Atlas Journal

Atlas of Genetics and Cytogenetics in Oncology and Haematology

Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal

Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS

Volume 13, Number 7, July 2009 Previous Issue / Next Issue Genes ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1) (9q34.1) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 757-766. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ABL.html BCL2L12 (BCL2-like 12 (proline-rich)) (19q13.3). Christos Kontos, Hellinida Thomadaki, Andreas Scorilas. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 767-771. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCL2L12ID773ch19q13.html BCR (Breakpoint cluster region) (22q11.2) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 772-779. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCR.html ENAH (enabled homolog (Drosophila)) (1q42.12). Paola Nisticò, Francesca Di Modugno. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 780-785. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ENAHID44148ch1q42.html FGFR2 (fibroblast growth factor receptor 2) (10q26.13). Masaru Katoh. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 786-799. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/FGFR2ID40570ch10q26.html MAPK6 (mitogen-activated protein kinase 6) (15q21.2). Sylvain Meloche. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 800-804. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MAPK6ID43349ch15q21.html MIRN125A (microRNA 125a) (19q13.33). Serkan Tuna, Ayse Elif Erson. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 805-808. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MIRN125AID44325ch19q13.html MIRN125B1 (microRNA 125b-1) (11q24.1). Serkan Tuna, Ayse Elif Erson. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 809-813. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MIRN125B1ID44326ch11q24.html MIRN125B2 (microRNA 125b-2) (21q21.1). Serkan Tuna, Ayse Elif Erson. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 814-818. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/MIRN125B2ID44327ch21q21.html RAC2 (ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein

Atlas Genet Cytogenet Oncol Haematol 2009; 7 I Rac2)) (22q13.1). Teresa Gómez del Pulgar, Juan Carlos Lacal. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 819-826. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/RAC2ID42021ch22q13.html SORBS2 (sorbin and SH3 domain containing 2) (4q35.1). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 827-832. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/SORBS2ID693ch4q35.html TIAM1 (T-cell lymphoma invasion and metastasis 1) (21q22.11). Michèle J Hoffmann, Rainer Engers. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 833-840. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/TIAM1ID42557ch21q22.html TNFRSF11B (tumor necrosis factor receptor superfamily, member 11b) (8q24.12). Maria Grazia Di Iasio, Federica Corallini, Paola Secchiero, Silvano Capitani. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 841-851. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/TNFRSF11BID42610ch8q24.html Leukaemias t(6;14)(q25-27;q32. Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 852-853. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0614q25q32ID1324.html t(8;11)(p12;p15). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 854. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0811p12p15ID1521.html t(8;12)(p12;q15). Jean-Loup Huret. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 855-856. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t0812p12q15ID1201.html t(14;15)(q32;q11-13). Silvia Rasi, Gianluca Gaidano. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 857-858. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/t1415q32q12ID1349.html Hepatosplenic T-cell lymphoma (HSTCL). Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 859-860. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/HepatoTlymphoID2099.html Intestinal T-cell lymphoma. Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 861-862. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Anomalies/IntestinalTlymphoID2101.html Solid Tumours Bone: Enchondroma. Twinkal C Pansuriya, Judith VMG Bovée. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 863-868. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Tumors/EnchondromaID5333.html Cancer Prone Diseases Enchondromatosis. Twinkal C Pansuriya, Judith VMG Bovée. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 869-872. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Kprones/EnchondromatosisID10151.html Familial platelet disorder with predisposition to acute myelogenous leukemia (FPD/AML). Paula G Heller.

Atlas Genet Cytogenet Oncol Haematol 2009; 7 II Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 873-878. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Kprones/FamPlateletDisAMLID10079.html Deep Insights The HLA-G non classical MHC class I molecule is expressed in cancer with poor prognosis. Implications in tumour escape from immune system and clinical applications. Catherine Menier, Nathalie Rouas-Freiss, Edgardo D Carosella. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 879-900. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Deep/HLAinCancerID20070.html Case Reports Educational Items

© Atlas of Genetics and Cytogenetics in Oncology and Haematology X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching

For comments and suggestions or contributions, please contact us [email protected].

Atlas Genet Cytogenet Oncol Haematol 2009; 7 III Atlas of Genetics and Cytogenetics in Oncology and Haematology

ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1)

Identity Other names ABL HGNC (Hugo) ABL1 Location 9q34.1 Location_base_pair Starts at 132700652 and ends at 132752879 bp from pter ( according to hg18- Mar_2006) [Mapping] Local_order CAN is more telomeric, TAN1 even more in 9q34.3. DNA/RNA

DNA diagram Description 12 exons; 230 kb. Transcription Alternate splicing: 1a and 1b are 5' alternative exons; mRNA of 6 and 7 kb (with 1a and 1b respectively), giving rise to 2 protein of 145 kDa. Protein

Protein diagram Description 1130-1143 amino acids; 4 domains: of which are SH (SRC homology) domains; NH2- term -- domain 1: SH3 (where can bind the binding protein BP1, to inhibit SH1 activation) and SH2 (with high affinity towards BCR first exon) -- domain 2: SH1 (with a self-phosphorylable tyrosine) -- 'domain' 3: nuclear localization domain (DNA binding, but not during mitosis) -- domain 4: actin binding (cytoskeleton) --COOH-term; note: 1b (but not the 1a alternative) myristylable allowing anchorage to the membrane. Normal ABL has a tri-dimensional structure which is tightly preserved in a closed, inactive conformation order to prevent oncogenic activation. The maintenance of this inactive conformation is possible by:  1- the "latching" of the myristilated NH2-terminal sequence which is directly linked to a myristilation recognition sequence on the c-lobe of the SH1 kinase domain;  2-The close contact between SH3 and SH2 domain  3- The interactions between SH3 domain and the C-lobe of the kinase domain. These interactions clamp the structure and prevent the kinase to switch to an active conformation, a process which requires the phosphorylation of Tyr 412 residue and the "unlatching" of the myristoyl group from the C-Lobe of the kinase domain. The attachment of proline-rich SH2 and SH3 ligands leads to the complete switch of the protein to an open, active conformation of the kinase. The NH2-terminal myristilation (autoregulatory role) is deleted during the t(9;22) translocation. Expression Ubiquitously expressed, c-ABL K/O phenotype is lethal. Localisation c-abl is localized to the nucleus, plasma membrane and actin cytoskeleton. Function c-ABL exhibit a permanent nuclear and cytoplasmic shuttling activity, driven by 3

Atlas Genet Cytogenet Oncol Haematol 2009; 6 757 nuclear localisation signals (NLS) and a single nuclear export signal (NES) close to the C-terminal region. Recent data suggest that nuclear and cytoplasmic ABL may have different functions.  1- Nuclear c-ABL plays a major role in the regulation of cell death after DNA damage. All DNA damage inducing agents activate nuclear c-ABL kinase in a ATM- dependent manner and in the presence of the p53-homolog p73 protein. The latter is physically associated with c-ABL after DNA damage through the SH3 domain of c-ABL. DNA damage also activates simultanously p53 pathway, leading to the activation of Rb which induces growth arrest and protects cells from apoptosis. The exacts mechanisms of apoptosis induced by c-ABL are unknown. The translocation of cytoplasmic c-ABL to the nucleus has been shown to be due to its release from 14-3-3 proteins to which c- ABL is associated in the cytoplasm. JNK-dependent phosphorylation of 14-3-3 upon an oxidative stress, allows this release process and translocation of c-ABL to the nucleus. The oncoprotein MUC has also been shown to block nuclear translocation of c-ABL after apoptotic stimuli.The nuclear entrapment of BCR-ABL has also been shown to induce apoptosis in leukemic cells.  2- Cytoplasmic c-ABL : possible function in adhesion signalling as an efflux of c-ABL from nucleus to the cytoplasm is found in fibroblasts after adhesion. Regulation: Experiments using purified c-abl in vitro allowed to elucidate the mechanism of c-abl regulation which is mediated by an intrinsic property of the molecule. This is the 80 amino-acid N terminal "cap" of the protein is able and sufficient its tyrosine kinase activity and the loss of this cap portion activates the oncogenic potential of c-abl. From the structural point of view, this inhibition is generated by the docking of the myristilated N-terminal of c-abl into the kinase domain. The current view is the fact that c-abl localized in the nucleus, plasma membrane and the actin cytoskeleton undergo different types of regulation. In the membrane-associated c-abl, the myristilated N- terminal end of membrane form can not interact with the kinase c-lobe and it has been suggested that phosphadytilinositol 4-5 bi-phosphate could play an inhibitory role. The autoregulatory mechanism remains functional in the cytoplasmic and nuclear form of c- abl. The latter is also negatively regulated by Rb in the G-phase of the cell cycle. Beside the structural auto-inhibition, several cellular proteins have been shown to inhibit c-ABL: Pag (or Peroxiredoxin-I), Rb and F(actin). Regulation of ABL could therefore be due to a dual mechanism, involving an autoinhibition in the presence of co- inhibitors, which can be active on normal ABL-kinase activity but inactive against increased TK activity of BCR-ABL proteins. Recent data suggest that pharmacological inhibition of endogenous ABL could lead to a genetic instability, potentially by inhibition of mismatch repair mechanisms. Long-term inhibition of c-ABL by TKI therapies could therefore be responsible of the occurrence of a mutator phenotypes. Activation of ABL can also be detected in solid malignant tumors (lung and breast). Similarly , it has been shown that tumor suppression induced by Ephrin receptor EphB4 requires the presence of an active ABL and phosphorylation of the downstream target CRK by ABL. Homology SRC homology; like SRC, ABL is one of the tyrosine kinases which are not membrane receptors. Implicated in Entity t(9;12)(q34;p12)/acute lymphoblastic leukemia (ALL) --> ETV6-ABL Disease Common ALL; yet poorly known. Hybrid/Mutated 5' ETV6/TEL from 12p12 - 3' ABL from 9q34. Gene Abnormal NH2-term Helix Loop Helix from ETV6(TEL) fused to Tyr Kinase from ABL COOH-term; Protein localised in the cytoskeleton. Oncogenesis Forms HLH-dependent oligomers, which may be critical for Tyr kinase activation; oncogenesis may be comparable to that induced by BCR/ABL. Entity t(9;22)(q34;q11)/chronic myelogenous leukemia (CML) --> BCR/ABL Disease All CML have a t(9;22), at least at the molecular level (BCR/ABL); phenotype and stem cell origin: multipotent progenitor: t(9;22) is found in all myeloid and B- lineage progenitors. Prognosis The prognosis of CML has changed radically over the last 10 years, due to the

Atlas Genet Cytogenet Oncol Haematol 2009; 6 758 development of novel drugs able to target the enhanced tyrosine kinase activity of BCR- ABL. The first of these therapies is Imatinib Mesylate (Gleevec) which has become the first line therapy for all patients with CML (See CML). In the first cohort trial of patients treated with Imatinib mesylate, the rates of complete cytogenetics responses (CCR) were exceptionally high (82 %) as compared to standard IFN-alpha - ARA-C therapy. At the most recent 6-year update, the overall survival is 90 % and most interestingly, the rates of progression towards more aggressive phases have been found to be progressively decreasing in all patients with major molecular responses (MMR). (For definition of MMR see CML). In IM-resistant or relapsing Ph1+ CML patients, second generation tyrosine kinase inhibitor (TKI) therapies such as Dasatinib (a dual SRC and ABL inhibitor) and Nilotinib have also recently become available. Cytogenetics Anomalies additional to the t(9;22) may be found either at diagnosis or during course of the disease, or at the time of acute transformation; mainly: +der(22), +8, i(17q), +19; +21, -Y, -7, -17, +17; variant translocations: t(9;22;V) and apparent t(V;22) or t(9;V), where V is a variable chromosome, karyotypes with apparently normal chromosomes 9 and 22, may be found.

