The Gall-Inducing Habit Has Evolved Multiple Times Among the Eriococcid Scale Insects (Sternorrhyncha: Coccoidea: Eriococcidae)

Blackwell Science, LtdOxford, UKBIJBiological Journal of the Linnean Society0024-4066The Linnean Society of London, 2004? 2004 834 441452 Original Article

MULTIPLE ORIGINS OF GALLING IN ERIOCOCCIDS L. G. COOK and P. J. GULLAN

Biological Journal of the Linnean Society, 2004, 83, 441–452. With 2 figures

The gall-inducing habit has evolved multiple times among the eriococcid scale insects (Sternorrhyncha: Coccoidea: Eriococcidae)

L. G. COOK* and P. J. GULLAN†

School of Botany and Zoology, The Australian National University, Canberra, ACT, 0200, Australia

Received 7 August 2003; accepted for publication 20 February 2004

The habit of inducing plant galls has evolved multiple times among insects but most species diversity occurs in only a few groups, such as gall midges and gall wasps. This phylogenetic clustering may reﬂect adaptive radiations in insect groups in which the trait has evolved. Alternatively, multiple independent origins of galling may suggest a selective advantage to the habit. We use DNA sequence data to examine the origins of galling among the most speciose group of gall-inducing scale insects, the eriococcids. We determine that the galling habit has evolved multiple times, including four times in Australian taxa, suggesting that there has been a selective advantage to galling in Australia. Additionally, although most gall-inducing eriococcid species occur on Myrtaceae, we found that lineages feeding on Myrtaceae are no more likely to have evolved the galling habit than those feeding on other plant groups. However, most gall-inducing species-richness is clustered in only two clades (Apiomorpha and Lachnodius + Opisthoscelis), all of which occur exclusively on Eucalyptus s.s. The Eriococcidae and the large genus Eriococcus were determined to be non-monophyletic and each will require revision. © 2004 The Linnean Society of London, Biological Journal of the Linnean Society, 2004, 83, 441–452.

ADDITIONAL KEYWORDS: adaptive radiation – Apiomorpha – Eriococcus – Eucalyptus – galling – host speciﬁcity – Myrtaceae.

INTRODUCTION Phylogenetic clustering of gall-inducing species is also apparent among the scale insects. Although gall The habit of inducing galls on plants has evolved mul- inducers are known from ten coccoid families, the tiple times among phytophagous insects, occurring in highest proportion (about 47%) of the more than 230 at least six orders. However, although there are more gallicolous species (Ferris, 1950; Beardsley, 1984; Gul- than 13 000 species of gall-inducing insects (Dreger- lan, 1984a; Ben-Dov, Miller & Gibson, 2003; Gullan, Jauffret & Shorthouse, 1992), most species diversity Miller & Cook, 2004) belongs to the Eriococcidae. This is clustered in only a few insect groups, such as proportion is even greater (about 57%) if species that the gall-midges (Diptera, Cecidomyiidae) (Dreger- produce only simple pits or depressions are excluded, Jauffret & Shorthouse, 1992) and the gall-wasps because almost all eriococcid gallers induce complex (Hymenoptera, Cynipidae) (Ronquist & Liljebblad, galls. The gall shapes are recognizably species-speciﬁc 2001). The phylogenetic clustering suggests that the and structural complexity is often considerable, with taxonomic distribution of species diversity reﬂects the gall induced by a female sometimes resembling a radiations in those groups that have evolved the habit fruit or other organ typically not found on that host rather than many independent origins of the ability to plant. The shape of the gall appears to be independent induce plant galls. of the host-plant species and the host-plant organ on which the gall grows and is determined by the species and sex of the scale insect (Gullan et al., 2004). Sexual dimorphism of gall morphology is apparent among *Corresponding author. E-mail: [email protected] †Current address: Department of Entomology, University of most eriococcid species in which males are known to California, Davis, CA 95616-8584, USA induce galls.

