REPRODUCTIONRESEARCH

Dielectrophoretic behavior of in vitro-derived bovine metaphase II oocytes and zygotes and its relation to in vitro embryonic developmental competence and mRNA expression pattern

Salilew-Wondim Dessie, Franca Rings, Michael Ho¨lker, Markus Gilles, Danyel Jennen, Ernst Tholen, Vitezslav Havlicek1, Urban Besenfelder1, Vladimir L Sukhorukov2, Ulrich Zimmermann2, Joerg M Endter2, Marc-Andre´ Sirard3, Karl Schellander and Dawit Tesfaye Animal Breeding and Husbandry Group, Institute of Animal Science, University of Bonn, Endenicher Allee 15, Bonn, Germany, 1University of Veterinary Medicine, Veterina¨r platz 1, A-1210 Vienna, Austria, 2Biotechnology center, University of Wuerzburg, D-97074, Wuerzburg, Germany and 3De´partment des Science Animales, Centre de Recherche en Biologie de la Reproduction, Universite´ Laval, G1K7p4, Quebec, Canada Correspondence should be addressed to D Tesfaye; Email: [email protected]

Abstract Selecting developmentally competent oocytes and zygotes based on their morphology is more often influenced by personal judgments and lacks universal standards. Therefore, this experiment was conducted to investigate the rate of development and mRNA level of dielectrophoretically separated oocytes and zygotes to validate dielectrophoresis (DEP) as non-invasive option for C K selection of oocytes and zygotes. In the first experiment, metaphase II oocytes with (PB ) and without (PB ) first polar body and zygotes were subjected to DEP at 4 MHz and 450 mm electrode distance and classified into fast, very fast, slow, and very slow depending on the time elapsed to reach one of the electrodes in the electric field. Parthenogenetic activation was employed to monitor the embryonic development of dielectrophoretically classified oocytes. The result revealed that at 6 and 7 days of post- C K activation, the blastocyst rate of very slow dielectrophoretic PB and PB oocytes was significantly (P!0.05) lower than other groups. Similarly, in zygotes, the blastocyst rate at 7 days post-insemination was higher (P!0.05) in the very fast dielectrophoretic categories when compared with the slow and very slow categories. In the second experiment, mRNA level was C analyzed in the very fast and very slow dielectrophoretic PB oocytes and zygotes respectively using the bovine cDNA microarray. The result showed that 36 and 42 transcripts were differentially regulated between the very fast and very slow C dielectrophoretic categories PB oocytes and zygotes respectively. In conclusion, dielectrophoretically separated oocytes and zygotes showed difference in the rate of blastocyst development accompanied by difference in transcriptional abundances. Reproduction (2007) 133 931–946

Introduction with their developmental competence (Blondin & Sirard 1995, Mayes & Sirard 2001). Moreover, the numbers of Oocytes retrieved from cattle ovaries collected from blastomeres, the ratio between inner cell mass and slaughterhouse are used as a source for embryo in vitro trophectoderm cell numbers, metabolic rates, and production (IVP). However, these oocytes are extremely cryotolerance (Mayes 2002) have been used as heterogeneous in developmental competence and indicators of developmental competence of oocytes. ultimately reduce the efficiency of embryo transfer, Furthermore, selection of oocytes relative to the nuclear transfer, and the blastocyst yield. reproductive status of the animal also increases the With advancement of IVP, different methods have in vitro development rates (Chohan & Hunter 2003). been employed to select oocytes that yield the highest Similar to the oocytes, morphological criteria, namely percentages of blastocysts after fertilization or partheno- the position of second polar body, the pronuclear genetic activation. The majorities of these methods morphology, and the nuclear morphology have been emphasize on categorization of the cumulus–oocyte employed to correlate with the developmental capacity complex into different morphological groups to correlate of zygotes. For instance, development of good-quality

q 2007 Society for Reproduction and Fertility DOI: 10.1530/REP-06-0277 ISSN 1470–1626 (paper) 1741–7899 (online) Online version via www.reproduction-online.org Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 932 S-W Dessie and others human embryos can be obtained from zygotes with behavior of MII oocytes and zygotes in relation to the centralized and juxtaposed pronuclear zygotes mRNA expression to generate candidate genes related to (Gianaroli et al. 2003). the developmental competence. Although morphological evaluation of oocytes or zygotes is easier to accomplish the routine IVP, selection of competent zygotes based on the morphological Materials and Methods parameters, namely polar body enlargement, pronuclear and nuclear morphology (Tesarik & Greco 1999, Experiment 1: dielectrophoretic behavior of oocytes Gianaroli et al. 2003) requires careful handling and and zygotes observation under the microscope until both pronuclei Oocyte collection and in vitro maturation and polar body are inspected. Moreover, zygotes with invisible pronuclear (Tesarik & Greco 1999)are Bovine ovaries were obtained from a nearby slaughter- excluded from evaluation. Furthermore, morpho- house and transported to the laboratory within 2–4 h in a logically best looking oocytes do not necessarily have thermos flask containing a 0.9% saline solution supple- the highest developmental competence (Blondin & mented with streptocombin. The cumulus–oocyte Sirard 1995) and those oocytes with better cumulus complexes (COCs) were aspirated from follicles of expansions during maturation may not necessarily show 2–6 mm in diameter using a sterilized 5 ml syringe the highest blastocyst rate. In addition, morphological fixed to 18 gauge needle. The COCs were washed thrice criteria are more often influenced by personal judgments with modified parker medium supplemented with 15% and they lack universal standards. Therefore, investi- estrus cow serum (OCS), 0.5 mM L-glutamine, 0.2 mM m gating other non-invasive techniques is required to pyruvate, 50 mg/ml gentamicin sulfate, and 10 l/ml predict and select competent oocytes and zygotes to follicle-stimulating hormone (Folltropin, Vetrepharm, increase the efficiency of IVP. Canada, Belleville, Canada). A group of 40–50 COCs m Dielectrophoresis (DEP), the motion of neutral were then cultured in 400 l maturation medium particles due to the application of an external non- covered with mineral oil (Sigma) in four-well dish uniform electric field, has been a useful non-invasive (Nunc, Roskilde, Denmark). Maturation was performed 8 technique for the extensive manipulation of living cells for 24 h at 39 C in a humidified atmosphere of 5% CO2. and DNA (Kadaksham et al. 2004). This method does not At the end of maturation, the cumulus cells were m require knowledge of cell surface antigens or the use of removed by vortexing the COCs in 200 l Dulbecco’s antibodies, or other reporter molecules to label PBS (Sigma) supplemented with 2 mg bovine hyalur- bioparticles (Burt et al. 1996). onidase enzyme/ml and washed thrice with TCM air Living cells can be electrically polarized depending (TCM 199 contains L-glutamine and 25 mM HEPES on their composition, morphology, and phenotype and (Sigma)) supplemented with 22 mg/ml pyruvate, frequency of the applied electrical field (Huang et al. 350 mg/ml NaHCO3, 50 mg/ml gentamicin, and 0.1% BSA (Sigma). The oocytes were then classified into two 1996). Therefore, different cell types in different C K physiological states can possess distinctly different groups based on the presence (PB ) or absence (PB )of the first polar body for further classification according to dielectric properties that can be utilized for separation their dielectrophoretic behavior. (Gascoyne et al. 1992, Wang et al. 1993). DEP has been employed for the separation of dead and live bacteria (Lapizco-Encinas et al. 2004), gram-positive and gram- Dielectrophoretic classification of oocytes and zygotes negative bacteria (Markx et al. 1994), differential Am/phase Lock Generator Model 7056 (Geoda¨tisches analysis of human leukocytes (Yan g et al. 2000), Institute Bonn) was used for DEP. The generator was manipulation and characterization of red blood cells connected to the voltmeter and the dielectrophoretic (Minerick et al. 2003), separation of viable and non- chamber through coaxial cable 7056. The dielectro- viable cells (Huang et al. 1992), and controlling sperm phoretic chamber (Kru¨ss, Hamburg, Germany) consists trajectories to characterize sperm motility and of base plate with electric connection points, an morphology before intracytoplasmic injection (Fuhr interchangeable microscope slide, two collapsible et al. 1998). However, the application of DEP in holders with two electrodes, and adjusting screw for screening of developmentally competent oocytes and electrodes distance. The two holders were fixed to the zygotes has not been documented. Hence, this experi- base plate by laminated springs. The electrodes are ment was conducted to 1) evaluate the dielectrophoretic platinum–iridium wire with a diameter of 200 mmand behavior of oocytes and zygotes, 2) investigate the the two electrodes are rod-shaped and parallel to each relationship between the dielectrophoretic mobility of other. The distance between the electrodes was adjusted metaphase II (MII) oocytes and zygotes and their using adjusting screw and for this experiment, it was developmental competence, 3) evaluate the size of the adjusted to 450 mm. blastocyst derived from dielectrophoretically separated Prior to DEP, the oocytes and the zygotes were washed zygotes, and 4) investigate the dielectrophoretic thrice in 400 ml of 0.3 M sorbitol solution (osmolarity of

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access Dielectrophoretic separation of oocytes/embryos 933

