Activation of P53 by Nutlin Leads to Rapid Differentiation of Human Embryonic Stem Cells

Home , Tartu

Oncogene (2008) 27, 5277–5287 & 2008 Macmillan Publishers Limited All rights reserved 0950-9232/08 $32.00 www.nature.com/onc ORIGINAL ARTICLE Activation of p53 by nutlin leads to rapid differentiation of human embryonic stem cells

T Maimets1,2, I Neganova2,3, L Armstrong2,3 and M Lako2,3

1Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia; 2Institute of Human Genetics, University of Newcastle, Newcastle upon Tyne, UK and 3North East Stem Cell Institute, University of Newcastle, Newcastle upon Tyne, UK

p53 is an important regulator of normal cell response to transition mechanisms remain largely obscure. One stress and frequently mutated in human tumours. Here, we possibility to clarify these relationships is to study the studied the effects of activation of p53 and its target activity of important components of signal-transduction gene p21 in human embryonic stem cells. We show that pathways—oncogenes and tumour suppressor genes—in activation of p53 with small-molecule activator nutlin each of these cell types. Several oncogenes and tumour leads to rapid differentiation of stem cells evidenced by suppressors, such as Bmi1 (Molofsky et al., 2003), Gfi1 changes in cell morphology and adhesion, expression of (Hock et al., 2004), Pten (Groszer et al., 2001), Wnt/ cell-specific markers for primitive endoderm and trophec- beta-catenin (Dravid et al., 2005) and Notch (Dontu toderm lineages and loss of pluripotency markers. p21 is et al., 2004), have been shown to control the self-renewal quickly and dose-dependently activated by nutlin. It can of normal untransformed tissue stem cells. also be activated independently from p53 by sodium p53 gene is mutated in more than half of human butyrate, which leads to the differentiation events very tumours (Hainaut and Hollstein, 2000), which indicates similar to the ones induced by p53. Duringdifferentiation, a central role for the p53-dependent pathways in tumour the activatingphosphorylation site of CDK2 Thr-160 cells. p53 is a tumour suppressor involved in cell cycle becomes dephosphorylated and cyclins A and E become regulation and cellular response to different stress degraded. The target for CDK2 kinase in p53 molecule, stimuli, including DNA damage and oncogenic stress. Ser-315, also becomes dephosphorylated. We conclude Owing to its ability to integrate many different signals that the main mechanism responsible for differentiation of controlling cell life and death, it has been named the human stem cells by p53 is abolition of S-phase entry and ‘guardian of the genome’ (Lane, 1992). Under normal subsequent stop of cell cycle in G0/G1 phase accompanied conditions, p53 is functionally inactive and rapidly by p21 activation. degraded by ubiquitin ligase hdm2 (or mdm2 in mouse Oncogene (2008) 27, 5277–5287; doi:10.1038/onc.2008.166; cells). However, after different types of cell stress hdm2- published online 2 June 2008 driven degradation is halted and this results in p53 accumulation and acquisition of transcriptional activity Keywords: cell cycle; differentiation; human embryonic (Vousden and Lu, 2002). stem cells; p53–p21 pathway; tumour suppression One of the target genes for p53-dependent transcription is p21. p21 is a well-known mediator of p53- dependent cell cycle arrest inhibiting the cyclin-Cdk2 or Cdk4 complexes (Gartel and Radhakrishnan, 2005 for Introduction review). It has been shown earlier that p21 can negatively regulate self-renewal of hematopoetic stem There is accumulating evidence showing that tumours cells (Cheng et al., 2000) and adult neural stem cells from different tissues contain a small sub-population of (Kippin et al., 2005), showing a link between cell cycle cells that possess stem cell characteristics, which can be regulation and differentiation of adult stem cells. resistant to treatment and maintain the growth of the In this study, we investigated the mechanism of human tumour. This tumour stem cell concept has important embryonic stem cell (ESC) differentiation through implications for our understanding of tumourigenesis activation of the p53/p21 pathway by nutlin, a small- and design of tumour therapy (see Wicha et al., 2006 for molecule inhibitor of p53-hdm2 interaction (Vassilev a recent review). Although in technical terms the tumour et al., 2004) that causes rapid elevation of p53, resulting cells, stem cells and tumour stem cells are well defined, in transcriptional activation. Activation of p53 results in the functional relationship between them and their loss of pluripotency and differentiation towards the primitive endoderm and trophectoderm lineages, as indicated by changes in cell morphology and adhesion, Correspondence:Dr T Maimets, Insitute of Molecular and Cell expression of cell-specific markers for these lineages and Biology, University of Tartu, Riia 23, Tartu 51010, Estonia. E-mail:[email protected] loss of pluripotency markers. Ser-315, the target for Received 8 November 2007; revised 4 April 2008; accepted 18 April 2008; CDK2 kinase in the p53 molecule, becomes depho- published online 2 June 2008 sphorylated. This is accompanied by dephosphorylation p53/p21 activation and stem cell differentiation T Maimets et al 5278 of CDK2 Thr-160 and degradation of cyclins A and E. A widely used differentiation inductor, sodium butyrate, was also able to induce p21 and similar cell differentiation, independently of p53, suggesting that activation of p21 is the linchpin underlying the rapid differentiation of human ESC observed after nutlin treatment. We show that the main mechanism responsible for ESC differentiation after p53/p21 activation is the block of cell cycle progression in G1 caused by inhibition of S-phase CDK–cyclin complexes. The downregulation of pluripotency genes NANOG and OCT4 is a later event well separated from early morphological changes, decrease of pluripotency marker GDF3 and induction of differentiation marker CDX2.