442 L. G. COOK and P. J. GULLAN

The high number of galling eriococcids is not 2. multiple origins of galling in separate lineages, because of a numerical dominance by the Eriococcidae, suggesting that a common factor, such as a partic- which is only a distant fourth among the scale insect ular environmental condition, may have promoted families in terms of total number of species (Ben-Dov the evolution of the gall-inducing lifestyle. et al., 2003). Therefore, another explanation is needed The study includes a broad taxonomic and geograph- to explain the prevalence of gall-inducing taxa in this ical range of eriococcids, both galling and non-galling. group. The speciose genus Apiomorpha is represented for the Gall-inducing insects in general are prevalent in first time in a molecular analysis of the Eriococcidae. regions dominated by sclerophyllous vegetation (Price et al., 1998; Wright & Samways, 1998), leading to an argument that there is a selective advantage to galling METHODS in these habitats or intrinsic features of sclerophyll communities that may favour speciation among SPECIMENS AND DNA EXTRACTION gallers (e.g. Mendonça, 2001). Although only 27% of Exemplars were chosen to sample the diversity of the eriococcid species worldwide occur in Australia, more Eriococcidae and to increase representation of groups than 80% of eriococcid gall-inducers occur in Australia whose placements in an earlier molecular study (Cook (Miller & Gimpel, 2000; Gullan et al., 2004), predom- et al., 2002) were controversial. In particular, this inantly on sclerophyllous plants of the Myrtaceae. If study includes Eriococcus williamsi Danzig, the mor- the gall-inducing eriococcid taxa belong to only one or phological sister taxon of E. buxi, and both described a few lineages, then an extensive radiation in those species of Cylindrococcus as well as additional repre- groups may explain the prevalence of galling. How- sentatives of Beesoniidae and Stictococcidae. Pseudo- ever, if galling has evolved many times within Erio- coccidae, previously identified as a suitable outgroup coccidae another explanation, such as common (Hodgson, 2001; Cook et al., 2002), was used to polar- ecology, may be required. ize trees. The taxa used, their current taxonomic clas- Several recent studies have conflicted in their sug- sification, hosts, gall type (if applicable) and collection gested relationships among Australian gall-inducing localities are given in Table 1. Voucher specimens of eriococcids. A molecular phylogeny of the scale insects Australian taxa will be lodged in the Australian (Cook, Gullan & Trueman, 2002) suggests that galling National Insect Collection (ANIC), CSIRO, Canberra, has evolved at least twice among the eriococcids. Australia. Although some of the Australian eriococcid gallers Embryos and/or ovarian tissues were dissected from formed a monophyletic group, the Casuarinaceae- larger females. Small females and eggs were homoge- feeding galling genus Cylindrococcus appeared to be nized whole. DNA was extracted from fresh or etha- more closely related to the non-galling type species of nol-preserved specimens of embryos, eggs and/or Eriococcus (E. buxi Boyer de Fonscolombe), and to ovarian tissues using the salting-out method of Sun- Beesoniidae and Stictococcidae. However, only one nucks & Hales (1996). A single chloroform wash was representative of each of the two latter taxa was performed prior to precipitation if solids or excessive included in the study and Apiomorpha, the most spe- pigments were present. ciose gall-inducing scale insect genus, was not represented at all. Hodgson’s (2001) phylogenetic study of adult male morphology also places Beesoniidae PCR AND SEQUENCING (which contains several gall-inducers) and Stictococ- The 5¢ region of the small subunit ribosomal RNA gene cidae among the eriococcids but generic placements (SSU rRNA) was amplified using the primers 2880 differ from those in Cook et al. (2002). Hodgson’s [for] (5¢-CTGGTTGATCCTGCCAGTAG) (Tautz et al., study suggested that the Australian gall-inducing 1988) and B- [rev] (5¢-CCGCGGCTGCTGGCACCAGA) genera Apiomorpha, Cystococcus, Lachnodius and (von Dohlen & Moran, 1995). Two new internal Opisthoscelis were related to each other. However, primers (E10for: GGAAGGAACGCTCTTATTAG, Hodgson’s results should be treated with caution and E10rev: CGGTTTTGATCTAATAAGAGC) were because male morphology may be subject to conver- designed for this region for Apiomorpha. An internal gent selection in galling taxa. region of Elongation Factor 1-alpha (EF-1a) was In this study, we used DNA sequence data from amplified using primers M44-1 and rcM52.6 (Cho three gene regions (two nuclear and one mitochon- et al., 1995). These primers did not amplify EF-1a drial) to investigate whether the observed species in all scale insects and new primers (EF-1a[a]for: richness of gall-inducing eriococcids in Australia may GATGCTCCGGGACAYAGAG and EF-1a[c]rev: best be explained by: GGTTTCAAGACACCAGTTTC) were designed inter- 1. an evolutionary radiation (possibly adaptive) nal to the original primers. An internal region of the within a single lineage, or mitochondrial COII gene was amplified using the

MULTIPLE ORIGINS OF GALLING IN ERIOCOCCIDS 443 primers C2-J-3400 (Liu & Beckenbach, 1992) and C2- mented in PAUP* 4.0b10 (Swofford, 2002) for each full N-3661 (Simon et al., 1994). data set and separately for third positions in COII Each reaction (25 mL) contained 5 pmol of each and EF-1a. Substitutional saturation was assessed primer, 10 mM Tris/HCl (pH 8.3), 3 mM MgCl, 50 mM by plotting the transition–transversion ratio (ti/tv) KCl, 0.2 mM of each dNTP, 1 unit of Taq-polymerase against genetic distance and checking whether the (Fisher Taq F1, Biotech) and 2 mL of template. Ampli- curve had levelled. fication was carried out in a Corbett Research FTS-960 A variety of different approaches to phylogenetic thermal sequencer using 45 s denaturation at 94 ∞C, reconstruction were used, primarily to guard against 30 s extension at 72 ∞C and using a 5 ∞C stepdown pro- undetected violations of underlying assumptions in gramme for annealing, with the first cycle at 65 ∞C and any one model. It was assumed that, when different annealing in later cycles reduced by 5 ∞C after every models and weighting schemes resulted in the same second cycle until reaching 55 ∞C (40 ∞C for COII). An topology, the resultant phylogeny was robust in additional 35 cycles were run with annealing set at respect of inference method. Robustness does not 55 ∞C (40 ∞C for COII). PCR products were precipitated imply that the phylogeny is accurate. Congruence and purified using ammonium acetate/ethanol (1 : 10) among data sets provides increased confidence of rela- precipitation followed by a 70% ethanol wash. PCR tionships (Miyamoto & Fitch, 1995). products that contained minor bands were individu- Bootstrap tests (Felsenstein, 1985) were conducted ally excised from a 1% agarose gel following electro- for maximum parsimony (MP) and distance-based phoresis and purified using a BRESAclean DNA analyses using 1000 replicates and the same settings purification kit (GeneWorks cat. no. BT-3000) follow- as the original analyses. The inferred amino acid ing the manufacturer’s instructions. A 10-mL sequenc- sequences were not used for phylogenetic analyses ing reaction was carried out using ABI (Perkin-Elmer) because the nucleotide compositional bias, and/or BigDye v.2 terminator chemistry following the manu- codon bias, may affect the inferred amino acid facturer’s instructions. Sequencing was performed sequence (Foster, Jermiin & Hickey, 1997; Singer & using an ABI Prism 377 automated DNA sequencer. Hickey, 2000) and therefore exacerbate, rather than All DNA fragments were sequenced in both the for- correct for, compositional bias. ward and the reverse directions.

