A., Alagawany,A., Abbas,H, Traditional Knowledge of Pigeon Pea A r i a n , M . A . , F a z l a n i , S . A . , (Cajanus cajan) and Risks of Hussain,A.I., Ayasan,T.(2017). Effect Extinction of Pigeon Pea, Jack Bean of different processing methods of (Canavalia ensiformis) and Lubia pigeon pea (Cajanus cajan) on Bean (Lablab purpureus) in Some growth performance, carcass traits, Parts of South West Nigeria. Journal and blood biochemical and of Experimental Agriculture hematological parameters of broiler International, 21(4): 1-11, 2018; chickens. 2017. Turkish Journal of Article no. JEAI. 39835 ISSN: 2457- Veterinary and Animal Sciences. 41: 0591 38-45, doi:10.3906/vet-1602-11 Ezeifeka,G. O.,Orji, M.U., Mbata, T. I. Ashidi, J.S., Houghton, P. J., and a n d P a t r i c k , A . O . ( 2 0 0 4 ) Hylands, P. J. (2004). Phytotherapy Antimicrobial Activities of Cajanus Research, 18(2):128-130. cajan, Garcinia cola and Xylopia Ayenan, M., A., T., Danquah, A., Ahoton, a e t h i o p i c a o n P a t h o g e n i c L., E., & Ofri, K. (2017). Utilization microorganisms. Biotehnology;3(1); and farmers' knowledge on pigeonpea pg41-43; diversity in Benin, West Africa. Faris D. G., Saxena K.B., Mazumdar, S., Journal of Ethnobiology and Singh, U. (1987). Vegetable pigeon E t h n o m e d i c i n e 1 3 p . D O I pea: A promising crop for India: 10.1186/s13002-017-0164-9 International Crop Research Institute Bodner, G.; Loiskandi, W.; Kaul, H.P. for the Semi Arid Tropics, Patancheru, (2007).Cover crop evapotranspira- AP, India.

131 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Fiacre Z, Adoukonou-Sagbadja,H., ISSN 2250-3153 www.ijsrp. Ahoton Léonard,A., Vodouhê org12(3):243-248. R.Ahanhanzo C. 2018. Quantitative Kwesiga, F.; Akinnifesi, F.K.; Analysis, Distribution and Traditional Mafongoya, P.L.; McDermot, M.H.; Management of Pigeon Pea [Cajanus Agumya, A. (2003). Agroforestry Cajan (L.) Millsp.] Landraces' research and development in Southern Diversity in Southern Benin. Africa during the 1990s: Review and European Scientific Journal March challenges ahead. Agroforestry 2018 edition Vol.14, No.9 ISSN: 1857 Systems. 59: 173 – 186. – 7881 (Print) e - ISSN 1857- 7431. Lose S.J, Hilger T.H, Leihner D.E, 1 8 4 . D o i : Kroschel J. 2003. Cassava, maize and 10.19044/esj.2018.v14n9p184, tree root development as affected by URL:http://dx.doi.org/10.19044/esj. various agroforestry and cropping 2018.v14n9p184 systems in Bénin, West Africa. Agric Heuzé V., Thiollet H., Tran G., Delagarde Ecosyst Environ. 2003;100:137–51. R., Bastianelli D., Lebas F., 2016. Mapa, R.B. and Gunasena, H.P.M. (1995) Pigeon pea (Cajanus cajan) forage. Effect of alley cropping on soil Feedipedia, a programme by INRA, aggregate stability of a tropical C I R A D , A F Z a n d Alfisol. Agroforestry Systems 32:237 FAO.http://www.feedipedia.org/node – 245. /22444 Mashood, A. (2009). Directorate of Pulse Hutchinson,J. and Dalzel,J.M.;Flora of Research, Kampur, India.15pp. west Africa;The British West African Mize, C.W., Brandle,JR, Schoeneberger, Territories, Liberia, the French and MM, Bentrup, G. 2008. Ecological Portuguese Territories South Development and Function of Lattitude 18 N to Lake Chad and Fernando Po;London Crown Agents Shelterbelts in Temperate North (1954)pp489-524. America.USDA Forest Service – ICRAF (1997). Redefining Agro forestry National Agroforestry Center – and opening Pandora Box. University of Nebraska, Lincoln, Agroforestry Today 9(1) ICRAF, Faculty Publications Nairobi, Kenya: 7 – 8. Morton, J.F.1976. The pigeon pea International Cereal Research Institute of [Cajanus cajan(L.)Millsp.], a high Semi Arid Tropics (ICRISAT). protein tropical bush legume. (1999)15 years of progress; Hortscience 11(1):11-19.' Government of Japan Project at Myaka F.M, Sakala W.D., Adu-Gyamfi ICRISAT 1984-99 (Adu-gyamfi, J.J, Kamalongo D, Ngwira A, Odgaard J.J.ed).1-2 Ohwashi, Tsukuba, Ibaraki R, Nielsen N.E, Høgh-Jensen H.2006. 3005-9851, Japan and Patancheru 502 Yields and accumulations of N and P 324, Andhra Pradesh, JIRCRAS and in farmer-managed intercrops of ICRISAT 32 pp. maize-pigeonpea in semi-arid Africa. Izekor, D. N. and Ajobi, R. 2016. Impact Plant Soil. 2006;285:207–20. Of Taungya Farming S On Rural Nao Tran Van (1978) Agrisilviculture: F a r m e r s I n E d o S t a t e , Joint production of food and wood. Nigeria.Nigerian Journal of Paper at the 8th World Forestry Agriculture, Food and Environment. Congress, Jakarta, Indonesia.16pp.

132 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Nwogwugwu, J.O., Olomola, D.B. and Phatak, S.C.; Nadimpalli, R.G.; Tiwari, Igboanugo, A.B.I. (2009).Evaluation S.C.; Bhardwaj, H.L. (1993) Pigeon of Cajanus cajan(L)Millsp. to a peas: Potential new crop for the sout population of rootknot nematode heastern United States. In; Janick, J. (Meloidogyne javanica). Paper and Simon, J.E (Eds.). New crops presented at the 18 t h Annual Wiley, New York :597 – 599. Conference of Botanical Society of Saxena, R., K., Varma Penmetsa, R., Nigeria, 2009, BUK, Kano, Upadhyaya, H., D., Kumar, A., Nigeria.9pp. Carrasquilla-Garcia, N., Schlueter, J., Odeny, D.A. (2007). The Potentials of A., Farmer, A., Whaley, A., M., Sarma, pigeon pea [Cajanus cajan (L) B., K., May, G., D., Cook, D., R., & Millisp.] in Africa. Natural Resources Varshney, R., K. (2012). Large-scale Forum 3: 297 – 305. development of cost effective single- Odewale, M. A., Asinwa, I. O., Kazeem- nucleotide polymorphism marker Ibrahim, F and Iroko, O.A ssessment assays for genetic mapping in pigeon of the Productivity of Resource Use in pea and comparative mapping in Taungya and Non -Taungya Land Use legumes. DNA Research.19(6): in Olokemeji Forest Reserve, Ogun 449–461. State. Journal of Forestry Research Seleman, K., Kaoneka, Rachit, K., and Management. Vol. 14 (1), 61-70; Saxena, Said, N., Silim, Damaris, A., 2017, ISSN 0189-8418 www.frin. Odeny, Nadigatla, Rao, Hussein, A., gov.ng/frin1/journals.html Shimelis, Moses, Siambi, Rajeev, K., Onim, J.F.M; Mathura, M.; Otieno, K.; & Rarshney. (2016) Pigeon pea breeding in eastern and southern Fitzhugh, H.A. (1990).Soil fertility Africa: challenges and opportunities. changes and response of maize and Plant Breeding 135: 148–154 beans to green manures of leucaena, Sheahan, C.M. 2012. Plant guide for sesbania and pigeon pea.Agroforestry pigeonpea (Cajanus cajan). USDA- Systems 12:197 – 215. Natural Resources Conservation Osuagwu, C.G. (2010). Mechanism of the Service, Cape May Plant Materials antisickling effects of Cajanus cajan Center. Cape May, NJ. 08210. and phenylalanine. Nigerian Journal Sheel Sharma, Nidhi Agarwal and Preeti of Biochemistry and Molecular Verma. 2011. Pigeon pea (Cajanus Biology 25 (2): 68 – 71. cajan L.): A Hidden Treasure of Osuagwu, C.G. and Mbeyi, C. Regime Nutrition. Journal of (2007).Altered sickle cell disease, Functional and Environmental plasma hexose sugar metabolism in Botany, Volume 1, Number 2, sickle cell anaemia. African Journal of November, 2011, 91-101 Biochemistry 1 (30): 37 – 40. Sogbedji, J. M.; vanES, H. M. and Oswald, A.and Ransom, J.K. (2001). Agbeko, K.L. (2006). Cover cropping Striga control and improved farm and nutrient management strategies productivity using crop rotation. Crop for maize production in western Protection 20:113 – 120. Africa. Agronomy Journal 98:883 – Parrotta, J.A, 2001.Healing Plants of 889. Peninsular India.CABI Publishers, Tegegne,F., S.P. Singh, D. Duseja, E. Wallingford, UK and New York.917p. Ekanem and R. Bullock. (2012).

133 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Pigeonpea as a Niche Crop for Small Forestry, University of Liberia.11pp. Farmers. Journal of Food Distribution Yeboah, E., Fening J.O and Ampontuah, Research Volume 43, Issue 1, March E.O. 2004. The use of Pigeonpea 2012. (Cajanus cajan) for amelioration of Tufour, K. (1981). Research Trends in Ultisols in Ghana, In: Bationo, A (ed.). Agroforestry.Paper at First Annual “Managing Nutrient Cycles to Sustain Symposium on “Self-sufficiency in Soil Fertility in Sub-Saharan Africa”. Food production in Liberia”.Dept. of Pp 401-410.

134 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Effects of Lima Bean (phaseolus Lunatus) Production on some Enzymatic Activities and Soil Biological Properties

Ezaka E1*., Taiwo L.B1., Uthman A.C.O1. and Oyedele O. A1 1Institute of Agricultural Research and Training, Obafemi Awolowo University, Moor Plantation, Ibadan Corresponding Authors email: [email protected]; +2348063289776

Abstract Lima-bean (Phaseolus lunatus) is a tropical legumes cultivated for its edible seed. The influence of this legume in restoring soil fertility through enhanced soil microbial activities was studied. The carbon dioxide

(CO2) evolution in the soil under lima-bean and control (without lima-bean) was evaluated using titrimetric method while the enzyme activities:-Phosphatase, Dehydrogenase, Amylase and Urease were carried out using Ultra-Violet spectrophotometer. The physicochemical analyses of the soil were determined using standard methods. The results showed significant difference (P=0.05) in the CO2 evolution on the soil with lima-bean and the control. The results of CO2 evolution in Ibadan (Transition), Ife (Tropical Rain forest), Ikenne (High rain forest), Ilora (Derived savanna) and kishi (Southern Guinea Savannah) were 5.7, 4.9, 8.3,

1.5 and 3.8 mgCO2/g soil, respectively while each control has 2.4, 3.2, 8.9, 0.7 and 6.8 mgCO2/g soils, respectively. Similar trends were observed on phosphatase activity in the soil; Ibadan (26.15 P-nitro g/soil) was significant while that of Ife (14.4), Ikenne (13.4), Ilora (11.10) and Kishi (13.07 P-nitro g/soil) were not significantly different when compared with control (Ibadan-12.78; Ife-12.72; Ikenne-11.20; Ilora-12.81; Kishi-11.97 nitro g/soil). Amylase and Urease activities indicated greater activities in the soil with Lima- bean when compared with control. There was no significant difference in the physicochemical parameters of the soil with Lima-bean and the control. However, the soil with Lima-bean recorded higher % organic carbon and Nitrogen when compared with the control. A significant correlation between dehydrogenase and % total nitrogen as well as sulphur content of the soil was observed. Thus, this study has revealed the importance of Lima bean in improving some chemical and biological parameters in soil.

Key words: Limabean; Soil enzyme activity; Soil respiration; Soil fertility Introduction and axillary flowering. It has thin roots Lima bean (Phaseolus lunatus L.) is a (Baudoin, 2006). The stems may be up to tropical and subtropical legume 4.5-8 m long. The leaves are alternate and cultivated for its edible seeds. There are trifoliate with ovate leaflets, 3-19.5 cm wild and cultivated types of Phaseolus long x 1-11 cm broad. Inflorescences are lunatus, generally referred to as 15 cm long and bear 24 white or violet Phaseolus lunatus var. silvester Baudet bisexual flowers. The fruits are 5-12 cm and Phaseolus lunatus var. Lunatus long, dehiscent pods with 2 to 4 seeds respectively. Lima bean is a herbaceous (Ecoport, 2011; Baudoin, 2006). Seeds plant with two main types of growth are very variable in size, shape and colour. habit. The perennial form is an Cultivar groups have been distinguished indeterminate, vigorous, climbing and according to seed differences (Baudoin, trailing plant, up to 2-6 m tall, with 2006). axillary flowering only. It has swollen Lima bean sprouts, leaves, young pods and fleshy roots up to 2 m long. Annual and green seeds (immature or dry) are lima bean is a pseudo-determinate, bushy edible and eaten as vegetables. The dry plant, 0.3-0.9 m tall with both terminal seeds are eaten boiled, fried, ground into

135 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 powder and baked, and used in soups and stews. The vines, leaves and empty pods Sample collection: The soil samples were collected from lima bean plots from different agro-ecological zones in Southwestern Nigeria. Soil samples were also collected from weed-grown control plots. These samples were collected with sterile container and transferred immediately to laboratory for analysis.

Physicochemical analysis of soil The following physicochemical analysis such as moisture contents, pH, temperature, cation exchange bases, phosphorus,% total nitrogen, % total carbon, sodium, magnesium, potassium, sulphate, chloride, % sand, clay and loam etc were determined on soil from lima bean farm and the control (without lima bean) using standard procedure (Baeta et al., 2006).

Soil Respiration Subsamples (50 g) were weighed and adjusted to 60% of water holding capacity in a plastic tube and placed in bottom of a Duran bottle, 25 ml of 0.05 N sodium hydroxide was pipetted and suspended on

the soil sample to trap evolved CO2 and incubated at 30°C for 7 days. After incubation, the bottles were opened and beakers containing the NaOH solution were emptied into the jar. Five mililiter Barium chloride solution (0.5 M) and some drops of indicator were added into the solution. The CO2 evolution was then determined by titrating the solution with HCl (0.05 M) under continuous stirring until the colour changes to colorless. Determination of Dehydrogenase activities in the soil: The dehydrogenase activity in soil with lima bean and the control(without lima bean) were evaluated. 2-3-5-Triphenyl tetrazolium chloride (TTC) reduction technique Dinder et al ( 2015) was used for the

136 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 estimation of dehydrogenase activity in 2015). To 5 g of sample in a 50 ml soil. One gramme of fresh soil was taken Erlenmeyer flask, 1.5 ml toluene was in a test tube. The soil was then mixed added and the mixture was gently shaken with 0.1 g of calcium carbonate (CaC03) and allowed to stand for 15 minutes. and 1 ml of 1 % TTC solution. The Thereafter, 10 ml distilled water and 5 ml mixture was then shaken and plugged of 2% soluble starch solution were added with a rubber stopper and incubated at 30° to the soil mixture. The flask was C for 24 hours in an incubator. Three stoppered and incubated at 37°C for 5 replicates were maintained in each case. hours. After the incubation, 15 ml distilled The resulting slurry was transferred on water was added to the soil mixture, the Whatman filter paper No.1 and extracted contents were mixed and 10 ml of the with successive aliquots of concentrated suspension was centrifuged at 3000rpm methanol. The volume of the filtrate was and the clear supernatant was filtered read made to 50 ml by adding methanol. The at 600nm using spectrophotometer. optical density of the filtrate was read at 485 nm on Hitachi Spectrophotometer Urease (220), using methanol extract as a blank. The activity of urease was measured by the method of Dinder et al ( 2015). One g Phosphatase activity fresh soil was kept in 100 ml volumetric The soil phosphatase activity was flask and 1 ml of toluene was added. It estimated using the procedure of Dinder was then allowed to stand for 15 minutes et al ( 2015). To 5 g of air dried soil, taken to permit the complete penetration of in a 100 ml conical flask, 1.5 ml of toluene toluene into the soil. Thereafter, 10 ml of was added and mixed well by shaking and buffer (pH 7) solution and 5 ml of 10% then allowed to stand for 15 min. To this, Urea solution were added. The flask was 10 ml of 0.1 M Tris -HC1 buffer (pH 7.0) shaken and incubated at 37°C for 3 hours and 5.0 ml of 0.013 M Disodium phenyl in an incubator. In the control, 10 ml of phosphate in Tris - HC1 buffer (pH 7.0) distilled water was added instead of urea were added. The flask was closed and then solution. After incubation, the volume incubated at 37°C for 3 h. After was made up to 100 ml by adding distilled incubation 10 ml of the suspension was water. The content in the flask was mixed centrifuged (3,000 rpm for 20 min). To thoroughly and was filtered through estimate the phenol released to 1 ml of the Whatman filter paper No. 5. Urease clear supernatant, 1 ml of Folins phenol activity was estimated on the filtrate using reagent (1:1 dilution) and 2 ml of 20% lndophenol blue method.

(w/v) Na2CO3 solutions were added. The mixture was kept in boiling water bath for Results 2 min and then kept in room temperature Influence of lima bean on soil respiration for 20 min. After 20 min the solution was The results of the influence of lima bean brought to a volume (10 ml) and the on microbial soil respiration are presented optical density was measured at 650 nm. in fig 1. Soil respiration in Ikenne soil under Lima-bean was highest when Determination of amylase activity of soil compared to other locations. The The amylase activity of soil was difference in its value was significantly determined in adaptation to the higher than any of the soils in other procedures described by Dinder et al ( locations . Similarly, CO2 was also highest 137 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

in control soil. The least CO2 evolution was obtained in Ilora soil. The results of

138 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Effect of lima beans production on soil chemical properties in different locations chemical properties in different locations Ca Mg K Na CEC % pH P % Mn S B Cu Fe Zn cmo/K cmo/K cmo/K cmo/K H+ cmo/K Org. (H2O) ppm T.N ppm ppm ppm ppm ppm ppm Location g g g g g C Control 5.84 5.12 1.30 0.64 0.34 0.12 7.52 4.8 1.87 0.16 54.8 16.2 0.07 1.66 96.47 2.85 Ibadan 5.85 5.66 1.84 0.36 0.39 0.12 8.37 10.6 1.96 0.18 54.9 15.61 0.08 0.56 159.1 1.17 Control 5.58 1.94 0.94 0.34 0.54 0.13 3.90 4.39 2.09 0.04 87.0 15.5 0.09 0.71 123.4 1.54 Ife 5.79 2.21 0.79 0.39 0.24 0.12 3.75 4.01 2.54 0.19 58.2 5.23 0.01 0.85 145.5 1.40 Control 5.45 3.86 1.82 0.51 0.35 0.14 6.67 8.08 1.90 0.18 61.0 15.3 0.16 1.12 148.1 2.30 Ilora 5.80 1.96 0.72 0.41 0.28 0.12 3.49 9.94 0.70 0.19 41.3 5.38 0.03 1.02 157.9 1.53 Control 5.37 2.87 0.73 0.71 0.30 0.14 4.75 11.9 1.22 0.14 18.8 9.24 0.02 0.53 116.3 1.20 Ikene 5.70 2.19 0.64 0.27 0.39 0.13 3.60 5.47 1.50 0.14 51.8 9.26 0.04 0.86 166.8 2.15 Control 5.64 1.19 0.45 0.38 0.21 0.13 2.36 8.39 0.59 0.05 33.0 4.75 0.03 0.32 153.6 1.01 Kishi 5.89 2.85 0.91 0.54 0.24 0.12 4.66 6.45 0.55 0.06 56.7 7.49 0.05 0.93 106.3 1.38

Table 2: C orrelation betw een the C O 2 evolution/enzym e activities and chem ical param eters of the soil

Physicochem ical A m ylase Phosphatase D ehydrogenase U rease C O 2 evolution param eters pH (H 2O ) 0.66 0.46 0.37 0.34 0.12 Ca -0.13 0.39 -0.08 0.13 0.30 M g -0.28 0.18 -0.39 -0.14 -0.14 K -0.27 0.06 0.05 -0.03 0.31 N a -0.03 -0.21 -0.51 -0.31 -0.03 H + -0.06 -0.46 -0.37 -0.34 -0.12 CEC -0.21 0.33 -0.20 0.03 0.23 P -0.20 -0.08 0.13 0.09 0.15 O rg. carbon -0.01 -0.09 -0.63 -0.24 0.05 % T otal N 2 -0.16 -0.16 -0.66** -0.33 0.02 M n -0.14 0.07 -0.55 -0.37 -0.28 S -0.12 0.02 -0.60** -0.25 0.14 B -0.14 -0.25 -0.53 -0.53 -0.49 Cu -0.08 0.13 -0.41 -0.12 0.19 Fe 0.30 -0.13 -0.06 0.20 -0.25 Zn 0.16 0.14 -0.51 -0.08 0.20

139 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 presented in fig.4. The results of urease influenced microbial activities. Our activities were presented in fig.5. The results for phosphatase activity were results from Ibadan, Kishi and Ilora were consistent with the findings of Elcio and significantly different (P=0.05) when the Julio, (2010) who reported improved results from soil with lima bean were Phosphatase activity under coffee culture. compared with the control while in Ife Phosphatase is enzymes that catalyze the and Ikene the results were not hydrolysis of both esters and anhydrides significantly different (P=0.05). of H3PO4. It is very importance in soil organic P mineralization and plant Discussion nutrition (Tabatabai, 1994; Dick, 1997). Lima bean has great potentials in High metabolic microbial activities in the improving soil fertility; this is evidenced soil enhances phosphatase sources in soil by the improved microbial activities on and leads to production of high amounts the soil where-lima beans were planted of enzymes (Elcio and Julio, (2010). when compared to the results from Though there is no significant difference unplanted soil. The results of soil in the Dehydrogenase and Phosphatase respiration were higher on the soil planted activity in different location when areas with lima bean which is an indication of with and without lima bean were improved microbial activities; this may compared but the Dehydrogenase and be as a result of improved metabolic amylase activity were still higher on the activities of microorganisms in the area. areas with lima bean. The pattern of This agrees with the work of Diogenes et Dehydrogenase activity in the present al.(2017) who reported an increase in study indicates that soil microbial microbial activities on the soil planted metabolism was enhanced by lima-bean. with leguminous crop. The increase in The results correlated with the finding soil respiration may be due to increased by Bolton et al. (1985) who revealed that metabolic activities of the soil dehydrogenase levels in eastern microorganisms and that can be as result Washington were always higher in of rapid transformation of organic waste legume green manured than in chemically into nutrients for plants. This is in line fertilized soils of winter wheat production with the findings of Tu et al. (2006) who systems. reported increased microbial activities on The results of urease were also the soil with leguminous crop. The higher on the area with limabean when increase in soil respiration on the plots compared to the control. The range of containing lima bean may also be as a urease activity was comparable with the result of increase in moisture content of findings of Klose and Tabatabai (1999) the soil because respiration is limited in and Silveira (2007). Urease is an enzyme dry soils because of lack of moisture for that catalyses hydrolysis of urea into CO2 microbial activity. The results of this and HN3 which is a very important work also agreed with the results of Zahir processes in the regulation of Nitrogen et al. (2010) who reported a consistently supply to plants. Large reduction in urease greater soil respiration in legume based activity may affect plant growth and yield. rice wheat plot than in fallow based rice The increase in urease activity in the areas plot. with lima bean may be as a result of The average values of enzyme addition of large residue which stimulates activities indicated that lima bean microbial activities. It can also be as a

140 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 result of the ability of the plants to microbial populations and activities produce substrates which activate urease as influenced by legume green fallow synthesis (Nannipieri et al., 1996). in a semiarid climate. Soil Biology Chirinda et al., (2008) observed that high and Biochemistry, 37: 1775-1784 C and N inputs enhanced microbial Chirinda, N., Olesen , J.E. and Porter, activity in the cropping system J.R. (2008). Effect of organic matter experiment. Similar to the results with input on soil microbial properties and respect to responses of microbial crop yields in conventional and activities on soil planted with lima bean organic cropping systems. 16th were also observed in other studies IFOAM Organic World Congress, (Biederbeck et al., 2005) where microbial Modena, Italy, June 16-20, 2008 activities in terms of dehydrogenase (Archived at http://orgprints. (202%), phosphatase (171%) and org/view/projects/conference.html). arylsulfatase (287%) were obtained in Baudoin, B. (2006). Record from cropping involving green legumes when Protabase. Brink, M. and Belay, G. compared with fallow-wheat. (Editors). PROTA (Plant Resources of The results of physicochemical Tropical Africa / Ressources properties of the soil showed an increase végétales de l'Afrique tropicale), in CEC on soil planted with lima bean Wageningen, Netherlands. when compared with the control. Bolton, H. Jr., Elliot, L.F., Papendick, R.I. Percentage organic carbon was also and Zendicek, D.F. (1985). Soil higher in most of the location when microbial biomass and selected soil compared with soil from the areas enzyme activities: effect of without lima beans. Higher percentage fertilization and cropping practices. total nitrogen was also observed on the Soil Biology and Biochemistry, areas with lima beans. This agrees with 17:297-302. the findings of Nweke (2016) who Dinder E, Sagban F.O. and Baskaya, reported a slight increase on the H.S.(2015). Evaluation of soil physicochemical properties of soil with enzyme activities as soil quality leguminous crop when compared with indicatiors in sludge-amended soils. control. Armstrong et al.(2010) also Journal of Environmental Biology, reported an increase in total nitrogen on 36:919-926. the soil with leguminous crop. The results Ibeawuchi, I. I.(2007). Landrace legumes: of the work has revealed that lima bean synopsis of the culture, importance, can be of help in enhancing microbial potentials and roles in agricultural activities in the soil and that will help in production systems. Journal improving soil fertility. Biological Science, 7 : 464-474 Nannipieri, P., Giagnoni, L. and References Renella, G.(2011). Role of Elcio, L. B. and Julio, C. D. C.(2011). phosphatase enzymes in soil. In: Microbial activity in soil cultivated Bunemann E.K., Oberson A., with different summer legumes in Frossard E. (Eds.), Phosphorus in coffee crop. Revista Brasileria de action. Springer-Verlag, Berlin, Ciencia do Solo, 34:806-57 Heidelberg, Pp. 215-243. Biederbeck, V.O., Zentner, R.P. and Nweke, I. A. (2016). Influence of different Campbell, C.A. (2005). Soil

141 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

leguminous crop on the ultisol that Klose, s. and Tabatabai, M.A. (1999). had been contineously cropped to Urease activity of microbial biomass cassava /maize for over six years. in soils. Soil Biol. Biochem, 31:205- Journal of soil science and 211. Environmental management, 7:222- Nannipieri, P. Sequi, P and Fusi, P.(1996). 229. Humus and enzyme activitie. In Beata, E.M., James, B.R., Pedro, L.O.A, PICCOLO, A. ED Humic substances Machado C.M, Elemo, T. and in terrestrial ecosystems. Amsterdam, Gregory, W.M. (2006).Mid and near Elsevier. Pp. 293-298 infrared spectroscopic assessment of Zahir,S. S. and Rashd, A and Hidayatur, R soil compositional parameters and ( 2010). Soil microbial biomass and structural indices in two ferralsols. activities as influenced by green Spectroscopy letters, 38: 721-740. manure legumes and N-fertilizer in Armstrong, R. D, Kushkopf, B.J., rice-wheat system. Parkistan Journal Millar, G. and Standley, J. (1999). of Botany, 42:2589-2598 Changes in soil chemical and Tabatabai, M.A. (1994). Soil enzymes. In: physical properties following Weaver, R.W., Angle, S., Bottomley, legumes and opportunity cropping on P. (Eds.), Methods of Soil Analysis. a cracking soil. Australian journal of Part 2: Microbiological and experimental agriculture, 39:445-56. Biochemical Properties. Soil Science Dick, R. P. (1997). Soil enzymes Society of America, Madison, Pp. activities as integrated indicators of 775–833. soil health. In Pankhurst, C.E; Kelly, J.J. ( 2003). Molecular techniques Double, B.M and Gupta V.V.S.R, eds. for the analysis of soil microbial Biological indicators of soil health. processes: functional gene analysis Wallingford CAB international, and the utility of DNA microarrays. 1997. Pp.121-156 Soil Sci. 168: 597–605.

142 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Productivity of Lima bean (phaseolus lunatus l.) Cultivars as influenced by NPK fertilization and staking in Northern Guinea and Sudan Savannah Zone, Nigeria*

1*Nasidi, Y. A., 1J.A.Y Shebayan., 1U. Ibrahim and 1Muhammad A.A 1Department of Agronomy, Faculty of Agriculture, Ahmadu Bello University, Zaria, Nigeria *Corresponding authors; [email protected]

Abstract Lima beans (Phaseolus lunatus L.) are alternative food and income sources for the population of Nigeria. In this region, lima beans are consumed either as green or dry grains. However, low yields have been observed, a challenge that could be overcome by adequate mineral fertilization. This work intended to assess lima beans yield, cultivar, and staking as affected by doses of mineral NPK fertilization. Pod yields were analyzed, as well as the economic revenue for pods. To measure the economic efficiency, pods and dry grains were employed as the exchange units. The lack of improved cultivars (Santos et al., 2002) and the habit of sowing with no organic and mineral fertilization contribute to the low yield levels and poor economic revenues, practically turning Lima beans into a subsistence crop. Thus, only production surplus is trade, usually, in local street free markets (Frazão et al., 2004). It is a high nutrient demanding species, and may extract 135 kg ha-1 of 91 of N, 81 of Ca, 30 of P, and 11 of Mg (Hester et al., 1951). According to Filgueira (1981), only P should be supplied in planting fertilization, unless the soil is poor in K. In this case, both K and N should be used. Increase in Lima beans yield as consequence of mineral fertilization is largely documented (Vieira et al., 1992; Frazão et al., 2004; Oliveira et al., 2004). Field trials were conducted during 2018 wet season at the Institute for Agricultural Research (IAR), Samaru,. Faculty of Agriculture, Ahmadu Bello University, Zaria and National Institute for Horticultural Research (NIHORT) Bagauda to evaluate the productivity of lima bean cultivars as influenced by NPK fertilization and staking. Treatments comprised of two Cultivar (C1and C2), two staking (staked and non-staked) and four NPK (15:15:15) compound fertilization rates (zero kg/ha, 150 kg/ha, 300 kg/ha and 450 kg/ha) laid out in a Randomized Complete Block Design replicated three times. Results revealed that lima bean cultivar C1 recorded higher LAI and CGR thus out-yielded C2 cultivar while vine length, branches and pod numbers were not significantly affected by cultivar. Stalking registered longer vines, higher branches and higher LAI than non stalked beans. It resulted in highest total grain yield than non-staked crop in Bagauda. Application of 450 kg ha-1NPK rate out yielded other rates in total grain yield of lima bean and other parameters. It could be concluded that cultivar C2 out-performed C1 in growth and yield parameters assessed, staking recorded higher values of these parameters and application of NPK fertilizer up to 450 kg ha-1 improved growth and yield of lima beans.

Key words: Lima bean, NPK, Staking and Cultivar Introduction as reported by (Lioi and Gallasso, 2001). Lima bean (Phaseolus lunatus L.) is one The wild lima bean is one of the few of the five cultivated Phaseolus spp. It is species for which multiple domestication believed to have originated from events have been documented, giving rise Guatemala, Mexico and Peru. Lima bean to three culti- groups, namely the 'Sieva' comprises of two botanical cultivars: P. and 'Potato' which are small- seeded and lunatus var. silvester (wild types) and P. the large- seeded types called 'Big lima' ( lunatus var. lunatus (domesticated types). Maquet et al., 1999). The distributions of The P. lunatus var. Silvester belongs to the both types were from the Pacific foothills Mesoamerica and Andean origin. P. of Mexico, through the Central and South lunatus var. lunatus comprises of a Americas to Southern Canada (Gutiérrez- smaller group of intermediate genotypes Salgado et al., 1995 and Rafael, 2001). It

143 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

was later spread to Southern Asia and could be attained (Ecocrop, 2011). Lima extended to West and Central Africa. Van bean straw (dried vines left after harvest) provides hay to cattle and sheep. Dairy cows can be fed on young vines which are highly nutritive (Ishler and Adams, 2010). Vines cut at stage where leaves are still green promote high intake. The vines can easily be converted into silage (Ishler and Adams, 2010) and fed to growing and milking cows. Ajayi (2011) indicated that silage made from young vines before flowering, incorporated with fresh Napier grass (Pennisetum purpureum) and pineapple increased dietary protein content, nutrient digestibility, nitrogen absorption and retention and reduction in weight loss of goats during the dry season. In addition, silage made from vines of lima bean, as compared to other crops such as cajan pea or African yam bean, produced optimal growth rate and weight gain in goats (Ajayi et al., 2012). Leaves and seeds of lima bean contain toxic substances such as cyanogenicglucosides and linamarase, which have the potential to cause rapid respiration, drop in blood pressure, headache, vomiting and convulsions (Heuzé et al., 2013). Baudoin (2006) intimated that domesticated species contain a lower amount of cyanoglucosides (100-120 ppm) as compared to wild species (2000-2400 ppm). Cyanogenic potential varies with respect to maturity, stage of development, genotype and cultivation conditions. Young leaves and seeds have higher HCN (hydrogen cyanide) potential as compared to older leaves (Ballhorn et al., 2005). It is important, therefore, to soak seeds overnight and cook lima beans properly to ensure most of the HCN is removed. The objectives of this study were to determine optimum fertilization rate and effect of staking on productivity of lima bean

144 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

cultivars. 4.0L/ha was applied on the day of sowing. All herbicides were applied using CP3 Materials and Method knapsack sprayer fitted with a green The trials were conducted during 2018 deflector nozzle kept at a pressure of cropping season simultaneously at two 2.1kg/cm2 to deliver 250L of spray locations namely Institute for solution per hectare. The crop was Agricultural Research (IAR), Samaru fertilized basal, according to treatment, 0 0 (Latitude 11 11'N, Longitude07 38'E and using NPK 15:15:15 in holes 5cm deep 686meters above sea level) and National made between each two stands. The Institute for Horticultural Research stakes were installed according to 0 (NIHORT) Bagauda (Latitude 11 53 treatment at six weeks after sowing and 0 Longitude N 8 14'E and 440meters above connected with polyethene rope. The lima sea level) in northern Guinea and Sudan bean was trailed to the polyethene rope Savannah ecological zones of Nigeria, and poles using plastic twines. Every plot respectively. The treatments were out in a had nine stakes each 2m long. The poles Randomized Complete Block Design were placed on the stakes while (RCBD) replicated three times. Duncan polyethene rope was used to connect the Multiple Range Test was used to separate poles. At 6 weeks after sowing (WAS) the the means. Soils of the experimental site crop was given a prophylactic spray of a were analyzed for physical and chemical mixture of recommended insecticide(s) properties before the experiment. and fungicide(s) at recommended rates. Meteorological data were collected from Further sprays were done at fortnightly both locations during the period of the intervals until completion of harvest. The experiment (appendix 1 and 2). The data crop was continuously harvested as pod are presented in Table 1. Land was mature, dried and processed to collect the ploughed, harrowed and prepared into data on yield and yield components. The ridges 75cm wide before planting. Gross number of branches, emanating from the plot comprised 6 ridges, each 5.0m long main vine, from 3 tagged plants in each 2 (22.5m ), while net plot comprised of 4 net plot was counted and the mean 2 inner ridges each 4.0m long (12.0m ). computed and recorded at 3, 6, 9 and Planting was done immediately after land 12WAS. The vine lengths of 3 tagged preparation. Seeds were dressed with plants from each plot was measured from (R) Apron Star 50DS (Mefenaxon-200g/kg, the ground level to the tip of the shoot of a Difenoconazole-20kg/g and Thiame- growing plant using measuring tape, and thoxam-200g/kg) at the rate of one sachet the mean was recorded. This was done at (10grams) per 4kg of seed. Three dressed 3, 6, 9 and 12WAS. Number of pods seed were sown per stand. Sowing was produce per plant were determined by th done on 30 May, 2018. At two weeks counting the total number of pods from after sowing the crop were thinned to 2 the 3 tagged plants in each net plot over plants per stands. A pre-emergence several harvests, the mean was computed (R) herbicide, pendimethelin (Stomp and recorded. The length of 10 mature 455g/l), at 4.0L/ha was mixed with pods sourced from the third picking in (R) paraquat (Gramoxone 200g/l) at each net plot at harvest was measured

145 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Effect of cultivar, staking and fertilization on vine length of Lima bean at Samaru and Bagauda, 2018 wet season

Vine Length (cm) Samaru Bagauda Treatment 3WAS 6WAS 9WAS 12WAS 3WAS 6WAS 9WAS 12WAS Cultivar(C) C1 19.98 64.71 169.83 254.38 19.64 73.12 148.08 212.25 C2 21.28 66.00 167.08 247.50 20.29 107.80 151.66 199.50 SE+ 0.9204 1.7549 2.9354 4.3090 0.9191 24.5339 6.0389 5.6204 Staking(S) Staked 21.70 6 4.92 169.83 267.67a 20.15 106.63 155.71 207.71 Non-staked 19.55 6 5.79 167.08 234.21b 19.78 74.28 144.03 204.04 SE+ 0.8471 1.7549 2.9354 4.3090 0.9191 24.5339 6.0389 5.6204 NPK Rate(F) 0.00kg/ha 16.46b 49.08c 158.25b 236.92b 17.61b 55.51a 138.50b 1 9 8.08b 150kg/ha 18.15b 53.58c 155.67b 240.92b 17.82b 64.04a 126.07b 180.58b 300kg/ha 20.34b 71.17b 177.17a 249.58b 20.65ab 79.68a 147.25b 202.75b 450kg/ha 27.57a 87.58a 182.75a 276.33a 23.78a 162.59a 187.67a 242.08a SE+ 1.3016 2.4819 4.1513 6.0939 1.2999 34.65 8.5404 7.9484 Interaction C X S NS NS NS NS NS NS NS NS C X F NS NS NS NS NS NS NS NS S X F NS NS NS NS NS NS NS NS C X S X F NS NS NS NS NS NS NS NS Means within the same treatment group or column followed by unlike letter(s) are significantly different at 5% level of probability using Duncan Multiple Range Test (DMRT). WAS = Weeks after sowing NS = Not significance at 5% level of probability using centimeter rule and the mean pod number in both locations. Increasing NPK -1 length was recorded. The numbers of fertilizer rate up to 450 kg ha had significant effect on these parameters of lima bean in both locations. Table 6 presents effect of fertilization and staking on grains per pod and yield of lima bean cultivars at Samaru and Bagauda. C1 recorded higher grains per pod than C2 at Samaru. This was reversed at Bagauda for grain yield. Staking recorded similar grains per pod in both locations. At bagauda, staked beans out-yielded non staked crop. Increasing NPK fertilizer rate up to 450 kg ha-1 recorded a linear increase in grain per pod and grain yield in Samaru and Bagauda respectively. There were no significant treatment interactions on grains per pod and yield of lima bean cultivars at Samaru and Bagauda in both locations.

Discussion Cultivar differences on parameters

146 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 2: Effect of cultivar, staking and fertilization on number of branches per plant of Lima bean at Samaru and Bagauda, 2018 wet season

Number of Branches/Plant Samaru Bagauda Treatment 3WAS 6WAS 9WAS 12WAS 3WAS 6WAS 9WAS 12WAS Cultivar(C) C1 3.167 5.750 8.625 12.208 2.875 5.250 6.542 10.125 C2 3.125 5.667 8.542 11.875 2.667 5.292 6.583 10.000 SE+ 0.1667 0.1943 0.2057 0.1669 0.1261 0.1346 0.1315 0.2366 Staking(S) Staked 3.167 5.875 8.875 12.417a 2.833 5.333 6.625 10.083 Non-staked 3.125 5.542 8.292 11.667b 2.708 5.208 6.500 10.042 SE+ 0.1667 0.1943 0.2057 0.1669 0.1261 0.1346 0.1315 0.2366 NPK Rate(F) 0.00kg/ha 2.500b 4.667c 7.917b 10.500c 2.667a 4.6 67c 5.917b 8.667c 150kg/ha 3.167ab 5.583b 8.083b 11.667b 2.750a 4.8 33bc 6.2 50b 9.417c 300kg/ha 3.250a 5.833b 8.583b 11.750b 2.750a 5.250b 6.833a 10.417b 450kg/ha 3.667a 6.750a 9.750a 14.250a 3.083a 6.333a 7.250a 11.750a SE+ 0.2357 0.2747 0.2909 0.2359 0.1784 0.1903 0.1860 0.3346 Interaction C X S NS NS NS NS NS NS NS NS C X F NS NS NS NS NS NS NS NS S X F NS NS NS NS NS NS NS NS C X S X F NS NS NS NS NS NS NS NS Means within the same treatment group or column followed by unlike letter(s) are significantly different at 5% level of probability using Duncan Multiple Range Test (DMRT). WAS = Weeks after sowing NS = not significance at 5% level of probability

Table 3: Effect of cultivar, staking and fertilization on leaf area index (LAI) of Lima bean at Samaru and Bagauda, 2018 wet season

Leaf Area Index (LAI) Samaru Bagauda Treatment 3WAS 6WAS 9WAS 12WAS 3WAS 6WAS 9WAS 12WAS Cultivar(C) C1 0.660 1.118 1.986 2.760 0.594 0.939b 1.437 2.487 C2 0.676 1.142 1.973 2.919 0.621 1.015a 1.3 62 2.455 SE+ 0.0202 0.0239 0.0459 0.0589 0.0239 0.0257 0.0704 0.0661 Staking(S) Staked 0.655 1.1 13 2.080a 2.849 0.624 0.9 80 1.428 2.546 Non-staked 0.682 1.1 46 1.879b 2.829 0.590 0.9 73 1.370 2.396 SE+ 0.0202 0.0239 0.0459 0.0589 0.0239 0.0257 0.0704 0.0661 NPK Rate(F) 0.00kg/ha 0.442d 0.916c 1.730c 2.415c 0.362d 0.803c 1.194b 2.267bc 150kg/ha 0.559c 0.978c 1.835c 2.678b 0.478c 0.849c 1.207b 2.146c 300kg/ha 0.735b 1.105b 2.042b 3.067a 0.662b 1.003b 1.489ab 2.437b 450kg/ha 0.936a 1.521a 2.311a 3.199a 0.662a 1.253a 1.707a 3.034a SE+ 0.0285 0.0338 0.0650 0.0833 0.0338 0.0363 0.0996 0.1118 Interaction C X S NS NS NS NS NS NS NS NS C X F NS NS NS NS NS NS NS NS S X F NS NS NS NS NS NS NS NS C X S X F NS NS NS NS NS NS NS NS Means within the same treatment group or column followed by unlike letter(s) are significantly different at 5% level of probability using Duncan Multiple Range Test (DMRT). WAS = Weeks after sowing NS = Not significance at 5% level of probability

147 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

assessed were observed in this study. branches of the crop (Adeniyan et. al, Cultivar 1 recorded higher values of LAI, 2007). With provision of a strong support, CGR, shorter pods and yielded lower than staking has a positive effect on the crop by cultivar 2. The two cultivars were similar allowing the growth habit of the plant in other parameters assessed. This is (vegetative adaptation), and results in the expected as both were local cultivars with crop growing faster. Stakes support the similar phenotypic expression but differ weak, long and twisted stem and branches in size and texture. However, C2 was enabling reproductive adaptation (which physically larger in seed size with higher numbers of leaves and branches than C1. results in pods distributed from the base to Wood et al (1977) reported that large the top of the plant or production of pods seeded lima beans yielded higher and for a long time), hence staking increases demanded higher market prices while the yield per unit area. The virtue of a Ries (1971) observed that large seed vertical position of the stake makes the increased seed yield of snap beans by 12 crop grow upwards producing fresh %. healthy leaves (used as forage and Staking significantly improved vegetables) and pods giving disease free lima beans growth parameters like vine seeds. Staked beans aeration is improved length , branch number, LAI and CGR at which reduces the influence of pests and later stages which translated into higher diseases compared to the non-staked grain yield at Bagauda. The yield increase beans. On the other hand when the stakes might probably be due to the grow old they can be used for fuel (fire advantageous effects of staking which wood). provided support for the numerous Consequently climbing beans are Table 4: Effect of cultivar, staking and fertilization on crop growth rate (CGR) of Lima bean at Samaru and Bagauda, 2018 wet season

Crop Growth Rate (CGR) in g/cm2/wk Samaru Bagauda Treatment 3WAS 6WAS 9WAS 12WAS 3WAS 6WAS 9WAS 12WAS

Cultivar(C) C1 1.897 0.861 0.669 2.688 1.582 0.678b 0.811 0.959 C2 1.915 1.025 0.568 2.893 2.629 0.896a 0.828 0 .908 SE+ 0.0578 0.08213 0.0736 0.2176 0.6451 0.0654 0.0804 0.1219 Staking(S) Staked 1.914 0.885 0.589 2.688 2.524 0 .864 0.850 1.028 Non-staked 1.899 1.001 0.649 2.893 1.688 0 .709 0.789 0.840 SE+ 0.0578 0.0821 0.0736 0.2176 0.6451 0.0654 0.0804 0.1219 NPK Rate(F) 0.00kg/ha 1.400c 0.575b 1.100a 2 .0 5 3b 1.275a 0.683a 0.919a 0.872a 150kg/ha 1.900b 0.831b 0.478b 2 .1 08b 1.603a 0.750a 0.708a 0 .781a 300kg/ha 1.994b 0.911b 0.436b 3 .2 78a 3.495a 0.794a 0.858a 1.150a 450kg/ha 2.331a 1.456a 0.461b 3 .7 22a 2.050a 0.919a 0.792a 0.933a SE+ 0.0817 0.1162 0.1040 0.3077 0.9123 0.0925 0.1137 0.1724 Interaction C X S NS NS NS NS NS NS NS NS C X F NS NS NS NS NS NS NS NS S X F NS NS NS NS NS NS NS NS C X S X F NS NS NS NS NS NS NS NS Means within the same treatment group or column followed by unlike letter(s) are significantly different at 5% level of probability using Duncan Multiple Range Test (DMRT) WAS = Weeks after sowing NS = Not significance at 5% level of probability

148 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 5: Effect of cultivar, staking and fertilization on number of grain per pod and grains yield of Lima bean at Samaru and Bagauda, 2018 wet season

SAMARU BAGAUDA Treatment Pod length Number of pod Pod length Number of pod per plant per plant Cultivar(C) C1 5.446b 92.583 5.050b 92.292 C2 6.546a 91.708 6.033a 94.958 SE+ 0.1238 5.0423 0.1149 1.2495

Staking(S) Staked 5.900 93.417 5.454 95.292 Non-staked 6.092 90.875 5.629 91.958 SE+ 0.1238 2.2455 0.1415 1.2494 NPK Rate(F) 0.00kg/ha 5.492b 82.083b 5.067b 83.833b 150kg/ha 5.858b 84.250b 5.283b 88.917b 300kg/ha 5.892b 100.167a 5.475b 99.833a 450kg/ha 6.742a 102.083a 6.341a 101.917a SE+ 0.1751 3.1757 0.1626 1.7669 Interaction C X S * NS NS NS C X F NS NS NS NS S X F NS NS NS NS C X S X F NS NS NS NS Means within the same treatment group or column followed by unlike letter(s) are significantly different at 5% level of probability using Duncan Multiple Range Test (DMRT). NS = Not significance at 5% level of probability

Table 6: Effect of cultivar, staking and fertilization on number of grain per pod and grains yield of Lima bean at Samaru and Bagauda, 2018 wet season

SAMARU BAGAUDA Treatment Grains per pod Grains yield Grains per pod Grains yield Cultivar(C) C1 3.167a 1730.4b 3.000 118.89b C2 3.708b 1790.9a 3.083 219.49a SE+ 0.0697 159.00 0.0712 23.27 Staking(S) Staked 3.375 1986.7 3.083 237.83a Non-staked 3.500 1534.6 3.000 100.55b SE+ 0.0833 159.00 0.0718 23.270 NPK Rate(F) 0.00kg/ha 3.167c 1630.0 2.917 66.02c 150kg/ha 3.333bc 1667.9 3.000 93.28c 300kg/ha 3.500ab 1800.4 3.083 210.36b 450kg/ha 3.750a 1944.4 3.167 307.08a SE+ 0.0986 224.86 0.1015 32.901 Interaction C X S NS NS NS NS C X F NS NS NS ** S X F NS NS NS NS C X S X F NS NS NS NS Means within the same treatment group or column followed by unlike letter(s) are significantly different at 5% level of probability using Duncan Multiple Range Test (DMRT).NS = Not significance at 5% level of probability

