Pest and Pathogen Complexes in Key Crops Described and Analyzed
Total Page：16
File Type：pdf, Size：1020Kb
Output 1: Pest and pathogen complexes in key crops described and analyzed. Activity 1.1. Rapid identification of Colletotrichum lindemuthianum-specific microsatellite markers using 5’anchored PCR. Contributors: G. Mahuku; M.A. Henriquez and M. Navia Highlight: We identified and developed primers specific to 16 microsatellite loci in the bean anthracnose pathogen, Colletotrichum lindemuthianum, and showed the potential of these primers to distinguish between Andean and Mesoamerican groups and to provide information on the genetic structure of the pathogen. Rationale Knowledge of the genetic structure of plant pathogen populations is important because the amount of genetic variation that is maintained in a population reflects the capacity of a pathogen to evolve, information which is important in choosing the most effective control strategy (Burdon, 1993, Genetic Variation in pathogens populations and its implications for adaptation to host resistance, In: Durability of Disease resistance (Jacobs, T., Parleviet [eds]), Kluwer, Dordrecht, pp 41-56; McDonald & McDermott, 1993, Bioscience 43: 311-319). The distribution of genetic variation can be used to select the most effective resistance gene(s) that are better suited to manage pathogen populations in a given locality. Several tools have been used to characterize C. lindemuthianum, but the lack of a standardized molecular system makes it impossible to compare data coming from different laboratories and to have a concerted (unified) effort (strategy) for developing anthracnose management strategies. A standard set of differential cultivars is used. Although this has greatly facilitated comparison of data, the process is long and tedious, and subject to environmental conditions. Where conditions for inoculum preparation, inoculation and humidity are not controlled, the procedure is not precise. Several types of molecular markers have been used, but there are disadvantages with many of these. For example, although RAPD-PCR has high resolution, and is simple to carry out, it requires exquisite control to achieve robustness. AFLPs are also very informative but require careful optimization of conditions for restriction enzyme activity, ligation of adapters and PCR. Microsatellites are tandemly repeated copies of short nucleotide sequences that are useful for PCR-based DNA typing of fungi. Once developed, microsatellites behave like RAPD markers with the added advantage of robustness. We used the 5’ anchored PCR method (Fisher et al., 1996, Nucleic Acid Research 24: 4369-4371), to identify microsatellite loci without the expenses of library screening. We report the isolation and characterization of microsatellite loci in the bean anthracnose pathogen C. lindemuthianum. Materials and Methods Fungal isolates and DNA extraction : Four C. lindemuthianum isolates previously characterized on a set of 12 anthracnose differential varieties and classified as Andean (two) and Mesoamerican (two), were used in this study. Isolates were recuperated from lyophilizaed samples. Mycelia production and DNA extraction was according to the method described by Mahuku et al. (2004, Plant Molecular Biology Reporter 22: 71-81). The DNA quality was assessed by electrophoresis in a 0.7% agarose gel and the quantity measured using the fluorometer (Hoefer® DyNA Quant 2000, Pharmacia Biotech, USA) and adjusted to 10 ng/µl in 0.1X TE buffer. A further 35 isolates 12 representative collected from Andean and Mesoamerican regions were used to standardize cycling protocol and test the suitability of developed microsatellites. RAMs PCR, sequencing and mi crosatellite identification: A series of degenerate di – and tri - nucleotides microsatellite primers anchored at the 5’ end (Table 1.1.1), were used to amplify genomic DNA from two Andean and two Misoamerican isolates. The 3’end of each primer was complemenatry to a common fungal repetitive sequence whilst the 5’end provided a degenarate anchor sequence to avoid slippage. The rationale behind this design was that if the primer annealed to two close and inverted simple sequences repeats, then the region between them, which may also contain repetitive sequences would be amplified. The conditions of the PCR amplification were according to Ganley and Bradshaw (Ganley and Bradshaw, 2001, Mycological Research 105: 1075-1078), in an MJ100 PTC model thermal cycler. PCR products were separatyed on 1.5% agarose gels. For each degenerate primer, descrite bands in the 600-1200 bp region were excised from the gels, gel purified with a QiaEX II gel Extraction Kit (QIAGEN) and cloned with a pGEM easy vector kit (INVITROGEN). Plasmid DNA was obtained and sequnced using the ABI PRISMTM 377 DNA automated sequencer (Perkin Elmer). DNA sequences were analysed using Seqman within DNAStar (DNAStar, Madison, WIS. USA) and PCR products containing repeated sequences were selected. Specific primers flanking the region of microsatellites were designed using Primer3 software (Center for Genome Research, Whitehead Institute, MA, USA - http://www-genome.wi.mit.edu/cgi-bin/primer/primer3), and commercially synthesized (Integrated DNA Technologies, Inc., Coralville, IA, USA). These primers were tested first on four isolates and on an additional set of 35 isolates representative of Andean and Mesoamerican groups. Table 1.1.1. 