300 mOsm and conductivity of 80 ms/cm and pH 7.0) to with TCM air and were parthenogenetically activated avoid any incidence of electric shock in the chamber due with 400 mlof5mM ionomycine and 400 mlof2mM to contamination of maturation or culture medium. 6-dimethylaminopurine. After the end of activation, Afterwards, 400 ml of 0.3 M sorbitol solution (osmolarity parthenogenetic-activating agents were removed by of 300 mOsm and conductivity of 80 ms/cm and pH 7.0) washing the oocytes thrice using Charles Rosenkrans 1 were decanted onto the microscope slide to submerge (CR1) medium. Following this, the oocytes were cultured the electrodes. Each of the oocytes or zygotes was then in CR1 medium supplemented with 10% OCS, 20 ml/ml placed on the microscope slide midway between the two Eagle’s basal medium (BME), and 10 ml/ml minimum electrodes. The center precision was determined by essential medium (MEM). The culture condition was scratching the interchangeable microscope slide at the maintained at 39 8C in an incubator with a humidified center, which is the midway between the two electrodes. atmosphere of 5% CO2. Therefore, every time, the oocytes or the zygotes were placed at the scratched position (center) so as to keep the IVP and dielectrophoretic categories of zygotes precision. One oocyte or zygote was treated at a time. A 14 peak-to-peak volt and 4 MHz frequency electric In vitro fertilization was performed as described in field was applied. This combination of voltage and Tesfaye et al. (2004). Briefly, a group of 50 matured electric field frequency was selected based on the oocytes were transferred into a four-well dish containing preliminary experimental results. Moreover, the 400 ml fertilization medium. Frozen–thawed spermato- repeatability of movement of bovine oocytes after zoa were swim-up and added to the fertilization medium ! 6 repeated exposure in the dielectrophoretic chamber at a final concentration of 1 10 spermatozoa/ml. was tested in the preliminary experiment. Accordingly, Oocytes were co-incubated with spermatozoa for 20 h measurement of the dielectrophoretic behavior of a in a humidified atmosphere of 5% CO2 at 39 8C. single oocyte up to ten times exposure in the electric Afterwards, the cumulus cells were removed by field showed a (meanGS.E.M.) 5.0G0.3 s for very fast vortexing for 90 s in CR1 culture medium. Cumulus- oocyte, 13.7G0.4 s for fast oocyte, 23.5G0.5 s for slow- free zygotes were washed twice in CR1 culture medium moving oocytes, and 38.5G0.3 s for very slow oocytes and transferred into 400 ml TCM air covered with mineral group. The low standard error mean has revealed the oil. Following this, the zygotes were washed thrice with repeatability of measurements of a single oocyte in all the dielectrophoretic emersion medium and subjected to the four dielectrophoretic categories. Therefore, in this the dielectrophoretic procedure and classified according study, the time elapsed by each of the oocytes or zygotes to their speed of movement into four groups (Table 1). to reach one of the electrodes was recorded by one-time Each dielectrophoretically grouped zygote was incu- exposure in the electric field and one oocyte or zygote bated in CR1 culture medium supplemented with 10% was treated at a time. Oocytes and zygotes were then OCS, 20 ml/ml BME, and 10 ml/ml MEM at 39 8Cina classified into four different dielectrophoretic groups humidified atmosphere of 5% CO2 to monitor the according to their speed in the electric field (Table 1). embryonic development. C K The time point to classify PB ,PB , and zygotes into different dielectrophoretic groups for monitoring the Data collection embryonic development was based on the preliminary The dielectric behavior of oocytes and zygotes was experimental results (data not shown). evaluated by recording the time spent by oocytes and zygotes to reach the electrodes from the centre. The Parthenogenetic activation of oocytes and in vitro culture cleavage rate at 3 days of post-parthenogenetic activation Due to low fertilization efficiency of denuded oocytes, (dpa) and the blastocyst rates at 6, 7, 8, and 9 at dpa were parthenogenetic activation was used to assess the recorded. Similarly, for each dielectrophoretic groups of developmental competence of dielectrophoretically zygotes, the cleavage rate (at 2-day post-insemination classified oocytes. For this, the dielectrophoretic (dpi)), the morula rate (at 5 dpi), and the blastocyst rates (at C K categories of PB and PB (very fast, fast, slow, and 6, 7, 8, and 9 dpi) were recorded. The diameters of very slow) and the control oocytes were washed thrice oocytes, zygotes, and blastocysts derived from zygotes

Table 1 Dielectrophoretic categories of oocytes and zygotes depending on the time elapsed to reach one of the electrodes in the electric field.

Dielectrophoretic categories

Developmental stages Very fast (s) Fast (s) Slow (s) Very slow (s) Control C PB oocytes 1–9 10–15 16–28 O29 – K PB oocytes 1–8 9–15 16–19 O20 – Zygotes 1–6 7–15 16–20 O21 –

Control, oocytes and zygotes which were not exposed to dielectrophoresis; s, seconds. www.reproduction-online.org Reproduction (2007) 133 931–946

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 934 S-W Dessie and others were measured using image tool Version 3.0 (University were added to the 10 ml double-strand cDNA and of Texas Health Science, San Antonio, TX, USA). incubated at 42 8C for 3.5 h. After the end of incubation, 1 ml DNase was added and incubated further at 37 8C for 30 min. The amplified RNA (aRNA) was purified using Experiment 2: transcriptional profiling of dielectro- RNeasy mini kit (Qiagen) according to manufacturer’s phoretically separated oocytes and zygotes instruction. In this experiment, the transcriptional abundance of the very fast and very slow dielectrophoretic categories of Aminoallyl labeling and dye coupling C PB oocytes and zygotes was analyzed using the bovine The amplified RNA (aRNA) samples of oocytes or cDNA microarray. zygotes representing very fast and very slow dielec- RNA isolation and cDNA synthesis trophoretic groups were first labeled with aminoallyl dUTP (AA-dUTP) using CyScribe post-labeling kit mRNA was isolated from each three biological pools of (Amersham Biosciences). Briefly, 1.5 ml anchored 20–30 very fast and very slow dielectrophoretic oligo (dT) primer, 1.5 ml random primer, and RNase- categories of oocytes and zygotes using Dynabead free water were added to 2 mg mRNA template to Oligo (dT)25 (Dynal Biotech, Oslo, Norway) following make a 10 ml reaction volume. This reaction was manufacturer’s recommendation. Briefly, each pool of incubated at 70 8C for 5 min and at 25 8C for 10 min oocytes or zygotes was lysated with 50 ml binding buffer consecutively. Following this, 10 ml mix containing (20 mM Tris–HCl (pH 7.5), 1 M LiCl, 2 mM EDTA (pH 4 mlof5! CyScript buffer, 2 ml of 0.1 M DTT, 1.5 ml 8.0)) at 70 8C for 5 min in a water bath. The cell lysate oligonucleotide mix, 1.5 AA-dUTP, and 1 ml CyScript was incubated with 20 ml Dynabead Oligo (dT)25 reverse transcriptase were added to the 10 ml reaction suspension at room temperature for 30 min. The bead volume and incubated at 42 8C for 90 min. At the end hybridized with mRNA was washed thrice with washing of this reaction, 2 ml of 2.5 M NaOH were added and buffer (10 mM Tris–HCl with pH 7.5, 0.15 mM LiCl, incubated at 37 8C for 15 min to hydrolyze the mRNA 1 mM EDTA with pH 8.0) and mRNA was eluted with template and then 10 ml of 2 M HEPES-free acid were 11 ml RNase-free water. added. Purification of aminoallyl-labeled cDNA was First-strand cDNA was synthesized in a 20 mlreaction performed using the CyScribe GFX purification kit volume. For this, 11 ml mRNA were incubated with 1 ml (Amersham Biosciences). Cy3 and Cy5 dye coupling oligo (dT)21 primer, TCT AGT CGA CGG CCA GTG AAT and purification of the aminoallyl dUTP-labeled very TGTAATACG ACT CAC TATAGG GCG (T)21, for 3 min at fast and very slow dielectrophoretic groups of zygotes ! 70 8C towhich 8 mlRTmix(4mlof5 first-strand synthesis or oocytes were performed using CyScribe post- buffer (50 mM Tris–HCl (pH 8.3), 75 mM KCl, and 3 mM labeling kit and CyScribe GFX purification kit MgCl2), 2 ml of 0.1 mM dithiothreitol (DTT), 1 ml of 0.3 M (Amersham Biosciences) respectively. Three biological dNTP,0.1 ml of 10 U RNase inhibitor (Promega), and 0.5 ml replicates were used for each experiment during of 200 U superscriptase II (Invitrogen)) was added. This hybridization. The dye effect during hybridization reaction was incubated at 42 8C for 90 min followed by was controlled by performing dye swap. The cDNA reaction termination at 70 8C for 15 min. concentration, Cy3, and Cy5 dye incorporation were measured at 260, 550, and 650 nm wavelength Double-strand cDNA synthesis and in vitro transcription respectively using Ultraspec 2100 pro-u.v./visible Double-strand cDNA was synthesized using degener- spectrophotometer (Amersham Biosciences). ated oligonucleotide primer (DOP)-PCR master kit (Roche Diagnostics GmbH). For this, 2 ml DOP, 2 ml Target clones ! T7 oligo (dT)23 primer, 40 ml2 DOP-PCR master mix, The ready-made bovine cDNA array (BlueChip, Depart- and 16 ml RNase-free water were added to 20 ml ment of Animal Science, Laval University, Quebec, single-strand cDNA. The mix was then incubated at Canada; Sirard et al. 2005) was used in this study. This 95 8C for 5 min, 94 8C for 1 min, and 30 8C for 2 min. chip consisting of more than 2000 clones (4928 spots) After the end of annealing time, the temperature was was separated into two subarrays. In addition to the jumped to 72 8C within 3 min and continued for 15 target clones, each subarray of the BlueChip consists of cycles at 94 8C for 1 min, 62 8C for 1 min, and 72 8C for nine clones to be used as a negative control, namely vide 2 min. The reaction was terminated after final extension (32 spots), alien1 (8 spots), alien2 (8 spots), GFP (8 spots), at 72 8C for 7 min and subjected to phenol–chloroform GFP1 (4 spots), GFP1/2 (4 spots), GFP1/4 (4 spots), GFP1/ purification. 8 (4 spots), GFP1/16 (4 spots) H2O/DMSO (50 spots), In vitro transcription was performed using Ampli- and plant (8 spots). The housekeeping genes, namely Scribe T7 transcription kit (Epicentre technologies, tubulin (eight spots), ubiquitin (eight spots), and actin Oldendorf, Germany). Briefly, 2 mlof10! reaction (eight spots) were included in each array to be used as buffer, 4 ml dNTP, 2 ml DTT, and 2 ml T7 RNA polymerase positive controls.

