Analysis of Gene Expression Associated with Drug-Induced Hyperthermia in Rat

ANALYSIS OF GENE EXPRESSION ASSOCIATED WITH DRUG-INDUCED HYPERTHERMIA IN RAT

Sudhan Pachhain

A Thesis

Submitted to the Graduate College of Bowling Green State University in partial fulﬁllment of the requirements for the degree of

MASTER OF SCIENCE

August 2019

Committee:

Vipaporn Phuntumart, Advisor

Raymond Anthony Larsen

Vipaporn Phuntumart, Advisor

Hyperthermia induced by 3,4-methylenedioxymethamphetamine (MDMA) and synthetic cathinones such as methylone (β-keto MDMA) can be life-threatening. The long-term use of these sympathomimetic drugs can lead to the development of tolerance in users contributing to dependency and addiction to the drugs. Recently, the role of the gut microbiome has been implicated in many diseases of the nervous system. This thesis focuses on identifying the role of the gut microbiome in MDMA-mediated hyperthermia (Chapter 2) and understanding the gender-wise differences in development of tolerance to the long-term use of methylone (Chapter 3). In chapter 2, fourteen days prior to treatment with MDMA subcutaneously, male Sprague- Dawley rats were provided water or water laced with antibiotics. Animals that had received antibiotics displayed a reduction in gut bacteria and an attenuated hyperthermic response to MDMA (20 mg/kg). The expression of genes associated with hyperthermia in skeletal muscle (SKM) and in brown adipose tissue (BAT) was measured by qRT-PCR. MDMA-treated animals showed increased uncoupling protein 1 (UCP1) and TGR5 expression levels in BAT and SKM while increased expression of UCP3 was observed only in SKM. Antibiotics prior to MDMA administration significantly blunted these increases in gene expression. These findings suggest a contributing role for the gut microbiota in MDMA-mediated hyperthermia with changes in expression of different genes. In chapter 3, male and female rats were treated weekly with methylone (10 mg/kg) via subcutaneous route. The females developed a tolerance to the methylone-induced hyperthermia by week two of drug exposure. By the third week, females displayed a hypothermic response to methylone. Conversely, males continued to display a hyperthermic response up to and including week four. At week four, the males demonstrated a significantly lower hyperthermia, and a complete tolerance seen at week five with no significant hyperthermia. Tissue samples collected after treatment on the sixth week indicate that chronic exposure to methylone reduced UCP1 expression in skeletal muscle and brown adipose tissue of the female rats. Only the females displayed increased TGR5 iv expression in BAT. UCP3 expression increased in both the SKM and BAT of the males and females. The differences between responses in male and female subjects further demonstrates the need for gender studies in the toxicology associated with drugs with abuse potential. v

Dedicated to my parents, sisters and my wife. vi ACKNOWLEDGMENTS

I would like to acknowledge some of the key people who played an instrumental role in com- pletion of my masters degree. First of all, I would like to sincerely thank my committee members. I am extremely grateful to my advisor Dr. Vipaporn Phuntumart who believed in my capabilities and allowed me to be part of the research in her lab. She has been a constant source of motiva- tion and encouragement to me. Her guidance and support helped me to learn the core concepts of the scientiﬁc research. I am also thankful to Dr. Raymond Anthony Larsen for his invaluable suggestions in my study. His guidance through out the study period has been immensely helpful in attaining my research goals. I would also like to express my gratitude to Dr. Jon E. Sprague, Director of Centre for the Future of Forensic Science, without whom this study would not have been possible. I am thankful to him for providing me an opportunity to work in animal research and informing me with the current knowledge in pharmacology and neurobiology. I feel extremely blessed to have them all as my committee members. I am grateful to my lab members Gayathri Beligala, Satyaki Ghosh, Kevin Rowlands, Joe Toguchi and Sayantan Roy Choudhury for their help during my research. I would also like to thank the Forensic lab members- Emily A. Ridge and Robert S. Goldsmith for their help in handling animals and collecting samples for my study. Robert also helped me in performing the statistical analysis for my data. I cannot thank enough to the Biology Department, BGSU, for providing me an opportunity to work as a Teaching/Research Assistant that supported me ﬁnancially. I would like to express my sincere thanks to the Nepalese community here in Bowling Green for providing the family environment and making me feel like at home. Vijaya Malla Shrestha, who is a resident of Bowling Green, has always been very loving and caring to the Nepalese students in Bowling Green State University. Her support during my stay here has helped me to focus on my study and I feel blessed to have her as my guardian. Finally, thanks to my wife Jyotshana Gautam who has always been there through my ups and downs. vii TABLE OF CONTENTS Page

CHAPTER 1 INTRODUCTION AND BACKGROUND ...... 1 1.1 Drugs and Hyperthermia ...... 1 1.2 Mechanism of Sympathetic Nervous System-mediated Thermogenesis and Uncou- pling Proteins ...... 2

1.3 Gut Bacteria and Body Temperature Regulation: Is There Any Link? ...... 3

CHAPTER 2 THE INFLUENCE OF THE HOST MICROBIOME ON 3,4- METHYLENE- DIOXYMETHAMPHETAMINE (MDMA)-INDUCED HYPERTHERMIA AND VICE VERSA ...... 7 2.1 Introduction ...... 7 2.2 Results ...... 9 2.2.1 Quantiﬁcation of Intestinal Bacteria by qPCR ...... 9 2.2.2 Analysis of Cultivatable Cecal Bacteria ...... 10 2.2.3 Effects of Gut Microbiota on MDMA-Induced Hyperthermia ...... 12 2.2.4 MDMA Treatment Results in Alteration of the Expression of Genes Asso- ciated with Hyperthermia ...... 14

2.2.5 Effect of Triamterene (TM) on MDMA-Induced Hyperthermia ...... 15 2.2.6 Effect of Iopanoic Acid (IOP) on MDMA-Induced Hyperthermia . . . . . 17 2.3 Discussion ...... 19 2.4 Methods ...... 22 2.4.1 Animals ...... 22

2.4.2 Drugs and Chemicals ...... 22 2.4.3 ABX Study Design ...... 23

2.4.4 RNA Isolation and qRT-PCR ...... 23 2.4.5 qPCR for Cecal Bacteria ...... 24 2.4.6 Agar Plate Assay and Antibiotic Screening ...... 24 viii 2.4.7 Isolation and Identiﬁcation of Swarming Bacteria ...... 25

2.4.8 Pharmacological Inhibition of TGR5 and D2 Study Design ...... 25 2.4.9 Statistical Analysis ...... 26 2.5 Acknowledgements ...... 26 2.6 Author Contributions ...... 26

CHAPTER 3 GENDER DIFFERENCES IN TOLERANCE TO THE HYPERTHERMIA MEDIATED BY THE SYNTHETIC CATHINONE, METHYLONE ...... 27 3.1 Introduction ...... 27 3.2 Materials and Methods ...... 28 3.2.1 Animals ...... 28 3.2.2 Drugs and Chemicals ...... 28 3.2.3 Study Design ...... 28

3.2.4 RNA Isolation and qRT-PCR ...... 29 3.2.5 Statistical Analysis ...... 29 3.3 Results ...... 29

3.3.1 Gender Differences in the Tolerance to Methylone-Mediated Hyperthermia 29 3.3.2 Expression of Genes Associated with Hyperthermia in Response to Chronic Methylone Treatment ...... 32 3.4 Discussion ...... 33

3.4.1 Roles of TGR5, UCP1 and UCP3 in Sympathomimetic Induced Hyperthermia 35 3.4.2 Clinical Implications ...... 35 3.5 Conclusions ...... 36 3.6 Funding ...... 36

3.7 Contribution to the Research ...... 36

BIBLIOGRAPHY ...... 37 ix LIST OF FIGURES Figure Page

1.1 Structure of MDMA and methylone ...... 2 1.2 Sympathetic stimulation and UCP-3 mediated heat generation...... 4

2.1 Daily fluid intake for both antibiotic-treated (ABX) and control (H2O) groups (A). Mean body weight for both antibiotic-treated and control groups (B)...... 9 2.2 Quantification of cecal bacteria by qPCR...... 10 2.3 Relative proportions of kanamycin-tolerant culturable bacteria recovered in cecal contents...... 11 2.4 Identification of swarming bacteria...... 12 2.5 Changes in core temperature following the administration of MDMA (A). Temperature- area under the curve (TAUC) following the administration of MDMA (B). Maxi- mum change in temperature following the administration of MDMA (C)...... 13

2.6 qPCR gene expression analysis of TGR5, UCP1 and UCP3 in (A) BAT and (B)

skeletal muscle ...... 15 2.7 Effect of triamterene pretreatment on MDMA-induced hyperthermia...... 16 2.8 Effects of IOP pretreatment on MDMA-induced hyperthermia...... 18

3.1 Weekly comparison of ∆◦C from baseline temperature in male treatment group at

30 (•), 60 (), and 90-min (N) post treatment vs male saline controls at 30 (◦), 60 (), and 90- min (4) time points...... 30 3.2 Weekly maximal temperature change (◦C) from baseline in male and female rats

following weekly treatment with methylone (10 mg/kg, sc) for five weeks . . . . . 32 3.3 qPCR gene expression analysis (Fold Change) of TGR5, UCP1 and UCP3 in skeletal muscle and brown adipose tissue following six weeks of chronic methylone

(10 mg/kg, sc) treatment of male (■) and female(□) rats...... 33 x LIST OF TABLES Table Page

2.1 Primers used for quantitative PCR reactions ...... 24 1

CHAPTER 1 INTRODUCTION AND BACKGROUND

1.1 Drugs and Hyperthermia

Psychostimulant drugs have been widely used by the young population for recreational pur- poses especially in rave parties (De la Torre et al., 2004; Palamar et al., 2015; Fernandez-Calderon et al., 2018). 3,4-methylenedioxymethamphetamine (MDMA) and 3,4-methylenedioxymethcathinone (methylone) are popularly used psychoactive agents found in the market with the common names of ’Ecstasy’ and ’Bath salt’, respectively. Methylone is a β-keto analogue of MDMA (Fig. 1.1) and has similar pharmacological properties. These drugs gained popularity because of their psy- chophysiological effects that include feelings of euphoria, sensual enhancement, arousal and emo- tional closeness to others (Parrott, 2004). Although these drugs enhance mood and perception, severe symptoms of intoxication are associated with their use. Intoxications due to MDMA are usually characterized by marked tachycardia, muscle rigidity, metabolic acidosis, seizures, hy- perkalemia and coagulopathy (Mills et al., 2004). One of the pronounced symptoms from these agents is hyperthermia. Hyperthermia induced by MDMA and methylone has been linked to severe complications, including rhabdomyolysis, renal failure, and ultimately death (Screaton et al., 1992; Fahal et al., 1992; Borek and Holstege, 2012; Mueller and Korey, 1998). Body temperature as high as 43.9◦C (Milroy et al., 1996) have been reported in cases of MDMA usage. Because of the poor understanding of how these agents induce hyperthermia at the cellular level, clinical management of hyperthermia due to drugs in the critical care/emergency department setting is complicated. The mechanisms of hyperthermia include interference with the physiological mechanisms of heat loss from the peripheries, interference with central temperature regulation, or direct damage to tissues. Neuroleptic malignant syndrome and serotonin syndrome are common to drugs that have antidopaminergic property and possess the ability to increase serotonin release in the body (Walter and Carraretto, 2015). Because dopamine and serotonin are the neurotransmitters involved in body temperature regulation, increases in the levels of these neurotransmitters induced by drugs is likely 2 H H O

N N O O

O O MDMA Methylone

Figure 1.1: Structure of MDMA and methylone. The core chemical structure of MDMA and methylone differing only by an oxygen atom on the phenethylamine pharmacophore (Zona et al., 2016). to interfere with body temperature regulatory mechanisms. Hyperthermia induced by MDMA involves both central and peripheral mechanism. Centrally, MDMA activates the dopaminergic (Mechan et al., 2002) and serotonergic (Herin et al., 2005) receptors in thermoregulatory circuits in the hypothalamus (Rusyniak and Sprague, 2005; Hargreaves et al., 2007; Benamar et al., 2008) resulting in the activation of peripheral mediators of heat generation.