Probe 1132H12 on a case of CML with t(9/22). Note the splitting of the probe, evident also on interphase nuclei - Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics Hybrid/Mutated see below Gene Abnormal see below Protein Oncogenesis see below Entity t(9;22)(q34;q11)/ALL --> BCR/ABL Disease Most often CD 10+ B-ALL; frequent CNS involvement. Prognosis The prognosis of Ph1+ ALL has changed since the introduction of tyrosine-kinase inhibitor therapies, especially imatinib mesylate which is currently used as a first line therapy associated with either high dose chemotherapy or classical ALL-type induction (steroids+ vincristine) and maintenance. Allogeneic stem cell transplantation is indicated in Ph1+ ALL patients relapsing after Imatinib-based regimens. In IM-resistant or relapsing Ph1+ ALL patients, second generation tyrosine kinase inhibitor (TKI) therapies such as Dasatinib (a dual SRC and ABL inhibitor) and Nilotinib have also recently become available. Cytogenetics The chromosome anomaly t(9;22) disappear during remission, in contrast with BC-CML cases (CML in blast crisis); additional anomalies: +der(22), -7, del(7q) most often, +8, but not an i(17q), in contrast with CML and AML cases; complex karyotypes, often hyperploid; variants and complex translocations may be found as in CML. Hybrid/Mutated see below. In Both CML and Ph1+ ALL, detection and quantification of p210 BCR-ABL Gene and p190 BCR-ABL have become the cornerstones of monitoring targeted therapies. Abnormal see below Protein Oncogenesis see below Entity t(9;22)(q34;q11)/acute myeloid leukemia (AML) --> BCR/ABL Disease AML mostly M1 or M2 AML. Prognosis High rates of hematologic , cytogenetic and molecular responses have been reported in de novo PH1+ AML, which is a rare entity. Cytogenetics The chromosome anomaly t(9;22) disappear during remission, in contrast with BC-CML cases (CML in blast crisis); additional anomalies: similar to what is found in CML.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 759 Hybrid/Mutated see below Gene Abnormal see below Protein Oncogenesis see below Hybrid/Mutated BCR/ABL the crucial event lies on der(22), id est 5' BCR - 3' ABL hybrid gene is the Gene crucial one, while ABL/BCR may or may not be expressed; breakpoint in ABL is variable over a region of 200 kb, often between the two alternative exons 1b and 1a, sometimes 5' of 1b or 3' of 1a, but always 5' of exon 2; breakpoint in BCR is either:  1- in a region called M-bcr (for major breakpoint cluster region), a cluster of 5.8 kb, between exons 12 and 16, also called b1 to b5 of M-bcr; most breakpoints being either between b2 and b3, or between b3 and b4; transcript is 8.5 kb long; this results in a 210 KDa chimeric protein (P210); this is found in (most cases of) CML, and in half cases of ALL or AML.  2- in a 35 kb region between exons 1 and 2, called m-bcr (minor breakpoint cluster region), -> 7 kb mRNA, resulting in a 190 KDa protein (P190); this is found in half of the cases of ALL or AML.  3- A breakpoint in the exon 19 of BCR (designed as micro-bcr) with fusion to abl sequences (a2) has been in neutrophilic CML, with presence of a larger protein (P230). Abnormal BCR/ABL P210 comprises the first 902 or 927 amino acids from BCR, P190 only the Protein 427 N-term from BCR; BCR/ABL has a cytoplasmic localization, in contrast with ABL, mostly nuclear. Oncogenesis BCR/ABL has a cytoplasmic localization role and all three BCR-ABL fusion proteins have been shown to exhibit oncogenic potential. All three hybrid proteins have increased protein kinase activity compared to ABL: 3BP1 (binding protein) binds normal ABL on SH3 domain,which prevents SH1 activation; with BCR/ABL, the first (N- terminal) exon of BCR binds to SH2, hidding SH3 which, as a consequence, cannot be bound to 3BP1; thereof, SH1 is activated; oncogenesis 1- proliferation is induced through activation by BCR/ABL of RAS signal transduction pathway, PI3-K (phosphatidyl inositol 3' kinase) pathway, and MYC; 2- BCR/ABL inhibits apoptosis (via activation of STAT5 and BclXL) 3- BCR/ABL provokes cell adhesive abnormalities (via CRK-L, FAK) as well as abnormalities of cell migration (via CXCR-4 whose expression is downregulated in CML cells expressing high levels of BCR-ABL). In experimental settings CD44 has been shown to play a major role in homing of BCR- ABL expressing cells. 4- BCR-ABL induces a major genetic instability: Molecular pathways involved in this phenomenon have recently been elucidated (See BCR-ABL). 5-BCR-ABL and endogenous ABL have been shown to be the target of miR 203 which is heavily methylated in CML cell lines expressing BCR-ABL. Restoration of miR 203 expression leads to reduction of BCR-ABL levels, suggesting a potential use of this strategy for therapeutic purposes. Breakpoints

Atlas Genet Cytogenet Oncol Haematol 2009; 6 760

External links Nomenclature HGNC (Hugo) ABL1 76 Entrez_Gene (NCBI) ABL1 25 c-abl oncogene 1, receptor tyrosine kinase Cards Atlas ABL GeneCards ABL1 (Weizmann) Ensembl (Hinxton) ENSG00000097007 [Gene_View] ABL1 [Vega] AceView (NCBI) ABL1 Genatlas (Paris) ABL1 euGene (Indiana) 25 SOURCE (Stanford) NM_005157 NM_007313 Genomic and cartography ABL1 - 9q34.1 chr9:132700652-132752879 + 9q34.1 [Description] (hg18- GoldenPath (UCSC) Mar_2006) Ensembl ABL1 - 9q34.1 [CytoView] Mapping of ABL1 [Mapview] homologs : NCBI OMIM 189980 Gene and transcription Gene : Genbank AA524892 AB209456 AB209642 AF113911 AJ131466 (Entrez) Reference sequence (RefSeq NM_005157 NM_007313 transcript) :SRS Reference transcript : NM_005157 NM_007313 Entrez RefSeq genomic : AC_000052 AC_000141 NC_000009 NT_035014 NW_001839240 NW_924573 SRS

Atlas Genet Cytogenet Oncol Haematol 2009; 6 761 RefSeq genomic : AC_000052 AC_000141 NC_000009 NT_035014 NW_001839240 NW_924573 Entrez Consensus coding sequences : CCDS ABL1 NCBI Cluster EST : Unigene Hs.431048 [ SRS ] Hs.431048 [ NCBI ] Alternative Splicing : 16214 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : P00519 (SRS) P00519 (Expasy) P00519 (Uniprot) UniProt/SwissProt With graphics : P00519 InterPro Splice isoforms : P00519(VarSplice FASTA) VarSplice FASTA Domaine pattern : PROTEIN_KINASE_ATP (PS00107) PROTEIN_KINASE_DOM (PS50011) Prosite (SRS) PROTEIN_KINASE_TYR (PS00109) SH2 (PS50001) SH3 (PS50002) Domain pattern : PROTEIN_KINASE_ATP (PS00107) PROTEIN_KINASE_DOM (PS50011) Prosite (Expaxy) PROTEIN_KINASE_TYR (PS00109) SH2 (PS50001) SH3 (PS50002) Domains : Interpro F_actin_bd Prot_kinase_core Protein_kinase_ATP_bd_CS SH2 SH3 (SRS) Tyr_pkinase Tyr_pkinase_AS Domains : Interpro F_actin_bd Prot_kinase_core Protein_kinase_ATP_bd_CS SH2 SH3 (EBI) Tyr_pkinase Tyr_pkinase_AS Related proteins : P00519 CluSTr Domain families : F_actin_bind (PF08919) Pkinase_Tyr (PF07714) SH2 (PF00017) SH3_1 Pfam SRS (PF00018) Domain families : F_actin_bind (PF08919) Pkinase_Tyr (PF07714) SH2 (PF00017) SH3_1 Pfam Sanger (PF00018) Domain families : pfam08919 pfam07714 pfam00017 pfam00018 Pfam NCBI Domain families : FABD (SM00808)SH2 (SM00252)SH3 (SM00326)TyrKc (SM00219) Smart EMBL Domain structure : Prot_kinase (PD000001) (PD000001) (PD000001) Prodom (Prabi Lyon) Blocks (Seattle) P00519 1AB2 1ABL 1AWO 1BBZ 1JU5 1OPL 1ZZP 2ABL 2E2B Crystal structure of 2F4J 2FO0 2G1T 2G2F 2G2H 2G2I 2GQG 2HIW 2HYY protein : PDB SRS 2HZ0 2HZ4 2HZI 2O88 2V7A 3CS9 1AB2 1ABL 1AWO 1BBZ 1JU5 1OPL 1ZZP 2ABL 2E2B Crystal structure of 2F4J 2FO0 2G1T 2G2F 2G2H 2G2I 2GQG 2HIW 2HYY protein : PDBSum 2HZ0 2HZ4 2HZI 2O88 2V7A 3CS9 1AB2 1ABL 1AWO 1BBZ 1JU5 1OPL 1ZZP 2ABL 2E2B Crystal structure of 2F4J 2FO0 2G1T 2G2F 2G2H 2G2I 2GQG 2HIW 2HYY protein : IMB 2HZ0 2HZ4 2HZI 2O88 2V7A 3CS9 1AB2 1ABL 1AWO 1BBZ 1JU5 1OPL 1ZZP 2ABL 2E2B Crystal structure of 2F4J 2FO0 2G1T 2G2F 2G2H 2G2I 2GQG 2HIW 2HYY protein : PDB RSDB 2HZ0 2HZ4 2HZI 2O88 2V7A 3CS9 HPRD 01809 Protein Interaction databases DIP (DOE-UCLA) P00519 IntAct (EBI) P00519 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : ABL1 dbSNP NCBI