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access Dielectrophoretic separation of oocytes/embryos 935

Probe preparation and hybridization groups of oocytes or zygotes. The real-time PCR was performed in 20 ml reaction volume containing 9 mlof Before hybridizing the samples, the arrayed slides were 2.5! RealM asterMix/20! SYBR (Eppendorf, Hamburg, placed in a corning GAPS II slide container containing Germany), the specific forward and reverse primers, 50 ml pre-hybridization buffer (0.5 g BSA (Roche) distilled water, and the serial dilution in ABI PRISM 7000 C0.5 ml of 10% SDSC7.5 ml of 20% SSCC42 ml sterile sequence detection system (Applied Biosystems). The water) and incubated for 20 min at 55 8C. After the end of thermal cycling parameter was 2 min at 50 8C, 10 min at incubation, the slides were sequentially washed with 95 8C, 45 cycles of 15 s at 95 8C and 60 s at 60 8C. The boiled water, cold water, and isopropanol followed by transcriptional abundance of the samples was calculated the centrifugation at 2000 g for 2 min. Immediately by the relative standard curve method using histone before hybridization, dye-labeled probes were dissolved (H2A) as endogenous control. in 55 ml formamide-based buffer (15 ml hybridization bufferC30 ml of 100% formamideC10 ml distilled water) to which 2.5 ml yeast tRNA and 2.5 ml human cot-DNA Statistical analysis (Invitrogen) were added to avoid non-specific hybrid- The general linear model procedure of SPSS version 12.0 ization. After denaturing at 95 8C for 5 min, the mix was (SPSS Inc., Chicago, IL, USA) was used to test the hybridized to the array and covered with cover slips (Roth, significant variation in the cleavage and blastocyst rates Karlsruhe, Germany). The hybridized array slide was then by considering dielectrophoretic categories as a fixed placed in the hybridization chamber (GFL, Du¨lmen, effect and the list significant difference t-test was Germany) and incubated at 42 8C for 20 h in darkness. employed to separate means between the dielectro- At the end of incubation, the slides were sequentially phoretic categories of oocytes or zygotes. washed for 10 min with 2! SSCC0.1% SDS, 5 min each with 0.2! SSC and 0.1% SSC buffers, 1 min each with water and isopropanol and centrifuged at 2000 g for 2 min. Results Experiment 1: the dielectrophoretic behavior of oocytes Image capture and array data analysis and zygotes Array scanning and image analysis were performed using Uniform time point was selected for comparing the C K Axon GenePix 4000B scanner and GenePix Pro-analysis dielectrophoretic behavior between PB ,PB,and software (version 4.0; Axon Instruments, Foster City, CA, zygotes. For this, the dielectrophoretic behavior data C K USA) respectively. Locally weighted scatter plot smooth- from 948 PB , 468 PB , and 1006 zygotes were C ing (LOWESS) fit normalization method was applied to considered. The result indicates that 15.7% of PB K normalize the channel intensity using GPROCESSOR oocytes, 13.2% of PB oocytes, and 15.8% of zygotes 2.0, a free software developed at Yale University (New reached the electrode within 1–5 s. Furthermore, 30% of C K Haven, CT, USA). From the merged data, a mean log2- PB oocytes, 24% of PB oocytes, and 23% of zygotes transformed value of (Cy5/Cy3) was calculated for the spent more than 20 s to reach the electrode indicating C replicates to obtain one value per clone. This result was that PB oocytes have relatively higher proportion of K submitted to statistical analysis for microarray (SAM), slow-moving population than the PB oocytes and free software developed at Stanford University (Stanford, zygotes (Fig. 1). CA, USA), to obtain the list of differential expressed genes. Heat map and average linkage hierarchical Dielectrophoretic behavior in relation to the size of clustering were performed using the PermutMatrix oocytes and zygotes software (Caraux & Pinloche 2004). A correlation analysis was performed between the Quantitative real-time PCR diameter of the cell and the speed of dielectrophoretic movement in order tovalidate whether the size of the cell is A total of seven and nine differentially regulated genes influencing the dielectrophoretic behavior of oocytes and in the very fast and very slow dielectrophoretic zygotes. The result showed that the dielectrophoretic C categories of PB oocytes and zygotes were selected speed has no significant correlation to the diameter of C K respectively to validate the result of microarray data. both the PB (nZ49, PZ0.118, rZ0.23) and PB (nZ63, Sequence-specific primers (Table 2) were designed using PZ0.75, rZ0.63) oocytes, indicating that the movement Primer Express v. 2.0 (Applied Biosystems, Foster City, of the oocytes in the electric field was not related to the size CA, USA). For each primer, a serial dilution of 101–109 of the cell itself. On the other hand, the speed of zygotes copy number or molecules was prepared from the in the electric field tends to show a negative correlation plasmid DNA. Quantification reaction was carried out (nZ37, PZ0.06, rZK0.31) to the size of the cell. using independent cDNA samples from three biological Nevertheless, the correlation was not statistically pools of 30–40 very fast and very slow dielectrophoretic significant (PO0.05). www.reproduction-online.org Reproduction (2007) 133 931–946

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 936 S-W Dessie and others

Table 2 Sequence of primers used for quantification of differentially expressed genes.

Gene name Accession no. Primer sequence (50–30) Product length Development stages RPLP0 AB098748 For: GAATCCCATATCCTCGTCCGA 162 Oocytes Rev: TTGCTGAAAAGGTCAAGGCCT MGC128854 BC103473 For: GGGAGGGCTCAACTTCAACAC 182 Oocytes Rev: CATGGCTCTCATGGCATTTG GCNT3 AY283766 For: AGCGGTTGCCTTTCACTGAC 183 Oocytes Rev: CATACACAGCTCGCAGCAGC PGHS-2 AF031698 For: GGAAATCCTCAGCTCAAAAC 221 Oocytes Rev: GTCTCCCTGGGAACTATTC DNMT1a NM_182651 For: TCGGGAAGCGAATGGATGT 223 Oocytes and zygotes Rev: TGATGGTGGTCTGCCTGGT KRT8a X12877 For: CACCAGTTCCAAGCCTGTGG 176 Oocytes and zygotes Rev: TCAGGTCTCCTGTGCAGATGC ANXA2 NM_174716 For: CGTGCTCCAGCTAACAGTTCT 139 Oocyte Rev: GGAAAGCCAGGTAATGCGTA DDX10 NM_004398 For: TCGGCTTCTTCAACACATGG 198 Zygotes Rev: CAAACTCAAGCGTGCAAGGTC NASP BT006757 For: CCTAGAGCTTGCCTGGGATATG 198 Zygotes Rev: TCGTGGGCTTCCAGGTACTG ARL6IP BC010281 For: AGGCGCTAGAATGGGAACAAG 232 Zygotes Rev: GGCTGCAGAGACTGCAAGTCT SMARCA5 NM_003601 For: AGTGAACTTTCGCCCATCTTG 194 Zygotes Rev: AGGCTTGTGGATCAGAATCTG RGS2 NM_002923 For: GCAGTTGTAAAGCAGCCACTTG 193 Zygotes Rev: ATATTGAATTCTGGCTGGCCTG RPS18 AB098899 For: TTCTTGGACACACCCACAGTG 189 Zygotes Rev: GGACGTGAAGGACGGGAAATA ZP3 NM_173974 For: CCACCTGTTGGAGGACTTGC 161 Zygotes Rev: TCTCACCGATGCCTCCTCTG H2a NM_178409 For: CTCGTCACTTGCAACTTGCTATTC 148 Rev: CCAGGCATCCTTTAGACAGTCTTC aGenes differentially regulated in oocyte and zygote categories.

Dielectrophoretic behavior and developmental 100, 50, and 16 were found to be very fast, fast, very K competence of oocytes slow and slow groups respectively. Moreover, 95 PB C For investigating the dielectrophoretic behavior of PB oocytes were used as control. The in vitro embryonic oocytes in relation to developmental competence, a total development of these dielectrophoretic groups indicates that the cleavage rate (meanGS.E.M.) was 72.3G1.9 in of 457 oocytes derived from four biological replicates G G G were subjected to DEP, in which 152, 121, 90, and 94 very fast, 77.1 4.3 in fast, 93.3 6.7 in slow, 76.4 1.6 were classified as very fast, fast, slow, and very slow C categories respectively. Moreover, 152 PB oocytes were used as control (not exposed to the electric field). The embryonic developmental competence of these dielectrophoretically classified oocytes and the control group was monitored after parthenogenetic activation. Results have shown that the cleavage rate (meanGS.E.M.) was 89.9G0.3 in very fast, 91.3G1.3 in fast, 88.5G2.7 in slow, 91.7G6.2 in very slow, and 91.5G0.8 in control C groups of PB oocytes. These differences were not significant (PO0.05). On the other hand, the very slow moving group had significantly (P!0.05) lower blas- tocyst rate when compared with the very fast, fast and slow, and the control groups at 6 and 7 dpa (Fig. 2). However, at 8 and 9 dpa, the blastocyst rate was not statistically different (PO0.05) but tended to be higher in the very fast dielectrophoretic categories. K Similarly, 210 PB oocytes obtained from a total of four biological replicates were subjected to the DEP procedure to study their dielectrophoretic behavior in Figure 1 Proportion of oocytes and zygotes in relation to the time spent relation to developmental competence, in which 54, to reach one of the electrodes in the electric field.