Results

Treatment of cells with nutlin leads to changes in ESC morphology We treated human ESC with two different concentrations of nutlin—10 and 30 mM. These concentrations were optimized by FRET analysis of p53–hdm2 interaction in vivo (data not shown). Different human ESC lines—H9 (Figures 1b, d and f), H1 and hES-NCL1 showed similar rapid change in cell morphology. After 24 h of nutlin treatment, the cells become considerably control +nutlin larger (Figures 1d and f), their cytoplasm to nucleus Figure 1 After treatment with nutlin H9 embryonic stem cell ratio increases and they progressively lose contacts with (ESC) change their morphology and become larger. Cells grown on neighbouring cells (Figure 1d). As a result, the borders mouse embryo fibroblast (MEF) feeders (a–d) or matrigel-coated of the ESC colonies become ‘hazy’ when viewed under plates (e and f) were treated with 10 mM (b)or30mM nutlin (d and f); (a, c and e) treated with vehicle only; (c and d) stained with alkaline low magnification (Figure 1b). This rapid morphological phosphatase. White bar represents 100 mm. effect was observed on cells grown both on feeder cells (mitomycin-inactivated mouse embryo fibroblasts) and on feeder-free growth on plates coated with Matrigel. Sensitivity of cells to nutlin was slightly higher on mechanism is involved in HDM2 downregulation. The Matrigel plates due to active intake of nutlin by feeder mRNA level of p53 also decreases after nutlin treatment cells. Progressive cell death was observed during nutlin (about 3 times, Figure 3a), which can explain the treatment, as dead cells were removed daily when decrease of p53 protein level after 4 days of treatment of changing the culture media. The effect of nutlin was cells with high dose of nutlin (Figure 2a). dose-dependent:at higher concentrations there were more differentiated cells. Removal of nutlin after 48 h and incubation with normal human ESC medium led to Nutlin treatment upregulates the expression of reversal of normal human ESC morphology after 6–7 differentiation markers and downregulates cell days (not shown). pluripotency markers in a dose-dependent manner Nutlin treatment and p53 activation resulted in upregu- Nutlin treatment causes rapid accumulation of lation of of primitive endoderm markers GATA4 transcriptionally active p53 protein (3 times compared to untreated cells) and GATA6 (5 times) Nutlin treatment causes a significant increase of steady- as well as trophectoderm marker CDX2 (6 times) sate levels of p53 protein (about 3 times) both at 10 and (Figure 3). Most importantly, treatment with nutlin 30 mM concentrations (Figures 2a and b). The accumu- led to downregulation of pluripotency markers, GDF3 (2 lating protein is located in cell nucleus (Figure 2c) and is times; Figure 3b), NANOG and OCT4 (the levels of both transcriptionally active as it induces transcription of its are undetectable after 4 days of treatment; Figures 2a, b target genes p21 and HDM2 (Figure 3a) and rapid and 3a). It is, however, important to mention that accumulation of p21 protein (Figures 2a and b). The 1 day treatment of cells with 30 mM nutlin is not level of p21 mRNA and protein increases 30 times, sufficient to downregulate OCT4 and NANOG whereas the level of HDM2 mRNA increases about 20 (Figure 3a), but it is sufficient to induce p53 protein times as compared to the untreated cells. The decrease of activity, which results in transactivation of p21 HDM2 protein (which contrast the increase in HDM2 (Figure 2a). Moreover, treatment of cells with a lower transcript levels) indicates that a separate cellular concentration of nutlin (10 mM) does not cause a

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5279 a 0 1 2 3 4 DAYS 0 10 30 M nutlin

p53 -actin p53

HDM2

p21 OCT4

NANOG OCT4 p21

P-Ser315 P53

CDK2

P-Thr160 CDK2

CYCLIN E

CYCLIN A

Figure 2 (a) As a result of nutlin treatment, different proteins are up- or downregulated. H9 embryonic stem cell (ESC) grown on matrigel were treated with 30 mM nutlin for 0, 1, 2, 3 and 4 days, lysed and loaded on SDS-gel. Western blots with antibodies specific for indicated proteins were performed. (b) Nutlin treatment at 10 mM for 2 days is enough to induce transcriptionally active p53, but not to downregulate OCT4 protein expression. H9 cells were treated with 10 mM (b)or30mM (c) nutlin for 2 days and analysed on western blots. (c) Immunofluorescent staining of nutlin-treated cells with p53-specific antibody and photographed at normal light (left panel) or at UV (right panel). decrease of OCT4 protein level within 2 days butyrate causes upregulation of p21, GATA4 and (Figure 2b). Inhibition of p53 by small interfering GATA6 mRNA levels, whereas the level of p53 mRNA RNA (siRNA) caused inhibition of p21 and GATA6 does not change and the level of protein decreases in induction (Figure 3c). We also attempted with contrast to nutlin treatment (Figure 5, inset). One day several p21-specific siRNAs to suppress the increase of treatment of cells with 2 mM sodium butyrate is enough p21 mRNA level after nutlin treatment, but without to induce p21 protein, exactly similarly to nutlin (not success. shown). It is also evident that the levels of NANOG and OCT4 mRNA do not change as a result of sodium butyrate treatment (Figure 5). Sodium butyrate treatment changes ESC morphology in Retinoic acid, which causes changes in morphology a manner similar to nutlin different from nutlin/sodium butyrate, also causes Sodium butyrate, retinoic acid and vitamin D3 are well different patterns of gene activation in ESCs. It down- known agents able to differentiate a wide variety of cells. regulates mRNAs for p21 and pluripotency genes OCT4 We treated H9 cells with 2 mM sodium butyrate, 10 and and NANOG, whereas no change in HDM2 or 30 mM retinoic acid and 1 mM vitamin D3. After 2 days, differentiation markers GATA4 and GATA6 could be no changes in cell morphology or gene expression were detected (Figure 6). detected with vitamin D3 (Figures 4 and 5). Retinoic acid caused considerable change in morphology, which Nutlin causes dephosphorylation of CDK2 substrate was clearly different from the effects of nutlin:the Ser-315 in p53 protein borders of the colonies stay clear and distinct and cell After treatment of cells with nutlin, the Ser-315 of p53, layers on the outer side of the colonies become thicker. which is a phosphorylation target of CDK2, becomes Also, the surface of the colonies becomes ‘crinkled’ dephosphorylated (Figure 1). This is accompanied by because of the presence of thicker and thinner cell layers. dephosphorylation of Thr-160, which is an ‘activating’ The change of morphology caused by sodium phosphorylation of CDK2 kinase and degradation of butyrate, however, is very similar to changes caused by CDK2 cyclin partners A and E (Figure 1). These cyclins nutlin (compare Figures 4 and 1). This includes are needed for cell cycle progression from S to G2 phase similarity in cell shapes as well as the tendency to lose and from G1 to S phase, respectively. The steady-state contacts with neighbouring cells. Moreover, sodium levels of CDK2 protein itself do not change.