Atlas Genet Cytogenet Oncol Haematol 2009; 6 762 SNP : GeneSNP Utah ABL1 SNP : HGBase ABL1 Genetic variants : ABL1 HAPMAP Somatic Mutations in ABL1 Cancer : COSMIC Translocation Breakpoints in Cancer ABL1 : TICdb Mutations and ABL1 Diseases : HGMD Hereditary diseases : 189980 OMIM Hereditary diseases : 189980 GENETests Diseases : Genetic ABL1 Association General knowledge Homologs : ABL1 HomoloGene Homology/Alignments : Family Browser ABL1 UCSC Phylogenetic Trees/Animal Genes : ABL1 TreeFam Catalytic activity : 2.7.10.2 [ Enzyme-Expasy ] 2.7.10.2 [ Enzyme-SRS ] 2.7.10.2 [ IntEnz- Enzyme EBI ] 2.7.10.2 [ BRENDA ] 2.7.10.2 [ KEGG ] Chemical/Protein 25 Interactions : CTD regulation of transcription during S-phase of mitotic cell cycle nucleotide binding magnesium ion binding DNA binding non-membrane spanning protein tyrosine kinase activity ATP binding nucleus nucleolus cytoplasm cytoskeleton mismatch Keywords Ontology : repair regulation of transcription, DNA-dependent protein modification AmiGO process cell adhesion protein C-terminus binding DNA damage response, signal transduction resulting in induction of apoptosis transferase activity peptidyl-tyrosine phosphorylation actin cytoskeleton organization manganese ion binding positive regulation of oxidoreductase activity regulation of transcription during S-phase of mitotic cell cycle nucleotide binding magnesium ion binding DNA binding non-membrane spanning protein tyrosine kinase activity ATP binding nucleus nucleolus cytoplasm cytoskeleton mismatch Keywords Ontology : repair regulation of transcription, DNA-dependent protein modification EGO-EBI process cell adhesion protein C-terminus binding DNA damage response, signal transduction resulting in induction of apoptosis transferase activity peptidyl-tyrosine phosphorylation actin cytoskeleton organization manganese ion binding positive regulation of oxidoreductase activity Pathways : KEGG Cell cycle Axon guidance Other databases Probes Probes : Imagenes ABL1 Related clones (RZPD - Berlin) Literature PubMed 336 Pubmed reference(s) in Entrez PubGene ABL1

Atlas Genet Cytogenet Oncol Haematol 2009; 6 763 Bibliography The molecular biology of chronic myeloid leukemia. Deininger MW, Goldman JM, Melo JV. Blood. 2000 Nov 15;96(10):3343-56. PMID 11071626

Regulation of cell death by the Abl tyrosine kinase. Wang JY. Oncogene. 2000 Nov 20;19(49):5643-50. PMID 11114745

BCR-ABL suppresses C/EBPalpha expression through inhibitory action of hnRNP E2. Perrotti D, Cesi V, Trotta R, Guerzoni C, Santilli G, Campbell K, Iervolino A, Condorelli F, Gambacorti- Passerini C, Caligiuri MA, Calabretta B. Nat Genet. 2002 Jan;30(1):48-58. Epub 2001 Dec 20. PMID 11753385

Autoinhibition of c-Abl. Pluk H, Dorey K, Superti-Furga G. Cell. 2002 Jan 25;108(2):247-59. PMID 11832214

Structural basis for the autoinhibition of c-Abl tyrosine kinase. Nagar B, Hantschel O, Young MA, Scheffzek K, Veach D, Bornmann W, Clarkson B, Superti-Furga G, Kuriyan J. Cell. 2003 Mar 21;112(6):859-71. PMID 12654251 c-Abl regulation: a tail of two lipids. Van Etten RA. Curr Biol. 2003 Aug 5;13(15):R608-10. PMID 12906815

The biology of CML blast crisis. Calabretta B, Perrotti D. Blood. 2004 Jun 1;103(11):4010-22. Epub 2004 Feb 24. PMID 14982876

Abl-dependent tyrosine phosphorylation of Sos-1 mediates growth-factor-induced Rac activation. Sini P, Cannas A, Koleske AJ, Di Fiore PP, Scita G. Nat Cell Biol. 2004 Mar;6(3):268-74. Epub 2004 Feb 22. PMID 15039778

Controlling Abl: auto-inhibition and co-inhibition? Wang JY. Nat Cell Biol. 2004 Jan;6(1):3-7. PMID 14704671

The BCR-ABL story: bench to bedside and back. Wong S, Witte ON. Annu Rev Immunol. 2004;22:247-306. PMID 15032571 p210BCR-ABL inhibits SDF-1 chemotactic response via alteration of CXCR4 signaling and down-regulation of CXCR4 expression. Geay JF, Buet D, Zhang Y, Foudi A, Jarrier P, Berthebaud M, Turhan AG, Vainchenker W, Louache F. Cancer Res. 2005 Apr 1;65(7):2676-83. PMID 15805265

Atlas Genet Cytogenet Oncol Haematol 2009; 6 764 JNK phosphorylation of 14-3-3 proteins regulates nuclear targeting of c-Abl in the apoptotic response to DNA damage. Yoshida K, Yamaguchi T, Natsume T, Kufe D, Miki Y. Nat Cell Biol. 2005 Mar;7(3):278-85. PMID 15696159

Requirement for CD44 in homing and engraftment of BCR-ABL-expressing leukemic stem cells. Krause DS, Lazarides K, von Andrian UH, Van Etten RA. Nat Med. 2006 Oct;12(10):1175-80. Epub 2006 Sep 24. PMID 16998483

The EphB4 receptor suppresses breast cancer cell tumorigenicity through an Abl-Crk pathway. Noren NK, Foos G, Hauser CA, Pasquale EB. Nat Cell Biol. 2006 Aug;8(8):815-25. Epub 2006 Jul 23. PMID 16862147

MUC1 oncoprotein blocks nuclear targeting of c-Abl in the apoptotic response to DNA damage. Raina D, Ahmad R, Kumar S, Ren J, Yoshida K, Kharbanda S, Kufe D. EMBO J. 2006 Aug 23;25(16):3774-83. Epub 2006 Aug 3. PMID 16888623

Genetic and epigenetic silencing of microRNA-203 enhances ABL1 and BCR-ABL1 oncogene expression. Bueno MJ, Perez de Castro I, Gomez de Cedron M, Santos J, Calin GA, Cigudosa JC, Croce CM, Fernandez-Piqueras J, Malumbres M. Cancer Cell. 2008 Jun;13(6):496-506. PMID 18538733

Activated c-Abl tyrosine kinase in malignant solid tumors. Lin J, Arlinghaus R. Oncogene. 2008 Jul 24;27(32):4385-91. Epub 2008 Apr 7. PMID 18391983

Role of c-Abl kinase in DNA mismatch repair-dependent G2 cell cycle checkpoint arrest responses. Wagner MW, Li LS, Morales JC, Galindo CL, Garner HR, Bornmann WG, Boothman DA. J Biol Chem. 2008 Aug 1;283(31):21382-93. Epub 2008 May 14. PMID 18480061

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Atlas Genet Cytogenet Oncol Haematol 2009; 6 765 URL : http://AtlasGeneticsOncology.org/Genes/ABL.html Turhan AG . ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1). Atlas Genet Cytogenet Oncol Haematol. April 2001 . URL : http://AtlasGeneticsOncology.org/Genes/ABL.html Turhan AG . ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/ABL.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 766 Atlas of Genetics and Cytogenetics in Oncology and Haematology

BCL2L12 (BCL2-like 12 (proline-rich))

Identity Other names BPR MGC120313 MGC120314 MGC120315 HGNC (Hugo) BCL2L12 Location 19q13.3 Location_base_pair Starts at 54860211 and ends at 54868985 bp from pter ( according to hg18- Mar_2006) [Mapping] Local_order Telomere to centromere. DNA/RNA Description Spanning 8.8 kb of genomic DNA, the BCL2L12 gene consists of 6 introns and 7 exons. Transcription The BCL2L12 gene has three splice variants with differences in exon 3. The predominant form is 1855 bp and encodes the full-length protein. The second splice variant lacks exon 3, which consists of 143 bp, thus resulting in no ORF. The third splice variant lacks 3 bp at the beginning of exon 3 and encodes a protein having one amino acid residue less than the full-lengh protein. Pseudogene Not identified so far. Protein Description The BCL2L12 protein is composed of 334 amino acids, with a calculated molecular mass of 36.8 kDa and an isoelectric point of 9.45. The BCL2L12 protein contains one BH2 and one putative BH3 domain, one proline-rich region similar to the TC21 protein, and five consensus PXXP tetrapeptide sequences. BCL2L12 protein also includes various putative posttranslational modification sites. There are numerous potential sites for O-glycosylation. Furthermore, several possible sites of phosphorylation have been identified for cAMP-dependent protein kinase, protein kinase C, and casein kinase 2. In addition, several N-myristoylation sites have been predicted. The BCL2L12 protein was found to have proline-rich sites. One PPPP site as well as five PP amino acid sites are present in this protein. Eight putative PXXP motifs were also identified. Proline-rich motifs are characterized by the presence of the consensus PXXP tetrapeptide, found in all proline-rich proteins identified to date. It is known that SH3 domains recognize proline-rich sequences and that all known SH3- binding proteins contain proline-rich regions with at least one PXXP motif. Proline-rich domains have been identified in a number of diverse proteins such as epidermal growth factors, phosphatidylinositol 3-kinase, and, more recently, the small GTPase RRAS protein and members of the RRAS superfamily such as the TC21 protein. Moreover, the amino acid loop (PPSPEP) at positions 271-276 of the BCL2L12 protein is identical with the PXXP motif present in the RRAS and TC21 oncogenes. This motif is required for integrin activation. The splice variant BCL2L12-A is expected to encode a truncated protein of 176 amino acids with five PP proline sites, two putative PXXP motifs, and no BH2 homology domain. Expression High levels of BCL2L12 expression are typically found in glandular epithelia in various organs, such as gastrointestinal tract and/or breast. Lower BCL2L12 protein expression has been found in prostate tissue. Function BCL2L12 is involved in apoptosis. However, its proapoptotic or antiapoptotic role in different types of cells and conditions remains unclear. Homology Human BCL2L12 shares 98% and 96% identity with chimpanzee and Rhesus monkey Bcl2l12, respectively, and 83% identity with rat/mouse Bc2l12 as well. Mutations