BAYESIAN INFERENCE PHYLOGENETIC ANALYSIS Bayesian analyses were performed using MrBayes Sequences were edited using Sequencher 3.02 (Gibbs (Huelsenbeck & Ronquist, 2001) assuming a GTR+G & Cockerill, 1995) and the protein encoding regions model. Each run comprised four chains starting from (COII and EF-1a) were checked for the presence of random trees, and 500 000 generations with trees stop codons in putative exons. A similarity search was saved at each ten. Five runs were performed for each performed on all sequences using the ‘basic blast’ data set to check for convergence among runs. The option (Altschul et al., 1997) at the NCBI website majority rule consensus tree was calculated after the (http://www.ncbi.nlm.nih.gov/BLAST/). The SSU removal of trees saved during the ‘burnin’ period. rDNA data were aligned by eye with reference to the predicted secondary structure model for eukaryote nuclear SSU rRNA (Van de Peer et al., 1998). Some MAXIMUM PARSIMONY highly variable regions, particularly E10 helices of V2, Heuristic searches comprising 100 random addition did not have the same predicted secondary structures sequence starting trees, TBR branch swapping and no and were not able to be unambiguously aligned across maxtrees restrictions were performed using PAUP* all taxa. Alignable groups of sequences were offset 4.0b10 (Swofford, 2002). The SSU rDNA alignment with respect to other such groups. The introns of EF- was analysed under two weighting schemes: equal 1a also were not able to be aligned across taxa and weights, and the V2 region weighted half that of the were excluded from further analyses. Sequence data more conserved regions. Two weighting schemes for from each gene region were analysed separately codon position (1st : 2nd : 3rd = 2 : 3 : 1 or 4 : 6 : 1) because not all taxa could be ampliﬁed for COII or EF- were used for the protein coding regions. Analyses 1a. Additionally, the three data sets represent two were also run for COII with third codon positions genomes under different modes of inheritance. excluded. Most methods of phylogeny reconstruction assume that the base composition is at equilibrium (stationary), with the base composition of homologous DISTANCE sequences the same for all taxa under study. Station- The LogDet model (Lockhart et al., 1994) was used arity was tested using a chi-squares test as imple- because base composition of third codon positions of

444 L. G. COOK and P. J. GULLAN ) a EF-1 Cactaceae, GenBank Accession ( No. = Sapindaceae, = ) COII GenBank Accession ( No. Myrtaceae, Myrtaceae, Sn Casuarinaceae, Ct Casuarinaceae, = = GenBank Accession (18S) No. Cornaceae, Cs Cornaceae, Lamiaceae, Lamiaceae, M = = N/A AY795513 AY791955 AY795493 stem swelling AY795525 – AY795488 enclosing AY795522 – – enclosing AY795524 – AY794591 enclosing AY795535 – AY795504 N/A AY795517 – – enclosing AY795523 AY791951 – enclosingenclosingenclosing AY795554/5 AY795551 AY791963 – AY795499 AY791962 AY795501 – AY795500 enclosing AY795552/3 AY791964 – Gall type N/AN/A AY795506 – AY795508 AY791948 – – M

Cs rosette AY795515 AY791956 AY795492 Cs rosette AY795516 AY791957 –

Icacinaceae, Icacinaceae, L W

M M M M M Cu N/A AY795505 – AY795483 =

M Cr N/A AY795547 – – M M

I Cu N/A AY795507 – AY795484 Ct N/A U20402 – –

Fg N/A AY795511 – –

† Ct N/A AY795538 – AY795502 M

? M N/A AY795518 – –

? D rosette AY795512 – – B

Sn N/A AY795539 – AY795498

elwitschia Acer Buxus Allocasuarina Leptospermum Griselinia Melaleuca Allocasuarina Corymbia Apodytes Baeckia Kunzea Corymbia Eucalyptus Eucalyptus Eucalyptus Eucalyptus Opuntia Opuntia Shorea Quercus Host genus Callitris Eucalyptus Calocedrus W Fagaceae, Fagaceae, I = Fabaceae, Fabaceae, Fg = Gullan Australia

Ericaceae, Ericaceae, Fb = Maskell Australia

Maskell Australia (Tepper) Australia

Beardsley * N/A U20429 – – Fuller Australia

illiams Australia akagi Malaysia (Froggatt) Australia (Maskell) Australia

roggatt Australia De Lotto Australia

T W

(Cockerell) *

F Brain South Africa

(Kuwana) Japan

(Maskell) New Zealand

(Maskell) Australia (Ehrhorn) USA (Froggatt) Australia

Schrader Australia

(Signoret) Hungary

(Boyer de Fonscolombe) France

sp. Australia

sp. Africa

Dipterocarpaceae, Dipterocarpaceae, E elwitschiaceae) = W

aracoccus = Eriococcus aceris Eriococcus buxi Eremococcus turbinata ‘callo2’ Eriococcidae sp. Australia Cylindrococcus spiniferus spinosus Eriochiton Cylindrococcus casuarinae Cystococcus echiniformis Calycicoccus merwei Calycicoccus Callococcus pulchellus Callococcus acaciae Apiomorpha spinifer Apiomorpha strombylosa Ascelis praemollis Apiomorpha munita tereticornuta Apiomorpha minor Dactylopius confusus Gallacoccus heckrothi Dactylopius austrinus Pseudococcus callitris Pseudococcus Beesonia napiformis Dysmicoccus neobrevipes Ehrhornia cupressi P Coccoidea species used in this study. Family classiﬁcation of host genus is shown after name (Cr Family Coccoidea species used in this study. Cupressaceae, Cupressaceae, D Sapotaceae, Sapotaceae, W = = able 1. lassiﬁcation Species Source *von Dohlen & Moran (1995). not native to collection locality. †Introduced species, Eriococcidae Dactylopiidae St Current family c Beesoniidae Pseudococcidae T Cu

© 2004 The Linnean Society of London, Biological Journal of the Linnean Society, 2004, 83, 441–452 MULTIPLE ORIGINS OF GALLING IN ERIOCOCCIDS 445 ) a EF-1 GenBank Accession ( No. ) COII GenBank Accession ( No. GenBank Accession (18S) No. Gall type rosette AY795527 AY791950 AY795487 blister AY795519 – – N/A AY795541 – – rosette AY795526 – – N/A AY795548 – AY795496 N/A AY795544 – – N/A AY795549 AY791961 AY795495 N/AN/A AY795545 AY795546 – – – – pitenclosingN/A AY795520 AY795528 AY791954 AY795550 AY795489 – – AY795485 – N/A AY795531 – – N/AN/A AY795534 AY795529 – – – – N/Apit/enclosing AY795521 AY791953 AY795514 AY795490 – – N/A AY795530 AY791949 – N/A AY795543 – – N/A AY795542 AY791960 – N/A AY795540 AY791959 AY795497 St N/A AY795509 – AY795494 M