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5280

1.4 16 1.8 1.2 p53 14 p21 1.6 GAPDH 1.4 1 12 10 1.2 0.8 1 8 0.6 0.8 6 0.6 0.4 4 0.4 0.2 2 0.2 0 0 0 0 10 30

times change of mRNA level 01234 02341 times change of mRNA level times change of mRNA level days days

35 6 6 4 3 30 HDM25 GATA65 GATA4 3.5 GATA62.5 GATA4 25 3 4 4 2.5 2 20 3 3 2 1.5 15 2 2 1.5 1 10 1 5 1 1 0.5 0.5 0 0 0 0 0 times change of mRNA level times change of mRNA level times change of mRNA level 01234 01234 times change of mRNA level 01234 01030 0 10 30 times change of mRNA level days days days

1.2 2 1.4 1.4 12 1 OCT4 UBC1.2 NANOG 1.2 GDF3 10 CDX2 1.5 0.8 1 1 8 0.8 0.8 0.6 1 6 0.6 0.6 0.4 4 0.5 0.4 0.4 0.2 0.2 0.2 2 0 0 0 0 0 01234 01234 01234 0 10 30 0 10 30 times change of mRNA level times change of mRNA level times change of mRNA level times change of mRNA level times change of mRNA level days days days

80 60 p21 GATA6 70 50 60 50 40 40 30 30 p21/UBC 20

20 GATA6/UBC 10 10 0 0 p53 siRNA - -++ -+-+ nutlin -++ - --++ Figure 3 Nutlin treatment induces expression of p53 target genes and markers of differentiation, whereas pluripotency genes are suppressed. (a) Cells were treated with 30 mM nutlin 0, 1, 2, 3 or 4 days (from left to right) or (b) with 0 (black), 10 (grey) or 30 mM (white) nutlin for 2 days. mRNA was extracted with Trizol, cDNA was synthesized with random oligonucleotides and analysed by Quantitative real-time PCR (RT–PCR). Genomic DNA or random human cDNA was used as internal standard. (c) Cells were transfected with p53 small interfering RNA (siRNA) (light grey and white) or mock-transfected (black and dark grey) and treated with either nutlin (dark grey and white) or vehicle only (black and light grey). Quantitative RT–PCR was performed with primers for p21 and GATA6.

Cells treated with nutlin accumulate in G0/G1 phase constructs for overexpression of p53, its transactiva- The cell cycle profile after nutlin treatment was analysed tion-deficient point mutant His273 and p21 proteins by flow cytometry (Figure 7). Nutlin clearly caused a under the control of cytomegalovirus promoter block of cell entry into S phase. As a result, most of the (Figure 8a). Both p53 and p21 caused extensive cell cells accumulated in G1/G0 phase of the cell cycle. In death, whereas the survival of cells transfected with untreated human ESCs the amount of S-phase cells is mutant p53 was much better. Analysis of p21 and p53 very high (48.7%, average of two experiments), but after mRNA expression patterns (Figure 8b) showed strong 4 days of treatment it is significantly downregulated to counter-selection against the cells expressing wild-type 13.8%. By then, however, most of the cells (70.9%) have p53 or p21. accumulated in G0/G1 phase. Treatment of cells under the same condition with 0.3% dimethyl sulphoxide only (dimethyl sulphoxide is solvent for nutlin) did not cause any changes in cell cyle (not shown). Discussion

In this article, we studied the mechanism of human ESC Cells differentiating due to activation of p53/p21 pathway differentiation by activation of the p53/p21 pathway do not survive in ESC ‘niche’ growth conditions with small chemical compounds. Nutlin has recently As seen from Figure 7, an extensive sub-G1 peak of the been shown to selectively activate the p53 pathway in cell cycle is visible after treatment of cells with nutlin. vitro and in vivo destroying its complex with hdm2, This indicates the presence of cell death, which is which is itself an E3 ubiquitin ligase and leads to the possibly caused by the inability of differentiated cells to degradation of p53 (Vassilev et al., 2004). This property survive in an ESC ‘niche’ represented by the media has made nutlin a potential drug for cancer treatment conditions optimized for ESC. We investigated this issue aiming at efﬁciently eliminating the tumour xenografts by transient transfection of H9 cells with DNA from nude mice (Tovar et al., 2006).

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5281

control ATRA

vitamin D3 Na-But

Figure 4 Treatment of H9 cells for 2 days with vitamin D3 does not cause phenotypic change. Treatment with retinoic acid (ATRA) causes changes in morphology that look very different to the ones caused by nutlin, whereas sodium butyrate causes changes exactly similar to nutlin.