149 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

considered to have the following Conclusion advantages expressed in relation to Based on the findings of this study, it staking: yield potential of two to three could be concluded that cultivar C2 out- times higher than the bush beans (Katungi performed C1 in growth and yield et al., 2009; Checa and Blair, 2012; parameters assessed, staking recorded Ramaekers et al., 2012). higher values of these parameters and There were significant increases application of NPK compound fertilizer in growth characters such as vine length, (15:15:15) up to 450 kg ha-1 improved numbers of branches, leaf area index and growth and yield of lima beans. crop growth rate due to application of fertilizer. It has been indicated that N References helps in photosynthetic activities, Abdel-Mawgoud A.M.R.. El-Desuki M., vigorous growth and dark green of the Salman S.R. and Abou-Hussein D., leaves (Kamara et al., 2011). N is required 2005. Performance of some snap bean in the largest quantities, and its varieties as affected by different availability and internal concentration levels of mineral fertilizers. Journal affect the partitioning of biomass of Agronomy 4(3): 242-247. between roots and shoots (Bown, et al Adeniyan, O. N., S. R. Akande, M. O. 2010). The amount and timing of N Baogun and J. O. Saka, 2007. application can also alter plant Evaluation of Crop Yield of African morphology, nutrient availability, and net Yam Bean, Maize and Kenaf Under photosynthesis (Zhao et al 2008). P is Intercropping Systems. American- essential in photosynthesis, respiration, Eurasian J. Agric. & Environ. Sci., energy storage and cell division while K 2(1): 99-102. is known to increase the availability of Ajayi, F. T. (2011). Effects of feeding other nutrient essential for growth and ensiled mixtures of elephant grass development (Olufajo, 2018). This result (Pennisetum purpureum) with three was similar to Shubhashree (2017) who grain plants on digestibility and reported dry matter accumulation nitrogen balance of West African increase with application of phosphorus Dwarf goats. Livestock Science, 142 rates. Similarly, significant and linear (1): 80-84. increase in total dry matter production of Ajayi, F.T., Funmi, O., Adewumi, A. and common bean plant was observed due to Sunday, D.E. (2012). Performance, increased phosphorus (Veeresh 2003). hematology and serum biochemistry Application of 450kg/ha result in a of West African dwarf goats fed significant increase of vine length, ensiled mixtures of elephant grass ( number of branches, leaf area index, crop Pennisetum purpureum) with lima growth rate, pods per plant, grain per pod, bean, African yam bean and pigeon and grain yield. This was similar to what pea. Kasetsart Journal, Natural Gordon Johnson et al., 2013 reported. Science, 46 (5): 694-702. Follow soil test recommendations. Asmaa R., Mahmoud M., El-de Suki and Average soils will require about 400 to Mona and Abdel Mounty M., 2010. 500 lb of 10-20-20 per acre. Response of snap bean plants to biological fertilizer and nitrogen level

150 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

application. International Journal of Academic Research. 2(3) 179-183. Ballhorn, D.J., Lieberel, R. and Ganzhorn, J.U. (2005).Plant cyanogenesis of Phaseolus lunatus and its relevance for herbivore-plant interaction.The importance of quantitative data.Journal Chemistry Ecology 31.1445-1473. Baudoin, J. P. (2006). Phaseolus lunatus L..Record from Protabase. Brink M. & Belay, G. (Editors).PROTA (Plant Resource of Tropical Africa/ R e s o u r c e Ve g e t a l e s d e 1 ' AfriqueTropicale), Wageningen, Netherlands. Bown HE, Watt M.S, Clinton P.W, Mason EG. Influence of ammonium and nitrate supply on growth, dry matter partitioning, N uptake and p h o t o s y n t h e t i c c a p a c i t y o f Pinusradiata seedlings. Trees. 2010; 24(6):1097–1107. Broughton, W. J., Hern´andez, G., Blair, M., Beebe, S., Gepts, P. and Vanderleyden, J. (2002).LBMPS, Universit´e de Gen`eve, ch. de l'Imp´eratrice, 1292 Chamb´esy, Gen`eve, Switzerland. CIFN, UNAM, Cuernavaca, Mexico.CIAT, Cali, Colombia. University of California, Davis, USA.CMPG, Katholieke Universiteit, Heverlee, Belgiu

151 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Checa OE, Blair MW (2012). Department of Crop Science and Inheritance of yield related traits in Technology, Federal University of climbing beans (Phaseolus vulgaris L.) . Technology, Owerri, Nigeria. Journal Crop Sci., 52: 1-16. of Biological Sciences 7(3): 464-474, Ecocrop (2011). Ecocrop database. FAO. 2007. El-Bassiony A.M., Fawzy Z.F., Abd El- Ishler, V. A. and Adams, R. S. (2010). Baky M.M.H and Mahmoud A.R., Drought-related issues in dairy cattle 2010. Response of snap bean plants to nutrition. mineral fertilizers and humic acid Kamara, A. Y., Ekeleme, F., Kwari, J. D., application. Research Journal of Omoigul, L.O. and Chikoye, D. Agricultural and Biological Sciences. (2011). Phosphorus effect on growth 6(2): 169-175FAO (2002). Legumes and yield of groundnut varieties on inoculates and their use. Food and tropical savannah of Northeast, Agriculture Organization of the Nigeria. Journal of Tropical United Nation, Rome. Agriculture 49 (1-&2): 25-30. FILGUEIRA FAR. 1981. Manual de Katungi E, Farrow A, ChinuJ,Sperling L, olericultura. São Paulo: Ceres. 336p. Beebe S 2009). Common bean in F R A Z Ã O J E M ; S A N T O S D ; Eastern and Southern Africa: A FERREIRA FMB; OLIVEIRA FP; situation and outlook analysis. PEREIRA WE; SOUZA AP. 2004. International Centre for Tropical Crescimento da fava em resposta a Agriculture, p. 61. níveis de fósforo na presença e Kee, E., Glancey, J. and Wooten, T. ausência de calagem em Latossolo (2004). Successful Lima Bean Amarelo. In: FERTBIO, Anais... Production in Delaware. Cooperative Lages: SBCS (CD-ROM). Extension Vf-6.1-15. Gutiérrez Salgado, A., Gepts, P. and Lioi, L. and Galasso, I. (2002). Debouck, D.G. (1995). Evidence for Oligonucleotide DNA fingerprinting two genssse pools of the lima bean, revealing polymorphism in Phaseolus Phaseolus lunatusL., in The lunatus L. Genetics Resources and Crop Evolution. 49:53–58. Americas. Genetic Resources and Maquet, A., Vekemans, X. and Baudoin, Crop Evolution 42: 15-28. J.P. (1999).Phylogenetic study on Heuzé, V., Sauvant, D., Tran, G., wild allies of lima bean, Phaseolus Bastianelli, D. and Lebas, F. (2013). lunatus(fabaceae), and implications Lima bean (Phaseolus lunatus). on its origin.Plant Systematics and Feedipedia.org. Evolution 218: 43-54. Hester JB; Shelton A; Isaacs JR. 1951. Olufajo, 2018 Personal communication The rate and amount of plant nutrients during lecture. absorved by various vegetables. Rafael, L. H. (2001). Los Mochicas. Journal of the American Society for MuseoArqueológico Rafael Larco Horticultural Sciences 57: 249-25 Herrera. Lima 2001. ISBN 9972-934- Ibeawuchi, I. I. (2007). Landrace 10-1. legumes: Synopsis of the culture, Oliveira AP; Alves EU; Alves AU; importance, potentials and roles in Dornelas CSM; Silva JA; Pôrto Ml; Agricultural Production Systems, Alves AU. 2004. Produção de feijão-

152 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

fava em função do uso de doses de The Levels of Nitrogen, Phosphorus fósforo. Horticultura Brasileira 22: and Potassium during Rabi in the 543-546. Northern Transition Zone”. 2007. Ramaekers L (2012). Climbing for nitrogen: symbiotic nitrogen fixation Van der Maeseen, L. J. G. and Sadikin, S. in climbing beans. CMPG-SPI (1989).Plant Resources of South East research project: Symbiotic nitrogen Asia. Pulses production. Wageningen, fixation in climbing beans.htm. pp: 56-60. [Viewed: 21/5/2014].Ramaekers L, Veeresh N.K., “Response of French bean Micheni A, Mbogo P, Vanderleyden J, (Phaseolus vulgaris L.) to fertilizer Ries SK (1971) The relationship of levels in Northern Transitional Zone protein content and size of bean seed of Karnataka” M.Sc. (Agri.)Thesis, with growth and yield. J. Am. Soc. Univ. Agric. Sci., Dharwad. 37-79. Hortic. Sci. 96:557-560. 2003. Santos D; Corlett Fmf; Mendes Jemf; VIEIRA C. 1992. Leguminosas de grãos: Wanderley Júnior Jsa. 2002. importância econômica na agricultura Produtividade e morfologia de vagens esementes de variedades de fava no e na alimentação humana. Informe Estado da Paraíba. Pesquisa Agropecuário 16: 5-11. Agropecuária Brasileira 37: 1407- Wood DW, Longden PC, Scott RK (1977) 1412. Seed size variation; its extent, source Shubhashree K.S., “Response of and significance in field crops. Seed Rajmash (Phaseolus Vulgaris L.) To Sci. Technol. 5:337-352.

Appendix 1: Meteorological data showing rainfall, temperature, relative humidity and sunshine hours at Samaru and Bagauda during 2018 wet season.

Parameter Rainfall (mm) Temperature oC Relative humidity (%) Sunshine (hours)

Month Samaru Bagauda Samaru Bagauda Samaru Bagauda Samaru Bagauda

Maximum Minimum Maximum Minimum January 0.00 0.00 30.23 13.17 29.50 20.90 17.47 34.50 NA NA February 0.00 33.00 36.39 18.32 32.70 22.50 20.39 30.20 NA NA March 0.00 0.00 38.61 19.65 35.50 26.80 13.00 24.10 NA NA April 2.40 0.00 38.13 22.03 38.60 35.20 28.72 36.50 NA NA May 120.60 93.80 35.32 22.03 36.70 26.80 64.48 40.50 NA NA June 144.70 170.00 32.33 20.87 28.50 24.20 76.47 45.90 6.70 NA July 232.10 655.00 30.87 20.03 26.40 22.00 85.19 56.80 5.43 NA August 638.10 441.00 30.29 19.61 29.80 20.50 80.12 59.50 4.96 NA September 256.70 209.00 31.93 18.97 32.80 23.40 76.70 50.20 6.75 NA October 3.00 55.00 44.09 18.09 34.50 28.10 64.45 42.50 8.09 NA November 0.00 0.00 38.61 19.65 38.20 27.50 13.00 19.50 NA NA December 0.00 31.35 12.48 16.90 8.85 Key NA= Not available

153 POST HARVEST AND UTILIZATION

154 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Effect of soaking and frying on the physical, chemical and sensory properties of lima beans snack

Abiodun, O.A.1*, Ojo, A.2, Olosunde, O.O. 2, Okewuyi, O.Y. 1 and Nwosu, C. 3 1Department of Home Economics and Food Science, University of Ilorin, Kwara State, Nigeria. 2Department of Food Science and Technology, Osun State Polytechnic, Iree 3 National Centre for Agricultural Mechanization (NCAM), Ilorin, Kwara State. *Correspondent author: [email protected], [email protected] +2348030701354 Abstract Effect of soaking and frying on the physical, chemical and sensory properties of lima beans snack were determined using three varieties of lima beans seeds (white, brown and black) and a control from cowpea seeds. Lima beans were milled into grits using fabricated attrition mill and soaked in distilled water for 22 hrs with intermittent change in water medium at 2hours intervals. The dehulled beans were ground into thick slurry, moulded and fried in hot oil until properly dried. Cyanide contents, colour, protein and sensory evaluation of the bean snacks were analyzed. Untreated brown lima bean had higher cyanide contents (28.67 mg/kg) while the black had the least value of 22.61 mg/kg. The values were drastically reduced with soaking time as the least values were observed at 22 hours of soaking. After frying, the cyanide contents were not detected in the beans snacks. The control snack had higher values in lightness (L?), redness (a?) and yellowness (b?) values. There were no significant differences (p>0.05) in a? of control and white lima beans. Protein contents ranged from 19.81 to 25.69 %. The control snack had slight increase in protein contents while there were reductions in protein contents of lima beans snacks. Brown and white lima bean snacks were acceptable in crispiness, taste, aroma and in overall acceptability.

Keywords: Colour, Cyanide, Frying, Lima beans, Snack, Soaking,

Introduction cooking, etc had been used to reduce the Lima bean (Phaseolus lunatus) is a cheap hydrogen cyanide contents in lima beans source of protein to the Nigerians rural (Akpapunam, 1985; Ologhobo et al., dwellers (Ezeagu and Ibegbu 2010). It is 1984). Lima beans had great potentials in herbaceous plant belonging to the family curbing food insecurity but the bean is Fabaceae in the genus Phaseollus. highly underutilized and unpopular in Ezeagu and Ibegbu (2010) further Nigeria (Seidu et al., 2018). The use of explained that the bean is a source of plant lima beans in making ready to eat snacks protein to millions of Nigeria and that the had not been thoroughly employed; type of processing methods used therefore, this paper presents the effect of determined the utilization of the beans. soaking and frying on the physical, Constraints to the consumption of lima chemical and sensory properties of lima beans include longer cooking or soaking beans snack. time and the presence of anti-nutritional factors (Giami, 2001). Presence of Materials and Methods hydrogen cyanide and other anti- Lima beans varieties (Brown, Black and nutrients in the beans limit it's use. White) and white cowpea seeds were Various cooking methods such as purchased in a local market at Ado-Ekiti, autoclaving, soaking, germinating, Ekiti State, Nigeria.

155 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Preparation of Lima Bean Snacks contents before soaking and after soaking The three varieties of the beans were for 18 hours. Higher cyanide contents coarsely milled to reduce the size using were observed in all the lima bean flours fabricated attrition mill. The smaller sized before soaking but the values reduced lima beans varieties were soaked for 22 with soaking time. At 22 hours, the hours and the water were changed cyanide contents (4.27 mg/kg) of the intermittently at 2 hours interval. The white lima bean flour were higher than samples were dried every two hours and other flours. Total HCN in the raw packaged in air tight container. The varieties ranged from 265 mg/kg in TPL cowpea seeds were soaked for 20 minutes 071 variety 33 to 553 mg/kg in TPL 13 and washed by rubbing it with hands. The variety (Ologhoho et al., 1984). Soaking beans were dried and kept in air tight of lima beans for 2 days had been reported container until ready for use. The by Ologhobo et al (1984) to cause 40.1% dehulled lima beans and cowpea (500 g) HCN loss in variety (TPL 2). According to were soaked in water for 20 minutes and Akpapunam (1985) and Ologhobo et al 10 g of salt was mixed with the soaked (1984) blanching, soaking, autoclaving, beans. The beans were then milled in germination and cooking of lima bean fabricated attrition mill without water. reduced the HCN concentrations to a safe The thick paste was molded flat with level. Akpapunam (1985) observed that hands and fried in hot oil until properly beans soaked for 12 hour had lower HCN dried. The beans snack was stored in levels than those soaked for 6 hour. This plastic container to avoid absorbing showed that more cyanide contents moisture. leached into water with increase in soaking time. After frying, the cyanide Analyses contents were not detected in all the lima Extraction and determination of cyanide beans snack. was done using method of Adebayo- Oyetoro et al. (2013). Colour was determined using the methods of Hsu et al. (2003). Protein content was determined using AOAC (2005) methods. Sensory evaluation was carried out using 9 point Hedonic scale with 9=extremely liked and 1=extremely dislike

Statistical Analysis The data obtained in this study were subjected to Analysis of Variance (ANOVA) and Duncan test as packaged by SPSS 17.0 Fig. 1: Effect of soaking on the cyanide contents of lima beans

Results and Discussion Table 1 showed the colour of African yam Cyanide contents of Lima beans flours are bean snacks. The control snack was shown in Fig. 1. Cyanide contents ranged significantly different (p<0.05) from the from 3.11-28.67 mg/kg. Brown coloured lima bean snacks in lightness values (L?). lima bean flour had higher cyanide

156 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Colour of African yam bean snacks

Sample L* A* B* Control 49.05±1.62a 7.64±0.65a 16.41±1.50a White 44.46±0.91b 6.18±0.80ab 12.04±1.35b Brown 45.28±1.03b 5.44±0.76b 13.07±1.27b Black 42.95±1.49b 4.73±0.78b 10.06±1.72b Value with the same letter were not significantly different (p<0.5) from each other

Among the lima bean snacks, brown variety had higher L?value but was not significantly different (p<0.05) from other lima beans snacks. Control snacks also had higher a? value (redness) and b? (yellowness) values. No significant differences existed in all the lima beans snacks in a? and b? values. Protein contents of Lima beans varieties are presented in Fig. 2. White lima beans flour had the least protein content (20.25%) among the flours while Fig. 2: Protein contents of dehulled soaked cowpea and lima beans flours and snacks the control flour had higher protein value (25.44%). The control cowpea snack had Sensory evaluation of lima beans snacks higher protein contents than the flour and is presented in Table 2. The control and the lima beans varieties. Among the brown lima beans were not significantly snacks, brown lima bean had the least protein content (19.81%). There were different (p>0.05) in their crispiness slight increase in protein contents of the value. The crispiness value ranged from control and white lima bean snacks while 6.45 to 7.22. Both the control and the there were reductions in the values brown lima beans snacks were more obtained for brown and black lima beans preferred in crispiness. The taste of white snacks. The values obtained for the lima and brown lima beans was more beans were within the values (23.93 %) acceptable than the control and black lima reported by Oshodi et al. (1997) and beans. There were no significant 25.91 to 30.29 g/100 g by Seidu et al differences (p>0.05) in taste of control (2018) for protein contents of lima bean and black lima beans snacks. The aroma varieties. The reductions in the protein of the control and lima beans snacks were contents of the snacks may be due to the acceptable with no significant differences soaking and frying treatment which may (p>0.05) in their values. Overall cause leaching of the soluble protein and acceptability showed no significant denaturation of protein. The slight differences (p>0.05) in the control, white increase noticed in the control and white lima beans may be due to release of bound and brown lima beans snacks. Black lima protein as a result of heat treatment which bean snack was significantly different destroyed the anti-nutritional compounds (p<0.05) from other snacks in overall in the beans. acceptability.

157 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 2: Sensory analysis of lima beans snacks

Sample Crispiness Taste Aroma Overall acceptability Control 7.22±0.23a 7.80±0.20b 7.55±0.09a 7.58±0.14a White 6.89±0.12b 8.11±0.34a 7.42±0.22a 7.47±0.10a Brown 7.13±0.17a 8.36±0.19a 7.49±0.24a 7.88±0.13a Black 6.45±0.36c 7.93±0.15b 7.27±0.21a 6.24±0.11b Value with the same letter were not significantly different (p<0.5) from each other

Conclusion Ezeagu, I. E. and Ibegbu, M. D. (2010). This study reveals the effect of soaking Biochemical composition and and frying on the physical, chemical and nutritional potential of ukpa: a variety sensory properties of a ready to eat snack, of tropical lima beans (Phaseolus made from lima beans. The result lunatus) from Nigeria – a short report. obtained from this study shows that Polish Journal of Food Nutrition and snacks from lima beans were comparable Science, 60(3): 231-235. to cowpea (control) snacks in the Giami, S.Y. (2001). Quality attributes of parameters analyzed. It was also revealed three new improved lines of Nigerian that the cyanide content of lima beans lima beans (Phaseolus lunatus were within acceptable limit of cyanide L.Walp.). Plant Foods for Human contents in food materials after 20 hours Nutrition, 56: 325– 333. of soaking. It was further revealed that Ologhobo, A.D., Fetuga, B.L. and Tewe, snacks from the brown and white lima O.O (1984). The cyanogenic beans were more acceptable and were not glycoside contents of raw and significantly different with cowpea processed lima bean phaseolus (control) in terms of general acceptability. lunatus varieties. Food Chemistry It therefore implies that soaking and 13(2): 117-128. frying is another way of safely and Oshodi, A.A., Ipinmoroti, K.O. and acceptably utilizing lima beans, Adeyeye, E.I. (1997) Functional especially in the production of ready to properties of some varieties of African eat snacks. yam bean (Sphenostylis stenocarpa) flour — III. International Journal of References Food Sciences and Nutrition 48(4): Adebayo-Oyetoro A. O., Oyewole O. B., 243-250. Obadina A. O, and Omemu M. A. Seidu, K.T., Osundahunsi, O.F. and (2013). Cyanide and Heavy Metal Osamudiamen, P.M. (2018). Nutrients Concentration of Fermented Cassava assessment of some lima bean Flour (Lafun) Available in the varieties grown in southwest Nigeria. Markets of Ogun and Oyo States of International Food Research Journal Nigeria. International Scholarly and 25(2): 848-853 Scientific Research and Innovation 7(7): 645-648

158 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Post – harvest losses in bambara groundnut (Vigna subterranea (L.) Verdc.) seeds – a preliminary investigation

John Olayinka Atoyebi and Timothy Oluwafemi Ajiboye National Centre for Genetic Resources and Biotechnology (NACGRAB), F.M.S.T., PMB 5382, Moor – Plantation, Ibadan, Nigeria Corresponding e-mail: [email protected], Phone number: 234-8033824752

Abstract Bambara groundnut (Vigna subterranea (L.) Verdc.) has immense nutrition potentials. However, the crop, like other legumes often experience post – harvest losses with common storage insect pests such as Callosobrochus maculatus and Tribolium castaneum. Their ravaging effects on seeds were observed in a simple preliminary observation to determine the extent of damages on harvested Bambara groundnut seeds. The harvested seeds numbering 157 were exposed to the atmospheric condition of 37 ? C in a plastic container that was covered for 6 weeks without the application of chemical preservatives. It was observed that 95% of the Bambara groundnut seeds (148) were infested with these two common insect pests. However, future studies will involve the use of potential biological control methods and novel molecular tools, such as the RNA alternative splicing techniques, complementing other existing approaches to properly elucidate and identify the different iso-forms of these insect pests, with the aim of reducing its ravaging effects on this legume and thus assist in controlling them for more economic gains.

Keywords: Post – harvest, Ravaging, Insect pests, Losses, Iso-forms Introduction grown on poor soils. The Bambara groundnut beans are related to cowpea and botanically known as Common Pests and Diseases of Vigna subterranea (L.) Verdc. There are Bambara groundnut two botanical varieties, namely V. Some of the common pests attacking subterranea var. spontanea which Bambara groundnut are fusarium wilt, includes the wild varieties and V. leaf spot, root-knot nematode. These are subterranea var. subterranea which worse in rainy climates than in dry areas. includes, the cultivated varieties. Others are leafhoppers, Hilda patruelis Bambara is an African indigenous crop; it and the larvae of Diacrisia maculosa and is used for both human and animal Lamprosema indicata. Meloidogyne consumption. It is a third crop among the incognita and Meloidogyne javanica are grain legume crops of the African lowland the most parasitic nematodes on Bambara tropics after the popular groundnut and groundnut. The level of nematode cowpea. The Bambara groundnut has infestation is usually much greater on become less important in many parts of light-textured soils. The symptoms of Africa because of the lack of nematode infestation include stunted understanding of its immense nutrition growth, leaf chlorosis and yield losses. resources and subsequent lack of About 10 weeks after planting, the leaves expansion facilities necessary for the turn yellow and the plants become stunted groundnut production. In recent years and die. Other post – harvest pests however, there has been renewed interest includes Callosobruchus maculatus for its cultivation in the arid savannah (cowpea weevils) and flour beetles. The zones. It is resistant to drought and has the cowpea weevil is a common pest of stored ability to produce a reasonable crop when legumes which has a cosmopolitan 159 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

which attacks the endosperm of the stored grain legume. They are generally pests of cereal silos and are widely used as laboratory animals, as they are easy to keep. The flour beetles consume wheat and other grains upon which they are adapted to survive in very dry environments, and can withstand even higher amounts of radiation than Fig. 1: Showing different varieties of African cockroaches. They are a major pest in the Bambara groundnut agricultural industry and are highly distribution, occurring mostly in West resistant to insecticides. When the larvae Africa, where it is likely to have of T.Molitor is fully-grown and originated and moved around the globe developed, they are known as with the trade of legumes and other crops. mealworms; small specimens and the As only a small number of individuals larvae of the other species are called mini were likely present in legumes carried by mealworms. The various species includes: people to distant places, the populations Tribolium castaneum – red flour beetle that have invaded various parts of the Tribolium confusum – confused flour globe have likely gone through multiple beetle bottlenecks. However, with these Tribolium destructor – destructive flour bottlenecks and the subsequent rounds of beetle inbreeding that exist among them and Tenebrio molitor – mealworm beetle making its populations persist and spread Tenebrio obscurus – mini mealworm quickly. This ability to withstand a high degree of inbreeding has likely contributed to this species' prevalence as a pest, especially in West Africa, where it destroys legumes.

Fig. 3: Red Flower beetle (Tribolium castaneum )

Some fungal diseases of Bambara groundnut includes: 1. Alternaria leaf blight Fig. 2: Female Callosobruchus maculatus Alternaria tenuissima (Kunze:Fr.) Wiltshire The flour beetles are also common post – 2. Alternaria leaf spot harvest pest of Bambara groundnut. They Alternaria arachidis Kulk are usually members of the darkling 3. Fusarium peg and root rot Fusarium beetle genera Tribolium or Tenebrio spp.

160 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

4. Fusarium wilt studies on these insect pests and virus Fusarium oxysporum Schlechtend:Fr. diseases diagnostics of the legume for more economic gains. Some of the parasitic nematodes diseases are: References 1. Dagger Adeoti, K., Dansi, A., Ahoton L., Xiphinema spp. Vodouhe, R., Ahohuendo, B.C., Rival, 2. Pod lesion A. and Sanni, A. Agro-morphological Tylenchorhynchus brevilineatus characterisation of Sesamum Williams radiatum (Schum. and Thonn.), a T. brevicadatus Hopper neglected and underutilised species of 3. Root-knot, Javanese traditional leafy vegetable of great Meloidogyne javanica (Treub) importance in Benin. African journal Chitwood of Agric Research, vol. 7(24), pp 3569 4. Root-knot, peanut – 3578; June, 2012. Meloidogyne arenaria (Neal) Atoyebi, O.J., and Esan, E.B. (2013). Chitwood B a m b a r a g r o u n d n u t ( Vi g n a subterranea) as a panacea for Materials and Methods malnutrition in developing countries Selected harvested seeds of Bambara like Nigeria. Poster presentation at the th groundnut of African origin numbering 20 International Union of Nutrition 157 were allowed to sun dry for 4 weeks Society (IUNS), congress at Granada, th th from the time of harvest. They were then Spain, September, 15 – 20 . put in a cylindrical plastic material and Azam – Ali, S.N., Sesay, A., Karikari, exposed to the normal atmospheric S.K., Massawe, F.J. (2001). Assessing condition of 37OC in this same plastic the potential of an under-utilised crop container covered for 6 weeks without the – a case study using Bambara application of chemical preservatives. At groundnut. Experimental agriculture the end of the six weeks interval, 37 : 433 – 472 (2001). preliminary damage of these two Bamishaiye, O.M., Adegbola, J. A. and common insect pests on the Bambara Bamishaiye, E.I. (2011). Bambara groundnut seeds were observed by groundnut: an under-utilized nut in counting the number of infested seeds Africa. Advances in Agricultural among these total number of seeds into Biotechnology 1: 60-72. another new plastic container. Begemann, F. (1986b). Bambara Groundnut (Vigna subterranea, (L.) Results and Discussion Verdc.): Pests and Diseases. At the end of the six weeks of International Institute of Tropical observation, it was found that at least 150 Agriculture (IITA), Genetic seeds out of the total number of 157 seeds, Resources Unit, Ibadan, Nigeria. 18 signifying 95% of the Bambara International Plant Genetic Resources groundnut seeds under observation were Institute (IPGRI, 2000). Descriptors infested with these two common insect for Bambara groundnut (Vigna pests of Bambara groundnut. However, subterranea), International Plant efforts are presently on-going to source Genetic Resources Institute, Rome, for funding / support for the molecular Italy.

161 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

John O. A, Odutola O., Olugbenga A. Presentation at the Biotechnology (2017). Sensory Evaluation of Society of Nigeria (BSN) conference, B a m b a r a G r o u n d n u t ( Vi g n a Abuja, Nigeria. August, 26 –30. subterranea (L.)Verdc.) Food Production Guidelines for Bambara Products in Ibadan, Nigeria. groundnut. Published by Directorate International Journal of Agriculture Agricultural Information Services , Innovations and Research, 5, Issue 5, Department of Agriculture, Forestry 2319 -1473. and Fisheries Private Bag X144, John O. A., Olaniyi O., Odutola O., Pretoria, 0001 South Africa (undated). Olugbenga A., Michael A. (2017). Tanimu, B. and Aliyu, L. (1995). Northern "Morphological characterisation of Nigeria. Proceedings of the Workshop selected African accessions of on Conservation and Improvement of B a m b a r a g r o u n d n u t ( Vi g n a B a m b a r a G r o u n d n u t ( Vi g n a s u b t e r r a n e a ( L . ) Ve r d c . ) " ) . subterranea (L.) Verdc.), 14–16 International Journal of Plant November 1995, Harare, Zimbabwe. Research (SAP series), 7 (2): pp 29 - Institute of Plant Genetics and Crop 35, Plant Research, Gatersleben, Atoyebi O. J., Faluyi J. O and Oyedapo O.O. (2014). Investigation of the Department of Research & Specialist Genetic Diversity of selected wild and Services, Harare and International cultivated sorghum germplasm using Plant Genetic Resources Institute, SDS – PAGE. (M.Sc thesis). Greeners Rome, Italy. journal of biological sciences; 4(1) pp Thottappilly G, Rossel HW, Singh BB. 001 – 008. Feb. . (1988). Virus diseases of cowpea in Atoyebi O.J., Adebawo O.O. , Osilesi O. Nigeria and development of multiple and Esan E. B (2013). Towards virus resistant cowpea lines. pp.383. Biofortification of Bambara In: Proc. Int. Congr. of Plant groundnut (Vigna subterranea) in Pathology, 5th. Kyoto, Japan. 20-27 Nigeria to combat hidden hunger. Aug. 1988. Kyoto, Japan.

162 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Evaluation of selected lima bean products for consumer acceptability at Erin-Oke, Osun State, Nigeria

Farinde, E. O. * Oyedokun, M. O., Fasoyiro, S. B. and Adebayo, A.K. Institute of Agricultural Research and Training, Obafemi Awolowo University, PMB 5029, Ibadan, Nigeria *Corresponding Author: [email protected]; [email protected]

Abstract Lima bean is a nutritious food legume crop. It is one of the underutilized legumes in Nigeria due to lack of knowledge on its processing and utilization potentials. Processing and utilization of lima beans were promoted through evaluation of acceptability of some selected products from lima bean among the farmers in Erin-Oke in Osun State of Nigeria. Lima bean was processed into cooked lima beans, lima bean daddawa (iru), plantain-lima bean momo, wheat-lima bean biscuit and wheat-lima bean chinchin. The lima bean products were sensory evaluated and compared with the conventional products that the farmers were familiar with. Results showed that cooked lima bean was preferred in terms of colour, appearance and flavor. However, there was no significant difference (p<0.05) in the flavor, texture, taste and overall acceptability of lima bean daddawa and locust bean daddawa; plantain lima momo and the normal plantain momo. There was also no significant difference (p<0.05) in the colour, appearance, taste and overall acceptability of wheat-lima bean biscuit and plain wheat biscuit. Both Plain-wheat chinchin and wheat- lima chinchin were accepted in all the sensory attributes evaluated. All the lima bean products disseminated and evaluated were accepted by the farmers in Erin-Oke. The high acceptability of the lima bean products by farmers in Erin-Oke is expected to facilitate improved lima bean production and utilization in Nigeria and subsequently enhances food and nutrition security.

Key words: Consumer acceptability, Lima bean, Processing, Utilization, Promotion,

Introduction for optimal utilization of these food crops Legumes are important food protein (Olanipekun et al., 2017). Lima bean source worldwide, particularly in the seeds are good sources of nutrients such as developing countries where they function proteins, carbohydrates and fiber as a protein source in the absence of (Kathirvel and Kumudha, 2011). Lima animal protein. They are low cost dietary beans contain both soluble and insoluble vegetables proteins and minerals when fibre which makes it a very good food compared with animal products such as crop for blood sugar regulation. Lima meat, fish, and egg (Siddhuraju et al., bean has been reported to have both 2002). Legumes are important cultural anthypoglycemic and antihypolipidemic crops that have been known for its effect (Ojo et al., 2013). Lima beans are significant roles in the description of the also rich in important minerals such as food patterns of many tribes in Nigeria calcium, potassium, phosphorus, iron and particularly among the Yoruba people of zinc. Different products of nutritional Southwest Nigeria. value have been be produced from lima Lima bean (Phaseolus lunatus) is beans (Farinde et al., 2011, 2017a and b) one of the underutilized legumes that are Lima bean daddawa (iru) is a already going into extinction in Nigeria. fermented condiment, and an alternative This is due to lack of knowledge and to locust bean daddawa (Farinde et al., awareness on the processing technologies 2011; 2014; 2017). Daddawa enhances

163 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 taste in soup and also serves as low cost propagation, processing, utilization and protein source in diet of low income reintegration of lima beans into the food families in Nigeria and some West pattern of the people of western Nigeria. African communities. Locust bean has Diverse Lima beans products such as been the traditional raw material for baked and cooked lima beans, lima bean processing daddawa and farmers are daddawa (iru), lima bean soup (gbegiri) familiar with the processing technology and lima bean veggie; lima bean flour, of locust bean into daddawa. Lima bean lima bean akara and maize-lima bean ogi, daddawa is nutritious and compared well plantain-lima bean mom, wheat-lima bean with locust bean daddawa in terms of biscuit and wheat-lima bean chinchin nutrients composition (Farinde et al., were produced for dissemination to 2011). people for household consumption, Cooked beans from cowpea are a acquisition of entrepreneurial and traditional popular plant protein diet for vocational skills and job creation for rural majority of people in Nigeria. It is women (Farinde, 2019). consumed by both the young and old. It is Momo is a traditional food diet of usually cooked plain and served with people of Osun, Ondo and Ekiti States of fried pepper sauce as “Ewa-woro” or it is Nigeria. It is usually prepared from unripe cooked in form of porridge with addition plantain. The plantain is normally peeled, of pepper, palmoil, onions and salt as sliced, dried and milled into powder. The “Ewa-pete” or “Adalu” among the plantain flour is then reconstituted in yorubas. It is also cooked in combination water; ingredients such as palm oil, with cereals such as rice and maize, and pepper and salt are added. The plantain tubers such as yam and potatoes to fortify paste and the ingredients are mixed, the carbohydrate based sources with plant wrapped in cooking leaves and steamed to protein. In Nigeria, Lima beans have been cook. traditionally consumed the same way Biscuit belong to the flour cowpeas are consumed, i.e. as sole confectionary. Biscuits are usually flat cooked beans or in combination with crisps which may or may not be cereals such as rice and maize or tuber sweetened. Biscuit can be made from hard such as yam and potatoes but its' dough e.g. crackers, hard sweet dough e.g. utilization this way started to reduce due rich tea and short or soft dough e.g. short to its hard seed coat which prolongs the bread and short cake. It is usually cooking time of the beans. This also produced from unfermented dough and removes lima beans consumption or baked in an oven. Wheat flour is the utilization from the food pattern of the conventional and fundamental ingredient people of western Nigeria. In a study by for biscuit production (Zoulias et al., Farinde et al. (2018), cooking time for 2002). Biscuits are consumed extensively lima beans was reduced to 2 hours from in Nigeria as a snack, ready-to-eat and the usual cooking time of about 4 hour convenient food. and above by first soaking the bean seeds Chinchin also belong to the flour in water for 8 to 10 h prior cooking. confectionary. Chinchin is one of the Cooked beans have been found to be popular snacks in West Africa. It is a nutritious (Rocha-Guzman et al., 2013; sweet, cookie-like product made from Farinde et al., 2017b). Hence, wheat flour and egg (Akubor, 2004). concentration of research efforts on the Dough from wheat flour and egg is

164 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 usually kneaded, rolled tightly to 1cm were soaked in water (1litre) for 10 h or thickness on a board and cut into small overnight. The soaked beans were drained sizes, usually cubed or rectangular shape and then washed thoroughly in portable prior to frying. Wheat flour is the main tap water for about 3 times so as to raw material. properly wash off the soaking water. The The objective of the work was to soaked and drained beans were put in a promote lima bean processing and pressure cooking pot, water (about 1.5 utilization through assessment of litres) was added to the beans, sliced acceptability of some selected lima bean onions (2 big of 450 g) and half teaspoon products among the farmers in Erin-Oke salt (2 g) was added. The pressure pot and in Osun State of Nigeria. the content were placed on gas cooker and cooked for about 1 hour. Cooking water Materials and Method was allowed to dry with the beans so as to Demonstration of lima beans processing retain the nutrients that must have been technologies leached into the cooking water. The Appropriate processing technologies for cooked beans were served with fried lima beans into selected food products pepper sauce. (Farinde, 2019) were demonstrated to farmers in Erin-Oke, Osun State, Nigeria. Lima bean daddawa A total number of fifty four (54) farmers Processing of lima bean daddawa was including male and female participated in carried out using the method described by the training. The women assisted in the Farinde et al. (2014). Lima bean seeds processing of the food products while the were sorted to remove dirty and broken men watch the demonstration activities. beans. The beans were roasted in open The health and economic benefits of the frying pan for about 10 minutes. The lima bean products were highlighted to roasted beans were dropped in boiling the farmers. Importance of food safety water and boiled for about 20 minutes. and hygiene during processing was also The roasted, boiled beans were dehulled discussed. Farmers were allowed to ask manually by robbing the beans between questions for better understanding and palms and washing off the beans coats clarification. with water. The dehulled beans were cooked for 30 minutes using pressure Processing of lima beans into products cooker during which the beans became Lima bean was processed into five type of soft. The cooked beans were drained and products, the products were selected to poured while still warm into clean represent whole lima bean products and calabash lined with clean banana leaves, products fortified with lima bean. The covered with another set of clean banana products include: Lima bean daddawa, leaves before covering with another cooked lima beans, plantain-lima bean calabash. The calabash with its content momo, wheat-lima bean chinchin and was placed in a warm place for 3 days (72 wheat-lima bean biscuit (Farinde, 2019). h) for fermentation to take place.

Cooked lima beans Plantain-lima bean momo Cooked lima beans were processed using Plantain-lima momo was processed from modified method of Farinde et al. (2018). composite mixture of unripe plantain and Sorted and clean lima bean seeds (5 cups) lima bean flour. Plantain flour and lima

165 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 bean flour were mixed in ratio 3:1, i.e. 3 ratio 3:1, i.e. 3 cups of wheat flour (300 cups of plantain flour to 1 cup of lima g)and 1 cup (100g) of lima bean flour. To bean flour in a bowl. Lima bean seeds (1 the mixture in a bowl was added 1 cup of cup) was soaked overnight and half sugar (100 g), 1 heaped table spoon of cooked. Cooking water was allowed to margarine (50 g), One teaspoon of nut meg dry with the beans. To the mixture of (5 g) and 1 teaspoon of baking powder (5g). plantain flour and lima bean flour was One big Egg (45 g) was whisked and added added grinded pepper (120 g), grinded to the mixture, three quarter to one cup of onions (300 g), palm oil (65 ML), water water was added and the mixture was (500 ML) and salt (4 g). The mixture was mixed together with fingers until a stiff mixed together with spoon. Cooked lima consistency of smooth dough was beans were then added to serve as fish or obtained. The dough was rolled evenly on a meat in the momo. The mixture was floured board, and then cut into desired mixed again and then wrapped in already shapes and sizes. The cut doughs were deep washed and dried clean cooking banana fried in vegetable oil until golden brown. leaves. The leaves and the content were Excess oil was drained from the chinchin, placed in cooking pot containing boiling cooled and packed in clean packaging water on gas cooker and steamed for plastic containers with tight covers about 40 min. Steamed momo was Sensory evaluation of the selected lima removed from fire and allowed to cool. bean products (Farinde, 2019) Sensory evaluation was carried out to assess the acceptability of the lima beans Wheat-lima bean biscuit products using the method of Iwe (2002). Processing of wheat-lima bean biscuit Lima bean was processed into lima bean was carried out according to the method daddawa, cooked lima beans, plantain- described for cassava cookies (Sanni et lima momo, wheat-lima biscuit and wheat- al., 2006) and wheat-muchroom cookies lima chinchin (Farinde, 2019). (Bello et al., 2017) with slight Conventional similar products from modification (Farinde, 2019). Composite cowpea, locust bean and whole wheat flour mixture of wheat flour and lima bean that farmers are familiar with were also flour in the ratio 3:1, i.e. 3 cups of wheat provided. Thirty educated farmers who flour (300 g) and 1 cup (100g) of lima have secondary school education and bean flour was used. The two flours were above (Twenty female and ten male) were weighed into a bowl. To the mixture of the selected and trained briefly on sensory flour was added ½ cup of sugar (50 g), 3 evaluation method. These represented heaped table spoon of margarine (150 g), more than half of the entire participants. ¼ teaspoon of baking powder (1g) and The lima bean products as well as the piece of egg (45 g). similar conventional products were coded and presented to these selected farmers Wheat-lima bean chinchin (used as sensory panel). The coded samples Processing of chinchin was carried out were presented to the farmers separately. following the method described by The panelists were seated separately at a Adebayo-Adetoro et al. 2017; Farinde, distance in such a way that none of them 2019). Wheat-lima bean chinchin was could see the evaluation of the other. The processed from composite mixture of farmers were asked to score the products wheat flour and lima bean flour in the for colour, appearance, flavor, texture, taste

166 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 and overall acceptability. The panelists attributes evaluated. Cooked lima bean were asked to score the attributes using 9- was well accepted in previous study by point headonic scale where 1 represents Farinde et al. (2017). dislike extremely and 9 represent like Table 2 presents the result of the extremely. Data obtained were subjected sensory scores by farmers in Erin-Oke for to Analysis of Variance using SPSS lima bean daddawa and locust bean version 20. Means were separated by daddawa. Both lima bean daddawa and Duncan Multiple range test. Acceptance locust bean daddawa recorded high was determined at 95% confidence scores for the sensory evaluation, ranging interval. between 6.4 and 7.9, an indication that they were both well accepted. Lima bean Results and discussion daddawa compared favorably well with Result of sensory scores by farmers in locust bean daddawa as there was no Erin-Oke for the cooked lima beans and significant difference (p< 0.05) in the cooked cowpea is shown in Table 1. Both flavor, texture, taste and overall cooked lima beans and cooked cowpea acceptability of lima bean daddawa and recorded high scores ranging between 6.5 locust bean dadddawa. However, locust and 8.1 in all the sensory attributes bean daddawa was preferred in terms of evaluated. There was no significant colour and appearance. Both daddawa difference (p< 0.05) in the taste and samples were accepted in all the sensory overall acceptability of cooked lima attributes evaluated. Previous study by beans and cooked cowpea. Cooked lima Farinde et al. (2011) showed high bean was preferred in terms of colour, acceptability of lima bean daddawa when appearance and flavour while cooked sensory evaluated. cowpea was preferred in terms of texture. The result of the sensory scores by Both cooked lima bean and cooked farmers in Erin-Oke for plantain-lima cowpea were accepted in all the sensory bean momo and plain plantain momo is

Table 1: Sensory scores for cooked lima bean and cooked cowpea

Sample Colour Appearance Flavour Texture Taste Overall acceptability DR 7.5 ± 7.4 ± 0.03 a 8.6 ± 0.05 6.5± 0.05b 7.9 ± 7.9 ± 0.06a 0.01a a 0.05a DF 6.5 ±0.02b 6.3 ± 0.01b 6.7 ± 7.1 ± 7.8 ± 8.1 ± 0.06a 0.01b 0.07a 0.04a n = 30. Means followed by the same superscript are not significantly different at p<0.05 DR = Cooked lima beans DF = Cooked cowpea

Table 2: Sensory scores for lima bean daddawa and locust bean daddawa

Sample Colour Appearance Flavour Texture Taste Overall acceptability LD 6.4 ± 0.10b 6.8± 0.07 b 7.3 ± 0.05a 6.7± 0.05a 6.9 ± 0.10a 6.9 ± 0.06a CD 7.4 ±0.12a 7.9 ± 0.07a 7.5 ± 0.11a 7.0 ± 0.07a 7.2 ± 0.08a 7.0 ± 0.05a n = 30. Means followed by the same superscript are not significantly different at p<0.05 LD = Lima bean daddawa CD = Locust bean daddawa 167 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 shown in Table 3. Plantain momo is an bean. Table 4 compares the result of indigenous food of people of Erin-Oke. sensory scores by the farmers in Erin-Oke Plantain has been reported to be a very for wheat-lima biscuit and plain wheat good source of dietary fibre, and a good biscuit. There was no significant food crop for diabetics due to it resistance difference (p<0.05) in the colour, starch content (Garcia-Valle et al., 2019). a p p e a r a n c e , t a s t e a n d o v e r a l l Fortifying it with lima bean empowered acceptability of wheat-lima biscuit and the food the more, by improving the plain wheat biscuit. However, plain wheat protein content of the product. There was biscuit was preferred in terms of flavor no significant difference (p< 0.05) in the and texture. Both wheat-lima biscuit and flavor, texture, taste and overall plain wheat biscuit were accepted in all acceptability of plantain-lima momo and the sensory attributes evaluated. plain plantain momo. Both the plain Wheat chinchin was also fortified plantain momo and plantain lima momo with lima bean. Studies have shown were accepted in all the sensory attributes nutritional improvement in chinchin evaluated. through fortification with legumes, nuts Biscuit and chinchin are popular and vegetables (Adebayo-Adetoro et al., snacks conventionally made from wheat. 2017; Akindele et al., 2017). These snacks could have their nutritional Acceptability of wheat-lima chinchin and status improved through fortification. plain wheat chinchin by farmers in Erin- Wheat biscuit was fortified with lima Oke were compared (Table 5). There was Table 3: Sensory score for plantain- lima momo and plain plantain momo

Sample Colour Appearance Flavour Texture Taste Overall acceptability PM 6.3 ± 0.10b 6.3± 0.07 b 7.6 ± 0.05a 6.8± 0.05a 8.0 ± 0.10a 7.8 ± 0.06a PN 6.9 ±0.12a 7.0 ± 0.07a 7.8 ± 0.11a 6.6 ± 0.07a 8.0 ± 0.08a 7.6± 0.05a n = 30. Means followed by the same superscript are not significantly different at p<0.05 PM = Plantain-lima momo PN = Plain plantain momo

Table 4: Sensory scores for wheat-lima biscuit and plain wheat biscuit

Sample Colour Appearance Flavour Texture Taste Overall acceptability LB 7.3 ± 0.10a 7.4± 0.05 a 6.5 ± 0.01b 6.9± 0.02b 7.9± 0.10a 7.7 ± 0.05a WB 7.6 ±0.01a 7.3 ± 0.07a 7.0 ± 0.01a 7.3 ± 0.07a 8.0 ± 0.10a 7.9± 0.05a n = 30. Means followed by the same superscript are not significantly different p<0.05 LB = Wheat-lima biscuit WB = Plain Wheat biscuit

Table 5: Sensory scores for wheat-lima chinchin and plain wheat chinchin

Sample Colour Appearance Flavour Texture Taste Overall acceptability LC 6.8 ± 0.10a 7.1± 0.05 a 6.5 ± 0.01b 6.9± 0.02b 7.9± 0.10a 7.2 ± 0.05a WC 7.2±0.01a 7.3 ± 0.07a 7.0 ± 0.01a 7.3 ± 0.07a 8.0 ± 0.10a 7.2± 0.05a n = 30. Means followed by the same superscript are not significantly different at p<0.05 LC = Wheat-lima biscuit WC = Plain Wheat biscuit 168 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 no significant difference (p<0.05) in the Akindele, O., Gbadamosi, O., Taiwo, K., colour, appearance, taste and overall Oyedele, D. J. and Adebooye, C. acceptability of wheat-lima chinchin and (2017). Proximate, mineral, sensory plain wheat chinchin. Plain wheat evaluation and shelf stability of chinchin was preferred in terms of flavor chinchin enriched with ugu and and texture. Lima bean chinchin i n d i a n s p i n a c h v e g e t a b l e s . compared very well with plain wheat lima I n t e r n a t i o n a l J o u r n a l o f chinchin. Both wheat-lima chinchin and Biochemistry Research & Review, plain wheat chinchin were accepted in all 18(4):1-14 the sensory attributes tested. Akubor, P. I. (2004). Protein contents, Conclusion physical and sensory properties of The selected lima bean products that were Nigerian snack foods (cake, chin-chin disseminated and evaluated for consumer and puff-puff) prepared from cowpea acceptability were all accepted by the - wheat flour blends. International farmers in Erin-Oke, Osun State. This is Journal of Food Science and an indication that the farmers are willing Technology, 39(4): 419–424 to adopt the technologies. Processing of Bello, M., Oluwamukomi, M. O. and lima beans into whole beans diets as in Enujiugha, V. N. (2017). Nutrient cooked beans and daddawa, fortification Composition and Sensory Properties of food crops with lima bean as in plantain of Biscuit from Mushroom-Wheat lima bean momo, wheat- lima biscuit and Composite Flours. Archives of wheat-lima chinchin will provide dietary Current Research International, varieties of improved nutrition and 9(3):1 - 11 livelihood for the farmer's households. Farinde, E. O., H. A. Adeniran and S. H. High acceptability recorded for these Abiose (2011). Proximate products by the farmers in Erin-Oke is expected to enhance the utilization composition, mineral content and potentials of lima bean and subsequently sensory assessment of an iru analogue improve the cultivation and production of produced from lima bean (Phaseolus the beans. It is recommended that the lunatus). Ife Journal of Technology. dissemination and evaluation of lima 20(2):1 – 6. bean products be extended to other Farinde, E. O., H. A. Adeniran and S. H. communities and States in the South Abiose (2014). Comparative West, Nigeria. This will go a long way to microbial assessment of fermented enhancing food and nutrition security in Lima bean (Phaseolus lunatus) and the country, Nigeria. Locust bean (Parkia biglobosa) in production of Daddawa. British References Microbiology Research Journal. Adebayo-Oyetoro, A. O., Ogundipe, O. 4(7): 772 – 784. O., Lofinmakin, F. K., Akinwande, F. Farinde, E. O., Abiose, S. H. and F., Aina, D. O. and Adeyeye, S. A. O. Adeniran, H. A. (2017a). Natural and (2017). Production and acceptability controlled fermentation of Lima bean of chinchin snack made from wheat and tigernut (Cyperus esculentus) (Phaseolus lunatus) for daddawa flour. Cogent Food and Agriculture. production. Malaysian Journal of 3:1-9 Microbiology. 13(2): 85 – 91

169 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Farinde, E. O., Obatolu, V. A. and Ojo, R. J., Segilola, L. I., Ogundele O. M., Fasoyiro, S. B. (2017b). Microbial, Akintayo, C. O. and Seriki, S. (2013). nutritional and sensory qualities of Biochemical evaluation of lima beans baked, cooked and steamed cooked (Phaseolus lunatus) in alloxan lima beans. American Journal of induced diabetic rats. ARPN Journal Food Science and Technology. 5(4): of Agricultural and Biological 156 – 161 Science, 8(4): 302 – 309 Farinde, E. O., Olanipekun, O. T. and Olanipekun, O.T., Farinde, E.O. and Olasupo, R. B. (2018). Nutritional Eyebiokin, A. (2017). Influence of composition and antinutrients knowledge and perception on the content of raw and processed lima utilization of some under-utilized bean (Phaseolus lunatus). Annals legumes among Nigerian students. Food Science and Technology. 19(2): International Journal of Food and 250 – 264 Nutrition Research, 1 (3): 001-007. Farinde, E .O. (2019). Manual for Rocha-Guzman, N. E., Gallegos-Infante, Processing and Utilization of Lima J. A., Gonzalez-Laredo, R. F., Bean (Phaseolus lunatus). Olakojo Cardoza-Cervantes, V., 1 Reynoso- (editor), Institute of Agricultural Camacho, R., 1 Ramos-Gomez, M., Garcia-Gasca, T. and De Anda Research and Training (I.A.R.&T), Salazar, A. (2013). Evaluation of Obafemi Awolowo University, culinary quality and antioxidant P.M.B. 5029, Moor Plantation, capacity for Mexican common beans Ibadan, Nigeria. 48p. (Phaseolus vulgaris L.) canned in pilot plant. International Food Garcia-Valle, D. E., Bello-Perez, L. A., Research Journal, 20(3): 1087-1093. Flores-Silva, P. C., Agama-Acevedo, Sanni, S. A., Adebowale, A. A., E. and Tovar, J. (2019). Extruded Olayiwola, I. O. and Maziya-Dixon, Unripe Plantain Flour as an B. (2006). Chemical composition and Indigestible Carbohydrate-Rich pasting properties of iron fortified Ingredient. Frontiers in Nutrition, maize flour. Food Agriculture and 6(2): 1- 9 Environment, 6:172 – 175. Iwe, M. O. (2002). Handbook of sensory Siddhuraju, P., Makkar, A. and Becker, K. methods and analysis. Rejoint (2002). The effect of ionizing Communication Services limited, radiation on antinutritional factors Enugu, Nigeria, 71-72. and nutritional value of plant materials with reference to human and Kathirvel, P. and Kumudha, P. (2011). A animal food. Food Chemistry, 78(8): comparative study on the chemical 187 – 205 composition of wild and cultivated Zoulias, E. I., Oreopoulou, V. and Tzia, C. germplasm of phaseolus lunatus L. (2002). Textural properties of low-fat International Journal of Applied cookies containing carbohydrate- or Biology and Pharmaceutical protein-based fat replacers, Journal of Technology, 2:296-305 Food Engineering, 55(4): 337– 342.