Cs N/A AY795532 – – Ct N/A AY795536 – AY795503

E P N N M M M M M M M M M

Cs N/A AY795533 AY791954 AY795486

M M

U Fb leaf fold AY795537 AY791958 –

Fb N/A AY795510 – – P

B b

odocarpus Host genus Chrysophyllum Melaleuca Acacia Ulmus Eucalyptus Hakea Olneya Pseudopanax Melaleuca Eucalyptus Eucalyptus Eucalyptus Leptospermum Casuarina Eucalyptus Nothofagus Eucalyptus Leucopogon Nothofagus P Eucalyptus Prostanthera Eucalyptus Buxus Mammillaria Eucalyptus Allocasuarina roggatt Australia roggatt Australia F Gullan & Strong Australia

Green Australia

Hoy New Zealand Maskell Australia roggatt Australia

Maskell Australia

Green Australia (Maskell) Australia

Cockerell Nigeria Danzig Georgia Cockerell USA Maskell Australia Maskell sp.2 Australia Maskell sp.1 Australia e (Maskell) New Zealand

roggatt Australia Hoy New Zealand Richard Kenya (Modeer) USA

Maskell Australia F

socialis pustulans ferrugineus ’ ’ ’ sp. ‘Nc’sp. Australia

sp. Australia sp. Australia

sp. ‘Hakea’sp. Australia sp. ‘CA1’sp. USA

Sphaerococcus Sphaerococcus Sphaerococcus Stictococcus sjostedti Hockiana insolitus Hockiana ‘ Eriococcus spurius ‘ Eriococcus ‘ Eriococcus Scutare lanuginosa Eriococcus irregularis Eriococcus leptospermi Eriococcus serratilobis Opisthoscelis mammularis Ourococcus Phacelococcus subcorticalis Eriococcus fossilis Madarococcus viridulus Madarococcus Lachnodius Madarococcus totara Eriococcus eucalypti Eriococcus williamsi Eriococcus coriaceus Eriococcus eucalypti Eriococcus tepperi Eriococcus coccineus Eriococcus casuarinae lassiﬁcation Species Source Current family c *von Dohlen & Moran (1995). not native to collection locality. †Introduced species, Stictococcidae

© 2004 The Linnean Society of London, Biological Journal of the Linnean Society, 2004, 83, 441–452 446 L. G. COOK and P. J. GULLAN both COII and EF-1a varied significantly among taxa taxa share the trait of interest. Host plants were (i.e. non-stationary). Characters were weighted by assigned to one of two categories: Myrtaceae or ‘other codon position (2 : 3 : 1) and a minimum evolution family’. Myrtaceae was treated separately because it search criterion was used. is the dominant host family in terms of eriococcid species richness. Myrtaceae was further divided into either Eucalyptus or ‘other genus’. Species of eriococ- TRAIT MAPPING cids were identified as being either galling or non-gall- The gall-inducing habit was mapped onto the SSU ing. Categories in which both galling and non-galling rRNA tree because it was generated using sequences taxa occur were scored in counts for both. If one host- from all taxa and was not strongly contradicted by plant taxon is more favoured during the evolution of either of the other two data sets. The putative origins the gall-induction habit it should support more lin- of galling were assessed by MP optimization using eages of gall-inducers than do other host-plant taxa. ACCTRAN (accelerated transition) and DELTRAN However, if a host-plant taxon is favoured by eriococ- (delayed transition) but other data, such as adult cids irrespective of whether or not they induce galls female morphology, also were considered. then this should to be taken into account in assessing Data on host use and gall-inducing habit (Tables 1 host-use bias. and 2) were obtained from Miller & Gimpel (2000), Gullan et al. (2004), ScaleNet (Ben-Dov et al., 2003) RESULTS and our unpublished records to determine whether there may be a host-preference bias among Australian There was no well-supported conflict among DNA gall-inducing eriococcids. Three hierarchical catego- sequence data sets (Figs 1, 2), although the resolution ries of taxon assemblages were used: species, genera among some of the terminal taxa differed. For exam- and lineages, with lineages being clades in which all ple, Apiomorpha was not recovered as a monophyletic group using EF-1a (Fig. 2A) despite strong support in the other two data sets. There was low support for Table 2. The host affiliations of all described species of most nodes in the COII data set (Fig. 2B), probably Australian Eriococcidae. Numbers in parentheses refer to owing to substitutional saturation in all codon posi- the number of taxa (galling/non-galling). Lineages are tions (>30% divergence). Similarly, third codon posi- those identified from phylogenies derived in this study and tions were saturated in EF-1a and there were only 25 do not include all described genera. Totals are not neces- potentially informative sites among first and second sarily the sum of observations because taxa with hosts codon positions. in more than one category are scored for each category. The gall-inducing eriococcids did not form a mono- Host genus is shown only for taxa feeding on species of phyletic group in any of the analyses. Three main Myrtaceae clades of eriococcids, each comprising both gall-inducing and non-galling taxa, were recovered from all Other plant three data sets. The ‘BSE’ clade comprises represen- Host family Myrtaceae families Total tatives of three previously recognized families: Beeso- species 125 (82/43) 32 (3/29) 154 (85/69) niidae, Stictococcidae and Eriococcus s.s. genera 17 (11/8) 5 (2/3) 20 (13/9) (Eriococcidae), thus rendering the Eriococcidae non- lineages 11 (7/6) 6 (3/4) 12 (10/9) monophyletic. The ‘A’ (acanthococcid) clade contains a range of taxa including Dactylopius (Dactylopiidae), the gall-inducing Apiomorpha and Eriococcus aceris Host genus Eucalyptus s.s. Other genera (Signoret), the type species of Acanthococcus if Erio- species 93 (66/27) 32 (16/16) coccus and Acanthococcus are recognized as separate genera 12 (7/6) 6 (5/3) genera (Melville, 1982). The ‘G’ (Gondwanan) clade lineages 6 (3/4) 6 (4/2) comprises species from Australia and New Zealand and contains the subclade ‘MF’ (Myrtaceae-feeding) in

Figure 1. Reconstruction of the evolution of the gall-inducing habit in the Eriococcidae on a phylogeny derived from SSU rDNA (18S) data using Bayesian analysis (GTR+G model). Bayesian posterior probabilities are shown above branches and maximum parsimony bootstraps are indicated below. Gall-inducing lineages are indicated by thick lines, with gall-type shown next to the taxon labels. Gall-type refers only to galls induced by females. An inferred loss of the gall-inducing habit is indicated by dashed lines. A schematic of adult female morphology is shown on the right of taxon labels. An inferred plesiomorphic eriococcid morphology is exempliﬁed by Eriococcus and Madarococcus species; appendage loss and/or changes in body shape are associated with gall living.