We show here that nutlin treatment rapidly induces discrepancy. Qin et al. induced p53 with UV, which the differentiation of human ESCs (H1, H9 and hES- caused within 6 h a significant increase of transcription- NCL1). This process is obvious as soon as 24 h after ally inactive p53 (and therefore there was no upregula- treatment:cells start to change their morphology and tion of p21 or hdm2) and downregulation of both OCT4 adhesion properties, express both primitive endoderm and NANOG at the transcriptional level. In our and trophectoderm-specific marker genes and down- experiments, nutlin rapidly induces transcriptionally regulate pluripotency genes. This rapid switch of cell active p53 (within 1 day) accompanied by increase of fate was somewhat unexpected, as most of the sponta- p21 and HDM2, whereas the levels of OCT4 and neous stem cell differentiation events take several days NANOG start to decline later (after 2–3 days) and at to weeks (see Hyslop et al., 2005b for review). higher concentrations of nutlin. In fact, after treatment Recently, Qin et al. (2007) suggested that p53 could of cells with 10 mM nutlin for 2 days there was no directly downregulate the expression of OCT4 transcrip- decrease in the levels of OCT4 protein, although this tion, which is important for retaining human stem cell treatment was sufficient to upregulate levels of trans- pluripotency. Similarly, it has been shown that in mouse criptionally active p53. Even after 4 days of low-dose ESCs, p53 may bind to Nanog promoter and therefore nutlin treatment, the level of OCT4 did not change (data inhibit its transcription (Lin et al., 2005). Indeed, not shown). In addition, after treatment at 30 mM nutlin bioinformatic analysis revealed the presence of a DNA concentration the OCT4 mRNA levels start to decline sequence in the OCT4 gene (starting from position significantly only from day 3, which is much later than þ 751 of OCT4 gene AGACAAATTC(N)14GAC the changes in differentiation markers used (significant CAAGTCC) that is very similar to the defined consenus upregulation for GATA4 and GATA6 is already p53-binding site (Wei et al., 2006). However, our observed from day 1). It is also important to notice analysis by chromatin immunoprecipitation using p53- that both NANOG and OCT4 transcription can be specific antibodies did not show any change in the p53 downregulated with retinoic acid, although no activa- binding at this OCT4 site after nutlin treatment (data tion of p53 or its transcriptional targets can be seen. not shown). These results suggest that the process of differentiation Our model clearly and principally differs from that of observed after p53 activation is not initiated by down- Qin et al. (2007) and this may be a reason for this regulation of OCT4 or NANOG. It is more likely that

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5282

1.4 7 3 1.2 p536 p21 2.5 HDM2 1 5 2 0.8 4 1.5 0.6 3 1 0.4 2 0.2 1 0.5 0 0 0 none D3 Na-But none D3 Na-But none D3 Na-But Times change of mRNA level Times change of mRNA level Times change of mRNA level

2 16 8 NANOG 14 GATA6 7 GATA4 1.5 12 6 10 5 1 8 4 6 3 0.5 4 2 2 1 0 0 0 none D3 Na-But none D3 Na-But none D3 Na-But Times change of mRNA level Times change of mRNA level Times change of mRNA level

1.6 Na-butyrate nutlin 1.4 OCT4 1.2 012 301 1 0.8 p53 0.6 0.4 0.2 0 none D3 Na-But Times change of mRNA level Figure 5 Gene expression pattern after vitamin D3 treatment does not differ from control, whereas sodium butyrate (Na-But) causes, similarly to nutlin, activation of p21 and upregulation of differentiation markers GATA4 and GATA6. H9 cells were treated without drug (black), 1 mM vitamin D3 (white) or 2 mM Na-but (grey) for 2 days. RNA was extracted with Trizol, reverse transcribed and analysed by Quantitative real-time PCR with appropriate primers. Inset:treatment of cells with Na-But decreases the level of p53 protein. Cells were treated for 0, 1, 2, and 3 days with Na-but (2 mM) or 0 and 1 day with nutlin (30 mM) and analysed by western blot with DO1 antibodies.

changes in these pluripotency markers demonstrate the loss of p21 compromises the quiescence of forebrain loss of pluripotency caused by p53 activation. stem cell proliferation eventually leading to exhaustion It has been shown that p53 can regulate the self- of their proliferative capacity (Kippin et al., 2005). renewal of adult stem cells (Cheng et al., 2000; Kippin Several small chemical compounds have been shown et al., 2005; Meletis et al., 2006). These cells express to transcriptionally activate p21, both through p53- neither OCT4 nor NANOG, and it is therefore clear dependent pathway as well as independently of it. that mechanisms other than direct downregulation of Induced differentiation of myelomonocytic cell line these genes by p53 must be involved. To reveal the U937 by vitamin D3 is facilitated by transcriptional possible mechanism of stem cell differentiation after p53 induction of the p21 gene by vitamin D3 receptor (Liu activation by nutlin, we therefore concentrated our et al., 1996a). The p21 gene is also a target for retinoic studies on other components of the p53 signalling acid, which contains a functional retinoic acid (RA) pathway, ﬁrst of all to gene p21 (also called WAF). response element in its promoter and thereby mediates Induction of both p21 mRNA and protein by nutlin is the differentiation of U937 cells by this compound (Liu very rapid, occurs at low concentration of nutlin and et al., 1996b). Sodium butyrate is another activator of yields remarkably high levels of p21 (about 25 times p21 promoter through Sp1 sites, which occurs indepen- increase at mRNA level), whereas the protein is virtually dently of p53 (Nakano et al., 1997). absent in control human ESCs. We used vitamin D3, retinoic acid and sodium p21 is a cell cycle inhibitor binding to both G1-to-S butyrate and found that human ESCs react differently and G2-to-mitosis CDK–cyclin complexes and inhibit- to these compounds. Vitamin D3 did not have any ing their kinase activity (for a review see Gartel and morphological effect or change of gene expression Radhakrishnan, 2005). p21 has been shown to nega- pattern in the range of concentrations and time intervals tively regulate self-renewal of hematopoietic stem cells used. Retinoic acid caused changes in cell morphology (Cheng et al., 2000). Recently, it has been shown that the and gene expression patterns very different from those