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access Dielectrophoretic separation of oocytes/embryos 937

the zygotes according to their dielectric properties has no significant effect on cleavage rates. The blastocyst rate at 7 dpi was significantly (P!0.05) higher in the very fast (16.1G2.2) than in the slow (9.1G2.5) and very slow (10.6G1.9) groups. However, it was not significantly (PO0.05) higher than the fast (12.2G4.1) and control (12.3G2.7; Fig. 4) groups. The total blastocyst rate at 9 dpi was not significantly (PO0.05) different between the dielectrophoretic categories of zygotes (Fig. 4).

The dielectrophoretic behavior of zygotes in relation to C Figure 2 Blastocyst rate of dielectrophoretic categories of PB oocytes. blastocyst size Bars with different letters on the same stage differ from each other statistically (P!0.05). The very fast dielectrophoretic categories of zygotes yield significantly (P!0.05) larger sized blastocysts (179.8G1.9 mm, nZ74) at 7 dpi compared with fast in very slow, and 95.5G2.8 in control groups showing (168.5G1.8 mm, nZ68), slow (168.9G1.7 mm, nZ12), significantly (P!0.05) higher cleavage rate in the slow- G m Z moving category and the control groups. The blastocyst very slow (168.8 1.7 m, n 52), and control G m Z rate at 6, 7, 8, and 9 dpa was significantly higher in the (173.7 1.5 m, n 55) groups. Moreover, the diam- very fast and fast categories compared with the slow and eter of blastocyst that appears at 8 dpi tends to be very slow groups (Fig. 3). bigger in the blastocysts derived from the very fast (173.5G1.9 mm, nZ40) group when compared with the fast (170.1G3.7 mm, nZ26), slow (172.4G3.9 mm, Dielectrophoretic behavior and developmental Z G Z competence of zygotes n 12), and very slow (169.4 2.3 mm, n 47) groups but tends to be lower than the control (179.3G4.0 mm, A total of 940 zygotes from seven biological replica- nZ30) group. tions were subjected to dielectrophoretic procedure to study the dielectrophoretic behavior in relation to developmental competence and classified into very Experiment 2: transcriptional profiling of fast (nZ329), fast (nZ329), slow (nZ97), and very slow dielectrophoretically separated oocytes Z (n 245) groups. Moreover, 323 zygotes were used as The microarray analysis between the very fast and the control group. After culturing these dielectrophoretic very slow oocytes revealed that out of 2000 transcripts, groups, the cleavage rate of zygotes was monitored at 2 713 were detected in both groups. The expression dpi. The result showed that the cleavage rate was G G G intensities (heat map) of these transcripts are shown in 74.3 3.1 in very fast, 75.5 7.1 in fast, 71.4 6.7 Fig. 5A. Scatter plot diagram was plotted for the log slow, 72.2G7.6 in very slow dielectrophoretic groups, 2 G value of Cy5 (very fast oocytes) total intensity against the and 77.0 3.6 in control groups and differences were log value of Cy3 (very slow oocytes). Similar scatter plot not significant (PO0.05), indicating that although 2 was generated for the dye swap by plotting the log value zygotes have different dielectric properties, separating 2 of Cy5 (very slow oocyte) total intensity against the log value of Cy3 (very fast oocytes). The coefficient of determination (R2) for the target and dye reversal

K Figure 3 Blastocyst rate of dielectrophoretic categories of PB oocytes. Figure 4 Blastocyst rate of dielectrophoretic categories of zygotes. Bars Bars with different letters on the same stage differ from each other with different letters on the same stage differ from each other statistically (P!0.05). statistically (P!0.05). www.reproduction-online.org Reproduction (2007) 133 931–946

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 938 S-W Dessie and others

Figure 5 Detected and deferentially expressed transcripts in the very fast and very slow C dielectrophoretic categories of PB oocytes. (A) Heat map of 713 normalized transcripts. D, E, and F describe the dye swap of A, B, and C. The 635/532 log2 ratio was calculated to determine the color intensity of the heat map and the hierarchical clustering. Upregulated transcripts (higher O 635/532 log2 ratio 0.5), non-differentially regulated transcripts (log ratioZK0.5!x!0.5), and downregulated transcripts (log ratio %K0.5) correspond to red, dark, and green colors respectively. (B) Hierarchical clustering of differ- entially expressed transcripts. A, B, and C on the top of the dendrogram refer the biological replications during hybridization. NNCBISY, no NCBI gene symbol. hybridization was 0.941 and 0.933 respectively. Similar 11 genes was 2.0–2.8 and 12 genes was 1.5–1.9 times value of R2 reveals the absence of the dye effect during higher in the very fast compared with the very slow the analysis. dielectrophoretic categories of oocytes. Moreover, the The data analysis performed by SAM revealed that out expression level of five genes was from 1.7 to 2 times of 713 commonly detected transcripts, 36 genes includ- lower in the very fast compared with the very slow ing the novel transcripts were found to be significantly dielectrophoretic categories (Fig. 5B). The functions of differentially expressed in the very fast and very slow differentially expressed transcripts were determined using oocytes. Of these, 31 and 5 were up- and down-regulated gene ontology (http://www.geneontology.org/), NCBI respectively in the very fast group when compared with (http://www.ncbi.nlm.nih.gov), and gene cards (http:// the very slow dielectrophoretic categories of oocytes. The www.genecards.org/index.shtml). Accordingly, 63.9% of average linkage clustering analysis (Fig. 5B) reveals that the differentially regulated genes have known function there were many subgroups within the up- or down- involving in rRNA binding and structural constituent of regulated genes (or clusters) sharing similar expression ribosome, cell cycle regulation, protein and ion binding, patterns. Such co-expressed genes may possibly be metabolic regulation, including amino acid metabolism sharing common biological function. The magnitude of and other different functions (Fig. 6). The lists and differentially regulated genes revealed by SAM showed functions of all differentially regulated genes are that the expression level of eight genes was 3.2–5.0 times, indicated in Tables 3 and 4.

Figure 6 Ontological classification of differen- tially regulated transcripts in the very fast and C very slow PB oocytes.

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access Dielectrophoretic separation of oocytes/embryos 939

C Table 3 List of upregulated genes in the very fast dielectrophoretic categories of PB oocytes and their function.

Accession no. Gene bank name Function BC000047 Homo sapiens ribosomal protein L8, mRNA (cDNA clone MAGE:3504599) rRNA binding, structural constituents of ribosome (RPL8) XM_372375 Predicted: Homo sapiens similar to 1-aminocyclopropane-1-carboxylate Amino acid metabolism, biosynthesis synthase (LOC390110) BC062798 Homo sapiens chromosome 6 open reading frame 173 (C6orf173) Unknown XM_230305 Rattus norvegicus similar to 2610203E10Rik protein (LOC311218) Unknown XM_601090 Predicted: Bos taurus similar to 1-aminocyclopropane-1-carboxylate Amino acid metabolism, biosynthesis synthase (LOC522802) BC103473 Bos taurus similar to RNA-binding motif protein 3 (MGC128854) RNA binding BC004170 Homo sapiens polymerase (DNA directed), epsilon 3 p17 subunit (POLE) Protein binding, epsilon DNA polymerase activity NM_174716 Bos taurus annexin A2, mRNA (ANXA2) Calcium- and phospholipid binding BC032121 Homo sapiens family with sequence similarity 58 member A (FAM58A) Regulation of cell cycle BC011008 Homo sapiens nucleolar and spindle-associated protein 1 (NUSAP1) Cytokinesis, microtubule binding X12877 Bovine mRNA fragment for cytokeratin A8 (KRT8) Protein binding U38619 Sus scrofa small intestine diadenosine tetraphosphatase (NUDT2) Tetraphosphatase activity BC007751 Homo sapiens CDC28 protein kinase regulatory subunit 1B (CKS1B) Cell division, protein kinase activity NM_174788 Bos taurus ribosomal protein, large (RPLP2) rRNA binding, structural constituents of ribosome BC003185 Homo sapiens coenzyme Q7 homolog, ubiquinone (yeast) (COQ7) Metabolic regulator AY550044 Sus scrofa 60S ribosomal protein L35(RPL35) rRNA binding, structural constituents of ribosome AY283766 Bos taurus type 4 mucus-type core 2 b-1,6-N-acetylglucosaminyltransferase Acetylglucosaminyltransferase activity (GCNT3) AB098748 Bos taurus mRNA similar to acidic ribosomal phosphoprotein PO (RPLP0) rRNA binding and structural constituents of ribosome BC030512 Homo sapiens CDC91 cell division cycle 91-like 1 (S. cerevisiae) (CDC91L1) Cell division control, GPI anchor binding XM_230305 Rattus norvegicus similar to 2610203E10Rik protein (RGD 309314_pre- Unknown dicted) AF031698 Bos taurus prostaglandin G/H synthase-2 (PGHS-2) or (PTGS2) Ion binding, cell motility, and peroxidase activity AB099147 Bos taurus mRNA similar to 16S RNA clone Unknown AF091090 Homo sapiens clone 669 unknown mRNA, complete sequence (RP11- Carboxylate synthase activity 82K18.3) NM_182651 Bos taurus DNA (cytosine 5) methyltransferase 1 (DNMT1) Zinc ion binding, DNA methylation X54703 Bovine mRNA for pancreatic anionic trypsinogen Unknown BC062798 Homo sapiens cDNA clone IMAGE: 6495746 Unknown NM_031706 Rattus norvegicus ribosomal protein S8 (Rps8) Structural constituents of ribosome

