DOCSLIB.ORG

Atlas Journal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Atlas Journal Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 13, Number 7, July 2009 Previous Issue / Next Issue Genes ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1) (9q34.1) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 757-766. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ABL.html BCL2L12 (BCL2-like 12 (proline-rich)) (19q13.3). Christos Kontos, Hellinida Thomadaki, Andreas Scorilas. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 767-771. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCL2L12ID773ch19q13.html BCR (Breakpoint cluster region) (22q11.2) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 772-779. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCR.html ENAH (enabled homolog (Drosophila)) (1q42.12). Paola Nisticò, Francesca Di Modugno. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 780-785. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ENAHID44148ch1q42.html FGFR2 (fibroblast growth factor receptor 2) (10q26.13). Masaru Katoh. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 786-799. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/FGFR2ID40570ch10q26.html MAPK6 (mitogen-activated protein kinase 6) (15q21.2). Sylvain Meloche. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 800-804. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MAPK6ID43349ch15q21.html MIRN125A (microRNA 125a) (19q13.33). Serkan Tuna, Ayse Elif Erson. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 805-808. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MIRN125AID44325ch19q13.html MIRN125B1 (microRNA 125b-1) (11q24.1). Serkan Tuna, Ayse Elif Erson. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 809-813. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MIRN125B1ID44326ch11q24.html MIRN125B2 (microRNA 125b-2) (21q21.1). Serkan Tuna, Ayse Elif Erson. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 814-818. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MIRN125B2ID44327ch21q21.html RAC2 (ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Atlas Genet Cytogenet Oncol Haematol 2009; 7 I Rac2)) (22q13.1). Teresa Gómez del Pulgar, Juan Carlos Lacal. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 819-826. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/RAC2ID42021ch22q13.html SORBS2 (sorbin and SH3 domain containing 2) (4q35.1). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 827-832. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/SORBS2ID693ch4q35.html TIAM1 (T-cell lymphoma invasion and metastasis 1) (21q22.11). Michèle J Hoffmann, Rainer Engers. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 833-840. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/TIAM1ID42557ch21q22.html TNFRSF11B (tumor necrosis factor receptor superfamily, member 11b) (8q24.12). Maria Grazia Di Iasio, Federica Corallini, Paola Secchiero, Silvano Capitani. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 841-851. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/TNFRSF11BID42610ch8q24.html Leukaemias t(6;14)(q25-27;q32. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 852-853. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0614q25q32ID1324.html t(8;11)(p12;p15). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 854. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0811p12p15ID1521.html t(8;12)(p12;q15). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 855-856. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0812p12q15ID1201.html t(14;15)(q32;q11-13). Silvia Rasi, Gianluca Gaidano. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 857-858. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t1415q32q12ID1349.html Hepatosplenic T-cell lymphoma (HSTCL). Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 859-860. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/HepatoTlymphoID2099.html Intestinal T-cell lymphoma. Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 861-862. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/IntestinalTlymphoID2101.html Solid Tumours Bone: Enchondroma. Twinkal C Pansuriya, Judith VMG Bovée. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 863-868. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/EnchondromaID5333.html Cancer Prone Diseases Enchondromatosis. Twinkal C Pansuriya, Judith VMG Bovée. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 869-872. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Kprones/EnchondromatosisID10151.html Familial platelet disorder with predisposition to acute myelogenous leukemia (FPD/AML). Paula G Heller. Atlas Genet Cytogenet Oncol Haematol 2009; 7 II Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 873-878. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Kprones/FamPlateletDisAMLID10079.html Deep Insights The HLA-G non classical MHC class I molecule is expressed in cancer with poor prognosis. Implications in tumour escape from immune system and clinical applications. Catherine Menier, Nathalie Rouas-Freiss, Edgardo D Carosella. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 879-900. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Deep/HLAinCancerID20070.html Case Reports Educational Items © Atlas of Genetics and Cytogenetics in Oncology and Haematology X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching For comments and suggestions or contributions, please contact us [email protected]. Atlas Genet Cytogenet Oncol Haematol 2009; 7 III Atlas of Genetics and Cytogenetics in Oncology and Haematology ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1) Identity Other names ABL HGNC (Hugo) ABL1 Location 9q34.1 Location_base_pair Starts at 132700652 and ends at 132752879 bp from pter ( according to hg18- Mar_2006) [Mapping] Local_order CAN is more telomeric, TAN1 even more in 9q34.3. DNA/RNA DNA diagram Description 12 exons; 230 kb. Transcription Alternate splicing: 1a and 1b are 5' alternative exons; mRNA of 6 and 7 kb (with 1a and 1b respectively), giving rise to 2 protein of 145 kDa. Protein Protein diagram Description 1130-1143 amino acids; 4 domains: of which are SH (SRC homology) domains; NH2- term -- domain 1: SH3 (where can bind the binding protein BP1, to inhibit SH1 activation) and SH2 (with high affinity towards BCR first exon) -- domain 2: SH1 (with a self-phosphorylable tyrosine) -- 'domain' 3: nuclear localization domain (DNA binding, but not during mitosis) -- domain 4: actin binding (cytoskeleton) --COOH-term; note: 1b (but not the 1a alternative) myristylable allowing anchorage to the membrane. Normal ABL has a tri-dimensional structure which is tightly preserved in a closed, inactive conformation order to prevent oncogenic activation. The maintenance of this inactive conformation is possible by: 1- the "latching" of the myristilated NH2-terminal sequence which is directly linked to a myristilation recognition sequence on the c-lobe of the SH1 kinase domain; 2-The close contact between SH3 and SH2 domain 3- The interactions between SH3 domain and the C-lobe of the kinase domain. These interactions clamp the structure and prevent the kinase to switch to an active conformation, a process which requires the phosphorylation of Tyr 412 residue and the "unlatching" of the myristoyl group from the C-Lobe of the kinase domain. The attachment of proline-rich SH2 and SH3 ligands leads to the complete switch of the protein to an open, active conformation of the kinase. The NH2-terminal myristilation (autoregulatory role) is deleted during the t(9;22) translocation. Expression Ubiquitously expressed, c-ABL K/O phenotype is lethal. Localisation c-abl is localized to the nucleus, plasma membrane and actin cytoskeleton. Function c-ABL exhibit a permanent nuclear and cytoplasmic shuttling activity, driven by 3 Atlas Genet Cytogenet Oncol Haematol 2009; 6 757 nuclear localisation signals (NLS) and a single nuclear export signal (NES) close to the C-terminal region. Recent data suggest that nuclear and cytoplasmic ABL may have different functions. 1- Nuclear c-ABL plays a major role in the regulation of cell death after DNA damage. All DNA damage inducing agents activate nuclear c-ABL kinase in a ATM- dependent manner and in the presence of the p53-homolog p73 protein. The latter is physically associated with c-ABL after DNA damage through the SH3 domain of c-ABL. DNA damage also activates simultanously p53 pathway, leading to the activation of Rb which induces growth arrest and protects cells from apoptosis. The exacts mechanisms of apoptosis induced by c-ABL are unknown. The translocation of cytoplasmic c-ABL to the nucleus has been shown to be due to its release from 14-3-3 proteins to which c-
Load more

Recommended publications
  • Analysis of Gene Expression Data for Gene Ontology
    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Glioma Oncoprotein Bcl2l12 Inhibits the P53 Tumor Suppressor