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5283 1.4 1.2 1.2 p53 p21 HDM2 1.2 1 1 1 0.8 0.8 0.8 0.6 0.6 0.6 0.4 0.4 0.4 0.2 0.2 0.2 times change of mRNA level times change of mRNA level 0 times change of mRNA level 0 0 01030 0 10 30 01030

1.2 1.6 1.8 NANOG 1.4 GATA41.6 GATA6 1 1.2 1.4 0.8 1.2 1 1 0.6 0.8 0.8 0.6 0.4 0.6 0.4 0.4 0.2 0.2 0.2 times change of mRNA level times change of mRNA level 0 times change of mRNA level 0 0 0 10 30 0 10 30 0 10 30

1.4 1.2 OCT4 1 0.8 0.6 0.4 0.2

times change of mRNA level 0 01030 Figure 6 Retinoic acid does not change the expression levels of p53 and its target HDM2, neither induces differentiation markers GATA4 nor GATA6. It suppresses, however, expression of p21 and pluripotency markers NANOG and OCT4. The cells were treated with 0 (black), 10 (white) and 30 mM (grey) retinoic acid, RNA was extracted with Trizol, reverse transcribed and analysed by Quantitative real-time PCR with appropriate primers. observed after nutlin treatment. Most importantly, the only observed after high concentrations of nutlin unlike level of p21 decreased in parallel with decrease of cell p21, which is activated immediately after 24 h of low and pluripotency markers, OCT4 and NANOG, in contrast high nutlin treatment. This suggests that these differen- to nutlin treatment, which results in p21 activation and tiation markers are unlikely to be immediate transcrip- OCT4 and NANOG downregulation. It is therefore tional targets of p53 and therefore not the initiators of clear that the effects of nutlin and retinoic acid to human ESC differentiation observed in this study. human ESCs are caused by different molecular mechan- A more likely explanation is provided by the changes isms and result in different cell morphology. in cell cycle, which start to occur as soon as 24 h after Sodium butyrate, however, caused morphological nutlin treatment and p21 activation. Nutlin treatment changes in human ESCs that were very similar to nutlin and p21 activation abolishes the entry of cells into treatment:the cells became larger and changed their S phase, which is accompanied by dephosphorylation of shape, their nucleus to cytoplasm ratio decreased and Thr-160 of CDK2 and degradation of its partner cyclins they became progressively nonadhesive. The real-time E and A. The functional inactivation of CDK2–cyclin quantitative PCR analysis showed that sodium butyrate complex is also indicated by dephosphorylation of Ser- causes the activation of p21 transcription, similarly to 315 of p53, which is a substrate for CDK2 kinase. nutlin. The levels of p53 mRNA and its other target Stem cells and their differentiated progenitors are HDM2, however, did not change and, in contrast to generally able to survive only in certain biochemical nutlin treatment, the levels of p53 protein decreased. conditions in the cell ‘niche’. The growth media and This shows that the effect of sodium butyrate on p21 conditions used in this study were optimized for human expression is independent of p53. As the cells were still ESC growth; therefore, it is not unexpected that differentiating along both primitive endoderm and differentiation of stem cells is accompanied by signiﬁ- trophectoderm lineages, we conclude that the activity cant cell death as shown by cell cycle analysis. More- of p53 may be mediated by p21 and differentiation over, after incubation of H9 cells for 2 days with 30 mM events occurring after nutlin and sodium butyrate nutlin and further incubation without the chemical, treatment are a consequence of p21 activation. This the cell culture reversed to normal ESC morphology leads to a very interesting question:what are the most after 6 days (not shown). A possible explanation here is immediate changes that take place in human ESCs after that all the differentiated cells eventually die in the p21 activation? GATA4 and GATA6 upregulation is ‘wrong’ cell niche and only ESC survive and proliferate.

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5284

control 1 day 2 days 100 280 160

80 210 120 60 Number Number 140 Number 20 40

70 40 20

0 0 0 40 80 120 160 200 0 40 80 120 160 0 30 60 90 120 150 Channels (2-355/450/50-A) Channels (2-355/450/50-A) Channels (2-355/450/50-A)

3 days160 4 days 100

80 120

60 0days 1day 2days 3days 4days 80

Number G1/G0 Number 42.50 31.28 45.58 67.73 70.85 40 S 48.72 32.98 22.20 17.77 13.77 40 G2 8.79 35.75 32.23 14.51 15.56 20

0 0 0 40 80 120 160 0 40 80 120 160 Channels (2-355/450/50-A) Channels (2-355/450/50-A)

Figure 7 Treatment of H9 cells with 30 mM nutlin blocks S-phase entry and causes arrest of cells in G1/G0 phase. Cells were treated with nutlin, isolated with Accutase, permeabilized and stained with DAPI and analysed by FACS ARIA (5000 cells). Results were analysed by ModFit LM software. Inset:percentages of cells in respective cell cycle phase (average of two experiments).