Transcriptional profiling of dielectrophoretically analysis confirmed a total of 42 differentially expressed separated zygotes transcripts among all the detected transcripts. Of these, Similar to the oocytes, six hybridizations (three biological 25 and 17 genes were up- and down-regulated and three technical replicates as dye swap) were carried respectively in the very fast zygotes. The average linkage out between the very fast and the very slow dielectro- hierarchical clustering, relative fold change difference, phoretic categories of zygotes. After performing LOWESS and the q (%) value of differentially regulated genes are normalization, the scatter plot diagram was plotted for the shown in Fig. 7B. The function of differentially expressed genes was log2 value of Cy5 total intensity against the log2 value of Cy3 as described previously for the oocytes. The coefficient described using the same source described for oocytes. of determination (R2) for the target and dye reversal Accordingly, some transcripts are involved in ion binding hybridization was 0.9137 and 0.9274 respectively, (ZNF85, ZNF519, and NANOS1), regulation of cell cycle showing the absence of the dye effect during the analysis. (NASP, DDX10, SMARCA5, and AURKA), and signal A total of 793 transcripts were commonly detected in transduction (RALA). The lists and functions of all both zygote groups. The expression intensities (heat differentially expressed genes are presented in Tables 5 map) of these transcripts are shown in Fig. 7A. The SAM and 6 and their ontological classification is shown in Fig. 8.

C Table 4 List of downregulated genes in the very fast dielectrophoretic categories of PB oocytes and their function.

Accession no. Gene bank name Function AC083812 Homo sapiens 12 BAC RP11-288D9 Amino acid dephosphorylation BC039831 Homo sapiens intraflagellar transport 52 homolog (Chlamydomonas), Unknown mRNA (cDNA clone MGC:48784 IMAGE:6095634) (IFT52) BC000852 Homo sapiens RAN, member RAS oncogene family (RAN) Protein binding, transcription coactivator activity XM_595660 Predicted: Bos taurus similar to PHD finger protein 22 (LOC517489) Unknown NM_130809 Homo sapiens hypothetical protein MGC12103 (LOC133619) Unknown www.reproduction-online.org Reproduction (2007) 133 931–946

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 940 S-W Dessie and others

Figure 7 Detected and deferentially expressed transcripts in the very fast and very slow dielectrophoretic categories of zygotes. (A) Heat map of 793 normalized transcripts. D, E, and F describe the dye swap of A, B, and C. The 635/532 log2 ratio was calculated to determine the color intensity of the heat map and the hierarchical clustering. Upregulated transcripts (higher O 635/532 log2 ratio 0.5), non-differentially regulated transcripts (log ratioZK0.5!x!0.5), and downregulated transcripts (log ratio%K0.5) correspond to red, dark, and green colors respectively. (B) Hierarchical clustering of differ- entially expressed transcripts. A, B, and C on the top of the dendrogram refer the biological replications during hybridization. NNCBISY, no NCBI gene symbol.

Validation of differentially regulated genes with validation of DEP technique to be used as one of the non- quantitative real-time PCR invasive tools for selecting developmentally competent In oocytes, the validation results confirm that seven out oocytes or zygotes. The movement of the cells toward the of seven transcripts were found to be in accordance with higher electric field was driven by the higher polarizable the microarray data indicating higher validity of the ability of oocytes and zygotes compared the sorbitol expression pattern which was observed in the microarray solution used as dielectrophoretic emersion medium data. This higher confirmation rate was brought by the (conduction medium). It is also stated that the cell or fact that differentially regulated genes were selected after particle can be pulled toward the higher electric field or it was confirmed by three dye-swap replications. repelled away depending on the medium used during However, the fold change difference obtained by real- DEP (Ramı´rez et al. 2003). As the conductivity of the time PCR is much higher than the microarray data. In medium is lower than the cells, the cells are more microarray data, the maximum fold change difference polarized than the medium and therefore the cells between the very fast and the very slow oocytes was migrate toward the electrode (higher electric fields; fivefold upregulation in the very fast oocytes. Never- Green & Morgan 1997, Goater & Pethig 1998). The theless, the maximum fold change obtained in real-time movement toward the higher electric field is usually PCR was 72 and the minimum was 6 (Fig. 9) and the known as a positive DEP (Poh et al. 1981, Ikeda et al. correlation coefficient of the microarray data and the 2005, Lao & Hsing 2005). Therefore, in our experimental real-time PCR was 0.458. setup, the oocytes and the zygotes also exhibited a Similarly, in zygotes, the real-time PCR results positive DEP because the medium used during DEP has a revealed that eight out of nine transcripts were in conductivity of 80 ms/cm which triggers the oocytes and accordance with the microarray data (Fig. 10). Further- the zygotes to be more polarizable than the medium. more, the coefficient of correlation between the In view of the dielectrophoretic behavior, both the microarray result and the real-time PCR was 0.552. oocytes and zygotes tended to exhibit a similar dielectric C behavior. However, the PB oocytes have relatively higher proportion of slow-moving population when K Discussion compared with zygotes and PB oocytes (Fig. 1). This may be due to the lower electrical conductivity of the C Dielectrophoretic behavior of oocytes and zygotes PB oocytes associated with the declining porosity in C Understanding the mechanism of dielectrophoretic oocyte membrane during maturation by losing the K mobility of oocytes and zygotes enables appropriate permeable channel (Lansman 1983). Moreover, a

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access Dielectrophoretic separation of oocytes/embryos 941

Table 5 List of upregulated genes in the very fast dielectrophoretic categories of zygotes and their function.

Accession no. Gene bank name Function NM_004398 Homo sapiens DEAD (Asp–Glu–Ala–Asp) box polypeptide 10, mRNA (DDX10) Cellular growth and division, embryogenesis, RNA helicase activity BT006757 Homo sapiens nuclear auto-antigenic sperm protein (histone binding; NASP) Encodes a H1 histone-binding protein, cell division NM_182651 Bos taurus DNA (cytosine 5) methyltransferase 1, mRNA (DNMT1) Metal ion binding, zinc ion binding, DNA methylation BC010281 Homo sapiens ADP-ribosylation factor-like 6-interacting protein (ARL6IP) Protein binding NM_003870 Homo sapiens IQ motif containing GTPase-activating protein 1 (IQGAP1) Calmodulin binding NM_003601 Homo sapiens SWI/SNF related, matrix associated, actin dependent (SMARCA5) Replication of pericentric heterochromatin in S-phase, regulate transcription BK001637 TPA: Mus musculus regulator of sex-limitation candidate 2 (Rslcan2) Unknown BC039858 Homo sapiens v-ral simian leukemia viral oncogene homolog A (ras) RALA Signal transduction, GTP binding BC047646 Homo sapiens zinc finger protein 85 (HPF4, HTF1), mRNA (cDNA clone Metal ion (zinc) binding, nucleic acid binding, ZNF85) transcription factor activity AC150515 Bos taurus BAC CH240-118E9 (Children's Hospital Oakland Research) Unknown NM_018158 Homo sapiens solute carrier family 4 (anion exchanger) member 1 (SLC4A1AP) Double-stranded RNA binding AF275269 Homo sapiens NANOS1 mRNA, complete cds Zinc ion binding, RNA binding, regulation of translation XM_132350 Mus musculus RIKEN cDNA 4930438O03 gene (4930438O03Rik), mRNA Unknown AC096629 Bos taurus clone rp42-152a4, complete sequence Unknown BC000764 Homo sapiens chromosome 6 open reading frame 166, mRNA (cDNA clone Unknown (C6orf166) BC024227 Homo sapiens zinc finger protein 519, mRNA (cDNA clone MGC:27166 Metal ion binding, DNA binding, regulation of (ZNF519)) transcription BC018147 Homo sapiens senescence downregulated leo1-like (LEO1) Unknown NM_002923 Homo sapiens regulator of G-protein signaling 2, 24 kDa, mRNA (RGS2) Signal transducer, GTPase activator activity, calmodulin binding NM_032598 Homo sapiens testes development-related NYD-SP20 (NYD-SP20) Unknown BC042755 Homo sapiens regulator of G-protein signaling 2, 24 kDa, mRNA cDNA (RGS2) Signal transducer activity, calmodulin binding, GTPase activator activity AC098686 Bos taurus clone rp42-146c17, complete sequence Unknown BC063533 Homo sapiens apoptosis, caspase activation inhibitor, mRNA cDNA (AVEN) Protein binding, anti-apoptosis AF312827 Homo sapiens tectorin-b (TECTB) mRNA, complete cds Extracellular matrix structural constituent BC027464 Homo sapiens aurora kinase A (AURKA) Cell cycle regulation decrease in plasma membrane conductivity as the oocyte properties of the cells. The difference in dielectrophore- progress to the MII stage is reported (Tosti & Boni 2004). tic mobility within bovine oocyte and/or zygotes can be Hence, the oocytes that extruded the first polar body driven by their intrinsic property within the cell. As during maturation were the ones which completed the reviewed by many authors, the features of a cell, maturational process and entered the MII stages. including the morphology, the cytoplasm content Examining the causes attributing for differences in (Arnold & Zimmerman 1988), the conductivity and dielectrophoretic mobility of oocytes and zygotes can permittivity of the cytoplasm (Wanichapichart et al. be useful to understand the electrical and physiological 2002), the membrane morphology and properties

Table 6 List of downregulated genes in the very fast dielectrophoretic categories of zygotes and their function.