1.2 Mechanism of Sympathetic Nervous System-mediated Thermogenesis and Uncoupling Pro- teins

The fundamental basis of thermogenic physiology was based primarily on the cold-induced brown adipose tissue thermogenesis pathway in rodents. Uncoupling protein 1 (UCP1) localized exclusively in brown adipose tissue is a mediator of sympathetic nervous system (SNS)-mediated heat generation in mammals. Hypothalamic activation of the SNS in response to cold leads to the release of norepinephrine by the sympathetic nerves that richly innervate brown adipose tissue. Norepinephrine then binds and activates plasma membrane receptors which leads to the activation of lipases. Free fatty acids (FFA) are released from triglycerides as a result of the catalytic activity of the lipases and transported into mitochondria where they bind to UCP1. When activated, this inner mitochondrial membrane protein dissipates the proton gradient across the mitochondrial inner membrane resulting in increased proton conductance and the release of energy as heat (Cannon and Nedergaard, 2004). Nedergaard et al. (2001) suggested that UCP1 is unique and is 3 the only protein involved in adaptive non-shivering thermogenesis. While brown adipose tissue- mediated thermogenesis is a major determinant of body temperature regulation, the low abundance of brown adipose tissue and UCP1 in adult mammals leads one to question its metabolic significance and clinical potential. There are three families of uncoupling proteins (UCP1, UCP2 and UCP3) which are present in the inner mitochondrial membrane that separates the mitochondrial matrix from the intermembrane space, uncouple the oxidative phosphorylation process and dissipate the proton gradient as heat (Cannon and Nedergaard, 2004). With the investigations on sympathomimetic-induced hyperthermia by Dr. Jon Sprague, Bowling Green State University, it was observed that there is a presence of another SNS-induced pathway. In one experiment, when UCP1 knockout mice were administered norepinephrine exogenously, thermogenic response was observed (Feldmann et al., 2009) indicating a presence of additional mediators of thermogenesis other than UCP1. In another experiment, UCP3 knock out mice treated with MDMA, a strong activator of the SNS, exhibited a larger attenuation of both sympathomimetic and norepinephrine- induced thermogenesis compared to wild type mice (Mills et al., 2003). Subsequently, Sprague and others also demonstrated that UCP3 is an important thermogenic target of thyroid hormone- induced body temperature regulation in skeletal muscle (Flandin et al., 2009; Sprague et al., 2007). Riley et al. (2016) elucidated that UCP1 and UCP3 play complementary roles in the onset (UCP1) and maintenance (UCP3) of sympathomimetic-induced hyperthermia (Riley et al., 2016). All these ﬁndings contradict the claims of Nedergaard et al. (2001) that UCP1 is the only thermogen and es- tablish an important role for UCP3 (Fig. 1.2) in mediating the facultative thermogenesis induced by sympathomimetic challenge.

1.3 Gut Bacteria and Body Temperature Regulation: Is There Any Link?

The relationship between the gut microbes and the pathophysiology of diseases has been demonstrated in many recent studies. Intestinal bacteria have been involved in playing signiﬁ- cant roles in diseases such as autism, depression and substance-use disorders (Collins et al., 2012). Zietak et al. (2017) also showed the relationship between intestinal bacteria, bile acids and UCP- regulated thermogenesis in ymice. Man studies showed that intestinal bacteria might alter mood 4

Figure 1.2: Sympathetic stimulation and UCP-3 mediated heat generation. NE stimulation of β- Adrenergic receptors on adipose tissue liberates FFA into the circulation through a HSL dependent mechanism. Extracellular FFAs are transported into the skeletal muscle by the FAT/CD36 transporter. Once inside the Skeletal muscle mitochondrial membrane, FFA serve as a proton transporter mediating UCP3 heat generation; NE - Norepinephrine; TG - Triglyceride; DG - Diglyceride; HSL - Hormone-sensitive lipase; LPL - Lipoprotein Lipase; FFA - Free Fatty Acids (Modified from the figure made by Sarah Suffel). 5 and behavior such as a decrease in anxiety level in the germ-free mice (Heijtz et al., 2011), and a study reported that the transplantation of gut microbiota between different strains of mice associated with strain-specific anxiety (Bercik et al., 2011). Gut environment inhabits more than 10 trillion microorganisms (Rajilic-Stojanovi´ c´ and de Vos, 2014) and gut bacteria are involved in production of short-chain fatty acids like acetoacetate, propionate etc. (Flint et al., 2008), conversion of tryptophan to quinolinic acid, a metabolite in the Kynurenine pathway (Kurnasov et al., 2003). Gut microbiome are also involved in adjusting the composition of the bile acid pool (Ridlon et al., 2006). FXR receptor regulates the synthesis of bile acid by negative feedback mechanism (Sinal et al., 2000). Since microbes modify the bile acid to tauro-conjugates, an antagonist of the FXR, controls the synthesis of bile acid under normal conditions in germ-free (Sayin et al., 2013) or antibiotic treated mice (Hu et al., 2014), reduced microbial activity results in larger bile acid pool. This indicates the change in bile acid composition due to change in gut microbe (Ridlon et al., 2006). Bile acids which are secreted in the duodenum by the hepatocytes binds to its receptor, TGR5 in intestinal cell, stimulating glucagon-like peptide production (Thomas et al., 2009) which in turn stimulates thermogenesis in brown adipose tissue (Lockie et al., 2012). Binding of the bile acids to TGR5 stimulates the production of cAMP that induces thyroxine (T4) to tri-iodothyronine (T3), ultimately releasing free fatty acid by lipolysis to activate thermogenesis (Gong et al., 1997). The importance of the role of the gut microbe in the nervous system through gut-brain axis has been increasingly acknowledged. It could perhaps due to the modulation of the host neurotransmitters that gut microbes interact with the nervous system (Strandwitz, 2018). Bacteria are found to have the capacity to produce various neurotransmitters (Lyte, 1993). Tsavkelova et al. (2000) reported that some bacteria like E. coli, Proteus vulgaris, Serratia marcescens, Bacillus subtilis, and Bacillus mycoides are able to produce norepinephrine in their biomass in vivo. Neurotransmitter serotonin can be extensively found in the gastrointestinal tract which is produced and stored in the Enterochromaffin cells (Resnick and Gray, 1961). The change of host serotonin levels appears to be mediated via secretion of small molecules (like short chain fatty acids or secondary bile acids) that signal enterochromaffin cells to produce serotonin via expression of tryptophan hydroxylase 6 (Yano et al., 2015). While how gut microbes assist in drug-mediated hyperthermia is unknown, it has been specu- lated that gut microbes activate potential transcription factors that are involved in the thermogenic process (Clark and Mach, 2017). It is known that different cellular molecules like PGC-1, CREB, AMPK, nuclear respiratory factors play vital role in mitochondrial respiration (Hood et al., 2011). Alteration of these factors changes the expression of genes associated with thermogenesis. Because sympathomimetic drugs induce hyperthermia with the activation of the sympathetic nervous system and gut microbes also interact with the nervous system through gut-brain axis, we hypothesize that drug-mediated hyperthermia could be modulataed by gut microbes. 7

CHAPTER 2 THE INFLUENCE OF THE HOST MICROBIOME ON 3,4-METHYLENEDIOXYMETHAMPHETAMINE (MDMA)-INDUCED HYPERTHERMIA AND VICE VERSA1

2.1 Introduction

3,4-Methylenedioxymethamphetamine (MDMA) is a synthetic sympathomimetic agent more commonly known as ”Ecstasy” or ”Molly.” MDMA induction of hyperthermia involves both central and peripheral triggers. Centrally, MDMA results in the activation of dopaminergic (Mechan et al., 2002) and serotonergic (Herin et al., 2005) receptors in thermoregulatory circuits in the hypothalamus (Rusyniak and Sprague, 2005; Hargreaves et al., 2007; Benamar et al., 2008); ultimately activating peripheral mediators of heat generation. In the periphery, MDMA-mediated increases in norepinephrine binding to the α1-adrenergeric receptor in vascular smooth muscle, results in vasoconstriction and attenuated heat dissipation (Sprague et al., 2007; Pedersen and Blessing, 2001). MDMA-induced norepinephrine release also triggers thermogenesis (Mills et al., 2003) by two routes; each mediated by signaling through β-adrenergic receptors in brown and white adipose tissue. Norepinephrine mediated activation of β-adrenergic receptor increases the expression of the UCP1 gene, leading to the production of the uncoupling protein UCP1 (Cassard- Doulcier et al., 1998). β-adrenergic receptor activation further induces lipolysis, with the resultant release of free fatty acids (FFA) from brown adipose tissue (BAT) and white adipose tissue (WAT) with subsequent transport of FFA into skeletal muscle mitochondria to serve as ligand activators for UCP-facilitated proton leak (Echtay et al., 2001; Brand and Esteves, 2005). When activated, UCPs dissipate the proton gradient across the inner mitochondrial membrane, resulting in increased proton conductance and the release of energy as heat (Cannon and Nedergaard, 2004). BAT-mediated thermogenesis is an important component in mammalian thermal homeostasis. Dependent upon stored metabolic fuels, BAT-mediated thermogenesis is modulated by a variety

1This chapter has been published as Ridge, E. A., Pachhain, S., Choudhury, S. R., Bodnar, S. R., Larsen, R. A., Phuntumart, V., & Sprague, J. E. (2019). The influence of the host microbiome on 3, 4- methylenedioxymethamphetamine (MDMA)-induced hyperthermia and vice versa. Scientific reports, 9(1), 4313. 8 of signals reflecting the metabolic and stored fuel status of the organism (Morrison and Madden, 2011). Bile acids provide one such signal, increasing energy expenditure in a UCP-dependent fashion in BAT and skeletal muscle (Watanabe et al., 2006). Using the G-protein coupled receptor TGR5, bile acids stimulate the production of cyclic AMP, inducing 2-iodothyronine deiodinase (D2) to convert local thyroxine (T4) into 3,5,3-tri-iodothyronine (T3). T3 in turn stimulates glucose metabolism and lipolysis, fueling thermogenesis (Gong et al., 1997). Binding of bile acids to TGR5 in intestinal cells stimulates the production of glucagon-like peptide 1 (GLP1) (Thomas et al., 2009), an insulinotropic hormone that stimulates BAT thermogenesis (Lockie et al., 2012). Bile acids are produced by hepatocytes and secreted into the duodenum where they function in the absorption of lipids and lipid soluble molecules. The intestinal microbiome actively modulates the size and composition of the bile acid pool (Ridlon et al., 2006). The farnesoid X receptor (FXR) provides for negative feedback regulation of bile acid synthesis (Sinal et al., 2000). Tauro- conjugated muricholic acids act as FXR antagonists, limiting hepatic bile acid synthesis under normal conditions; however, in germ-free (Sayin et al., 2013) or antibiotic treated mice (Hu et al., 2014), tauro-conjugates are not modified by microbial activity, resulting in a much larger bile acid pool, indicating that alterations in gut microbiome can alter bile acid composition (Ridlon et al., 2014). Interestingly, mice undergo dramatic remodeling of their gut microbiota when adapting to cold temperatures with accompanying changes in BAT tissue and browning of white adipose tissue. These tissue changes were transferable with microbiota transplantation into germ-free mice (Chevalier et al., 2015). Based on these studies and previous knowledge of UCP regulation of MDMA-induced hyperthermia, we hypothesized that the actions of some members of the intestinal microbiota might influence the sympathomimetic-induced thermogenic response to MDMA. Because of the role of bile acids in UCP regulation and role of the intestinal microbiome in reg- ulating the size and composition of the bile acid pool (Ridlon et al., 2006), we further tested the role of the TGR5 receptor (Li et al., 2017) and D2 (Larsen et al., 1979) in MDMA-mediated hyperthermia through their inhibition with triamterene and iopanoic acid respectively. The results of this study support this hypothesis and further suggests that MDMA can in turn trigger a rapid 9 remodeling of the microbiota composition in at least some intestinal compartments.