Transfection of cells with constructs expressing either potential of activated p53 to efficiently eliminate at least wild-type p53 or p21 under cytomegalovirus promoter some types of tumours (for example, prostate and also confirmed this explanation. After the transfection, osteosarcoma xenografts in nude mice Tovar et al., human ESCs undergo considerable death, whereas the 2006) could be explained by its ability to target the stem ones expressing p53 or p21 are eliminated. In contrast, cells of these particular tumours. At the same time, the the survival of cells expressing a mutant form of p53 loss of normal stem cells would create a major problem unable to induce p21 transcription is much higher. in treating the tumours with this type of p53 activators. In summary, our experiments show that p53 is able to cause differentiation of human ESCs due to activation of p21 and subsequent block of S-phase entry (Figure 9). Materials and methods Sodium butyrate causes similar effects independently of p53 due to direct activation of p21. Is the inhibition of Cell lines, their maintenance and treatment with low-molecular cell cycle sufficient to induce differentiation of human weight compounds ESCs? It seems very likely that for ESCs, differentiation Human ESCs were grown on mitotically inactivated mouse is a ‘default’ pathway and therefore inhibition of S- embryonic fibroblasts and passaged essentially as described in phase entry is indeed a starting point. This hypothesis is Stojkovic et al. (2004). Few passages before experiments, well supported by current ongoing work in our group human ESCs were transferred to Matrigel-coated plates with that has underlined an important role for NANOG in feeder-conditioned media as previously described in Stojkovic et al. (2004); Hyslop et al. (2005a). Cells were treated with 10 enhancing G1 to S transition in human ESCs, thus and 30 mM nutlin-3, 2 mM sodium butyrate, 10 and 30 mM linking for the first time the maintenance of pluripotent retinoic acid (all from Sigma, Dorset, UK) or 1 mM 1a,25- phenotype to cell cycle regulation and in particular G1 dihydroxyvitamin D3 (Biomol International, Exeter, UK). H9, to S transition. H1 (both from WiCell Inc., Madison, WI, USA) and hES- The ability of p53 to differentiate stem cells can NCL1 (Stojkovic et al., 2004) were used in this study. explain two important in vivo properties of this protein. First, it has been shown that high activity of p53 causes Immunostaining premature aging of mice (Tyner et al., 2002), which can Cells in 6-well plates were washed with phosphate-buffered be explained by loss of normal stem cells. Second, the saline, fixed with 4% paraformaldehyde for 10 min and

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5285

10 Control wtp53 8 6 4 p21/UBC 2 0 transfection - wtp53His273 p21

400

300

His273 p21 200 p53/UBC 100 pCGp21 0 transfection - wtp53His273 p21

Figure 8 (a) Overexpression of p53 and p21 is not tolerated by H9 cells. Cells were transfected by nucleofection with wild-type p53, its mutant His273 and p21 under the control of cytomegalovirus promoter in pCG plasmid and incubated for 2 days at Matrigel-coated plates in conditioned embryonic stem (ES) growth medium. (b) RNA was isolated by Trizol, cDNA was reverse transcribed and analysed by quantitative real-time PCR with appropriate oligonucleotides. Ubiquitin C (UBC) was used as an internal control gene. Black—cells transfected with control, dark grey—wtp53, light grey His273 and white—p21. White bar—100 mm.

pThr160 Transient transfection of human ESCs with full p53, mutant CDK2 CYCLIN E p53 and p21 constructs G1 pThr160 G2 p53 (human), mutant His273 and p21 cDNAs were cloned into CDK2 CYCLIN A pCG vector (Tanaka and Herr, 1990) as described earlier (Joers et al., 1998). Human ESCs were cultured under feeder- s free conditions with feeder-conditioned media free of anti- biotics for at least 5 days before transfections and dissociated using Accutase (Chemicon, Temecula, CA, USA, diluted 1:1 in Dulbecco’s modified Eagle’s medium). Accutase treatment was Na-butyrate nutlin stopped with 10% FCS in Dulbecco’s modified Eagle’s Thr160 DIFFERENTIATION CDK2 medium, the cells were centrifuged 800 r.p.m. 3 min and CYCLIN E resuspended in nucleofection solution (Mouse ESC Nucleofec- Thr160 p53 p21 CDK2 CYCLIN A tion Kit, Amaxa International, Cologne, Germany). Five microgram of each construct was nucleofected into approxi- mately 106 human ESCs using the program A-23. The transfected human ESCs were plated under feeder-free X conditions and incubated for 2 days. Figure 9 p53 causes differentiation of human embryonic stem cells, transcriptional activation of p21 and subsequent high-level production of this protein. As a result, the cells are unable to enter siRNAs and transfection S phase, accumulate at G0/G1 and differentiate. Sodium butyrate p53 siRNA was obtained from Invitrogen (Carlsbad, CA, USA) is able to activate the same mechanism independently from p53 by (Validated Stealth RNAi DuoPak for p53, final concentration direct transcriptional activation of p21. in transfection 40 nM). The cells were collected by Accutase treatment. Transfection of siRNA into human ESCs was carried out using the Mouse ESCs Nucleofection Kit from Amaxa. Our preliminary studies with FITC-labelled control siRNA (Invitro- permeabilized using 0.2% Triton X-100, 5% fetal calf gen) indicated 75% transfection efficiency in human ESCs. serum (FCS) in phosphate-buffered saline. After washing After transfection, the cells were cultured for 48 h in mouse three times with 5% FCS in phosphate-buffered saline, the embryonic fibroblast-conditioned medium and then treated with cells were incubated with p53-specific antibody pAb421 (1:200 nutlin for an additional 48 h in the same medium. dilution) for 1 h at room temperature. After washing three times with 5% FCS anti-mouse IGG-FITC conjugate was Cell lysis and Western blotting added (1:100 dilution), cells were kept for 1 h in dark and Cells in 6-well plates were washed with cold phosphate-buffered washed three times with 5% FCS. Microscopy was performed saline and lysed in RIPA buffer (50 mM Tris–HCl pH 8.0, 150 mM with a Zeiss Axiovert 200 microscope and AxioVision NaCl, 1% IGEPAL CA 630, 0.5% Na-DOC and 0.1% SDS). software. Before the treatment of cells, 1 mM PMSF and Roche protease