Accession no. Gene bank name Function BC000047 Homo sapiens ribosomal protein L8, mRNA (RPL8) rRNA binding, structural constituents of ribosome AY283766 Bos taurus type 4 mucus-type core 2 Carbohydrate metabolism NM_033301 Homo sapiens ribosomal protein L8, transcript variant 2 (RPL8) rRNA binding, structural constituents of ribosome AB098899 Bos taurus mRNA similar to ribosomal protein S18, partial cds (RPS18) rRNA binding, structural constituents of ribosome BC019262 Homo sapiens Huntingtin-interacting protein K (HYPK) Protein binding AB098748 Bos taurus mRNA similar to acidic ribosomal phosphoprotein PO (RPLP0) rRNA binding, structural constituents of ribosome BC062798 Homo sapiens cDNA clone IMAGE:6495746, partial cds (C6orf173) Unknown NM_031706 Rattus norvegicus ribosomal protein S8 (Rps8) Structural constituents of ribosome BC004170 Homo sapiens polymerase (DNA directed), epsilon 3 (p17 subunit) DNA transcription, replication, and packaging AC110780 Homo sapiens BAC clone RP11-357A22 from 2 Amino acid dephosphorylation AB099089 Bos taurus mRNA similar to ribosomal protein S14 (RPS14) rRNA binding, structural constituents of ribosome BC003751 Mus musculus degenerative spermatocyte homolog Drosophila (Degs1) Zinc ion binding, oxidoreductase activity AC012175 Homo sapiens chromosome 16 clone RP11-19H6 Unknown NM_173974 Bos taurus zona pellucida glycoprotein 3 (ZP3) Prevents post-fertilization polyspermy X06423 Rat mRNA for ribosomal protein S8 (RPS8) Structural constituents of ribosome NM_174731 Bos taurus Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) Structural constituent of ribosome www.reproduction-online.org Reproduction (2007) 133 931–946

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 942 S-W Dessie and others

Figure 8 Ontological classification of differen- tially regulated genes in the very fast and very slow zygotes.

(Wang et al. 1997), the cell size (Pethig 1991, Goater & dielectrophoretic mobility. Therefore, the difference in Pethig 1998), shape and composition of the plasma dielectrophoretic mobility of individual oocytes or membrane, and the cell cytoplasm and nucleus (Archer zygotes can be driven by variation in the abundance of et al. 1999) can be the major factors resulting in transcripts in the cytoplasm that can be associated with differences in dielectrophoretic mobility. However, in the modification in morphology of a cell. For instance, this experiment, it has been shown that the speed of Cristofanilli et al. (2002) noted the difference in oocytes and zygotes in the electric field was not related dielectric properties that have occurred in MCF-7 to the size of the cells as confirmed by the correlation sublines because of the overexpression of HER-2/ analysis. neuoncogen. Moreover, after separating cell membrane, Difference in the cytoplasmic conductivity is the dielectric properties of five different cultivated cell lines major contributor for the variation in cell conductivity and human peripheral blood mononuclear cells, it was at frequencies higher than 1 MHz (Docoslis & shown that the gene expression profiles of the post- Alexandridis 2002). Hence, bovine oocytes and zygotes separated cells were significantly different from those of with different cytoplasmic contents can possess different the pre-separated cell mixtures (Huang et al. 2002). tendencies of polarization and speed of migration in the Similarly, the expression analysis in our experiment electric field. Furthermore, the variability in the speed showed that PTGS2, DNA (cytosine 5) methyltransferase within the zygotes can be attributed by difference in the 1 (DNMT1), and ANXA2 (Table 3) were abundant in fast- accumulation of ions during and after fertilization. moving oocytes; and ZNF85, ZNF519, and NANOS1 Fertilization causes a constant increase in the ionic (Table 5) were enriching very fast zygotes and all these conductance of the plasma membrane (Jaffe et al. genes are believed to play in ion binding. In addition, 1983). The concentration of ions may foster some of the IQGAP1, which is enriched in the very fast dielectro- cells to acquire charges and induce dipole. Based on phoretic zygotes, is involved in cell motility. As reported this notation, we can explain that higher ionic by Mataraza et al. (2003), the overexpression of IQGAP1 concentration on the plasma membranes after fertiliza- in mammalian cells can enhance cell migration and cell tion in some of the zygotes may have triggered the motility. However, the involvement of IQGAP1 in motion of the zygotes. Similarly, a report by Arnold passive migration of oocytes in the electric field needs et al. (1989) revealed an increase in the cell membrane further investigation. conductivity of rabbit oocyte when compared with the In addition to investigating the electrical behavior of unfertilized oocyte as a result of changing the the bovine MII oocytes and zygotes, looking into the membrane structure due to fertilization. This may lead developmental behavior is paramount important to to the conclusion that zygotes which moved very fast in predict the validity of the dielectrophoretic technique the electric field might be those derived from success- as the one non-invasive option for selecting fully fertilized oocytes.

Dielectrophoretic behavior, developmental compe- tence, and mRNA expression of oocytes and zygotes Unpublished data in our laboratory on bovine oocytes show that zona-free and zona-intact oocytes have the same moving time in the electric field showing the absence of the zona pellucida effect on the dielectro- phoretic mobilities of oocytes. This in turn can suggest Figure 9 Relative abundance of differentially regulated transcripts in the that the cytoplasmic content may govern the very fast versus very slow dielectrophoretic categories oocytes.

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access Dielectrophoretic separation of oocytes/embryos 943

modification are required to enrich the oocyte with sufficient molecular stores for triggering the develop- ment to the start of embryonic genome activation (Donnison & Pfeffe 2004). Similarly, our microarray experiments showed that 86 and 60% of the differen- tially regulated genes were found to be more abundant in the very fast moving oocytes and zygotes respectively Figure 10 Relative abundance of differentially regulated genes in the revealing the differences in the accumulation of specific very fast versus very slow dielectrophoretic categories zygotes. transcripts in oocytes and zygotes with different developmental competences. Among the transcripts enriching the very fast moving developmentally competent oocytes and zygotes. In this oocytes, RPL2, RPL8, RPL35, RPLP0, LOC52280L, and regard, our result revealed a significant difference in the LOC390110 (Table 3; Fig. 5B) are known to be involved rate of development at 6 and 7 dpa of dielectrophoretic in amino acid metabolism, biosynthesis biological C K separated PB oocytes and at 6, 7, 8, and 9 dpa of PB process, and encode ribosomal protein. C oocytes. Furthermore, at 7 dpi, the very fast dielectro- ANXA2, a Ca2 - and phospholipid-binding protein phoretic categories of zygotes yielded significantly (Dreier et al. 1998, Filipenko et al. 2004), found to be higher number of blastocysts compared with the very higher in competent oocytes (Costa et al. 2006), in virally slow dielectrophoretic groups of zygote. Therefore, this transformed cell lines and in human tumors (Filipenko variation in the rate of development of oocyte and zygote et al. 2004) and involved in ion channel activity (Burger of different dielectrophoretic categories is an indicator of et al. 2006). Similarly, ANXA2 was abundant in the very the tendency of dielectrophoretic procedure to discrimi- fast moving categories of oocytes which exhibited higher nate oocytes and/or zygotes according to the physio- blastocyst rate at 6 and 7 dpa. logical status. Others, namely CDC91L1, NUSAP1, FAM58A, and The critical point remaining as a challenge is to find CKS1B which are known to be involved in cell division out the fundamental causes which trigger the very fast were also upregulated in the very fast dielectrophoretic C moving dielectrophoretic categories of PB oocytes to categories (Table 5). For instance, cells transfected with become developmentally competent at 6 and 7 dpa CDC91L1 gene grew at a faster rate and had increased compared with the very slow moving counter parts, anchorage-independent growth capability compared despite the total blastocyst yield at 9 dpa, which was not with control cells (Guo et al. 2004). Furthermore, the significantly different. suppression of NUSAP1 in a cell by RNA interference In living cells, transmembrane enzymes can likely has shown mitotic defects, aberrant mitotic spindles, absorb free energy from an oscillating electric field and defective chromosome segregation, and cytokinesis that transduce it to chemical energy (Westerhoff et al. 1986). interfere with normal cell cycle progression (Raemaekers Similarly, the application of a 1 or 10 Hz electric field to et al. 2003). In addition, these authors noticed the human hepatoma cells was found to induce a fourfold upregulated NUSAP expression in proliferating cells C increase in Ca2 within 30 min of continuous field during G2/M-phase of the cell cycle. The higher exposure (Cho et al. 1999). However, these assertions expressional pattern of these genes in the very fast cannot signify the differences for developmental compe- dielectrophoretic oocytes might have fostered the rate of tence of the very fast and very slow dielectrophoretic embryonic development at days 6 and 7 dpa due to groups of oocytes and zygotes as both groups were co-ordinated and proper cell programing and cell exposed to electric field. Therefore, investigating their division compared with the very slow groups where molecular basis was essential to evaluate the differences these genes are downregulated. in the cytoplasmic content. In order to get insight of the Similarly, differentially expressed genes, including molecular differences between these groups of oocytes NASP, DDX10, IQGAP, SMARCA5, RGS2, and AURKA and zygotes, transcriptional analysis of the very fast and (aurora kinase A) were more abundant in the very fast very slow oocytes or zygotes was performed using the zygotes that exhibited significantly higher blastocyst rate bovine cDNA microarray. at 7 dpi compared with the very slow dielectrophoretic The transcriptional abundance and developmental categories. These genes are believed to be involved in competence of oocytes has been assessed by many cell division and progression, transcriptional regulation, authors (Lonergan et al. 2003, Lequarre et al. 2004). and other similar functions. For instance, the nuclear High rates of RNA and protein synthesis, storage of auto-antigenic sperm protein (NASP), a homolog of the ribosome mRNAs and protein in ooplasm during the N1/N2 gene expressed in oocytes of Xenopus laevis, was oocyte growth are needed in high developmental found in all dividing cells that is regulated by the cell capacity (Eichenlaub-Ritter & Peschke 2002). Since the cycle (Richardson et al. 2000). Moreover, the human molecular mechanism related to the development somatic and testis NASP mRNAs are expressed in all the involves mRNA and protein synthesis, degradation and transformed cell lines and human tumors revealing the www.reproduction-online.org Reproduction (2007) 133 931–946

