Blackwell Science, LtdOxford, UKBIJBiological Journal of the Linnean Society0024-4066The Linnean Society of London, 2004? 2004 834 441452 Original Article MULTIPLE ORIGINS OF GALLING IN ERIOCOCCIDS L. G. COOK and P. J. GULLAN Biological Journal of the Linnean Society, 2004, 83, 441–452. With 2 figures The gall-inducing habit has evolved multiple times among the eriococcid scale insects (Sternorrhyncha: Coccoidea: Eriococcidae) L. G. COOK* and P. J. GULLAN† School of Botany and Zoology, The Australian National University, Canberra, ACT, 0200, Australia Received 7 August 2003; accepted for publication 20 February 2004 The habit of inducing plant galls has evolved multiple times among insects but most species diversity occurs in only a few groups, such as gall midges and gall wasps. This phylogenetic clustering may reflect adaptive radiations in insect groups in which the trait has evolved. Alternatively, multiple independent origins of galling may suggest a selective advantage to the habit. We use DNA sequence data to examine the origins of galling among the most spe- ciose group of gall-inducing scale insects, the eriococcids. We determine that the galling habit has evolved multiple times, including four times in Australian taxa, suggesting that there has been a selective advantage to galling in Australia. Additionally, although most gall-inducing eriococcid species occur on Myrtaceae, we found that lineages feeding on Myrtaceae are no more likely to have evolved the galling habit than those feeding on other plant groups. However, most gall-inducing species-richness is clustered in only two clades (Apiomorpha and Lachnodius + Opisthoscelis), all of which occur exclusively on Eucalyptus s.s. The Eriococcidae and the large genus Eriococcus were determined to be non-monophyletic and each will require revision. © 2004 The Linnean Society of London, Biological Journal of the Linnean Society, 2004, 83, 441–452. ADDITIONAL KEYWORDS: adaptive radiation – Apiomorpha – Eriococcus – Eucalyptus – galling – host specificity – Myrtaceae. INTRODUCTION Phylogenetic clustering of gall-inducing species is also apparent among the scale insects. Although gall The habit of inducing galls on plants has evolved mul- inducers are known from ten coccoid families, the tiple times among phytophagous insects, occurring in highest proportion (about 47%) of the more than 230 at least six orders. However, although there are more gallicolous species (Ferris, 1950; Beardsley, 1984; Gul- than 13 000 species of gall-inducing insects (Dreger- lan, 1984a; Ben-Dov, Miller & Gibson, 2003; Gullan, Jauffret & Shorthouse, 1992), most species diversity Miller & Cook, 2004) belongs to the Eriococcidae. This is clustered in only a few insect groups, such as proportion is even greater (about 57%) if species that the gall-midges (Diptera, Cecidomyiidae) (Dreger- produce only simple pits or depressions are excluded, Jauffret & Shorthouse, 1992) and the gall-wasps because almost all eriococcid gallers induce complex (Hymenoptera, Cynipidae) (Ronquist & Liljebblad, galls. The gall shapes are recognizably species-specific 2001). The phylogenetic clustering suggests that the and structural complexity is often considerable, with taxonomic distribution of species diversity reflects the gall induced by a female sometimes resembling a radiations in those groups that have evolved the habit fruit or other organ typically not found on that host rather than many independent origins of the ability to plant. The shape of the gall appears to be independent induce plant galls. of the host-plant species and the host-plant organ on which the gall grows and is determined by the species and sex of the scale insect (Gullan et al., 2004). Sexual dimorphism of gall morphology is apparent among *Corresponding author. E-mail: [email protected] †Current address: Department of Entomology, University of most eriococcid species in which males are known to California, Davis, CA 95616-8584, USA induce galls. © 2004 The Linnean Society of London, Biological Journal of the Linnean Society, 2004, 83, 441–452 441 442 L. G. COOK and P. J. GULLAN The high number of galling eriococcids is not 2. multiple origins of galling in separate lineages, because of a numerical dominance by the Eriococcidae, suggesting that a common factor, such as a partic- which is only a distant fourth among the scale insect ular environmental condition, may have promoted families in terms of total number of species (Ben-Dov the evolution of the gall-inducing lifestyle. et al., 2003). Therefore, another explanation is needed The study includes a broad taxonomic and geograph- to explain the prevalence of gall-inducing taxa in this ical range of eriococcids, both galling and non-galling. group. The speciose genus Apiomorpha is