Ehrhornia cupressi 96 Dysmicoccus neobrevipes 93 76 Paracoccus sp. 59 Pseudococcus callitris Pseudococcus sp. BSE 100 Stictococcus sjostedti 100 Hockiana insolitus 94 90 Beesonia napiformis 57 Gallacoccus heckrothi 57 100 Eriococcus buxi 100 94 Eriococcus williamsi 98 98 Cylindrococcus spiniferus 98 Cylindrococcus casuarinae Callococcus acaciae MF 94 G 91 54 Callococcus pulchellus 89 "Sphaerococcus" pustulans 98 90 Opisthoscelis mammularis 76 Lachnodius sp. Eremococcus turbinatus 52 100 99 Ascelis praemollis 64 67 Cystococcus echiniformis Eriococcidae sp. "callo2" 99 92 89 "Sphaerococcus" ferrugineus "Sphaerococcus" socialis 93 100 73 59 100 Madarococcus sp. "Nc" 100 99 Madarococcus viridulus 52 53 Eriococcus eucalypti sp.1 85 Eriococcus eucalypti sp.2 100 Eriococcus casuarinae 66 95 Eriococcus fossilis Madarococcus totarae Calycicoccus merwei 100 A 99 Eriococcus coccineus 100 66 97 Eriococcus sp. "CA1" 62 100 Dactylopius confusus 100 Dactylopius austrinus 80 Eriococcus aceris 100 84 Eriococcus spurius 79 Eriococcus hakeae 93 Eriococcus coriaceus Eriococcus tepperi 96 68 69 Eriococcus serratilobis Eriococcus irregularis Gall type Eriococcus leptospermi Eriochiton spinosus leaf fold Scutare lanuginosa pit Phacelococcus subcorticalis Ourococcus sp. rosette 65 Apiomorpha spinifer stem swelling 100 90 100 Apiomorpha minor enclosing 94 Apiomorpha munita tereticornuta

A B Ehrhornia cupressi Pseudococcus sp. Pseudococcus callitris G Eriococcus eucalypti G Eriococcus sp. "Nc" 67 "Sphaerococcus" socialis Eriococcus fossilis 69 91 100 "Sphaerococcus" socialis 55 Ascelis praemollis 97 100 Eriococcidae sp. "callo2" 92 Eriococcus fossilis 100 71 Opisthoscelis mammularis Lachnodius sp. 65 100 Lachnodius sp. 67 61 99 Cystococcus echiniformis Opisthoscelis mammularis BSE Cylindrococcus spiniferus BSE Eriococcus buxi 71 89 60 Eriococcus buxi 100 Cylindrococcus spiniferus 75 85 Stictococcus sjostedti 99 Cylindrococcus casuarinae A 79 Phacelococcus subcorticalis Scutare lanuginosa Eriococcus sp. "CA1" 86 A Eriococcus spurius Eriococcus spurius 100 71 100 Eriococcus aceris 76 Eriococcus coriaceus 100 Apiomorpha munita tereticornuta 92 82 Phacelococcus subcorticalis 100 Apiomorpha strombylosa 62 96 Apiomorpha spinifer Apiomorpha spinifer 71 Dactylopius austrinus 100 Apiomorpha munita tereticornuta 100 Eriococcus coccineus 100 Apiomorpha minor Calycicoccus merwei 0.01 substitutions/site 0.05 substitutions/site

Figure 2. Independent origins of the gall-inducing habit are supported by Elongation Factor-1 alpha (EF-1a) (A) and Cytochrome Oxidase subunit II (COII) (B). Gall-inducing lineages are indicated by thick lines. Phylograms were both derived using a Logdet model with minimum evolution criterion as implemented in PAUP* because there was signiﬁcant base compositional bias among taxa. Bootstrap values (>60) from the Logdet analysis are shown above branches and Bayesian posterior probability values from MrBayes analysis (GTR + gamma model) are shown below.

which all species feed exclusively on species of Myrt- The patterns of host use exhibit a strong phyloge- aceae. The BSE and the A clade each comprise taxa netic component. The large monophyletic MF clade, from the northern and southern hemispheres and four comprising at least seven sampled genera, is or more continents. The sole South African gall-induc- restricted to species of Myrtaceae. The Melaleuca- ing eriococcid, Calycicoccus merwei Brain, did not feeding taxa ‘Sphaerococcus’ and Eriococcidae sp. group strongly with any of the major eriococcid clades (callo2) cluster together, separate from the eucalypt- and its position varied among gene partitions. feeding ‘Sphaerococcus’ pustulans Green. Ascelis and Morphologically ‘typical’ eriococcids whose females Cystococcus, the only two taxa on Corymbia, are sis- have anal lobes and well-developed appendages, such ters. However, the two speciose groups on Eucalyptus, as species found in the large genus Eriococcus, occur Apiomorpha (A clade) and Opisthoscelis/Lachnodius in each of the three main clades along with taxa with (MF clade), are not closely related. Similarly, the gall- highly reduced or modiﬁed adult female morphology. A inducing genus Cylindrococcus is not closely related parsimony reconstruction of adult female morphology to other Australian eriococcids sampled from on the SSU rRNA tree (Fig. 1) infers that the morphol- Casuarinaceae. ogy typiﬁed by E. buxi (the type species of Eriococcus) Myrtaceae is host to the majority of species of erio- is plesiomorphic for the Eriococcidae. coccid in Australia (Table 2) and more than 65% of Enclosing galls of complex morphology occur in species on this host induce galls compared with only three separate lineages (A, MF and C. merwei) 10% of species feeding on other hosts inducing galls. (Fig. 1). Species that induce rosette galls also occur in Within Myrtaceae, a greater proportion of species multiple lineages (BSE and MF clades), as do those feeding on Eucalyptus induce galls (>70%) than do so that induce only simple pits (G and MF clades). on other myrtaceous hosts.