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Glioma oncoprotein Bcl2L12 inhibits the p53 tumor suppressor Alexander H. Stegh,1,2,7 Cameron Brennan,3 John A. Mahoney,1 Kristin L. Forloney,1 Harry T. Jenq,4 Janina P. Luciano,2 Alexei Protopopov,1 Lynda Chin,1,5 and Ronald A. DePinho1,6,8 1Belfer Institute for Applied Cancer Science, Department of Medical Oncology, Dana-Farber Cancer Institute, Boston, Massachusetts 02115, USA; 2Ken and Ruth Davee Department of Neurology, Robert H. Lurie Comprehensive Cancer Center, The Brain Tumor Institute, Center for Genetic Medicine, Northwestern University, Chicago, Illinois 60611, USA; 3Brain Tumor Center, Department of Neurosurgery, Memorial Sloan-Kettering Cancer Center, New York, New York 10021, USA; 4Division of Health Sciences and Technology, Harvard Medical School and Massachusetts Institute of Technology, Boston, Massachusetts 02114, USA; 5Department of Dermatology, Harvard Medical School, Boston, Massachusetts 02115, USA; 6Department of Medicine and Genetics, Harvard Medical School, Boston, Massachusetts 02115, USA Glioblastoma multiforme (GBM) is a lethal brain tumor characterized by intense apoptosis resistance and extensive necrosis. Bcl2L12 (for Bcl2-like 12) is a cytoplasmic and nuclear protein that is overexpressed in primary GBM and functions to inhibit post-mitochondrial apoptosis signaling. Here, we show that nuclear Bcl2L12 physically and functionally interacts with the p53 tumor suppressor, as evidenced by the capacity of Bcl2L12 to (1) enable bypass of replicative senescence without concomitant loss of p53 or p19Arf, (2) inhibit p53-dependent DNA damage-induced apoptosis, (3) impede the capacity of p53 to bind some of its target gene promoters, and (4) attenuate endogenous p53-directed transcriptomic changes following genotoxic stress.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
    International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genetic Variant in 3' Untranslated Region of the Mouse Pycard Gene
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 2 3 Title: 4 Genetic Variant in 3’ Untranslated Region of the Mouse Pycard Gene Regulates Inflammasome 5 Activity 6 Running Title: 7 3’UTR SNP in Pycard regulates inflammasome activity 8 Authors: 9 Brian Ritchey1*, Qimin Hai1*, Juying Han1, John Barnard2, Jonathan D. Smith1,3 10 1Department of Cardiovascular & Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, 11 Cleveland, OH 44195 12 2Department of Quantitative Health Sciences, Lerner Research Institute, Cleveland Clinic, Cleveland, OH 13 44195 14 3Department of Molecular Medicine, Cleveland Clinic Lerner College of Medicine of Case Western 15 Reserve University, Cleveland, OH 44195 16 *, These authors contributed equally to this study. 17 Address correspondence to Jonathan D. Smith: email [email protected]; ORCID ID 0000-0002-0415-386X; 18 mailing address: Cleveland Clinic, Box NC-10, 9500 Euclid Avenue, Cleveland, OH 44195, USA. 19 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.26.437184; this version posted March 26, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 20 Abstract 21 Quantitative trait locus mapping for interleukin-1 release after inflammasome priming and activation 22 was performed on bone marrow-derived macrophages (BMDM) from an AKRxDBA/2 strain intercross.
    [Show full text]
  • Alpha;-Actinin-4 Promotes Metastasis in Gastric Cancer
    Laboratory Investigation (2017) 97, 1084–1094 © 2017 USCAP, Inc All rights reserved 0023-6837/17 α-Actinin-4 promotes metastasis in gastric cancer Xin Liu and Kent-Man Chu Metastasis increases the mortality rate of gastric cancer, which is the third leading cause of cancer-associated deaths worldwide. This study aims to identify the genes promoting metastasis of gastric cancer (GC). A human cell motility PCR array was used to analyze a pair of tumor and non-tumor tissue samples from a patient with stage IV GC (T3N3M1). Expression of the dysregulated genes was then evaluated in GC tissue samples (n = 10) and cell lines (n =6) via qPCR. Expression of α-actinin-4 (ACTN4) was validated in a larger sample size (n = 47) by qPCR, western blot and immunohistochemistry. Knockdown of ACTN4 with specific siRNAs was performed in GC cells, and adhesion assays, transwell invasion assays and migration assays were used to evaluate the function of these cells. Expression of potential targets of ACTN4 were then evaluated by qPCR. Thirty upregulated genes (greater than twofold) were revealed by the PCR array. We focused on ACTN4 because it was upregulated in 6 out of 10 pairs of tissue samples and 5 out of 6 GC cell lines. Further study indicated that ACTN4 was upregulated in 22/32 pairs of tissue samples at stage III & IV (P = 0.0069). Knockdown of ACTN4 in GC cells showed no significant effect on cell proliferation, but significantly increased cell-matrix adhesion, as well as reduced migration and invasion of AGS, MKN7 and NCI-N87 cells.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • Inhibition of Mitochondrial Complex II in Neuronal Cells Triggers Unique