5’anchored primer sequences (5’to 3’). ID Sequence PTC1 KKYHYHY(GA)6 PTC3 KKYNSSH(AAG)5 PTC4 KKVRVRV(CT)6 PTC5 KKVRVRV(TG)6 PTC6 KKBNVSS(GATA)4 Results and Discussion Amplification of four C. lindemuthianum isolates using the anchored primers gave distinct ‘RAPD-type’ DNA profiles; and example with the anchored PTC1, PTC4 and PTC5 primers are shown in Figure 1.1.1. No products were observed for PTC3 and PTC6 primers (Figure 1.1.1). Reproducible profiles were seen in replicate tests for all primers. Potentially informative microsatellite loci were identified by selecting anchored-PCR products from gels on the basis of their consistent amplification or their apparent uniqueness to an individual isolate. Thirty such PCR products were purified, cloned and sequenced. Sixteen of the cloned microsatellite loci were chosen for further assessment on the basis of the size of the microsatellite repeat or the number of repetitive sequences present. For each of these a locus-specific primer was designed so that a PCR product of approximately 100-500 bp in length would be obtained when used in conjunction with the anchored primer or in pairs. Seventeen 13 primer pair combinations were obtained; eight of which gave single PCR products, one gave two, one gave four, and six consistently gave multiple PCR products (Figure and Table 1.1.2). Figure 1.1.1. PCR amplification products from Colletotrichum lindemuthianum isolates obtained using the anchored PTC1, PTC3, PTC4, PTC5, and PTC6 primers. Lane 1 and 2 are C. lindemuthianum Andean isolates while lanes 3 and 4 a Mesoamerican isolates. Lane 5 is negative control (no fungal DNA was added) and lane M is the 100 bp molecular size marker. NO products were obtained with PTC3 and PTC6. Figure 1.1.2. Microsatellite length variation between Andean and Mesoamerican isolates of Colletotrichum lindemuthianum isolates. Lanes 1 and 2 are Andean isolates; lanes 3 and 4 are Mesoamerican isolates, lane 5 is negative control (no DNA added), lane M is 100 bp molecular size marker. We are in the process of optimizing the annealing temperature so that single fragments are consistently amplified, after which we will test promising microsatellite primers on 35 Andean and Mesoamerican isolates from different regions where anthracnose of common bean is a serious problem. Preliminary evaluation of nine C. lindemuthianum isolates collected from Andean and Mesoamerican beans and regions using primers specific to the Anth.CL_006 loci revealed four alleles (Figure 1.1.3), while amplification of 35 isolates from a world-wide collection using Anth.CL001 primer pair revealed two alleles, one that was consistently associated with isolates belonging to the Andean group, and another of isolates belonging to the Mesoamerican group (Figure 1.1.4). These preliminary results show the potential of these markers to distinguish between Andean and Mesoamerican groups and for population genetic studies. 14 ableT 1.1.2. Polymorphic microsatellite loci for the bean anthracnose pathogen, Colletotrichum lindemuthianum. Primer sequence 5’ to ’3 # of ocusL Foward Reverse alleles Repeat type size range Anth.CL_001 TGCTCACGAGAGAGAGAGAGAGTGACAGCAACCAGAAGG T multiple PTC1 271 Anth.CL_002 TGAGACTCTCTCTCTCTTCCG GAGGATGTGGAGGTAGCAA 2 PTC4 46 Anth.CL_003 AGGCCTCTCTCTCTCT CAGAAACAAACAGAGGAG multiple PTC4 243 Anth.CL_004 TCATGTCTACTCGTACTCCTGAGGTAG ACGG GACTCTGAC multiple PTC4 400 Anth.CL_005 CCCTCAACCTCTTTGCTGAG GGTAGG GACGGACTCTGAC PTC4 234 Anth.CL_006 TGCGGTATCCGTAGTATG GCAGGCGTGATATAATCGG T 2 PTC 5 270 Anth.CL_007 GCGATGTTCTCGGCTACCTA ACAAATGGTAAGTCGG 2 PTC5 239 Anth.CL_008 TGCTGG TTATCAACGG ACCT ACCCCGTTATCATACGG 4 PTC5 243, 1200 Anth.CL_009 TCTCTAACAGGTGGCGAAGC GTGTGTGTGTGTGCGTGTGT multiple PTC5 274 Anth.CL_010 TAGTGACAGACGG AGGTC GCCATCGTTCGTCACAT 2 PTC5 289 Anth.CL_011 GATGTGTGTGTGTGTTG ATGATTCGATTGCGATCTCG multiple PTC5 641 Anth.CL_012 TACCTATCTGGTCGAAGG AGGAGGAGATGG CGAAGT 2 PTC5 335 15 Anth.CL_013 GCGATGTGTGTGTGTGGTG GCAGCTCCGTTCACATCAA 4 PTC5 500 Anth.CL_014 TCAGTGGTGTGTG TGTGTG CCCATCG TTTGTATGCCTGT multiple PTC5 184 Anth.CL_015 CATACAAAGG ATGGCATGG G ACCCCTAGACGAGTTGG GAT 2 PTC5 340 Anth.CL_016 AATAAAGG CCCTGT CAAA GTCAGACACAGACACTTCTCG 2 PTC5 248 Figure 1.1.3. PCR amplification of