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5286 inhibitors (1 tablet per 10 ml) were added. After 30 min on ice, the Crawley, UK). Real-time PCR analysis was carried out using lysates were homogenized and centrifuged 13 000 r.p.m. 15 min. DyNAmo SYBR Green qPCR Kit (Finnzymes, Espoo, The total protein concentration was determined using a Bradford Finland) and 7900HT Fast Real-Time PCR System (Applied Kit (Bio-Rad, Hercules, CA, USA) using bovine serum albumin Biosystems, Foster City, CA, USA). Primers for CDX2, GAPDH, as the concentration standard. Absorption at 595 nm was detected GATA4, GATA6, NANOG and OCT4 have been described using a Thermo Labsystems Multiskan Ascent. Lysates (20–25 mg earlier (Hyslop et al., 2005a). Primers for p53 were AGCC total protein) were electrophoresed on a 10% SDS–polyacryla- AAGTCTGTGACTTGCA and AACCTCCGTCATGTG mide gel electrophoresis and electrophoretically transferred to a CTGT, for p21 CGAAGTCAGTTCCTTGTGGA and CATG nylon membrane (Hybond-P, Amersham Biosciences, Piscat- GGTTCTGACGGACAT; for hdm2 TGCCATTGAACC away, NJ, USA). Membranes were blocked in Tris-buffered TTGTGTGATT and TGGTTGTCTACATACTGGGCA; for saline with 5% milk and 0.1% Tween. The blots were probed UBC ATTTGGGTCGCGGTTCTTG and TGCCTTGA overnight at 4 1C with the following antibodies:for p53 pAb421 CATTCTCGATGGT; for GDF-3 GTCCGCGGGAATG (for p53, 2 mg/ml, Eugenics, Brussels, Belgium), pAb1801 (2 mg/ TACTTCG and CACCTTGTGGCCATGGGACT. As a stan- ml, Santa Cruz sc-98) or DO-1 (1 mg/ml, Santa Cruz, Santa Cruz, dard, human genomic DNA or random-primed cDNA (Clon- CA, USA). Antibodies for phospho-serine p53 (sc-1706-R, final tech, Mountain View, CA, USA) was used. dilution 1:200), p21 (sc-6246, 1 mg/ml), oct-4 (C-10, 1:200), cdk2 (D-12, 1:200), cyclin A (H-432, 1:200) and b-actin (sc-47778, Cell cycle analysis 1:1000) were also obtained from Santa Cruz. The antibody for Cell cycle analysis was performed using the CyStain DNA 2 step hdm2 (2A10) was obtained from Abcam (Cambridge, UK) (2 mg/ protocol (Partec Gmbh, Germany), which uses DAPI (4,6- ml), for NANOG from Aviva Systems Biology (San Diego, CA, diamidino-2-phenylindole) staining. Human ESCs were harvested USA) (0.5 mg/ml) and for GAPDH from (Abcam, 1:2000). permeabilized and stained in accordance with manufacturers’ Antibodies for cyclin E were from Upstate (Dorset, UK) (05- instructions and the sample was analysed by flow cytometry 363, 1:1000) and for phospho-cdk2 from Cell Signaling (Boston, (Becton Dickinson, Franklin Lakes, NJ, USA; FACS ARIA). MA, USA) (1:1000). The next morning, the blots were incubated The data were analysed using ModFit (Verity Software House) to for 2 h with horseradish peroxidase-conjugated secondary anti- generate percentages of cells in G1, S and G2/M phases. bodies:donkey anti-goat, goat anti-mouse or goat anti-rabbit (all from Santa Cruz, 1:2000). Antibody/antigen complexes were detected using ECL reagent (Amersham Biosciences) and Alkaline phosphatase staining GeneSnap software (version 4.00.00, SYNGENE) with GeneG- Alkaline phosphatase staining was carried out using the nome (SYNGENE). Bands were analysed using the GeneTools Alkaline Phosphatase Detection Kit following manufacturer’s software (version 3.00.22, SYNGENE). instructions (Chemicon). Briefly, cells were fixed in 90% methanol and 10% formamide for 2 min and then washed with rinse buffer (20 mM Tris–HCl, pH 7.4, 0.05% Tween-20) once. Isolation of RNA and Quantitative Real-Time PCR analysis Staining solution (Naphthol/Fast Red Violet) was added to the RNA was isolated using TRIzol Reagent (Invitrogen) accord- wells and plates were incubated in the dark for 15 min. The ing to the manufacturer’s protocol. For each well of a 6-well bright field images were obtained using a Zeiss microscope and plate 1 ml of TRIzol was added and the lysate was transfered AxioVision software (Carl Zeiss, Jena, Germany). to Eppendorf tubes. After 5 min, 0.2 ml chloroform was added, vortexed, kept for 2 min and then centrifuged 12 000 g 15 min. The upper phase was taken into a fresh Eppendorf tube, RNA Acknowledgements was precipitated with 0.5 ml isopropanol, centrifuged and the pellet was washed with 75% ethanol. RNA was dissolved in We thank Ian Dimmick for help in flow cytometry and Stuart RNase-free water. 1 mg of RNA was treated with DNaseI, Atkinson for assistance with Quantitative real-time-PCR. This cDNA was synthesized with MMLV Reverse Transcriptase work has been supported by grants from Estonian Science (Promega, Madison, WI, USA) using random hexamers as Foundation (ETF6459) and Citrina Foundation (TM) and primers and purified on QIAquick Spin columns (Qiagen, One North East Regional Developmental Agency (ML).