170 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Microbial Evaluation of Stored Breakfast Meal Prepared from African Yam Beans (AYB) and Quality Protein Maize (QPM).

Ejigbo, Elizabeth Abimbola Institute of Agricultural Research and Training, Obafemi Awolowo University P.M.B. 5029, Moor Plantation, Ibadan, Oyo State, Nigeria. [email protected] 08036222247

Abstract Quality Protein Maize (QPM) contains more lysine and tryptophan than most traditional maize varieties. African Yam Bean (AYB) is one of the lesser known legumes and it is a good source of dietary protein. At present no work has been done on the microbial properties of stored composite mixture of AYB and QPM blends. The AYB were purchased from Aleshinloye market in Ibadan while QPM was obtained from the seed store of IAR&T, Ibadan. The samples were prepared in the food processing laboratory, IAR&T. The composite mixtures of QPM and AYB flour blends were formulated at; 10%AYB+90%QPM (T1), 20%AYB+80%QPM (T2), 30%AYB+70%QPM (T3), 40%AYB+60%QPM (T4), 50%AYB+50%QPM (T5) and 100%QPM (T6) which served as control. Each composite mixture was kept inside clean transparent polythene bag and stored under ambient temperature (28 ± 20C) for 12months. The total bacteria count increased gradually with increase in storage period; at zero month there was no significant difference in the total bacteria count in all the samples. At the third month, T4 (8.3x101cfu/g) was significantly higher in value among other samples. On 12th month, T6 was significantly higher than the rest of the samples. There was no growth for total coliform at zero month, thereafter the growth increased gradually with storage time. At third month there was no significant difference at p<0.05 in samples T2 and T5. At 12th month the values ranged from 8.0x101cfu/g to 14.0x101cfu/g, and there was no significant difference between T3 and T6 respectively. There was no growth recorded for E-coli and Staphylococci in all the samples throughout the storage period. There was no growth for total mould count from zero `month till third month of storage. At 6th month T1 shows significant difference among others. On the 12th month, there was no significant difference in total mould count between T1 and T5. In conclusion, food pathogenic organisms like E. coli and Staphylococcus were absent which indicates that the breakfast meal is safe for consumption even at 12 month of storage.

Key words: African yam bean, Quality protein maize, Bacteria count, Coliform count, Mould count Introduction used less. These under-exploited legumes Quality Protein Maize (QPM) produces include African yam bean, bambara 70-100% more of lysine and tryptophan groundnut and pigeon pea. The AYB is than the most modern varieties of tropical grown in West Africa, particularly in maize (Omolaran et al., 2014). Despite Cameroon, Cote divoire, Ghana, Nigeria the fact that it contains lysine and and Togo (Adesoye and Nnadi, 2011). In tryptophan which are complete protein Nigeria it is found in localized areas there is still need to fortify with where it is grown by peasant farmers as a underutilized legumes like African yam security crop (Klu et al., 2001). The bean (AYB) in order to increase the African yam bean is grown for both its protein quality. Grain legumes constitute edible seeds and its tubers; the beans the main source of protein in the diets of contain amounts of essential proteins average Nigerian. The most common comparable to levels found in soybeans ones are cowpea, groundnut and soya and other beans. beans. However, there are other pulses Nigeria, like many third world that could help meet dietary needs but are countries is a food deficit country cultivated only in localized areas and especially with the increasing population

171 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 growth. Most rural communities cannot Research and Training, Ibadan. The afford animal proteins and over three African yam beans were bought from million children lack sufficient proteins Bodija market in Ibadan. The composite within the last decade, and therefore mixture of QPM and AYB were processed suffer grossly retarded physical growth in the IAR&T food processing laboratory and development (Klu et al., 2001). and the samples were later taken to Protein deficiencies also directly or laboratory for microbial analysis indirectly affect the health and economic productivity of adult populations. With Preparation of QPM and AYB Composite the ever increasing population pressure Mixtures and fast depletion of natural resources, it The QPM used was sorted, soaked for has become necessary to explore the three days, wet milled, sieved and dried, possibilities of exploiting new plant while AYB was sorted, blanched, resources to meet the growing needs of dehulled, dried and milled into powder. the human society. The African yam bean Composite mixture of the QPM and AYB [Sphenostylis stenocarpa], it is one of the flour was made at different ratios: 10% lesser known legumes and widely cultivated in the southern parts of AYB +90% QPM, 20% AYB +80% QPM, Nigeria. The legumes are a good source 30% AYB + 70% QPM, 40% AYB + 60% of dietary protein. They are cheaper than QPM, 50% AYB + 50% QPM and 100% animal products such as meat, fish, QPM served as control. Each composite poultry, egg, therefore they are consumed mixture and the control was kept inside worldwide as a major source of cheap clean transparent polythene bag and protein and especially in the developing stored under ambient temperature. or poor countries where consumption of Microbial evaluation and shelf-life animal protein may be limited as a result studies of these composite flour were of economic, social, cultural or religious- evaluated for 12 months factors (Beckley and Joseph, 2012). Global food security however is Preparation of Media becoming shaky with increasing All the media preparation were done dependence on a few major staple crops. according to Sanders (2012) This has resulted in an alarming reduction not only in crop diversity but also in the Plate Count Agar variability within crops. Through this A 23g of plate count medium was study effort have been made to promote suspended in one litre of purified water. It and aware consumers with the use of was heated with frequent agitation and AYB in preparing different products was boiled for one minute to completely including breakfast meal. Therefore, the dissolve the medium. It was autoclaved at objective of this study is to determine the 1210C for 15min and waited for it to cool shelf-life studies of the composite down at temperature 450C. Colonies on mixture of AYB and QPM product. PCA differ in their shape, size, colour and texture. Materials and Methods Source of Materials Used MacConkey Agar Quality protein maize variety ART Dehydrated medium of macconkey agar 98/SW6-OB was obtained from the seed of 49g was suspended in 1000ml distilled store of the Institute of Agricultural water. The medium was heated to boil to

172 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 dissolve the medium completely. It was properly and allowed to solidify. After, sterilized by autoclaving at 1210C for the plates were incubated at 370C for 24- 15min. The medium was cooled to 450C. 48hrs for bacteria and 24-72hrs for fungi It was then mix well and poured into the at room temperature. The colonies were petri-dishes then counted and recorded appropriately.

Mannitol Salt Agar Statistical Analysis Suspended 111g of mannitol salt agar was All determinations were measured in dissolved in 1000ml of distilled water. It triplicate and the data obtained from the was boiled to dissolve the medium analyses were subjected to an analysis of completely. The medium was sterilized variance (ANOVA). Means of values by autoclaving at 1210C for 15min were separated using the Duncan Multiple Range Test. Significance was Eosin Methylene Blue accepted at p < 0.05 (SAS, 1995). This is for isolation and differciation of gram negatve enteric bacteria. A 35g of Results the medium in one litre of distilled water. The composite mixtures of QPM and It was mixed well until the suspension AYB made at different ratios and the was uniform and it was heated to dissolve control were stored for twelve months. the medium completely. It was observed that the total bacteria count increased gradually with increase in Potato Dextrose Agar storage period. At zero month there was Thirty-nine gram of the powder was no significant difference in the total suspended in one litre of purified water bacteria count in all the samples (table 1). and was mixed thoroughly. It was heated At the third month, T4 (8.3x102cfu/g) was with frequent agitation and boil for 1min significantly higher in value among other to completely dissolve the powder. It was samples. On 12th month T6 was autoclaved at 1210C for 15min. The significantly higher than the rest of the m e d i u m w a s c o o l e d t o 4 5 0 C . samples. Streptomycin was added in other to In table 2, there was no growth for inhibit the growth of bacteria. total coliform at zero month, thereafter the growth increased gradually with Microbial Analysis storage time. At third month there was no Microbial analysis of the composite significant difference at p<0.05 in mixture of QPM and AYB were samples T2 and T5. At sixth month, there determined using the method of Sanders were no significant difference between T1 (2012). One gram of each sample was and T3 (6.67 and 7.00) cfu/g x 101. There serially diluted. After serial dilution, 1ml was also no significant difference -1 aliquot was taken from dilution 10 and between T2, T4, T5 and T6 respectively. were put in separate well labeled At 12th month the values ranged from petridishes. Molten agar plate count agar 8.0x101cfu/g to 14.0x101cfu/g, and there (PCA), macconkey agar (MAC), eosin was no significant difference between T3 methylene blue agar (EMB), mannitol and T6 respectively. salt agar (MSA) and potato dextrose agar There was no growth for total (PDA) was poured on each plate mould count from zero `month till third according to labels. They were swirled month of storage (table 3). At 6th month T1 173 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Total bacterial count of composite mixture of AYB and QPM (cfu/g) x101

Sample code Zero month 3rd month 6th month 9th month 12th month 10% (T1) 1.00a 5.33b 9.67d 14.67bc 19.00ab 20% (T2) 0.67a 5.00b 10.67cd 16.00abc 17.33bc 30% (T3) 1.00a 5.33b 11.00bcd 17.00ab 15.67c 40% (T4) 0.00a 8.33a 13.00a 13.67c 17.00bc 50% (T5) 0.67a 6.67ab 11.67abc 17.67a 18.67ab 100% QPM 1.00a 7.67ab 12.67ab 17.00ab 21.00a (T6) Means in the same column followed by the same letter are not significantly different from each other at p < 0.05 Note: 10% (T1): 10%AYB+90%QPM 20% (T2): 20%AYB+80%QPM 30% (T3): 30%AYB+70%QPM 40% (T4): 40%AYB+60%QPM 50% (T5): 50%AYB+50%QPM 100% (T6): 100%QPM Table 2: Total Coliform count of composite mixture of AYB and QPM (cfu/g) x 101

Sample code Zero month 3rd month 6th month 9th month 12th month 10% (T1) 0a 4.00ab 6.67a 11.33b 8.00c 20% (T2) 0a 4.33a 5.33b 11.33b 11.67ab 30% (T3) 0a 3.33ab 7.00a 12.00b 14.00a 40% (T4) 0a 2.33b 4.67b 13.33ab 13.00ab 50% (T5) 0a 4.67a 5.67b 12.00b 10.33bc 100% QPM 0a 3.67ab 4.67b 11.67b 14.00a (T6) Means in the same column followed by the same letter are not significantly different from each other at p < 0.05

Note: 10% (T1): 10%AYB+90%QPM 20% (T2): 20%AYB+80%QPM 30% (T3): 30%AYB+70%QPM 40% (T4): 40%AYB+60%QPM 50% (T5): 50%AYB+50%QPM 100% (T6): 100%QPM T able 3: T otal m ould count in com posite m ixture of A Y B and Q PM (cfu/g) x 10 1

Sam ple code Zero m onth 3 rd m onth 6 th m onth 9 th m onth 12 th m onth 10% (T1) 0 a 0 a 4.67 a 2.00 ab 3.67 a 20% (T2) 0 a 0 a 0.67 c 1.67 b 3.33 ab 30% (T3) 0 a 0 a 3.33 b 2.00 ab 2.67 ab 40% (T4) 0 a 0 a 1.33 c 4.33 a 1.00 b 50% (T5) 0 a 0 a 3.33 b 2.67 ab 4.67 a 100% Q PM 0 a 0 a 3.00 b 3.67 ab 2.67 ab (T6) M eans in the sam e colum n follow ed by the sam e letter are not significantly different from each other at p < 0.05

N ote: 10% (T1): 10% A Y B +90% Q PM 20% (T2): 20% A Y B +80% Q PM 30% (T3): 30% A Y B +70% Q PM 40% (T4): 40% A Y B +60% Q PM 50% (T5): 50% A Y B +50% Q PM 100% (T6): 100% Q PM

174 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 4: Total E. coli count in composite mixture of AYB and QPM (cfu/g) x 101

Sample code Zero month 3rd month 6th month 9th month 12th month 10% (T1) 0a 0a 0a 0a 0a 20% (T2) 0a 0a 0a 0a 0a 30% (T3) 0a 0a 0a 0a 0a 40% (T4) 0a 0a 0a 0a 0a 50% (T5) 0a 0a 0a 0a 0a 100% QPM 0a 0a 0a 0a 0a (T6) Means in the same column followed by the same letter are not significantly different from each other at p < 0.05

Note: 10% (T1): 10%AYB+90%QPM 20% (T2): 20%AYB+80%QPM 30% (T3): 30%AYB+70%QPM 40% (T4): 40%AYB+60%QPM 50% (T5): 50%AYB+50%QPM 100% (T6): 100%QPM

Table 5: Total Staphylococci count in composite mixture of AYB and QPM (cfu/g) x 101

Sample code Zero month 3rd month 6th month 9th month 12th month 10% (T1) 0a 0a 0a 0a 0a 20% (T2) 0a 0a 0a 0a 0a 30% (T3) 0a 0a 0a 0a 0a 40% (T4) 0a 0a 0a 0a 0a 50% (T5) 0a 0a 0a 0a 0a 100% QPM 0a 0a 0a 0a 0a (T6) Means in the same column followed by the same letter are not significantly different from each other at p < 0.05

Note: 10% (T1): 10%AYB+90%QPM 20% (T2): 20%AYB+80%QPM 30% (T3): 30%AYB+70%QPM 40% (T4): 40%AYB+60%QPM 50% (T5): 50%AYB+50%QPM 100% (T6): 100%QPM shows significant difference among throughout the storage period. Likewise others. On the 12th month, there was no for Staphylococcus which normally show significant difference in total mould count yellow colony on mannitol salt agar but in between T1 and T5. this study it did not grow throughout the No growth was recorded for E- storage period (Tables 4 and 5). coli and Staphylococci in all the samples throughout the storage period. Generally Discussion the growth of E. coli on eosin methylene There was no growth for total coliform at blue gives green metallic sheen but in this zero month, thereafter the growth study there was no growth at all increased gradually with storage time.

175 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

This correlates with the work of Rahman References et al. (2016) which reported that the initial Adesoye AI and Nnadi NC (2011). total coliforms bacteria count recorded no Mitotic Chromosome Studies of some growth in soy flour and increased with Accessions of African yam bean storage time till six month at room Sphenostylis stenocarpa (Hochst. Ex. temperature. According to this study no A. Rich.) Harm. African Journal of Plant Science 5(14): 835-841. growth was recorded for E-coli and Beckley I and Joseph KM (2012). Genetic Staphylococci in all the samples Assessment of Three Colour Variants throughout the storage period. It also of African Yam Bean[Sphenostylis agrees with the work of Rahman et al. Stenocarpa] Commonly Grown in the (2016), the report said that fecal indicator Midwestern Region of Nigeria. bacteria Escherichia coli and Staphylo- International Journal of Modern coccus aureus were not observed Botany 2(2): 13-18. throughout the storage period in soy bean Klu GYP, Bansa D, Kumaga FK and flour. Amoatey HM (2001). Cultivation and F e c a l i n d i c a t o r b a c t e r i a use of African yam bean (Sphenostylis stenocarpa) in the Volta region of Escherichia coli were not observed Ghana. Plant Genetic Resources throughout the storage period. The Newsletter, (124): 1-5. number of molds counted was found Omolaran BB, Odunayo JO, Sunday AI, within acceptable level throughout the Jimoh M, Micheal SA, Musibau AA, storage period at ambient temperature. Suleiman YA (2014). Agro- Nutritional Variations of Quality Conclusion Protein Maize (Zea Mays L.) in Nigeria. Journal of Agricultural In conclusion, food pathogenic Sciences 59 (2): 101-116 . organisms like E. coli and Staphylo- Sanders ER (2012). Aseptic Laboratory coccus were absent which indicates that Techniques: Plating Methods. the breakfast meal is safe for Journal of Visualized Experiments consumption even at 12 month of ambient (63): 1-18 e3064 storage. SAS (1995). SAS User's Guide, Statistical Analysis System Institute, Inc., Cary, NC.

176 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Bambara groundnut production and utilization value chain in Ebonyi State

1Nwanchor, K. and 2Okeke, G.C. 1Department of Crop Production and Landscape Management, Ebonyi State University P.M.B. 053 Abakaliki, Nigeria, 2National Agricultural Extension and Research Liaison Service, Ahmadu Bello University, Zaria, Kaduna State Nigeria. (Email: [email protected])

Abstract: Bambara groundnut (Vigna subterranean (L) Verdc.) is an important legume crop grown in sub-saharan Africa by subsistence farmers usually women. The crop has high nutritional and agronomic potentials. The seed when processed into flour, can be used to prepare Okpa, Moi-moi, akara (bean ball), milk, beancake (kulikuli), soup and porridge. The flour has protein content of 15.6-19.6%, starch 47.8-52.0% and sucrose 1.9-5%. Processing of bambara groundnut seeds into flour for making these products will motivate its consumption and provide more diversity in our local diets. Despite all these important uses, the crop still remains neglected and underutilized with low production due to lack of improved variety and inadequate processing techniques. This paper therefore, sought to examine all aspects of bambara groundnut production such as management practice by farmers, post- harvest utilization, processing, value chain and marketing. Value chain approach will not only improve income generation, sustainable food security and nutrition but will also create more jobs and contribute to rural development. Smallholder households can be provided with incentives to obtain improved seeds and invest more of their lands and labour for the production of bambara groundnut if there is available and accessible market outlets.

Key words. Bambara groundnut, legume crop, production, utilization, food security and value chain. Introduction becoming one of the greatest challenges Food is an indispensible commodity facing man, as the world population is required by man for various activities, its expected to exceed 9 billion by 2050 constituent's supply man with energy and (Conforti,2011). According to WPC raw materials for building his body. (2018), Nigeria with an average Although food has become costly and population growth of approximately scarce because consumption rate is higher 2.34% per annum, it is estimated that by than the rate of agricultural productivity 2030 the population will grow up to 260 resulting in food insufficiency and million. If the present economic trends insecurity at both local and global level. persist by 2030 real growth GDP of 2.15% Aviara et al., (2013) reported that the per annum will not be able to sustain the present increasing rate of world's population growth, resulting in an annual population in relation to the rate of growth of GDP per capita of less than agricultural productivity shows that zero. Banjo (2019) quoted Nigeria to be production of main crop should not only poverty capital of the world, having the be increased but also encourage the largest number of people living in an cultivation of other neglected and extreme poverty with an estimated 87 underutilized legume crops such as million people living less than $1.90 per bambara groundnut, in order to meet food day, taking over India a country with and nutritional insecurity. seven times the population of Nigeria. Production of food to sustain the According to Muhammad (2019) the steadily increasing population is cause of extreme poverty is the denial of 177 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 citizens access to basic necessities of life Underutilized crops such as bambara such as food, healthcare and sanitation, groundnut will not just provide food and education and other assets, tackling these nutrition security but could also help to issues will probably lift populations out of provide purchasing power for poor poverty. It therefore, becomes expedient resource and subsistence farmers as the to focus on means of increasing recent spikes in the prices of food sustainability of crop production to meet commodity show that the poor farmers do up the increasing food demand and one of not have the purchasing power to obtain the means of realizing this may be by the food even if it is physically available growing indigenous crops that require (Padulosi et al., 2011). less inputs and are more resistance to Nevertheless, agricultural environmental stresses (Mayes et al., organization has recognized the important 2011). role and untapped potentials of neglected Padulosi et al. (2012) and Ani et and underutilized crops for food and al. (2013) observed that increased nutrition security, income generation in weather variability and climatic change rural areas, adapting to climate change have resulted in decreased agricultural and mitigation, agronomic and economic productivity leading to negative effect of risks. Promotion and cultivation of food and nutritional insecurity. Similarly, indigenous, drought tolerant legume Easterling et al.(2007) stated that in crops such as bambara groundnut has Africa most developing countries are been recommended by researchers located in a low-latitude regions where because of its high adaptability which climate change has resulted to low makes it suitable for semi-arid regions agricultural production. In addition, where other crops fail to thrive (Enwere Davies (2003) reported highest rate of and Hung in Mubaiwa et al., 2018). population growth in this same region of Bambara groundnut is an important developing countries where poverty and legume crop grown in sub-Sahara Africa food shortage is greatest. Therefore, by subsistent farmers usually women for relying on only a small number of staple their income, food/nutrition security and crops for the increasing population fodder for livestock (Ngwako et al., 2013; pressure and climate change is potentially Hillocks et al., 2012). The crop originated dangerous (Taylor et al.,2009). in Africa particularly Northeastern In order to tackle this problem of Nigeria and Northern Cameroon. At increasing demand for food due to present it is widely grown and distributed pressure of population, there is need to in the semi-arid zone of sub-Saharan focus on breeding for neglected and Africa, America, Asia and Australia as underutilized crops like bambara reported by Aviara et al. (2013); groundnut which are resistance to Nichtertein (2011); Suwanprasert et drought, pests and diseases with high al.(2006). Bambara groundnut is highly nutritional value to improve the genetics nutritious with seed protein content of of the existing varieties, exploring post- 24.14%, carbohydrate 63%, fat 6.5%, harvest technology and better water 19%, ash 3.4% and cellulose 4.4%. management practice so as to fill some of Other nutrients include vitamins A, C and the yield gaps and enhance food/ E, thiamine, riboflavin, niacin, carotene, nutritional security (Foley et al., 2011; ascorbic acid, zink, iron, calcium and Mohan and Suprasanna, 2011). potassium (Bamishaiye et al.,2011;

178 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Enyidi and Mgbenka, 2014; Muibmba- lactating mothers and it is also given to Kankolongo, 2018). women who just gave birth to heal their wounds. The seed contains kaempferol, Importance of Bambara groundnut an antioxidant polyphenol that reduces Nutritionally, the crop serves as a cheap the risk of many chronic diseases such as source of rich protein that can be used to colon cancer (Jideani and Diedericks improve the food and nutrition security 2014; Yao et al., 2015 and Temegne, status of rural households who cannot 2018). afford protein from meat and other Despite all the important uses of expensive sources (Ijarotimi, 2008). bamabara groundnut, it still remains Apart from the food value, bambara highly neglected and underutilized. There groundnut plays an important agronomic has been little or no reasonable research role in soil fertility improvement through towards the improvement of the seed for atmospheric nitrogen fixation into the production, Post-harvest utilization, soil, which makes it very useful to processing and marketing. This lack of farmers in crop rotation and intercropping research interest on the crop in long term without application of chemical nitrogen may result to its genetic erosion (Aviara et fertilizers, it reduces erosion when al., 2013 and Abdou et al., 2018). This planted on the yam mounds, soil paper, therefore sought to examine all temperature fluctuations and improves aspects of bambara groundnut production soil moisture (Yao et al., 2005; which includes management practice by Mkandawire in Abdou et al., 2018). farmers, post-harvest utilization, Fakunmoju et al. (2016) equally reported processing, value chain and marketing in the use of bambara ground waste meal as Ebonyi State, Southeast Nigeria. soil manure. The crop serves as a medicinal plant, in Senegal the leaves are Bambara groundnut utilization/ prepared and used for the treatment of processing abscesses, infected wounds, leaf sap is In spite of the huge nutritional and applied to the eyes to treat epilepsy, agronomic potentials inherent in bambara pounded seeds mixed with water is used groundnut, it remains largely neglected in to treat cataracts, roots of bambara research, production and utilization. This groundnut are taken as an aphrodisiac, it may be due to some constraints such as is also used in treatment of kwashiorkor, hard seed coat when dry, long cooking menorrhagia (excessive menstruation), time, presence of anti-nutritional factors nausea in women during pregnancy and like tannins and trypsin inhibitors, since prevent heart diseases. the seed does not dehull easily, it has poor In Nigeria the Igbo tribe uses the milling characteristics. In Ebonyi state plant to treat venereal diseases while in and other parts of southeast the crop is Cameroon diseases such as amoebic consumed in different traditional recipes; dysentery, sore throat, headaches, Fresh pods are eaten as snacks when stomach pain, joint pain and bone boiled and added with salt, dry seeds are decalcification (loss of calcium) have roasted and chewed with palm kernel, dry been treated using bambara groundnut. It seed is ground into flour by milling helps in digestion through its laxative followed by sieving using sieves with properties, stimulates milk production in 1mm pores. The flour is then used to

179 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 prepare okpa (steamed gel), akara (bean lysine and tryptophan content, nutritional balls) and moi-moi. Other beans can be composition of cooked banana also used to prepare these fast foods but those increased when fortified by adding made from bambara groundnut are fermented bambara groundnut flour as considered to be the best. traditional weaning food. Bamshaiye et al. (2011) reported Expensive commercial weaning the use of bambara groundnut flour for products can be substituted using making pancake/ kulikili (bean cake) by bambara groundnut flour, especially for the Nupes and Yorubas in Niger and the poor or low income mothers in the Kwara states. Hillocks et al. (2012) and rural communities of Ebonyi State. In Mbata et al. (2009) recorded the use of Mtwara, Tanzania and Awka, Nigeria bambara groundnut flour for the same Hillocks et al. (2012) and Mbata et al. purposes in Coted'Ivoire, Zimbabwe and (2009) reported that milk obtained from East Africa. While in Zambia, Olaposi et bambara groundnut flour has been rated al. (2017) confirmed the production of bread using bambara groundnut flour higher and preferred in taste and colour to while fermented flour was used as a milk from other legume crops like weaning food in supporting child growth cowpea, pigeon pea and soya bean. In and development. Hillocks et al. (2012) Dosso region of Western Niger, Abdou et observed an increase in the protein al. (2018) stated that bambara groundnut content of fermented maize dough from flour is used for feeding animal and 10% to 16.4% while the pH decreased making spaghetti. According to Yao et al. with an increase in moisture, fat, ash, (2005); Brink et al. (2006) and Bamshiaye

Figure 1: Processing of Bambara groundnut seed into flour for various product

180 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 et al. (2011) bambara groundnut leaves or for rural development projects. The which are rich in nitrogen, phosphorus growing population in Nigeria can and potassium and the seeds are used as provide market potentials for commercial pig and livestock feed. In fish production, production of bambara groundnut. Fakunmoju et al. (2016) reported that use Agriculture has been the mainstay of of bambara groundnut waste meal as a Nigerian economy, though continues to dietary supplement in the diets of Tilapia rely on primitive methods to sustain the niloticus was the best means of reducing growing population without efforts to add value. Neglecting the agriculture sector cost of fish production and also effective will lead to slow economic growth and way of achieving the best output in terms inequality in income distribution. Even of weight gain. Commercial production of though the sector can single-handedly bambara groundnut fodder for animal transform the economy and equally f e e d i n g w o u l d g r e a t l y r e d u c e provide a suitable condition in kick farmers/herdsmen clashes in Nigeria. starting industrialization in the early stage Bambara groundnut value chain of development Tolulope & Chinonso, Value chain is referred to as the (2013) and Byerlee et al. (2005). Johnston series of activities required and utility and Mellor in (Tolulope and Chinonso, a d d e d d u r i n g t h e p r o c e s s o f 2013) summarized the role of agriculture manufacturing a product using a needed sector to economic development in five raw materials, it also involves a inter-sectoral linkages; food, labour, combination of physical transformation market, domestic savings and foreign and the input of various actors in the exchange. production and processing services. The supply chain refers to the entire vertical Marketing of Bambara groundut chain of activities from production on the Bambara groundnut is mainly farm, through processing, distribution, grown for home consumption and also retailing and delivery to the final sold at different forms like fresh mature consumers and final disposal after use. In pods, cooked fresh mature pods, dry order words, from gate to plate grains, dry pods and its products such as (Kaplinsky, 2013; Rich et al., 2011; okpa, akara, moi-moi and pancake/ Hobbs et al., 2000). Bambara groundnut kulikuli by women or girls who engage in if it is considered as a lucrative cash crop the sales/hawking at local markets, streets and not just a local snack or food or bus stop. Presently, in Ebonyi State supplement can impact the livelihood of there is no formal market designated for the small holders', producers, processors the sale of bambara groundnut like other and marketers. Value chain approach in legumes and staple crops. This may be bambara groundnut will not only identify due to lack of advertisement and the major players in the supply chain of awareness on proper information about the commodity but will quantify value the potentials of the crop and its products, added by each stage of the production and resulting to neglect, underutilization and supply processes. poor marketing. Existing bambara Income obtained from bambara groundnut and its products are not well groundnut value chain can either be used promoted in the local and international to meet food and other house hold needs markets. The market potential is negatively affected because priority and

181 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 attention is not given to the crop as it is and E. The crop is adapted to a harsh considered unprofitable and left for environment where other legume crops women. cannot grow, given that it is well adapted More research effort on the to various agro-ecological conditions and market outlet should be intensified in climate change. Bamara groundnut could order to develop high quality products be taken as a potential future crop to be that may go beyond the level of household exploited for food security, climate consumption. Commercial processing of change mitigation and poverty alleviation bambara groundnut into canned products because of its ecology, distribution, will likely open up a buoyant new market nutrition and medicinal properties. In outlet, canned products seem to have high Ebonyi state it is mostly cultivated by marketing potentials especially in urban women on a small scale usually areas. In the early 1960s bambara intercropped with yam, cassava, cowpea groundnut was canned in Zimbabwe and and maize. It has faced low productivity Ghana where over 50,000 and 40,000 due to some constraints such as lack of cans respectively were sold annually improved variety, modern techniques for (Bamishaiye et al., 2011). Nigeria has production and processing, hard seed coat many opportunities for such enterprises causing barrier to hydration and long which will create major markets for cooking time involved in boiling as farmers and boost their income complained by farmers and consumers. opportunities in rural areas. This means that further breeding Absence of functioning value programme is required to improve chain has been a major factor affecting productivity, commercialization and accessible market outlet of the crop. If utilization. marketing of bambara groundnut and its If the utilization of bambara products is adequately structured, the groundnut is improved, it will enhance livelihood of the households involved in increased cheap food and nutrition all the stages of production, processing security to the rural population in Ebonyi and marketing will be enhanced state. Processing of bambara groundnut into flour for various products can also especially in Ebonyi state. Standard encourage its consumption and ease the grading system of bambara groundnut utilization by providing more diversity in should be designed just like other main our local diets. Development of functional crops in order to improve its acceptability value chain approach for bambara in both local and international markets, groundnut and its products can provide a this could also improve its value chain. sustainable means of livelihood for participants in the production stages such Conclusion and Recommendations as producers, processors, retailers/ Bambara groundnut is an marketers. Income generated from the important African indigenous legume various economic activities can be used to crop grown for its agronomic, medicinal, meet up with household needs and rural food and nutritional values for both development projects. human and animal consumption. The The following recommendations seeds contain on average 63% of would contribute to the improvement of carbohydrate, 19% of proteins and 6.5% production, processing and utilization of fats. They also contain calcium, value chain of bambara groundnut by potassium, iron, nitrogen, vitamins A, C farmers. 182 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

a. Governments, NGOs, Extension millions of lives of mothers will agents/services, Research institutes/ automatically be improved and offer a commercial organizations and seed good opportunity for gender and companies/suppliers should assist in vulnerable group oriented innovation seed multiplication of available since women are mostly involved in landraces and distribute to farmers the production, processing and with other incentives for commercial marketing. production of bambara groundnut and f. If the Value chain approach is not to be left for women alone or seen developed and improved, it will as poor people's crop. provide income for household needs, b. Commercial production of bambara rural development projects, create groundnut for fodder will enhance jobs for the teeming unemployed animal feeding and nutrition, it could citizens, alleviate poverty and reduce also reduce the incessant clashes high rate of crimes in Nigeria. between farmers and herdsmen in g. Farmers especially men should be different parts of Nigeria. encouraged to use bambara groundnut c. Nutritionists and food technologists for crop rotation and intercropping should pay closer attention to because it will enhance soil fertility bambara groundnut and its products improvement and minimize the use of and advice governments to fully synthetic nitrogen fertilizer, which is integrate it into her home grown food expensive, deteriorates soil properties policy for school children, as this will and contaminates food produce. When reduce the vulnerability of rural planted on yam mounds it protects the household to food and nutritional mound from erosion, conserves insecurity especially malnutrition in moisture leading to reduced children and also bridge the huge temperature fluctuation. gaps in the knowledge base. d. The production, processing and h. On-farm promotion and public marketing of bambara groundnut awareness program should be produce should be developed into organized because many farmers do industrial level for export and foreign not plant bambara groundnut solely e x c h a n g e e a r n i n g s t h r o u g h due to lack of knowledge or advice. mechanized cultivation, harvesting, Farmers-to-farmers exchange shelling(using machine to crack open program nationally and interna- pods) and processing (especially tionally should also be undertaken as a canning, milling, popping, puffing good mechanism for upgrading and and protein extraction) as this could promoting bambara groundnut. really advance this abandoned crop. e. Improving the post-harvest utilization Conflict of Interest In compliance with and handling of bambara groundnut ethical standards, the authors declared and its products would mean an that they have no conflict of interest. increase in food and nutrition security, provide more diversity in our References local diets in order to meet increasing Abdou, R.I., Alexander, D., Mohamadou, food demand due to population S., Abdou, O., Ali, A. and Wazir, A. pressure in Nigeria. Above all, (2018). Farmer's practices, utilization,

183 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

conservation and marketing of Brink, M., Grubben, G.J.H., Belay, G. and B a m b a r a g r o u n d n u t ( Vi g n a Agrooh, J.A. (2005). Plant Resources Subterranea (L.) Verdc.) In Dosso of Tropical Africa. Cereals and Region, Western Niger. Genet Resour Legumes 2; Publisher; Earthprint Crop Evol 65:1907-1914. Limited. pp:238. Adjima, O., Senge, F.Z., Mahama, O., Byerlee, D., Diao, X. and Jackson, C. Herve, N., Hamed, M.O., Romaric, ( 2 0 0 5 ) . A g r i c u l t u r e , R u r a l K.N., Nerbewende, S., Elisabeth, P.Z., Development and Pro-poor growth: Konate, N.M., Congo, A.K., Romain, country experiences in the post reform W.S. and Mahamadou, S. (2017). e r a . A g r i c u l t u r e a n d R u r a l Assessment of genetic diversity in Development Discussion Paper 21. B a m b a r a g r o u n d n u t ( Vi g n a The World Bank. Subterranea (L) Verdc.) landraces in Conforti, P. (2011). Looking Ahead in Burkina Faso using microsatellite World Food and Agriculture: markers 9SSR). Agricultural Science Perspectives to 2050, office of Research Joaurnal 7 (3): 96-102. Knowledge Exchange, Research and Aviara, N.A., Lawal, A.A., Atiku, A.A. E x t e n s i o n , FA O , F o o d a n d and Hawue, M.A. (2013). Bambara Agricultural Organisation of the groundnut processing; storage and United Nationss, Italy. Pp560. utilization in Northeast Nigeria. Enyidi, U.D. and Mgbenka, B.O. (2014). Continental J. Engineering Sciences 8 Substitution of fishmeal with bambara (1): 28-36. groundnut waste meal in diets of first Banjo, D.(2019). How corruption and bad feeding (Clarias gariepinus x governance helped make Nigeria a H e t e ro b r a n c l u s b i d o r s a l i s ) poverty capital of the world. Heteroclarias. International Journal of International Anti-corruption Fisheries and Aquatic Studies 1 (3): conference, Seoul, Republic of Korea. 118-122. Bamshaiye, O.M., Adegbola, J.A., and Fakunmoju, F.A., Babalola, O.A., Bamishaiye, E.I. (2011). Bambara Ijimakinde, B., Anjola, O.A. and groundnut (Vigna subterranae (L.) Orowole, P.F. (2016). Effect of Verdc.) an underutilized nut in Africa. substituting maize with bambara A d v a n c e s i n A g r i c u l t u r a l groundnut (Voandzeia subterrenea Biotechnology 1: 60-72. Thouars) waste meal in the practical Barrett, C. (2008). “Smallholder market Diets of Tilapia niloticus Fingerlings. participation: concepts and evidence Journal of Fisheries and Aquatic from eastern and southern Africa”. Science, 11:185-189. Food Policy vol. 33 pp.299-317. FAO (2007). Data sheet Vigna Berchie, J.N., Adu-Dapaah, H.K., subterranean. Ecocrop. FAO Dankyi, A.A., Plahar W.A., Nelson- FAO (2018). Statistic of production Quartey, F. and Haleegoah, J. (2010). (FAOSTAT). Food and Agriculture Practices and constraints in Bambara Organisation of the United Nations. groundnut production, marketing and Foley, J.A., Ramankutty, N., Brauman, consumption in the Brong Ahafo and K.A., Cassidy, E.S., Gerber, J.S., Upper-East Regions of Ghana. J.Agro Johnston, M., Muller, N.D., 9(3):111-118. O'Connell, C., Polasky, S.,

184 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Rockstrom, J., Sheeham, J., Siebert, suterranea and moringa oleifera.In S.R., Monfreda, C., Ray, D.K., West, Oguntibeju O (Ed), Antioxidant- P.C., Balzer, C., Bennett, E.M., antidiabetic agents and human health. Tilman, D. and Zaks, D.P.(2011). Intch Publishers, pp22. Solutions for a cultivated planet. Kaplinsky, R. (2013). Development Nature 478:337-42. Policy and Practice. The Open Davies, P.D.O. (2003). The world wide University. i n c r e a s e t u b e r c u l o s i s : H o w Mayes, S., Massawe, F.J., Alderson, P.G., demographic changes, HIV infection Roberts, J.A., Azam-Ali, S.N. and and increasing numbers in poverty are Hermann, M. (2011). The potential for increasing tuberculosis. Annual of underutilized crops to improve Medicine 35:235-243. security of food production. J Exp Bot Eatserling, W.E., Aggarwal, P.K., Batima, 63:1075-9. P., Brander, K.M., Erda, L., Howden, Mbata, T.I., Ikenebomeh, M.J. and S.M., Kirilenko, A., Morton, J., Ezeibe, S. (2009). Evaluation of Soussana, J.F., Schmidhuber, J.and Mineral content and functional Tubiello, F.N.(2007). Food, fibre and properties of fermented maize forest products. Contribution of (Genetic and specific) flour blended working group 11 to the Forth with bambara groundnut (Vigna Assessment Report of IPCC, in M. L. Subterranea (L.) Verdc.) African Parry, et al. (Eds), Climate change Journal of Food Science 3(4):107-12. 2007: Impacts, adaptation and Mohan, J.S. and Suprasanna, P. vulnerability, Cambridge University (2011).Induced mutations for Press. Cambridge, UK, pp. 273-313. enhancing nutrition and food Hillock, R.J., Bennett, C. and Mponda, production. Gene Conserve 40:201- O.M. (2012). Bambara groundnut: a 215. review of utilization, market potential Mubaiwa, J. Fagliano, V. Chidewe, C., and crop improvement. Afr Crop Sci J Bakker, E.J. and Linnemann, A.R. 20(1):1-6. (2018). Utilization of bamabara Hobba, J., Cooney, A. and Fulton, M. groundnut (Vigna Subterranea(L) (2000). Value chains in the agric-food verdc.)for sustainable food and sector. What are they? How do they nutrition security in semi-arid regions work? Are they for me? Department of Zimbabwe. P.LoS ONE 13 (10): o f A g r i c u l t u r a l E c o n o m i c s , e0204817. University of Sasketchewan. Muhammad, S.A. (2019). Three things Ijarotimi, D.S. (2008). Nutritional Nigeria must do to end extreme composition, microbial status, poverty. World Economic Forum, functional and sensory properties of World Poverty Clock. World Lab infants diets formulated from cooking Data. banana fruits (Musa spp. ABB Muimba-Kankolongo, A. (2018). genome) and fermented bambara Leguminous Crops. Food crop groundnut (Vigna Subterranea (L.) production by small holder farmers in Verdc.) seeds. Nutritional and Food southern Africa. Academic press. P. Science 38:325-340. 173-203. Jideani, V.A. and Diedericks, C.F. (2014). Ngwako, S., Balole, T.V. and Malambane, Nutritoinal, therapeutic and G. (2013). The effect of irrigation and prophylactic properties of Vigna planting date on the growth and yield

185 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

of Bambara ground landrace. Int. J. E. and Ntsomboh-Ntsefong, G. Agric. Crop Sci. 6(3):116-120 (2018). Origin and Ecology of Olaposi, R.A., Oladipupo, Q.A., b a m b a r a g r o u n d n u t ( Vi g n a Olumide, S.F. and Gbeminiyi, O. subterranean (L.) Verdc.). AReview. (2017). Effect of soaking and boiling Journal of Ecology and Nutritional on Anti-nutritional factors; Resources 2 (4). Oligosaccharide content and protein Tolulope, O. and Chinonso, E. (2013). Digestibility of newly developed Contribution of Agriculture to bambara groundnut cultivars. Turkish Economic Growth in Nigeria. 18th Journal of Agriculture Food Science Annual Conference of the African and Technology, 5(9): 1006-1014. Econometric Society (AES) Accra, Padulosi, S., Bergamini, N. and Ghana. 22nd-23rd, July, 2013. Lawrence, T. (2011). On farmer Tsoata, E., Njock, N.R., Youmbi, E. and conservation of neglected and Nwaga, D. (2015). Early effects of underutilized species: Status, trends water stress on some biochemical and and novel approaches to cope with mineral parameters of mycorrhizal climate change: Proceedings of an Vigna subterranean (L.) Verdc. International Conference, Frankfurt, (Fabaceae) cultivated in Cameroon. 5:191-197. IJAAR 7(2): 21-35. Rich, K.M., Ross, R.B., Baker, A.D. and Tsoata, E., Temegne, N.C. Youmbi, E. Negassa, A. (2011). Quantifying (2016). Analysis of early criteria to value chain analysis in the context of screen four Fabaceae plants for their livestock systems in developing tolerance water stress. Int J Recent Sci countries. Food Policy 36:214-222. Res 7 (11): 14334-14338. Taylor,M., Jaenicke, H., Skelton, P. and Mathur, P.N. (2009). Regional WPC (2018) World Poverty Clock. The Consultation on Crops for The Future: percentage of Nigerians living in To w a r d s F o o d , N u t r i t i o n a l , extreme poverty. The United Nations Economic and Enviromental Security Development Programm. in The Pacific, secretariat of the Yao, D., Beket, B.S. and Zoro, B.L. Pacific Community. Asia-Pacific (2005). Preliminary observation of Association of Agricultural Research v a r i a b i l i t y b e t w e e n s o m e Institutions. Bioversity International. morphotypes of bambara groundnut Crops for the Future. Agricultural (Vigna subterrenea(L.) Verdc.) From Research Institute, PNG. Pp 28. Cote dIvoire. Biotechnol Agron Soc Temegne, N.C. (2018). Improvement in the performances of Voandzou (Vigna Environ 9(4): 249-258. suterranea) in response to phosphate Yao, D.N., Kouassi, K.N., Erba, D., deficiency through chemical and Scazzina, F. and Pellegrini, N. (2015). biological fertilization. Ph.D thesis, Nutritive evaluation of the bambara Fac Sci University of Yoaunde. groundnut Ci12 landrace (Vigna Temegne, N.C., Gouertoumbo, W.F., subterraneae (L.) Verdc.) Fabacaea Waken, G.A., Nkou, F.T.D., Youmbi, produced in Cote d Ivoire.