2.2 Results

2.2.1 Quantiﬁcation of Intestinal Bacteria by qPCR

To determine if changes in intestinal microbiota influence the thermogenic response to MDMA, animals were provided a cocktail of antibiotics (ABX): bacitracin, neomycin, and vancomycin, via their drinking water, for 14 days before MDMA treatment. With the exception of the first day of exposure to the antibiotics (Fig. 2.1A- two-tailed t-test: p=0.0019; t=3.535), daily fluid intake and body weight (Fig. 2.1B- two-tailed t-test: p=0.2144; t=1.278) did not differ between groups over the course of the experiment. To ensure the ability of mixed ABX in reducing gut bacteria, total DNA was purified from 200mg of the cecum of each animal and they were pooled together, followed by qPCR analysis using 200ng of pooled DNA and universal primers specific for the bacterial 16S rRNA gene. Based on the quantification cycles (Cq) values, a significant reduction in apparent bacterial number was evident in the ABX groups compared to the H2O control groups (Fig. 2.2- two-tailed t-test: p=0.0016; t=4.296). Prolonged treatment with antibiotics resulted in markedly enlarged ceca (data not shown), similar to the previous observations of others (Kiraly et al., 2016).

Figure 2.1: Daily ﬂuid intake for both antibiotic-treated (ABX) and control (H2O) groups (A). Mean body weight for both antibiotic-treated and control groups (B). * indicates signiﬁcantly different from all other treatment groups (p=0.0019). Each value is the mean±SEM (n=12). 10

Figure 2.2: Quantification of cecal bacteria by qPCR. Quantification cycles (Cq) values of the 16S rRNA gene using 200ng of a pool of DNA extracted from twelve animals per treatment. All qPCR assays were run in triplicate including no template negative controls. * indicates significant difference between treatment groups (p=0.0016). Each value is the mean±SEM (n=12).

2.2.2 Analysis of Cultivatable Cecal Bacteria

qPCR analysis (Fig. 2.2) established that ABX treatment reduced bacterial numbers in the cecum relative to untreated controls, evident by the increased Cq value for the ABX-treated animals (Fig. 2.2). Our working assumption was that ABX treatment would alter the composition of the cecal microbiota by differentially selecting against antibiotic sensitive bacterial strains. To determine if this occurred, we evaluated kanamycin resistance in cecal samples harvested at necropsy from each of the four groups. Resistance to kanamycin would be indicative of the selection of strains capable of producing aminoglycoside modifying enzymes by the ABX regimen. Comparison of the relative proportions of kanamycin resistant culturable bacterial veriﬁed that such alterations did occur. For the six saline-challenged animals that received no antibiotics (H2O control), only 15-48% (mean=27%) of the culturable cecal bacteria grew in the presence of kanamycin, whereas for the six saline-challenged ABX treated animals (ABX control) 53-100% (mean=78%) of the culturable cecal bacteria grew in the presence of kanamycin. A similar proportion of culturable cecal bacteria (46-83%; mean=64%) able to grow in the presence of kanamycin were found in the six MDMA-challenged ABX treated animals (Fig. 2.3-One way ANOVA with Student-Newman- 11 Keuls post hoc test: F(2,15)=12.823, p=0.006).

Figure 2.3: Relative proportions of kanamycin-tolerant culturable bacteria recovered in cecal contents. * indicates signiﬁcantly different from H2O control group (p=0.006) Each value is the mean±SEM (n=6).

For the six non-ABX-treated MDMA-challenged animals (H2O MDMA), the proportion of kanamycin-resistant culturable bacteria could not be determined, as the colonies were obscured by the presence of swarming bacteria on plates lacking kanamycin. Bacterial swarming on a nutrient- rich medium is a phenotype associated with the genus Proteus, a common inhabitant of mammalian digestive systems (Janda et al., 2006). The swarmers were subsequently isolated as single colonies on MacConkey agar, which contains bile salts that inhibit swarming behavior. Colony PCR of eight such isolates using primers speciﬁc for 16S rRNA produced amplimers corresponding with a sequence to a 314-base pair region of the 16S rRNA genes (GeneBank accession number MK033607) that is shared by both Proteus mirabilis and certain isolates of Salmonella enterica, including a serovar Typhimurium strain, all with 100% sequence identity and minimum E-values of 2.30 E−158 (Fig. 2.4A). Isolates were compared with a well-documented strain of S. enterica serovar Typhimurium (ATCC 19585) by plating on another bile salt-containing medium, Hektoen enteric (HE) agar, that distinguishes salmonella from other enteric bacteria based on the production of hydrogen sulﬁde, as visualized by the formation of black ferric sulfate precipitates in the inner 12 region of the colony. Such precipitates were not evident in swarmer isolates grown on HE agar, but were apparent for the S. enterica strain (Fig. 2.4B). Swarmer isolates were re-plated onto a nutrient rich medium (LB) where swarmer behavior was again evident, in contrast to S. enterica, which did not swarm (Fig. 2.4C). Collectively, these data suggest that the swarming bacteria are Proteus mirabilis.

Figure 2.4: Identification of swarming bacteria. (A) Consensus sequence representing eight swarmer isolates, corresponding and identical to bases 458-772 of rRNA gene of P. mirabilis AR 0029 (Genebank CPO29725) and numerous other isolates and S. enterica serovar Ty- phimurium (Genebank MH356711). (B) Comparison of swarmer isolate and S. enterica serovar Typhimurium grown on Hektoen enteric agar for 18 hrs at 37◦C. Scale is indicated by the 1 cm bar at the lower right of the figure. (C) Comparison of swarmer isolate and S. enterica serovar Ty- phimurium grown on LB agar for 18 hrs at 37◦C. Contrast in this image was increased to enhance visualization of the swarming pattern. Scale is indicated by the 1 cm bar at the lower right of the figure.

2.2.3 Effects of Gut Microbiota on MDMA-Induced Hyperthermia

MDMA signiﬁcantly increased core body temperature in both the antibiotic (ABX) and water

(H2O) experimental groups at the 30- and 60-minute time points as compared to control groups (Fig. 2.5A-One way ANOVA with Dunnett’s post hoc: F(2,15)=65.14, p<0.0001). The ABX

MDMA group showed an attenuated thermogenic response compared to that of the H2O MDMA 13

Figure 2.5: Changes in core temperature following the administration of MDMA (A). Temperature-area under the curve (TAUC) following the administration of MDMA (B). Maxi- mum change in temperature following the administration of MDMA (C). * indicates signiﬁcant difference from all other treatment groups (p<0.05). 14 group (Fig. 2.5A-One way ANOVA with Student-Newman-Keuls post hoc between time points: F(3,20)=177.35, p<0.0001). Calculation of the temperature area under the curve (TAUC) provided additional evidence for the diminished thermogenic responses of the ABX MDMA group relative to that of the H2O MDMA group (Fig. 2.5B- two-tailed t-test: p=0.0043; t=3.67). ABX pretreatment before MDMA signiﬁcantly attenuated the maximal change in core temperature (Fig. 2.5C- two-tailed t-test: p=0.006; t=3.47). To exclude the possibility that the effects of the oral antibiotic treatment on MDMA-induced hyperthermia were due to pharmacodynamic interactions between MDMA and the antibiotics, a second experiment was performed, with animals injected with a single intraperitoneal dose of antibiotics (1.67mg/kg vancomycin, 20mg/kg neomycin, and 293 U/kg bacitracin in PBS) thirty minutes prior to treatment with MDMA. These animals did not display an attenuated thermogenic response to MDMA. Instead, these animals displayed a similar maximum change in temperature as the control group (data not shown- two-tailed t-test: p=0.4525; t=0.781), supporting the interpretation that components of the microbiota, not the antibiotics, were responsible for the attenuated thermogenic response to MDMA in the ABX MDMA group.

2.2.4 MDMA Treatment Results in Alteration of the Expression of Genes Associated with Hyper- thermia

To assess the molecular mechanisms underpinning MDMA-mediated hyperthermia, expression of UCP1, UCP3 and TGR5 was examined in BAT and skeletal muscle by qRT-PCR. Results were normalized to β-actin. In BAT, MDMA treatment showed elevated expression of UCP1 (Fig. 2.6A-One way ANOVA with Student-Newman-Keuls post hoc test: F(3,8)=849.93, p=0.0001) and TGR5 (Fig. 2.6A-One way ANOVA with Student-Newman-Keuls post hoc test: F(3,8)=2373, p=0.0001) while the expression of UCP3 was reduced compared to controls (Fig. 2.6A-One way ANOVAwith Student-Newman-Keuls post hoc test: F(3,8)=339.12, p=0.0001). In skeletal muscle, MDMA increased the expression of UCP1 (Fig. 2.6B-One way ANOVA with Student-Newman- Keuls post hoc test: F(2,5)=3857, p=0.0001), UCP3 (Fig. 2.6B-One way ANOVA with Student- Newman-Keuls post hoc test: F(3,8)=10872, p=0.0001) and TGR5 (Fig. 2.6B-One way ANOVA with Student-Newman-Keuls post hoc test: F(3,8)=2696, p=0.0001). Treatment with ABX for 14 15

Figure 2.6: qPCR gene expression analysis of TGR5, UCP1 and UCP3 in (A) BAT and (B) skeletal muscle. * signiﬁcantly different from all other treatment groups ( p < 0.01). ** signiﬁcantly different from all other treatment groups (p < 0.001). Each value is the mean±SEM (n=6). days prior to MDMA challenge down-regulated the expression of these genes in both BAT and

skeletal muscle compared to H2O MDMA group.

2.2.5 Effect of Triamterene (TM) on MDMA-Induced Hyperthermia

In both the vehicle (VEH)/MDMA and TM/MDMA groups, MDMA administration resulted in a signiﬁcantly higher core body temperature than the other treatment groups at the 90-minute time point (Fig. 2.7A-One way ANOVA with Student-Newman-Keuls post hoc between time points: F(3,19)=64.05, p=0.0001). Animals treated with TM 30minutes prior to MDMA demonstrated an attenuated thermogenic response when compared to the VEH/MDMA group (Fig. 2.7A-One way ANOVA with Student-Newman-Keuls post hoc between time points: F(3,18)=23.34, p=0.0001). TAUC analysis for the VEH/MDMA group was signiﬁcantly greater compared to the TM/MDMA group (Fig. 2.7B- two-tailed t-test: p=0.04; t=2.43). MDMA induced a hyperthermic response that 16

Figure 2.7: Effect of triamterene pretreatment on MDMA-induced hyperthermia. (A) The effects of triamterene pretreatment 30minutes prior to MDMA on core body temperature over a 90-minute time interval. Each value is the mean±SEM (n=6). * indicates significantly different between treatment groups (p<0.05)]. (B) Temperature Area Under the Curve (TAUC) following MDMA treatment 30 minutes after triamterene pretreatment. Each value is the mean±SEM (n=6). * indicates significantly different between treatment groups (p< 0.05). (C) Max Change in Temperature (∆Tmax) following treatment of MDMA 30 minutes prior to triamterene pretreatment. Each value is the mean±SEM (n=6). ** indicates significantly different between treatment groups (p<0.01). 17 resulted in a maximal temperature change (∆Tmax) of 3.7±0.2◦C, while TM treatment prior to MDMA attenuated the hyperthermic response with a ∆Tmax of 2.2±0.4◦C (Fig. 2.7C- two-tailed t-test: p=0.0045; t=3.763).