Atlas Genet Cytogenet Oncol Haematol 2009; 6 767 Note No germinal or somatic mutations are identified to be associated with cancer so far. Implicated in Entity Human Leukemias, Solid Tumors. Note Significant alterations of BCL2L12 mRNA expression have been noticed in HL-60 leukemia cells as well as in MCF7 breast cancer cells, after treatment with various antineoplastic agents including cisplatin, carboplatin, doxorubicin, methotrexate, and etoposide. These important modulations of BCL2L12 mRNA levels seem to depend on both the apoptotic inducer and the specific apoptotic pathway, implying a strong relationship between alterations in BCL2L12 mRNA levels and apoptosis. Expression analysis of the BCL2L12 gene has showed that BCL2L12 mRNA expression may be considered as a new prognostic marker for breast cancer, as breast tumours of lower stage or grade are more often BCL2L12-positive. Moreover, breast cancer patients with BCL2L12 mRNA expression are less likely to relapse or die, in comparison with BCL2L12-negative patients. Regarding BCL2L12 gene expression in colon cancer, the BCL2L12-A transcript is overexpressed in cancer tissues as compared to their normal mucosa counterparts. BCL2L12-A mRNA expression is also associated with colon cancer progression, since it is usually greater in patients being at the initial stages of the disease or having negative nodal status. BCL2L12 were found also to inhibits post-mitochondrial apoptosis signaling in glioblastoma. Cytogenetics No cytogenetic abnormalities are identified so far. Hybrid/Mutated Not identified so far. Gene External links Nomenclature HGNC (Hugo) BCL2L12 13787 Entrez_Gene (NCBI) BCL2L12 83596 BCL2-like 12 (proline rich) Cards Atlas BCL2L12ID773ch19q13 GeneCards BCL2L12 (Weizmann) Ensembl (Hinxton) ENSG00000126453 [Gene_View] BCL2L12 [Vega] AceView (NCBI) BCL2L12 Genatlas (Paris) BCL2L12 euGene (Indiana) 83596 SOURCE (Stanford) NM_001040668 NM_138639 Genomic and cartography BCL2L12 - 19q13.3 chr19:54860211-54868985 + 19q13.3 [Description] GoldenPath (UCSC) (hg18-Mar_2006) Ensembl BCL2L12 - 19q13.3 [CytoView] Mapping of BCL2L12 [Mapview] homologs : NCBI OMIM 610837 Gene and transcription Gene : Genbank BC007724 BC104004 BC104005 BC104006 (Entrez) Reference sequence (RefSeq NM_001040668 NM_138639 transcript) :SRS Reference transcript : NM_001040668 NM_138639 Entrez RefSeq genomic : AC_000062 AC_000151 NC_000019 NT_011109 NW_001838497 NW_927240 SRS RefSeq genomic : AC_000062 AC_000151 NC_000019 NT_011109 NW_001838497 NW_927240 Entrez Consensus coding BCL2L12

Atlas Genet Cytogenet Oncol Haematol 2009; 6 768 sequences : CCDS NCBI Cluster EST : Unigene Hs.289052 [ SRS ] Hs.289052 [ NCBI ] Alternative Splicing : 14338 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : Q9HB09 (SRS) Q9HB09 (Expasy) Q9HB09 (Uniprot) UniProt/SwissProt With graphics : Q9HB09 InterPro Splice isoforms : Q9HB09(VarSplice FASTA) VarSplice FASTA Domaine pattern : BH2 (PS01258) Prosite (SRS) Domain pattern : BH2 (PS01258) Prosite (Expaxy) Domains : Interpro Bcl2_BH (SRS) Domains : Interpro Bcl2_BH (EBI) Related proteins : Q9HB09 CluSTr Blocks (Seattle) Q9HB09 HPRD 16543 Protein Interaction databases DIP (DOE-UCLA) Q9HB09 IntAct (EBI) Q9HB09 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : BCL2L12 dbSNP NCBI SNP : GeneSNP Utah BCL2L12 SNP : HGBase BCL2L12 Genetic variants : BCL2L12 HAPMAP Somatic Mutations in BCL2L12 Cancer : COSMIC Mutations and BCL2L12 Diseases : HGMD Hereditary diseases : 610837 OMIM Hereditary diseases : 610837 GENETests Diseases : Genetic BCL2L12 Association General knowledge Homologs : BCL2L12 HomoloGene Homology/Alignments : Family Browser BCL2L12 UCSC Phylogenetic Trees/Animal Genes : BCL2L12 TreeFam Chemical/Protein 83596 Interactions : CTD

Atlas Genet Cytogenet Oncol Haematol 2009; 6 769 Keywords Ontology : apoptosis AmiGO Keywords Ontology : apoptosis EGO-EBI Other databases Probes Probes : Imagenes BCL2L12 Related clones (RZPD - Berlin) Literature PubMed 11 Pubmed reference(s) in Entrez PubGene BCL2L12 Bibliography Molecular cloning, physical mapping, and expression analysis of a novel gene, BCL2L12, encoding a proline-rich protein with a highly conserved BH2 domain of the Bcl-2 family. Scorilas A, Kyriakopoulou L, Yousef GM, Ashworth LK, Kwamie A, Diamandis EP. Genomics 2001; 72: 217-221. PMID 11401436

Cisplatin-induced apoptosis in HL-60 human promyelocytic leukemia cells: differential expression of BCL2 and novel apoptosis-related gene BCL2L12. Floros KV, Thomadaki H, Lallas G, Katsaros N, Talieri M, Scorilas A. Ann N Y Acad Sci 2003; 1010: 153-158. PMID 15033711

Expression of BCL2L12, a new member of apoptosis-related genes, in breast tumors. Talieri M, Diamandis EP, Katsaros N, Gourgiotis D, Scorilas A. Thromb Haemost 2003; 89: 1081-1088. PMID 12783122 mRNA expression analysis of a variety of apoptosis-related genes, including the novel gene of the BCL2-family, BCL2L12, in HL-60 leukemia cells after treatment with carboplatin and doxorubicin. Floros KV, Thomadaki H, Katsaros N, Talieri M, Scorilas A. Biol Chem 2004; 385: 1099-1103. PMID 15576332

Expression analysis of BCL2L12, a new member of apoptosis-related genes, in colon cancer. Mathioudaki K, Scorilas A, Papadokostopoulou A, Xynopoulos D, Arnogianaki N, Agnanti N, Talieri M. Biol Chem 2004; 385: 779-783. PMID 15493871

Topotecan and methotrexate alter expression of the apoptosis-related genes BCL2, FAS and BCL2L12 in leukemic HL-60 cells. Floros KV, Talieri M, Scorilas A. Biol Chem 2006; 387: 1629-1633. PMID 17132110

Alterations in mRNA expression of apoptosis-related genes BCL2, BAX, FAS, caspase-3, and the novel member BCL2L12 after treatment of human leukemic cell line HL60 with the antineoplastic agent etoposide. Floros KV, Thomadaki H, Florou D, Talieri M, Scorilas A. Ann N Y Acad Sci 2006; 1090: 89-97. PMID 17384250

BCL2 family of apoptosis-related genes: functions and clinical implications in cancer. Thomadaki H, Scorilas A. Crit Rev Clin Lab Sci 2006; 43: 1-67. (REVIEW) PMID 16531274

Treatment of MCF-7 cells with taxol and etoposide induces distinct alterations in the

Atlas Genet Cytogenet Oncol Haematol 2009; 6 770 expression of apoptosis-related genes BCL2, BCL2L12, BAX, CASPASE-9 and FAS. Thomadaki H, Talieri M, Scorilas A. Biol Chem 2006; 387: 1081-1086. PMID 16895478

BCL2L12 inhibits post-mitochondrial apoptosis signaling in glioblastoma. Stegh AH, Kim H, Bachoo RM, Forloney KL, Zhang J, Schulze H, Park K, Hannon GJ, Yuan J, Louis DN, DePinho RA, Chin L. Genes Dev. 2007 Jan 1;21(1):98-111. PMID 17210792

Breast cancer cells response to the antineoplastic agent's cisplatin, carboplatin, and doxorubicin at the mRNA expression levels of distinct apoptosis-related genes, including the new member, BCL2L12. Thomadaki H, Scorilas A. Ann N Y Acad Sci 2007; 1095: 35-44. PMID 17404015

Prognostic value of the apoptosis related genes BCL2 and BCL2L12 in breast cancer. Thomadaki H, Talieri M, Scorilas A. Cancer Lett 2007; 247: 48-55. PMID 16647810

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Christos Kontos, Hellinida Thomadaki, Andreas Scorilas Department of Biochemistry and Molecular Biology, Faculty of Biology, University of Athens. 157 01, Panepistimiopolis, Athens, Greece Citation This paper should be referenced as such : Kontos C, Thomadaki H, Scorilas A . BCL2L12 (BCL2-like 12 (proline-rich)). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/BCL2L12ID773ch19q13.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 771 Atlas of Genetics and Cytogenetics in Oncology and Haematology

BCR (Breakpoint cluster region)

Identity Other names BCR1 PHL (Philadelphie) HGNC (Hugo) BCR Location 22q11.2 Location_base_pair Starts at 21852552 and ends at 21990224 bp from pter ( according to hg18- Mar_2006) [Mapping] Local_order Distal to IGL in 22q11.1, proximal to EWS and NF2, both in 22q12.