186 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Physical, Cyanide Contents and Functional Properties of African Yam Beans Accessions

Ojo, A.1, Abiodun, O.A.2*, Olosunde, O.O.1, Amanyunose, A.A.1, Ogundimu, M.O.2 and Nwosu, C.3 1Department of Food Science and Technology, Osun State Polytechnic, Iree, Osun State. Nigeria 2Department of Home Economics and Food Science, University of Ilorin, Kwara State, Nigeria. 3 National Centre for Agricultural Mechanization (NCAM), Idofian, Ilorin, Kwara State. *Correspondent author: [email protected], [email protected] +2348030701354

Abstract Physical, cyanide and functional properties of African yam beans accessions were determined in this study. Six accessions of African yam beans were milled into flour and kept in air tight containers. Physical, cyanide and functional properties of the beans were also determined. TSs 23 seeds had the highest height of 7.97 cm while TSs 22 had the least value. TSs 23 weighed (57.60g) more than other varieties and the lowest values in weight and diameter was recorded for TSs 34. Lightness value (L?) of whole seeds of TSs 33 was 43.58 while TSs 34 and TSs 24 seeds were darker in colour than other samples. TSs 30, TSs 33 and TSs 23 had higher yellowness values which ranged from 10.27 to 10.71. Lightness and yellowness values of the flour were higher than the whole seed colour parameters. Cyanide contents of the beans were low values which were less than 1 mg/kg in TSs 34 but not detected in other accessions. Bulk density of TSs 22 (0.91g/cm3) was higher than other samples while TSs 30 had the least value. TSs 34 had higher water absorption capacity (0.91 ml/g) followed by TSs 30 (0.87 ml/g). Least value for water absorption capacity was in TSs 23 (0.62 ml/g). TSs 34 was more soluble (10.04%) in water than other samples while TSs 23 had the least solubility value of 8.37 %. The physical and functional properties of African yam beans accessions studied revealed that the seed could be used in food applications.

Keywords: African yam beans, Accessions, Colour, Cyanide, Functional properties, Introduction African yam bean. Like other legumes, African yam bean (AYB), Sphenostylis AYB is also reported to be associated with stenocarpa (Hoechst. ex. A. Rich.) is an flatulence caused by flatulence inducing underutilized legume cultivated for its oligosaccharides (Nnam, 1999; Ene- edible seeds and tubers in sub-Saharan Obong & Obizoba, 1995). These African countries. The bean is unpopular limitations can be overcome using and lesser known in the tropics as other processing methods like fermentation, legume. The seeds have high protein soaking, roasting, boiling among others content and are good sources of amino (Ene-Obong, 1995; Nnam, 1999). acids (Adewale et al., 2013). African yam Jaenicke and Pasiecznik (2009) suggested beans can be consumed in various forms that increase in the use of underutilized (Asoiro and Ani, 2011) such as fried c r o p s m a y r e d u c e n u t r i t i o n a l , snack and cooked like cowpea pottage. environment, and financial vulnerability Some of the limitations in the utilization as well as their contribution to food of African yam bean may be long cooking security. Therefore, this paper presents the time which could be traced to hard seed physical, cyanide contents and functional coat and beans flavour which arises as a properties of African yam beans result of some anti-nutrients present in the accessions.

187 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Materials and methods swirling and 5 drops of Reagent CN-2 was Materials added. Immediately the test strip was Six Accessions (TSs 22, TSs 23, TSs 24, immersed in the reaction zone of the TSs 30, TSs 33 and TSs 34) of African measurement sample for 30 sec. The strip yam bean seeds were collected at Genetic was removed, allow excess liquid to run Resource Center of International Institute off via the long edge of the strip onto an of Tropical Agriculture (IITA), Ibadan, absorbent paper towel, and, within 10 sec, Nigeria. determine with which color field on the label the color of the reaction zone Methods coincides most exactly. The value was African yam beans were cleaned and read and corresponding result in mg/L milled in Kenwood blender into flour and CN-1. kept in air tight containers Functional Properties Physical parameters determination Bulk density determination The physical properties of the six African The method used by Udensi and Okaka yam bean accessions were measured. The (2000) was adopted. Bulk density was seed diameter and height were measured determined by weighing 3 g of each using digital Vernier caliper. The seed sample into 10 ml graduated cylinders and weights of the accessions were tapping ten times against the palm of determined by selecting 100 seed and hand. The volume of the flour after weighed on analytical balance. tapping was recorded and bulk density was expressed as g/ml. Colour Measurement The colour attributes (Hunter L, a, and b Water Absorption Capacity (WAC) values) of the flours and dough were determination measured using colorimeter the colour Flour sample (1 g) from each treatment coordinates system L* a* and b* values was weighed into dry centrifuge tube. were recorded and the brown index was Distilled water was mixed with the flour calculated Hsu et al. (2003). Where: L, a, to make up to 10 ml dispersion. It was then and b were Hunter L*= Whiteness, a*= centrifuged at 3500 rpm for 15 min. The Redness and b*= yellowness values. supernatant was discarded while the tube with its content was reweighed. The gain Determination of Hydrogen Cyanide in mass is the water absorption capacity of Two gram of each of sample was made the flour sample (Iwuoha, 2004). into paste in 20 mL of distilled water in a corked conical flask overnight after Swelling power which extraction took place. The extract Swelling power was determined by using was filtered and the filtrate was used for Kusumayanti et al. (2015). The 0.1 g the analysis (Adebayo-Oyetoro et al., sample is heated in 10 ml distilled water in 2013). Cyanide test kit Quantofix (7070- a water bath at 60°C for 30 minutes with 1EA) was supplied by Bristol Scientific constant mixing. The samples were Company Limited, Nigeria. The test centrifuged at 1600 rpm for 15 minutes. vessel was filled with extracted sample to The precipitated part was weighted and the 5 ml mark. One level spoon of calculated Reagent CN-1 was added, dissolved by

188 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Water solubility with the lightness values. b* was more Water solubility was determined using pronounced in the flour than the whole Kusumayanti et al. (2015). The 0.5 g seeds. No significant differences sample is heated in 10 ml distilled water (p>0.05) was observed in the b* values of bath at 60°C for 30 minutes without all the flours. mixing. The samples were centrifuged at The height, weight and diameter 1600 rpm for 10 minutes. The supernatant of the AYB seeds were measured and was separated (5 ml), dried, weighted and shown in Table 2. Height of the bean calculated. ranged from 7.23 to 9.07 mm. TSs33 was Statistical analyses longer than other accessions followed by The data obtained in this study were TSs23 (8.10 mm). The least height was subjected to Analysis of Variance observed in TSs22 (7.23 mm). The weight (ANOVA) and Duncan test as packaged of one hundred seeds measured showed by SPSS 17.0 that TSs23 weighed more than other accessions with significant differences Results and Discussion (p>0.5) in the weight of all the samples. Table 1 shows the colour of African yam The weight values obtained in this work bean seeds and their flours. TSs 33 flour were greater that the values (31.81-39.41 had higher lightness value (L*) which g) reported for 100 seeds of lima bean was not significantly different (p>0.05) according to Seidu et al. (2018). Diameter from flours of TSs 34, TSs 24, TSs 22 and of TSs23 (5.67mm) was significantly TSs 23. The lightness values of flours different (p<0.05) from other accessions. from all the accessions were higher than There were no significant differences that of whole seeds. Whole seeds of TSs (p>0.5) in diameter values of TSs30, 30, TSs 33, TSs 34 and TSs 23 were not TSs33, TSs34, TSs24, TSs22. Asoiro and significantly different (p>0.05) from each Ani (2011) reported higher values ranging other in redness (a*) values. The a* values from 5.0 to 7.7 mm for intermediate ranged from 2.38-4.23. The a* values for diameter of African yam beans purchased the whole seeds were higher than that of in the market. Except for TSs23, other their flours. Yellowness (b*) value of the accessions were slightly lower than the seeds and the flour had the same trend

Table 1: Colour of African yam bean seeds and their flour

Sample Treatment L* a* b* TSs 30 Raw seed 42.86de±1.64 4.11a±0.92 11.05bcd±1.55 Flour 63.67c±2.25 2.83bcd±0.26 14.47a±0.82 TSs 33 Raw seed 43.93d±1.99 3.57ab±0.90 10.42cd±1.30 Flour 68.81a±3.42 2.60bcd±0.37 14.14a±1.17 TSs 34 Raw seed 39.80e±1.29 4.23a±1.03 8.56e±1.17 Flour 66.16abc±1.63 3.29abcd±0.08 14.79a±0.70 TSs 24 Raw seed 41.45de±1.28 2.70bcd±0.22 8.65e±0.61 Flour 67.69ab±1.19 2.38cd±0.24 14.01a±0.72 TSs 22 Raw seed 42.33de±1.32 2.53bcd±0.23 9.91e±1.29 Flour 68.37ab±3.12 3.35abc±0.39 15.43a±0.90 TSs 23 Raw seed 43.95d±2.46 3.44abc±1.26 11.12bcd±1.72 Flour 66.85abc±1.96 3.04bcd±0.56 14.44a±0.67 Mean with the same superscripts were not significantly different (p<0.05)

189 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 2: Height, weight and diameter of African yam beans accessions Sample Height (mm) Weight (g) Diameter (mm) TSs30 6.83b±0.58 25.80c±0.11 4.70b±0.10 TSs33 9.07a±0.81 25.79c±0.28 4.83b±0.12 TSs34 6.83b±0.40 25.63c±0.17 4.70b±0.10 TSs24 6.80b±0.53 28.42a±0.19 4.77b±0.21 TSs22 7.23b±1.30 26.55b±0.12 4.70b±0.30 TSs23 8.10ab±0.62 28.80a±022 5.67a±0.40 Mean with the same superscripts were not significantly different (p<0.05)

Table 3: Cyanide and Functional properties of African yam beans flour Sample Cyanide Bulk density Water Solubility (%) (mg/L CN-1) (g/cm3) absorption capacity (ml/g) TSs 30 ND 0.76d±0.01 0.88b±0.01 8.76d±0.01 TSs 33 ND 0.78c±0.01 0.69d±0.01 8.92c±0.01 TSs 34 <1 0.81b±0.01 0.91a±0.01 10.05a±0.01 TSs 24 ND 0.81b±0.01 0.69d±0.01 8.25f±0.01 TSs 22 ND 0.91a±0.01 0.81c±0.01 9.98b±0.01 TSs 23 ND 0.41e±0.01 0.62e±0.01 8.38e±0.01 ND= Not detected Mean with the same superscripts were not significantly different (p<0.05) reported values. Variation in value may be capacity of TSs34 (0.91 ml/g) was due to the type of AYB used for the study. significantly different (p<0.05) other Cyanide and functional properties accessions. Sample TSs34 was higher in of the African yam beans flour is shown in solubility (10.05 %) than other samples. Table 3. Cyanide contents in the AYB The least solubility value was observed in were very low and were not detected in TSs24 (8.25 %). five accessions as shown in Table 3. TSs34 showed cyanide content less than 1 Conclusion in the AYB accessions. This may be The findings revealed that AYB eliminated during processing into other accessions had variations in the colour forms. Bulk density of TSs22 was when intact and when in flour form. significantly different (p<0.05) other TSs22 and TSs34 flours were more accessions while sample TSs23 had the yellowish in colour than other accessions. least value in bulk density. No significant Lightness values of the flours were more differences (p>0.05) was observed in the pronounced than the seed. Although, bulk densities of TSs34 and TSs 24. Bulk there were no significant differences density reported for AYB was 0.89 gcm3 (p>0.5) in the weight of AYB seeds but which was slightly lower than the values TSs24 and TSs23 weighed more than obtained for TSs22 but higher than other other accessions. TSs33 were longer than accessions. The water absorption other accessions while TSs 23 had higher 190 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 diameter. Higher bulk density was Anti-nutrients and Functional observed in TSs22 while TSs 34 absorbed Properties of the Flour. Journal of more water and soluble in water than Food and Nutrition Sciences, 3(4): other accessions. 147-151. Hsu, C. L, Chen, W., Weng, Y. M. and References Tseng, C. Y. (2003).Chemical Adebayo-Oyetoro A. O., Oyewole O. B., composition, physical properties, and Obadina A. O, and Omemu M. A. antioxidant activities of yam flours as (2013).Cyanide and Heavy Metal affected by different drying Concentration of Fermented Cassava methods.Food Chemistry 83(1): 85- Flour (Lafun) Available in the 92. Markets of Ogun and Oyo States of Iwuoha, C. I. (2004). Comparative Nigeria. International Scholarly and evaluation of physicochemical Scientific Research and Innovation qualities of flours from steam- 7(7): 645-648 processed yam tubers. Journal of Adewale, B., Daniel, A. and Aremu,C.O Food Chemistry, 85: 541-551. (2013). The nutritional potentials and Kusumayanti, H., Handayani, N.A. and possibilities in African yam bean for Santosa, H. (2015). Swelling power Africans. International Journal of and water solubility of cassava and Agriculture, 3(1): 8-19 sweet potatoes Flour. Procedia Asoiro, F.U. and Ani, A.O. (2011). Environmental Sciences, 23: 164 – Determination of some Physical 167 Properties of African Yam Beans. The Nnam, N.M (1999). Nitrogen and mineral Pacific Journal of Science and utilization of young children fed Technology, 12 (1):374-380 blends of fermented or unfermented Ene-Obong, H.N. (1995). Content of corn (Zea mays l.) african yam bean antinutrients and in vitro protein (Sphenostylis stenocarpa) and cowpea digestibility of the African yambean, (Vigna unguiculata). Ecology of Food pigeon and cowpea. Plant Food for and Nutrition, 38, 21-34. Human Nutrition, 98(3), 225-233. Seidu, K.T., Osundahunsi, O.F. and Ene-Obong, H.N & Obizoba, I. C (1995). Osamudiamen, P.M. (2018). Nutrients Effect of domestic processing on the assessment of some lima bean cooking time, nutrients, antinutrients varieties grown in southwest Nigeria. andin vitro Protein digestibility of the International Food Research Journal African yambean (Sphenostylis 25(2): 848-853 stenocarpa). Plant Food for Human Udensi, E.A. and Okaka, J.C. (2000). Nutrition, 49(1), 43-52. Predicting the effect of blanching, Evanson, I.U. and Atanguma, E.E. drying temperature and particle size (2015). .Effect of Soaking African profile on the dispersibility of cowpea Yam Bean Seeds in Unripe Plantain flour. Nigerian Food Journal, 18:25- Peel Ash Solutions on the Nutrients, 31.

191 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Production of biscuits from two underutilized food crops in Nigeria

Olanipekun, O.T. Product Development Programme, Institute of Agricultural Research and Training, Obafemi Awolowo University, Nigeria. [email protected] 08060330088

Abstract This study was carried out to determine the physico- chemical parameters and sensory evaluation of biscuits produced from composite (mixture of cocoyam, and bambara groundnut) flour. Five biscuit samples were made from mixture of cocoyam flour, wheat flour and bambara groundnut flour at varying proportions. Protein value in the biscuits varied from 6.28% in E (100% cocoyam flour) to 8.15% in D (50% cocoyam, 30% bambara, and 20% wheat). All biscuit samples were high in carbohydrate content with highest values found in sample A (100% wheat) and sample E (100% cocoyam). Mineral analyses revealed that sample E had significantly higher values (p<0.05) for Ca, Fe and Na. Sensory evaluation revealed that sample A was most accepted by consumers, and sample B (70% cocoyam, 10% bambara and 20% wheat) was the least accepted biscuit sample; however, all biscuit samples were rated above average in acceptance. Sample E had the highest diameter thickness (24mm), while sample C (60% cocoyam, 20% bambara, 20% wheat) had the highest spread factor of 125. The possible use of cocoyam flour/bambara groundnut flour in biscuit production has been established in this work.

Key words: Biscuit, Cocoyam, bambara groundnut, Underutilized food, Minerals, Thickness, spread factor.

Introduction with about 25% starch on net weight Biscuit belong to the flour confectionary; basis, and in most part of West Africa, it is it is a flat crisp and may be sweetened or usually consumed as purees mixed with unsweetened according to preference. other ingredient (Owusu, 2008). Protein Biscuit can be made from hard dough e.g content of cocoyam is low (1-2%), and Crackers, hard sweet dough e.g rich tea sulfur containing amino acids is limiting and short or soft dough e.g short bread (Olayiwola et al., 2012). and short cake. It is produced by mixing Food legumes have a major role to various ingredients like flour, fat, play in the fight against malnutrition, it sweeteners and water to form dough. The serves as a source of protein to a large dough formed, like bread is not allowed to proportion of the population in the poor ferment; and then it is baked in the oven. countries of the world, it is less expensive, It could be baked in the traditional is easily stored and easily transported for better than primitive or modern oven, but rural and urban dwellers. Nigeria is the fundamental ingredient is wheat flour blessed with variety of grain legumes that ((Adebowale et al., 2012). could be used to address the protein Cocoyam (Colocesia esculenta) deficiency problems that is prevalent in is an important household food security the country; however, these legumes are and income crop, it contains starch and underutilized, as consumption have fibre that can provide energy and satisfy centered mainly on cowpea, groundnut the consumer. Cocoyam is cultivated in and soybeans (Fasoyiro et al., 2009). The West Africa, and they are important food common legumes are very expensive, and crops for more than 400 million people are out of reach of the poor masses. worldwide. Cocoyam produce corms Several other locally available species

192 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 like, bambara groundnut, kidney bean, biscuit will extend the uses of cocoyam Lima bean, pigeon pea, Jack bean, etc. tuber and bambara groundnut, if adopted; which show remarkable adaptation to it will generate income for cocoyam and tropical conditions are less commonly bambara groundnut farmers and used by the people. It is therefore processors as well as provide varieties of necessary that their consumption, which nutritious snack items that will be is already too low in a number of available and acceptable to consumers. developing countries, be increased. Bambara groundnut (Vigna Materials and Methods subterranean L.) is a pulse with Cocoyam corms and bambara groundnut subterranean fruit set and is cultivated by seeds were purchased from Bodija small holder farmers much of semi-arid market, Ibadan. All ingredients for the Africa (Stamp, 2006). Bambara preparation of biscuit (wheat flour, sugar, groundnut is regarded as the third most salt, baking powder, nutmeg, butter) were important crop after groundnut (Arachis purchased at Apata market, Ibadan. hypogea), and cow pea (Vigna unguiculata) in Africa, it is an ideal crop Production of cocoyam flour for farmers as it produces high yield, with Cocoyam was peeled, washed and sliced low input (Bamishaye et al., 2011). into thin pieces, the sliced cocoyam Bambara groundnut seeds make a pieces were then soaked in hot water complete food; it contains sufficient (800C) for 15 minutes (blanching). After quantity of protein (19-22.3%), expiration of blanching process, the carbohydrate (48.2-50.7%), and fat sliced cocoyam pieces were removed (3.0%) (Bamishaye et al., 2011). from the water, arranged in a tray and Bambara groundnut protein contain allowed to cool at ambient temperature, higher amount of methionine than other they were then taken to the laboratory for grain legumes, the seed contains fair drying; using a cabinet drier at 600C for 7 amount of iron (7.6mg/100g); and hours. significant level of calcium (73mg/100g) (Abu-salem and Abou-Arab, 2011). Production of bambara groundnut flour The use of composite flour of Bambara groundnut was thoroughly some tubers and legumes have been rinsed in water, after that it was arranged documented to increase and improve in a tray to sundry, the dried bambara protein content of food products, as the groundnut was then ground, using a legumes supplies protein, especially hammer mill, sieved and put in a well sulfur containing amino acids that is labeled polythene bag for future use. limiting in root tubers (Olayiwola et al., 2012, Asaye et al., 2015). However, there Composite flour formation is dearth of information on root tubers Composite mixture of flour used for fortified with bambara groundnut in the biscuit production was made as in table 1 processing of food products. This work below: therefore aims at assessing the physico- chemical and sensory properties of Production of biscuits biscuits made from composite mixture of The biscuits were produced according to cocoyam flour and bambara groundnut the recipe described by Sanni et al (2006) flour. Production of cocoyam/bambara for cassava cookies with slight

193 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 modification. All dry ingredients were crude protein calculated by multiplying first weighed into a clean dry plastic bowl Kjeldahl Nitrogen by 6.25; moisture was and thoroughly mixed with sugar (12.8g), determined by oven drying method; lipid salt (1.6g), baking powder (3.4g) and content was determined by soxhlet nutmeg (2.4g). Margarine (16.5g) was solvent extraction method, ash was added to the content of the bowl and determined by furnace method, crude mixed; finally water (50ml) was added to fibre was determined by exhaustive achieve non sticky soft dough. The dough extraction of soluble substances in the was placed on a floured wooden work samples using 5% H2SO4 and 5% NaOH table, rolled out and cut into round shapes (sodium hydroxide) solutions, followed with a biscuit cutter (0.4cm thickness). by ashing in the oven at 600°C. The surface was pricked with fork to Carbohydrate was estimated by prevent the dough from rising. The difference. biscuits were baked in hot oven set at 0 Mineral analyses 175 C for 30-35 minutes. Samples were dry-ashed according to AOAC (2000) method. Analysis of calcium was done using Jenway Digital Flame Photometer (PFP7 Model), while Buck 200 Atomic Absorption Spectrophotometer (AAS) was used for the analyses of Magnesium, Iron, Zinc, and Sodium.

Physical properties of biscuit samples Diameter Chemical analyses The diameter of biscuit was determined Proximate analyses by placing three biscuit edge to edge. The Proximate composition of the samples total diameter of the three biscuit was was determined using the method of measured in mm by using a ruler. The AOAC (2000). All the chemical analyses biscuits were rotated at an angle of 900 for were done in triplicates using standard duplicate reading. This act was repeated procedures. Nitrogen content was twice and average diameter was reported determined by Kjeldahl method and the in mm. (AACC, 2000).

Table 1: Composite flour formulation (gram by weight)

SAMPLE Cocoyam Flour(g) Bambara Wheat Flour (g) groundnut Flour (g) A 0 0 100 B 70 10 20 C 60 20 20 D 50 30 20 E 100 0 0

Sample A = Biscuit made from 100% wheat Sample B = Biscuit made from 70% cocoyam, 10% Bambara, 20% wheat Sample C = Biscuit made from 60% cocoyam, 20% Bambara, 20% wheat Sample D = Biscuit made from 50% cocoyam, 30% Bambara, 20% wheat Sample E = Biscuit made from 100% cocoyam 194 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

taste and overall acceptability on a Thickness hedonic scale of 1-9, where 1 = dislike The thickness of biscuit was determined extremely and 9 = like extremely. by placing three biscuits on top of one another. The total height was measured in Statistical analysis: mm with the help of ruler. This process Data obtained from the analyses were was repeated thrice to get an average subjected to statistical analysis, using value and result in mm (AACC, 2000). SAS (1995), expressed as mean ± SEM. Spread factor Mean scores were analyzed using Spread factor was determined as analysis of variance (ANOVA). Means described by Ayo (2007); spread factor is were separated using DMRT (Duncan the ratio that depends on the value of the multiple range test). thickness and diameter of the biscuit. Table 2 showed the proximate Spread factor was determined from the analysis of biscuit samples (A to E). It was diameter and thickness using the formula: observed that sample E had the highest SF = D x CF x 10 value of carbohydrate (71.00 %), this T value was significantly (p<0.05) higher Where: than values obtained for biscuit samples C SF is the spread factor and D; the high carbohydrate value of D is the diameter of the biscuit in mm sample E was due to the use of 100 % T is the thickness of the biscuit in mm cocoyam in preparing the biscuit sample. CF is a correction factor at constant Similar result was observed for sample A atmospheric pressure, its value was 1.0 in (made from 100 % wheat flour), which this case (AACC 2000) had carbohydrate content of 70.15 %. Sample D had the lowest carbohydrate Sensory evaluation of biscuit samples content (69.02 %), this was not surprising The biscuit samples were evaluated by 20 because the sample D had the highest men panel drawn from the Federal amount of bambara groundnut added to it. College of Agriculture, Ibadan; the Carbohydrate content reduced as the panelists are used to eating biscuits, and percentage inclusion of bambara they evaluated our biscuits for attributes groundnut increased, this result agrees of colour, appearance, flavour, crispiness, with Ashaye et al (2015) and Taiwo

Results and Discussion

Table 2: Nutritional composition of biscuit samples

Samples Carbohydrate Protein C. fibre C. fat Ash Moisture A 70.15±3.12a 6.89±0.13c 0.74±0.23a 15.26±3.24a 1.89±0.02b 5.07±0.07b B 69.86±1.24a 7.38±1.13b 0.65±0.07a 13.92±1.15b 2.04±0.01a 6.15±0.65a C 69.46±2.08ab 7.67±0.96b 0.69±0.73a 14.05±2.15b 1.96±0.01b 6.57±0.74a D 69.0±1.112b 8.15±0.74a 0.62±0.13a 14.03±3.14b 2.09±0.07a 6.09±0.09a E 71.00±2.86a 6.28±1.06c 0.71±0.10a 13.96±0.87b 2.13±0.07a 5.92±0.04ab Values are mean of three determinations ±SEM. Means with different superscript within the same column are significantly different at (p<0.05)

Sample A = Biscuit made from 100% wheat Sample B = Biscuit made from 70% cocoyam, 10% Bambara, 20% wheat Sample C = Biscuit made from 60% cocoyam, 20% Bambara, 20% wheat Sample D = Biscuit made from 50% cocoyam, 30% Bambara, 20% wheat Sample E = Biscuit made from 100% cocoyam C. Fibre = Crude fibre; C. Fat = Crude fat 195 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

(2006); where carbohydrate content of of human body and brain development. products decreased as percentage For all the biscuit samples made, the ash inclusion of legumes increased. content was found to be low, however the Protein content of the biscuit highest value was found in sample E (100 samples ranged from 6.28 % in sample E % cocoyam flour) the result obtained to 8.15 % in sample D; it was observed suggests that sample E would have higher that protein content was increased as the amount of minerals. Nnamani et al (2009) amount of bambara groundnut used had explained that ash content is a increased; similar observation was made measure of the mineral content of food. by Ashaye et al (2015) when pigeon pea For all biscuit samples, the moisture flour was added to cassava flour to make content ranged from 5.07 % in sample A to biscuits. In that work, crude protein was 6.57 % in sample C. moisture content of increasing as level of pigeon pea flour all biscuit samples were within acceptable increased; this confirmed that bambara value, the low moisture content will groundnut has appreciable amount of increase the shelf life of the biscuit protein. Protein is important for growing samples. children, it is also important for the Table 3 showed the mineral replacement of worn out tissue (Nnamani content of the biscuit samples. Sample E et al., 2009). The value for fibre varied had significantly higher value (p<0.05) from 0.62 % in sample D to 0.74 % in for Calcium (Ca), Iron (Fe), Sodium (Na) sample A, the values obtained were not and Magnesium (Mg). The result obtained significantly different (p>0.05) from each for minerals correlates with that obtained other, indicating that the biscuits for ash in table 1 and confirms that sample produced were not good sources of fibre. E (100% cocoyam flour) had highest Fat content of the biscuit samples ranged amount of minerals in all biscuit samples between 13.65 % in sample C to 15.26 % made. The importance of minerals cannot in sample A; the result showed that 100 % be overemphasized in the body. Though wheat flour had a higher oil absorption they are not needed in large amount, capacity than other samples. Oil minerals play important function in the absorption capacity is important since oil human body, for example they act as co- acts as flavor retainer, and increases the factors for enzyme reactions, and they mouth feel of foods (Olanipekun et al., facilitate the transfer of nutrients across 2015). Fat is responsible for maintenance cell membranes, they also maintain proper Table 3: Mineral Analysis of biscuit samples.

Sample Calcium(Ca) Magnesium(Mg) Zinc(Zn) Iron(Fe) Sodium(Na) mg/kg mg/kg mg/kg mg/kg mg/kg A 421±11.24c 2455±23.15b 153±14.07a 92±6.71d 0.22±0.14c B 475±10.32b 2614±22.14a 47±5.34b 174±11.14a 0.61±0.17ab C 401±09.13d 2335±17.27c 35±7.81c 101±13.21c 0.49±0.03b D 325±11.11c 2456±21.32b 41±3.11bc 110±2.15b 0.72±0.02a E 496±09.36a 2611±15.12a 49±8.13b 174±5.32a 0.79±0.03a Values are mean of three determinations ±SEM. Means with different superscript within the same column are significantly different at (p<0.05)

Sample A = Biscuit made from 100% wheat Sample B = Biscuit made from 70% cocoyam, 10% Bambara, 20% wheat Sample C = Biscuit made from 60% cocoyam, 20% Bambara, 20% wheat Sample D = Biscuit made from 50% cocoyam, 30% Bambara, 20% wheat Sample E = Biscuit made from 100% cocoyam

196 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 nerve conduction, help to contract and reiterated by Ejoh et al (2013) who relax muscles, help to regulate our bodies' explained that in Nigeria, cocoyam suffers tissue growth as well as provide structural stiff competition from yam and cassava and functional support for the body which is preferred for planting and (Okudu et al., 2017). The mineral content consumption. Addition of bambara of a food product correlates with the groundnut flour to the cocoyam flour in mineral content of the material from biscuit production reduced the mineral which it is made; the values obtained for content of the biscuits, our result agrees minerals in the biscuits made from 100% with that of Olayiwola et al (2012) where cocoyam was much lower than values it was reported that addition of cowpea to obtained for cocoyam by Ndabikunze et cocoyam decreased the mineral content of al (2011); the difference could be products. Anti nutrients present in attributed to genetic variation and season legumes could be a major setback in the of harvest of the cocoyam corms used. bioavailability of metals, as anti-nutrients Also, in Nigeria, cocoyam is usually have been documented to chelate metals grown in marginal land, with poor soil making them unavailable (Oboh, 2006). fertility, and this may result in the low Table 4 showed the sensory mineral content of the biscuits made from evaluation of the biscuit samples. The the cocoyam corms; this was also result showed that biscuit sample A (100

Table 4: Sensory evaluation of the biscuit samples

Samples Colour Appearance Flavor Crispiness Taste Overall acceptability A 7.7c 7.7a 7.9a 7.5a 7.7a 8.2a B 5.0c 5.2c 5.5bc 5.7b 5.8bc 5.6b C 6.1b 6.1bc 5.2c 5.8b 6.2b 6.1b D 5.7b 6.5b 6.0b 5.4bc 3.8d 6.1b E 5.6b 6.1bc 5.2c 5.0c 5.3c 5.6b

Values are mean of three determinations. Means with different superscript within the same column are significantly different at (p<0.05)

Sample A = Biscuit made from 100% wheat Sample B = Biscuit made from 70% cocoyam, 10% Bambara, 20% wheat Sample C = Biscuit made from 60% cocoyam, 20% Bambara, 20% wheat Sample D = Biscuit made from 50% cocoyam, 30% Bambara, 20% wheat Sample E = Biscuit made from 100% cocoyam

197 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 percent wheat flour) was generally most with increasing level of soybean flour. accepted; the high acceptance of sample The thickness of the biscuit also varied A can be due to familiarity with taste with treatment; biscuit samples with 20 panelists. The score for overall percent and 30 percent bambara groundnut flour had the highest thickness, acceptability of the biscuit samples B, C, while that from 100 percent cocoyam D and E were not significantly different flour had the least thickness; however, (p>0.05). This showed that the level of there was no significant difference inclusion of bambara groundnut flour into (p>0.05) between thickness of samples B the biscuit did not affect acceptability of ,C and D. The result correlates with Abu- the biscuit samples. The least score of 5.6 salem and Abou-Arab (2011), where for overall acceptability of biscuit thickness of biscuit increased gradually as percentage inclusion of bambara samples showed that all samples were groundnut flour increased. well accepted; hence the use of cocoyam The spread factor is the ratio that flour to make biscuit has been established depends on the value of thickness and in this research work. diameter of the biscuit. The result Table 5 showed the physical obtained for spread ratio revealed that properties of biscuit produced from spread factor of sample D was the highest different composite flour of cocoyam and (101) while sample A (biscuit from 100% bambara groundnut flour. Mean diameter wheat flour) had the least spread factor (87). It has been reported that composite of the biscuit varied significantly flours form aggregate with increased (p<0.05) between the samples. Diameter numbers of hydrophilic sites found within of the biscuit showed gradual increase as the oligosaccharides, polysaccharides, the level of cocoyam flour decreased; and and protein (Abu-salem and Abou-Arab, bambara groundnut flour increased, this 2011); this aggregate increased result agrees with the result of Ayo et al competition for the limited free water in (2007), where biscuit diameter increased cookies dough, hence the variation in the

Table 5: Physical properties of the biscuit samples

Sample Thickness (mm) Spread factor mm) A 133±4.13d 15±0.07b 87±4.16c B 166±3.24c 17±0.05a 98±5.21b C 175±4.84b 18±0.04a 97±2.13b D 182±3.42b 18±0.02a 101±2.11a E 140±2.14e 14±0.05b 100±1.14a Values are means of three determinations ± SEM. Means with different superscript within the same column are significantly different at (p<0.05)

Sample A = Biscuit made from 100% wheat Sample B = Biscuit made from 70% cocoyam, 10% Bambara, 20% wheat Sample C = Biscuit made from 60% cocoyam, 20% Bambara, 20% wheat Sample D = Biscuit made from 50% cocoyam, 30% Bambara, 20% wheat Sample E = Biscuit made from 100% cocoyam

198 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 spread factor. organoleptic evaluation of Acha- Conclusions and Recommendations wheat biscuit supplemented with Nigeria climate does not favour the soybean flour. Nigerian Food Journal cultivation of wheat but favourable for the 25 (1): 77- 89. cultivation of legumes like bambara groundnut and tuber crops such as Bamishaye, O. M., Adegbola, J. A., cocoyam. The possibility of producing Bamishaye, E. I. (2011). Bambara nutritious biscuits from these two under- groundnut, an under-utilized nut in utilized food crops has been identified in Africa. Advanced Agricultural this study. The use of cocoyam and Biotechnology 1: 66-72 Bambara groundnut in biscuit production Ejoh, S. I., Obatolu, V.A., Olanipekun, will help reduce the amount of wheat to be O.T. and Farinde, E.O. (2013). imported into Nigeria and therefore save Extending the use of an underutilized our foreign exchange. tuber 1: Physicochemical and pasting properties of cocoyam flour and its References suitability for making biscuits. AACC (2000) Approved methods of the African Journal of Food Science 7 American Association of Cereal (9): 264-273. Chemists, 10th Ed. USA Fasoyiro, S. B., Obatolu, V. A., Ashaye, O. Abu- salem, F. M and Abou-Arab, A. A. A., Adeojo, E. A and Ogunleti, D. O. (2011). Effect of supplementation of (2009). Chemical and sensory B a m b a r a g r o u n d n u t ( v i g n a qualities of pigeon pea developed into Subterranean) flour on the quality of a local spice 'dawadawa' Nigerian biscuits. African Journal of Food Food Journal 27: 150-159 Science. 5 (7): 376-383 Ndabinkuze, B. K; Talawana, H. A. L., Adebowale, A. A., Adegoke, M. T., Sanni, Mongi, R.J., Issa-Zacharia, A., S. A., Adegunwa, M. O and Fetuga, G. Serem, A. K., Palapala V and Nandi, J. O. (2012). Functional properties of O. M. (2011). Proximate and biscuit making potentials of nutritional composition of cocoyam sorghum/wheat flour composite. grown along Lake Victoria basin in A m e r i c a n J o u r n a l o f F o o d Tanzania and Uganda. African Technology 7 (6): 372-379 Journal of Food Science 5 (4): 248- AOAC (2000) Official methods of 254. Analysis of the Association of Nnamani, C. V., Oselebe, H.O and Official Analytical Chemists, 17th Ed. Agbatutu, A. (2009). Assessment of Washington, DC n u t r i t i o n a l v a l u e o f t h r e e Ashaye , O. A., Olanipekun, O. T and Ojo, underutilized indigenous leafy S.O. (2015). Chemical and vagetables in Ebonyi State, Nigeria. Nutritional evaluation of biscuit African Journal of Biotechnology, processed from cassava and pigeon 8(2): 2321-2324. pea flour. International Journal of Oboh G. (2006). Nutrient and antinutrient Scientific Research in Science and composition of condiments produced Technology 1 (4): 84-89 from some fermented underutilized Ayo, J. A., Ayo, V.A., Nkama, I. and l e g u m e s . J o u r n a l o f F o o d Adewori R. (2007). Physico- Biochemistry 30: 579-588. chemical, invitro-digestibility, and Okudu, T. O., Okwu, U. P and Umoa, E. J

199 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

(2017). Chemical composition of two Strattclyde Institute of Pharmacy and commonly consumed cocoyam based Bio-medical Sciences, University of dishes in Ummuneochi, Abia State, Strattclyde, Glasgow. Nigeria. EC Nutrition 8 (4): 145-151. Sanni, L., Maziya-Dickson, B., Onabolu, Olanipekun, O. T. and Elejogun, A. E. O. A., Arowosegbe, B. E., Okoruwa, (2015). Chemical and Functional A. E., Tarawali, G., Gutelona, C. properties of kidney bean seed flour. (2006) Cassava recipes for household Moor Journal of Agricultural food security. International Institute Research 16: 37-45. of Tropical Agriculture (IITA); Olayiwola, I. O., Folaranmi, F., Integrated cassava project, Ibadan, Adebowale, A., Onabanjo, O. O., Nigeria Sanni, S. A. and Afolabi, W. A. O. SAS (1995). SAS User's Guide, (2012). Nutritional composition and Statistical Analysis System Institute, sensory qualities of cocoyam based Inc., Cary, NC. recipes enriched with cowpea flour. Stamp, D. L. (2006). Principles of Fold Nutrition and Food Sciences 2 (10): Crop Production, Macmillan 170-176. Publishing Co. Inc. Pp 278-286 Owusu, P. G. (2008). Tannia (xanthosona Taiwo K. A. (2006). Utilization potentials Saggitifolium) starch: properties and of Cassava in Nigeria: The Domestic flavor volatiles release. Ph.D. thesis, and Industrial Products. Food

200 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Determination of Ascorbic acid (vitamin C) content in sprouted brown African yam beans (Sphenostylis stenocarpa)

Omenna, E.C.1 and Amadife, A. E.2 1Institute of Agricultural Research and Training, Obafemi Awolowo University, P.M.B.5029, Ibadan, 2Enugu State University of Science and Technology, (ESUTECH), P.M.B.1440, Enugu Corresponding email and phone number: [email protected]; +2348055007555

Abstract Vitamin C is an essential welfare food in human diet, most species of animals including human beings cannot synthesis their own vitamin C from other hexose sugars. And consequently, an experiment was conducted to evaluate the impact of sprouting on the vitamin C (ascorbic acid) content of African yam bean. The ascorbic acid content of brown African yam bean sprouts were determined by titrimetric method in which the acidified aqueous extract was titrated against 2,6-dichlorophenolindophenol. The ascorbic acid content determined daily during sprouting for five consecutive days were:13.2mg/100g,15.4mg/100g, 17.6mg/100g, 20.00mg/100g and 22.00mg/100g respectively. The results showed that the highest amount of ascorbic acid was obtained on the fifth day of sprouting while the lowest amount of ascorbic acid was obtained on the first day of sprouting. It was also observed that the ascorbic acid level was increasing as the sprouting period lasts. From the results, it can be inferred that sprouting enhances the vitamin C (ascorbic acid) content of this bean, as there was an exponential increase in the vitamin C content with number of days of sprouting. Sprouts proffer the safest nutritional advantage of both vegetables and fruits without contamination. In conclusion, sprouting is an inexpensive method of obtaining high amount of vitamin C in seeds.

Keywords: Vitamin C, African yam bean, sprouting.

Introduction However, legumes are the potential In developing countries, the production source of protein and calories since their of milk and other animal–based foods is seeds contain high amount of highly inadequate to meet the nutritional carbohydrate (50-67%) and protein (23- needs of the teeming population. And 25%) (Olapade et al., 2012). But, it is humans who do not obtain enough worrisome to note that many of vitamin C develop scurvy, which is leguminous crops are neglected and characterised by haemorrhage under the grossly underutilized. Meanwhile, studies skin and tissues, swollen and spongy have shown that combination of lesser gums from teeth are easily dislodges, –known-legumes with other conventional poor wound healing, painful joints and legumes can be used to combat food and common cold (Wagner and Folker, 1994). nutrition insecurity particularly in Nigeria Human beings and non –human primates and the World at large (Ajibola and cannot synthesis vitamin C from other Olapade, 2016). related hexose sugars and therefore there African yam bean (Sphenostylis is need for the dietary intake of this stenocarpo) is one of the grossly essential welfare food. Furthermore, underutilized legumes with great protein-energy and/or -nutrient nutritional potentials (Adewale and Odoh, malnutrition is the major affront to food 2013). African yam bean is a climbing and nutrition security in many developing legume and also an annual crop with an countries like Nigeria (FAO, 2000). exceptional ability to adapt low land

201 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 tropical conditions. African yam bean Preparation of stock solutions: (AYB) is largely cultivated in the Eastern 0.58g of 2, 6-dichlorophenolindophenol and Southern parts of Nigeria (Njoku and was weighed on analytical balance. The Eli, 1991). AYB produces nutritious 0.58g of 2, 6-dichlorophenolindophenol seeds as well as underground edible powder was dissolved in 2 litres (2000ml) tubers. Like a cowpea, African yam bean of distilled water and was stored in a have its seeds enclosed in pods. Each pod brown reagent bottle for future use. contains ten –thirty seeds of many colours ranging from brown, white, speckled, and marble (Ajibola and Olapade, 2016; Phosphoric acid Edem et al.,1990).These pods are borne 85 percent of the acid was diluted to ten on a climbing stem with wide heart percent using the dilution formula

–shape-leaves, one at each node spaced C1V1=C2V2. (1) apart long the stem (Asoiro and Ani, 2011). Studies have shown that African More water was added to 117.7cm3 yam bean is grown extensively in West Where C1 is the initial concentration, V1 is

Africa for various dietary preparations the initial volume, C2 is the required due to its potentials for supplementing concentration, and V2 is the required protein requirement of many families volume. (Ajayi, 2011). Processing of African yam bean may bring about value-addition Extraction and determination of ascorbic which can alleviate protein –energy acid malnutrition as well as nutrients 1 gram of sprouted brown African yam deficiency. According to Ajibade et al. bean sample was weighed out on (2005), African yam bean is a good source analytical balance and then ground in a of protein, carbohydrate, minerals and mortal with a spatula of acid -washed - vitamins but the major constraints to its sand followed by the addition of 5ml of utilisation are the presence of anti- diluted phosphoric acid and then nutrient factors and long cooking time. triturated (AOAC, 2005). After Many literatures highlighted that triturating, the macerate was filtered, processing such as soaking or using cotton wool placed in the plastic fermentation and heating can reduce the funnel into a conical flask. The separation level of anti-nutrient factors to tolerable was aided by pressing the residue. The level (Ndidi et al., 2014; Fasoyiro et al., residues returned to the mortar and the 2006; Verderames, 1995). This study extraction was repeated for two more aimed at the effect of sprouting on the times using the same quantity (i.e. 5 ml) of ascorbic acid content in African yam phosphoric acid. The filtrate was poured bean. into 100ml of volumetric flask and then distilled water was added to make up the Materials and Methods marks of 100ml.The mixture was shaking Chemical reagents (such as 2, 6-dichloro- for few minutes.10ml of the extract solution was taken into a beaker and was phenolindophenol, phosphoric acid, titrated with 2, 6-dichloropheno- tetraoxosulphate (VI) acid) used in this lindophenol solution from a micro-burette study were of analytical grade. until the last drop that discharges a pink

202 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 colouration, which persisted for the next bean for each sprouting day was 30 seconds. The titration was repeated for evaluated according to Stroev and two times and the average titres of the two Makarova (1989) using the formula: readings were calculated using the formula. Y = (3) D1 + D2 Average titre = 2 (2) Where D1 is the difference between final Where Y = ascorbic acid concentration reading and the initial reading of the first (mg/kg), titration; Ma = mass of ascorbic acid (i.e.0.088 D2 is the difference between final and mg) titrimetrically equivalent to initial readings of the second titration for 1 m l o f 0 . 0 0 1 M 2 , 6 - each sprouting day. dichlorophenolindophenol solution, Calculation for the determination of 100 = the dilution ratio of the sample ascorbic acid content in brown African taken, yam bean 1000 = the scaling factor for conversion to The ascorbic acid content of African yam per kilogram of raw material,

Results and Discussion Table 1: First day titration

1st titration 2nd titration Initial reading in ml 1.60 1.70 Final reading in ml 1.40 1.60 Difference in ml 0.20 0.10 0.2+0.10 Average titre = = 0.15ml 2

Table 2 : Second day titration

1st titration 2nd titration

Initial reading in ml 5.30 5.50 Final reading in ml 5.50 5.65 Difference in ml 0.2 0.15 0.2+0.15 Average titre = = 0.175???? 2. Table 3: Third day titration

1st titration 2nd titration Initial reading in ml 2.30 2.50 Final reading in ml 2.50 2.70 Difference in ml 0.20 0.20 0.2+0.2 Average titre = = 0.2ml 2 Table 4: Fourth day titration

1st titration 2nd titration Initial reading in ml 8.15 8.30 Final reading in ml 8.30 8.60 Difference in ml 0.15 0.30 ??.????+??.???? Average titre = = 0.225ml ??