2.2.6 Effect of Iopanoic Acid (IOP) on MDMA-Induced Hyperthermia

In both the VEH/MDMA and IOP/MDMA groups, MDMA administration resulted in a significantly higher core body temperature than the other treatment groups at both the 60- and 90-minute time points. Additionally, pretreatment with IOP significantly a ttenuated M DMA-induced hyperthermia at the 60- and 90-minute time points when compared to the VEH/MDMA group (Fig. 2.8A-One way ANOVA with Student-Newman-Keuls post hoc between time points: F(3,20)=64.67, p=0.0001). Furthermore, theUC TA for VEH/MDMA was significantly greater than IOP/MDMA (Fig. 2.8B- two-tailed t-test: p=0.005; t=3.562). Finally, the IOP/MDMA treatment resulted in a ∆Tmax of 2.1±0.2◦C, which was significantly less than that of VEH/MDMA ∆Tmax of 3.7±0.5 (Fig. 2.8C- two-tailed t-test: p=0.0005; t=5.072). 18

Figure 2.8: Effects of IOP pretreatment on MDMA-induced hyperthermia. (A) The effects of IOP pretreatment each day for 7 days and 30 minutes prior to MDMA on core body temperature over a 90-minute time interval. Each value is the mean±SEM (n=6). * indicates significantly different between treatment groups (p<0.05). (B) Temperature Area Under the Curve (TAUC) following MDMA treatment 30 minutes after iopanoic acid pretreatment. Each value is the mean±SEM (n=6). ** indicates significantly different between treatment groups (p < 0.01). (C) Max Change in Temperature (∆Tmax) following treatment of MDMA 30 minutes after iopanoic acid pretreatment. Each value is the mean±SEM (n=6). *** indicates significantly different between treatment groups (p<0.001). 19 2.3 Discussion

Several studies have found that microbiome-generated heat contributes to the maintenance of body temperature in animals (for a review see Rosenberg and Zilber-Rosenberg (2016)). Oral treatment of rabbits (Fuller and Mitchell, 1999) and rodents (Kluger et al., 1990; Bowers et al., 2014) with non-absorbable antibiotics lowers core body temperature. Recent findings using Brandt’s voles suggest that changes in core body temperature changes the host gut microbial community, which in turn regulates the hosts thermal homeostasis (Zhang et al., 2018). The present findings suggest that the microbiome-gut-brain axis may play a contributory role in the hyperthermia mediated by MDMA. ABX treatment for 14 days prior to MDMA treatment not only reduced the number and altered the composition of the cecal bacterial population, but also attenuated MDMA- induced hyperthermia. Recently, Althobaiti et al. (2016) demonstrated that the β-lactam antibiotic, ceftriaxone, administered for three days following methamphetamine treatment blocked the methamphetamine-induced hyperthermia. Those authors did not examine the effects of ceftriaxone treatment on the gut microbiome, but linked the effects to ceftriaxone regulation of the central expression of the glutamate transporter. Intraperitoneal injection of minocycline for three days has been shown to attenuate the hyperthermic effects of MDMA (Anderson et al., 2011), but had no effect on body temperature when given for two days (Orio et al., 2010). Previous studies by Rawls et al. (2007) found that ceftriaxone given for seven days prior to hyperthermic doses of morphine also blocked hyperthermia. They suggested a potential role for the glutamate transporter, but did not examine the effects of ceftriaxone on the gut microbiome. This present study is the first to examine the potential role of the bacterial component of the gut microbiome in the hyperthermia associated with drugs of abuse. Although the results of the present study demonstrate a potential relationship between MDMA-induced hyperthermia and the gut microbiome, they do not suggest that the microbiome is a major contributor to this hyperthermia in that the effects of the ABX treatment were slight yet significant. We have recently ascertained that UCP1 and UCP3 play complementary roles in the onset (UCP1) and maintenance (UCP3) of sympathomimetic-induced hyperthermia (Riley et al., 2016). 20 In the present study, we observed an increase in UCP1 expression in both BAT and skeletal muscle following MDMA challenge while UCP3 expression increased only in skeletal muscle. ABX treatment blocked these changes in UCP expression levels, consistent with our previous studies regarding the role of UCP in MDMA-mediated hyperthermia (Riley et al., 2016). The TGR5 receptor has been suggested to play a role in cold-induced thermogenesis through its regulation of the thyroid-catalyst protein deiodinase II (D2) and the ultimate regulation of UCP expression (Watanabe et al., 2006; Zietak et al., 2017). Similarly, in both BAT and skeletal muscle of our rat models, MDMA increased TGR5 expression levels. Conversely, prior ABX treatment rendered TGR5 gene expression refractory to this MDMA-induced change. Recent studies have suggested that TM inhibits the TGR5 receptor (Li et al., 2017). Those authors reported that TM was able to dose-dependently inhibit the increase in glucose uptake mediated by TGR5 agonists in Chinese hamster ovary cells (CHO-K1 cells). Moreover, glucagon-like peptide-1 secretion and increased cAMP levels, which are induced by TGR5 activation, were both shown to be dose dependently reduced by TM (Li et al., 2017). Additional animal studies by the same researchers using streptozotocin-induced diabetic rats supported these findings, indicating that TM is an effective TGR5 antagonist (Li et al., 2017). In the present study, we demonstrate and confirm that TM functions as an antagonist of the TGR5 receptor to attenuate the hyperthermia mediated by MDMA. Additionally, the D2-inhibitor IOP significantly attenuated MDMA-mediated hyperthermic response. IOP was first shown to inhibit D2 activity and the enzymatic conversion of T4 to T3 by Larsen et al. (1979). T3 has been demonstrated to increase UCP1 and UCP3 mRNA expression in BAT and skeletal muscle, respectively (Silva Queiroz et al., 2004; Masaki et al., 2000). TGR5 receptor activation facilitates cAMP production that ultimately leads to an increase of D2 production (Watanabe et al., 2006). The attenuated MDMA-mediated hyperthermic response seen after D2 inhibition is consistent with previous studies from our laboratory, demonstrating a role for thyroid hormone in the hyperthermia mediated by MDMA (Sprague et al., 2007). This study suggests that the resident gut flora influences the physiological response of their host to the challenge of MDMA. The nature of this influence, and the specific members of the resident 21 microbial community responsible, remains to be discerned, but clearly merits further consideration. Identifying mechanisms by which the microbiota modulate hyperthermic responses provides alternative strategies to dissect this and other complex regulatory pathologic processes. The fact that MDMA changed the composition of the gut microbiota, coupled with the observation that altering the gut microbiota with antibiotics modified the thermogenic response to MDMA in the rodent model, suggests a potential relationship between human gut microbiota and body temperature regulation of relevance to our understanding of MDMA-induced pathological thermogenesis in humans. The hyperthermia mediated by sympathomimetic agents such as MDMA involves both peripheral and central mechanisms. The communication between the gut-brain-axis is complex and involves many of the same neurotransmitters that are targets for the pharmacological and toxi- cological actions of MDMA. For example, serotonin and norepinephrine play key roles in reg- ulating the communication between gut-brain-axis. Subsequently, an association has been made between intestinal bacteria and the pathophysiology of CNS disorders such as autism, depression and substance-use disorders (for a review, see Collins et al. (2012)). In the present study, we did not examine the potential link between the gut-brain-axis and studies in this area are therefore warranted. This present study was optimized to provide for a consistent pathological response to afford greater precision to evaluate the potential of individual components (such as the composition of the gut microbiota) to enhance MDMA-induced thermogenesis. To this end, we used a 20mg/kg dose of MDMA. This is the standard dose that our lab has used to induce MDA induced hyperthermia (Sprague et al., 2007). Additionally, toxicity studies with MDMA typically use a dosage range of 10 to 80mg/kg (for a review, see Baumann et al. (2007)). Ambient temperature has been shown to influence the thermogenic response to amphetamines (Hargreaves et al., 2007; Gordon et al., 1991; Broening et al., 1995). O’Shea et al. (2005) demonstrated that rats treated with MDMA in environmental temperatures of 30◦C or higher became hyperthermic. However, if the ambient temperature is reduced to 20-22◦C, MDMA mediates a hypothermic response (Malberg and Seiden, 22 1998). In present study, we maintained an ambient temperature 24-26◦C. Finally, we had previously demonstrated that the amount of fat in the diet further enhanced the thermogenic response to MDMA (Mills et al., 2007). We therefore fed the animals a 10% fat diet. Intriguingly, this study found the presence of a Proteus population of sufficient relative number to obscure colony counting, but only in non-ABX animals treated with MDMA. This indicated that MDMA itself either directly or indirectly stimulates rapid alterations in the composition of the resident bacterial population of the cecum. This suggests the possibility that the repeated use of MDMA and similar compounds may result in long-term alterations in the composition of resident intestinal bacterial populations. This possibility and its potential consequences also merit further consideration.

2.4 Methods

2.4.1 Animals

Male Sprague-Dawley rats (284.6 ± 2.4g, Envigo, Indianapolis, IN) were used. Animals were housed one per cage (21.0x41.9x20.3cm3), maintained on a 12:12h light/dark schedule, and provided access to food and water ad libitum. Animals were sustained on a minimum 10% fat diet and housed in a room kept at 24-26◦C in order to maximize thermogenic responses (Mills et al., 2007; Dafters, 1994). Animal maintenance and research were conducted in accordance with the eighth edition of the Guide for the Care and Use of Laboratory Animals as adopted and circulated by the National Institutes of Health, and protocols were approved by the Bowling Green State University Animal Care and Use Committee. All animals were allowed to acclimate to the facility for one week prior to the start of any treatments.

2.4.2 Drugs and Chemicals

Racemic MDMA was donated by Dr. Mathew Banks of Virginia Commonwealth University (Richmond, VA) in the HCl salt form. Triamterene (TM) in salt form was obtained from Cayman Chemicals (Ann Arbor, MI), and iopanoic acid (IOP) in salt form was obtained from Fisher Sci- entiﬁc (Waltham, MA). All other chemicals and reagents were obtained from Sigma Chemical (St. 23 Louis, MO). MDMA was diluted in normal saline (NS), and TM and IOP in dimethylsulfoxide (DMSO).

2.4.3 ABX Study Design

Animals were randomly assigned to four treatment groups (n=6): H2O saline, ABX saline,

H2O MDMA, and ABX MDMA. Antibiotics were administered via the drinking water for fourteen days in accordance with the methods described in the study by Kiraly et al. (2016). Antibiotic doses were: Neomycin 2mg/mL, Vancomycin 0.2mg/mL, and Bacitracin 0.5mg/mL. eFluid intak was measured daily, and body weight was measured every ﬁve d ays. On the fourteenth day, animals were injected subcutaneously with either saline or MDMA (20mg/kg). Temperatures were taken rectally just prior to treatment (baseline) and every 30min for an hour post-treatment using a Physiotemp Thermalert TH-8 termocouple (Physitemp Instruments, Clifton, NJ) attached to a RET-2 rectal probe. The animals were then euthanized by carbon dioxide asphyxiation and BAT, SKM, and cecum were dissected out for qPCR analysis and for bacterial count (cecum only), UCP 1&3 and TGR5 quantiﬁcation (BAT and SKM only). To rule out the systemic effects of the antibiotics, six animals were injected intraperitoneally with 1.67mg/kg vancomycin, 20mg/kg neomycin, and 293 U/kg bacitracin in PBS (Kiraly et al., 2016) thirty minutes before the administration of MDMA (20mg/kg). Temperatures were recorded just prior to antibiotic administration (baseline) and every 30minutes for an hour post-treatment of MDMA.