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 944 S-W Dessie and others involvement of NASP in the cell cycle of dividing cells reprograming and inefficient demethylation as a result (Richardson et al. 2001). of low level of DNMT1. The DDX10 gene belongs to the DEAD-box proteins In conclusion, the difference in the rate of develop- and involves translation initiation, nuclear and mRNA ment between the dielectrophoretically categorized splicing, ribosome and spliceosome assembly, and oocytes and zygotes is accompanied by the differences mRNA stability (Schmid & Linder 1992, Iost and Dreyfus in transcriptional abundance. Furthermore, the results 1994, Arai et al. 1997). showed the potential of DEP to be applied as a non- SMARCA5, which contains an open reading frame of invasive tool to screen developmentally competent 3156 nucleotides encoding a 1052 amino acid peptide oocytes and embryos. (Aihara et al. 1998), also upregulated in the very fast moving zygotes and plays a central role in eukaryotic Acknowledgements transcriptional regulation (Mohrmann et al. 2004). IQGAP binds calmodulin, E-cadherin and involves a The authors are grateful to Mr Horst Fassbender and Mr Plech crucial role in transuding Cdc42 signaling to the (Geoda¨tisches Institut University of Bonn, Germany) for cytoskeleton (Sokol et al. 2001, Swart-Mataraza et al. providing the AM/phase lock AC generator and voltmeter 2002). The overexpression of IQGAP1 can significantly reader. They are also grateful to Dr Andreas Waha (Institute of Neuropathology, University of Bonn) for his technical support increase the amount of active Cdc42 in embryonic cells during array scanning. The authors declare that there is no which in turn control the organization of the conflict of interest that would prejudice the impartiality of this cytoskeleton, cell cycle progression, and gene transcrip- scientific work. tion (Sokol et al. 2001). The higher expression of IQGAP in the very fast zygote may be one of the transcripts for fast development of the very fast zygotes compared with References the very slow zygotes. Moreover, RGS2, a regulator of G-protein signaling family member (Zmijewski et al. Aihara T, Miyoshi Y, Koyama K, Suzuki M, Takahashi E, Monden M & Nakamura Y 1998 Cloning and mapping of SMARCA5 encoding 2001), possibly involved in regulating the intracellular hSNF2H, a novel human homologue of Drosophila ISWI. Cytoge- 2C Ca mobilization and T-cell proliferation at the netics and Cell Genetics 81 191–193. maternal–fetal interface during embryo implantation Arai Y, Hosoda F, Kobayashi H, Arai K, Hayashi Y, Kamada N, Kaneko Y (Huang et al. 2003). The higher expression level of this & Ohki M 1997 The inv(11)(p15q22) chromosome translocation of de novo and therapy-related myeloid malignancies results in fusion gene in the very fast moving zygotes exhibited higher of the nucleoporin gene, NUP98, with the putative RNA helicase rate of development at 7 dpi may indicate the gene, DDX10. Blood 89 3936–3944. involvement of RGS2 in growth and development of Archer S, Morgan H & Rixon FJ 1999 Electrorotation studies of baby pre-implantation embryo. hamster kidney fibroblasts infected with herpes simplex virus type. Biophysical Journal 76 2833–2842. The very fast zygotes are also enriched with AURKA. It Arnold WM & Zimmerman U 1988 Electrorotation: development of a is involved in cell cycle control by regulating M-phase technique for dielectric measurements on individual cells and events. In mammals, AURKA is located at the mitotic particles. Journal of Electrostatics 21 151–191. spindle to regulate the centrosome and mitotic micro- Arnold WM, Schmutzler RK, Al-Hasani S, Krebs D & Zimmermann U 1989 Differences in membrane properties between unfertilized and tubules (Udayakumar et al. 2006). Furthermore, it is fertilized single rabbit oocytes demonstrated by electro-rotation: believed to be involved in mitotic control (Prigent & Giet comparison with cells from early embryos. Biochimica et Biophysica 2003), which means that the AURKA is required for Acta 979 142–146. centrosome maturation, proper chromosome segre- Blondin P & Sirard MA 1995 Oocyte and follicular morphology as gation, and assembly and maintenance of a bipolar determining characteristics for developmental competence in bovine oocytes. Molecular Reproduction and Development 41 spindle (Satinover et al. 2006). 54–62. DNMT1 is one of the genes enriching both the very Burger A, Berendes R, Liemann S, Benz J, Hofmann A, Gottig P, fast moving oocytes and zygotes. DNMT1 is thought to Huber R, Gerke V, Thiel C, Romisch J & Weber K 2006 The crystal maintain genomic methylation through DNA replication structure and ion channel activity of human annexin II, a peripheral membrane protein. Journal of Molecular Biology 257 839–847. (Grohmann et al. 1997). The loss of phenotype Burt JPH, Chan KL, Dawson D, Parton A & Pethig R 1996 Assays for associated with reduction in DNMT1 has been reported microbial contamination and DNA analysis based on electrorota- to reveal the importance of DNMT1 for mammalian cell tion. Annales de Biologie Clinique 54 253–257. development and growth. For instance, the loss of Caraux G & Pinloche S 2004 PermutMatrix: a graphical environment to arrange gene expression profiles in optimal linear order. Bioinfor- DNMT1 from somatic cells causes p53-dependent matics 21 1280–1281. apoptosis (Jackson-Grusby et al. 2001). Depletion of Cho MR, Thatte HS, Silvia MT & Golan DE 1999 Transmembrane DNMT1 from X. laevis embryos causes embryonic calcium influx induced by ac electric fields. Official Publication of lethality and inappropriate gene expression (Stancheva the Federation of American Societies for Experimental Biology 13 677–683. & Meehan 2000). Similarly, the lower level of blastocyst Chohan KR & Hunter AG 2003 Effect of reproductive status on in vitro of the very fast oocytes at 6 and 7 dpa and at the very developmental competence of bovine oocytes. Journal of Veterinary slow zygotes may be attributed by deficient Science 4 67–72.

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access Dielectrophoretic separation of oocytes/embryos 945