203 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 5 : Fifth day titration

1st titration 2nd titration Initial reading in ml 14.00 14.20 Final reading in ml 14.20 14.50 Difference in ml 0.2 0.30 0.2+0.30 Average titre = = 0.25 ml 2 while the fifth sprouting day had the highest amount of ascorbic acid (22.0mg/100g). The data obtained from this study were strongly in agreement with the publication report by Colditz et al., (1985) that sprouting improves the level of vitamin C in dry seeds. In addition, the observation of this study supported the research findings by Boehringer (1997) which emphasized that sprouting supplies food in pre- digested form as the enzymes would have Figure 1: Ascorbic acid content of African yam acted upon the food materials. And as beans for five sprouting days starch is broken down into simple sugars 10 = the titre volume in ml like glucose, fructose, sucrose) and V = titrant volume (i.e. 2, 6- dichloro- proteins are converted to amino acids and phenolindophenol solution) in amides as well as fats and oils are ml, and converted to free fatty acids. Sprouting is b = the sample weight in gram. a novel and cheap processing-method that can enhance the nutritional value of Statistical analysis beans. In the light of this, Pezacka and Data obtained were analysed using Walerych (1991) reported that sprouting analysis of variance and means were makes beans to lose its objectionable gas- separated using Duncan's Multiple Range producing quality which causes stomach Test at P =0.05. Statistical Package for flatulence. The findings of this study were Social Science package (version 16) was in consonance with Pezacka and used. Walerych (1991) that sprouting was The ascorbic acid content of extremely an inexpensive method of sprouted brown African yam bean is obtaining a high concentration of presented in Figure 1. From the results, it vitamins, minerals and enzymes. The was observed that sprouting had results of this study was also at par with significantly increased the amount of other literature reports which stated that vitamin C in African yam beans. At day dried seeds, grains, and legumes do not zero, there was no trace of ascorbic acid contain any discernible traces of ascorbic found in the dry brown African yam acid yet when sprouted, they revealed beans. The amount of ascorbic acid had quite significant quantities with increased as the number of sprouting days corresponding decrease in calories and last. The first sprouting day had the lowest carbohydrate content(Helen and Barker, amount of ascorbic acid (13.2mg/100g) 1999). Sprouts are the freshest and most

204 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 nutritious of all vegetables available to Asoiro, F.U. and Ani, A.O. (2011). human diet. Sprouts were also considered Determination of some physical as wonder foods (Hurst, 2002; Helen and properties of African yam beans. The Barker, 1999). Eating of sprouts was Pacific Journal of Science and described as the best and safest way of Technology, 12(1); 14-25 getting the advantage of both fruits and Boehinger, M.G. (1997). Methods of vegetables without the contamination of enzymatic bioanalysis and food harmful insecticide (Helen and Barker, analysis. Mannheim, Germany, pp 66- 1999). The results of this study 79 vehemently supported the observation Colditz, G. A., Branch, I.G. and Lipnick, from the literature publication by K.J. (1985). Increased green and Onyeike et al., (1995) that animal fed on yellow vegetables intake and lowered the germinated cooked mash bean gained cancer deaths in elderly population. more weight than those fed on the American Journal of Clinical Nutr. ungerminated beans. 41, 32-36. Edem, D.O., Amugo, C.L. and Eka, U.O. References (1990). Chemical composition of Adewale, B.D. and Odoh, N.C. (2013). African yam beans. Trop. Sc., 30, Review on genetic Resources, 59-63. Diversity and Agronomy of African FAO (2000). Protein quality evaluation y a m b e a n s ( S p h e n o s t y l i s (Report of joint FAO /WHO expert sternocarpa). A potential Future Food consultation held in Bethesda, MD, crop. Sustainable Agricultural USA), FAO. Rome, Italy. Research, 2(1): 32-43. Fasoyiro, S. B., Ajibade, S.R., Omole, Ajayi, A.O. (2011). Sustainable Dietary A.J., Adeniyan, O.N., and Farinde, Supplements: An Analytical Study of E.O. (2006). Proximate, mineral and African yam bean-Sphenostylis anti-nutrient factors of some sternocarpa and Corn-Zea mays. underutilized grain-legumes in South- European Journal of Experimental Western Nigeria. Nutr. Food Sci., Biology 1(4); 189-201. 36(1), 18-23. Ajibade, S.R., Balogun, M.O., Afolabi, Helen, M. and Barker, C. (1999). O.O., Ajomale, K.O. and Fasoyiro, Nutrition and Dietetics for health care. S.B. (2005). Genetic Variation in Longman Group Ltd pp.47-50 nutritive and anti-nutritive content of Hurst, J.W. (2002). Methods of analysis African yam bean. Trop. Sc., 5. 144- f o r f u n c t i o n a l f o o d s a n d 148 nutraceuticals. C. R. C. Press, New Ajibola, G. O. and Olapade, A. A. (2016). York, London, pp.291-294. Physical, proximate and anti- Ndidi, U.S., Ndidi C.U., Abbas,O., Aliyu, nutritional composition of African M., Francis ,G.B., and Oche, O. yam bean (Sphenostylis stenocarpa) (2014).Proximate, antinutrients and seed varieties. Journal of Food mineral composition of raw and Research 5(2); 67-72. processed (Boiled and roasted ) AOAC. (2005). Official methods of Sphenostylis sternocarpa seeds from Analysis (18th Ed).Association of Southern Kaduna, Northwest Nigeria. Njoku, H.O., Ofuya, C.O. and Eli, L. Official Analytical Chemists. (1991). Development of cheese like Washington D.C. USA. Pp.118-120 205 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

products from African African yam Pezacka, E. and Walerych,W.(1991). beans. Food Chem. 39, 197-204. Biosynthesis of Vitamin C : Roles of Olapade, A.A., Oluwole, O.B. and microsomal enzymes in vitamin C Aworh, O.C. (2012). Physico- biosynthesis. Biochem. Biophs., chemical properties and consumer Aceta, 678,300 acceptance of instant cowpea (Vigna S t r o e v, E . A . a n d M a k a r o v a , u n g u i c u l a t a ) p o w d e r f o r V.G.(1989).Laboratory Manual in complementary food. African Journal Biochemistry. Mir Publisher Moscow, of Food Science and Technology, 3; pp.197-199. 102-106). Verderames, M. (1995). Hand book of Onyeike, E.U., Ayalogu, E.O. and H o r m o n e s , V i t a m i n s a n d Uzogara, S.G. (1995). Influence of Radiopaques. C.R.C. Press Inc., heating processing of African yam pp.245-307 bean seed flour on growth and organ Wagner, A. F. and Folker, K. weight of rats. Plant Foods for (1994).Vitamins and Co-enzymes. Human Nutrition 48, 85-93. Inter Sci., New York, 42-46

206 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

African yam bean: a review of an unharnessed important source of protein for livestock feed

*Omodewu. I. A., Boladuro B. A. and Harry B. J. Institute of Agricultural Research and Training, Obafemi Awolowo University, Moor Plantation, Ibadan Corresponding Author: Omodewu Ifeoluwa. A. E-mail: [email protected]

Abstract In Africa, a lot of small-scale and medium-scale livestock farmers contribute to food security and protein supply by raising Snails, rabbits, grass-cutters, small ruminants (sheep and goat), pigs and poultry for household consumption and business. The exorbitant prices and sometimes unavailability of commercial protein sources such as fish meal, Groundnut cake, Soya Bean meal and Full-Fat Soya are limitations to productivity and profitability in livestock production for small scale and medium scale farmers. In this paper review, options of including African yam bean (AYB) an underutilized grain legume as an alternative source of protein in livestock feed so as to create more protein sources and reduce the reliance on exorbitant protein sources became important. Apart from utilization of African yam bean as a livestock feed component, in integrated farming systems AYB could offer ecological benefits such as nitrogen fixation, soil improvement and erosion control which contribute to cropping efficiency. The manure derived from livestock fed with AYB could in turn be utilized toenrich soil for crop production. The potential nutritional and anti-nutritional effect of AYB is explained, evaluated and discussed in this review. Finally, methods of processing AYB (heat, chemical or biological) to reduce anti-nutritional factors for goodperformance and physiological response of livestock are also discussed

Key Words: Livestock, Farmers, Protein, Feed and Performance.

Introduction ignored (Bhag, 1992). They are important The main limitation to the expansion of sources of dietary proteins for both human t h e l i v e s t o c k i n d u s t r y i s t h e and animals, but the presence of relatively unavailability of adequate supplies of high concentration of toxins (trypsin needed feed ingredients at reasonable inhibitors, phytic acid, saponin, oxalate prices (Babatunde and Hamzat, 2005). etc.) affects the nutritional quality, inhibit Feed account for about 70% of total cost a number of enzyme and bind nutrients of production (Ademola and Farinu, 2006). The high cost of feed is mainly due making them unavailable (Nowacki, to the increasing competition between 1980). Its effects limit the use of raw man and livestock for grains and African yam bean seeds in livestock feed. conventional sources of plant (soybean, Although various processing techniques groundnut seed) and animal proteins such as sun-drying, boiling, roasting, de- (Emenalom, 2004). hulling and fermentation tend to reduce Legumes are rich sources of plant the anti-nutritional factors in African Yam proteins and present a substitute for the bean. African Yam bean (Sphenostylis scarce animal proteins. African yam stenocarpa) is one of the edible, bean (AYB) is an Under-utilized legume underutilized grain legumes widely that has tremendous potential for cultivated in Africa that is used in man and commercial exploitation but remains animal nutrition (Eke, 2002).

207 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Nutritional profile of African yam bean et al. (2015) were higher than the values African Yam bean is rich in protein (19.5 reported by other authors; Kay (1987): %), carbohydrates (62.6 %), fat (2.5 %), 24-28%; Adeyeye et al. (1999): 20-25% vitamins and minerals (Iwuoha and Eke, and Apata and Ologhobo (1990) who 1996). The protein is made up of over 32 reported 22.6 to 23.8%. The protein % essential amino acids with lysine and content of AYB is higher than most of leucine being predominant (Onyenekwe other legumes such as lima beans, lentils, et al., 2000). The utilization of this lesser- chick pea and peanuts except soybean known and under-utilized legume in the which is higher (Eromosele et al., 2008). feed formulation for livestock especially The fat content ranged between 2.67 and in the developing countries for animal 3.33%. These values indicate that AYB consumption will be of high benefits. seeds are low in fat content and this could be an advantage in storage. The ash and Varieties of the African yam bean (AYB) crude fibre contents are between 3.23 and Abioye et al. (2015) listed nine variants 3.57% and 2.60 and 2.77% respectively. of the African yam bean: AYB 13, AYB The carbohydrate contents ranges 34, AYB 95N, AYB 95, AYB 45, AYB 91, between 51.90 and 53.57%. The crude AYB 93, AYB50, AYB 61. The colour of fibre contents of the seed in nine varieties the seed coat of AYB varies from white to of African yam bean seeds were more shades of cream, brown and grey than other legumes (Apata and Ologhobo, (Adewale et al., 2012). Onuoha et al. 1994). This suggests that the seed could (2017) reported different varieties of serve as functional input with health African Yam bean seeds developed and benefits associated with both soluble and grown in some research institutes in insoluble fibre. Calcium content ranged Nigeria such as IITA (International from 48.33 to 85.00 mg/100 g and this Institute of Tropical Agriculture), could still be referred to as a good source. I A R & T ( I n s t i t u t e o f Tr o p i c a l The calcium content of soybeans Agricultural Research and Training) and however, is higher than that of African NACGRAB (National Centre for Genetic yam bean seed of all other legumes. The Resources and Biotechnology). Onuoha potassium content ranged from 11.17 et al. (2017) also reported that white or (AYB 91) to 14.50 mg/100 g (AYB 34). closely white coloured AYB have nutrient The iron content ranged from 4.77 (AYB values that are considered good for 95) to 8.03 mg/100 g (AYB 45). Iron is incorporation in livestock feed. The high in all varieties of AYB, Legumes are moisture content of variants of African generally low in iron contents but high yam bean seed is higher than that of values are recorded in African yam bean peanut but lower than those of soybean, seed (Poulter and Caygill, 2006). The cowpea and chickpea (Ekpenyong and high content of iron will have beneficial Borchers, 1978). The protein contents of effects on the haematology and serum the nine variants of African yam seeds biochemistry of livestock. The African evaluated by Abioye et al. (2015) ranged yam bean seed is a good source of between 28.63 and 30.43%. AYB 34, a phosphorus, phosphorus content ranged variant had highest protein content when between 108.33 (AYB 95) and 135.00 compared with other variants while AYB mg/100 g (AYB 45). Vitamin C (ascorbic 13 had the least. The protein contents of acid) ranged between 4.37 (AYB 91) to nine variants of AYB reported by Abioye 5.67 % (AYB 95) while Beta-carotene

208 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 which is a precursor of vitamin A ranged al. (2005) who studied the common black, between 56.67 (AYB 95) to 93.33 % marble and white African yam bean (AYB 50) and this will help combat varieties, proximate contents vary among vitamin A deficiency. According to these three varieties. Crude protein for the Abioye et al. (2015) varietal differences black, marble and white were 224, 221 in the nutritional and anti-nutritional and 254 g kg- 1, Total starch 451, 472 and composition of African yam bean seed 417 g kg- 1, Total lipid 17.5, 15.3 and 4.1g have been confirmed. Variety AYB 34 has kg- 1, Ash 29.3, 30.4 and 36.2g kg- 1 the highest protein content, AYB 95 had a respectively. The greenish type African minimal content of tannin (6 mg/100 g) yam bean reported by Nwodo and Nwinyi against about 23.3 mg/100 g of tannin (2012) had crude protein, fat, ash, crude content reported for African yam bean fibre and carbohydrates of 37.21, 9.49, seeds. 5.35, 3.55 and 44.4 respectively. According to Adeyeye and Nutritional value of AYB Arogunjo (1997), Ndidi et al. (2015) and The range of the proximate content of Abioye et al., (2015) AYB has a high AYB is listed in Table 1. The protein mineral composition which includes: content: (28.63-30.43%), fat (2.40- iron, copper, manganese, potassium, 3.33%), crude fibre (2.40-3.03%) and magnesium, sodium, phosphorus, zinc carbohydrate (50.80-53.57%) present in and calcium which are essential for AYB are within the range that makes it a sustainable health. Mineral contents: good of choice ingredient for livestock calcium (48-33.85 mg/100 g); potassium feed production. Protein content is lower (10.83-14.56 mg/100 g); iron (4.77-8.03 than that of soybean (25 % vs. 38%) but mg/100 g); and phosphorus (108-135 the proportion of most essential amino mg/100 g) present in AYB seeds will be of acids corresponds to the WHO/FAO tremendous benefit to the growth and recommendation. Uguru and Madukaife development of various livestock. AYB (2001) evaluated the nutritional genotype also possess Vitamin C content which of 44 African Yam Beans and reported ranges from 4.37-5.67 mg to Beta- that the crop is well balanced in essential carotene that ranges from 56.67to amino acids and has higher amino acid 93.33ìg which is a precursor of Vit. A. levels compared to pigeon pea, cowpea, These vitamins (A and C) are needed for and Bambara nut. According to Azeke et proper functioning of the eyes, boosting

Table 1: Proximate composition of African yam bean (% Dry weight)

Nutrient Range in AYB (%) Moisture 3.20 – 9.37 Dry Matter 93.64 – 94.75 Ash 2.06 - 3.2 Crude protein 18.3 – 30.43 Carbohydrate 50.80 – 74.1 Fat 0.4 – 10.18 Ash 2.3 - 3.7 Crude Fibre 3.05 – 6.4 Sources Duke et al. (1977), Watson (1977), Edem et al. (1990), Thomas et al., 2005, Abioye et al. (2015), Soetan (2017).

209 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 immunity, suppressing infections and flavonoids at different levels in the AYB also combatingstress. accessions. According to Abioye et al., (2015) Several authors: Edem et al. differences occur in mineral content (1990), Thomas et al. (2005), Azeke et al. based on processing methods. Roasting (2005), Akinmutimi et al. (2006), increased the percentage levels of Ca, K, Fadahunsi and Sanni (2010) and Soetan Cu, Fe, Mn, Mg, P, and Na while Zn was (2017) to mention a few have reported that decreased. Boiling, on the other hand, anti-nutritional factors (toxins and caused decrease in Ca, K, Fe, Mn, and Zn, biological active substances) such as while there was increase in Cu, Mg, P, and trypsin inhibitor, á-galactosides, á- Na. Boiling reduced the levels of Ca, K, Amylase inhibitor, Phytic acid, lectin, and Zn compared to raw AYB. No haemoaglutinins, total and soluble oxalate, cyanogenic glycosides, tannin, difference was reported for Fe and Mg in anticoagulant and toxic histones are both processed and unprocessed AYB. present in AYB. The range of ANF's in According to Soetan et al. (2018) AYB is AYB and their effects on animal rich in antioxidants and can serve as a physiology are listed in Table 3. Azeke et nutraceutical. Phytochemical screening al. (2005) and Thomas et al. (2005) showed the presence of different reported that in different seed varieties, phytochemical such as alkaloids, anti-nutrients potentially capable of cardenolides, saponins, Phenols and having deleterious effects, reducing

Table 2: Mineral composition of the African yam bean

Minerals Range Functions Calcium 21.20-85.00 Calcium functions in bone formation and blood coagulation (Seidu et (mg/100 g) al. 2014). Magnesium 12.19-16.11 Magnesium is an active component of several enzymes and thymine (mg/100 g) pyrophosphate is a cofactor (Murray et al. 2000). Magnesium regulates diverse biochemical reactions in the body, including protein synthesis, muscle and nerve functions, blood glucose control and blood pressure regulation. It also keeps bones strong and heart rhythm steady (Murray et al. 2000). Potassium 10.83-14.56 Potassium is the principal Cation in intracellular fluid. It functions in (mg/100 g) acid-base balance, regulation of osmotic pressure, conduction of nerve impulse, muscle contraction particularly the cardiac muscle, and cell membrane function (Murray et al. 2000). Potassium is a building block of body tissue. Phosphorus 108.33-135.00 Phosphorus regulates essential biochemical processes like regulation (mg/100 g) of enzyme activity, formation skeletal structures (bones and teeth) and in neuromuscular irritability (Kalita et al. 2007). Sodium 355.93-591.88 Sodium is the principal extracellular cation and is used for acid-base (mg/g) balance and osmoregulation (Crook, 2006). Sodium stimulates cell proliferation, protein synthesis and increase cell mass (Twum et al. 2015). Iron 4.77-8.03 Iron aids in transport of oxygen in red blood cells and in muscles. It is (mg/100g) an important constituent of succinate dehydrogenase and is also a part of the haeme of haemoglobin (Hb), myoglobin and the cytochromes (Antia et al. 2006). Copper 9.70-16.10 Copper acts as an antioxidant by protecting the brain and nervous (mg/g) system. Although, copper is an essential metal, it can also produce toxic effects when the metal intake is excessively high (Murray et al. 2000). Sources: Adeyeye and Arogunjo (1997), Ndidi et al. (2015), Abioye et al., (2015), Soetan (2017),

210 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 3: Anti-nutritional Factors (ANF’s) in African Yam Bean

ANF’s Range Effects Tannins (mg/g) 0.9 - 23.33 Tannins form insoluble (inactive complexes) with dietary proteins and reduces their biological value, causing reduced weight gain, reduced palatability and poor feed efficiency (Emiola et al. 2007; Omoyeni and Adeyeye, 2009; Akande et al. 2010). Saponins (mg/kg) 1.10 - 4.00 Saponins reduce uptake of certain nutrients (cholesterol) in the gut causing hypocholesterolaemia (Umaru et al. 2007). It causes haemolysis of red blood cells of rats (Akande et al. 2010). Oxalates 6.67 - 35.00 Oxalates complex with calcium forming calcium crystals which (mg/100g) get deposited as stones and are associated with blockage of renal tubules (Banso and Adeyemo, 2007). Oxalates also prevent the body’s absorption of calcium ions by forming insoluble calcium-

oxalate complex (Adeniyi et al. 2009). Phytates (mg/g) 4.51 - 33.33 Phytates form stable complexes with mineral ions like Ca, Fe, Mg and Zn and lower their bioavailability for intestinal absorption (Walter et al. 2002; Banso and Adeyemo, 2007). Trypsin inhibitors 0.68 - 19.2 TI in large quantities disrupts digestive process and may lead to (TIUmgprotein-1) undesirable physiological reactions. Trypsin inhibitors cause hypertrophy and hyperplasia of the pancreas (Ologhobo et al. 2003). Alkaloids (mg/kg) 12.05 - 15.02 Alkaloids can cause gastrointestinal and neuronal disorders (Tadele, 2015). Cyanogenic 12.3 - 225 Long-term exposure to improperly processed cyanogenic glycoside (mg/kg) glycoside-rich foods has been linked to the occurrence of tropical ataxic neuropathy (Montgomery, 1965). Haemoaglutinins 0.13 - 0.57 Haemoaglutinin are characterized and detected by their actions (mg) on red blood cells membranes, causing the clumping of cells. á-Amylase 6 - 13 This reduces the glucose peak that can occur after a meal, it also inhibitor disrupts the digestion of starch and glycogen (AIU g- 1) á-galactosides 2.3 - 3.4 á-galactosides are regarded as the main flatulence causing factor -1 (g 100 g ) Sources: Edem et al. (1990), Thomas et al. (2005), Azeke et al. (2005), Akinmutimi et al. (2006), Fadahunsi and Sanni (2010), Fadahunsi and Sanni (2010), Soetan (2017). protein, starch and mineral availability cyanogenic glycoside-rich foods has been occur at different levels. Cyanogenic linked to the occurrence of tropical ataxic glycoside content was very high in white neuropathy and this could be of serious seeds (225mgkg- 1,) while concentrations concern to the utilization of AYB in ranged from 37 to 40mg kg- 1 in the black livestock feed. Azeke et al. (2005) and marble AYB. An unspecified variety recommended lactic acid fermentation of African yam bean was reported by over traditional cooking method as all Edem et al. (1990) to contain 61mg HCN anti-nutrients, except phytic acid, were equiv. kg- 1. Cyanogenic glycoside significantly reduced in the seeds of concentrations as high as this are African yam bean. considered a serious health risk, bearing in mind that the lethal dose for an adult Processing of AYB for livestock Nutrition human is between 50 and 250 mg Simple preparative procedures such as (Montgomery, 1965). Long-term sun-drying, germination, roasting, exposure to improperly processed soaking in warm water and thorough

211 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 cooking which usually require high fuel currently unlikely to be suitable for input and prolonged cooking have been smallholders due to cost and their limited evaluated by various authors (Oluwole availability. Reduction of ANF's by and Taiwo, 2009). Methods for processing fermentation (by up to 85%) using lactic AYB so as to reduce the ANF's include acid is clearly more effective than breeding of AYB with thinner seed coat traditional cooking (10–20%), sun- and less ANF (Adewale, 2014), adequate drying, roasting and de-hulling. pre-cooking treatments such as lactic-acid According to Ndidi et al. (2014) fermentation (Azeke et al., 2005), the permissible limit for oxalate soaking, boiling/cooking, baking, (3–5mg/kg), Tannins (20mg/g), Phytate autoclaving, dehulling, germination, (250–500mg), Trypsin Inhibitor alkaline treatment reduces or eliminates (0.7–3.0mg/100 g) and HCN (50mg/kg) ANFs (Soetan and Oyewole, 2009). Heat must not be exceeded to ensure proper processing, aqeous and dry heating utilization and avert the deleterious effect (toasting) increases the digestible of the ANF's. According to Onuoha et al. nutrients in AYB available to young (2017) and Soetan et al., (2018) before chicks (Emiola, 2011). Phytate-degrading AYB seed can be incorporated into enzymes also reduce phytic acid content livestock feed, it has to be processed and and increase bioavailability of minerals detoxified by processes such as soaking, (Hidvegi and Lasztity, 2003). Ndidi et al. boiling, autoclaving and fermentation to a (2014) evaluated different processing safe level. This will reduce the negative methods: Boiling, roasting and effect of the anti-nutritional factors and unprocessed AYB for the proximate and improve the nutritional quality of the mineral composition, it was concluded African Yam Bean. The utilization of that the AYB seeds has good nutritional fermentation can substantially improve profile with high level protein, the nutritional quality, the energy required carbohydrate, lipid, minerals and other to produce a basic consumable fermented nutrients comparable with common feed from African yam bean is only 10% legume grains. Crude protein content for of that which is required in traditional unprocessed (21.78%) AYB was higher cooking. This process is therefore than the processed (boiled and roasted) proposed as an effective cost and energy- AYB (19.74-20.47%). According to saving means for improving the Christopher et al. (2008), only ash and moisture content were affected with nutritional quality of African yam bean for increased cooking time up to 120 minutes. livestock consumption. The levels of crude fibre in processed AYB was lower than those of the Performance of livestock fed AYB unprocessed AYB. The percentage of lipid Adewale (2010) reported that AYB would composition of boiled AYB was lower be a good alternative source of protein for (1.79%) than the unprocessed (2.84%) livestock feeds. Underutilized legumes and the roasted AYB (2.41%). The level of contribute immensely to food security in a carbohydrate in roasted AYB was higher many ways, due to increasing demand for than that in the unprocessed AYB. There plant proteins in lieu of expensive animal have been various attempts to mix protein sources (Adebowale et al. 2009). different enzymes into feeds to reduce anti-nutrients but the only successes are Performance of Poultry Fed AYB with phytase (Varley et al., 2011) and According to Ojewola et al., (2006) and NSPases (Ao et al., 2010). Enzymes are Okoye and Ihekoronye (2004) the final

212 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 body weight, total weight gain and daily ratio, weight gain and low globulin level weight gain of broiler chicken fed raw which implies susceptibility to infections. AYB decreased as the quantity of AYB in the diets increased. It was reported that Performance of Ruminants fed AYB the result was most likely due to the Asare, et al (1994), observed that African presence of anti-nutritional factors such Yam Bean is a good source of fodder for as trypsin inhibitors, phytic acid, tannin, ruminant animals. Incorporating African saponin and hydrochloric acid found in Yam Bean in the feeds of some livestock raw AYB. Tannin for example forms has been attempted. Anya and Ozung complex linkage with protein hence poor (2018) fed WAD goats cassava peel meal digestibility leading to loss of protein and based diets supplemented with African poor growth (Akinmutimi, 2003). Phytic yam bean concentrate and reported acid makes mineral unavailable for enhanced the growth performance and metabolic processes as it chelates with carcass characteristics. Recommendation them (Aletor and Fasuyi, 1997; Roberts et of inclusion of up to 30% AYB Meal in al., 2006) also resulting in poor growth. cassava peel meal based – diets was made The results of growth performance, to livestock farmers in the tropics. carcass yield, carcass characteristic and economics of broiler chicken fed raw with Performance of Wister Rats fed AYB AYB showed that at 5% level of inclusion The experimentation of AYB hull on rat raw AYB cannot replace soybean without feeding (Agunbiade and Longe; 1999), deleterious effect (Eburuaja, 2017)). showed increased weight and higher feed According to Raji et al. (2016), toasted conversion efficiency compared with African yam bean seed meal (up to 20%) cellulose free and pure cellulose meal. used in broiler starter and finisher diets This infers that AYB hull could be a good with enzyme supplementation improved source of dietary fibre. According to growth performance and nutrient Onwuka et al. (2009) performance of digestibility of broilers at the starter phase male Wister albino rats fed ungerminated and had no negative effect on serum and germinated African yam bean seed biochemistry. Abioye et al. (2016) fed revealed that the proteins of germinated broiler chicken locally fermented AYB up AYB were found to have high true to 100% replacement of SBM and digestibility and feed conversion ratio. reported blood profile (Haematological The implication of this is that and serum biochemistry), organ weight Sphenostylis stenocarpa seed protein is a and carcass yield better than conventional good source of high quality protein protein source (Soya bean meal). especially in the preparation of protein According to Hussein et al. (2016) an supplements and formulation of new increase in weight of animals in both the diets. control and the test groups was obtained As at the time of this review in white Leghorn layers fed AYB. reports on the utilization of AYB to feed cattle, pigs and micro-livestock such as Performance of Rabbits fed AYB Cane-Rat (Grass-cutter), Snails and 10% raw AYB meal was recommended by quails were unavailable. Akinmutimi et al. (2006) as the best inclusion level in the diet of growing Conclusions and outlook rabbits. Rabbit fed higher level showed The AYB is a legume that could substitute, reduced feed intake, feed conversion partly replace, or incorporated as a source

213 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 of protein and other nutrient in the diet of The protein content was very high and farm animals in the tropics. The high compares well with other legumes, resistant to environmental stress and making it a good substitute for protein. ability to produce acceptable yields even The variety AYB 34 with protein value of under unfavourable conditions validates 30% which is close to soybean (32 %) the prospects of AYB. could be substituted into various feed Nutrient contents has been formulations where soya bean meal is evaluated by various authors and used in livestock diet and this will relieve regarded as nutritionally beneficial to the heavy dependency on fish meal, human and livestock if the nutritional soybean meal and groundnut cake in constraints (anti-nutritional factors) can developing tropical countries. be eliminated or reduced to the barest minimum using appropriate methods References recommended, to drastically reduce the Abioye, A. A., Ojediran T. K. and Emiola, level of anti-nutrients in the AYB. I. A. (2017). Fermented African Yam Creative approaches are required to fit Bean (Sphenostylis stenocarpa) and forage-based feed solutions for livestock Pigeon Pea (Cajanus cajan) Seed into existing small and medium holder Meals: Effect of Residual Anti- systems and further systematic research is Nutrients on the Blood Profile, Organ required to define the actual value of well Weight and Carcass Characteristics of processed AYB (using the recommended Broiler Chickens. J. of Agric. and Vet. Lactic acid fermentation) required for Sci., Volume 10, Issue 12, PP 01-07. different animal species. There is need to Abioye, V. F. Olanipekun, B. F. and close the large knowledge gaps of the Omotosho, O.T (2015). Effect of digestibility of total protein or crude Varieties on the Proximate, protein and the direct effects of feeding Nutritional and Anti-nutritional AYB to different farm animals. Composition of Nine Variants of The potentials of AYB as an A f r i c a n Ya m B e a n S e e d s alternative to rather expensive plant and (Sphenostylis Stenocarpa) Donnish J. animal protein sources cannot come to of Food Sci. and Tech., Vol 1(2) pp. reality if farmers and investors will not to 017-021 take up the legume, massively cultivate A d e b o w a l e , Y. A , H e n l e , T. S c h w a r z e n b o l z , U . ( 2 0 0 9 ) . and process for human and animal Acetylated and Succinylated consumption. Agronomic researchers and Derivatives of African Yam Bean scientists should endeavor to educate and (Sphenostylis stenocarpa Hochst. Ex pass on innovations and recommenda- A. Rich.)Harms) protein isolates. J. tions on the full potential of African yam Mobile. Communicat. 3(2):34-36. bean to producers as the reality of Lactic Ademola, S. G. and Farinu, G. O. (2006). acid fermentation is still unknown to Performance of laying birds fed diets many; and this is the only way to containing forage meal of Tithonia encourage eco-efficient and market- diversifo-lia (Hems/A. Gray) and oriented animal production. antibiotics. Nig. J. of Animal Prod. This review has been able to 33(1): 58-68. establish that frican yam bean varied in Adewale D (2014). Improving the the nutritional and anti-nutritional value African Yam Bean, A neglected of African yam bean seeds with varieties. c r o p . h t t p : / / b l o g . w o r l d -

214 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

agroforestry.org/index.php/2014/07/ Australasian J. of Anim. Sci., 23, 14/improving-the-african-yam-bean- 1632–1638. neglected-crop/. Apata, D.F. and Ologhobo, A.D. (1994). Adewale, B. D., Dumet, D. J., Vroh-Bi, I., Biochemical evaluation of some Kehinde, O. B.,Ojo, D. K., Adegbite, Nigerian legume seeds. F o o d A. E. and Franco, J. (2012). Chem., 49: 333- 338. Morphological diversity analysis of Azeke. M. A., Fretzdorff, B. Buening- African yam bean and prospects for Pfaue, H. Holzafel, W. and Betsche, T. utilization in germplasm conservation (2005). Nutritional value of African and breeding. Gen. Res. and Crop yam bean (Sphenostylis stenocarpa Evo., 59(5): 927-936. L): improvement by lactic acid Adewale, D. (2010). African Yam Bean: A fermentation. J. of the Sci. of Food food security crop. http:// improving- and Agric. 85:963–970 the-african- y a m - b e a n - Babatunde, B. B. and Hamzat, R. A. neglected-crop. (2005). Effect of feeding graded Akinmutini, A. H., N. Amaechi and M. levels of kolanut husk meal on the Unogu (2006). Evaluation of Raw performance of cockerels. Nig. J. of African Yam Bean as substitute Animal Prod. 32(1):61-66. for Soya Bean Meal in the diet of Bhag, M. 1992. Biodiversity utilization Weaner Rabbits. J. of Ani. and vet. and conservation in under-utilized Adv. 5(11): 907-911 plants: Indian p e r s p e c t i v e . Aletor, V. A. and Fasuyi, A. O. (1997). Indian J Plant Genet Resour, 5: 1-12. Nutrient Composition and processing Christopher, A. C. Igene, F. U. and Oboh effects on cassava leaf ( M a n ih o t S. O. (2008). Effects of Cooking esculenta, cranzi) anti-nutrients. A Time on the Nutritive Values of paper presented at the 2nd Annual African Yam Bean (Sphenostylis Conference of Animal Science Stenocarpa), M. Agric. Thesis, Association of Nigeria, Lagos. Pp. Department of Animal Science, 231-242. Ambrose Alli University, P.M.B. 14, Anya, M. I., and P. O. Ozung, (2018). Ekpoma, Edo State, Nigeria. P e r f o r m a n c e a n d C a r c a s s Eburuaja, A. S. (2017). Performance of Characteristics Of West African Broilers fed Graded Dietary Levels of Dwarf (Wad) Goats Fed Cassava Peel Raw African Yam B e a n s Meal Based Diets Supplemented with (Sphenostylis stenocarpa). Nig. J. of African Yam bean Concentrate, Agric., Food and Environ. 13(1):75- International Journal of Advances in 79. A g r i c u l t u r a l S c i e n c e a n d Edem, D. O., Amugo, C. I. and Eka, O. U Technology, Vol.5 Issue.7, pg: 95- (1990). Chemical composition of yam 108. beans ( S p h e n o s t y l i s Ao, X., Meng, Q. W., Van, L., Kim, H. J., stenocarpa). Trop Sci 30:59–63. Hong, S. M., Cho, J. H. & Kim, I. H. (2010). Effects of Non-starch Eke, O.S. (2002). Effect of malting on the Polysaccharide-degrading Enzymes dehulling characteristics of African on Nutrient Digestibility, Growth yam bean (Sphenostylis stenocarpa) Performance and Blood Profiles of seeds and the functional properties of Growing Pigs Fed a Diet Based on the flour. J Food Sci Technol, 39: 406- Corn and Soybean M e a l . A s i a n - 409.

215 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Emenalom, O. O. (2004). “Comparative Iwuoha, C.I. and Eke, O.S. (1996). performance of broiler chicks fed Nigerian Indigenous fermented diets containing d i f f e r e n t l y foods: their traditional p r o c e s s processed Mucuna pruriens seed operations, inherent problems, meals. Nig. J. Animal Prod. 2004. improvements and current status. 31(1) 12- 16. Food Res Int, 29: 527 -540 Emiola, I. A. Ologhobo, A. D. and Gous, Kehinde O. Soetan (2017). Preliminary R. M, (2007). Influence of processing Studies on the Nutritional and Anti- of mucuna (Mucuna pruriens var nutritional Constituents Of Six utilis) and kidney bean (Phaseolus Accessions Of African Yam Bean vulgaris) on the performance and (Sphenostylis stenocarpa), An nutrient utilization of broiler Underutilized Legume. Annals. Food chickens. The J. of Poult. Sci., 44:168- Science and Technology, Volume 18, 174. Issue 4: 625-631 Eromosele, C.O., Arogundade, L.A., Montgomery, R. D. (1965). The medical Eromosele, I.C. and Ademuyiwa O. significance of cyanogens in plant (2008). Extractability of African yam foodstuffs. Am. J. Clin. Nutr. bean (Sphenostylis sternocarpa) 17:103–113. protein in acid, salt and alkaline Ndidi, S. U, Charity, U. N, Abbas, O. aqueous m e d i a . F o o d Aliyu, M. Francis, G. B. and Oche, O. Hydrocolloids, 22: 1622-1628. (2014) Proximate, Antinutrients and Fadahunsi IF, Sanni AI (2010). Chemical Mineral Composition of Raw and status of fermented, germinated and Processed (Boiled and Roasted) roasted bambara groundnut seeds Sphenostylis stenocarpa Seeds from (Vigna subterranea)", Brit. Food Southern Kaduna, Northwest Nigeria J., 111(4): 376-386. ISRN Nutrition Volume 2014, Onuoha, C. H, Harry, B. J. and Eze, S. O. Article ID 280837, 9. (2017). Evaluation of Nutrients and Nowacki, K. (1980). Heat stable anti- Anti-Nutritional F a c t o r a n d nutritional factors in leguminous biochemical changes in Bambara nut plants. In: Summerfield, R.J. (Voandzeia subterranean (L) (thours) Legumes. Hulse, J.H. (Ed.). during fermentation to tempeh Elect. International Development Research J. Environ. Agric. Food. C h e m . , Center. Ottawa. Canada. p. 61. 9(2): 275-283. Ojewola, G. S., Otteh, J. O., and Hidvegi, M. and Lasztity. R., (2003). Abasiekong, S. F. (2006). Effect of Phytic acid content of cereals and African Yam Bean ( S p h e n o s t y l i s legumes and interaction w i t h stenocarpa) Meal-based diets proteins. Periodica Polytechnics. Ser. supplemented at varying levels with Chem. Eng. 46: 59-64. Nutrase- Xyla Enzyme on broiler Hussein, T., Urge, M., and Animut, G. starter. Agric. J. 1(3):172-175. (2016). Effect of replacing soybean Okoye, F. C., and Ihekoronye, C. C. meal (Glycine max) with kidney (2004). Substitution of African Yam bean (Phaseolus vulgaris) on egg Bean meal (Sphenostylis stenocarpa) quality parameter of white Leghorn for groundnut cake in broiler diets. layers. Inter. J. of Liv. Prod., 7(6), PGD thesis of Coll. Of Anim. Sci. 33-40. and Anim. Health. Michael

216 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

University of Agriculture, Umudike. Nwodo Chinedu S. and Obinna Nwinyi Oluwole, S. I. and Taiwo, R. E., (2009) C. (2012) Proximate analysis of C o m p a r i s o n o f n u t r i t i o n a l Sphenostylis stenocarpa a n d composition and anti-nutrient s of Voadzeia subterranean consumed in Different Species of African Yam South –Eastern Nigeria. Journal of Bean (Sphenostylis stenocarpa), Agricultural Extension and Rural European J. of Basic and App. Sci., Development. Vol. 4(3), pp. 57 – 62. Vol. 4: 1. Soetan, K. O. and Oyewole, O. E., Onwuka, C. F, Ikewuchi, C. C, Ikewuchi, (2009). The need for adequate C. J, Ayalogu, O. E, (2009). Effect of processing to reduce the anti- Germination on the Performance nutritional factors in plants used for Characteristics of African Yam Bean human food and animal feeds- A (Sphenostylis stenocarpa Hochst e x Review. African Journal of Food A Rich) Seed Meal on Albino Rats, J. Science. Vol. 3(9): 123-132. Appl. Sci. Environ. Vol. 13(2) 51 – 53. Thomas, B. Marshall, A. Hans, B. and B, Onyenekwe, P.C.; Njoku, G.C. and Fretzdorff (2005). Food safety and Ameh, D.A. (2000). Effect of cowpea security: Fermentation as a tool to processing methods on flatus improve the nutritional value of causingoligosaccharides. Nutr Res, A f r i c a n . C o n f e r e n c e o n 20: 349-358. Poulter, N.H. and Caygill, J.C. (2006). International Agricultural Research Vegetable milk processing and for Development. Stuttgart- rehydration characteristics o f Hohenheim, October 11-13, pp: 463 bambara groundnut [Voandzeia Uguru, M. I. and S. O. Madukaife, (2001). subterranean (L.) thouars. J. Sci. “Studies on the variability in Food. Agric., 31: 1158-1163. a g r o n o m i c a n d n u t r i t i v e Raji, M. O. Adeleye, O. O. Mosobalaje, characteristics of African yam bean M. A. Ogunjimi, J. T. and Tewe, O.O. (Sphenostylis stenocarpa) (Hochst ex. (2016). Growth r e s p o n s e a n d A. Rich. Harms),” Plant Prod. Res. serum biochemical parameters of J., vol. 6, pp. 10–19. starter broiler chickens fed toasted Varley, P. F., Flynn, B., Callan, J. J. and African yam bean (Sphenostylis stenocarpa) seeds meal with enzyme O'Doherty, J. V. (2011). Effect of supplementation. Arch. Zootec. 65 phytase level in a low phosphorus (250): 139-143. diet on performance and bone Roberts, K. M., Daryl, K. G. Peter A. M., development in weaner pigs and the and Victor, W. R. 2006. Harpers subsequent effect on finisher pig illustrates B i o c h e m i s t r y. 2 7 t h bone development. Livestock Science, Edition, McGraw-Hill, New York. 138, 152–158. 27:489-506.

217 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

The Effects of Bambara groundnut (Vignasubterreanea) Diets on the Haematology and Serum Chemistry of Male Wistar Rats

K. O. Soetan*, O. Ogheneruona and O. C. Akinsulie Department of Veterinary Physiology and Biochemistry, University of Ibadan, Ibadan. *Corresponding Author: [email protected] +234-08074437629

Abstract The haematology and serum chemistry of male wistar rats fed with varying inclusion levels of unprocessed Bambara groundnut seeds were investigated. 18 male rats of average weights 200g-250g were divided into 3 groups of 6 rats each. Group A rats received commercial rat feed and served as control, Group B rats received 50% Bambara groundnut inclusion diet (50% BgD) while Group C rats received 100% Bambara groundnut diet (100% BgD). 25g of feed were given per day and water was given ad-libitum for 14 days.Haematologyand serum chemistry were analysed according to standard protocols. Results showed that the platelet counts for rats in groups B (166,500 ± 50206.60 /uL) and C (161,000 ± 52256.80 /ul) were significantly reduced as compared with the values of rats in control group A. All the other haematological parameters were within normal reference interval. All the serum chemistry values were all within the reference interval. The study concluded that unprocessed Bambara groundnut had no deleterious effect on the haematology and serum chemistry of the rats, as all the values were within the normal reference intervals.

Keywords: Bambara groundnut, Hematology, Serum chemistry, Wistar rats. Introduction human consumption. Bambara groundnut (Vigna subterranea), Ouedraogo et al., 2008 described Bg sometimes called “okpa” locally, because seeds as a complete balanced diet, making of its high protein-energy component, is a it a good supplement to cereal-based diets. legume grown for its edible seeds or The seeds contain 63% carbohydrate, beans. Vigna subterraneais the third most 19% protein and 6.5% oil (Goli, 1997), economical important legume in Africa, and minerals like calcium, (95.5-99 both in temperate and subtropical regions. mg/100 mg), iron (5.1-9 mg/100 mg), It is drought resistant, disease tolerant and potassium (11447-14355 mg/100 mg) and insect tolerant. It is a rich source of plant sodium, (2.9-10.6 mg/100 mg) (Karikari protein (Bello-Perez et al.,2007; Falaye et et al., 1999). As efforts are on, to improve al.,2014) and it is classified as one of the the propagation and utilization of under-utilized legumes in Nigeria (Aletor underutilized legumes as sources of and Aladetimi, 1989)and West Africa (Asante et al.,2008). Bambara groundnut human food and animal feed, this study is one of the lesser known legumes and investigated the effects of feeding graded underutilized legumes in Africa and levels of Bambara groundnut on the globally. haematology and serum chemistry of It is an indigenous African Wistar strain rats. leguminous crop which has been cultivated in the tropical regions of sub- Materials and Methods Saharan Africa and Madagascar for many Experimental Protocol centuries (Zengeriand Mupamba, 1995) Eighteen (18) male Wistar rats weighing and the crop is essentially grown for between 200g and 250g were purchased

218 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 from the Animal house of the Department Haematology of Physiology, University of Ibadan, Blood collection and preparation Ibadan. The rats were kept in individual At the end of the feeding experiment, 3mls stainless steel metabolism cages located of blood was collected from the rats at the Department of Veterinary through the orbital veins. 2mls of blood Physiology and Biochemistry, University from each rat was collected into a sample of Ibadan, Ibadan. They were allowed to bottle for serum biochemical analysis acclimatise for a period of 7 days. The while 1ml of blood was collected into animals were weighed and the weights bottles containing sodium ethylene recorded before commencement of diamine tetra acetic acid (Na EDTA) and experiment. The rats were then assigned used to determine hematological to 3 groups (A-C) of 6 rats each. Group A parameters. was fed a commercial rat feed, group B The blood meant for the serum was fed 50% Bambara groundnut diet, analysis was left and allowed to clot at while Group C was fed 100% Bambara room temperature in the plain sample groundnut diet. All the rats were given bottles and then centrifuged for 10 25g of feed per day for 14 days and water minutes in a bench centrifuge at 2000 was given ad libitum. Ethical approval revolutions per minutes. The clear serum was given by the Institutional Animal was obtained and collected into clean Care Use in Research Ethical Committee sample bottles and stored immediately in (ACUREC). the freezer until it was required for further analysis. The 1ml of blood for the whole Feed Preparation blood count which include the The Bambara groundnut (Vigna erythrocytes count and leucocytes count subterranea) seeds and the rat feed were collected into clean EDTA bottles (12.5kg each) were ground into powder and the samples were immediately form using an electric mill. The feed was analysed by the microhaematocrit method then reconstituted into different of Jain, (1986). inclusions levels of Bambara groundnut seeds (50% and 100%) and normal feed as Haematology Parameters control according to (Soetan et al. 2018). The Packed Cell Volume (PCV) was The feed composition of the graded levels determined by the microhaematocrit of Bambara groundnut inclusion in diets method as described by Jain (1986). The is shown in Table 1. blood hemoglobin concentration was

Table 1: Graded levels of Bambara groundnut (Vignasubterranea) Inclusion in Diets

Groups Normal feed(g) Bambara Total(g) groundnut inclusion(g) A (Control, Normal feed) 25.00 - 25.00 B (50% inclusion) 12.50 12.50 25.00

C (100% Inclusion) - 25.0 25.00

Source: Soetan et al. (2018).

219 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 estimated using the cyanometha Protein - Albumin Concentration. emoglobin method as described by The activity of AST was Schalm et al. (1975). The erythrocyte determined using a photoelectric count was done using a haemocytometer colorimeter (Duncan et al., 1994). according to methods described by The activity of ALT was Schalm et al., (1975). The haematometric determined using a photoelectric indices; Mean Corpuscular Volume colorimeter (Duncan et al., 1994). (MCV), Mean Corpuscular Hemoglobin The alkaline phosphatase activity (MCH) and Mean Corpuscular was assayed using the method of (Talwar Hemoglobin Concentration (MCHC) and Srivastava, 2004). Total Bilirubin was were calculated from the values of Red done based on the colorimetric method Blood Cell count (RBC), Packed Cell described by (Jendrassik and Grof, Volume (PCV) and Hemoglobin (Hb) 1938).Serum urea and creatinine levels (Schalm et al., 1975). Total White Blood were determined using the method of Cell Counts were made in duplicates in a (Coles, 1989). haemocytometer using the white blood cell diluting fluid according to Schalm et Statistical Analysis al., (1975). Statistical analysis was done using one- way analysis of variance (ANOVA) of Serum Chemistry SPSS version 17 to compare the Determination of total serum protein was experimental groups followed by done based on the biuret reaction as Bonferroni's test, to identify significantly described by Gornall et al.,(1949). Serum different groups. Values at P<0.05 were albumin concentration was determined considered statistically significant. using the modification of bromocresol green method of McPherson and Everad, Results (1972). Serum globulinwas calculated as The results of the haematological shown below: parameters are shown in Table 2, while the Globulin Concentration = Total results for the serum chemistry are shown in Table 3. Table 2: Haematological parameters of rats fed control feed and graded levels of Bambara groundnut Diets.

Haematology GROUP A GROUP B GROUPC %PCV 37.3 ± 4.23 37.83 ± 3.98 34.83 ± 3.87 Hb (g/dl) 12.13 ± 1.44 12.47 ± 1.54 11.43 ± 1.35 RBC (106 /ul) 6.15 ± 0.77 6.39 ± 0.62 5.68 ± 1.58 MCV (Fl) 61.89 ± 3.60 59.2 ± 1.70 61.35 ± 3.28 MCHC (g/dl) 32.48 ± 0.48 33 ± 0.60 32.83 ± 0.56 MCH (pg) 19.8 ± 0.98 19.51 ± 0.80 20.18 ± 1.03 Platelet (/ul) 256,167 ± 58683.6 166,500 ± 50206.60* 161,000 ± 52256.80* WBC (103/ul) 3800 ± 575.3 3516.7 ± 1096.7 4875 ± 2088.48 Lym (103/ul) 67.67 ± 2.07 66.33 ± 4.68 63.17 ± 4.62 Neut (103/ul) 28.83 ± 0.75 30.83 ± 4.36 34.33 ± 3.33 Mon (103/ul) 1.83 ± 0.75 1.5 ± 0.55 1.83 ± 0.75 Eos (103/ul) 1.67 ± 0.12 1.33 ±1.03 2.33 ± 1.21 Values are reported as mean±SD Group A: Control, Group B: 50% Bg, Group C: 100% Bg. * = means there is significant difference (P<0.05). Mean ± SD, n = 6

220 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 3: Serum Chemistry of Rats Fed Control Feed and Graded Levels of Bambara groundnut Diets

Serum Chemistry GROUP A GROUP B GROUPC Total Protein (g/dl) 7.97 ± 0.88 7.85 ± 0.82 7.37± 1.51 Albumin (g/dl) 3.35 ± 0.55 3.13 ± 0.50 3.02 ± 0.44 Globulin (g/dl) 4.62 ± 0.51 4.72 ± 0.44 4.35 ± 1.18 Albumin:GlobulinRatio 0.72 ± 0.12 0.68 ± 0.07 0.80 ± 0.25 Aspartate aminotransferase (u/l) 43.67 ± 3.33 42.67 ± 5.13 44.33 ± 3.83 Alanine aminotransferase (u/l) 32.50 ± 1.87 31.33 ± 3.56 32.00 ± 2.9 Alkaline phosphatase (u/l) 119.8 ± 8.66 115.33 ± 11.72 114.17 ± 5.64 Total bilirubin (mg/dl) 0.30 ± 0.19 0.23 ± 0.18 0.30 ± 0.13 Urea (mg/dl) 17.50 ± 0.94 17.58 ± 0.86 17.45 ± 1.08 Creatinine (mg/dl) 0.98 ± 0.18 0.95 ± 0.26 1.00 ± 0.34 Mean ± SD, n = 6 Group A: Control, Group B: 50% Bg, Group C: 100% Bg.