2.4.4 RNA Isolation and qRT-PCR

SKM and BAT were collected and preserved at -80◦C. Total RNA was isolated after homog- enizing the tissues using PureZOLTM RNA Isolation reagent (Biorad). The concentration and quality of the RNA was determined using a NanoDrop Spectrophotometer (Thermo) and by 1% agarose gel electrophoresis, respectively. cDNA was synthesized from 200ng of total RNA using the iScriptTM Select cDNA Synthesis Kit (Biorad). Single-plex real-time quantitative PCR was carried out in CFX Connect Real-Time PCR Detection System (Biorad) using iTaqTM universal SYBR Green supermix (Biorad) with the following parameters: 3min at 95◦C; 40 cycles of 95◦C 24 for 10s, 52-58◦C for 30s, 68◦C, 10s; and graded heating to 95◦C to generate melt peak curve. Quantiﬁcation cycle (Cq) values for all the genes within all four groups were compared and analyzed by using the ∆∆C(t) method (Kiraly et al., 2016). All the primer pairs used for the analysis of UCP1, UCP3, TGR5 and actin are shown in Table 2.1. Table 2.1: Primers used for quantitative PCR reactions

Target name Forward primer (5’-3’) Reverse primer (5’-3’) Beta-actin CAACCTTCTTGCAGCTCCTC TTCTGACCCATACCCACCAT UCP-1 ATCACCTTCCCGCTGGAC GGCAGACCGCTGTAGAGTTTC UCP-3 TGGTGAAGGTCCGATTTCAAG CGTTTCTTGTGATGTTGGGC TGR5 CTGGCCCTGGCAAGCCTCAT CTGCCATGTAGCGCTCCCCGT EubF-16S TCCTACGGGAGGCAGCAGT GGACTACCAGGGTATCTAATCCTGTT

2.4.5 qPCR for Cecal Bacteria

200mg of frozen cecal samples from each animal were ground in liquid nitrogen and bacterial DNA was extracted using Puregene Blood Core Kit B (Qiagen, CA) according to the manufacturers instructions. The concentration and quality of the DNA was assessed using NanoDrop (Thermo Fisher Scientific, PA). Equal volumes of 100µl of DNA samples from each individual were pooled together into one sample for each treatment and was subjected to qPCR. Each qPCR reaction contained 200ng of DNA in 20µl reaction volume. The qPCR reaction (iTaqTM Universal SYBR Green Supermix, BioRad, CA) contained the universal eubacterial primers for 16S rRNA gene listed in Table 2.1. The qPCR cycle parameters were 3min at 95◦C; 40 cycles of 95◦C for 10s, 55◦C for 20s, and 68◦C, 10s. Each qPCR reaction was run in triplicate along with reactions without DNA (no template) as negative controls. Quantification cycles (Cq) threshold was placed above baseline of the background noise of the fluorescence dye present in negative controls within the linear portion of the curve and were further used for statistical analysis.

2.4.6 Agar Plate Assay and Antibiotic Screening

Cecal contents from all animals were collected in sterile tubes and adjusted to 200mg/ml with 4◦C phosphate buffered saline (PBS; 0.1M, pH 7.4). The resultant cecal slurries were homogenized and centrifuged at 400g for 2minutes (Vanhaecke et al., 2008). Serial 10-fold dilutions of the cecal 25 slurry were spread on LB agar (Miller formulation; Difco-BRL) with or without 50g/ml kanamycin

◦ (LBkan50), incubated at 37 C overnight, then manually scored for colony forming units (CFU), with the percent of kanamycin resistant (kanr) determined by dividing the number of CFU on the

LBkan50 by the number of CFU on LB, and multiplying by 100.

2.4.7 Isolation and Identiﬁcation of Swarming Bacteria

Swarmers were isolated from the initial LB agar plates by subculture onto MacConkey agar (Difco-BRL), where the presence of bile salts inhibited swarming behavior. Plates were incubated for 18 hrs at 37◦C. Resultant colonies were picked and streaked for isolation onto fresh MacConkey agar and incubated as above. Isolated swarmer colonies were subjected to colony PCR, with the 16S rRNA gene ampliﬁed using the primer set Eub-16S F (Table 2.1, Nadkarni et al. (2002)) corresponding to bp of 331 to 799 of 16S rRNA of Escherichia coli. Sequencing of the PCR amplicons was performed at the University of Chicago DNA sequencing and genotyping facility, Chicago, Illinois, USA. Sequences were evaluated for similarity to known sequences in the National Cen- ter for Biotechnology Information (NCBI) nucleotide sequence database using BLAST (Altschul et al., 1990). Because the resultant rRNA sequences were identical to those of both P. mirabilis and S. enterica, the phenotype of the swarming isolate was compared to that of S. enterica, by plating on the differential medium Hektoen enteric agar (Difco-BRL) and by the ability to swarm on LB agar.

2.4.8 Pharmacological Inhibition of TGR5 and D2 Study Design

Animals were randomly allocated into one of six test groups (n=6): VEH/SAL (vehicle/saline), VEH/MDMA (MDMA only), TM/SAL (Triamterene only), TM/MDMA, IOP/SAL (Iopanoic acid only), and IOP/MDMA. Following the methods of Li et al. (2017), TM (50mg/kg) was administered via an ip injection 30 minutes before treatment with MDMA (20mg/kg, sc). Animals in the IOP/SAL and IOP/MDMA groups were pretreated with IOP (50mg/kg/day, ip) daily for seven days, with the IOP dose size in accordance with Larsen et al. (1979). On day 7, animals were treated with MDMA (20mg/kg, sc) 30minutes after treatment with IOP or its vehicle, and core 26 rectal temperature was measured at 30-minute intervals for 90minutes post-treatment.

2.4.9 Statistical Analysis

GraphPad InStat v.6.0 software was used to complete all statistical analyses of data. Tempera- tures between treatment groups were compared using one-way ANOVA with a Student-Newman- Keuls post-hoc test. Additionally, temperatures within a treatment group were compared using a one-way ANOVA with a Dunnett’s post-hoc test. Maximum temperature change (∆Tmax) was calculated by comparing the maximum increase in core temperature to the animal’s baseline temperature. An unpaired, two-tailed t-test was used to compare the maximum temperature changes

between the ABX MDMA and H2O MDMA groups. Signiﬁcance was set at the 95% conﬁdence level (p<0.05).

2.5 Acknowledgements

This work was supported in part by an internal grant from the Ohio Attorney Generals Center for the Future of Forensic Science to .V.P

2.6 Author Contributions

Emily A. Ridge conducted the in vivo microbiome studies, biological sample collections and TM studies. Sara R. Bodnar conducted the IOP studies. Sudhan Pachhain and Vipaporn Phuntu- mart conducted the qPCR analysis. Sayantan Roy Choudhury and Ray A. Larsen conducted the microbiome analysis. Jon E. Sprague conceived the project rationale and supervised all experi- ments. All authors contributed equally to the writing of the manuscript. 27

CHAPTER 3 GENDER DIFFERENCES IN TOLERANCE TO THE HYPERTHERMIA MEDIATED BY THE SYNTHETIC CATHINONE, METHYLONE1

3.1 Introduction

The hyperthermia induced by synthetic cathinones (”bath salts”) has been linked to acute kid- ney injury, rhabdomyolysis, and ultimately death (Borek and Holstege, 2012; OConnor et al., 2015). Methylone, the β-keto analog of 3,4-methylenedioxymethamphetamine (MDMA), con- tinues to be commonly seen in forensic laboratories (NFLIS). We have previously demonstrated that methylone is the most potent thermogen of the synthetic cathinones (Grecco and Sprague, 2016). Both males and females demonstrate an increase in plasma norepinephrine levels following MDMA treatment; however, males display a signiﬁcantly greater acute increase in norepinephrine levels relative to female animals (Wyeth et al., 2009). Additionally, skeletal muscle uncoupling protein 3 (UCP3) expression is 80% less in females than in males. This depressed expression level is dependent upon estrogen levels and correlates with a reduced thermogenic response in the female rats following acute MDMA treatment (Wyeth et al., 2009). UCP1 and UCP3 play complementary roles in the onset (UCP1) and maintenance (UCP3) of sympathomimetic-induced hyperthermia (Riley et al., 2016) Most preclinical studies have focused on the acute pharmacological effects of synthetic cathinone analogs, despite prevailing epidemiological evidence that these drugs are abused repeatedly (Johnson and Johnson, 2014). Clemens et al. (2007) demonstrated that female rats given MDMA at a dose of 8 mg/kg (ip) at an ambient temperature of 28◦C developed tolerance to the hyperthermic response after eight weeks of treatment. Those authors did not directly compare females to males. In the present study, we examine the gender differences in the development of tolerance to the hyperthermia mediated by methylone.

1This Chapter has been submitted for publication in a journal and is currently under review. 28 3.2 Materials and Methods

3.2.1 Animals

Adult, male (n=12, 275-300 g) and female (n=12, 225-250 g) Sprague-Dawley (Rattus norvegi- cus domesticus) rats (N=24) were obtained from Envigo (Indianapolis, IN). Animals were housed one per cage (cage size: 21.0 x 41.9 x 20.3 cm) and maintained on a 12:12 h light/dark schedule. To maximize the thermogenic response, animals were maintained at an ambient temperature of 25◦C to 27◦C and fed a minimum 10% fat diet (Dafters, 1994; Mills et al., 2007). Animal maintenance and research were conducted in accordance with the eighth edition of the Guide for the Care and Use of Laboratory Animals; as adopted and promulgated by the National Institutes of Health, with protocols approved by the Bowling Green State University Animal Care and Use Committee.

3.2.2 Drugs and Chemicals

Methylone was obtained from Cayman Chemicals (Ann Arbor, MI) as a hydrochloride salt. On the day of the study, methylone solutions were made fresh at a concentration of 10 mg/mL in 0.9% normal saline. All other chemicals and reagents were obtained from Sigma Chemical (St. Louis, MO).

3.2.3 Study Design

Male and female rat cohorts were randomly assigned into two groups of six (6) each, the first group being the treatment group and the second serving as the saline controls. On testing day, all subjects were weighed prior to drug challenge, and a core temperature reading was taken with a rectal thermometer at time zero. On treatment days, the ambient temperature averaged 27.1±0.4 ◦C. Following the first temperature measurement, male and female treatment groups received a 10 mg/kg subcutaneous (sc) dose of methylone, and control groups received an equal volume of saline solution (sc). Following drug challenge, core temperature readings were recorded every 30 minutes for a total of 90 minutes. This treatment schedule was maintained once a week for a total of five weeks. On the sixth testing session, the above protocol was performed up to the 90-minute time point, upon which rats were euthanized with CO2. Brown adipose tissue (BAT) and skeletal 29 muscle (SKM), namely the gastrocnemius, were removed and flash frozen with liquid nitrogen,

then stored at -80◦C.

3.2.4 RNA Isolation and qRT-PCR

To isolate total RNA, samples from SKM and BAT were homogenized, then extracted using PureZOLTM RNA Isolation reagent (BioRad, CA). The concentration and quality of the RNA were determined using a NanoDrop Spectrophotometer (Thermo, MI) and by 1% agarose gel electrophoresis, respectively. cDNA was synthesized from 200 ng of total RNA using the iScriptTM Select cDNA Synthesis Kit (Biorad, CA). Real-time quantitative PCR (qRT-PCR) was carried out in the CFX Connect Real-Time PCR Detection System (Biorad, CA) using iTaqTM universal SYBR Green supermix (Biorad, CA). The PCR parameters were as follows: 3 min at 95◦C; 40 cycles of 95◦C for 10s, 52-58◦C for 30s, 68◦C, 10s; followed by melt curve analysis (65◦C -95◦C). Quantiﬁcation cycle (Cq) values for all genes were compared and analyzed by using the ∆∆C(t) method (Kiraly et al., 2016). All primer pairs used for the analysis of UCP1, UCP3, TGR5, and actin controls were as described (Ridge et al., 2019).