References

Cheng T, Rodrigues N, Shen H, Yang Y, Dombkowski D, Sykes M Hock H, Hamblen MJ, Rooke HM, Schindler JW, Saleque S, Fujiwara et al. (2000). Hematopoietic stem cell quiescence maintained by Y et al. (2004). Gfi-1 restricts proliferation and preserves functional p21cip1/waf1. Science 287:1804–1808. integrity of haematopoietic stem cells. Nature 431:1002–1007. Dontu G, Jackson KW, McNicholas E, Kawamura MJ, Abdallah Hyslop L, Stojkovic M, Armstrong L, Walter T, Stojkovic P, WM, Wicha MS. (2004). Role of Notch signaling in cell-fate Przyborski S et al. (2005a). Downregulation of NANOG induces determination of human mammary stem/progenitor cells. Breast differentiation of human embryonic stem cells to extraembryonic Cancer Res 6:R605–R615. lineages. Stem Cells 23:1035–1043. Dravid G, Ye Z, Hammond H, Chen G, Pyle A, Donovan P et al. Hyslop LA, Armstrong L, Stojkovic M, Lako M. (2005b). Human (2005). Defining the role of Wnt/beta-catenin signaling in the embryonic stem cells:biology and clinical implications. Expert Rev survival, proliferation, and self-renewal of human embryonic stem Mol Med 7:1–21. cells. Stem Cells 23:1489–1501. Joers A, Kristjuhan A, Kadaja L, Maimets T. (1998). Tumour Gartel AL, Radhakrishnan SK. (2005). Lost in transcription:p21 associated mutants of p53 can inhibit transcriptional activity of p53 repression, mechanisms, and consequences. Cancer Res 65:3980–3985. without heterooligomerization. Oncogene 17:2351–2358. Groszer M, Erickson R, Scripture-Adams DD, Lesche R, Trumpp A, Kippin TE, Martens DJ, van der Kooy D. (2005). p21 loss Zack JA et al. (2001). Negative regulation of neural stem/progenitor compromises the relative quiescence of forebrain stem cell prolifera- cell proliferation by the Pten tumor suppressor gene in vivo. Science tion leading to exhaustion of their proliferation capacity. Genes Dev 294:2186–2189. 19:756–767. Hainaut P, Hollstein M. (2000). p53 and human cancer:the first ten Lane DP. (1992). p53, the guardian of the genome. Nature 358: thousand mutations. Adv Cancer Res 77:81–137. 15–16.

Oncogene p53/p21 activation and stem cell differentiation T Maimets et al 5287 Lin T, Chao C, Saito S, Mazur SJ, Murphy ME, Appella E et al. (2005). Stojkovic M, Lako M, Stojkovic P, Stewart R, Przyborski S, p53 induces differentiation of mouse embryonic stem cells by suppressing Armstrong L et al. (2004). Derivation of human embryonic stem Nanog expression. Nat Cell Biol 7:165–171. cells from day-8 blastocysts recovered after three-step in vitro Liu M, Iavarone A, Freedman LP. (1996b). Transcriptional activation culture. Stem Cells 22:790–797. of the human p21(WAF1/CIP1) gene by retinoic acid receptor. Tanaka M, Herr W. (1990). Differential transcriptional activation by Correlation with retinoid induction of U937 cell differentiation. Oct-1 and Oct-2:interdependent activation domains induce Oct-2 J Biol Chem 271:31723–31728. phosphorylation. Cell 60:75–86. Liu M, Lee MH, Cohen M, Bommakanti M, Freedman LP. (1996a). Tovar C, Rosinski J, Filipovic Z, Higgins B, Kolinsky K, Hilton H Transcriptional activation of the Cdk inhibitor p21 by vitamin D3 et al. (2006). Small-molecule MDM2 antagonists reveal aberrant p53 leads to the induced differentiation of the myelomonocytic cell line signaling in cancer:implications for therapy. Proc Natl Acad Sci U937. Genes Dev 10:142–153. USA 103:1888–1893. Meletis K, Wirta V, Hede SM, Nister M, Lundeberg J, Frisen J. Tyner SD, Venkatachalam S, Choi J, Jones S, Ghebranious N, (2006). p53 suppresses the self-renewal of adult neural stem cells. Igelmann H et al. (2002). p53 mutant mice that display early ageing- Development 133:363–369. associated phenotypes. Nature 415:45–53. Molofsky AV, Pardal R, Iwashita T, Park IK, Clarke MF, Morrison Vassilev LT, Vu BT, Graves B, Carvajal D, Podlaski F, Filipovic Z SJ. (2003). Bmi-1 dependence distinguishes neural stem cell self- et al. (2004). In vivo activation of the p53 pathway by small-molecule renewal from progenitor proliferation. Nature 425:962–967. antagonists of MDM2. Science 303:844–848. Nakano K, Mizuno T, Sowa Y, Orita T, Yoshino T, Okuyama Y et al. Vousden KH, Lu X. (2002). Live or let die:the cell’s response to p53. (1997). Butyrate activates the WAF1/Cip1 gene promoter through Nat Rev Cancer 2:594–604. Sp1 sites in a p53-negative human colon cancer cell line. J Biol Chem Wei CL, Wu Q, Vega VB, Chiu KP, Ng P, Zhang T. (2006). A global 272:22199–22206. map of p53 transcription-factor binding sites in the human genome. Qin H, Yu T, Qing T, Liu Y, Zhao Y, Cai J et al. (2007). Regulation of Cell 124:207–219. apoptosis and differentiation by p53 in human embryonic stem cells. Wicha MS, Liu S, Dontu G. (2006). Cancer stem cells:an old idea—a J Biol Chem 282:5842–5852. paradigm shift. Cancer Res 66:1883–1890.

Oncogene