represented for the Gall-inducing insects in general are prevalent in first time in a molecular analysis of the Eriococcidae. regions dominated by sclerophyllous vegetation (Price et al., 1998; Wright & Samways, 1998), leading to an argument that there is a selective advantage to galling METHODS in these habitats or intrinsic features of sclerophyll communities that may favour speciation among SPECIMENS AND DNA EXTRACTION gallers (e.g. Mendonça, 2001). Although only 27% of Exemplars were chosen to sample the diversity of the eriococcid species worldwide occur in Australia, more Eriococcidae and to increase representation of groups than 80% of eriococcid gall-inducers occur in Australia whose placements in an earlier molecular study (Cook (Miller & Gimpel, 2000; Gullan et al., 2004), predom- et al., 2002) were controversial. In particular, this inantly on sclerophyllous plants of the Myrtaceae. If study includes Eriococcus williamsi Danzig, the mor- the gall-inducing eriococcid taxa belong to only one or phological sister taxon of E. buxi, and both described a few lineages, then an extensive radiation in those species of Cylindrococcus as well as additional repre- groups may explain the prevalence of galling. How- sentatives of Beesoniidae and Stictococcidae. Pseudo- ever, if galling has evolved many times within Erio- coccidae, previously identified as a suitable outgroup coccidae another explanation, such as common (Hodgson, 2001; Cook et al., 2002), was used to polar- ecology, may be required. ize trees. The taxa used, their current taxonomic clas- Several recent studies have conflicted in their sug- sification, hosts, gall type (if applicable) and collection gested relationships among Australian gall-inducing localities are given in Table 1. Voucher specimens of eriococcids. A molecular phylogeny of the scale insects Australian taxa will be lodged in the Australian (Cook, Gullan & Trueman, 2002) suggests that galling National Insect Collection (ANIC), CSIRO, Canberra, has evolved at least twice among the eriococcids. Australia. Although some of the Australian eriococcid gallers Embryos and/or ovarian tissues were dissected from formed a monophyletic group, the Casuarinaceae- larger females. Small females and eggs were homoge- feeding galling genus Cylindrococcus appeared to be nized whole. DNA was extracted from fresh or etha- more closely related to the non-galling type species of nol-preserved specimens of embryos, eggs and/or Eriococcus (E. buxi Boyer de Fonscolombe), and to ovarian tissues using the salting-out method of Sun- Beesoniidae and Stictococcidae. However, only one nucks & Hales (1996). A single chloroform wash was representative of each of the two latter taxa was performed prior to precipitation if solids or excessive included in the study and Apiomorpha, the most spe- pigments were present. ciose gall-inducing scale insect genus, was not repre- sented at all. Hodgson’s (2001) phylogenetic study of adult male morphology also places Beesoniidae PCR AND SEQUENCING (which contains several gall-inducers) and Stictococ- The 5¢ region of the small subunit ribosomal RNA gene cidae among the eriococcids but generic placements (SSU rRNA) was amplified using the primers 2880 differ from those in Cook et al. (2002). Hodgson’s [for] (5¢-CTGGTTGATCCTGCCAGTAG) (Tautz et al., study suggested that the Australian gall-inducing 1988) and B- [rev] (5¢-CCGCGGCTGCTGGCACCAGA) genera Apiomorpha, Cystococcus, Lachnodius and (von Dohlen & Moran, 1995). Two new internal Opisthoscelis were related to each other. However, primers (E10for: GGAAGGAACGCTCTTATTAG, Hodgson’s results should be treated with caution and E10rev: CGGTTTTGATCTAATAAGAGC) were because male morphology may be subject to conver- designed for this region for Apiomorpha. An internal gent selection in galling taxa. region of Elongation Factor 1-alpha (EF-1a) was In this study, we used DNA sequence data from amplified using primers M44-1 and rcM52.6 (Cho three gene regions (two nuclear and one mitochon- et al., 1995). These primers did not amplify EF-1a drial) to investigate whether the observed species in all scale insects and new primers (EF-1a[a]for: richness of gall-inducing eriococcids in Australia may GATGCTCCGGGACAYAGAG and EF-1a[c]rev: best be explained by: GGTTTCAAGACACCAGTTTC) were designed inter- 1. an evolutionary radiation (possibly adaptive) nal to the original primers. An internal region of the within a single lineage, or mitochondrial COII gene was amplified using the © 2004 The Linnean Society of London, Biological Journal of the Linnean Society, 2004, 83, 441–452 MULTIPLE ORIGINS OF GALLING IN ERIOCOCCIDS 443 primers C2-J-3400 (Liu & Beckenbach, 1992) and C2- mented in PAUP* 4.0b10 (Swofford, 2002) for each full N-3661 (Simon et al., 1994). data