Costa LFS, Machado MSN,Oliveira JFC, ZamberlanG & Gonc¸alvesPBD Iost I & Dreyfus M 1994 mRNAs can be stabilized by DEAD-box 2006 Annexin II mRNA expression in bovine oocytes during follicular proteins. Nature 372 193–196. development. Genetics and Molecular Biology 29 396–400. Jackson-Grusby L, Bear C, Possemat R, Tudor M, Fambroug D, Cristofanilli M, De Gasperis G, Zhang L, Hung MC, Gascoyne PR & Csankovszki1 G, Dausman J, Lee P, Wilson C, Lander E & Jaenisch R Hortobagyi GN 2002 Automated electrorotation to reveal dielectric 2001 Loss of genomic methylation causes p53-dependent apoptosis variations related to Her-2/neu over expression in MCF-7 sub lines. and epigenetic deregulation. Nature Genetics 27 31–39. Clinical Cancer Research 8 615–619. Jaffe LA, Sharp AP & Wolf DP 1983 Absence of an electrical Docoslis A & Alexandridis P 2002 One, two, and three-dimensional polyspermy block in the mouse. Developmental Biology 96 organization of colloidal particles using non-uniform AC electric 317–323. fields. Electrophoresis 23 2174–2183. Kadaksham AT, Singh P & Aubry N 2004 Dielectrophoresis of nano Donnison M & Pfeffer PL 2004 Isolation of genes associated with particles. Electrophoresis 25 3625–3632. developmentally competent bovine oocytes and quantification of Lansman JB 1983 Voltage-clamp study of the conductance activated at their levels during development. Biology of Reproduction 71 fertilization in the starfish egg. Journal of Physiology 345 353–372. 1813–1821. Lao AI & Hsing IM 2005 Flow-based and sieving matrix-free DNA Dreier R, Schmid KW, Gerke V & Riehemann K 1998 Differential differentiation by a miniaturized field flow fractionation device. Lab expression of annexins I, II and IV in human tissues: an on a chip 5 687–690. immunohistochemical study. Histochemistry and Cell Biology 110 Lapizco-Encinas BH, Simmons BA, Cummings EB & Fintschenko Y 137–148. 2004 Insulator-based dielectrophoresis for the selective concen- Eichenlaub-Ritter U & Peschke M 2002 Expression in in vivo and tration and separation of live bacteria in water. Electrophoresis 25 in vitro growing and maturing oocytes: focus on regulation of 1695–1704. expression at the translational level. Human Reproduction Update 8 Lequarre AS, Traverso JM, Marchandise J & Donnay I 2004 Poly(A) 21–41. RNA is reduced by half during bovine oocyte maturation but Filipenko NR, MacLeod TJ, Yoon CS & Waisman DM 2004 Annexin A2 increases when meiotic arrest is maintained with CDK inhibitors. is a novel RNA-binding protein. Journal of Biological Chemistry 279 Biology of Reproduction 71 425–431. 8723–8731. Lonergan P, Gutierrez-Adan A, Rizos D, Pintado B, de la Fuente J & Fuhr G, Muller T, Baukloh V & Lucas K 1998 High-frequency electric Boland MP 2003 Relative messenger RNA abundance in bovine field trapping of individual human spermatozoa. Human Reproduc- oocytes collected in vitro or in vivo before and 20 h after the tion 13 136–141. preovulatory luteinizing hormone surge. Molecular Reproduction Gascoyne PRC, Huang Y, Pethig R, Vykoukal J & Becker FF 1992 and Development 66 297–305. Dielectrophoretic separation of mammalian cells studied by Markx GH, Huang Y, Zhou XF & Pethig R 1994 Dielectrophoretic computerized image analysis. Measurement Science & Technology characterization and separation of micro-organism. Microbiology 3 439–445. 140 585–591. Gianaroli L, Magli MC, Ferraretti AP, Fortini D & Grieco N 2003 Mataraza JM, Briggs MW, Li Z, Entwistle A, Ridley AJ & Sacks DB 2003 Pronuclear morphology and chromosomal abnormalities as scoring IQGAP1 Promotes cell motility and invasion. Journal of Biological criteria for embryo selection. Fertility and Sterility 80 341–349. Chemistry 278 41237–41245. Goater AD & Pethig R 1998 Electrorotation and dielectrophoresis. Mayes M 2002 The meiotic arrest of bovine oocytes. PhD. thesis, Parasitology 117 177–189. Department of Animal Sciences, Faculty of Agricultural Sciences, Green NG & Morgan H 1997 Dielectrophoretic investigations of University of Laval, Quebec, Canada. submicrometre latex spheres. Journal of Physics D: Applied Mayes MA & Sirard MA 2001 The influence of cumulus–oocyte Physics 30 2626–2633. complex morphology and meiotic inhibitors on the kinetics of Grohmann M, Spada F,Schermelleh L, Alenina N, Bader M, Cardoso MC, Green NG & Morgan H 1997 Dielectrophoretic investigations of sub nuclear maturation in cattle. Theriogenology 55 911–922. micrometre latex spheres. Journal of Physics D: Applied Physics 30 Minerick AR, Zhou R, Takhistov P & Chang HC 2003 Manipulation and 2626–2633. characterization of red blood cells with alternating current fields in Guo Z, Linn JF, Wu G, Anzick SL, Eisenberger CF, Halachmi S, micro devices. Electrophoresis 24 3703–3717. Cohen Y, Fomenkov A, Hoque MO, Okami K, Steiner G, Engles JM, Mohrmann L, Langenberg K, Krijgsveld J, Kal AJ, Heck AJ & Osada M, Moon C, Ratovitski E, Trent JM, Meltzer PS, Westra WH, Verrijzer CP 2004 Differential targeting of two distinct SWI/SNF- Kiemeney LA, Schoenberg MP, Sidransky D & Trink B 2004 related Drosophila chromatin-remodeling complexes. Molecular CDC91L1 (PIG-U) is a newly discovered oncogene in human and Cellular Biology 8 3077–3088. bladder cancer. Nature Medicine 10 374–381. Pethig R 1991 Application of AC electrical fields to the manipulation Huang Y, Holzel R, Pethig R & Wang XB 1992 Differences in the AC and characterization of cells. In Automation in Biotechnology,pp electrodynamics of viable and non viable yeast cells determined 159–185. Ed. I Karube. Amsterdam: Elsevier. through combined dielectrophoresis and electrophoresis studies. Poh HA, Kaler K & Pollock K 1981 The continuous positive and Physics in Medicine and Biology 37 1499–1517. negative dielectrophoresis of micro organisms. Journal of Biological Huang Y, Wang XB, Becker FF & Gascoyne PR 1996 Membrane Physics 9 67–86. changes associated with the temperature sensitive p85gagmos- Prigent C & Giet R 2003 Aurora A and mitotic commitment. Cell 114 dependant transformation of rat kidney cells as determined by 531–532. dielectrophoresis and electrorotation. Biochimica et Biophysica Raemaekers T, Ribbeck K, Beaudouin J, Annaert W, Van Camp M, Acta 1282 76–84. Stockmans I, Smets N, Bouillon R, Ellenberg J & Carmeliet G 2003 Huang Y, Joo S, Duhon M, Heller M, Wallace B & Xu X 2002 NuSAP, a novel microtubule-associated protein involved in mitotic Dielectrophoretic cell separation and gene expression profiling on spindle organization. Journal of Cell Biology 162 1017–1029. microelectronic chip arrays. Analytical Chemistry 74 3362–3371. Ramı´rez A, Zehe A & Starostenko O 2003 Dielectrophoretic field Huang ZP, Ni H, Yang ZM, Wang J, Tso JK & Shen QX 2003 Expression fractionation of rouleaux formed of human erythrocytes: a feasibility of regulator of G-protein signalling protein 2 (RGS2) in the mouse study. Revista Mexicana de Ingenierı´a Biome´dica 24 14–22. uterus at implantation sites. Reproduction 126 309–316. Richardson RT, Batova IN, Widgren EE, Zheng LX, Whitfield M, Ikeda I, Monjushiro H & Watarai H 2005 Measurement of dielec- Marzluff WF & O’Rand MG 2000 Characterization of the histone trophoretic mobility of single micro-particles in a flow channel. H1-binding protein, NASP, as a cell cycle-regulated somatic protein. Analyst 130 1340–1342. Journal of Biological Chemistry 275 30378–30386. www.reproduction-online.org Reproduction (2007) 133 931–946

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access 946 S-W Dessie and others

Richardson RT, Bencic DC & O’Rand MG 2001 Comparison of mouse Tosti E & Boni R 2004 Electrical events during gamete maturation and and human NASP genes and expression in human transformed and fertilization in animals and humans. Human Reproduction Update tumor cell lines. Gene 274 67–75. 10 53–65. Satinover DL, Leach CA, Stukenberg PT & Brautigan DL 2006 Udayakumar TS, Belakavadi M, Choi KH, Pandey PK & Fondell JD Activation of Aurora-A kinase by protein phosphatase inhibitor-2, a 2006 Regulation of Aurora-A kinase gene expression via GABP bi functional signaling protein. PNAS 23 8625–8630. recruitment of TRAP220/MED1. Journal of Biological Chemistry 281 Schmid SR & Linder P 1992 DEAD protein family of putative RNA 14691–14699. helicases. Journal of Molecular Microbiology and Biotechnology 6 Wang XB, Huang Y, Burt JPH, Markx GH & Pethig R 1993 Selective 283–292. dielectrophoretic confinement of bioparticles in potential energy Sirard MA, Dufort I, Vallee M, Massicotte L, Gravel C, Reghenas H, wells. Journal of Physics D: Applied Physics 26 1278–1285. Watson AJ, King WA & Robert C 2005 Potential and limitations of Wang XB, Huang Y, Wang X, Becker FF & Gascoyne PR 1997 bovine-specific arrays for analysis of mRNA levels in early Dielectrophoretic manipulation of cells with spiral electrodes. development: preliminary analysis using a bovine embryonic array. Biophysical Journal 4 1887–1899. Reproduction, Fertility and Development 17 47–57. Wanichapichart P, Bunthawin S, Kaewpaiboon A & Kanchanapoom K Sokol SY, Li Z & Sacks DB 2001 The effect of IQGAP1 on Xenopus 2002 Determination of cell dielectric properties using dielectro- embryonic ectoderm requires Cdc42. Biological Chemistry 276 phoretic technique. ScienceAsia 28 113–119. 48425–48430. Westerhoff HV, Tsongt TY, Chocks PB, Chen YID & Astumiant RD Stancheva I & Meehan RR 2000 Transient depletion of xDnmt1 leads to 1986 How enzymes can capture and transmit free energy from an premature gene activation in Xenopus embryos. Genes & develop- oscillating electric field. PNAS 83 4734–4738. ment 14 313–327. Yang J, Huang Y, Wang XB, Becker FF & Gascoyne PR 2000 Differential Swart-Mataraza JM, Li Z & Sacks DB 2002 IQGAP1 is a component of analysis of human leukocytes by dielectrophoretic field flow- Cdc42 signaling to the cytoskeleton. Journal of Biological Chemistry fraction. Biophysical Journal 78 2680–2689. Zmijewski JW, Song L, Harkins L, Cobbs CS & Jope RS 2001 Oxidative 277 24753–24763. stress and heat shock stimulate RGS2 expression in 1321N1 Tesarik J & Greco E 1999 The probability of abnormal pre- astrocytoma cells. Archives of Biochemistry and Biophysics 392 implantation development can be predicted by a single static 192–196. observation on pronuclear stage morphology. Human Reproduc- tion 14 1318–1323. Tesfaye D, Ponsuksili S, Wimmers K, Gilles M & Schellander K Received 17 October 2006 2004 A comparative expression analysis of gene transcripts in post fertilization developmental stages of bovine embryos First decision 9 November 2006 produced in vitro or in vivo. Reproduction in Domestic Animals Revised manuscript received 15 January 2007 39 396–404. Accepted 14 February 2007

Reproduction (2007) 133 931–946 www.reproduction-online.org

Downloaded from Bioscientifica.com at 09/30/2021 02:16:01AM via free access