3.2.5 Statistical Analysis

GraphPad InStat v.6.0 software was used to complete all statistical analyses of data. The results are presented as the mean ± SEM of the rectal core body temperatures of the treatment/control groups. Between-group differences were compared with a One-way ANOVA followed by Student- Newman-Keul’s multiple comparison test. Dunnet’s post-hoc tests were performed to analyze signiﬁcance of within-group changes over the six-week time c ourse. When only two groups were compared, a two-tailed t-test was performed. Signiﬁcance was established at p<0.05 a priori.

3.3 Results

3.3.1 Gender Differences in the Tolerance to Methylone-Mediated Hyperthermia

The ﬁrst week of treatment with methylone (10 mg/kg, sc) resulted in a signiﬁcant hyperthermic response in both the male (p<0.01; Figure 3.1A) and female (p<0.01; Figure 3.1B) rats in measures of ∆◦C from baseline temperature. The male rats continued to express a hyperthermic 30

Figure 3.1: (A) Weekly comparison of ∆◦C from baseline temperature in male treatment group at 30 (•) , 60 (), and 90-min (N) post treatment vs male saline controls at 30 (◦), 60 (), and 90- min (4) time points. Significance of hyperthermic response is denoted by asterisks; *= p<0.05, **= p<0.01, ***= p<0.001, while significant tolerance effects are denoted by †. (B) Weekly ◦ comparison of ∆ C from baseline temperature in female treatment group at 30 (•), 60 (), and 90-min (N) post treatment vs female saline controls at 30 (◦), 60 (), and 90- min (4) time points. Significance of hyperthermic response is denoted by asterisks; *= p<0.05, **= p<0.01, ***= p<0.001, while significant tolerance effects are denoted by †. Significant hypothermic effect is denoted by /c.(C) Weekly comparison of ∆◦C from baseline temperature in male treatment group at (•), 60 (), and 90-min (N) post treatment vs female treatment group at 30 (◦), 60 (), and 90- min (4) time points. Significance of hyperthermic response is denoted by asterisks; *= p<0.05, **= p<0.01 =, ***= p<0.001. 31 response (p<0.001) to methylone at weeks two and three. By the fourth week of methylone treatment, the male response, while still hyperthermic (p<0.05), yielded a significantly lower ∆◦C from baseline temperature than week three (p<0.001), suggesting a developing tolerance response. A significant difference in maximal temperature change from baseline in males between weeks three and four (p<0.001) further illustrates a tolerance effect (Figure 3.2). There was no hyperthermic effect in males (Figure 3.1A) at either week five or six, suggesting a sustained tolerance effect (Figure 3.2). Conversely, week one was the only time point where hyperthermia occurred in female rats treated with methylone (Figure 3.1B). By week two, female rats not only displayed no hyperthermic response to methylone, but also demonstrated a tolerance to the hyperthermia, with a significantly lower ∆◦C from baseline temperature compared to week one (p<0.01; Figure 1B). Furthermore, a hypothermic effect was observed after methylone treatments in female rats at weeks three, four, five and six, shown by significant ∆◦C from baseline temperature readings that were below zero (p<0.01). Weeks four and five in measures of maximal temperature change from baseline were significantly lower when compared to week one (p<0.01), in addition to being maximally below zero, further illustrating the hypothermic effect of methylone in female treatment group (Figure 3.2). Significant differences between males and females ∆◦C from baseline temperature were observed at the 30-min time point only on week one (p<0.001; Figure 3.1C). Nevertheless, there was no significant difference in maximal temperature change (p = 0.1169; Fig- ure 3.2). Weeks two and three resulted in significant differences in ∆◦C from baseline temperature following methylone exposure between male and female’s treatment groups at 30, 60, and 90- min time points (p<0.001). At week four, there was a significant difference ∆◦C from baseline temperature at both the 30 and 60-minute time points (p<0.05). Significant differences in maximal temperature change between males and females were seen at weeks two, three, four, and five (p<0.002). 32

Figure 3.2: Weekly maximal temperature change (◦C) from baseline in male and female rats following weekly treatment with methylone (10 mg/kg, sc) for five weeks. Each value is the mean ± SEM; n=6. Significance of between group differences are denoted by asterisks; *= p<.05, **= p<.01, ***= p<.001, while significant (p<0.002) tolerance effects are denoted by †.

3.3.2 Expression of Genes Associated with Hyperthermia in Response to Chronic Methylone Treatment

Gene expression analysis by qRT-PCR in SKM indicated down-regulation of TGR5 expression in both male and female methylone-tolerant rats. The down-regulation of TGR5 expression was significantly larger in methylone-tolerant males than in methylone-tolerant females (p<0.0001). The expression of UCP1 was almost 100-fold increased in methylone tolerant males whereas a down-regulation of UCP1 was observed in methylone-tolerant females (p<0.0001). For UCP3, the comparable significant fold changes were observed in both males and females methylone- tolerant rats compared to controls, with UCP3 expression in females being slightly higher than that observed in males (p = 0.0004; Figure 3.3). In brown adipose tissue, there was significant 33

Figure 3.3: qPCR gene expression analysis (Fold Change) of TGR5, UCP1 and UCP3 in (A) skeletal muscle and (B) brown adipose tissue following six weeks of chronic methylone (10 mg/kg, sc) treatment of male () and female () rats. ** = male and female fold changes for that specific gene are significantly different from each other (p<0.0004). ** = male and female fold changes for that specific gene are significantly different from each other (p<0.0001). Each value is the mean ± SEM (n=6). up-regulation in TGR5 expression in methylone-tolerant females relative to methylone-tolerant males (p < 0.0001). The expression of UCP1; however, showed a significant down-regulation in methylone-tolerant females compared a small positive up-regulation in methylone-tolerant males (p<0.0001). For UCP3, expression was increased in both methylone-tolerant males and females, with significantly increased expression in males relative to females (p < 0.0001; Figure 3.3).

3.4 Discussion

Here, we demonstrate for the first time that chronic treatment with the synthetic cathinone methylone can result in tolerance to the overall hyperthermic effects of the drug in both male and female rats. However, significant differences were seen between the males and females. The females rapidly developed a tolerance effect evident after the first week of exposure. By the fourth 34 week of methylone exposure, the response of female rats demonstrated a marked hypothermic response to the drug. Conversely, the males continued to display an acute hyperthermic response for the first three weeks of treatment. By the fourth week of treatment, the male hyperthermic response was blunted, and by the fifth week, the hyperthermic response was dissipated altogether. Clemens et al. (2007) treated female rats with MDMA (8 mg/kg), methamphetamine (8 mg/kg) or the combination weekly for 16 weeks. Those authors measured changes in body temperature following drug exposure on weeks one, eight and sixteen. They found that the hyperthermic effects of MDMA or MDMA/methamphetamine were lost by week eight. These findings are similar to our present finding, where the hyperthermic effects in our female animals were lost after one week of treatment and hypothermia was seen by three weeks of methylone treatment. Piper et al. (2014) utilized adolescent female rats also demonstrated a hypothermic response after MDMA (10 mg/kg) every five days from postnatal day 35 to 60. Peripherally, sympathomimetic-induced hyperthermia is mediated by an inability to dissipate heat through norepinephrine-mediated vasoconstriction (Pedersen and Blessing, 2001) and an increase in heat generation through the activation of mitochondrial uncoupling (Mills et al., 2004). Previously, we had demonstrated that the acute differences in thermogenic responses to MDMA in males and females rats could be attributed to four sex specific mechanisms: 1) female subjects have reduced sympathetic activation; 2) female vasculature is less sensitive to α1-adrenergic stimulation; 3) female vasculature has an increased sensitivity to nitric oxide and 4) female expression of UCP3 in skeletal muscle is less than that seen in males (Wyeth et al., 2009). Alteration of gene expression can also be mediated by epigenetic regulation via DNA methylation and chromatin/histone modifications. According to the National Institute on Drug Abuse, exposure to drugs of abuse can lead to the alteration of gene expression via epigenetic mechanism. Sprague-Dawley rats given cocaine demonstrated alteration in the expression of genes that correspond with drug-seeking and addiction behaviors via histone modifications (Kumar et al., 2005). Sex-dependent DNA methylation has been observed in the cortex of male and female rats during development and in adult rat (Wilson et al., 2011). Hypermethylation of the estrogen receptor 35 promoter was reported in rat following neonatal bisphenol A exposure (Doshi et al., 2011). The difference in expression of genes in our experiment between males and females following chronic methylone could be due, in part, to epigenetic regulation, which warrants further investigation.

3.4.1 Roles of TGR5, UCP1 and UCP3 in Sympathomimetic Induced Hyperthermia

UCP3 knockout mice exhibit a blunting of both sympathomimetic and norepinephrine induced thermogenesis compared to dtheir wil type littermates (Mills et al., 2003). Subsequently, UCP3 was demonstrated to be an important thermogenic target of thyroid hormone-induced body temperature regulation in skeletal muscle (Sprague et al., 2007; Flandin et al., 2009). Recently, UCP1 and UCP3 were found to play complementary roles in the onset (UCP1) and maintenance (UCP3) of sympathomimetic-induced hyperthermia (Riley et al., 2016). Bile acids increase energy expenditure in a UCP-dependent fashion in BAT and SKM (Watanabe et al., 2006). Through the activation of the G-protein coupled bile acid receptor TGR5 (aka. M-BAR, GPBAR1), bile acids increase uncoupling to generate heat (for a review see, Fiorucci et al. (2009)). Antagonism of the TGR5 receptor with triamterene has also been demonstrated to attenuate the hyperthermic effects of MDMA (Ridge et al., 2019). In the present study, chronic weekly exposure to methylone resulted in a signiﬁcant UCP1 reduction in SKM and BAT of the female rats. Although the males and females both demonstrated a reduction in TGR5 in SKM, in BAT the male displayed no change in TGR5 and the females an increase in TGR5. Finally, UCP3 expression increased in both the SKM and BAT of the males and females.

3.4.2 Clinical Implications

In a recent review of synthetic cathinone-related fatalities, Zaami et al. (2018) found that death was attributed to hyperthermia, hypertension and serotonin syndrome. Further, a majority of the victims were white males, with a previous history of drug abuse. In the present study, we found that weekly exposure to methylone resulted in a hyperthermic response in males over a longer period and that the females became tolerant within in a week of ﬁrst e xposure. Pharmacologic targeting of the peripheral mediators of MDMA-induced or methylone-induced hyperthermia with 36 carvedilol providing both β1-3AR antagonism with α1AR antagonism has also been shown to effectively reverse this hyperthermia in animal (Sprague et al., 2005; Zona et al., 2016; Kiyatkin et al., 2016) and human subjects (Hysek et al., 2012). Additionally, targeting the central triggers of the peripheral response with the atypical antipsychotic agent clozapine has also been effective in reducing MDMA-mediated thermogenesis (Kiyatkin et al., 2016). The gender differences in tolerance to the hyperthermia mediated by methylone were also associated with differences in the expression of genes associated with heat generation in target tissue.

3.5 Conclusions

Male and female rats treated weekly to methylone develop a tolerance to the drugs ability to induce hyperthermia. Female rats develop this tolerance much more rapidly and subsequently develop a hypothermic response to repeated dosing of methylone. The differences between the male and female subjects further demonstrates the need for gender studies when examining the toxicologic effects of drugs with abuse potential.

3.6 Funding

This study was funded in part by an internal grant from the Ohio Attorney Generals Center for the Future of Forensic Science.