Parsimony reconstructions using both ACCTRAN habit of living in (Ourococcus) or under (Phacelococ- and DELTRAN suggest multiple origins of galling. cus) bark. There appears to be a minimum of seven origins of gall Adult females of non-gall-inducing species of Callo- induction under DELTRAN, with one reversion to a coccus, which is nested well within the MF clade, have non-galling habit in Callococcus. ACCTRAN infers no legs or anal lobes and the antennae are highly five origins of galling with three reversions (BSE clade reduced; this is similar to the morphology observed in except Cylindrococcus; Callococcus; and the G clade several galling genera of the MF group (e.g. Eremococ- minus MF) and regains of galling in Gallacoccus heck- cus and ‘Sphaerococcus’). This is consistent with the rothi Takagi and Madarococcus sp. nov. ‘Nc’. Non-gall- non-gall-inducing Callococcus lineage having under- inducing species of Callococcus are nested within the gone morphological reductions during a period of gall- otherwise gall-inducing MF clade. habitation and then subsequent return to a non-galling habit. If so, then the highly specialized lifestyle of gall-induction and associated loss of features associ- DISCUSSION ated with mobility has not led to an evolutionary dead end. Females of the two Callococcus species live on ORIGINS OF GALLING stems and produce waxy covers. The gall-inducing habit has probably arisen seven Male nymphs of five eriococcid genera (Eremococ- times among the taxa included in this study, as cus, Ascelis, Cystococcus, gall-inducing ‘Sphaerococ- follows: cus’ and Eriococcidae sp. ‘callo2’) and several 1. the Myrtaceae-feeding (MF) clade in Australia; beesoniids (Mangalorea and Gallacoccus) develop 2. Cylindrococcus on Allocasuarina in Australia; within the chamber or bracts of the maternal gall 3. Calycicoccus merwei on Apodytes in Africa; (Gullan et al., 2004). Our results indicate that this 4. Apiomorpha (A clade) on Eucalyptus in Australia; habit has evolved independently in beesoniids and 5. the leaf-folding Eriococcus sp. nov. ‘CA1’ (A clade) perhaps several times within the MF clade. However, on Olneya in North America; our results do not unequivocally rule out the possibil- 6. Madarococcus sp. nov. ‘Nc’ on Nothofagus in ity that the above five MF clade genera may represent Australia; a monophyletic group. The five genera, although fall- 7. Gallacoccus (Beesoniidae) on Dipterocarpaceae in ing in two clades, have a Bayesian posterior probabil- Asia. ity of only 76 and no MP bootstrap support separating Multiple origins of gall-induction, rather than mul- them on the SSU rRNA tree. Alternatively, the habit tiple losses, are implicated because each of these may have evolved in the ancestor of the MF group and groups has non-gall-inducing sister taxa with adult subsequently been lost once in the remainder of the female morphology of the apparently plesiomorphic clade. eriococcid type (anal lobes, well-developed legs and antennae). By contrast, each of the galling lineages has a different adult female morphology usu- GALL MORPHOLOGY ally involving reduction of legs and antennae and Enclosing galls, pit galls and rosette galls have all modifications for plugging gall orifices. Adult apparently evolved more than once among the erio- females of pit-gall inducers exhibit few or no modi- coccids. In general, these data do not suggest a tran- fications relative to those that induce enclosing sitional series from simple galls to more complex galls. Adult females within enclosed galls are not galls, as suggested for some other gall-inducing dorsoventrally flattened like the pit-gall formers insects (e.g. Nyman, Widmer & Roininen, 2000). and non-gall-inducers. Inducers of simple galls (pits, leaf folds) are phyloge- If the gall-inducing habit was ancestral for Austra- netically scattered and occur in three clades. They lian eriococcids and had been lost multiple times then do not form a paraphyletic group within which com- it would be expected that adult females of the sister plex gall-inducers are nested. However, a more com- taxa of gall-inducing groups would have morphologies prehensive sampling across the eriococcids may help reflecting their galling past. However, sister taxa of to determine whether there is an evolutionary tran- most of the gall-inducing taxa have well-developed sitional series of gall forms. In particular, the MF legs and antennae typical of non-gall-inducing females clade may provide the best opportunity for a phylo- of Eriococcidae and most other families. Exceptions, in genetic study of gall evolution. This clade is well which non-gall-inducing adult females are highly supported, speciose and comprises taxa that induce modified, occur in the BSE (Stictococcidae) and MF a diversity of gall forms yet all constituent taxa (Callococcus) clades. There are also several non-gall- occur on hosts within a single plant family, thus inducing taxa in the A clade in which adult females minimizing the prospect of variability as a result of have modified morphology but each of these have the divergent host use.