Map of the BCR region; - Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics. Laboratories willing to validate the probes are wellcome: contact M Rocchi . DNA/RNA

DNA Diagram Description About 23 exons; 130 kb; 5' centromere - 3' telomere orientation. Transcription Into various mRNA, of which are 4.5 kb and 7 kb. Protein Description 130 KDa, 190 KDa; mainly 160 KDa (1271 amino acids); N-term ATP binding/Serine- Threonine kinase domain, SH2 binding, GTP/GDP exchange domain, and C-term domain which functions as a GTPase activating protein for p21rac. Expression Ubiquitously expressed, with highest expression in brain and hematopoietic tissue. Localisation Cytoplasmic. Function Protein (serine/threonine) kinase; includes major signalisation domains such as:  Oligomerization domain, responsible of homotetramerization of BCR-ABL molecule and necessary for its transforming potential;  Serine threonine kinase domain, including at least three SH2 binding sites; able to interact with proteins with SH2 domains: These sites include TYR177, necessary for binding of Grb2 and activation of RAS pathway and beta-isoform of 14-3-3 proteins;  GEF domain, in which lie the binding activity to the xeroderma pigmentosum protein,

Atlas Genet Cytogenet Oncol Haematol 2009; 6 772 involved in DNA repair;  A COOH-terminal RAC-GAP domain which does not participate to hybrid BCR-ABL proteins. From the functional point of view, the role of bcr has been studies in bcr-null mice which shows an increased respiratory burst suggesting the involvement of bcr protein in the regulation of superoxide production , probably via RAC. In the context of CML, the role of bcr protein has been studies in in vitro and in vivo models; bcr gene has been shown to be a negative regulator of BCR-ABL. Its reduced expression increases the transforming potential of BCR-ABL. When overexpressed, bcr blocks BCR-ABL-mediated transformation in experimental mouse models. Serine 354 is required for the inhibitory function of bcr over BCR-ABL, as kinase mutants of bcr overexpressed in BCR-ABL expressing cells induce an increased tumorigenicity. Homology Drosophila rotund protein; other guanine-nucleotide releasing factors of the CDC24 family. Implicated in Entity t(9;22)(q34;q11)/chronic myelogenous leukemia (CML) --> BCR / ABL Disease All CML have a t(9;22), at least at the molecular level (BCR/ABL); phenotype and stem cell origin: multipotent progenitor: t(9;22) is found in all myeloid and B- lineage progenitors. Prognosis The prognosis of CML has changed radically over the last 10 years, due to the development of novel drugs able to target the enhanced tyrosine kinase activity of BCR-ABL. The first of these therapies is Imatinib Mesylate (Gleevec) which has become the first line therapy for all patients with CML (See ABL and CML). In the first cohort trial of patients treated with Imatinib mesylate, the rates of complete cytogenetics responses (CCR) were exceptionally high (82 %) as compared to standard IFN-alpha - ARA-C therapy. At the most recent 6-year update, the overall survival is 90 % and most interestingly, the rates of progression towards more aggressive phases have been found to be progressively decreasing in all patients with major molecular responses (MMR). (For definition of MMR see CML). In IM-resistant or relapsing Ph1+ CML patients, second generation tyrosine kinase inhibitor (TKI) therapies such as Dasatinib (a dual SRC and ABL inhibitor) and Nilotinib have also recently become available. Cytogenetics Anomalies additional to the t(9;22) may be found either at diagnosis or during course of the disease, or at the time of acute transformation; mainly: +der(22), +8, i(17q), +19; +21, -Y, -7, -17,+17; variant translocations: t(9;22;V) and apparent t(V;22) or t(9;V), where V is a variable chromosome, karyotypes with apparently normal chromosomes 9 and 22, may be found. Deletion of the derivative chromosome 9: Detected at diagnosis (in 10% of patients), probably indiacting a genetic instability phenotype, this finding has been associated to the more aggressive behavior of the disease, a poor prognostic factor potentially reversed by the use of imatinib mesylate.

72M14 on a case of CML with t(9/22). Note that the probe remains on der(22) (Ph) - Courtesy Mariano Rocchi, Resources for Molecular Cytogenetics .

Atlas Genet Cytogenet Oncol Haematol 2009; 6 773 Hybrid/Mutated see below Gene Abnormal see below Protein Oncogenesis see below Entity t(9;22)(q34;q11)/acute lymphoblastic leukeùia (ALL) --> BCR / ABL Disease Most often CD 10+ B-ALL; frequent CNS involvement. Prognosis The prognosis of Ph1+ ALL has changed since the introduction of tyrosine-kinase inhibitor therapies, especially imatinib mesylate which is currently used as a first line therapy associated with either high dose chemotherapy or classical ALL-type induction (steroids+ vincristine) and maintenance. Allogeneic stem cell transplantation is indicated in Ph1+ ALL patients relapsing after Imatinib-based regimens. In IM-resistant or relapsing Ph1+ ALL patients, second generation tyrosine kinase inhibitor (TKI) therapies such as Dasatinib (a dual SRC and ABL inhibitor) and Nilotinib have also recently become available. Cytogenetics The chromosome anomaly t(9;22) disappear during remission, in contrast with BC- CML cases (CML in blast crisis); additional anomalies: +der(22), -7, del(7q) most often, +8, but not an i(17q), in contrast with CML and AML cases; complex karyotypes, often hyperploid; variants and complex translocations may be found as in CML. Hybrid/Mutated see below. In Both CML and Ph1+ ALL, detection and quantification of p210 BCR-ABL Gene and p190 BCR-ABL have become the cornerstones of monitoring targeted therapies. Abnormal see below Protein Oncogenesis see below Entity t(9;22)(q34;q11)/acute myeloid leukemia (AML) --> BCR / ABL Disease AML mostly M1 or M2 AML Prognosis High rates of hematologic , cytogenetic and molecular responses have been reported in de novo PH1+ AML, which is a rare entity. Cytogenetics The chromosome anomaly t(9;22) disappear during remission, in contrast with BC- CML cases (CML in blast crisis); additional anomalies: similar to what is found in CML. Hybrid/Mutated BCR/ABL the crucial event lies on der(22), id est 5' BCR - 3' ABL hybrid gene is the Gene crucial one, while ABL/BCR may or may not be expressed; Breakpoint in ABL is variable over a region of 200 kb, often between the two alternative exons 1b and 1a, sometimes 5' of 1b or 3' of 1a, but always 5' of exon 2; breakpoint in BCR is either:  1- in a region called M-bcr (for major breakpoint cluster region), a cluster of 5.8 kb, between exons 12 and 16, also called b1 to b5 of M-bcr; most breakpoints being either between b2 and b3, or between b3 and b4; transcript is 8.5 kb long; this results in a 210 KDa chimeric protein (P210); this is found in (most cases of) CML, and in half cases of ALL or AML.  2- in a 35 kb region between exons 1 and 2, called m-bcr (minor breakpoint cluster region), -> 7 kb mRNA, resulting in a 190 KDa protein (P190) found in approximately 25% of adult ALL cases.  3- A breakpoint in the exon 19 of BCR (designed as the micro-bcr) with fusion to abl sequences (a2) has been found in neutrophilic CML, with presence of a larger protein (P230). Abnormal BCR/ABL P210 comprises the first 902 or 927 amino acids from N-term of BCR, Protein whereas P190 BCR and P230 include 427 and 1176 aminoacids respectively, from the N-term region of BCR; BCR/ABL has a cytoplasmic localization, probably by the ability of the oligomerization domain to interact with Factin. ABL is both nuclear and cytoplasmic, due to the presence of nuclear localisation and export signals (NLS and NES) within its COOH terminal region. Oncogenesis All three forms of BCR-ABL oncogenes have transforming potential and it is now clear that they are responsible for initiation of the leukemic process associated with BCR- ABL oncogenes: Several signalling pathways are simultaneously activated and some phenotypic correlations can be made with the molecular abnormalities  1- Constitutive activation of RAS pathway (via TYR177 of the BCR) mimicking the growth-factor-stimulation of cells, leads to a proliferative behavior;

Atlas Genet Cytogenet Oncol Haematol 2009; 6 774  2- Activation of PI-3K/Akt as well as JAK/STAT pathways is most likely responsible for the anti-apoptotic potential;  3- BCR/ABL provokes cell adhesive abnormalities (via CRK-L, FAK) as well as abnormalities of cell migration (via CXCR-4 whose expression is downregulated in CML cells expressing high levels of BCR-ABL). In experimental settings CD44 has been shown to play a major role in homing of BCR-ABL expressing cells. Activation of focal adhesion molecules (FAK / ) via CRK-L as well as abnormal response to SDF-1 leads to adhesive and migratory abnormalities of leukemic cells. It should be noted that specific signalling events leading to ALL with P190 and to CML with P210 have not been clearly established. A differential activation of Rho protein could play a role between the two phenotypes: rho Rac and cdc42 interact with BCR-ABL p210 but BCR-ABL p190 activates rac and cdc42 only. Deletion of Ikaros, has recently been implicated as a major oncogenic event cooperating with BCR-ABL in the BCR-ABL+ ALL.  Progression to blast crisis in CML: Multiple events could be involved, with the major phenotype being a genetic instability: 1-Mutation of P53, 2-methylation of internal ABL promoter; 3- telomere shortening; 4- Inhibition of negative regulators of BCR-ABL (such as Abi-1) 5- BCR-ABL induces a major genetic instability: Molecular pathways involved in this phenomenon have recently been elucidated (See ABL AND CML). Breakpoints

External links Nomenclature HGNC (Hugo) BCR 1014 Entrez_Gene (NCBI) BCR 613 breakpoint cluster region Cards Atlas BCR GeneCards BCR (Weizmann) Ensembl (Hinxton) ENSG00000186716 [Gene_View] BCR [Vega] AceView (NCBI) BCR Genatlas (Paris) BCR euGene (Indiana) 613 SOURCE (Stanford) NM_004327 NM_021574 Genomic and cartography BCR - 22q11.2 chr22:21852552-21990224 + 22q11 [Description] (hg18- GoldenPath (UCSC) Mar_2006) Ensembl BCR - 22q11 [CytoView] Mapping of BCR [Mapview]

Atlas Genet Cytogenet Oncol Haematol 2009; 6 775 homologs : NCBI OMIM 151410 608232 Gene and transcription Gene : Genbank AB209991 AF192533 AF487522 AK122842 AK124310 (Entrez) Reference sequence (RefSeq NM_004327 NM_021574 transcript) :SRS Reference transcript : NM_004327 NM_021574 Entrez RefSeq genomic : AC_000065 AC_000154 NC_000022 NG_009244 NT_011520 NW_001838745 SRS NW_927628 RefSeq genomic : AC_000065 AC_000154 NC_000022 NG_009244 NT_011520 NW_001838745 Entrez NW_927628 Consensus coding sequences : CCDS BCR NCBI Cluster EST : Unigene Hs.715409 [ SRS ] Hs.715409 [ NCBI ] Alternative Splicing : 2499 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : P11274 (SRS) P11274 (Expasy) P11274 (Uniprot) UniProt/SwissProt With graphics : P11274 InterPro Splice isoforms : P11274(VarSplice FASTA) VarSplice FASTA Domaine pattern : C2 (PS50004) DH_1 (PS00741) DH_2 (PS50010) PH_DOMAIN Prosite (SRS) (PS50003) RHOGAP (PS50238) Domain pattern : C2 (PS50004) DH_1 (PS00741) DH_2 (PS50010) PH_DOMAIN Prosite (Expaxy) (PS50003) RHOGAP (PS50238) Domains : Interpro Bcr-Abl_oncoprot_oligo C2_Ca-dep DH-domain GDS_CDC24_CS PH (SRS) RhoGAP Domains : Interpro Bcr-Abl_oncoprot_oligo C2_Ca-dep DH-domain GDS_CDC24_CS PH (EBI) RhoGAP Related proteins : P11274 CluSTr Domain families : Bcr-Abl_Oligo (PF09036) C2 (PF00168) RhoGAP (PF00620) RhoGEF Pfam SRS (PF00621) Domain families : Bcr-Abl_Oligo (PF09036) C2 (PF00168) RhoGAP (PF00620) RhoGEF Pfam Sanger (PF00621) Domain families : pfam09036 pfam00168 pfam00620 pfam00621 Pfam NCBI Domain families : C2 (SM00239)PH (SM00233)RhoGAP (SM00324)RhoGEF (SM00325) Smart EMBL Blocks (Seattle) P11274 Crystal structure of 1K1F protein : PDB SRS Crystal structure of 1K1F protein : PDBSum Crystal structure of 1K1F protein : IMB Crystal structure of 1K1F protein : PDB RSDB HPRD 01044 Protein Interaction databases