3.7 Contribution to the Research

My contribution to this research involved extraction of RNA from the rat tissues and gene expression analysis using Real-time Quantitative PCR. 37

BIBLIOGRAPHY

Althobaiti, Y. S., Alshehri, F. S., Almalki, A. H., and Sari, Y. (2016). Effects of ceftriaxone on glial glutamate transporters in wistar rats administered sequential ethanol and methamphetamine. Frontiers in neuroscience, 10:427.

Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990). Basic local alignment search tool. Journal of molecular biology, 215(3):403–410.

Anderson, P., Hutchinson, M., Irvine, R., and Salem, A. (2011). Attenuating glial activation with minocycline reduces the hyperthermic response to 3, 4-methylenedioxymethamphetamine (mdma) in the rat.

Baumann, M. H., Wang, X., and Rothman, R. B. (2007). 3, 4-methylenedioxymethamphetamine (mdma) neurotoxicity in rats: a reappraisal of past and present ﬁndings. Psychopharmacology, 189(4):407–424.

Benamar, K., Geller, E. B., and Adler, M. W. (2008). A new brain area affected by 3, 4- methylenedioxymethamphetamine: A microdialysis–biotelemetry study. European journal of pharmacology, 596(1-3):84–88.

Bercik, P., Denou, E., Collins, J., Jackson, W., Lu, J., Jury, J., Deng, Y., Blennerhassett, P., Macri, J., McCoy, K. D., et al. (2011). The intestinal microbiota affect central levels of brain-derived neurotropic factor and behavior in mice. Gastroenterology, 141(2):599–609.

Borek, H. A. and Holstege, C. P. (2012). Hyperthermia and multiorgan failure after abuse of bath salts containing 3, 4-methylenedioxypyrovalerone. Annals of emergency medicine, 60(1):103– 105.

Bowers, S., Thompson, R., Mika, A., Greenwood, B., and Fleshner, M. (2014). 150. disruption 38 of the gut microbiome with oral antibiotic reduces core body temperature and disrupts diurnal rhythms of locomotor activity, but not sleep, in rats. Brain, Behavior, and Immunity, 40:e43.

Brand, M. D. and Esteves, T. C. (2005). Physiological functions of the mitochondrial uncoupling proteins ucp2 and ucp3. Cell metabolism, 2(2):85–93.

Broening, H. W., Bowyer, J. F., and Slikker, W. (1995). Age-dependent sensitivity of rats to the long-term effects of the serotonergic neurotoxicant (+/-)-3, 4-methylenedioxymethamphetamine (mdma) correlates with the magnitude of the mdma-induced thermal response. Journal of Phar- macology and Experimental Therapeutics, 275(1):325–333.

Cannon, B. and Nedergaard, J. (2004). Brown adipose tissue: function and physiological signiﬁ- cance. Physiological reviews, 84(1):277–359.

Cassard-Doulcier, A.-M., Gelly, C., Bouillaud, F., and Ricquier, D. (1998). A 211-bp enhancer of the rat uncoupling protein-1 (ucp-1) gene controls speciﬁc and regulated expression in brown adipose tissue. Biochemical journal, 333(2):243–246.

Chevalier, C., Stojanovic,´ O., Colin, D. J., Suarez-Zamorano, N., Tarallo, V., Veyrat-Durebex, C., Rigo, D., Fabbiano, S., Stevanovic,´ A., Hagemann, S., et al. (2015). Gut microbiota orchestrates energy homeostasis during cold. Cell, 163(6):1360–1374.

Clark, A. and Mach, N. (2017). The crosstalk between the gut microbiota and mitochondria during exercise. Frontiers in physiology, 8:319.

Clemens, K. J., Cornish, J. L., Hunt, G. E., and McGregor, I. S. (2007). Repeated weekly exposure to mdma, methamphetamine or their combination: long-term behavioural and neurochemical effects in rats. Drug and alcohol dependence, 86(2-3):183–190.

Collins, S. M., Surette, M., and Bercik, P. (2012). The interplay between the intestinal microbiota and the brain. Nature Reviews Microbiology, 10(11):735. 39 Dafters, R. I. (1994). Effect of ambient temperature on hyperthermia and hyperkinesis induced by 3, 4-methylenedioxymethamphetamine (mdma or ecstasy) in rats. Psychopharmacology, 114(3):505–508.

De la Torre, R., Farre,´ M., Roset, P. N., Pizarro, N., Abanades, S., Segura, M., Segura, J., and Cam´ı, J. (2004). Human pharmacology of mdma: pharmacokinetics, metabolism, and disposition. Therapeutic drug monitoring, 26(2):137–144.

Doshi, T., Mehta, S. S., Dighe, V., Balasinor, N., and Vanage, G. (2011). Hypermethylation of estrogen receptor promoter region in adult testis of rats exposed neonatally to bisphenol a. Toxicology, 289(2-3):74–82.

Echtay, K. S., Winkler, E., Frischmuth, K., and Klingenberg, M. (2001). Uncoupling proteins 2 and 3 are highly active h+ transporters and highly nucleotide sensitive when activated by coenzyme q (ubiquinone). Proceedings of the National Academy of Sciences, 98(4):1416–1421.

Fahal, I. H., Sallomi, D., Yaqoob, M., and Bell, G. (1992). Acute renal failure after ecstasy. BMJ: British Medical Journal, 305(6844):29.

Feldmann, H. M., Golozoubova, V., Cannon, B., and Nedergaard, J. (2009). Ucp1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality. Cell metabolism, 9(2):203–209.

Fernandez-Calderon, F., Cleland, C. M., and Palamar, J. J. (2018). Polysubstance use proﬁles among electronic dance music party attendees in new york city and their relation to use of new psychoactive substances. Addictive behaviors, 78:85–93.

Fiorucci, S., Mencarelli, A., Palladino, G., and Cipriani, S. (2009). Bile-acid-activated receptors: targeting tgr5 and farnesoid-x-receptor in lipid and glucose disorders. Trends in pharmacological sciences, 30(11):570–580. 40 Flandin, P., Lehr, L., Asensio, C., Giacobino, J.-P., Rohner-Jeanrenaud, F., Muzzin, P., and Jimenez, M. (2009). Uncoupling protein-3 as a molecular determinant of the action of 3, 5, 3-triiodothyronine on energy metabolism. Endocrine, 36(2):246–254.

Flint, H. J., Bayer, E. A., Rincon, M. T., Lamed, R., and White, B. A. (2008). Polysaccharide utilization by gut bacteria: potential for new insights from genomic analysis. Nature Reviews Microbiology, 6(2):121.

Fuller, A. and Mitchell, D. (1999). Oral antibiotics reduce body temperature of healthy rabbits in a thermoneutral environment. Journal of basic and clinical physiology and pharmacology, 10(1):1–14.

Gong, D.-W., He, Y., Karas, M., and Reitman, M. (1997). Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, β3-adrenergic agonists, and leptin. Journal of Biological Chemistry, 272(39):24129–24132.

Gordon, C. J., Watkinson, W. P., O’Callaghan, J. P., and Miller, D. B. (1991). Effects of 3, 4- methylenedioxymethamphetamine on autonomic thermoregulatory responses of the rat. Phar- macology Biochemistry and Behavior, 38(2):339–344.

Grecco, G. G. and Sprague, J. E. (2016). Impact of functional group modiﬁcations on designer phenethylamine induced hyperthermia. Chemical research in toxicology, 29(5):871–878.

Hargreaves, G., Hunt, G., Cornish, J., and McGregor, I. (2007). High ambient temperature increases 3, 4-methylenedioxymethamphetamine (mdma,ecstasy)-induced fos expression in a region-speciﬁc manner. Neuroscience, 145(2):764–774.

Heijtz, R. D., Wang, S., Anuar, F., Qian, Y., Bjorkholm,¨ B., Samuelsson, A., Hibberd, M. L., Forssberg, H., and Pettersson, S. (2011). Normal gut microbiota modulates brain development and behavior. Proceedings of the National Academy of Sciences, 108(7):3047–3052. 41 Herin, D. V., Liu, S., Ullrich, T., Rice, K. C., and Cunningham, K. A. (2005). Role of the serotonin 5-ht 2a receptor in the hyperlocomotive and hyperthermic effects of (+)-3, 4- methylenedioxymethamphetamine. Psychopharmacology, 178(4):505–513.

Hood, D. A., Uguccioni, G., Vainshtein, A., and D’souza, D. (2011). Mechanisms of exercise- induced mitochondrial biogenesis in skeletal muscle: implications for health and disease. Com- prehensive Physiology, 1(3):1119–1134.

Hu, X., Bonde, Y., Eggertsen, G., and Rudling, M. (2014). Muricholic bile acids are potent reg- ulators of bile acid synthesis via a positive feedback mechanism. Journal of internal medicine, 275(1):27–38.

Hysek, C., Schmid, Y., Rickli, A., Simmler, L., Donzelli, M., Grouzmann, E., and Liechti, M. (2012). Carvedilol inhibits the cardiostimulant and thermogenic effects of mdma in humans. British journal of pharmacology, 166(8):2277–2288.

Janda, J. M., Abbott, S. L., et al. (2006). The enterobacteria. American Society for Microbiology (ASM).

Johnson, P. S. and Johnson, M. W. (2014). Investigation of bath salts use patterns within an online sample of users in the united states. Journal of psychoactive drugs, 46(5):369–378.

Kiraly, D. D., Walker, D. M., Calipari, E. S., Labonte, B., Issler, O., Pena, C. J., Ribeiro, E. A., Russo, S. J., and Nestler, E. J. (2016). Alterations of the host microbiome affect behavioral responses to cocaine. Scientiﬁc reports, 6:35455.

Kiyatkin, E. A., Ren, S., Wakabayashi, K. T., Baumann, M. H., and Shaham, Y. (2016). Clinically relevant pharmacological strategies that reverse mdma-induced brain hyperthermia potentiated by social interaction. Neuropsychopharmacology, 41(2):549.

Kluger, M. J., Conn, C. A., Franklin, B., Freter, R., and Abrams, G. D. (1990). Effect of gastroin- 42 testinal ﬂora on body temperature of rats and mice. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 258(2):R552–R557.

Kumar, A., Choi, K.-H., Renthal, W., Tsankova, N. M., Theobald, D. E., Truong, H.-T., Russo, S. J., LaPlant, Q., Sasaki, T. S., Whistler, K. N., et al. (2005). Chromatin remodeling is a key mechanism underlying cocaine-induced plasticity in striatum. Neuron, 48(2):303–314.

Kurnasov, O., Goral, V., Colabroy, K., Gerdes, S., Anantha, S., Osterman, A., and Begley, T. P. (2003). Nad biosynthesis: identiﬁcation of the tryptophan to quinolinate pathway in bacteria. Chemistry & biology, 10(12):1195–1204.

Larsen, P., Dick, T., Markovitz, B., Kaplan, M., and Gard, T. (1979). Inhibition of intrapituitary thyroxine to 3.5. 3’-triiodothyronine conversion prevents the acute suppression of thyrotropin release by thyroxine in hypothyroid rats. The Journal of clinical investigation, 64(1):117–128.

Li, Y., Cheng, K. C., Niu, C.-S., Lo, S.-H., Cheng, J.-T., and Niu, H.-S. (2017). Investigation of triamterene as an inhibitor of the tgr5 receptor: Identiﬁcation in cells and animals. Drug design, development and therapy, 11:1127.

Lockie, S. H., Heppner, K. M., Chaudhary, N., Chabenne, J. R., Morgan, D. A., Veyrat-Durebex, C., Ananthakrishnan, G., Rohner-Jeanrenaud, F., Drucker, D. J., DiMarchi, R., et al. (2012). Direct control of brown adipose tissue thermogenesis by central nervous system glucagon-like peptide-1 receptor signaling. Diabetes, 61(11):2753–2762.