Discussion toxicity and phytochemical studies of The platelet counts for rats in groups B the stem bark aqueous extract of and C were significantly reduced as Musanga cecropioides in rats. compared with the rats in the control Journal of Ethnopharmacology, group (group A). All the other 105(3): 373-379. haematological parameters were within Aletor, V.A. and Aladetimi, O.O. (1989): the normal reference interval. Compositional evaluation of some Haematological parameters are useful cowpea varieties and some indicators of physiological responses of underutilized edible legumes in animals to the diet they are consuming Nigeria. Food/Nahrung, 33: 999- (Madubuike and Ekenyen2006). It can 1007. also be used to determine the extent of Asante, I. K., Offei, S. K., Addy, R. and deleterious effect of foreign compounds, Carson, A. G. (2008): Phenotypic and including plant extracts, on the blood of seed protein analysis in 31 lima bean rats (Adeneye et al., 2006; Odeyemiet al., (Phaseolus lunatus) accessions in 2009). The serum chemistry values were Ghana. West African J. Appl. Ecol. all within the reference interval. 12:1-10. Haematological and serum parameters Bello-Pérez A., Luis, T., Sayago-Ayerdi, have been observed as good indicators of S., Chavez Murillo, C. Agama, E. and the physiological status of animals and To v a r, J . ( 2 0 0 7 ) : P r o x i m a l changes in their values are important in compostion and in vitro digestibility assessing the response of animals to of starch in Lima bean (Phaseolus various physiological situations (Khan lunatus) varieties. Journal of the and Zafar, 2005). The study concluded Science of Food and Agriculture. 87. that thehaematological and serum 2570 - 2575. 10.1002/jsfa.3005. chemistry showed that the consumption Coles, E.H. (1989): Veterinary Clinical of the Bambara groundnut had no adverse Pathology. (4th Edn., W.B. Saunders effects on the blood of the Wistar rats. Co., USA, 130-148. Duncan, J.R., Prasse, K.W. and Mahaffey, References E.A. (1994): Veterinary Laboratory Adeneye, A. A., Ajagbonna, O.P. and Medicine (Clinical Pathology). Iowa Bello, S.O. (2006): Preliminary State University Press, 112-129..

221 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Falaye, A. E., Omoike, A. and Orisasona, Odeyemi, O.O., Yakubu, M.T., Masika, O. (2014): Apparent digestibility P.J. and Afolayan, A.J. (2009): Coefficient of Differently Processed Toxicological evaluation of the Lima Bean (Phaseolus lunatus L.) for essential oil from Mentha longifolia L Clarias gariepinus juveniles. Journal Subsp. capensis leaves in rats. Journal of Fisheries and Aquatic Science. of Medical Food, 12(3): 669-674. pg.10. Ouedraogo, M., Ouedraogo, J. T., Gornall, A.G., Bardawill, C.J and David, Tignere, J. B., Balma, D., Dabire, C. M.M. (1949): Determination of serum B. and Konate, G. (2008): proteins by means of the biuret Characterisation and evaluation of reagent. Journal of Biological accessions of bambara groundnuts Chemistry, 177:751-755. (Vignasubterranea (L.) Verdcourt) Jain, N.C. (1986): Schalm's Veterinary from Burkina Faso. Science and Haematology 4th Ed. Lead and Nature, 5(2): 191-197. Febiger, Philadelphia, U.S.A. Schalm, O. W., Jain, N. C. and Carroll, E. Jendrassik, L. and Grof, P. (1938): J. (1975): Veterinary Haematology Method for determination of (3rd Ed., pp.15, 218). USA: Lea and Bilirubin. Biochemistry, 297:81. Fabiger, Philadelphia. Marine Pollution Bulletin, 40(2), 152-164. Khan, T. A. and Zafar, F. (2005): Soetan K.O., Ajani O. S., Akinsulie, O. C. Haematological study in response to a n d T i j a n i M . O . ( 2 0 1 8 ) : various doses of estrogen in broiler Spermatotoxicity and testicular production. Int. J. Poult. Sci., pathology in Wistarstrain rats fed 40(10):748-751. graded levels of pigeon pea diet. Karikari, S. K., Chaba, O. and Molosiwa, Nigerian Journal of Physiological B. (1999): Effects of intercropping Sciences, 33: 57-62. bambara groundnut on pearl millet, Talwar, G.P. and Srivastava, L.M. (2004): sorghum and maize in Botswana. Textbook of Biochemistry and Human Africa Crop Science Journal, 7(2), Biology. PHI Learning Pvt. Ltd. P. 143-152. 268. Khan, T. A. and Zafar, F. (2005): Zengeri, S. B. and Mupamba, J. (1995): Haematological study in response to P r e l i m i n a r y s t u d i e s o n t h e various doses of estrogen in broiler germinability and vigour of production. Int. J. Poult. Sci., Zimbabwean bambara groundnut 40(10):748-751. genotypes. In Heller J., F. Begeman, & Madubuike, F.N., and Ekenyen B.U., J. Mushonga (Eds.), bambara (2006): Haematology and serum groundnut Vigna subterranea (L.) biochemistry characteristics of broiler Verdc. Promoting the conservation chicks fed varying dietary levels of and use of underutilized and neglected Ipomoea asarifolia leaf meal. crops. 9. Proceedings of the workshop International Journal of Poultry on Conservation and Improvement of Science, 5: 9–12. b a m b a r a G r o u n d n u t ( Vi g n a McPherson, I.G. and Everad, D.W. subterranea (L.) Berdc.)(Harare, (1972): Serum Albumin estimation: Zimbabwe, 4- 16 November, 1995, Modification of the bromocresol IPK/IPGRI, p.93-97). Rome, Italy: green method. Clinical Chemistry International Plant Genetic Acta, 37: 117-121. Resources Institute.

222 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Medicinal Properties of Some Selected Underutilized Legumes

Soetan, K.O. Department of Veterinary Physiology and Biochemistry, University of Ibadan, Ibadan. [email protected] +234-08074437629

Abstract Underutilized legumes are non-conventional food legumes which reduce inadequacies of plant proteins as a result of ever increasing human and animal populations globally. Awareness on the nutritional benefits of underutilized legumes are increasing but literature is limited on the medicinal applications of underutilized legumes. This study highlighted the medicinal properties of some selected under-utilized legumes: African yam bean (Sphenostylis stenocarpa), Bambara groundnut (Vigna subterranea), Jack bean (Canavalia ensiformis), Lima bean (Phaseolus lunatus), Sword bean (Canavalia gladiata), Winged bean (Psophocarpus tetragonolobus) and Lablab beans (Lablab purpureus). Phytochemical analyses, in vitro antioxidant assays and other analyses were done using standard methods. Results showed the presence of different phytochemicals like anthraquinones, alkaloids, cardiac glycosides, flavonoids, saponins and tannins at various levels in the under-utilized legumes. Various medicinal properties of these selected underutilized legumes like antioxidants, anti-cancer, hepatoprotective, antimicrobial, pesticidal, and antidiabetic properties were discussed. It was concluded that these underutilized legumes, also called lesser-known legumes have great potentials as medicinal plants, which needs to be utilized as nutraceuticals for the benefits of humans and animals.

Keywords: Medicinal, Underutilized legumes, Nutraceuticals, Human, Animals. Introduction Winged bean (Psophocarpus Lima bean (Phaseolus lunatus) is of the tetragonolobus), has great potentials as family Leguminosae and it is mostly food source for the tropics (Amoo et al., cultivated in South America (Yellavila et 2006). Several parts of the plant: leaves, al., 2015). The other names for lima beans pods, seeds and tubers: are edible and rich are pallar beans, Burma beans, sugar in protein, which makes it unique among beans, butter beans, civet beans, haba leguminous crops (Amoo et al., 2006). beans, Madagascar beans, Guffin beans, Jack bean (Canavalia ensiformis) hibbert beans and sieva beans (Yellavila is a tropical dry beans which is widely et al., 2015). distributed in Africa, Asia, the West Bambara groundnut [Voandzeia subterranean (L) Thouars] originated Indies, Latin America and India (Marimuthu and Gurumoorthi, 2013). from Africa and is used locally as a -1 vegetable (Ayo et al., 2014). The other Raw Jack bean seed has about 300 g kg names for Bambara groundnut in Nigeria protein and 600 g kg-1 carbohydrates are'Epakuta' (Yoruba tribe), 'Okpa' (Ibo (Marimuthu and Gurumoorthi, 2013). tribe), 'Gurjiya or Kwaruru' (Hausa tribe) Sword bean (Canavalia gladiata) and 'Kwam' (Geom, Plateau State).It can is of the Pea family: Fabaceae and it be consumed in different forms (either in originated either from southern Asia or mature or immature green stages) as a Africa (Adebowale et al., 2006). Sword vegetable and it can boost food bean is resilient to adverse climate availability and reduce malnutrition (Ayo et al., 2014). changes, and is thus desirable for

223 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 improving food and nutrition security in Test for saponins: 2 g of the powdered the tropics (Adebowale et al., 2006). sample was boiled in 20 ml of distilled African yam bean (Sphenostylis water in a water bath and then filtered. stenocarpa), is a legume of the tropical 10ml of the filtrate was mixed with 5 ml of and subtropical areas of the world (Obasi distilled water, shaken vigorously and et al., 2012). It has a high dietary fibre observed for a stable persistent froth. The content (Obasi et al., 2012). frothing was mixed with 3 drops of olive Lablab beans (Lablab pur- oil, shaken vigorously again, and then pureus). Lablab purpureus is one of the further observed for the formation of major leguminous forage and green emulsion which confirmed the presence manure crop in Africa (Cameron, 1988). of saponins. The wild forms of lablab are reported to have originated from India (Deka and Test for flavonoids: A portion of the Sarkar, 1990) and it was introduced into powdered plant sample was in each case Africa from southeast Asia during the heated with 10 mls of ethyl acetate over a 18th Century (Kay, 1979). Lablab bean is steam bath for 3 minutes. The mixture was presently common in Africa, extending filtered and 4 ml of the filtrate was shaken from Cameroon to Nigeria, Swaziland with 1 ml of dilute ammonia solution. A and Zimbabwe, through Sudan, Ethiopia, yellow colouration was observed indicating a positive test for the presence Uganda, Kenya and Tanzania (Skerman of flavonoids. et al., 1991). There are many publications on Test for phenols (Lead Acetate test): 1 ml the nutritional importance of these of alcoholic or aqueous extract was underutilized legumes but much still diluted to 5 ml with distilled water; a few needs to be done on the experimental and drops of 1% aqueous solution of lead awareness of their medicinal benefits. acetate were added. A yellow precipitate This paper therefore reports the medicinal was formed to indicate the presence of and pharmacological properties of phenols. selected underutilized and lesser-known legumes. Test for Alkaloids: 0.5g of the extract was stirred with 5ml of 1% aqueous HCl on a Materials and Methods steam bath and few drops of picric acid Phytochemical Screening solution was added to 2cm3 of the extract. Phytochemical analyses on the aqueous The formation of a reddish brown extracts of the powdered samples of precipitate was taken as a preliminary underutilized legumes were done using evidence for the presence of alkaloids. the methods of (Harborne, 1984; Trease and Evans, 1996; Sofowora, 1993). Test for Glycosides: To 1ml of the test solution, 2 drops of concentrated Test for tannins: 0.5 g of the dried sulphuric acid was added and placed in powdered samples was boiled in 20 ml of water bath for about 15 minutes. A few water in a test tube and then filtered. A drops of 20% KOH were added to make few drops of 0.1% ferric chloride was the solution alkaline. To this solution, few added and observed for brownish green or drops of concentrated FeCl2 were added. a blue-black colouration. The formation of a brick red precipitate

224 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 indicates the presence of glycosides. Phytochemicals can be incorporated into foods or food supplements as In Vitro Antioxidative Effects nutraceuticals. (van Rensburg et al., DPPH radical scavenging activity 2007). It has generally been reported that DPPH (2, 2-diphenyl -1- picrylhydrazyl) the health promoting effects of radical scavenging activity of the selected nutraceuticals and other functional foods underutilized legumes was estimated are likely due to the biochemical and according to the method of (Gyamfi et al., cellular interactions, which together 1999). promote the overall health of an individual (Dillard and German, 2000). Total phenolic content The presence of phytochemicals in seeds The total phenolic content of the selected suggest possible medicinal applications. underutilized legumes was determined by They are known to exhibit both medicinal spectrophotometric method (Kim et al., activities as well as physiological and 2003). pharmacological activities (AOAC, 2000). The pharmacological and other Total flavonoid content m e d i c i n a l p r o p e r t i e s o f p l a n t The total flavonoid content of the selected phytochemicals have been reviewed underutilized legumes was determined (Soetan, 2008; Kalu et al., 2019). using the method of Park et al. (1999). Phytochemistry is the investiga- tion of the different varieties of organic The reducing power substances produced by plants. It involves The reducing power of the selected studies on the biosynthesis of these underutilized legumes was determined substances, their metabolism, natural according to the method of Oyaizu distribution, biological functions and (1986). their chemical structures (Harborne, 1973). Total antioxidant capacity The total antioxidant capacity (TAC) of African yam bean (Sphenostylis the selected underutilized legumes was stenocarpa) determined by the method of Prieto et al. Phytochemical evaluationof the seeds of (1999). Sphenostylis stenocarpa (Hochst ex A.Rich.) Harms revealed the presence of Results flavonoids (tricin, apigenin, chrysoeriol Phytochemical Constituents of the and genisten), tannin and alkaloids Selected Underutilized Legumes (Nyananyo and Nyingifa, 2011). Phytochemicals are the natural chemical Alkaloids, saponins and flavonoids were compounds produced during the normal the phytochemical constituents of six metabolic processes of plants and they accessions of African yam bean, h a v e c h e m o p r e v e n t i v e a n d according to Soetan et al. (2018). chemotherapeutic properties in cell lines and animal models of cancer (Okigbo et Bambara groundnut (Vigna subterranea) al., 2009; Bathaie et al, 2014). The Mbagwu et al. (2011) reported the antioxidant effects of plants have been presence of flavonoids, saponin and attributed to their rich phytochemical alkaloids in the seeds of Vigna constituents (Ramachandranet al, 2014). subterranean. According to Soetan et al.

225 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

(2019), saponins, tannins, flavonoids, al., 1986) phaseolin, (Moraes et al., 2000) steroids, alkaloids and terpenoids were phaseollidin, (O'Neill et al., 1986) phytic the phytochemicals present in Bambara acid, (Adeparusi, 2001) psoralidin, groundnut. (O'Neill et al., 1986) robinin, (Onyilagha Jack bean (Canavalia ensiformis) and Islam, 2009), saponins, sapogenol Canavalia ensiformisis reported to and sojasapogenol, tannins and á- contain phytochemicals like trypsin galactosidase (Oboh et al., 1998). inhibitor, lectins and canavanine (Makkar Saponins, flavonoids and alkaloids were et al., 2007). Eke et al., 2007 reported the the detected phytochemicals in lima beans presence of phytochemicals like (Soetan et al., 2019). (protease inhibitors, lectins, saponins and tannins in Canavalia ensiformis. Winged bean (Psophocarpus tetragono- Canavalmine and homospermidine are lobus) also present in Canavalia ensiformis Flavonoids, phenolics and tannins were (Fujihara et al., 1986). Saponins, tannins, the reported phytochemicals in flavonoids, steroids and alkaloids were Psophocarpus tetragonolobus (Ruma, the phytochemicals present in jack bean 2016). Saponins, flavonoids, tannins, (Soetan and Antia, 2018). alkaloids, terpenoids and steroids, were the phytochemicals present in winged Sword bean (Canavalia gladiata) bean (Olaiya et al., 2018). Phytochemical constituents of Canavalia gladiata are gibberellin (Yokota and Lablab beans (Lablab purpureus) Takahashi, 1981), canavalmine (Fujihara Phytochemical analysis of the fresh leaf et al., 1986), homospermidine (Fujihara extracts of Dolichos lablab showed that it et al., 1986), glucose/mannose/ contains sugar, alcohols, phenols, rhamnose-specific lectin (Wong and Ng, steroids, essential oils, alkaloids, tannins, 2005). Canavalia gladiata contains flavonoids, saponins, coumarins, alkaloids and globulins, canavalin, terpenoids , pigments, glycosides and concanavalin A and B (Chopra and Nayar, anthnanoids and many other metabolites 1982).Saponins, tannins, flavonoids, (Torres and Manalo, 1990; Deoda et al., terpenoids, steroids and alkaloids were 2012; Balekari, 2013). Phytochemicals the phytochemicals present in sword bean investigation of the raw and aqueous (Soetan and Antia, 2018). crude extracts of three varieties of Lablab purpureus seeds (Rongai brown, Rongai Lima bean (Phaseolus lunatus) white and Highworth black) showed the The reported phytochemical constituents p r e s e n c e o f t r y p s i n i n h i b i t o r, of Phaseolus lunatus are coumestrol heamagglutinin, cyanogenic glycosides, (O'Neill et al., 1986), cyanidin, oxalates, phytates, tannins and saponins (Onyilagha and Islam, 2009), cyanogenic (Soetan, 2012). glycosides, (Akande et al., 2010) cytokinin, (Mok et al., 1982), kievitol, Medicinal Applications of Selected kievitone, cyclokievitone, (O'Neill et al., Underutilized Legumes 1986), lectins, (Roberts et al., 1982) African yam bean (Sphenostylis linamarin, (Frehner and Conn, (1987), stenocarpa) lunatone, (O'Neill et al., 1986) lunatusin, The seeds of the African yam bean (Wong and Ng, 2005) luteone, (O'Neill et (AYB) (Sphenostylis stenocarpa) have

226 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 been reported to be used traditionally in are sometimes used as an aphrodisiac the management of diabetes mellitusand (Protabase, 2019). The plant is also used this was experimentally reported (Ubaka in the treatment of veneral diseases. Vigna and Ukwe, 2010). Pastes from AYB seeds subterranean has been applied to treat are usedto cure stomach aches and as a some malignancies and inflammatory remedy for acute drunkenness when disorders in Africa (Lim, 2012). The mixed with water (Asuzu, 1986; Klu et medicinal benefits of Bambara groundnut al., 2001). Omitogun et al., (1999) are due to the presence of some nutrients reported that the lectins in the seed of inherent in them. It provides relief from AYB could be biologically exploited as general debility, malnutrition, weakness, an effective insecticide against pests of prolonged or heavy menstruation, legumes. Ajibola et al., (2011) reported insomnia, irritable bowel syndrome and the potential use of protein hydroxylate of diarrhea (Ayurtimes, 2019). Bambara AYB and its membrane fractions as groundnut also enhances red blood cell antioxidants, for the management of production, and as such, it is good for oxidative stress-related metabolic anaemic patients (Ayurtimes, 2019). disorders and also in food products for the prevention of lipid oxidation. AYB has Jack bean (Canavalia ensiformis) been reported to exhibit numerous The heat-treated seeds and pods of antioxidant activities (Ajibola et al., Canavalia ensiformis have medicinal 2011; Okonkwo et al., 2013; Ojiako et al., applications, and the chemical 2016; Soetan et al., 2018) and non- hapatotoxic properties (Okonkwo et al., constituents of the jack bean might be 2013). Okonkwo et al, (2013) reported used for medicinal purposes or for control the hepatoprotective properties of of pests (Perry, 1980; Chee et al., 2016). Sphenostylis stenocarpa seeds against The seeds of Canavalia ensiformis have liver damage caused by CCl4 in rats. antihypercholesterolaemic effects (Mafro Okonkwo et al., (2013) also reported the et al., 1990), hypoglycaemic activities anti-anaemic effect of methanol seed (Enyikwola et al., 1991) and antidiabetic extract of Sphenostylis stenocarpa properties (Malviya et al., 2010).Oral (African yam bean) in Wistar strain rats.It administration of aqueous extract of C. is useful in the management of chronic ensiformis seeds are reported to reduce d i s e a s e s l i k e h y p e r t e n s i o n , blood and urinary glucose levels (Rachel, cardiovascular diseases and diabetes 2003). Aqueous extracts of the jack bean (Obasi et al., 2012). AYB extracts exhibited in vitro antioxidative effects exhibited high in vitro antioxidant (Soetan and Antia, 2018). activities.The AYB extracts showed hightotal phenolics and high total flavonoid contents(Soetan et al. 2018). Sword bean (Canavalia gladiata) Sword bean has the potential to be used in Bambara groundnut (Vigna subterranea) numerous other ways including Leaf preparations of Vigna subterranea nutraceuticals, phytopharmaceuticals, are used as a poultice for infected wounds and other agricultural products (Morris, and abscesses and the leaf sap is used to 2007). Flavonoids such as rutin identified treat epilepsy by ocular application in swordbean seeds may decrease (Protabase, 2019). Pounded seeds of precancerous lesions in the large intestine Vigna subterranea, when mixed with while the phytochemical, beta- water are used to treat cataracts. The roots aminopropionitrile inhibits breast

227 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 adenocarcinoma growth. Canatoxin, the protozoan parasite (Moore et al., 2001). potential pesticide from swordbean seeds Stigmasterol is a steroid found in showed toxicity to the cotton pest, winged bean (ILDIS, 1994) and is used Dysdercus peruvianus (Morris, 2007). for hypercholesterolaemic patients as an Canavalia gladiata root extract protects adjunctive therapy (Nigon et al., 2001). the liver from severe damage caused by Winged bean has beta-sitosterol D-Galactosamine and it could also serve (ILDIS, 1994), a steroid with good as a useful adjuvant in several clinical potential in the treatment of benign conditions associated with liver damage prostatic hyperplasia (Klippel et al., (Prabhakaran and Ranganayakulu, 2014). 1997) and also in the lowering of low Aqueous extracts of the sword bean density lipoprotein cholesterol levels showed in vitro antioxidative effects (Becker et al., 1993). Winged bean (Soetan and Antia, 2018). contains quercetin, a flavonoid useful for the treatment of chronic, nonbacterial Lima bean (Phaseolus lunatus) prostatitis (Shoskes et al., 1999). Different extracts of Phaseolus lunatus Delphinidin, another flavonoid in winged exhibited diverse medicinal benefits like bean (ILDIS, 1994), contributes to the antidiabetic (Johnson et al., 2013), antioxidant activity of pomegranate fruits hypocholesterolaemic (Oboh and (Noda et al., 2002). Isovitexin, a Omofoma, 2008), antifungal and flavonoid in winged bean has antiproliferative properties (Wang et al., antimicrobial and antifungal activities 2009), cysteine proteinase inhibition (Agnese et al., 2001). Winged beancould (Lawrence and Nielsen, 2001) and trypsin serve as a good source of dietary and chymotrypsin inhibition (Haynes and antioxidants and as free radical Feeney, 1967). scavengers in man and animals Olaiya et al., 2018). Winged bean (Psophocarpus tetragono- Lablab beans (Lablab purpureus) lobus) Fruits of Lablab purpureus have Leaves and seeds of Psophocarpus been reported to have antihyperglycaemic tetragonolobus are consumed to treat and antinociceptive activities and is boils and ulcers (Perry, 1980). The extract suggested to be good at lowering blood of Psophocarpus tetragonolobus is a sugar in diabetic patients and for potential source for novel antimicrobial alleviating pain (Ahmed et al., compounds (Latha et al., 2007).Winged 2015).Lablab purpureus phytochemicals bean lectin is applied as a marker of is a potential source of nutraceuticals and human muscle capillaries (Kirkeby et al., pharmaceuticals(Morris, 2009). 1997). Psophocarpus tetragonolobus Lablab purpureus's lectin-like possess some reported therapeutic protein, alpha-amylase inhibitor has activities like antioxidant, anti- antifungal effect against Aspergillus inflammatory, analgesic, antiulcer, flavus (Fakhoury and Woloshuk, 2001). antidiabetic, cytotoxic and and anti- The lectin extracts of Lablab purpureus nociceptive activities (Lee et al., 2011; also exhibited pesticidal effects against Dhanya, 2018). Agmatine, an alkaloid in cowpea pests (Omitogun et al., 1999). the seedlings of winged bean (ILDIS, Lablab beans has vicilins, alpha amylase 1994) has inhibitory effect against inhibitors and lectins which confer activities of Cryptosporidium parvum, a resistance against Callosobruchus

228 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 maculatus Fabricius (Ignacimuthu et al., phytochemicals and have various 2000). medicinal applications. These medicinal properties should be exploited for the Lablab purpureus is reported to benefit of human and animals. More possessantidiabetic,(Singh and Sankar, research is needed to investigate the other 2012; Ahmed et al., 2015), anti- inherent medicinalproperties of inflammatory (Habib et al., 2012), underutilized legumes. analgesic (Habib et al., 2012), antioxidant (Habib et al., 2012, Maheshu References et al., 2013), cytotoxic (Habib et al., Adebowale, K. O., Afolabi, T. A. and Olu- 2012; Nasrin et al., 2012), hypolipidemic Owolabi, B. I. (2006): Functional, (Ramakrishna et al., 2007), antimicrobial physicochemical and retrogradation (Priya and Jenifer, 2014), insecticidal p r o p e r t i e s o f s w o r d b e a n (Janarthanan et al., 2012;Janarthanan et (Canavaliagladiata) al., 2008), hepatoprotective (Im et al., acetylated and oxidized starches. 2016), antilithiatic (Deoda et al., 2012), Carbohydrate Polymers, 65: 93-101. antispasmodic (Soni et al., 2006) effects Adeparusi, E. (2001): Effect of and it is also used for the treatment of iron processing on the nutrients and deficiency anemia (Somulung et al., antinutrients of lima bean (Phaseolus 2012). lunatus L.) flour. Food/Nahrung, Lablab beans contains kievitone 45(2): 94-6. and flavonoid with potential applications Agnese, A.M., Perez, C. and Cabrera, J.L. as phytopharmaceuticals (ILDIS, 1994). (2001): Adesmia aegiceral: Kievitone has potential usefulness in the antimicrobial activity and chemical treatment of breast cancer (Hoffman, study. Phytomedicine 8: 389-394. 1995) and the flavonoid, genistein is Ahmed, M., Trisha, U.K., Shaha, S.R., important in the prevention of Dey, A.K. and Rahmatullah, M. carcinogenesis (Kobayashi et al., 2002). (2015): An initial report on the It is also applied as a chemopreventive a n t i h y p e r g l y c e m i c a n d and/or chemotherapeutic agent for neck and head cancer (Alhasan et al., 2001). antinociceptive potential of Lablab Myo-inositol, the useful purpureus beans. World Journal of carbohydrate in lablab beans, has been Pharmacy and Pharmaceutical applied in the treatment of panic disorders Sciences 4(10): 95-105. (Benjamin et al., 1995). Lablab beans Ajibola, C., Fashakin, J.B., Fagbemi, T.N. contain high levels of amino acids and Aluko, R.E. (2011): Effect of tyrosine and leucine (Morris, 2003). peptide size on antioxidant properties Tyrosine is used for the treatment of o f A f r i c a n y a m b e a n s e e d phenylketonuria (van Spronsen et al., (Sphenostylis stenocarpa) protein 2001) and also improves alertness (Neri hydrolysate fractions. Int. J. Mol. Sci. et al., 1995). Leucine plays important role 12:6685–702. in the management of latent hepatic Akande, K.E., Doma, U.D., Agu, H.O. encephalopathy (Plauth et al., 1993). and Adamu, H.M. (2010): Major antinutrients found in plant protein Conclusion sources: their effect on nutrition. These studies and review show that the Pakistan Journal of Nutrition, 9(8): selected underutilized legumes are rich in 827-832.

229 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Alhasan, S.A., Aranha, O. and Sarkar, Dolichos Lablab seed extract on F.H. (2001): Genistein elicits streptozotocin - nicotinamide induced pleiotropic molecular effects on head d i a b e t i c r a t s . I n t e r n a t i o n a l and neck cancer cells. Clinical Conference and Exhibition on Cancer Research 7: 4174-4181. Pharmacognosy, Phytochemistry and Amoo, I. A., Adebayo, O. T. and Oyeleye, Natural Products, Hyderabad-India, A. O. (2006): Chemical evaluation of 21-23 October, 2013. winged beans (Psophocarpus Benjamin, J., Levine. J. and Fux, M. tetragonolobus), pitanga cherries (1995): Double-blind, placebo- (Eugenia uniflora) and orchid fruit controlled, crossover trial of inositol (orchid fruit myristica). African treatment for panic disorder. Journal of Food, Agriculture, American Journal of Psychiatry 152: Nutrition and Development, 6(2): 1- 1084-1086. 12. Cameron, D.G. (1988): Tropical and Association of Official Analytical subtropical pasture legumes Chemists (AOAC) (2000): ''Official Queensland Agricultural J Method of Analysis'' 16th Edition Chee, Y.K., Hacker, J.B., Ramirez, L. and (129-135), Washington D.C. U.S.A. Chen, C.P. (2016): Plant Resources of Asuzu, I.U. (1986): Pharmacological S o u t h - E a s t A s i a . C a n a v a l i a evaluation of the folklore use of ensiformis (L.) DC. Sphenostylis stenocarpa. Journal of Chopra, R.N., Nayar, S.L. and Chopra, Ethnopharmacology 16: 263-267. I.C. (1982): Glossary of In dian Ayo, J. A., Popoola, C. A., Ayo, V. A. and medicinal plants. New Delhi: Council Andrew, E. (2014): Effect of added of Scientific and Industrial Research. bambara groundnut flour on the Deka, R. K. and Sarkar, C. R. (1990): quality of 'acha' based 'fura'. British Nutrient composition and anti- Journal of Applied Science and nutritional factors of Dolichos lablab Technology, 4(1): 168-176. L seeds. Food Chemistry, 38: 239- Ayurtimes (2019): https://www. 246. Journal, March-April: pp. 110- ayurtimes..com/Bambara-groundnut. 113. Accessed 14/01/2019. Chee, Y.K., Hacker, J.B., Ramirez, L. and Chen, C.P. (2016): Plant Resources of Bathaie, S.Z., Bolhasani, A. and Tamanoi, South-East Asia. Canavalia F. (2014): Anticancer effect and ensiformis (L.) DC. molecular targets of saffron Chopra, R.N., Nayar, S.L. and Chopra, carotenoids. In: Bathaie SZ, Tamanoi I.C. (1982): Glossary of Indian F, editors. The enzymes: natural medicinal plants. New Delhi: Council products and cancer signaling: of Scientific and Industrial Research. isoprenoids, polyphenols and flavonoids. 36th ed. USA: Academic Deka, R. K. and Sarkar, C. R. (1990): Press; 2014; 57-86. Nutrient composition and anti- Becker, M., Staab, D. and Von Bergman, nutritional factors of Dolichos lablab K. (1993): Treatment of severe L seeds. Food Chemistry, 38: 239- familial hypercholesterolemia in 246. childhood with sitosterol and Deoda, R.S., Pandya, H., Patel, M., Yadav, sitostanol. Journal of Pediatrics 122: K.N., Kadam, P.V. and Patil, M.J. 292-296. (2012): Antilithiatic activity of leaves, Balekari, U. (2013): Antihyperglycemic bulb and stem of Nymphea odorata and antihyperlipidaemic activities of and Dolichos lablab Beans. Research

230 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Journal of Pharmaceutical, 10.1104/pp.82.3.795. Biological and Chemical Sciences, Habib, M.A.M., Hasan, R., Nayeem, J., 3(1): 814-819. Uddin, N. and Rana, S. (2012): Anti- Dhanya, R. (2018): A Review on inflammatory, antioxidant and Pharmacognostical, Phytochemical cytotoxic potential of methanolic and Pharmacological aspects of extract of two Bangladeshi bean Psophocarpus tetragonalobus. A Lablab purpureus L. sweet white and Review on Pharmacognostical, purple. International Journal of Phytochemical and Pharmacological a s p e c t s o f P s o p h o c a r p u s Pharmaceutical Sciences and tetragonalobus. Research Journal of Research; 3 (3): 776-781. P h a r m a c o g n o s y a n d Harborne, J.B. (1984): Phytochemical Phytochemistry. 10(4): 331-335. methods. A guide to modern Dillard, C.J. and German, J.B. (2000): techniques of plant analysis. Chapman Phytochemicals: nutraceuticals and and Hall, London., pp. 49-188. human health. A Review. Journal of Haynes, R. and Feeney, R.E. (1967): the Science of Food and Agriculture, Fractionation and properties of trypsin 80: 1744-1756. and chymotrypsin inhibitors from Eke, C.N.U., Asoegwu, S.N. and lima beans. Journal of Biological Nwandikom, G.I. (2007): “Physical Chemistry, 242(22): 5378-5385. Properties of Jackbean (Canavalia Hoffman, R. (1995): Potent inhibition of e n s i f o r m i s ) ” A g r i c u l t u r a l breast cancer cell lines by the Engineering International: the CIGR isoflavonoid kievitone: comparison E Journal Manuscript FP 07 014. IX. with genistein. Biochemical September, 2007. Enyikwola, O., Addy E.O. and Adoga, Biophysical Research Communica- G.I. (1991): Discov. Innovat. 3: 61. tion 211: 600-606. Fakhoury, A.M. and Woloshuk, C.P. Ignacimuthu, S., Janarthanan, S. and (2001): Inhibition of growth of Balachandran, B. (2000): Chemical Aspergillus flavus and fungal alpha- basis of resistance in pulses to amylases by a lectin-like protein from Callosobruchus maculatus (F.) Lablab purpureus. Molecular Plant (Coleoptera: Bruchidae). Journal of Microbe Interactions 14: 955-961. Stored Products Research 36: 89-99. Frehner, M. and Conn, E.E. (1987): The ILDIS (1994): Plants and their Linamarin â-Glucosidase in Costa constituents. Pages 1-748 in F.A. Rican Wild Lima beans (Phaseolus Busby et al., eds., Phytochemical lunatus L.) is apoplastic. Plant dictionary of the leguminosae. Physiology, 84(4): 1296-1300. Chapman and Hall, New York. Im, A.R., Kim, Y.H., Lee, H.W. and Song, Fujihara, S., Nakashima, T., Kurogochi, K.H. (2016): Water extract of Y. and Yamaguchi, M. (1986): Dolichos lablab attenuates hepatic Distribution and Metabolism of sym- lipid accumulation in a cellular Homospermidine and Canavalmine nonalcoholic fatty liver disease in the Sword Bean Canavalia model. J Med. Food 19(5): 495-503. gladiata cv Shironata. Plant Janarthanan, S., Sakthivelkumar, S., Physiology 82 (3): 795-800. DOI: Veeramani, V., Radhika, D. and

231 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Muthukrishanan, S. (2012): A new U s e s o f A f r i c a n y a m b e a n variant of antimetabolic protein, (Sphenostylis stenocarpa) in the Volta arcelin from an Indian bean, Lablab Region of Ghana. The Journal of purpureus (Linn.) and its effect on the Food Technology in Africa, 6:74-77. stored product pest, Callosobruchus Kobayashi, T., Nakata, T. and Kuzumaki, maculatus. Food Chem. 135(4): T. (2002): Effect of flavonoids on cell 2839-2844. cycle progression in prostate cancer Janarthanan, S., Suresh, P., Radke, G., cells. Cancer Letter 176: 17-23. Morgan, T.D. and Oppert, B. (2008): Latha, L.Y., Sasidharan, S., Zuraini, Z ., Arcelins from an Indian wild pulse, Suryani, S ., Shirley, L., Sangetha, S. Lablab purpureus, and insecticidal a n d D a v a s e l v i , M . ( 2 0 0 7 ) : activity in storage pests. J Agric. Food Antimicrobial activities and toxicity Chem. 56(5): 1676-1682. of crude extract of the Psophocarpus Johnson, O.R., Isaac, S.L., Michael, O.O., tetragonolobus pods. The African Oloruntoba, A.C. and Samuel, S. Journal of Traditional, Complemen- (2013): Biochemical evaluation of tary and Alternative Medicines, 4(1): Lima beans (Phaseolus lunatus) in 59-63. alloxan induced diabetic rats. ARPN Lim, T.K. (2012): Vigna subterranea. In: Journal of Agricultural and Edible Medicinal and Non-Medicinal Biological Science, 8: 302-309. Plants. Springer, Dordrecht. Kalu, E.C., Ikewuchi, C.C., Ayalogu, Lawrence, J.C. and Nielsen, S.S. (2001): E.O. and Nwauche, K.T. (2019): Partial isolation and characterization Proximate and Phytochemical Profile of a cysteine proteinase inhibitor from of Melanthera biflora Leaves. lima bean (Phaseolus lunatus). International Journal of Biochemistry Journal of Agricultural and Food Research and Review, 25(4): 1-12. Chemistry, 49(2): 1020-1025. Kay, D.E. (1979): Hyacinth bean-Food Lee, K.H., Padzil, A.M., Syahida, A., Legumes Crop and Product Digest Abdullah, N., Zuhainis, S.W. and No.3. Tropical Products Institute, 16: Maziah, M. (2011): Evaluation of 184-196. anti-inflammatory, antioxidant and Kirkeby., S., Singha, N.C. and Surolia, A. anti-nociceptive activities of six (1997): Localized agglutinin staining Malaysian medicinal plants. Journal in muscle capillaries from normal and of Medicinal Plants Research 5:5555- very old atrophic human muscle using 5563. winged bean (Psophocarpus tetragonolobus) lectin. Histo- Mafro, E.K., Wallace, P. and Timpo, G. chemical Cell Biology 107: 31-37. (1990): Anti-Diabetic potential of Klippel, K.F., Hiltl, D.M. and Schipp, B. medicinal plants. Pharmacology, 21: (1997): A multicentric, placebo- 753. controlled, double-blind clinical trial Maheshu, V., Priyadarsini, D.T. and of beta-sitosterol (phytosterol) for the Sasikumar, J.M. (2013): Effects of treatment of benign prostatic processing conditions on the stability hyperplasia. British Journal of of polyphenolic contents and Urology 80: 427-432. antioxidant capacity of Dolichos Klu, G.Y.P., Amoatey, H.M., Bansa, D., lablab L. J. Food Sci. Technol. Kumaga, F.K. (2001): Cultivation and 50(4):731-738.

232 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Makkar, H., Francis, G. and Becker, K. dium parvum infection in infant mice. (2007):Bioactivity of phytochemicals Journal of Parasitology 87: 211-213. in some lesser-known plants and their Morris, B. (2003): Bio-Functional effects and potential applications in Legumes with Nutraceutical, livestock and aquaculture production Pharmaceutical and Industrial uses. systems. Animal,1(9): 1371-1391. Economic Botany 57(2): 254-261. Doi:10.1017/S1751731107000298. Morris, J.B. (2007): Swordbean Malviya, N., Jain, S. and Malviya, S. (Canavalia ensiformis (L.) DC.) (2010): Antidiabetic potential of Genetic Resources Regenerated for medicinal plants. Acta Poloniae Potential Medical, Nutraceutical and Pharmaceutica - Drug Research, Agricultural Traits. Genetic 67(2): 113-118. Resources and Crop Evolution,54 (3): Marimuthu, M. and Gurumoorthi, P. 585-592. (2013): Physicochemical and Morris, J.B. (2009): Morphological and functional properties of starches from Reproductive Characterization in Indian Jack bean (Canavalia Hyacinth Bean, Lablab Purpureus ensiformis), an underutilized wild (L.) Sweet Germplasm with food legume. Journal of Chemical Clinically Proven Nutraceutical and and Pharmaceutical Research, 5(1): Pharmaceutical Traits for Use as a 221-225. Medicinal Food, Journal of Dietary Mbagwu F. N., Okafor V. U. and Supplements,6(3):263-279. Ekeanyanwu J. (2011): Phyto- Nasrin, F., Bulbu, I.J., Begum, Y. and chemical screening on four edible Khanum, S. (2012): In vitro legumes (Vigna subterranean, antimicrobial and cytotoxicity Glycine max, Arachis hypogea, and screening of n-hexane, chloroform Vigna uniguiculata) found in eastern and ethyl acetate extracts of Lablab Nigeria. African Journal of Plant purpureus (L.) leaves. Agric. Biol. J. Science, 5(6): 370-372. North Am. 3 (2): 43-48. Mok, M.C., Mok, D.W.S., Armstrong, Neri, D.F., Wiegmann, D. and Stanny, D.J., Shudo, K., Isogai, Y. and R.R. (1995): The effects of tyrosine Okamoto, T. (1982): Cytokinin on cognitive performance during activity of N-phenyl-N'-1, 2, 3- extended wakefulness. Aviation thiadiazol-5-ylurea (thidiazuron). Space and Environmental Medicine Phytochemistry, 21(7): 1509-1511. 66:313-319. Moraes, R.A., Sales, M.P., Pinto, M.S.P., Nigon, F., Serfaty-Lacrosniere, C., Silva, L.B., Oliveira, A.E.A, Beucler, I., Chauvois, D., Neveu, C. Machado, O.L.T., Fernandes, K.V.S. Giral., M., Chapman, M.J. and and Xavier-Filho, J. (2000): Lima Bruckert, E. (2001): Plant sterol- bean (Phaseolus lunatus) seed coat enriched margarine lowers plasma phaseolin is detrimental to the cowpea LDL in hyperlipidemic subjects with weevil (Callosobruchus maculatus). low cholesterol intake: effect of Brazilian Journal of Medical and fibrate treatment. Clinical Chemistry Biological Research, 33(2): 191-8. and Laboratory Medicine 39: 634- Moore, D., Waters, W.R., Wannemuehler, 640. M.J. and Harp, J.A. (2001): Treatment Noda, Y., Kaneyuki, T., Mori, A. and with agmatine inhibits Cryptospori- Packer, L. (2002): Antioxidant

233 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

activities of pomegranate fruit extract Omitogun, O.G., Jackai, L.E.N. and and its anthocyanidins: delphinidin, Thottappilly, G. (1999): Isolation of cyanidin, and pelargonidin. Journal insecticidal lectin-enriched extracts of Agriculture and Food Chemistry from African yam bean (Sphenostylis 50: 166-171. stenocarpa) and other legume Nyananyo, B. L. and Nyingifa, A. L. species. Entomologia Experimentalis (2011): Phytochemical investigation et Applicata 90:301-311. on the seed of Sphenostylis O'Neill, M. J., Adesanya, S. A., Roberts, stenocarpa (Hochst ex A. Rich.) M. F. and Pantry, I. R. (1986): Harms (Family Fabaceae). J. Appl. Inducible isoflavonoids from the lima Sci. Environ. Manage, 15 (3): 419- b e a n , P h a s e o l u s l u n a t u s . 423. Phytochemistry, 25(6): 1315-22. Obasi, N.E., Uchechukwu, N. and Eke- Onyilagha, J. C. and Islam, S. (2009): Obia, E. (2012): Production and Flavonoids and other polyphenols of evaluation of biscuits from African the cultivated species of the genus yam bean (Sphenostylis stenocarpa) Phaseolus. International Journal of and wheat (Triticum aestivum) flours. Agriculture and Biology, 11: 231-34. F o o d S c i e n c e a n d Q u a l i t y Perry, L.M., (1980): Medicinal plants of Management,7: 5-12. East and South-East Asia: Attributed Oboh, H.A., Muzquiz, M., Burbano, C., properties and uses. MIT Press, Cuadrado, C., Pedrosa, M.M., Ayet, Cambridge, Massachusetts, United G. and Osagie, A.U. (1998): Anti- States. pp. 209, 231. nutritional constituents of six Plauth, M., Egberts EH, Hamster W, et al. underutilized legumes grown in (1993): Long-term treatment of latent Nigeria. Journal of Chromatography, portosystemic encephalopathy with 823(1): 307-312. branched-chain amino acids. A Okigbo RN, Anugasi C.L. and Amadi, double-blind, placebo-controlled J.E. (2009): Advances in selected crossover study. Journal of medicinal and aromatic plants Hepatology 17: 308-314. indigenous to Africa. Journal of Prabhakaran, V. and Ranganayakulu, D. Medicinal Plants, Research. 2009; (2014): Hepatoprotective activity of 3(2): 86-95. canavalia gladiata root extract on d- Okonkwo, C. C., Njoku, O. U., Ikevude, galactosamine induced hepatic C. T. and Odo, C. E. (2013): damage. International Journal of Hepatoprotective effect of methanol Biological and Pharmaceutical seed extract of Sphenostylis Research. 5(2): 125-130. stenocarpa (Hoschst ex. A. Rich, Priya, S. and Jenifer, S. (2014): Harms) against carbon tetrachloride Antibacterial activity of leaf and induced liver toxicity in wistar rats. flower extract of Lablab purpureus /BioMedRx 1(3): 293-298. against clinical isolates of Olaiya, C.O., Soetan, K.O. and Karigidi, Staphylococcus aureus. Journal of K.O. (July 2018): Evaluation of in vitro Antioxidant Capacities of Six Drug Design and Discovery 1(3): 1-3. Accessions of Winged Beans Protabase, (2019): Plant Resources of (Psophocarpus tetragonolobus). EC Tropical Africa http://www.prota.org. Nutrition, 13(8): 589-595. Accessed 11/01/2019.

234 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Rachel, N. U. (2003): Biokemistri 15, 7. Antinutritional Factors in Plants- A Ramachandran, B., Kamaraj, M., Review. African Journal of S u b r a m a n i , V. a n d J e r o m e Biotechnology, 7(25): 4713-4721. Jeyakumar, J. (2014): Screening of Soetan, K.O. (2012): Comparative Phytochemistry and Secondary evaluation of phytochemicals in the Metabolites: A Case Study on raw and aqueous crude extracts from Nyctanthes arboritis. International seeds of three Lablab purpureus Journal of Pharma Research & varieties. African Journal of Plant Review, March 2014; 3(3):7-11. Science 6(15): 410-415. Ramakrishna, V., Rani, P.J. and Rao, P.R. Soetan, K.O., Olaiya, C.O. and Karigidi, (2007): Hypocholesterolemic effect K.O. (July 2018): Comparative in of diet supplemented with Indian vitro antioxidant activities of six bean (Dolichos lablab L. var accessions of African yam beans lignosus) seeds. Nutrition and Food (Sphenostylis stenocarpa L.). Annals. Science, 37(6): 452-456. Food Science and Technology, 19(3): Roberts, D.D., Etzler, M. and Goldstein, 455-461. I.J. (1982): Subunit heterogeneity in Soetan, K.O. and Antia, R.E. (July 2018): the lima bean lectin. Journal of Comparative Phytochemicals and In Biological Chemistry, 257(15): 9198- Vitro Antioxidative Effects of Jack 9204. Beans (Canavalia ensiformis) and Ruma, O.C. (2016): Phytochemical Sword Beans (Canavalia gladiata). screening of selected indigenous A n n a l s . F o o d S c i e n c e a n d edible plants from the towns of Technology, 19(3): 499-505. Isabela, Philippines. Asian Journal of Sofowora, A. (1993): Phytochemical Natural and Applied Sciences Vol. screening of medicinal plants and 5(1) March 2016. traditional medicine in Africa. 2nd Shoskes, D. A., Zeitlin, S. I., Shahed, A. Edition Spectrum Books Limited, and Rajfer, J. (1999): Quercetin in Nigeria, pp. 150-156. men with category III chronic Somulung, S.A., Lucero, M.A., Niverca, prostatitis: a preliminary prospective, M.S., Dalin, K.A., Dejesus, R. and double-blind, placebo-controlled Domingo, E.D. (2012): In vivo study trial. Urology 54:960–963 on the effect of Dolichos lablab Singh, R. and Sankar, C. (2012): (bataw) beans extract against Iron- Screening for anti-diabetic activity of deficiency in Rattus norvergicus the ethanolic extract of Dolichos (Wistar rat). Fatima University lablab leaves. Ph. Tech. Med. 1(5): Research Journal, 4:112-115. 177-180. Soni, K.K., Uikey. J. and Saxena, R.C. Skerman, P.J., Cameron, D.G. and (2006): Smooth muscles relaxant Riveros, F. (1991): Leguminosas activity of herbal drug isolated from forrajeras tropicales. Coleccion; Dolichos lablab. Research Hunt, FAO: Production, Protection Vegetal, 1(1):60-64. No. 2. Organizacion de las Naciones Torres, R.C. and Manalo, .J.B. (1990): Unidas para la Agricultura Phytochemical investigation of Alimentacion, Roma pp. 40: 61. Dolichos lablab L. by thin layer Soetan, K.O. (2008): Pharmacological chromatography. Philipp. Tech. and other Beneficial effects of Journal, 15(1): 41-50.