Atlas Genet Cytogenet Oncol Haematol 2009; 6 776 DIP (DOE-UCLA) P11274 IntAct (EBI) P11274 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : BCR dbSNP NCBI SNP : GeneSNP Utah BCR SNP : HGBase BCR Genetic variants : BCR HAPMAP Somatic Mutations in BCR Cancer : COSMIC Translocation Breakpoints in Cancer BCR : TICdb Mutations and BCR Diseases : HGMD Hereditary diseases : 151410 608232 OMIM Hereditary diseases : 151410 608232 GENETests Diseases : Genetic BCR Association General knowledge Homologs : BCR HomoloGene Homology/Alignments : Family Browser BCR UCSC Phylogenetic Trees/Animal Genes : BCR TreeFam Catalytic activity : 2.7.11.1 [ Enzyme-Expasy ] 2.7.11.1 [ Enzyme-SRS ] 2.7.11.1 [ IntEnz- Enzyme EBI ] 2.7.11.1 [ BRENDA ] 2.7.11.1 [ KEGG ] Chemical/Protein 613 Interactions : CTD protein serine/threonine kinase activity guanyl-nucleotide exchange factor activity Rho guanyl-nucleotide exchange factor activity GTPase activator Keywords Ontology : activity intracellular protein amino acid phosphorylation intracellular signaling AmiGO cascade kinase activity transferase activity regulation of Rho protein signal transduction protein serine/threonine kinase activity guanyl-nucleotide exchange factor activity Rho guanyl-nucleotide exchange factor activity GTPase activator Keywords Ontology : activity intracellular protein amino acid phosphorylation intracellular signaling EGO-EBI cascade kinase activity transferase activity regulation of Rho protein signal transduction Pathways : Inhibition of Cellular Proliferation by Gleevec [Genes] Integrin Signaling BIOCARTA Pathway [Genes] Other databases Probes Probes : Imagenes BCR Related clones (RZPD - Berlin) Literature PubMed 194 Pubmed reference(s) in Entrez PubGene BCR Bibliography cDNA sequence for human bcr, the gene that translocates to the abl oncogene in chronic myeloid leukaemia.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 777 Hariharan IK, Adams JM. EMBO J. 1987 Jan;6(1):115-9. PMID 3107980

Unique fusion of bcr and c-abl genes in Philadelphia chromosome positive acute lymphoblastic leukemia. Hermans A, Heisterkamp N, von Linden M, van Baal S, Meijer D, van der Plas D, Wiedemann LM, Groffen J, Bootsma D, Grosveld G. Cell. 1987 Oct 9;51(1):33-40. PMID 2820585

Increased neutrophil respiratory burst in bcr-null mutants. Voncken JW, van Schaick H, Kaartinen V, Deemer K, Coates T, Landing B, Pattengale P, Dorseuil O, Bokoch GM, Groffen J, et al. Cell. 1995 Mar 10;80(5):719-28. PMID 7889565

The BCR-ABL oncoprotein potentially interacts with the xeroderma pigmentosum group B protein. Takeda N, Shibuya M, Maru Y. Proc Natl Acad Sci U S A. 1999 Jan 5;96(1):203-7. PMID 9874796

Bcr: a negative regulator of the Bcr-Abl oncoprotein. Wu Y, Ma G, Lu D, Lin F, Xu HJ, Liu J, Arlinghaus RB. Oncogene. 1999 Aug 5;18(31):4416-24. PMID 10442632

The molecular biology of chronic myeloid leukemia. Deininger MW, Goldman JM, Melo JV. Blood. 2000 Nov 15;96(10):3343-56. PMID 11071626

BCR-ABL down-regulates the DNA repair protein DNA-PKcs. Deutsch E, Dugray A, AbdulKarim B, Marangoni E, Maggiorella L, Vaganay S, M'Kacher R, Rasy SD, Eschwege F, Vainchenker W, Turhan AG, Bourhis J. Blood. 2001 Apr 1;97(7):2084-90. PMID 11264175

The BCR gene and philadelphia chromosome-positive leukemogenesis. Laurent E, Talpaz M, Kantarjian H, Kurzrock R. Cancer Res. 2001 Mar 15;61(6):2343-55. PMID 11289094

Bcr: a negative regulator of the Bcr-Abl oncoprotein in leukemia. Arlinghaus RB. Oncogene. 2002 Dec 9;21(56):8560-7. PMID 12476302

Differential interaction and activation of Rho family GTPases by p210bcr-abl and p190bcr-abl. Harnois T, Constantin B, Rioux A, Grenioux E, Kitzis A, Bourmeyster N. Oncogene. 2003 Sep 25;22(41):6445-54. PMID 14508524

Atlas Genet Cytogenet Oncol Haematol 2009; 6 778 The biology of CML blast crisis. Calabretta B, Perrotti D. Blood. 2004 Jun 1;103(11):4010-22. Epub 2004 Feb 24. PMID 14982876

BCR-ABL1 lymphoblastic leukaemia is characterized by the deletion of Ikaros. Mullighan CG, Miller CB, Radtke I, Phillips LA, Dalton J, Ma J, White D, Hughes TP, Le Beau MM, Pui CH, Relling MV, Shurtleff SA, Downing JR. Nature. 2008 May 1;453(7191):110-4. Epub 2008 Apr 13. PMID 18408710

Kinase domain mutants of Bcr enhance Bcr-Abl oncogenic effects. Perazzona B, Lin H, Sun T, Wang Y, Arlinghaus R. Oncogene. 2008 Apr 3;27(15):2208-14. Epub 2007 Oct 15. PMID 17934518

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 10-1997 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France Updated 04-2001 Ali G Turhan Translational Research - Cell Therapy, Laboratory, Institut Gustave Roussy, INSERM U. 362, 1 - 39, rue Camille Desmoulins, 94805 Villejuif Cedex, France Updated 08-2008 Ali G Turhan Pole de Biologie-Sante - 40 avenue du Recteur Pineau - 86022 Poitiers Cedex, France Citation This paper should be referenced as such : Huret JL . BCR (Breakpoint cluster region). Atlas Genet Cytogenet Oncol Haematol. October 1997 . URL : http://AtlasGeneticsOncology.org/Genes/BCR.html Turhan AG . BCR (Breakpoint cluster region). Atlas Genet Cytogenet Oncol Haematol. April 2001 . URL : http://AtlasGeneticsOncology.org/Genes/BCR.html Turhan AG . BCR (Breakpoint cluster region). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/BCR.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 779 Atlas of Genetics and Cytogenetics in Oncology and Haematology

ENAH (enabled homolog (Drosophila))

Identity Other names FLJ10773 MENA NDPP1 HGNC (Hugo) ENAH Location 1q42.12 Location_base_pair Starts at 223741157 and ends at 223907468 bp from pter ( according to hg18- Mar_2006) [Mapping] Note ENAH is a member of the Ena / VASP family encoding actin cytoskeleton regulatory proteins controlling cell motility and adhesion. DNA/RNA

Diagrammatic representation of human ENAH gene trancripts. Exons are enumerated and the relative protein domains are indicated. Description The human ENAH gene is located on the minus strand of chromosome 1 and is constituted by 15 exons. Other features of the ENAH gene such as promoter or enhancer have not been fully investigated. Transcription Two alternative splice variants isolated in the human ENAH. The size of the longer variant (hMena+11a or ENAH variant 1) is 1776 nt. The shorter variant (hMena or ENAH variant 2) lacks an internal exon (exon 11a) of 63nt. Protein

Human ENAH protein, the four conserved domains are indicated with the respective amino acid positions. The 11a peptide is included at position 513 and characterizes the ENAH isoform a (hMena+11a). Description Mena is a member of Ena/VASP proteins characterized by the presence of specific domains including the NH2-terminal EVH1 domain, which plays a role in intracellular protein localization (Prehoda et al., 1999) and interacts with proteins bearing FPPPP motifs. Among the Ena/VASP proteins only the EVH1 domain of Mena possesses the ability to bind to the LIM3 domain of the oncosuppressor TES (Boeda et al., 2007). The central proline-rich domain mediates the interaction with proteins containing the SH3 and WW domains and with the small actin monomer binding protein profilin (Gertler et al., 1996). The LERER region is constituted by a long repeat of Arg/Leu/Glu amino acids probably acting as a protein protein binding interface, located between the EVH1 and the prol-rich region. Only Mena among the Ena/VASP proteins possesses this domain. The EVH2 COOH-terminal domain, which forms a right handed alpha helical coiled coil structure, is responsible for tetramerization and for the binding to G- and F- actin (Kuhnel et al., 2004); its interaction with the growing ends of the actin filaments is required for targeting the Ena/VASP to lamellipodia and filopodia (Louriero et al., 2002). Human Mena (hMena or ENAH isoform b) is a 570 amino acid protein. The longer hMena+11a isoform (ENAH isoform a) presents an additional internal peptide of 21aa located in the EVH2 domain of the protein. This isoform undergoes phosphorylation upon treatment of breast cancer cell lines with EGF and NRG1 (Di Modugno et al., 2007). Mena is alternately spliced to give rise to multiple isoforms, an additional reported