HOST RELATIONSHIPS SYSTEMATICS AND BIOGEOGRAPHY

About 80% of Australian eriococcid species occur on The three major clades of Eriococcidae recovered in myrtaceous hosts despite this plant family compris- this study correspond to the three previously identi- ing less than 10% of the species diversity of the Aus- fied by Cook et al. (2002). The recovery of the same tralian flora (Orchard, 1999). Our data suggest that three clades, despite increased taxon sampling in this even when lineages only, rather than species num- study, and the occurrence of the three clades in three bers, are considered there is an apparent bias independent data sets suggest that the inferred rela- towards Myrtaceae as a host. However, our data sug- tionships are robust. However, increased sampling gest that lineages feeding on Myrtaceae are no more from other scale insect families is still required to likely to have evolved the gall-inducing habit than determine whether the concept of the Eriococcidae those on other plant groups (64% and 75%, respec- needs only to be expanded to include Beesoniidae, tively). It is apparent, though, that lineages that gall Stictococcidae and Dactylopiidae. If Dactylopiidae Myrtaceae are more species-rich than others. This (represented only by the genus Dactylopius) belongs relationship is primarily driven by the species rich- with the eriococcids, then there are serious nomencla- ness of the gall-inducing eriococcids from two clades tural implications because Dactylopiidae is an older (Apiomorpha and MF clade) on Eucalyptus. It is name than Eriococcidae (Williams, 1969). If Eriococ- unclear whether ‘S.’ pustulans, Lachnodius and cidae is rendered further paraphyletic by the inclu- Opisthoscelis represent independent shifts onto Euca- sion of major families such as Diaspididae and lyptus or whether these three taxa are sisters with a Asterolecaniidae, then division of Eriococcidae should common ancestor on Eucalyptus. Irrespective of the be considered. relationships among these three taxa, Apiomorpha Other taxonomic implications of this study are as and the MF clade may be considered to be indepen- follows. ‘Sphaerococcus’ ferrugineus Froggatt is not dent observations because gall induction has evolved closely related to the Beesoniidae as suggested by separately in each. Thus, eucalypt-feeding appears to Miller, Gullan & Williams (1998). Callococcus belongs have favoured higher species diversification among with the eriococcids and not to the Asterolecaniidae as gall-inducing eriococcids. currently placed (Miller et al., 1998). The large It is probable that the high species richness of genus Eriococcus is not monophyletic, in agreement Eucalyptus and host-specificity has led to the high with the results of previous molecular data (Cook species richness of some eucalypt-galling eriococcid et al., 2002). genera. For example, species of Apiomorpha (Euca- The Australian eriococcids are distributed across lyptus-feeding) are more host-specific than are the three major eriococcid clades, two of which (G and their non-gallicolous eucalypt-feeding relatives in A) also comprise taxa from New Zealand and two the A clade (Gullan, 1984b; Miller & Gimpel, 2000; (BSE and A) have representatives from the Northern Cook, 2001). In addition, high species richness is Hemisphere. A morphological study by Hodgson & associated with host specificity on eucalypts in Miller (2002) suggested close affiliations between other gallers such as the Fergusobia/Fergusonina some non-galling New Zealand and South American nematode/fly complex (Taylor, Davies & Giblin- eriococcids. This worldwide distribution suggests that Davis, 2003) and non-galling psyllids (Yen, 2002). the current biogeographical patterns of some eriococ- A similar species radiation may have occurred cid clades may pre-date the break-up of Gondwana. A among beesoniids on dipterocarps in Asia but most diverse eriococcid fauna was already present by the beesoniid taxa are yet to be described (Takagi, Late Cretaceous (Koteja, 2000), suggesting that erio- 2001). Nevertheless, not all eriococcid taxa that coccids could have been widespread across Gond- gall eucalypts are species-rich (e.g. Floracoccus and wana. However, many scale insects appear well Sphaerococcopsis; Gullan et al., 2004). Sister-group suited for aerial dispersal as crawlers and not all cur- comparisons are required to test whether eucalypt- rent distributional patterns may represent vicari- galling groups are indeed significantly more spe- ance. In particular, there is very little molecular cies-rich. divergence among several members within both the A To date, there have been no tests of whether euca- and the BSE clades despite disjunct and widely sepa- lypt-feeding gall-inducing insects have radiated in rated distributions. response to speciation of their hosts (cospeciation) or Sampling taxa from South America in particular whether speciation has been associated with a recent will be important in determining systematic status radiation onto eucalypts. However, host use data and boundaries in Eriococcidae. In particular, several (Cook, 2001) suggest that the co-speciation may have gall-inducing taxa are known from South America occurred within Apiomorpha because host specificity (Gullan et al., 2004) but their affiliations are not clear. exhibits a strongly hierarchical pattern. Additionally, several of the South American taxa are