    www.nature.com/scientificreports OPEN Inhibition of mitochondrial complex II in neuronal cells triggers unique pathways culminating in autophagy with implications for neurodegeneration Sathyanarayanan Ranganayaki1, Neema Jamshidi2, Mohamad Aiyaz3, Santhosh‑Kumar Rashmi4, Narayanappa Gayathri4, Pulleri Kandi Harsha5, Balasundaram Padmanabhan6 & Muchukunte Mukunda Srinivas Bharath7* Mitochondrial dysfunction and neurodegeneration underlie movement disorders such as Parkinson’s disease, Huntington’s disease and Manganism among others. As a corollary, inhibition of mitochondrial complex I (CI) and complex II (CII) by toxins 1‑methyl‑4‑phenylpyridinium (MPP+) and 3‑nitropropionic acid (3‑NPA) respectively, induced degenerative changes noted in such neurodegenerative diseases. We aimed to unravel the down‑stream pathways associated with CII inhibition and compared with CI inhibition and the Manganese (Mn) neurotoxicity. Genome‑wide transcriptomics of N27 neuronal cells exposed to 3‑NPA, compared with MPP+ and Mn revealed varied transcriptomic profle. Along with mitochondrial and synaptic pathways, Autophagy was the predominant pathway diferentially regulated in the 3‑NPA model with implications for neuronal survival. This pathway was unique to 3‑NPA, as substantiated by in silico modelling of the three toxins. Morphological and biochemical validation of autophagy markers in the cell model of 3‑NPA revealed incomplete autophagy mediated by mechanistic Target of Rapamycin Complex 2 (mTORC2) pathway. Interestingly, Brain Derived Neurotrophic Factor
    [Show full text]
  • Using Long Nanopore Reads to Delineate Structural Variants (Svs)
    Using long nanopore reads to delineate structural variants (SVs) in the human genome SVs, including large deletions, duplications, inversions, translocations and copy-number changes are abundant in large genomes, and require long reads for precise characterisation Contact: [email protected] More information at: www.nanoporetech.com and publications.nanoporetech.com Unique Repeat Unique Repeat Unique a) b) a) b) sequence 1 1 sequence 2 2 sequence 3 1,000 60 Short reads Insertions Long A B C D E Reference chromosome 1 40 reads 800 Deletions > 50 bp Short-read assembly 20 Collapsed repeat consensus Unique contig 1 Long-read Bases sequenced (Mb) assembly 600 0 Unique contig 1 Unique contig 3 0 10 20 30 40 V W X Y Z Reference chromosome 2 Single, fully-resolved contig Count Read length (kb) c) > 50 bp 400 chr7 (q33) 7p21.3 15.321.1 15.3 7p14.3 7p14.1 13 11.2 11.21 11.22 11.23 7q21.11 q21.3 7q22.1 7q31.1 7q33 7q34 7q35 36.1 36.3 Scale 50 kb hg38 chr7: 134,550,000 134,600,000 134,650,000 134,700,000 Inversion A D C B E GENCODE v24 comprehensive transcript set (only Basic displayed by default) 200 AKR1B10 AKR1B15 BGPM CALD1 AKR1B15 BGPM Deletion BGPM A B C E AC009276.4 Duplication A B C C C D E 0 1,000 10,000 20,000 30,000 Translocation V W C D E + A B X Y Z Event size (bp) Adapted from Huddleston, J. et al. Discovery and genotyping of structural variation from long-read haploid genome sequence data.
    [Show full text]
  • BCL2L12 (NM 138639) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC221347 BCL2L12 (NM_138639) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: BCL2L12 (NM_138639) Human Tagged ORF Clone Tag: Myc-DDK Symbol: BCL2L12 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC221347 representing NM_138639 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGGACGGCCCGCTGGGCTGTTCCCGCCCCTATGCCCTTTTTTGGGTTTCCGGCCAGAGGCATGCTGGG AGCGTCACATGCAAATTGAGCGTGCACCCAGCGTTCCGCCCTTTCTACGCTGGGCCGGTTATCGACCCGG CCCAGTGCGCAGGCGCGGGAAAGTTGAACTAATAAAGTTTGTACGAGTTCAGTGGAGGAGACCGCAAGTT GAGTGGAGGAGGCGGCGGTGGGGCCCCGGACCAGGTGCCTCCATGGCAGGCTCTGAAGAGCTGGGGCTCC GGGAAGACACGCTGAGGGTCCTAGCTGCCTTCCTTAGGCGTGGTGAGGCTGCCGGGTCTCCTGTTCCAAC TCCACCTAGAAGCCCTGCCCAAGAAGAGCCAACAGACTTCCTGAGCCGCCTTCGAAGATGTCTTCCCTGC TCCCTGGGGCGAGGAGCAGCCCCCTCTGAGTCCCCTCGGCCTTGCTCTCTGCCCATCCGCCCCTGCTATG GTTTAGAGCCTGGCCCAGCTACTCCAGACTTCTATGCTTTGGTGGCCCAGCGGCTGGAACAGCTGGTCCA AGAGCAGCTGAAATCTCCGCCCAGCCCAGAATTACAGGGTCCCCCATCGACAGAGAAGGAAGCCATACTG CGGAGGCTGGTGGCCCTGCTGGAGGAGGAGGCAGAAGTCATTAACCAGAAGCTGGCCTCGGACCCCGCCC TGCGCAGCAAGCTGGTCCGCCTGTCCTCCGACTCTTTCGCCCGCCTGGTGGAGCTGTTCTGTAGCCGGGA TGACAGCTCTCGCCCAAGCCGAGCATGCCCCGGGCCCCCGCCTCCTTCCCCGGAGCCCCTGGCCCGCCTG GCCCTAGCCATGGAGCTGAGCCGGCGCGTGGCCGGGCTGGGGGGCACCCTGGCCGGACTCAGCGTGGAGC
    [Show full text]