Atlas Genet Cytogenet Oncol Haematol 2009; 6 780 isoform is the neuronal specific Mena-140 found in mouse and humans (Gertler et al., 1996; Urbanelli et al., 2006). Expression In normal tissues, hMena expression was confined to isolated epithelia (i.e.pancreas). Mammary epithelium was negative and hMena was overexpressed in about 75% of breast primary tumors tested, with a variable staining intensity. Localisation Predominantly in cytoplasm and in some tumor cells with a reinforced juxtamembrane staining. Function Mena controls cell shape and movement (Bear et al., 2002; Vasioukhin et al., 2000; Krause et al., 2003) by protecting actin filaments from capping proteins at their barbed ends (Barzik et al., 2005). It controls actin organization on cadherin adhesion contact (Scott et al., 2006). Homology The sequence of hMena (ENAH isoform b) displays 87% identity with the murine protein but is longer with the majority of the additional aminoacids located in the Arg/Leu/Glu rich region (LERER). The human hMena sequence conserved the two serine phosphorylation sites of murine Mena, whereas the tyrosine residue, site of phosphorylation in mouse Mena (Tani et al., 2003), is substituted by a glutamine residue in the human sequence. Implicated in Entity Breast Cancer Disease In human tissues, human ENAH (hMena) protein, not expressed in normal breast, is detectable in a small percentage of low-risk proliferative lesions, with a progressive increase of positivity in benign breast lesions at higher risk of transformation and in in situ and invasive cancers. In the latter, a significant direct correlation was found between hMena, tumor size, proliferation index, and HER-2 overexpression whereas an inverse relationship was evidenced with estrogen receptor (ER) and progesterone receptor (PgR) expression (Di Modugno et al., 2006). These results suggest that hMena may be a marker of breast cancerogenesis and breast cancer progression. In cancer cell lines of different histological origin, hMena is overexpressed respect to the normal counterparts (i.e. breast, melanoma, colon, cervical cancer). hMena expression while up-regulated by Neuregulin-1 and EGF, is down-regulated by Herceptin treatment in breast cancer cell lines, thus suggesting that hMena couples tyrosine kinase receptor (TKR) signaling to the actin cytoskeleton. hMena+11a isoform (ENAH isoform a) is epithelial-specific and is phosphorylated after mitogenic stimuli, such as EGF. This phosphorylation is accompanied by an increased proliferation rate and p42 / 44 MAPK activation in breast cancer cell lines (Di Modugno et al., 2007), thus suggesting a functional role of hMena+11a in breast cancer cell proliferation. In a murine model Mena is overexpressed, among a set of genes coding for the minimum motility machine regulating β-actin polymerization, in a subpopulation of invasive breast tumor cells collected using the in vivo invasion assay in response to EGF (Wang et al., 2004). A role of hMena in the invasive behaviour of human tumor cells has not yet been reported. Entity Pancreatic Cancer Disease hMena is expressed in primary and metastatic pancreatic cancer. The expression of hMena+11a isoform (ENAH isoform a) characterizes pancreatic cancer cell lines with an epithelial phenotype which express the epithelial marker E-Cadherin and lack the expression of mesenchymal markers as N-Cadherin and Vimentin. These cell lines show a constitutive activated EGFR and are sensitive to the treatment with the EGFR inhibitor Erlotinib. ENAH acts as a mediator of the EGFR signaling pathway and significantly modulates the growth of pancreatic cancer cell lines dependent on EGFR signaling. Thus the expression of hMena/hMena+11a is predictive of in vitro response to EGFR inhibitors (Simo et al., 2008). Entity Tumor Immunity Disease Human ENAH (hMena) protein is able to induce a cancer-restricted antibody response. Twenty percent of cancer patient sera, showed anti-hMena-specific IgG, while no antibodies were present in healthy donors (Di Modugno et al., 2004). External links Nomenclature

Atlas Genet Cytogenet Oncol Haematol 2009; 6 781 HGNC (Hugo) ENAH 18271 Entrez_Gene (NCBI) ENAH 55740 enabled homolog (Drosophila) Cards Atlas ENAHID44148ch1q42 GeneCards ENAH (Weizmann) Ensembl (Hinxton) ENSG00000154380 [Gene_View] ENAH [Vega] AceView (NCBI) ENAH Genatlas (Paris) ENAH euGene (Indiana) 55740 SOURCE (Stanford) NM_001008493 NM_018212 Genomic and cartography ENAH - 1q42.12 chr1:223741157-223907468 - 1q32.2 [Description] GoldenPath (UCSC) (hg18-Mar_2006) Ensembl ENAH - 1q32.2 [CytoView] Mapping of ENAH [Mapview] homologs : NCBI OMIM 609061 Gene and transcription Gene : Genbank AF519769 AK001635 AK025108 AK096246 AK126894 (Entrez) Reference sequence (RefSeq NM_001008493 NM_018212 transcript) :SRS Reference transcript : NM_001008493 NM_018212 Entrez RefSeq genomic : AC_000044 AC_000133 NC_000001 NT_004559 NW_001838543 NW_927128 SRS RefSeq genomic : AC_000044 AC_000133 NC_000001 NT_004559 NW_001838543 NW_927128 Entrez Consensus coding sequences : CCDS ENAH NCBI Cluster EST : Unigene Hs.497893 [ SRS ] Hs.497893 [ NCBI ] Alternative Splicing : 17864 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : Q8N8S7 (SRS) Q8N8S7 (Expasy) Q8N8S7 (Uniprot) UniProt/SwissProt With graphics : Q8N8S7 InterPro Splice isoforms : Q8N8S7(VarSplice FASTA) VarSplice FASTA Domaine pattern : WH1 (PS50229) Prosite (SRS) Domain pattern : WH1 (PS50229) Prosite (Expaxy) Domains : Interpro EVH1 PH_type RanBP1 VASP_tetra (SRS) Domains : Interpro EVH1 PH_type RanBP1 VASP_tetra (EBI) Related proteins : Q8N8S7 CluSTr Domain families : VASP_tetra (PF08776) WH1 (PF00568) Pfam SRS Domain families : VASP_tetra (PF08776) WH1 (PF00568)

Atlas Genet Cytogenet Oncol Haematol 2009; 6 782 Pfam Sanger Domain families : pfam08776 pfam00568 Pfam NCBI Domain families : RanBD (SM00160)WH1 (SM00461) Smart EMBL Blocks (Seattle) Q8N8S7 Crystal structure of 2IYB protein : PDB SRS Crystal structure of 2IYB protein : PDBSum Crystal structure of 2IYB protein : IMB Crystal structure of 2IYB protein : PDB RSDB HPRD 12360 Protein Interaction databases DIP (DOE-UCLA) Q8N8S7 IntAct (EBI) Q8N8S7 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : ENAH dbSNP NCBI SNP : GeneSNP Utah ENAH SNP : HGBase ENAH Genetic variants : ENAH HAPMAP Mutations and ENAH Diseases : HGMD Hereditary diseases : 609061 OMIM Hereditary diseases : 609061 GENETests Diseases : Genetic ENAH Association General knowledge Homologs : ENAH HomoloGene Homology/Alignments : Family Browser ENAH UCSC Phylogenetic Trees/Animal Genes : ENAH TreeFam Chemical/Protein 55740 Interactions : CTD Keywords Ontology : actin binding cytoplasm cytoskeleton SH3 domain binding cell junction cell AmiGO projection synapse intracellular transport Keywords Ontology : actin binding cytoplasm cytoskeleton SH3 domain binding cell junction cell EGO-EBI projection synapse intracellular transport Other databases Probes Probes : Imagenes ENAH Related clones (RZPD - Berlin) Literature PubMed 34 Pubmed reference(s) in Entrez PubGene ENAH Bibliography

Atlas Genet Cytogenet Oncol Haematol 2009; 6 783 Mena, a relative of VASP and Drosophila Enabled, is implicated in the control of microfilament dynamics. Gertler FB, Niebuhr K, Reinhard M, Wehland J, Soriano P. Cell. 1996 Oct 18;87(2):227-39. PMID 8861907

Structure of the enabled/VASP homology 1 domain-peptide complex: a key component in the spatial control of actin assembly. Prehoda KE, Lee DJ, Lim WA. Cell. 1999 May 14;97(4):471-80. PMID 10338211

Directed actin polymerization is the driving force for epithelial cell-cell adhesion. Vasioukhin V, Bauer C, Yin M, Fuchs E. Cell. 2000 Jan 21;100(2):209-19. PMID 10660044

Antagonism between Ena/VASP proteins and actin filament capping regulates fibroblast motility. Bear JE, Svitkina TM, Krause M, Schafer DA, Loureiro JJ, Strasser GA, Maly IV, Chaga OY, Cooper JA, Borisy GG, Gertler FB. Cell. 2002 May 17;109(4):509-21. PMID 12086607

Critical roles of phosphorylation and actin binding motifs, but not the central proline-rich region, for Ena/vasodilator-stimulated phosphoprotein (VASP) function during cell migration. Loureiro JJ, Rubinson DA, Bear JE, Baltus GA, Kwiatkowski AV, Gertler FB. Mol Biol Cell. 2002 Jul;13(7):2533-46. PMID 12134088

Ena/VASP proteins: regulators of the actin cytoskeleton and cell migration. Krause M, Dent EW, Bear JE, Loureiro JJ, Gertler FB. Annu Rev Cell Dev Biol. 2003;19:541-64. (Review) PMID 14570581

Abl interactor 1 promotes tyrosine 296 phosphorylation of mammalian enabled (Mena) by c-Abl kinase. Tani K, Sato S, Sukezane T, Kojima H, Hirose H, Hanafusa H, Shishido T. J Biol Chem. 2003 Jun 13;278(24):21685-92. PMID 12672821

Human Mena protein, a serex-defined antigen overexpressed in breast cancer eliciting both humoral and CD8+ T-cell immune response. Di Modugno F, Bronzi G, Scanlan MJ, Del Bello D, Cascioli S, Venturo I, Botti C, Nicotra MR, Mottolese M, Natali PG, Santoni A, Jager E, Nistico P. Int J Cancer. 2004 May 10;109(6):909-18. PMID 15027125

The VASP tetramerization domain is a right-handed coiled coil based on a 15-residue repeat. Kuhnel K, Jarchau T, Wolf E, Schlichting I, Walter U, Wittinghofer A, Strelkov SV. Proc Natl Acad Sci U S A. 2004 Dec 7;101(49):17027-32. PMID 15569942

Identification and testing of a gene expression signature of invasive carcinoma cells within primary mammary tumors. Wang W, Goswami S, Lapidus K, Wells AL, Wyckoff JB, Sahai E, Singer RH, Segall JE, Condeelis JS. Cancer Res. 2004 Dec 1;64(23):8585-94. PMID 15574765

Ena/VASP proteins enhance actin polymerization in the presence of barbed end capping

Atlas Genet Cytogenet Oncol Haematol 2009; 6 784 proteins. Barzik M, Kotova TI, Higgs HN, Hazelwood L, Hanein D, Gertler FB, Schafer DA. J Biol Chem. 2005 Aug 5;280(31):28653-62. PMID 15939738

The cytoskeleton regulatory protein hMena (ENAH) is overexpressed in human benign breast lesions with high risk of transformation and human epidermal growth factor receptor-2- positive/hormonal receptor-negative tumors. Di Modugno F, Mottolese M, Di Benedetto A, Conidi A, Novelli F, Perracchio L, Venturo I, Botti C, Jager E, Santoni A, Natali PG, Nistico P. Clin Cancer Res. 2006 Mar 1;12(5):1470-8. PMID 16533770