235 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

antiproliferative potency. Applied Trease G.E. and Evans W.C. (1996): Microbiology and Biote hnology, Pharmacognosy. Macmillian Publishers, London. 82(1): 79-86. Ubaka, C.M. and Ukwe, C.V. (2010): Wong, J.H. and Ng, T.B. (2005): Isolation Antidiabetic effect of the methanolic a n d c h a r a c t e r i z a t i o n o f a seed extract of Sphenostylis glucose/mannose/rhamnose-specific stenocarpa (Hoechst ex. A. Rich. lectin from the knife bean Canavalia Harms) in rats. Journal of Pharmacy gladiata. Archives of Biochemistry Research, 3(9): 2192-2194. and Biophysics, 439(1): 91-98. Van Rensburg, J., W.S., van Averbeke, Yellavila, S. B., Agbenorhevi, J. K., W., Slabbert, R., Faber, M., van Asibuo, J. Y., and Sampson, G. O. Jaarsveld, P., van Heerden, I., (2015): Proximate composition, Wenhold, F., and Oelofse, A. (2007): minerals content and functional African leafy vegetables in South properties of five lima bean Africa. Water SA, 33, 317-326. accessions. Journal of Food Van Spronsen, F.J., van Rijn, M. and Security,3(3): 69-74. Bekhof, J. (2001): Phenylketonuria: Yokota, T. and Takahashi, N. (1981): tyrosine supplementation in Gibberellin A59: A New Gibberellin phenylalanine-restricted diets. from Canavalia gladiata. Takao American Journal of Clinical Yokota and Nobutaka Takahashi Nutrition 73: 153-157. (1981) Gibberellin A59: A New Wang, S., Rao, P. and Ye, X. (2009): Gibberellin from Canavalia gladiata, Isolation and biochemical characteri- Agricultural and Biological zation of a novel leguminous defense Chemistry, 45:5, 1251-1254. DOI: peptide with antifungal and 10.1080/00021369.1981.10864661.

236 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Crop physiology Varietal response of pigeon pea (Cajanus cajan (l.) millsp.) to compost application

1 &2Ogunjinmi, S. O. 2Adejumo, S.A, 3 Adediran, J.A, 2Togun, A.O and 4Olunloyo,A.A. 1Department of Crop Production Technology, Oyo State College of Agriculture and Technology, P. M. B. 10, Igboora, Nigeria. 2Department of Crop Protection and Environmental Biology, University of Ibadan, Nigeria. 3Land and Water Programme,Institute of Agriculture Research and Training, Ibadan Nigeria 4Department of Agricultural Technology, Federal College of Forestry, Ibadan Nigeria. Corresponding Author: [email protected]

Abstract The study was carried out at the Screen house of the Institute of Agriculture Research and Training (I.A.R&T), Ibadan to evaluate the effects of different levels of compost fertilizer on the growth and yield on three varieties of pigeon pea. (A) NSWCC 24 (B) NSWCC 29A (c) NSWCC 34D Compost (Poultry manure + Mexican Sun flower) was applied in 0 tha-1, 5 tha-1, 10 tha-1and 15 tha-1. Growth data were collected on days to flowering, 50% and 100 % flowering, plant height, Stem height, Number of leaves and stem diameter., While yield parameters were collected on pod length, number of seeds pod-1, pod weight, grain yield kg ha-1, 100 seed mass (g) were sampled when the pods were matured. All data collected were subjected to analysis of variance using Genstat statistical package (2013) and treatment means separated using Least Significant Difference (LSD) at P=0.05. The result obtained showed the highest mean number of leaves was obtained in the compost 2 application on variety A having 272.33 leaves. From the result considering grain weight, seed weight harvested/plot, 100 seed weight, number of seeds/pod and days to flowering the sorting order results indicated that the best mean performance was obtained in compost 3 application on variety A. The application of the compost has significant effect on the three varieties and therefore can be recommended for cultivation of pigeon

Key word: Crop, Fertilizer Nutrient Soil fertility and yield pea. Introduction Legumes are nutritious foods The world population is growing at an which are a good substitute for animal astronomical rate and to feed this proteins (Adebowale and Maliki, 2011). population; agricultural productivity Dry beans, peas, soya beans, groundnuts, must also increase at the same rate. This chick peas, pigeon peas, lintels, mung however demands that we develop beans and cowpeas are among some of the different strategies and look inward in most consumed legume crops in the order to increase food production in the world. Legumes are regarded as face of different environmental important supplements of cereal-based challenges. One of the strategies being foods and cheap sources of proteins proposed is utilization of leguminous Ramakrisna et al., 2006; Pratap and crop species majority of which are Kumar, (2011). With very high protein underutilized or already going into content, legumes are of high importance extinction. Example is the pigeon pea in eliminating protein malnutrition. (Cajanus cajan) a leguminous crop that Pigeon pea Cajanus Cajan (L.) has been reported to be drought resistant Millsp. (Leguminosae) known as “fio fio” and of high yield. in Igbo, otiili in Yoruba and pigeon pea in

237 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

English (Aiyeloja and Bello, 2006). It is through symbiotic association between native to India which is the world's largest the root nodules and a species of bacteria, producer. It is also grown in Africa and the Rhizobia Kwame, (2003). Americas, and has been suggested to be Pigeon pea production in Nigeria one of Africa's drought-tolerant crops is very important considering its referred to as 'orphan crop' because it falls economic importance and ability to enrich into the group of least researched crops the fertility status of the soil. In addition, world-wide (Odeny, 2007). It is one of the most soils on which the farmers grow their most common tropical and subtropical crop are low in fertility, to this end; legumes cultivated for its edible seeds. increase in production of Pigeon pea Pigeon pea is fast growing, hardy, widely could be achieved through fertilizers adaptable, and drought resistant Bekele- application. It is expected that the use of Tessema, (2007). Because of its drought different organic amendments which will resistance it can be considered of utmost increase the growth and yield of pigeon importance for food security in areas pea will in turn encourage the production where rainfall is not reliable and droughts of pigeon pea and enhance food security. are likely to occur (Crop Trust, (2014). At Soil fertility maintenance is very the end of the dry season, pigeon pea essential in achieving and maintaining provides green forage of outstanding high crop yields over a period of time. value when other forages are not available There is need to apply fertilizers to Sloan et al., (2009). maintain soil fertility. Fertilizer is an Pigeon pea (Cajanus cajan (L.) important input that contributes to crop Millsp.) is an important food legume in production. It increases the productivity Nigeria. The crop is predominantly grown of the soil for plant growth and improves in the guinea savannah agro ecological the quantity and quality of produce. zone usually in mixture with cassava, Fertilizer can either be organic or maize, yam, and sorghum Egbe and Kalu, inorganic. Before the introduction of (2006). It is an important component of inorganic fertilizers, organic fertilizers, traditional farming systems with its particularly animal manures, crop fodder having forage potential for residues, green manure and composts, domestic livestock during the critical dry were practically the only source of months of December to May. The seeds nutrients for crop production and pods are consumed in many Compost use is one of the most households as vegetable and also used as important factors, which contribute to flour additives in soups and rice. It is an increased productivity and sustainable excellent food and protein source in agriculture. In addition, compost can developing tropical countries (CNCPP, solve the problem faced on farmers with (2002); Kwame, (2003). The crop is a decreasing fertility of their soil. Due to multi-purpose leguminous crop that plays soil fertility problems, crops returns often important role in food security, decrease and the crops are more maintenance of soil fertility through litter susceptible to pest and disease because fall and nitrogen fixation, provision of they are in bad condition Madeleine et al fodder for livestock and fuel for small- (2005), Compost consists of the relatively scale farmers in subsistence-agriculture stable decomposed organic materials Egbe and Kalu, (2006). The crop has resulting from the accelerated biological ability to fix 41 to 250 kg ha-1 of nitrogen degradation of organic materials under 238 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 controlled, aerobic conditions Paulin and rate and control and replicated four times Peter, (2008). resulting to a total of forty eight (48) Aim of this investigation is to polythene bag. The compost applications evaluate the effects of different levels of are in 0 tha-1, 5 tha-1, 10 tha-1and 15 tha-1. compost fertilizer on the growth and yield Growth data were collected at on three varieties of pigeon pea. vegetative stage (pre flowering/flowering and post – anthesis on flowering stage: Materials and Methods days to flowering was collected when the The study was carried out at the Screen plants attained 50% and 100 % flowering, house of the Institute of Agriculture while plant height, Plant height, Stem Research and Training (I.A.R&T), height, Number of leaves and stem Ibadan, located on Derived Savannah diameter., While yield parameters were Latitude 07o 221 29.711”N and Longitude collected on pod length, number of seeds E0030 501.18.211”E altitude 195m above pod-1, pod weight, grain yield kg ha-1, sea level) Soil samples were collected at 100 seed mass (g) were sampled when the 0-30cm depth from the experimental field pods were matured, (Teaching Research stations of the All data collected were subjected to Institute of Agriculture Research and analysis of variance using Genstat Training (I.A.R&T) at Ibadan, The soils statistical package (2013) and treatment were air dried and sieved with 2mm sieve, means separated using Least Significant the soil samples were properly mixed to Difference (LSD) at P=0.05. ensure homogeneity while Composite samples were selected for the physical Treatment code and chemical analyses in the laboratory Variety A = NSWCC 24 Planting operation Variety B = NSWCC 29A Three varieties of pigeon pea Variety C = NSWCC 34D were used (A) NSWCC 24 (B) NSWCC TACOMP1 = Treatment on Variety A 29A (c) NSWCC 34D and it was -1 a c q u i r e d f r o m G r a i n L e g u m e Compost at 5 t/ha Improvement Programme IAR&T TACOMP2 = Treatment on Variety A -1 Ibadan, 25kg of soil was filled into each Compost at 10 t/ha polythene bag with space at the top to TACOMP3 = Treatment on Variety A -1 make allowance for watering and the Compost at 15 t/ha polythene bag perforated at the bottom to TACONT = Treatment on Variety A enhance soil aeration and leaching of Control excess water. Compost (Poultry manure + TBCOMP1 = Treatment on Variety B -1 Mexican Sun flower) was mixed with the Compost at 5 t/ha soil in each polythene bag two weeks TBCOMP2 = Treatment on Variety B -1 before sowing the seeds. Two seeds of Compost at 10 t/ha Pigeon pea were sowed and thinned to TBCOMP3 = Treatment on Variety B -1 one plant per polythene bag after two Compost at 15 t/ha weeks TBCONT = Treatment on Variety B Factorial experiment fitted in to Control Complete Randomized Design which TCCOMP1 = Treatment on Variety C -1 involves three (3) varieties of pigeon pea, Compost at 5 t/ha Compost fertilizer, three (3) application TCCOMP2 = Treatment on Variety C

239 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 1: Physical and Chemical Analysis for Pre planting Soil and Dried Compost

PARAMETERS Soil Dried compost pH 6.21 Sand% 91.2 Silt % 4.2 Clay 4.6 ECEC 10.86 Base salt 98.9 Calcium Cmol/ kg 7.8 0.43 Magnesium Cmol/ kg 1.72 11.87 Potassium Cmol/ kg 0.42 6.8 Sodium Cmol/ kg 0.8 14.8 Acidity Cmol/kg 0.6 Manganese mg/g 91.9 16 Iron mg/g 20.9 9.73 Copper mg/g 3.25 75 Zinc mg/g 7.03 2.05 Total Nitrogen % 0.09 1.92 Total Organic Carbon % 1.25 16.7 Av. Phosphorus 8.17 7.84

Compost at 10 t/ha-1 TCCOMP3 = Treatment on Variety C Compost at 15 t/ha-1 TCCONT = Treatment on Variety C Control

Result and Discussion The pre planting soil physical and chemical analysis to estimate the Figure 1: Mean stem diameter (mm) of three varieties parameters showed that the soil pH is of pigeon pea as affected by compost application slightly acidic at 6.21 with a very high percentage of sand thereby the soil classification is sandy clay. The essential nutrient estimates are nitrogen (0.09%), phosphorus (8.17) and potassium (0.42 Cmol/kg). For the compost analysis the essential nutrients are nitrogen (1.92%), phosphorus (7.84) and potassium (6.82). The compost have higher values in the magnesium, potassium, sodium, total Figure 2: Mean stem height (cm) of three varieties of nitrogen and total organic carbon, thereby pigeon pea as affected by compost application the compost have the capability to improve the nutrient status of the soil and to supply required nutrient for pigeon pea crops.

240 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

application on variety A having 272.33 leaves.

Stem diameter The mean stem diameter of three varieties of pigeon pea as affected by compost application as shown in Figure 4 showed there was increase as the weeks progressed. At week 10 the lowest mean Figure 3: Mean number of leaves of three varieties of stem diameter was produced in variety C pigeon pea as affected by compost application with the application on compost 2 (12.67mm) while the highest mean stem diameter was recorded in variety C control having 15.67mm.

Leaf area The mean leaf area of three varieties of pigeon pea as affected by compost application as shown in Figure 3 showed there was no steady increase as the weeks Figure 4: Mean leaf area of three varieties of pigeon pea as affected by compost application progressed. the least mean was obtained variety C control having 29.89cm2 while the highest was recorded in variety B with Stem height compost 3 having 46.53 at week 10. The mean of stem height of three varieties of pigeon pea as affected by three levels of Yield components compost application is shown in Figure 1. The results on the yield components on The result obtained showed steady the three varieties of pigeon pea as progression of increase in the stem height. affected by compost application. the At week 10, the control variety A had the result obtained showed there were highest mean of 198.33cm, also the -1 significant response in the pod weight application of compost at 10 ton/ha 2 and /plant, pod length, grain weight, 100-seed 3 on variety B and C having 193.33cm weight and seed weight harvested/plot and 186.67cm respectively were also however there were no significant having high means of stem height. The response in the varieties to the compost least mean was recorded in compost1 application in number of seed/pod, days application on variety A and B having to flowering, days to 50% flowering, days 161.67cm and 154.33cm respectively. to 100% flowering and days to podding. from the result considering grain weight, Number of leaves seed weight harvested/plot, 100 seed The mean number of leaves of three weight, number of seeds/pod and days to varieties of pigeon pea as affected by flowering the sorting order results compost application as shown in Figure 2 showed there was increase as the weeks indicated that compost 1 on variety B and progressed. at weeks 10, the least mean compost 2 on the three varieties were number of leaves was recorded compost 2 sorted lower than the control application application on variety C having 160.33 on the three varieties while the best mean leaves while the highest mean number of performance was obtained in compost 3 leaves was obtained in the compost 2 application on variety A. 241 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 2: Mean of days to flowering, days to 50% flowering, days to 100% flowering and days to podding of three varieties of pigeon pea as affected by compost application

Variety treatments DAYs to Days to 50% Days to 100% DAYs OF FLOWERing flowering flowering PODDING A COMP1 130.00a 134.50a 145.00a 177.50a COMP2 133.50a 138.50a 145.00a 170.00a COMP3 125.00a 135.00a 148.00a 172.50a CONTROL 128.00a 138.50a 143.50a 172.50a B COMP1 128.00a 136.00a 156.50a 180.00a COMP2 121.50a 135.00a 150.00a 175.00a COMP3 132.00a 141.50a 150.00a 172.50a CONTROL 131.50a 140.00a 152.50a 173.00a C COMP1 141.00a 153.00a 160.50a 174.00a COMP2 140.50a 146.50a 155.00a 177.50a COMP3 138.00a 147.50a 155.00a 172.50a Mean CONTROL 124.00a 138.00a 154.50a 175.00a Means with the same letters are not significantly different at 5% level of probability.

Table 3: Mean of harvestable yield components of three varieties of pigeon pea as affected by compost application

var 100 seed pod weight pod length No of seed Grain Seed weight Trt weight per/plt per plant per pod weight per rep per/plant A COMP1 39.63 ab 5.93ab 4.13a 30.73ab 9.13cd 122.93ab COMP2 19.40 b 5.43b 4.00a 14.50c 9.97bcd 58.00c COMP3 40.13 ab 5.83ab 4.67a 33.33a 11.43ab 133.33a CONTL 18.93 b 4.93b 3.67a 16.60c 8.57d 66.40c B COMP1 26.53ab 5.53b 4.33a 12.53c 9.00cd 50.13c COMP2 32.17ab 5.23b 4.33a 13.83c 10.37abcd 55.33c COMP3 42.67ab 7.10a 4.67a 22.93abc 9.67bcd 91.73abc CONTL 25.20ab 4.63b 4.00a 16.70c 8.37d 66.80c C COMP1 46.07ab 5.03b 4.00a 20.73abc 12.47a 82.93abc COMP2 30.40ab 5.30b 4.67a 12.63c 8.27d 50.53c COMP3 58.93a 5.50b 4.33a 25.60abc 10.87abc 102.40abc CONTL 31.83ab 4.67b 4.00a 17.26bc 9.77bcd 69.07bc

Conclusion Reference From the investigation of the growth and Adebowale, O.J., and K. Maliki. 2011. yield response of three varieties of pigeon Effect of fermentation period on the pea to compost application. The chemical composition and functional application of the compost have properties of pigeon pea seed flour. significant effect on the three varieties International Research J. 18:1329- with the application of compost 1 and 3 1333 having better yield response can be Aiyeloja, A.A., Bello, O.A., 2006. Ethno recommended for cultivation. botanical potentials of common herbs

242 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

in Nigeria: A case study of Enugu Odeny,D.A. 2007. The potential of pigeon state. Educational Research and pea (Cajanus cajan (L.) Millsp.) in Review, 1: 16–22. Africa. Natural Resources Forum, 31 Bekele-Tessema, A., 2007. Profitable (2007), 297-305 agroforestry innovations for eastern Patrap, A., and J Kumar. 2011. Biology Africa: experience from 10 and breeding food legumes. CAB agroclimatic zones of Ethiopia, India, international. Kanpur. Kenya, Tanzania and Uganda. World Agroforestry Centre (ICRAF), Paulin B and Peter O`M. 2008. Compost Eastern Africa Region Production and Use in Horticulture. CNCCP, 2002. Centre for New Crops and Western Australian Agri. Authority, Plants Products. Cajanus cajan (L.) Bulletin 4746. [Online] Available: Millsp. Purdue www.agric.wa.gov.au (Nov. 2013 Crop Trust, 2014. Pigeon Pea: Food for Ramakrisna,V., P. Rani, and P.R. Roa. Drought. www.croptrust.org 2006. Anti-nutritional factors during Egbe, O.M, and B.A. Kalu 2006 Farming germination in Indian bean seeds system study: Participatory Rural World Dairy and Food Sciences J. Appraisal of Pigeon pea cropping 1:06-11. systems in Southern Guinea Savanna Sloan, J.; Heiholt, J.; Iyer, H.; Metz, S.; of Nigeria. J. of Environ. (Abia State Phatak, S.; Rao, S.; Ware, D., 2009. University Environmental Review). Pigeon pea: a multipurpose, drought 5(1): 37-47. Kwame, F.P. (2003). Correlation and Path resistant forage, grain and vegetable Coefficient analysis of yield and yield crop for sustainable southern farms. components in pigeon pea. Pakistan J. 2009 Annual Report, SARE Research Bio. Sci., 6(19): 1689- 1694 and Education Project.

243 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Incidence and Severity of Leaf Spot Disease of Mungbean (Vigna radiata) and the Associated Fungal Pathogens

Oduwaye O. F*. and Agbeleye O. A. 1Institute of Agricultural Research and Training, Obafemi Awolowo University, Moore Plantation, P. M. B.5029 Ibadan, Oyo State, Nigeria. *Corresponding author email address [email protected]

Abstract The incidence and severity of leaf spot disease were assessed in 20 accessions of Mungbean (Vigna radiata (L) R. Wilczek) cultivated at the Teaching and Research Farm of Institute of Agricultural Research and Training, Ibadan. The experiment was laid out in a randomized complete block design consisting of plots sprayed with insecticide (Lambda Cyalothrin (at 2.2kg a.i/ha)) and unsprayed plots, in three replicates. Leaf spot disease was observed on the field and the associated fungal pathogens were determined by inoculating the diseased leaf on potato dextrose agar. Disease incidence observed in sprayed plots was higher than (up to 100%) in unsprayed plots with the exception of three accessions (Tvr-27and Tvr-33 and Tvr-86). The severity of the diseases was moderate in about 90% of the accessions under both sprayed and unsprayed regimes. The exception in this trend was observed in Tvr-86 and Tvr-95 which showed high disease severity for both the sprayed and unsprayed plots. Four fungi were isolated from the diseased leaves namely; Macrophomina phaseolina, Alternaria alternata, Cercospora canescens and Rhizoctonia solani. However, pathogenicity test carried out suggests C. canescens as the causal pathogen of the leaf spot disease. Accessions with low fungal incidence (Tvr-27and Tvr-33 and Tvr-86) can be used as parental stock in breeding varieties tolerant to fungal diseases to harness the yield potentials of mungbean.

Keywords: Mungbean, Fungal disease, Variety development

Introduction traditional cure for paralysis, rheumatism, Mungbean (Vigna radiata (L) R. coughs, fevers and liver ailments Wilczek.), belongs to the family (Mogotsi, 2006). Split seeds are eaten l e g u m i n o s a e a n d s u b f a m i l y fried and salted as a snack. The seeds may Papilionaceae. It is a short duration, also be parched and ground into flour after herbaceous, annual, self-pollinated removing the seed coat; the flour is used in legume pulse crop. Mungbean is an various Indian and Chinese dishes. The excellent source of protein (24.5 percent) flour may be further processed into highly with a high lysine (460 mg/g N) and valued starch noodles, bread, biscuits, tryptophan (60mg/g N) content. It has a vegetable cheese and extract for the soap remarkable quantity of ascorbic acid industry (Nair et al. 2012). Sprouted when sprouted and also contains mungbean seeds are eaten raw or cooked riboflavin (0.21 mg/ 100 g) and minerals as a vegetable (Tan et al., 2014). The plant (3.84 g/100 g) (Sandhya et al., 2017). residues and cracked or weathered seeds Cereals, on the other hand, are rich in both are fed to livestock. Mungbean is these amino acids but deficient in lysine sometimes grown for fodder, green which is available in pulses (Gopalan et al manure or as a cover crop (Mogotsi, 1995). Consumption of Mungbean along 2006). with cereals provides a balanced amino Mungbean, like other legume acid profile and improves human crops, is susceptible to various diseases nutrition. Mungbean seeds are said to be a caused by fungi, bacteria and viruses.

244 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Fungal incidence causes more than 35- (PDA). Inoculated Petri dishes were 55% yield loss on Mungbean plant incubated at room temperature (24 ± 2oC). (Sandhya et al. 2017). Various leaf and Fungi which grew from the plant parts stem diseases have been reported, these were sub-cultured until pure cultures include powdery mildew, anthracnose, were obtained. The fungi were identified Cercospora leaf spot, Fusarium wilt, with the aid of colony and conidia Rhizoctonia root rot and web blight. characteristics following identification Given the importance of the crop, guides (Domsch et al. 1981; Barnett and emphasis needs to be given to the Hunter, 2010). management of its diseases. In view of Assessment of disease incidence these, this research is aimed at and severity: Each plot was observed for determining the incidence and severity of disease incidence and plants were scored leaf spot disease of mungbean and the for severity and disease development. associated fungal pathogens. Disease incidence: Disease incidence was determined as percentage of plants Materials and Methods showing symptoms, from the total plant Sources of material population sample per treatment in each Twenty genotypes of mungbean used in plot. this experiment were sourced from the i.e. Disease incidence = Genetic Resources Center, International no. of infected plants in the plot x 100 Institute of Tropical Agriculture (IITA), total no. of plant assessed in the plot Ibadan. The study was carried in 2018 at the Training and Research farm of the Disease severity: The rating for the Institute of Agricultural Research and disease is shown below as described by Training (IAR&T), Ibadan, which is Oladiran and Oso (1983) located in the rain forest transitional zone 0 - no disease symptoms of Southwest, Nigeria (Latitude 7.36220N 1- a few spots towards tip covering 10% 0 per cent leaf area Longitude 3.85 3E) and mean elevation 2 - several dark brown patches covering of 180 to 210 m above sea level. The up to 20% leaf area experiment was laid out in randomized 3 - several dark brown patches covering complete block design with three up to 40% leaf area replicates and two treatments. The 4 - leaf blight covering up to 75% leaf area treatments comprised of the control of or breaking of the leaf insects using Lambda cyalothrin at foliar 5 - complete drying of the leaves or and podding stages while the other breaking of the leaves from plant treatment consisted of unsprayed plots. Isolation and identification of fungi Pathogenicity test of the fungal isolates: Fungal species were isolated from Pathogenicity test was carried out by leaf diseased leaves of mungbean showing detachment method. Healthy leaves of characteristic symptoms of leaf spot freshly cut plants were surface-sterilized disease according to Burgdorf et al. with 95% ethanol. Each leaf was (2014). Cut out portions of the infected incubated individually in sterile plastic leaves were surface-sterilized (1% box, with an addition of sterilized tissue NaOCl for 5 minutes then rinsed in five paper moistened with sterilized water. changes of sterile distilled water) and Disc containing mycelia from the actively inoculated on potato dextrose agar 245 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 growing edge were cut using a sterile cork Table 1: Incidence and severity of leaf spot diseases of mungbean borer and placed on a subset of healthy wounded and unwounded detached Genotype % Incidence Severity mungbean leaves. The inoculated plates Sprayed Unsprayed Sprayed Unsprayed were incubated for 2 weeks. Necrotic MB1 74.07ab 72.22abc 2 2 bc bc lesion was observed and re-inoculated to MB2 48.15 44.44 2 2 MB3 66.67abc 83.33ab 2 2 confirm the suspected causal pathogen(s). MB4 114.81a 77.78ab 2 2 Data was collected on disease incidence MB5 62.96abc 50.00bc 2 2 and severity. MB6 66.67abc 94.44abc 2 2 Data Analysis MB7 59.26abc 100.00ab 2 2 Data generated on disease incidence was MB8 44.44bc 61.11abc 2 2 subjected to analysis of variance to MB9 92.59ab 38.89bc 4 2 MB10 74.07ab 77.78ab 3 2 determine the effects of genotypes on ab bc disease incidence. Means were separated MB11 77.78 50.00 2 3 MB12 85.19ab 66.67abc 2 2 with Duncan's multiple range test MB13 100.00ab 66.67abc 4 2 (DMRT). MB14 96.30ab 11.11c 3 3 MB15 85.19ab 100.00ab 2 2 Results MB16 55.56abc 88.89ab 4 2 This research was carried out to find out MB17 77.78ab 83.33ab 3 2 the level of leaf spot disease incidence MB18 81.48ab 55.56abc 2 2 and severity on mungbean and the MB19 70.37abc 72.22abc 2 2 ab bc associated fungal pathogens. It was MB20 77.78 50.00 2 2 Means with the same latter along the column are not observed that incidence of leaf spot in significantly different from each other at p =0.05 plots sprayed with insecticides was higher Four fungal pathogens were isolated from than unsprayed plots. However an the diseased leaves and were identified exception was observed in MB6, MB7 based on the cultural and morphological and MB16 (Fig 1). The severity result characters as Rhizoctonia solani, (table 1) showed the level of disease Macrophomina phaseolina I, Alternaria severity among the different genotypes of alternata and Cercospora canenscens. mungbean studied. Disease severity was Rhizoctonia solani culture is white at the assessed by estimating the proportion of surface and cream under (Plate 2). The total necrotic area. High disease severity characteristic feature of R solani is the was observed in MB9, MB13 and Mb16. hyphal branching at right angle and constriction at the point of branching of the mycelia. Macrophomina phaseolina culture on potato dextrose agar (PDA) is grayish black at the surface and the underside is black, the texture is cottony (Plate 3). M. phaseolina produces sclerotia which are round shaped and black in colour. Alternaria alternata (Fries) Keissler colony is black velvety Fig. 1 Disease occurrence in different mungbean with rough edges (Plate 4). The conidia is genotypes obclavate, short conical beak. The conidia is septate both transversely and longitudinally. Cercospora canenscens 246 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Plate 5. Cercospora canensce culture (a) and conidia at the point of attachment (arrowed)

colony is white to light gray in colour, the conidia is straight, septate, hyaline, with a thickened and darkened conidial scar Plate 1: Detached mungbean leaf showing leaf (Plate 5). The pathogenicity test showed spot symptoms (arrowed) that Alternaria. alternata and Cercospora canenscens produces leaf spot disease symptoms on inoculated leaves however C. canenscens gave the characteristic leaf spot symptom observed on the field. The spot is characterized by sub-circular to irregular, pale brown spot with a pale tan to grey centre surrounded by a dark brown a b margin. The spot development starts with Plate 2. Rhizoctonia solani culture on PDA(a) a tiny brown spot and latter enlarges. and hyphae (b). Discussion In the field, host plants are likely to interact with insects which may substantially influence the spread of the disease or condition of the shared host. The higher disease incidence observed in a b plots sprayed with insecticides compared to unsprayed plots is contrary to several Pate 3: Macrophomina phaseolina culture (a), findings from research. Jassy et al (2017) spore (b) observed a high infection in wheat field by Fusarium graminearum as a result of high aphid infestation. Also the activities of thrips and mites had been reported to correlate with increased disease severity in a host of plants and showed capability of altering the disease process (Parsons

a b and Munkvold, 2010; Piesk et al., 2011).

Plate 4. Alternaria alternata culture on PDA (a) Blandino et al. (2008) also reported that early sowing of maize in addition to and spore (b) insecticides treatment reduces the

247 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 severity of Fusarium verticilloides, Fernandez et al. (2006). The description causal pathogen of red ear rot of maize, by of Rhizoctonia solani culture as a white up to 67%. colony at the surface and cream under The fungal species isolated from given by Lal and Janki (2009) the diseased leaves was subjected to corroborates the findings in this study, and pathogenicity test to confirm Koch's Barneth and Hunter (2010), gave a similar postulate. The result showed that description of the characteristic feature of Cercospora canescens and Alternaria R. solani has having the hyphal branching alternata produces leaf spot diseases at right angle and constriction at the point symptom on inoculated leaves but only C. of branching of the mycelia. canescens produced the characteristics symptom as observed on the field. The Conclusion spot is sub-circular to irregular, brown This study suggests Cercospora with a gray or tanned centre surrounded canescense as the causal fungi of leaf spot by dark brown margin. This observation is disease of mungbean observed in this in line with the findings of Surmatini study. However, it should be noted that for (2017), who isolated C canescens along any disease symptom, there are always with other organisms from mungbean leaf associated fungi which may not be and confirmed C. canesens as the causal responsible for the observed symptom. A fungi of leaf spot disease on the plant. higher disease incidence was observed in Crous and Bran (2003) and Semangun plots sprayed with insecticides compared (2004) also reported that Cercospora to unsprayed plots which indicate that insect does not have any effect on disease leafspot is generally caused by C. incidence and severity in this study. canescens. The fungi C. canescens is slightly References white to light gray in colour, the conidia is Barnett, H. C. and Hunter, B. B. (2010). straight, septate, hyaline, with a thickened Illustrated genera of imperfect fungi and darkened conidial scar. MacKenzi 4th ed. The American Phytopatho- (2013) also gave similar description of C. logical Society. canescens isolated from the phyllosphere Beas-Fernández, A. De Santiago-De of mungbean leaf. Alternaria alternata Santiago, S. Hernández-Delgado and colony in this study is black with rough N. Mayek-Pére. 2006 edges, the conidia is obclavate, short Characterization of Mexican and non- conical beak and is septate both Mexican Isolates of Macrophomina transversely and longitudinally. A similar phaseolina based on Morphological result was given by Reddy et al. (2019) in Characteristics, Pathogenicity on the study on morpho-cultural characters Bean Seeds and Endoglucanase of A. alternata infecting groundnut crop genes. Journal of Plant Pathology, by various media. Meena et al. (2014) also 88(1), 53-60. g a v e a s i m i l a r d e s c r i p t i o n . Blandino M, Reyneri A, Vanara F, Pascale Macrophomina phaseolina culture gave M, Haidukowski M, Saporiti M, grayish black colony at the surface and the 2008. 543 Influence of sowing date underside is black with a cottony texture and insecticide treatments Ostrinia and produces a round shaped sclerotia, the nubilialis (Hubner) damage 544 and description of M. phaseolina in this study fumonisin contamination in maize is similar to the description given by Beas- kernels. Maydica 52, 199-206. 545

248 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Burgdorf R. J, Laing M. D, Morris C. D, Pathol. 77-81, 39. Jamal-Ally S. F. 2014. A procedure to Meena,R. K. S. S. Sharma and S. Singh. evaluate the efficiency of surface (2014). Studies on Variability in sterilization methods in culture Alternaria alternata (kessler) causing independent fungal endophyte leaf blight of isabgol (plantago ovata) studies. Brazilian J Microbiol 45: SAARC J. Agri., 12(2): 63-70. 977-983. Mogotsi, K.K. (2006) Vigna radiata (L.) C r o u s P. W, B r a u n U . 2 0 0 3 . Mycosphaerella and its anamorphs. 1. R. Wilczek. In: Brink, M. and Belay, Names published in G., Eds., PROTA (Plant Resources of Cercospora and Passalora. CBS Tropical Africa/Ressources végétales Biodiversity Series 1:1-571. d e l ' A f r i q u e t r o p i c a l e ) , Domsch, K. H., Gams, W. and Anderson Wageningen,Netherlands.https://ww G. H. (1981). Compendium of Soil w.prota4u.org/database/protav8.asp? Fungi. 1 and 2, Academic Press, h=M4&t=Vigna,radiata&p=Vigna+r London. adiata#Synonyms Drakulic J, Bruce T. J. A., Ray R. V, Nair, R.M., Schafleitner, R., Kenyon, L., (2017). Direct and Host-mediated Srinivasan, R., Easdown, W., Ebert, interaction between Fusarium A. and Hanson, P. (2012) Genetic p a t h o g e n s a n d h e r b i v o r o u s Improvement of Mungbean. SABRAO arthropods in cereals. Plant Journal of Breeding and Genetics pathology 66(1): 3-13. 44:177-190. Gopalan G., Ramasastri B.V. and Oladiran AO, Oso BA (1983) Balasubramanian S.C. (1995) Comparative susceptibility of some Nutritive value of Indian foods ICMR, cowpea lines to brown blotch. Hyderaba-5000, India. Tropical Grain Legume Bulletin Ginting E, Ratnaningsih, Iswanto R. (2008). The physical and chemical 28:10–17 Parsons M. W, Munkvold G. P, (2010). characteristics of mungbean seeds Relationships of immature and adult derived from 17 genotypes. In: thrips with silk cut, Fusarium ear rot Harsono A, Taufiq A, Rahmiana AA, and fumonisin B-1 contamination of Suharsono, Adie MM, Rozi F, maize in California and Hawaii. Plant Wijanarko A, Wijono A, Soehendi R Pathology 59:1099-106713. (eds). Legumes and Tuber Crops Piesik D, Lemnczyk G, Skoczek A, Technology Innovation, Supported Lamparski R, Bocianowski J, In-house Foods Production and Kotwica K, Delaney K.J, 2011. Energy Supply. Indonesian Legumes Fusarium infection in maize: Volatile and Tuber Crops Research, Malang. induction of infected and neighboring http://www.mungbean.org.au/assets/ uninfected plants has the potential to 2010_mungbean_management_guid attract a pest cereal leaf beetle, e.pdf Oulema melanopus. 719 Journal of M. Lal and J. Kandhari, (2009). “Cultural Plant Physiology 168:1534-42. 720 and morphological variability in Reddy V. V, Ghante P. H and Kanase K. Rhizoctonia solani isolates causing M. 2019. Studies on Morpho-Cultural sheath blight of rice” J. Mycol. Characters of Alternaria alternata

249 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Infecting Groundnut Crop by using Communication: Biocontrol activity Various Culture Media. Journal of of Phyllosphere fungi on mungbean Pharmacognosy and Phytochemistry; leaves against Cercospora canescens 8(2): 85-87. Biodiversitas 8(2):720 – 726. Sandhya N. Vijaya kumar S., Lawrence Tang, D., Dong, Y., Ren, H., Li, L. and He, Rubina and Jeyakumar Ebenezer. C. (2014). A Review of Phyto- (2017). Incidence of Fungal chemistry, Metabolite Changes, and P a t h o g e n s A s s o c i a t e d w i t h Medicinal Uses of the Common Food Mungbean (Vigna radiata) in Mung Bean and Its Sprouts (Vigna Allahabad Region. International radiata). Chemistry Central Journal, Journal of Agriculture Sciences, 9, 8, 4. https://doi.org/10. 1186/1752- issue 23, pp.-4267-4271. 153X-8-4 Semangun H. 2004. Diseases of Food ..http://eprints. nottingham.ac. Crops in Indonesia. Gajah Mada uk/41124/1/Revised% 20manu- University Press, Yogyakarta. script%20Drakulic%20et%20al%20 BIODIVERSITAS ISSN: 1412-033X %20plant%20path2017.pdf 18, Number 2, Sumartini. 2017. Short

250 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Incidence, Severity and Serological Detection of Potyvirus in Sprayed and Unsprayed Lima bean plants

Kareem, K.T. and Agbeleye, O.A. Grain Legumes Improvement Programme, Institute of Agricultural Research and Training, Obafemi Awolowo University, Moor Plantation, Ibadan E-mail: kt_kareem @yahoo.com Phone No. +2348024158641

Lima bean (Phaseolus lunatus) is a protein-rich food source regarded as an underutilized legume in Nigeria. The most common approach for the management of plant viruses is through the application of pesticides. This study focused on the incidence, severity and serological detection of potyvirus in sprayed and unsprayed lima bean accessions. Treatments comprised of twenty accessions of lima bean sprayed with lambda cyalothrin while the other set was not sprayed. Data were collected on viral incidence and severity and leaf samples tested for the presence of potyvirus. Analysis of variance showed that treatment was significant for all disease traits; genotypic influence was significant (ñ ? 0.01) on potyvirus titers and viral severity but not on viral incidence. The interaction between treatment and genotype was only significant on virus titers. LB4_2005-014 had the highest incidence (66.67%) and severity (2.75) in the sprayed plot and the same variety had the highest incidence (58.34%) and severity (3.25) in the unsprayed plot. In each treatment, four varieties tested positive to potyvirus with LB4_2005-014, LB5_2005-015 and LB17_2006- 015 positive in both instances. A positive and significant relationship occurred between viral incidence and severity. The study revealed the presence of potyvirus in sprayed and unsprayed lima bean plants. Since potyviruses are transmitted in a non-persistent manner, breeding for resistance varieties with integrated disease management is proposed as suitable means of controlling the virus in lima bean.

Key words: Lima beans, Genotype, Virus incidence Introduction Bromoviridae, Cucumovirus) (Beserra et Phaseolus lunatus L. is an important al., 2017). source of nutrition in many developing Potyvirus is one of the largest countries (Nordenstedt et al., 2017). It is groups of viruses infecting plant an inexpensive source of protein to rural population (Rajamäki et al., 2004). The dwellers in Nigeria (Ezeagu and Ibegbu, genus contains over a hundred species 2010). The seeds contain 24% protein, transmitted by aphids in a non-persistent 61% carbohydrate and some mineral manner (Adams et al., 2005; Gibbs and elements (Seidu et al., 2018). Despite all Ohshima, 2010). However, some are the nutritious importance of this legume, transmitted through seed (Fauquet et al., there is little or no information on the viral 2005; Albrechtson, 2006). One of the diseases of lima bean. The viruses which commonest methods of controlling plant infect cowpea are considered as potential viruses is through the applications of pathogens for lima bean (Phaseolus pesticides to control the vectors. The use lunatus L.), mainly because they belong to the same botanical family (Beserra et of pesticides prevents the spread of al., 2017). Some of the most important vectors either by decreasing the vector viruses of cowpea infecting lima bean population or by impeding virus include Cowpea severe mosaic virus transmission (Perring et al., 1999). This (CPSMV - Secoviridae, Comovirus), study is aimed at determining the Cowpea aphid-borne mosaic virus incidence, severity and titers of potyvirus (CABMV - Potyviridae, Potyvirus) and in sprayed and unsprayed lima bean Cucumber mosaic virus (CMV - accessions.

251 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Materials and Methods (ACP-ELISA). Absorbance at 405 nm Twenty accessions of lima bean collected was read in an ELISA plate reader in from the germplasm of the Genetic duplicates, after the application of p- Resources Center, International Institute nitrophenyl phosphate as substrate. of Tropical Agricultural (IITA), Ibadan Samples were considered positive when were planted in 2018 on the experimental the absorbance readings were twice the field of the Institute of Agricultural value of the negative control absorbance Research and Training (I.A.R.&T), values. Ibadan. Plants were spaced at 1 m x 1 m using Randomized Complete Block Statistical analysis Design with two replications. Split plot The Statistical Package for Social design was used, in which some set were Scientists (SPSS) version 16 was used to sprayed with pesticide (lambda analyse all the collected data. Analysis of cyalothrin) while another set was not variance (ANOVA) and Tukey test was sprayed. Plants were sprayed two times carried out using the General Linear (at the foliar stage and at podding) and Model (GLM). data were collected on virus incidence and severity. Results and Discussion Results of the analysis of variance Determination of virus disease traits revealed that accessions (A) had Virus incidence was determined by significant effect on virus severity and counting the number of infected plants titers at 1%. However, its effect on virus and expressing as a percentage of the total incidence was not significant. Treatment number of plants per plot. Virus disease (T) was significant for all disease traits severity was rated on a scale of 1 to 5. while the A x T effect was only significant Leaf samples from lima bean accessions for potyvirus titer (Table 1). showing symptoms of mosaic and The significant effect of accession chlorosis were collected in October, 2018 on virus severity and titers implied that for serological assay. Leaf samples were Potyvirus is one of the viral diseases of also collected from accessions that were lima bean. This is not surprising as the not showing symptoms. All the samples occurrence of Potyvirus in lima bean and including positive and negative controls other underutilized legumes has been were analyzed using antigen coated plate previously reported by other authors enzyme-linked immunosorbent assay (Beserra et al., 2017; Kareem and

Table 1. Analysis of variance showing mean square values of virus disease traits

Source of Df Incidence Severity Titer variation Replication 1 56.297ns 0.028ns 0.003** Accession (A) 19 583.589 ns 0.883** 0.966** Treatment (T) 1 2116.962* 1.953* 0.028** A x T 19 276.188ns 0.453ns 1.478** Error 39 399.673 0.381 0.000 *= significant at 5% level of probability; ** = significant at 1% level of probability; ns = not significant 252 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Agbeleye, 2019). The significant effect of 003B and LB20_NSWP-27 (Table 2). treatment on disease traits indicated that The severity of the virus in the sprayed application of the pesticide played a plants was mild and there was no significant role in the control of the virus. significant difference in the values The report of Castle et al. (2009) showed obtained. However, the severity in the that pesticides play a significant role in unsprayed plants varied from mild to virus vector management by reducing the moderate with LB4_2005-014 having the population of individual vector that can acquire or transmit a virus highest severity (3.25) followed by The effect of treatment on lima LB5_2005-015 (3.0) (Table 2). bean accessions showed that there was no The higher prevalence of the virus significant difference in the incidence of in the sprayed plants compared to the the virus on all the sprayed plants and unsprayed plants could be due to the non- values ranged from 0.0% to 66.67%. persistent mode of transmission of the LB20_NSWP-27 had no incidence of virus by aphids. Thresh (2003) has potyvirus. Similarly, virus incidence in reported that insecticides have limited the unsprayed plots was not significantly effectiveness in controlling aphid vectors different and mean incidence ranged of non-persistent viruses. Perring et al. between 0.0 % and 58.34%. No incidence (1999) also reported that application of of the virus was recorded in LB11_2006- pesticides may allow rapid movement of

Table 2. Effect of Treatment on the Incidence and Severity of Potyvirus

S/No. Accession Incidence Severity Sprayed Unsprayed Sprayed Unsprayed 1. LB1_2005-011 16.67 21.43 2.00 2.00 ab 2. LB2_2005-012A 39.29 8.34 2.25 1.50 abc 3. LB3_2005-12B 26.79 40.00 2.00 1.75ab 4. LB4_2005-014 66.67 58.34 2.75 3.25 a 5. LB5_2005-015 28.57 30.00 2.50 3.00 ab 6. LB6_2005-015B 33.93 23.81 2.00 2.00 ab 7. LB7_2005-016 25.00 33.33 2.00 2.00 ab 8. LB8_2006-001 41.07 44.45 2.00 2.00 ab 9. LB9_2006-002A 27.09 20.00 2.00 1.50 abc 10. LB10_2006-003A 50.00 8.34 2.50 1.50 abc 11. LB11_2006-003B 50.00 0.00 2.75 1.00bc 12. LB12_2006-004 25.39 7.15 2.25 1.50 abc 13. LB13_2006-005A 31.25 11.11 2.00 1.50 abc 14. LB14_2006-005B 26.79 30.00 2.50 1.75 ab 15. LB15_2006-007 22.50 20.54 2.00 2.00 ab 16. LB16_2006-009 16.67 10.00 1.50 1.50 abc 17. LB17_2006-015 26.11 22.22 2.00 2.00 ab 18 LB18_2006-17A 41.43 18.26 2.50 2.00 ab 19. LB19_TPl-2432 32.15 14.29 2.00 1.50 abc 20. LB20_NSWP-27 0.00 0.00 1.00 1.00bc Tukey test NS NS NS 5% Mean values followed by the same letter along the column are not significantly different according to Tukey test at 5% level of probability 253 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 insect vectors of non-persistently LB6_2005-015B. Instead, LB9_2006- transmitted viruses leading to probing of 002A was found positive (Table 3). plants in turn. The mild to moderate The presence of the virus in the severity of the virus in the accession is an sprayed plots may be due to the fact that indication that the accessions do not allow potyviruses are transmitted in a non- rapid multiplication and movement of the persistent manner, hence the virus might virus in the plants. According to the have been transmitted before spraying or when the effect of the chemical has Enzyme-linked immunosorbent assay disappeared on the field. Thresh (2003) (ELISA) result, most of the accessions reported in his study that the role played were negative to potyvirus. Four by pesticide in the control of aphid- accessions were positive to the virus in the transmitted viruses is limited because sprayed plots and they include reduced vector population does not imply LB4_2005-014, LB5_2005-015, a decrease in virus spread. He further LB6_2005-015B and LB17_2006-015. In stated that virus acquisition and the unsprayed plots, the accessions that transmission occur in a brief probes and were positive to the virus in the sprayed the aphids do not need to colonize the plots were also found positive except sprayed crops before transmission occur.