Lyte, M. (1993). The role of microbial endocrinology in infectious disease. Journal of Endocrinol- ogy, 137(3):343–345.

Malberg, J. E. and Seiden, L. S. (1998). Small changes in ambient temperature cause large changes in 3, 4-methylenedioxymethamphetamine (mdma)-induced serotonin neurotoxicity and core body temperature in the rat. Journal of Neuroscience, 18(13):5086–5094. 43 Masaki, T., Yoshimatsu, H., and Sakata, T. (2000). Expression of rat uncoupling protein family mrna levels by chronic treatment with thyroid hormone. International Journal of Obesity, 24(S2):S162.

Mechan, A. O., Esteban, B., O’Shea, E., Elliott, J. M., Colado, M. I., and Green, A. R. (2002). The pharmacology of the acute hyperthermic response that follows administration of 3, 4- methylenedioxymethamphetamine (mdma,ecstasy) to rats. British journal of pharmacology, 135(1):170–180.

Mills, E., Weaver, K., Abramson, E., Pfeiffer, M., and Sprague, J. (2007). Inﬂuence of dietary fats on ecstasy-induced hyperthermia. British journal of pharmacology, 151(7):1103–1108.

Mills, E. M., Banks, M. L., Sprague, J. E., and Finkel, T. (2003). Pharmacology: uncoupling the agony from ecstasy. Nature, 426(6965):403.

Mills, E. M., Rusyniak, D. E., and Sprague, J. E. (2004). The role of the sympathetic nervous system and uncoupling proteins in the thermogenesis induced by 3, 4- methylenedioxymethamphetamine. Journal of molecular medicine, 82(12):787–799.

Milroy, C., Clark, J., and Forrest, A. (1996). Pathology of deaths associated with” ecstasy” and” eve” misuse. Journal of clinical pathology, 49(2):149–153.

Morrison, S. F. and Madden, C. J. (2011). Central nervous system regulation of brown adipose tissue. Comprehensive Physiology, 4(4):1677–1713.

Mueller, P. D. and Korey, W. S. (1998). Death by ecstasy: the serotonin syndrome? Annals of emergency medicine, 32(3):377–380.

Nadkarni, M. A., Martin, F. E., Jacques, N. A., and Hunter, N. (2002). Determination of bacterial load by real-time pcr using a broad-range (universal) probe and primers set. Microbiology, 148(1):257–266. 44 Nedergaard, J., Golozoubova, V., Matthias, A., Asadi, A., Jacobsson, A., and Cannon, B. (2001). Ucp1: the only protein able to mediate adaptive non-shivering thermogenesis and metabolic inefﬁciency. Biochimica et Biophysica Acta (BBA)-Bioenergetics, 1504(1):82–106.

Orio, L., Llopis, N., Torres, E., Izco, M., OShea, E., and Colado, M. I. (2010). A study on the mechanisms by which minocycline protects against mdma (ecstasy)-induced neurotoxicity of 5-ht cortical neurons. Neurotoxicity research, 18(2):187–199.

O’Shea, E., Escobedo, I., Orio, L., Sanchez, V., Navarro, M., Green, A. R., and Colado, M. I. (2005). Elevation of ambient room temperature has differential effects on mdma-induced 5-ht and dopamine release in striatum and nucleus accumbens of rats. Neuropsychopharmacology, 30(7):1312.

OConnor, A. D., Padilla-Jones, A., Gerkin, R. D., and Levine, M. (2015). Prevalence of rhabdomyolysis in sympathomimetic toxicity: a comparison of stimulants. Journal of Medical Toxicology, 11(2):195–200.

Palamar, J. J., Grifﬁn-Tomas, M., and Ompad, D. C. (2015). Illicit drug use among rave attendees in a nationally representative sample of us high school seniors. Drug and alcohol dependence, 152:24–31.

Parrott, A. (2004). Is ecstasy mdma? a review of the proportion of ecstasy tablets containing mdma, their dosage levels, and the changing perceptions of purity. Psychopharmacology, 173(3- 4):234–241.

Pedersen, N. and Blessing, W. (2001). Cutaneous vasoconstriction contributes to hyperthermia induced by 3, 4-methylenedioxymethamphetamine (ecstasy) in conscious rabbits. Journal of Neuroscience, 21(21):8648–8654.

Piper, B. J., Henderson, C. S., and Meyer, J. S. (2014). Adolescent mdma exposure diminishes the physiological and neurotoxic consequences of an mdma binge in female rats. Developmental psychobiology, 56(5):924–934. 45 Rajilic-Stojanovi´ c,´ M. and de Vos, W. M. (2014). The ﬁrst 1000 cultured species of the human gastrointestinal microbiota. FEMS microbiology reviews, 38(5):996–1047.

Rawls, S., Tallarida, R., Robinson, W., and Amin, M. (2007). The beta-lactam antibiotic, ceftriaxone, attenuates morphine-evoked hyperthermia in rats. British journal of pharmacology, 151(7):1095–1102.

Resnick, R. and Gray, S. (1961). Distribution of serotonin (5-hydroxytryptamine) in the human gastrointestinal tract. Gastroenterology, 41:119–121.

Ridge, E. A., Pachhain, S., Choudhury, S. R., Bodnar, S. R., Larsen, R. A., Phuntu- mart, V., and Sprague, J. E. (2019). The inﬂuence of the host microbiome on 3, 4- methylenedioxymethamphetamine (mdma)-induced hyperthermia and vice versa. Scientiﬁc reports, 9(1):4313.

Ridlon, J. M., Kang, D.-J., and Hylemon, P. B. (2006). Bile salt biotransformations by human intestinal bacteria. Journal of lipid research, 47(2):241–259.

Ridlon, J. M., Kang, D. J., Hylemon, P. B., and Bajaj, J. S. (2014). Bile acids and the gut microbiome. Current opinion in gastroenterology, 30(3):332.

Riley, C. L., Dao, C., Kenaston, M. A., Muto, L., Kohno, S., Nowinski, S. M., Solmonson, A. D., Pfeiffer, M., Sack, M. N., Lu, Z., et al. (2016). The complementary and divergent roles of uncoupling proteins 1 and 3 in thermoregulation. The Journal of physiology, 594(24):7455– 7464.

Rosenberg, E. and Zilber-Rosenberg, I. (2016). Do microbiotas warm their hosts? Gut microbes, 7(4):283–285.

Rusyniak, D. E. and Sprague, J. E. (2005). Toxin-induced hyperthermic syndromes. Medical Clinics, 89(6):1277–1296. 46 Sayin, S. I., Wahlstrom,¨ A., Felin, J., Jantti,¨ S., Marschall, H.-U., Bamberg, K., Angelin, B., Hyotyl¨ ainen,¨ T., Oresiˇ c,ˇ M., and Backhed,¨ F. (2013). Gut microbiota regulates bile acid metabolism by reducing the levels of tauro-beta-muricholic acid, a naturally occurring fxr antagonist. Cell metabolism, 17(2):225–235.

Screaton, G., Cairns, H., Sarner, M., Singer, M., Thrasher, A., and Cohen, S. (1992). Hyperpyrexia and rhabdomyolysis after mdma (” ecstasy”) abuse. The Lancet, 339(8794):677–678.

Silva Queiroz, M., Shao, Y., and Ismail-Beigi, F. (2004). Effect of thyroid hormone on uncoupling protein-3 mrna expression in rat heart and skeletal muscle. Thyroid, 14(3):177–185.

Sinal, C. J., Tohkin, M., Miyata, M., Ward, J. M., Lambert, G., and Gonzalez, F. J. (2000). Tar- geted disruption of the nuclear receptor fxr/bar impairs bile acid and lipid homeostasis. Cell, 102(6):731–744.

Sprague, J. E., Moze, P., Caden, D., Rusyniak, D. E., Holmes, C., Goldstein, D. S., and Mills, E. M. (2005). Carvedilol reverses hyperthermia and attenuates rhabdomyolysis induced by 3, 4- methylenedioxymethamphetamine (mdma, ecstasy) in an animal model. Critical care medicine, 33(6):1311–1316.

Sprague, J. E., Yang, X., Sommers, J., Gilman, T. L., and Mills, E. M. (2007). Roles of norepinephrine, free fatty acids, thyroid status, and skeletal muscle uncoupling protein 3 expression in sympathomimetic-induced thermogenesis. Journal of Pharmacology and Experimental Ther- apeutics, 320(1):274–280.

Strandwitz, P. (2018). Neurotransmitter modulation by the gut microbiota. Brain research, 1693:128–133.

Thomas, C., Gioiello, A., Noriega, L., Strehle, A., Oury, J., Rizzo, G., Macchiarulo, A., Yamamoto, H., Mataki, C., Pruzanski, M., et al. (2009). Tgr5-mediated bile acid sensing controls glucose homeostasis. Cell metabolism, 10(3):167–177. 47 Tsavkelova, E., Botvinko, I., Kudrin, V., and Oleskin, A. (2000). Detection of neurotransmitter amines in microorganisms with the use of high-performance liquid chromatography. Dok- lady biochemistry: proceedings of the Academy of Sciences of the USSR, Biochemistry section, 372(1-6):115.

Vanhaecke, L., Vercruysse, F., Boon, N., Verstraete, W., Cleenwerck, I., De Wachter, M., De Vos, P., and Van de Wiele, T. (2008). Isolation and characterization of human intestinal bacteria capable of transforming the dietary carcinogen 2-amino-1-methyl-6-phenylimidazo [4, 5-b] pyridine. Appl. Environ. Microbiol., 74(5):1469–1477.

Walter, E. and Carraretto, M. (2015). Drug-induced hyperthermia in critical care. Journal of the intensive care society, 16(4):306–311.

Watanabe, M., Houten, S. M., Mataki, C., Christoffolete, M. A., Kim, B. W., Sato, H., Messaddeq, N., Harney, J. W., Ezaki, O., Kodama, T., et al. (2006). Bile acids induce energy expenditure by promoting intracellular thyroid hormone activation. Nature, 439(7075):484.

Wilson, M. E., Westberry, J. M., and Trout, A. L. (2011). Estrogen receptor-alpha gene expression in the cortex: sex differences during development and in adulthood. Hormones and behavior, 59(3):353–357.

Wyeth, R. P., Mills, E. M., Ullman, A., Kenaston, M. A., Burwell, J., and Sprague, J. E. (2009). The hyperthermia mediated by 3, 4-methylenedioxymethamphetamine (mdma, ecstasy) is sensitive to sex differences. Toxicology and applied pharmacology, 235(1):33–38.

Yano, J. M., Yu, K., Donaldson, G. P., Shastri, G. G., Ann, P., Ma, L., Nagler, C. R., Ismagilov, R. F., Mazmanian, S. K., and Hsiao, E. Y. (2015). Indigenous bacteria from the gut microbiota regulate host serotonin biosynthesis. Cell, 161(2):264–276.

Zaami, S., Giorgetti, R., Pichini, S., Pantano, F., Marinelli, E., and Busardo, F. (2018). Synthetic cathinones related fatalities: an update. Eur Rev Med Pharmacol Sci, 22(1):268–274. 48 Zhang, X., Sukhchuluun, G., Bo, T., Chi, Q., Yang, J., Chen, B., Zhang, L., and Wang, D. (2018). Huddling remodels gut microbiota to reduce energy requirements in a small mammal species during cold exposure. microbiome 6 (1): 103.

Zietak, M., Chabowska-Kita, A., and Kozak, L. P. (2017). Brown fat thermogenesis: Stability of developmental programming and transient effects of temperature and gut microbiota in adults. Biochimie, 134:93–98.

Zona, L. C., Grecco, G. G., and Sprague, J. E. (2016). Cooling down the bath salts: carvedilol attenuation of methylone and mephedrone mediated hyperthermia. Toxicology letters, 263:11– 15.