© 2004 The Linnean Society of London, Biological Journal of the Linnean Society, 2004, 83, 441–452 MULTIPLE ORIGINS OF GALLING IN ERIOCOCCIDS 451 known from Myrtaceae and their relationship with the animal mitochondria. Journal of Molecular Evolution 44: Australian fauna may help to elucidate further the 282–288. association between eriococcids and Myrtaceae. Gibbs RA, Cockerill M. 1995. Sequencher, version 3.0. Ann Arbor: Gene Codes Corporation. Gullan PJ. 1984a. A revision of the gall-forming coccoid genus ACKNOWLEDGEMENTS Apiomorpha Rübsaamen (Homoptera: Eriococcidae: Apio- We would like to thank the following colleagues who morphinae). Australian Journal of Zoology Supplementary provided us with specimens: D. W. deLittle, S. R. Series 97: 1–203. Donaldson, J. S. Dugdale, J. H. Giliomee, R. J. Gill, H.- Gullan PJ. 1984b. Taxonomy and biology of Australian gall- forming Coccoidea. Verhandlungen des Zehnten Internation- P. Heckroth, R. C. Henderson, C. J. Hodgson, J. R. alen Symposiums über Entomofaunistik Mitteleuropas Hosking, G. O. Japoshvili, F. Kozár, D. R. Miller, C. P. (SIEEC). Verh. (SIEEC), Budapest 1983: 381–383. Malumphy, M. Shobu, J. Schwarz and M. L. Stanton. Gullan PJ, Miller DR, Cook LG. 2004. Gall-inducing scale We thank the relevant Australian state authorities for insects (Hemiptera: Sternorrhyncha: Coccoidea). In: Raman permission to collect samples. An Australian Biologi- A, Schaefer CW, Whithers TM, eds. Biology, ecology, and evo- cal Resources Study grant to P.J.G. and an Australian lution of gall-inducing arthropods. New Delhi: Oxford & IBH Research Council small grant to P.J.G. and D. M. Row- Publishing Co. Pvt, Ltd, 159–229. ell provided partial funding for the project. Hodgson CJ. 2001. Preliminary phylogeny of some non-mar- garodid Coccoidea (Hemiptera) based on adult male charac- REFERENCES ters. Bollettino di Zoologia Agraria e Bachicoltura 33: 129– 137. Altschul SF, Madden TL, Schaffer AA, Zhang JH, Zhang Hodgson CJ, Miller DR. 2002. A new genus and two new Z, Miller W, Lipman DJ. 1997. Gapped blast and psi-blast species of felt scales (Hemiptera: Coccoidea: Eriococcidae) – a new generation of protein database search programs. from Chile, with comments on zoogeographical affinities Nucleic Acids Research 25: 3389–3402. between the eriococcid faunas of southern South America Beardsley JW. 1984. Gall-forming Coccoidea. In: Anan- and New Zealand. Systematic Entomology 27: 191–209. thakrishnan TN, ed. Biology of gall insects. London: Edward Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian Arnold (Publishers) Ltd, 79–106. inference of phylogenetic trees. Bioinformatics 17: 754–755. Ben-Dov Y, Miller DR, Gibson GAH. 2003. ScaleNet (web Koteja J. 2000. Advances in the study of fossil coccids (Hemi- site). http://www.sel.barc.usda.gov/scalenet/scalenet.htm. ptera: Coccinea). Polish Journal of Entomology 69: 187–218. Cho S, Mitchell A, Regier JC, Mitter C, Poole RW, Fried- Liu H, Beckenbach AT. 1992. Evolution of the mitochondrial lander TP, Zhao S. 1995. A highly conserved nuclear gene cytochrome oxidase II gene among 10 orders of insects. for low-level phylogenetics: Elongation-Factor 1a recovers Molecular Phylogenetics and Evolution 1: 41–52. morphology-based tree for Heliothine moths. Molecular Biol- Lockhart PJ, Steel MA, Hendy MD, Penny D. 1994. Recov- ogy and Evolution 12: 650–656. ering evolutionary trees under a more realistic model of Cook LG. 2001. Extensive chromosomal variation associated sequence evolution. Molecular Biology and Evolution 11: with taxon divergence and host specificity in the gall-induc- 605–612. ing scale insect Apiomorpha munita (Schrader) (Hemiptera: Melville RV. 1982. Opinion 1203. Eriococcidae Cockerell, Sternorrhyncha: Coccoidea: Eriococcidae). Biological Jour- 1899 conserved: type species designated for Eriococcus Tar- nal of the Linnean Society 72: 265–278. gioni-Tozzetti, 1868 (Insecta, Homoptera). Bulletin of Zoolog- Cook LG, Gullan PJ, Trueman HE. 2002. A prelimi- ical Nomenclature 39: 95–98. nary phylogeny of the scale insects (Hemiptera: Sternor- Mendonça MD. 2001. Galling insect diversity patterns: the rhyncha: Coccoidea) based on nuclear small-subunit resource synchronisation hypothesis. Oikos 95: 171–176. ribosomal DNA. Molecular Phylogenetics and Evolution Miller DR, Gimpel ME. 2000. A systematic catalogue of the 25: 43–52. Eriococcidae (felt scales) (Hemiptera: Coccoidea) of the world. von Dohlen CD, Moran NA. 1995. Molecular phylogeny of Andover, UK: Intercept Ltd. the Homoptera: a paraphyletic taxon. Journal of Molecular Miller DR, Gullan PJ, Williams DJ. 1998. Family Evolution 41: 211–223. placement of species previously included in the scale insect Dreger-Jauffret F, Shorthouse JD. 1992. Diversity of gall- genus Sphaerococcus Maskell (Hemiptera: Coccoidea). Pro- inducing insects and their galls. In: Rohfritsch O, ed. Biology ceedings of the Entomological Society of Washington 100: of insect-induced galls. Oxford: Oxford University Press, 8– 286–305. 33. Miyamoto MM, Fitch WM. 1995. Testing species phylogenies Felsenstein J. 1985. Confidence limits on phylogenies: an and phylogenetic methods with congruence. Systematic Biol- approach using the bootstrap. Evolution 39: 783–791. ogy 44: 64–76. Ferris GF. 1950. Report upon scale insects collected in China Nyman T, Widmer A, Roininen H. 2000. Evolution of gall (Homoptera: Coccoidea). Part I. Microentomology 15: 1–34. morphology and host-plant relationships in willow-feeding Foster PG, Jermiin LS, Hickey DA. 1997. Nucleotide com- sawflies (Hymenoptera: Tenthredinidae). Evolution 54: 526– position bias affects amino acid content in proteins coded by 533.

Orchard AE. 1999. Introduction. In: Orchard AE, ed. Flora dipterocarp-associated gall-inhabiting coccoids (Homoptera: of Australia, 2nd edn. Melbourne: ABRS/CSIRO Australia, Coccoidea: Eriococcidae and Beesoniidae). Insecta Matsumu- 1–9. rana (New Series) 58: 51–113. Price PW, Fernandes GW, Lara ACF, Brawn J, Barrios H, Tautz D, Hancock JM, Webb DA, Tautz C, Dover GA. Wright MG, Ribeiro SP, Rothcliff N. 1998. Global pat- 1988. Complete sequences of the rRNA genes of Droso- terns in local number of insect galling species. Journal of phila melanogaster. Molecular Biology and Evolution 5: Biogeography 25: 581–591. 366–376. Ronquist F, Liljebblad J. 2001. Evolution of the gall wasp– Taylor GS, Davies KA, Giblin-Davis RM. 2003. Species- host plant association. Evolution 55: 2503–2522. richness in gall-ﬂies (Diptera: Fergusoninidae), nematodes Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook (Nematoda: Neotylenchidae) and associated parasitoids and P. 1994. Evolution, weighting, and phylogenetic utility of inquilines on Myrtaceae. Records of the South Australian mitochondrial gene sequences and a compilation of con- Museum Monograph Series 7: 249–256. served polymerase chain reaction primers. Annals of the Van de Peer Y, Caers A, Derijk P, Dewachter R. 1998. Entomological Society of America 87: 651–701. Database on the structure of small ribosomal subunit RNA. Singer GAC, Hickey DA. 2000. Nucleotide bias causes a Nucleic Acids Research 26: 179–182. genomewide bias in the amino acid composition of proteins. Williams DJ. 1969. The family-group names of the scale Molecular Biology and Evolution 17: 1581–1588. insects (Hemiptera: Coccoidea). Bulletin of the British Sunnucks P, Hales DF. 1996. Numerous transposed Museum (Natural History), Entomology 23: 315–341. sequences of mitochondrial cytochrome oxidase I–II in Wright MG, Samways MJ. 1998. Insect species richness aphids of the genus Sitobion (Hemiptera: Aphididae). Molec- tracking plant species richness in a diverse ﬂora: gall-insects ular Biology and Evolution 13: 510–524. in the Cape Floristic Region, South Africa. Oecologia 115: Swofford DL. 2002. PAUP*: phylogenetic analysis using par- 427–433. simony (*and other methods), Version 4. Sunderland, MA: Yen AL. 2002. Short-range endemism and Australian Psyl- Sinauer Associates. loidea (Insecta: Hemiptera) in the genera Glycaspis and Takagi S. 2001. Four gall-inducing eriococcids, with notes on Acizzia (Psyllidae). Invertebrate Systematics 16: 631–636.