Table 3. Occurrence of Potyvirus in lima bean accession as measured by Enzyme-linked immunosorbent assay

S/No. Accession Sprayed Unsprayed 1. LB1_2005-011 - - 2. LB2_2005-012A - - 3. LB3_2005-12B - - 4. LB4_2005-014 + + 5. LB5_2005-015 + + 6. LB6_2005-015B + - 7. LB7_2005-016 - - 8. LB8_2006-001 - - 9. LB9_2006-002A - + 10. LB10_2006-003A - - 11. LB11_2006-003B - - 12. LB12_2006-004 - - 13. LB13_2006-005A - - 14. LB14_2006-005B - - 15. LB15_2006-007 - - 16. LB16_2006-009 - - 17. LB17_2006-015 + + 18 LB18_2006-17A - - 19. LB19_TPl-2432 - - 20. LB20_NSWP-27 - - + = positive, - = negative

254 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 4. Relationship between disease traits

Titer Incidence Severity Titer 1 0.125ns 0.107ns Incidence 0.125ns 1 0.773** Severity 0.107ns 0.773** 1 ns = not significant; ** = significant at 1% level of probability

The correlation between virus titer and Fauquet, C.M., Mayo, M.A., Maniloff, J., the other two disease traits was not Desselburger, U. and Ball, L.A. (eds.) significant. However, incidence and (2005). Virus taxonomy. Eighth severity were positively correlated and report of the international committee the relationship was highly significant for the nomenclature of viruses. (Table 4). The positive and significant Elsevier, London. relationship between disease incidence Ezeagu, I.E. and Ibegbu, M.D. (2010). and severity in fifteen accessions of Biochemical composition and African yam bean was reported by nutritional potential of ukpa: A variety Kareem et al. (2019). of tropical lima beans (Phaseolus lunatus) from Nigeria- A short review. Conclusion Polish Journal of Food and Nutrition The study showed that pesticide is not Sciences 60(3):231-235. enough for controlling non-persistently Gibbs, A.J. and Ohshima, K. (2010). transmitted viruses. Use of Integrated Potyviruses and the digital revolution. disease Management (IDM) is the best Ann. Rev. Phytopathol. 48:205-223. option for controlling such virus. Kareem, K.T., Agbeleye, O.A. and Akinbode, O.A. (2019). Response of References African yam bean to Cucumber Adams, M.J., Antoniw, J.F. and Fauquet, mosaic virus infection in south- C.M. (2005). Molecular criteria for western ecology. Moor Journal of Agricultural Research Special edition genus and species discrimination th within the family Potyviridae. Arch. for 50 Anniversary. Virol. 150:459-479. Kareem, K.T. and Agbeleye, O.A. (2019). Albrechtson, S.E. (2006). Testing Cucumber mosaic virus in African methods for seed-transmitted viruses: yam bean (Sphenostylis stenocarpa): principles and protocols. CABI Occurrence and management with Publishing, Wallingford. baking soda. Journal of Underutilized Beserra, A., Evando, J., Teixeira, M., Legumes 1(1): 153-158. Nordenstedt, N., Marcenaro, D., Wilgney, J., Lima, M., Josemar, K. Chilagane, D., Mwaipopo, B., and Marcelo, E. (2017). Preliminary Rajamaki, M.L. and Nchimbi-Msolla, survey of RNA genome viruses in S. (2017). Pathogenic seedborne lima bean. Publications from USDA- viruses are rare but Phaseolus ARS/UNL Faculty vulgaris endornaviruses are common Castle, S., Palumbob, J. and Prabhaker, in bean varieties grown in Nicaragua N. (2009). Newer insecticides for and Tanzania. PLoS ONE 12(5):1-18. plant virus disease management. Perring, T.M., Gruenhagen, N.M. and Virus Research 141:131-139. Farrar, C.A. (1999). Management of

255 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

plant viral diseases through chemical Nutrients assessment of some lima control of insect vectors. Annual bean varieties grown in southwest Review of Entomology 44:457-481. Nigeria. International Food Research Rajamäki, M.L., Maki-Valkama, T., Makinen, K. and Valkonen, J.P.T. Journal 25(2):848-853. (2004). Infection with potyviruses. Thresh, J.M. (2003). Control of plant In: Talbot, N. ed. Plant-pathogen virus diseases in sub-Saharan Africa: interactions. Blackwell Publishing, Oxford, pp. 68-91. The possibility and feasibility of an Seidu, K.T., Osundahunsi, O.F. and integrated approach. African Crop Osamudiamen, P.M. (2018). Science Journal 11(3):199-223.

256 Economics and Extension

257 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Economics and Extension

Economic Analysis of soybean prodction in Ibarapa zone of Oyo State, Nigeria

Rasaki,W.A, Olojede, M.O. Omotoso, A.B and Sulaimon, I.O Oyo State College of Agriculture and Technology, Igboora, Oyo State, Nigeria. [email protected] +2347065893037

Abstract There is growing believe that Soybean is not only supplying protein to the diet of Nigeria people but also contributes immensely to the economic development of rural farmers. Therefore, this study analysed the economics of Soybean in Ibarapa zone of Oyo State, Nigeria. Ibarapa zone of Oyo State is mainly agrarian area with over 90% of its population engaged directly or indirectly in crop productions. Multi-stage sampling technique was used to select 160 Soybean farmers. The data were analysed using descriptive statistics (frequency table, percentages, mean) and inferential statistics (t-test, Gross margin, multiple regression). The result revealed that majority (91.88%) of the farmers were males with average age of 49years. Most of the farmers (73.12%) have no formal education and engaged primarily (71.25%) on crop production. They were mostly married (88.13%) with average of 6 persons per household. It was discovered that the challenges the farmers were facing are; pest infestations, high cost of pesticides, herdsmen destructive activities, low yield, high labour cost, insufficient capital among others. The result of t-test showed that there is significant different between male and female farmers in term of farm size, years of experience and revenue generated. The gross margin (GM) was ? 377,106.41 with the average profit of ? 230,530.11 and Benefit Cost Ratio (BCR) of 1.63. Regression analysis showed that level of education, years of farming experience, farm size, labour used and chemical used have positive significant effect on the revenue while pest infestation has negative effect. In conclusion, this study provided strong evidence that soybean cultivation is a profitable venture with profit margin of about 60%. It is recommended that farmers should engage in commercial production of soybean and seed breeders should develop pest and disease resistance varieties.

Introduction animal feed. The crop also improves the Soybean (Glycin max) is a legume that soil fertility by adding nitrogen from the grows in the tropical, subtropical and atmosphere and used as cover crop to even the temperate climate and was prevent erosion (IITA, 2015). introduced to Africa in the 19th century The origin and early history of by Chinese traders along the East Coast of soybeans are unknown. It is not Africa (IITA, 2015). Soybean is the uncommon to read in agronomic richest source of plant protein known to publications that the earliest recorded man (FAO, 2011). It is also an important origins of soybeans date back to 2800 source of income. The crop is an B.C. in China (Thoenes, 2014). Soybean, important source of high quality, a short-day plant, is a very important oil inexpensive protein and oil, the protein and protein crop. It can grow on all types and oil levels are about 40% 20% of soil, but deep fertile loam with good respectively (Ahmed, 2009). The oil drainage is most suitable for growth produced from soybean is highly (Whigham, 1974). It is a versatile food digestible and contains no cholesterol. A plant that, used in its various forms, is by-product from it oil production- capable of supplying most nutrients. It can soybean cake is used as a high protein substitute for meat and to some extent for

258 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 milk. It is a crop capable of reducing year 2000 and 2006, there is a marked protein malnutrition. In addition, decline in the production of soybean in soybeans are a source of high value the year 2007. Also, the contribution of animal feed (Martin, 1998). Soybean is an Nigeria to world soya bean production alternative protein source to the rural which stood at an average of 0.28% in families and can be utilized at home in 2006, declined to about 0.26% in 2007 various forms and the surplus can be sold (FAOSTATS, 2009). Research has shown to other consumers and manufacturers for that the problems of small scale income (Ambitsi, Onyango & Oucho, agriculture in Nigeria include the lack of 2007). Soybean is among the major high yielding cultivars, inadequate industrial and food crops grown in every information about new production continent (Dugje, et al.,2009) . Soybean technology, inadequate basic farm inputs has an average protein content of 40% and the use of traditional technology of (Collombet, 2013) and is more protein- low productivity. rich than any of the common vegetable or The crop can be processed into animal food sources. Soybean seeds also various forms such as soymilk, soyflour , soymeat, soyspice, yoghurt, biscuit, baby contain about 20% oil on a dry matter food, condiments, breakfast cereals, etc. basis, and this is 85% (Dugje, et al.,2009) these products are highly patronized unsaturated and cholesterol-free because they are inexpensive, have (Ambitsi, Onyango and Oucho, 2007). acceptable taste and high nutritional Soybean is gaining ground values as well as major source of the daily globally due to its multipurpose use as protein intake of children and adults human food, livestock feed, industrial (Kokoiwen, 2002). purposes, and more recently, as a source In the recent years there is of bio-energy (Myaka et al., 2005). increase in soybeans production round Unlike most other beans it contains 40% the globe. With the rapid expansion of protein compared to 20% and 13% protein soybean production around the world, content in meat and egg, respectively competition in global soybean trade (Greenberg and Hartung, 1998). It also imposes new challenges to conventional contains 20% non-cholesterol oil and its commodity cropping systems. Lower fortified products are considerably production costs and comparable cheaper than other sources of high quality technologies are just a few results of protein. It is the primary source of edible worldwide production competitiveness oil globally with the highest gross output (Paz, Batchelor, and Jones, 2003; of vegetable oil among the cultivated Lambert and Lowenberg-DeBoer, 2003). crops with total cultivated area of 117.7 Additionally, utilizing new ways to add million hectares and total production of value to commodity soybean (e.g., 308.4 million tons (FAOSTAT, 2015). planting of food-grade specialty Soybean is one of important crops soybeans) could improve profitability produced in Nigeria. However, it was and competitiveness in the world market reported that the crop is grown in rather (Fernandez-Cornejo, Wechsler, small holder farms in most African Livingston, and Mitchell, 2014). countries including Nigeria (Olorunsanya et al., 2009). Available statistics on world Problem statement soya bean production shows that although In the major Soybean producing production tends to increase between the countries and particularly in Brazil,

259 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Argentina, Paraguay and the USA Ibarapa area falls within latitude 70.5'N soybean contributes significantly to the and 70.55'N and longitudes 30E and total value added by the agricultural 30.30'E. It is located approximately sector. In these countries, soybeans and 100km north of the coast of Lagos. The its sub-products also occupy an important population of the area is approximately position in total export earnings. Among 380,150. The area is approximately smaller producers only India and Bolivia 2,496km2 in geographical size, and earn significant income from the consists mostly of rolling savannah with exportation of soybean and derived forests situated along the Southern border products (Thoenes, 2014). The and in isolated patches along river courses aforementioned countries are making such as the Ogun. The natural vegetation fortunes fortune from exportation of was originally rainforest but that has been soybeans but Nigeria is yet to tap into this mostly transformed into derived type opportunity. Worst still, the level savanna as a result of several centuries of production in Ibarapa zone is far below slashes and burn agricultural practices. the other in Oyo State. This problem of under-utilization of soybean in Ibarapa Sample Size and Sampling Technique may be due to lack of information about Respondents were selected through a economic importance of soybean. This multistage sampling technique. In the first lack of information constitutes a gap in stage, four towns (Igboora, Idere, Aiyete research that formed the basis for this and Iganagan) were purposively selected. study. Hence, to fill the knowledge gap In the second stage, 40 Soybean farmers and gain better insight on the economics were randomly selected from each of the of soybean production in Ibarapa Zone of Oyo State, the study therefore seeks to four selected towns, totaling 160 achieve the following objectives: respondents.

i. identify socio-economic charac- Data Collection and Analysis teristics of soybeans farmers Data used for the study were obtained ii. identify challenges that soybean from primary source through the use of farmers are facing pre tested structured and validated iii. analyse the gross margin and questionnaires. Questionnaires were profitability of soybean produc- administered to the farmers to elicit tion information from them about their iv. examine the factors that production process. Data collected were determine soybean outputs. analysed by descriptive statistic (frequency table, mean and percentage) Methodology and inferential statistic (Gross Margin, T- Study Area test and Regression). This study was carried out in Ibarapa zone of Oyo State. The name Ibarapa is derived Model Specification from local cultivar of the melon plant, Gross Margin known locally as “Egusi Ibara”, which was historically acknowledged by neighboring people. Ibarapa has seven Where towns namely: Eruwa, Lanlate, Igboora, GM= Gross Margin Idere, Aiyete, Tapa and Igangan. The Pi = Unit Price of Output i, 260 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

qi = quantity of output i, Multiple Regression Model rj = unit cost of variable input j, x j = quantity of the variable input j, piqi = Total Revenue (TR) rjxj = Total Variable cost (TVC) lnYi = lnâ +â lnX + â lnX + â lnX + GM = TR-TVC 0 1 1 2 2 3 3 â lnX + â lnX + â lnX + â lnX + ð = GM-TFC 4 4 5 5 6 6 7 7 Where; â8lnX8+µ ð = Profit Where; TFC = Total Fixed Cost ln = the natural logarithm Yi = Soybeans output (kg) Xij = Vector of farm inputs (X1 – X8) used Table 1: Frequency distribution of respondents by socio-economic characteristics (N=160)

Socio-economic Characteristics Frequency percentage(%) mean Age (years) = 30 3 1.88 31-40 27 16.88 41-50 75 46.88 48.72 51-60 35 23.12 Above 60 18 11.24 Sex Male 147 91.88 Female 13 8.12 Marital Status Single 1 0.63 Married 141 88.13 Divorced/Separated 8 5.00 Widowed 10 6.24 Religion Christianity 43 26.88 Islam 106 66.24 Traditional 11 6.88 Formal Education Status Non-formal 117 73.12 Formal 43 26.88 Major Occupation Farming 114 71.25 Artisan 19 11.88 Civil Service 10 6.25 Trading/Business 17 10.62 Farming years of experience 1-5years 15 9.38 6-10years 53 33.12 11.63 11-15years 93 57.50 Farm Size (Ha) 1-5 66 41.24 6-10 44 27.50 7.86 11-15 29 18.13 16-20 21 13.13 Household Size 1-5persons 101 63.12 5.38 6-10persons 59 36.88 Source: Field survey, 2018.

261 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

X1 = Farmers' age (Year) single. Divorced and widowed X2 = Education level respondents were 5.00% and 6.24% X3 = Household size respectively. This implied that majority of X4 = Farming experience (year) the soybeans producers were married and X5 = Farm size (Ha) have families to cater for. X6 = Pest/disease infestation X7 = Labour used (Number/quantity) Religion: The table also revealed that X8 = Chemical used (Litre). 26.88% of the respondents practiced Christian religion, 66.24% were Muslims Result and Discussion while only 6.88% were traditional Socio-Economic Characteristics of the worshippers. This implies that Soybeans Respondents production is not a taboo to any of the Age: Table 1 revealed large number three major religions practiced in Nigeria. (46.88%) of the respondents have age between 41-50years and this is closely Formal education: It was revealed that followed by those that were between 51- 73.12% of the respondents have non- 60years (223.12%). Only 1.88% of the formal education while only 26.88% have respondents were 30 years or less while formal education. This shows that 11.24% were above 60years of age. The majority of the respondents were mean age was approximately 49years. illiterate. This result is contrary to the This implies that the farmers in the study finding Birhanu, Adam and Mazengia area were in their productive age. This is (2018) in their study “Analysis of Cost in tandem with findings of Birhanu, Adam and Return of Soybean Production Under and Mazengia (2018) in their study Small Holder Farmers in Pawe District, “Analysis of Cost and Return of Soybean North Western Ethiopia” where only Production Under Small Holder Farmers 38.64% of the farmers were illiterates. in Pawe District, North Western Ethiopia” where average age was 41.98years. Major occupation: Table 1 showed that large number (71.25%) of the respondents Sex: Table 1 showed that majority taken farming as their primary occupation (91.88%) of the farmers were males while while only 6.25% were civil servants only 8.12% were females. This implies primarily. Those who chosen trading and that majority of soybeans farmers were artisan as their main occupations were male. This echoed the findings of 10.62% and 11.88% respectively. This Birhanu, Adam and Mazengia (2018) in implies that respondents engaged more in their study “Analysis of Cost and Return farming as main occupation than other of Soybean Production under Small occupations. Holder Farmers in Pawe District, North Western Ethiopia” where majority Farming years of experience: table 1 (95.45%) of the soybean farmers were revealed large number (57.50%) of the males. respondents have between 11-15years of farming experience while 9.38% have Marital status: Table 1 showed that between 1-5 years of experience. The majority (88.13%) of the respondents mean years of experience was were married while only 0.63% were approximately 12years.

262 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Farm Size (Ha): The mean farm size was and transportation cost were ranked as 7.86 hectares. This is contrary to findings fourth, fifth, sixth and seventh prevalent of SHALMA, H.J. (2014) in his study challenges respectively. “Economic Analysis of Soya Bean About 41% agreed that high cost Production Under Sasakawa Global 2000 machinery was a serious while only 8.2% Project in Kaduna State, Nigeria” where strongly disagreed with this assertion. average farm size was 0.89 hectares. Unavailability of High Yield Variety (HYV) was ranked ninth problem with the Household size: It was also revealed that mean response of 3.06. Majority majority (73.33%) of the respondents (75.00%) of the respondents strongly have household members ranges between disagreed that market unavailability is a 6-10 persons. Those that have 1-5 serious challenge with the mean response household members were 25.56% while of 1.42 which make it the least problem. only 1.11% of respondents have above 10 Table 3 presents the result of Gross margin and Profitability Analysis persons in their household. The mean of soybean production in the study area. It household size was 6 persons. This was revealed that average total variable implies that the women have sizeable cost (TVC) was ? 218,691.89 while the household members to take care. average total fixed cost (TFC) was ? 146,576.30. The average total cost (TC) Challenges facing by Soybean Farmers was ? 365,268.19. According to table 2, 93.75% of the The average total revenue (TR) respondents affirmed strongly that high r e c e i v e d b y t h e f a r m e r s w a s cost of pesticides was a very serious ? 595,798.30. The gross margin (GM) problem facing soybean farmers with the was ? 377,106.41. This indicated that mean response of 4.93 which makes it the soybean is highly profitable in the study most prevalent problem in the study area. with profit (ð) of ? 230,530.11. This is closely followed by pest/disease The benefit cost ratio (BCR) was infestation with the mean response of 1.63, this indicate 160% return on 4.88. investment. It simply means that every ? 1 Large number ((88.12%) of the invested in soybean production, will bring farmers strongly claimed that herdsmen ? 1.63k. This implies 63% profit margin destructive activities was one of serious on invest. challenges facing soybean farmers with the mean response of 4.73 which make it Regression Analysis third most prevailing problem. Low yield, Table 4 showed the result of multiple high cost of labour, insufficient capital regression which was used to determine

263 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Table 3: Gross margin and Profitability Analysis of soybean production

Variables Mean Value (? ) Variable costs Labour Cost 78,044.38 Cost of Seed 12,975.00 Chemical Cost 94,585.00 Processing Cost 15,000.00 Transportation 14,189.38 Marketing Cost 3,898.13 Total Variable cost (TVC) 218,691.89

Fixed Costs Depreciated Land Cost 57,282.50 Depreciated cost of Equipment 89,293.80 Total Fixed Cost (TFC) 146,576.30 Total Cost (TC) 365,268.19 Total Revenue (TR) 595,798.30 Gross Margin (GM) = TR-TVC = (595,798.30 – 218,691.89) 377,106.41 Profitability (ð) = TR-TC = (595,798.30 – 365,268.19) 230,530.11 Benefit Cost Ratio (BCR)= (TR TC) = (595,798.30 365,268.19) = 1.63 Source: Data Analysis, 2018

Table 4: Regression analysis

Variables Coefficient Standard Error T-Value Probability Age -0.0503 0.0533 -0.94 0.348 Education Level 0.0623 0.0333 1.87 0.063* Household Size 0.0013 0.0242 0.06 0.955 Farming years of Experience 0.2692 0.1521 1.77 0.080* Farm Size 0.6536 0.0834 7.84 0.000*** Pest/Disease Infestation -0.2119 0.0631 -3.36 0.001*** Labour used 0.1470 0.0874 1.68 0.095* Chemical Used 0.3721 0.1013 3.67 0.000*** Constants 9.0257 1.0591 8.52 0.000 R2 = 0.8983 Adjusted R2 = 0.8906 F-Value = 0.0000 Number of observation = 160 Source: Data Analysis, 2018 that factors that influence the output of farming experience (significant at 10%), soybean. It was revealed that education farm size (significant at 1%), labour used level was positively correlated with about (significant at 10%) and chemical used with coefficient of 0.0623 and was (significant at 1%) were all positively significant at 10% level of significant. correlated with output and were This implies that if the level of education statistically significant at different level. is increase by one unit, soybean output this implies that an increase in any of will be increased by 0.0623. Also, year of these factors brings about certain increase

264 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 in soybeans output. Pest/disease null hypothesis was rejected. infestation was also significant at 1% Male and female soybeans level but negatively correlated with farmers were not statistical different in output which means that an increase in term of their education level and age. pest/disease infestation brings about Therefore, null hypotheses were decrease in output. Age and Household accepted. size were not significant. 2 Adjusted R was 0.8906 which Conclusion and Recommendations means 89.06% of factors that determine The study concludes that majority the output of soybean have been (91.88%) of the soybean farmers were explained by independent variables while males with average age of 49years. Most the rest has been captured by stochastic (73.12%) have no formal education and error term. they were married with average household size of 6 persons. It was Hypotheses discovered that the challenges that facing Table 5 revealed that male and female farmers in the study area among others are soybean farmers were statistically High cost of pesticides, Pest/Disease different in term of farm size. The average infestation, Herdsmen activities, Low farm size for male was 8.29ha while that yield, High labour cost and Insufficient of female was 3ha. The mean difference capital. The gross margin (GM) was was 5.29ha and this was statistically ? 377,106.41 with profit (ð) of significant at 1%, therefore, null ? 230,530.11 and benefit cost ratio (BCR) hypothesis was rejected. was 1.63. The factors that influence Also males have average years of soybean output are; education level, year farming experience of 11.93years while of farming experience, farm size, labour used, chemical used and pest/disease females have 8.15years of farming 2 experience with the difference of infestation. Adjusted R was 89.06%. 3.78years and this was statistically Male and female soybean farmers were different at 1%. Therefore, null statistically difference in terms of farm hypothesis was rejected. Likewise, the size, years of farming experience and revenue generated. Average revenue revenue generated. It is recommended that seed generated by male farmers was ? 612,444 breeders should endeavuor to develop while that of female was ? 204,880 with disease resistance cultivars or varieties. the average difference of ? 75,578 and Government should provide credit facility was statistically significant at 1%. Hence, for farmers. Farmers should engage in

Table 5: T-test estimates of the variables (difference between means)

Variables Mean Diff Std. Error T-Value P-Value Decision Male Female

Farm Size 8.29 3.00 5.29 1.4205 3.72 0.0001*** Reject HO Farming years of exp. 11.93 8.15 3.78 1.0295 3.68 0.0002*** Reject HO Revenue 612444 4075645 204880 75578 2.71 0.0037*** Reject HO Education Level 0.55 0.38 0.17 0.1446 1.15 0.1257 Accept HO Age 48.91 46.54 2.37 2.7996 0.85 0.1990 Accept HO Source: Data Analysis, 2017 Note: ***, ** and * represent 1%, 5% and 10% level of significance

265 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 commercial production of soybean to tap (2014). Genetically Engineered into economic benefits of soybeans. Crops in the United States. Economic Research Report No. (ERR-162). Reference Department of Agriculture, Economic Ahmed, M. C. (2009). Soybean- the meat Research Service, U.S.A. that grow in on plants. U. S. Food and Agricultural Organization Department of Agriculture, farmer's (FAO), 2011. Technology of bulletin, No. 1617. production of edible flours and Ambitsi, N., Onyango, E. and Oucho, P protein products from soybeans. FAO (2007). “Assessment of Adoption of Agricultural service bulletin (107) Soya Bean Processing and Utilization 4-9. Technologies in Navakholo and Greenberg, P and Hartung, H.N. (1998). Mumias Divisions of Western Kenya”, Kenya Agricultural Research The whole soy cookbook: 175 Institute, 1434-1438. delicious, nutritious,easy-to prepare Birhanu, A., Adam, B. and Yalew, M. recipes featuring tofu, tempeh, and (2018). Analysis of Cost and Return various forms of nature's healthiest of Soybean Production Under bean. Three Rivers Press, New York. Small Holder Farmers in Pawe International Institute for Tropical District, North Western Ethiopia. A g r i c u l t u r e ( I I TA ) ( 2 0 1 5 ) . Ethiopian Institute of Agricultural Agricultural yearly report of selected Research, Ethiopia; 8(1), 28-34. crops in Nigeria. IITA yearly Collombet, R.N. (2013). “Investigating publication 201, Ibadan, Nigeria. soybean market situation in Western Kokoiwen, M. R. (2002). Socio- Kenya: constraints and opportunities economic analysis of soybean for smallholder producers”, product usage as a protein supplement Wageningen University, 1-43. for nursing rural women in Gboko Dugje, I.Y., Omoigui, L.O., Ekeleme, F. L.G.A. of Benue State, Nigeria. Lambert, D. M., & Lowenberg-DeBoer, J. Bandyopadhyay, R. Kumar P.L. and (2003). Economic analysis of row Kamara, A.Y. (2009) “Farmers' Guide spacing for corn and soybean. to Soybean Production in Northern Agronomy Journal, 95(3), 564-573. Nigeria”, International Institute of Martin, F.W. (1998)“Soybean, Why Tropical Agriculture, Ibadan, Nigeria, Grow Soybeans”, ECHO, 17391 1-16. Durrance Rd, North Ft. Myers FL FAOSTATS (2009). Food and Agriculture 33917, USA, 1-5. Statistical Database Internet: Myaka, F. A., Kirenga, G., Malema, B. http://apps.fao.org/page/collections? (Eds) (2005). Proceeding of the First Subset=agriculture. http://www. National Soybean Stakeholders faostat 2009.org Workshop, Morogoro, Tanzania. FAOSTAT (2015). Food and Agriculture Olorunsanya, E. O., Babatunde, R.O., Organization of the United Nations Orebiyi, J.S. and Omotosho, J. O. (2009). Economic Analysis of Statistical Database available at Soyabean Production in Kwara State, http://www.fao.org/faostat North Central Nigeria. Global Fernandez-Cornejo, J., Wechsler, S. J., Approaches to Extension Practice Livingston, M., & Mitchell, L. (GAEP), 5(2), 2009.

266 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Paz, J. O., Batchelor, W. D., & Jones, J. Agriculture Organization of the W. (2003). Estimating potential United Nations”,. 1-25. economic return for variable soybean Whigham, D.K (1974). “Soybean variety management. Transactions of Production, Protection, and the ASABE. 46(4), 1225- 1233. Utilization”, Proceedings of a Conf. SHALMA, H.J. (2014). Economic for Scientists of Africa, The Middle Analysis of Soya Bean Production East, and South Asia, University of Under Sasakawa Global 2 0 0 0 Illinois International Soybean Project in Kaduna State, Nigeria. Program Urbana, Illinois 61801, 1- Unpublished thesis. 266. Thoenes, P. (2014). “Soybean International Commodity Profile, Markets and Trade Division Food and

267 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Assessment of Information Channels for technology adoption among under utilised legumes' farmers in Oke Ogun area of Oyo State.

Amusat, Adeniyi Suraju Institute of Agricultural Research and Training, Obafemi Awolowo University, Moor Plantation, Ibadan. [email protected] +234-8023469575

Abstract The production of the underutilised legumes in Nigeria is at a very low ebb, attempt to increase its production requires adoption of improved technologies on the crops. Hence, Information channels for technology adoption among underutilised legumes's farmers in Oke-Ogun area of Oyo state was therefore investigated. A multi-stage sampling procedure was used and 75 respondents were selected through snowball technique. Results indicate that 49.3% of farmers were above 50 years, majority were male (81.3%),married (76.0%) and educated (67.6%). Majority of the respondents had high access to radio ( = 1.81) and farmers' association (x =1.41) for information on underutilized legumes and preferred radio (x = 0.93) and extension agents (x = 0.92) as major sources of information dissemination .Poor seed viability (x = 1.78 ) and poor yield (x = 1.77 ) were the major constraints limiting production of under utilised legumes in the study area. There was significant relationship in the respondents' educational status (÷2 =10.363; p=0.016) and information channels for technology adoption among underutilised legumes' farmers. It is recommended that research institutes should carry out studies with a view to generate technologies that would alleviate constraints faced by farmers in the production of lesser legumes.

Keywords: Underutilised legumes, information dissemination strategies, limabean , pigeonpea. Introduction The underutilised legume crops due to Recent development portends that the their rich nutritional profile, high analysis of food insecurity especially adaptability to adverse climatic adequate nutrition need to be carried out conditions and ability to grow in poor in a dynamic and more comprehensive soils are highly advantageous for context. The myopic focus on cowpea and sustainable cultivation. Because of their soybean as the major vegetable source of high drought tolerance and excellent protein in the diet especially in sub-sahara nutritional profile comparable to African countries must be reconsidered commercially available legume crops for sustainable livelihood of the farm (soybean, peanut and cowpea), these families and improved nutrition of the could potentially provide sustainable ever increasing population. food and feed resources in the future. The Attempts to focus on technology richness of these crops in protein can generation and dissemination of the support the global protein demand in underutilized legumes such as pigeon pea future to partially or completely replace (cajanus cajan), lime bean (Phaseolus other animal proteins in the human diet. lunnatus luna) African yam bean Intense agronomic, genetic and applied (Sphenostylis stenocarpa) and Bambara research is required to move these crops groundnut (Vigna subtarranea Thurs) out of obscurity and to use their potential would be a right step in the right direction as cash crops. and additional efforts towards Equally important is the fact that strenghtening the new agricultural underutilised leguminous crops provide transformation programmes in Nigeria. economic benefits for farmers. Farmers

268 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 can grow these crops on their own, or as methods of production so that desired part of crop rotation systems or inter-plant change is achieved (Amusat and them with other crops. This will definitely Oyedokun, 2018). yield more income. Furthermore, when Information dissemination farmers have a wide range of crops to strategies or channels of information choose from in a crop rotation system, the dissemination for technology adoption cycles of some pests and diseases are among underutilised legumes' farmers disrupted and infestation possibilities are need to be assessed so that researchers minimized. It also allow farmers to have efforts would not be in futility. This will more sustainable production system. In go a long way in enhancing the adoption addition, encouraging the cultivation of of the technology generated and underutilised legumes for food will boost consequently increase the production of the livelihoods of small holder farmers. lesser legumes. For us to make food security a reality in developing countries, we must bring back Objectives of the study into the food value chain over forgotten The general objective of the study was to and underutilise crop species. We must assess the information channels for also seek to promote the consumption of technology adoption among underutilized local cuisines and develop ways to lessen legumes' farmers. It specifically the burden of methods of preparing some identified personal characteristics of of these food crops. farmers, information channels , frequency Due to their resilience to drought, of accessing information from the poor soil and weather conditions, available channels and factors that underutilized legumes may also help to constrained farmers from production of stem the decline in food crop production lesser legumes. caused by climate change (Karigidi, 2018) Methodology To achieve this, research must The study was conducted among concentrate on the development of underutilized legumes' farmers in Oke- adaptable and adoptable technologies Ogun area of Oyo State. Oke-Ogun area is aimed at improving the genetic potentials, the northern part of Oyo State and yield adaptation and nutritional quality of popularly referred to as the food basket of the underutilized legumes. It is also the state. Oke ogun area is made up of 10 speculated that adoption of the out of 33 LGs in Oyo State with a technologies generated for the improve- population of about 1.5 million according ment of the productivity of the to 2006 National census. underutilised legumes depend heavily on A multi stage sampling procedure the effectiveness of the communication was used to select samples for this study. strategies or channels used for the In the first place, 30% of the local transferring of the generated technolo- governments in Oke-Ogun area were randomly selected. This gave a total of gies to farmers. 3LGs from the 10LGs in the area. In the Adequate dissemination of second stage, from the sampled local information to farmers at the grassroot governments, five wards were randomly level, therefore, would not only create the selected from each local government awareness of the need for change but making a total of 15 wards. Thereafter, 5 would also explore all avenues and underutilised legumes farmers were

269 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 selected through snowball technique of underutilized legumes. from each ward. Therefore, 75 For available information respondents were used for this study. dissemination methods or channels, a list Variable measured include of methods were provided and the strategies of information dissemination, respondents were asked to indicate their preference. frequency of accessing information from Accessibility was measured as the available methods and constraints always, occasionally and never. 2, 1 and 0 experienced by farmers in the production were assigned as scores.

Results and Discussion Distribution of Respondents by their personal characteristics n=75

A g e F r e q u e n c y P e r c e n ta g e 2 0 -2 9 1 1 1 4 .7 3 2 -3 9 7 9 .3 4 0 -4 9 2 0 2 6 .7 5 0 -5 9 2 5 3 3 .3 > 6 0 1 2 1 6 .0 S e x M a le 6 1 8 1 .3 F e m a le 1 4 1 8 .7 M a rita l S ta tu s S in g le 1 0 1 3 .3 M a rrie d 5 7 7 6 .0 D iv o rc e d 5 6 .7 W id o w e d 3 4 .0 R e lig io n Isla m 3 7 4 9 .3 C h ristia n ity 3 4 4 6 .4 T ra d itio n a l 4 5 .3 E d u c a tio n P rim a ry 2 1 2 8 .0 S e c o n d a ry 1 9 2 5 .3 T e rtia ry 1 3 1 7 .3 N o n e 2 2 2 9 .4 H o u se h o ld siz e 1 -3 1 0 1 3 .3 4 -6 5 6 7 4 .7 7 a n d a b o v e 9 1 2 .0 A sso c ia tio n s C o o p e ra tiv e 3 1 4 1 .3 F a rm e rs a s so c ia tio n 7 9 .3 S o c ia l g ro u p 3 4 .0 A g e g ro u p 3 4 .0 C o s m o p o lite n e s s E v e ry 2 w e e k 2 2 .7 M o n th ly 8 1 0 .7 E v e ry 6 m o n th s 1 6 2 1 .3 Y e a rly 3 0 4 0 .0 N e v e r 1 9 2 5 .3 In c o m e 8 0 ,0 0 0 -1 2 0 ,0 0 0 2 0 2 6 .7 1 3 0 ,0 0 0 -1 7 0 0 0 2 8 3 7 .4 1 8 0 ,0 0 0 -2 2 0 ,0 0 0 2 7 3 5 .9 A c re a g e D e v o te d to le sse r le g u m e s 1 – 2 2 2 2 9 .3 3 - 4 2 8 3 7 .3 5 – 6 1 7 2 2 .7 6 .1 a b o v e 8 1 0 .7 F a rm in g E x p e rie n c e 1 – 4 1 4 1 8 .7 5 – 8 1 8 2 4 .0 9 – 1 3 1 1 1 4 .6 1 4 – 1 7 1 3 1 7 .3 1 8 a n d a b o v e 1 9 2 5 .4

270 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Types of lesser legumes African yam beans 12 16.0 Pigeon pea 35 46.7 Lima beans 18 24.0 Bambara Groundnut 10 13.3 Cropping System Monocropping 12 16.0 Mixed Cropping 6.3 84.0 Contact with Ext Agents Yes 34 45.3 No 41 54.7 Sources of Inputs Government 1 1.3 Open market 59 78.7 Agro dealers 15 20.0 Sources of seed Previous harvest 26 34.7 Fellow farmers 40 53.3 Agro-Input 4 5.4 Open market 5 6.6 Source : Field survey,2019

A list of constraints usually experienced while only 13.3% of the respondents were by farmers on the production according single. This emphasises the importance of to literature were provided and marriage in the rural areas where the study respondents were asked to rate each was carried out as no adult would be regarded as responsible without constraint as Serious (2) ,Mild 1 and Not a marriage. constraint (0) The study also found that the two religions mostly practiced in the study Respondents' personal characteristics area were Islam (49.3%) and Christianity Information available in Table 1 shows (46.4%). This is line with Yekinni and that most of the underutilised legumes' Oguntade (2014). farmers (49.3%) were above the age of The data on educational 50. This indicates that most of them are attainment of the respondents revealed getting old and may not be too keen on that 67.6% of the respondents had one learning modern system of farming. This form of education or the other. Only may be due to the fact that lesser legumes 29.4% did not have formal education. are traditional crops growing mostly for According to Oladeji (2011), farmers are local consumption. not totally illiterates but had one form of Overwhelming majority of the education or the other. The level of farmers were male (81.3%) which means education attained by farmers determine men are highly involved in the production their ability to perceive, inteprete and of lesser legumes crops. This may be due correctly determines action that would to the strenous nature of agricultural possibly enhance their performance in enterprise especially growing of lesser farming activities. Majority of farmers in legumes. The finding is in consonance the study area had between 4-6 persons as with earlier study by Yekinni etal (2015) their household size. This depicts fairly who reported similar trend in agriculture. large size which is a normal trend in The study also found that majority farming communities (Amusat, (76.0%) of the respondents were married 2018).

271 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

Majority of the respondents agents who were to disseminate belong to different associations; improved system of farming to them. This cooperative societies (41.3%), farmers could be due to dearth of funds association (45.4%) and social group experienced by the Oyo State Agricultural (9.3%). Development Programme in the last few On cosmopoliteness, the study years (Amusat, 2018) and also lack of reveals that most farmers (40%) barely emphasis on lesser legumes as against moved out of their village and as a result grain legumes like cowpea and soybean. may not be exposed to modern technique The table also reveals that of farming and may also have limited majority of the respondents sourced their knowledge. This will likely affect their inputs from open market (78.7%). This output. may affect the quality of inputs used by The table also reveals that majority of farmers and may likely affect the yield. respondents (37.4%) who grow The table also revealed that majority of underutilised legumes in the study area farmers (53.3%) sourced their seed from were on income of between N130,000- fellow farmers. This may be due to the N170,000 per annum. This is appreciably fact that research institutes with mandate low and an indication that lesser legume on legumes neglected breeding work on does not command good price in the lesser legumes but laid too much market and may also be affected by some emphasis on major legumes like cowpea production constraints which reduce the and soybean to the detriment of the lesser yield. The study also found that most legumes. farmers (37.3%) had 3-4 acres of lesser Table 2: Distribution of respondents preference to legumes. This is in line with the ealier Information channels finding that majority of farmers in Nigeria are small holders cultivating less than 5 Strategies Mean Rank hectares of farm land (Ogunbodede, Radio 0.93 1st Extension Agents 0.92 2nd 2011). The result of the year of experience Farmers guides 0.04 5th in under utilised legume cultivation Television 0.01 6th Mobile phones 0.49 4th revealed that most (25.4%) of the Farmers’ association 0.82 3rd respondents were having 18 years and Source :Field survey,2019 above experience. This implies that underutilised legumes production is an Preference to Information Channels age long farming activity in the study The data in Table 2 reveals that majority area. The result on type of underutilised of the underutilised legume farmers in legumes planted in the study area the study area believed that radio revealed that majority planted pigeon pea ( x=0.93) was the most preferred medium (46.7%) ,followed by lima beans of information channels and it ranked 1st, (24.0%). It was also found that majority Table 3: Distribution of respondents by frequency of the respondents practiced mixed of access to information dissemination strategies cropping (84.0%). This is expected as Strategies Mean Rank mixed cropping is a kind of insurance Radio 1.81 1st among farmers and tend to guide against Extension agents 1.02 3rd Farmers guides 0.38 6th crop failure. Television 0.40 5th Majority of farmers (54.7%) were Mobile Phones 0.94 4th Farmers’ association 1.41 2nd not having regular contact with extension Source :Field survey,2019 272 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 followed by extension agents (x=0.92 ) Table 5: Chi-square analysis of relationship between respondents' personal characteristics and which ranked 2nd, then farmers' information channels among underutilised legumes' rd association (x= 0.82 ) which ranked 3 . farmers in Oke-Ogun area of Oyo state.

This finding validates Yahaya ( 2008) and Variable ÷2 Df p-value Remark Ajayi (2003) which had ealier Sex 0.218 1 0.641 NS Marital status 2.439 3 0.486 NS acknowledge radio as veritable source of Education 10.363 3 0.016 S information. Source : Data analysis,2019 Respondents' personal characteristics Access to Information channels and information channels among Table 3 reveals that majority of the underutilised legumes' farmers in Oke- respondents affirmed that radio (1.81) , Ogun area of Oyo state. farmers' association (1.41) and extension It shows that there was significant agents (1.02 ) are more accessible to difference between farmers' educational farmers on dissemination of information attainment and information channels of on underutilised legumes as compared to farmers in the study area. This implies that television (0.40) and farmers'guides education has roles to play in the (0.38). i n f o r m a t i o n c h a n n e l s u s e d b y underutilized legumes' farmers in the Table 4 Distribution of respondents by constraints study area. The result also shows there to production of underutilised legumes were no significant difference between Constraints Mean (x) Rank the respondents' sex (p= 0.641) and Inadequate seed supply 1.13 6th Poor seed viability 1.78 1st marital status (p=0.486).This implies that

High pest infestation 0.26 10th neither sex nor marriage affects or Disease infestation 0.22 11th influences information channels of Poor yield 1.77 2nd Lack of good market 1.76 3rd farmers. Poor storage quality 1.06 8th Lack of support from government 1.53 4th Inadequate Technology diffusion 1.08 7th Table 6: Relationship between respondents' age on the improvement and information channels among underutilised Too much emphasis on the major 0.93 9th legumes' farmers in Oke-Ogun area of Oyo state. legumes by research Institutes Source : Field survey, 2019 Variable Df r-value p-value Remark Age 3 0.060 0.611 NS Constraints to production of under- Source : Data analysis, 2019 utilised legumes. Table 6 above shows that there was no Table 4 shows that the most serious constraints against production of significant relationship between the age underutilized legumes in the study area of farmers and information channels of were poor seed viability (x = 1.77) and underutilised legumes' farmers in Oke lack of good market (x = 1.53). To –Ogun area of Oyo state. This implies that overcome some of these identified age has nothing to do with information constraints, the need for various channels of respondents in the study government agencies especially area. agricultural research Institutes to carry out study with a view to generate Conclusion and Recommendation technologies that would produce quality Based on the findings, it is evident that seeds and disseminate same to farmers most underutilised legumes' farmers are cannot be over emphasised. male , old, married with fairly large family

273 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019 size and had one form of education or the sustainable agriculture. Retrieved 9 others. Majority preferred radio and June 2016. extension agents as their means of getting Karigidi, M (2018): Promoting neglected information on underutilized legumes and underutilized crops for food while access to radio and farmers' security: accessed at https/www. association was high. The respondents Financial Nigeria .com on 26th were however constrained by poor seed January, 2019. viability, poor yield and lack of good Minnar Gultzan (2017):www science market. The educational attainment of the direct. com/science/article. Assesed respondents influenced their means of on 14,April,2018. getting information on the underutilized Ogunbodede, B.A (2012): Gene Interplay legumes in the study area. It is for Food Security and National Development ,Inaugural lecture on recommended that research institutes th with mandates on grain legumes should 11 ,May 2012 at Obafemi Awolowo endeavor to generate technologies on University, Ile Ife. lesser legumes that are capable of Oladeji,J.O (2011) :Farmers' perception enhancing yield, improving seed viability of Agricultural Advertisement in and grain quality. Nigerian Newspaper in Ibadan municipality, Oyo State. References RFID News (2009): Malaysia begins RFID-enable livestock tracking Ajayi, M.T (2003): Analysis of Mass program” Retrieved 15 March 2013. Media Use by Farmers in Egbeda World Bank (2015): World Bank's Local Government of Oyo State e-sourcebook ICT in agriculture – ,Nigeria. Journal of Extension connecting smallholder farmers to Systems.19920.:45-47pp k n o w l e d g e , n e t w o r k s a n d Amusat, A. S and Oyedokun, M.O institutions” Retrieved 9 June, 2016. (2018):Media Use Pattern of Fish Yahaya, M.K ( 2008 ): Development F a r m e r s i n O l u y o l e L o c a l Communications, Lessons from Government Area, Oyo State, Change and Social Engineering Nigeria. International Journal of Projects:Kraft Books Ltd, Ibadan. Advance Agricultural Research 6 (1) Yekini, O.T. and M.I. Oguntade (2014) : 47-54pp Training needs of woven vegetable Amusat, A (2018): Effectiveness of farmers in Akinyele local government Research Extension. Farmers Input area of Oyo State. International linkage System on Maize production Journal of Tropical Agriculture in Nigeria. Unpublished Phd Theni, Research and Extension (17 (1): Department of Agricultural Extension 38-44 and Rural Development, University Yekini, O.T., Ojeleye, O. O. and of Ibadan. Ladigbolu, T. A. (2015): Use of Ani AO.: Undiandeye UC and Anogie DA coping strategies to manage risks 1997 the role of mass media in encountered in farming activities of agricultural information in Nigeria, rural households in Saki Agricultural Educational forum, 3 (1): 80-85 zome of Oyo State. (Proceeding of the FA O ( 2 0 1 5 ) : I n f o r m a t i o n a n d 20th Annual National Conference of communication technologies for the AESON (15 – 17, 2015) pg 14.

274 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

COMMUNIQUE OF THE 3RD ANNUAL CONFERENCE OF THE SOCIETY FOR UNDERUTILIZED LEGUMES (SUL) HELD AT THE INSTITUTE OF AGRICULTURAL RESEARCH AND TRAINING, OBAFEMI AWOLOWO UNIVERSITY, IBADAN BETWEEN 9TH AND 11TH JULY, 2019

he 3rd Annual conference of the Society for Underutilized Levine (SUL) was held at Tthe Institute of Agricultural Research and Training, Obafemi Awolowo University, Moor Plantation, Apata, Ibadan from the 9th to 11th July 2019. The theme of the conference was 'unraveling the historic values and promotion of underutilized legumes for enhanced production, nutrition, and value addition'. The opening ceremony which took place at the Professor Adebisi Adebowale Training Hall of the Institute was chaired by the Director, Institute of Agricultural Research and Training, Prof. Veronica Obatolu ably represented by the Deputy Director of the Institute, Dr. J. Saka. Dignitaries who attended the occasion were, the Head, Genetic Resource Centre, International Institute of Tropical Agriculture (IITA), Ibadan, Prof. M. Abberton, the representative of the Provost of College of Animal Health and Production Technology, Ibadan, Dr (Mrs) Ogunleke, Non-Governmental Organizations (NGOs) and many others. The president of the society, Dr. Daniel Adewale highlighted the achievements of the society so far and stressed the need to address the problem of food scarcity, insecurity and suggested the incorporation of underutilized legumes into the daily diets of the resource-poor people to alleviate malnutrition. Chairman of Local Organizing Committee, Prof. L.B. Taiwo urged the private sectors to partner with the Research Institutes to commercialize products derivable from underutilized legumes. The keynote speaker, Prof. (Mrs) Henrietta Ene-Obong and the coordinator, Human Nutrition and Dietetics Programme, Department of Biochemistry, Faculty of Basic Medical Sciences, University of Calabar, Cross River State, Nigeria presented a paper on the theme of the conference. Profs. M. O. Ateyese of the Department of Plant Physiology and Crop Production, the Federal University of Agriculture, Abeokuta and K.A. Taiwo of the Department of Food Science and Technology, Obafemi Awolowo University was the lead paper presenters. Over forty (40) papers were presented in the area of genetic improvement of the crops, Agronomy, Physiology, Soil science, Economics, and Extension.

B. Observations Following the deliberations on the lead and technical papers as well as the discussions during the field trip, the society observed as follows: field trip, the society observed as follows: 1. Food insecurity and low supply in Nigeria are threatening the increasing human population and survival in many parts of Nigeria.

2. Several crops that could have tackled the problems of malnutrition, hunger, and rural poverty has been neglected and underutilized.

275 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

3. In Nigeria, many legume crops such as Bambara groundnut, Lima bean, Jack bean, African yam bean, Pigeon pea, and Lupin are previously used as an important source of proteins, edible fats, fiber, minerals, and other nutritional components are on the verge of becoming scarce.

4. There are inadequate efforts in the area of agronomic, genetic, and food research on these potentially important crops.

5. The society also notes that in spite of the importance of these crops, they remain poorly documented and neglected by the mainstream research, international scientific communities, the industries, and development activities when compared to rice, corn (Zea mays), and wheat.

6. The neglect has resulted in a lack of genetic improvement, resulting in inferior yield in terms of both quality and quantity.

C. Resolutions Given the importance of these crops to human nutrition, social-economic development of the resource-poor households and the generality of the people and considering the roles they play in food security, the society resolved as follows: 1. That there is the need to intensify and carry out more research on the underutilized legumes to provide the evidence of their benefit and create the needed awareness among the general population and policymakers.

2. That every effort must be made to reintroduce the underutilized species into the dietary pattern of society to avoid their complete extinction and that there is the need to create database and repositories of information on economic, social, nutritional and other benefits of underutilized legumes to always provide evidence for all these aspects

3. Those appropriate technologies must be developed for processing these legumes into ready to use products and new foods to remove the laborious processing employed in their preparation for consumption.

4. Develop better varieties that will eliminate many of the anti-nutritional factors, hard-to-cook phenomenon and beany flavor of some of the legumes to enhance acceptability and promote the use

5. Agricultural policies should focus on specific underutilized legumes for promotion, conservation, and use

6. That a multi-stakeholder group like the Society for Underutilized legumes could act as the advocacy group to promote the production and use of the underutilized legumes

276 Proceedings of the 3rd Annual Conference of the Society for Underutilised Legumes (SUL) 2019

7. National and International agencies should advocate for the inclusion of underutilized legumes into nutrition policies and crop diversification programs.

D. Appreciation The society appreciates the warm reception by the Institute of Agricultural Research and Training. The contribution of the International Institute of Tropical Agriculture is well acknowledged and appreciated.

Prof. L. B. Taiwo Dr. Daniel B. Adewale LOC Chairman National President

277