Ena/VASP proteins can regulate distinct modes of actin organization at cadherin-adhesive contacts. Scott JA, Shewan AM, den Elzen NR, Loureiro JJ, Gertler FB, Yap AS. Mol Biol Cell. 2006 Mar;17(3):1085-95. PMID 16371509

Characterization of human Enah gene. Urbanelli L, Massini C, Emiliani C, Orlacchio A, Bernardi G, Orlacchio A. Biochim Biophys Acta. 2006 Jan-Feb;1759(1-2):99-107. PMID 16494957

Tes, a specific Mena interacting partner, breaks the rules for EVH1 binding. Boeda B, Briggs DC, Higgins T, Garvalov BK, Fadden AJ, McDonald NQ, Way M. Mol Cell. 2007 Dec 28;28(6):1071-82. PMID 18158903

Molecular cloning of hMena (ENAH) and its splice variant hMena+11a: epidermal growth factor increases their expression and stimulates hMena+11a phosphorylation in breast cancer cell lines. Di Modugno F, DeMonte L, Balsamo M, Bronzi G, Nicotra MR, Alessio M, Jager E, Condeelis JS, Santoni A, Natali PG, Nistico P. Cancer Res. 2007 Mar 15;67(6):2657-65. PMID 17363586

Human Mena+11a isoform serves as a marker of epithelial phenotype and sensitivity to epidermal growth factor receptor inhibition in human pancreatic cancer cell lines. Pino MS, Balsamo M, Di Modugno F, Mottolese M, Alessio M, Melucci E, Milella M, McConkey DJ, Philippar U, Gertler FB, Natali PG, Nistico P. Clin Cancer Res. 2008 Aug 1;14(15):4943-50. PMID 18676769

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Paola Nisticò, Francesca Di Modugno Regina Elena Cancer Institute, Department of Experimental Oncology, via delle Messi d'Oro 156, 00158 Rome, Italy Citation This paper should be referenced as such : Nisticò P, Di Modugno F . ENAH (enabled homolog (Drosophila)). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/ENAHID44148ch1q42.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 785 Atlas of Genetics and Cytogenetics in Oncology and Haematology

FGFR2 (fibroblast growth factor receptor 2)

Identity Other names BEK CD332 CEK3 ECT1 KGFR K-sam TK14 TK25 HGNC (Hugo) FGFR2 Location 10q26.13 Location_base_pair Starts at 123227834 and ends at 123347962 bp from pter ( according to hg18- Mar_2006) [Mapping] Local_order WDR11 - FGFR2 - ATE1 - NSMCE4A - TACC2. Note FGFR2 was independently cloned and characterized by several groups as a novel receptor-type tyrosine kinase BEK, KGFR, K-sam, or TK14. DNA/RNA Note FGFR2 gene at chromosome 10q26.13 and FGFR1 gene at chromosome 8p12 are paralogs within the human genome.

Structure and alternative splicing of FGFR2 gene. Description FGFR2 gene, consisting of at least 21 exons, encodes multiple isoforms due to alternative splicing. FGFR2b and FGFR2c with extracellular three Ig-like domains, transmembrane domain and cytoplasmic tyrosine kinase domain, are representative FGFR2 isoforms almost identical except the latter half of the third Ig-like domain. Exon 9 and 10, corresponding to the latter half of the third Ig-like domain, are incorporated into FGFR2b and FGFR2c in a mutually exclusive manner. Splicing silencer sequence within intron 8 and splicing activator sequence within intron 9 are implicated in the regulation of splicing preferentiality for FGFR2b and FGFR2c. Exons 20 and 21 of FGFR2 gene are alternative last exons encoding the C-terminal region of FGFR2 isoforms. Wild type FGFR2 transcripts with exon 21 are expressed in normal cells and most tumor cells, while aberrant FGFR2 transcripts with exon 20 are overexpressed in

Atlas Genet Cytogenet Oncol Haematol 2009; 6 786 cases with FGFR2 gene amplification due to the exclusion of exon 21 from the FGFR2 amplicon. FGFR2 gene also encodes transmembrane-type FGFR2 isoforms lacking the first Ig-like domain, and secreted-type FGFR2 isoforms. Transcription FGFR2b isoform is predominantly expressed in epithelial cells, while FGFR2c isoform preferentially in mesenchymal cells. FGFR2 is expressed in undifferentiated human ES cells, and also in ES-derived embryoid body, endodermal precursors, and neural precursors. FGFR2 is relatively highly expressed in fetal brain. Among adult human tissues, FGFR2 is relatively highly expressed in brain, retina, spinal cord, salivary gland, skin, kidney and uterus. FGFR2 is overexpressed in human breast cancer and gastric cancer due to gene amplification. Protein Note FGFR2 functions as transmembrane receptor for FGF family members, such as FGF1 (aFGF), FGF2 (bFGF), FGF3, FGF4 (Kaposi's sarcoma-derived FGF or KFGF), FGF6, FGF7 (keratinocyte growth factor or KGF), FGF9, FGF10, FGF16, FGF20 and FGF22 FGFR2b and FGFR2c are representative FGFR2 isoforms with distinct ligand specificity.

Schematic representation of FGF signaling cascades. Description FGFR2b and FGFR2c are representative FGFR2 isoforms, consisting of extracellular three Ig-like domains, transmembrane domain, and cytoplasmic tyrosine kinase domain. FGFR2b and FGFR2c are almost identical except the latter half of the third Ig- like domain. The divergence in the latter half of the third Ig-like domain leads to distinct ligand specificity between FGFR2b and FGFR2c. FGFR2b is a high affinity receptor for FGF1, FGF3, FGF7, FGF10 and FGF22, while FGFR2c is a high affinity receptor for FGF1, FGF2, FGF4, FGF6, FGF9, FGF16 and FGF20. Localisation FGFR2b and FGFR2c with the N-terminal signal peptide and a single transmembrane domain are localized to the plasma membrane. Function FGFR2 is a high affinity receptor for FGFs associated with heparan sulfate proteoglycans (HSPGs). Ligand-dependent FGFR2 dimerization releases FGFR2 from autoinhibition due to autophosphorylation of a key tyrosine residue within the activation loop of kinase domain. FRS2 (FRS2A) and FRS3 (FRS2B) are tyrosine phosphorylated by FGFR2 to recruit GRB2 and PTPN11 for the activation of SOS - RAS - RAF- MAP3K - MAP2K - MAPK and GAB1 - PI3K - AKT signaling cascades. Phospholipase C- gamma (PLCgamma) is recruited to FGFR2 through its interaction with

Atlas Genet Cytogenet Oncol Haematol 2009; 6 787 phosphotyrosine residues on the C-terminal tail of activated FGFR2, which results in the catalysis of phosphatidylinositol diphosphate (PIP2) to diacylglycerol (DAG) and inositol triphosphate (IP3). DAG activates protein kinase C (PKC) signaling cascade, while IP3 induces Ca2+ release from endoplasmic reticulum for the following activation of Calmodulin-Calcineurin-NFAT signaling cascade. FGFR2 transduces FGF signals to the MAPK and PI3K-AKT signaling cascades through FRS2 or FGF3, and to the PKC and NFAT signaling cascades through PLCgamma. Homology FGFR2b and FGFR2c are almost identical except the latter half of the third Ig-like domain as mentioned above. Among receptor-type tyrosine kinases, FGFR2 isoforms are more homologous to FGFR1 isoforms. Mutations Note Germinal missense mutations of FGFR2 gene occur in congenital skeletal disorders. Intronic single nucleotide polymorphisms (SNPs) of FGFR2 gene are associated with increased cancer risk. Somatic missense mutations or gene amplification of FGFR2 occur in several types of cancer.

Germinal and somatic point mutations of FGFR2. Germinal Germinal missense mutations of FGFR2 gene occur in congenital skeletal disorders, such as Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, and Beare-Stevenson syndrome, which are featured by short-limbed bone dysplasia (craniosynostosis), and syndrome-specific abnormalities, such as Crouzonoid facies, bone syndactyly, limb abnormalities, and cutis gyrata. FGFR2 missense mutations around the third Ig-like domain result in altered ligand-receptor specificity to create the autocrine signaling loop. FGFR2 missense mutations within the tyrosine kinase domain lead to ligand independent activation of FGFR2. Germinal FGFR2 missense mutations cause congenital skeletal disorders due to aberrant FGFR2 signaling activation. In addition, SNPs within intron 2 of FGFR2 gene are associated with increased risk of breast cancer, partly due to transcriptional upregulation of FGFR2. Somatic Somatic missense mutations or gene amplification of FGFR2 occur in uterus cancer (endometrial cancer), lung cancer, breast cancer, gastric cancer, and ovarian cancer. Genetic alterations of FGFR2 lead to aberrant activation of FGFR2 signaling cascades

Atlas Genet Cytogenet Oncol Haematol 2009; 6 788 due to the creation of autocrine signaling loop or the release of FGFR2 from autoinhibition. Implicated in Entity Cancer Disease Somatic missense mutations or gene amplification of FGFR2 occur in endometrial cancer, lung cancer, breast cancer, gastric cancer, and ovarian cancer as mentioned above. In addition, class switch from FGFR2b to FGFR2c occurs during malignant progression of prostate cancer and bladder cancer. Somatic mutations and class switch of FGFR2 isoforms induce aberrant FGFR2 signaling activation in tumor cells. Prognosis FGFR2 gene amplification accompanied by FGFR2 overexpression in breast cancer and gastric cancer is associated with poor prognosis. Class switch from FGFR2b to FGFR2c is associated with more malignant phenotype in prostate cancer and bladder cancer.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 789

Mechanisms of oncogenic FGFR2 signaling activation. Entity Congenital skeletal disorder Disease Germinal mutations of FGFR2 gene occur in Crouzon syndrome, Jackson-Weiss syndrome, Apert syndrome, Pfeiffer syndrome, and Beare-Stevenson syndrome. FGFR2 missense mutations cause congenital skeletal disorders due to aberrant FGFR2 signaling activation as mentioned above. External links Nomenclature HGNC (Hugo) FGFR2 3689 Entrez_Gene (NCBI) FGFR2 2263 fibroblast growth factor receptor 2 Cards

Atlas Genet Cytogenet Oncol Haematol 2009; 6 790 Atlas FGFR2ID40570ch10q26 GeneCards FGFR2 (Weizmann) Ensembl (Hinxton) ENSG00000066468 [Gene_View] FGFR2 [Vega] AceView (NCBI) FGFR2 Genatlas (Paris) FGFR2 euGene (Indiana) 2263 NM_000141 NM_001144913 NM_001144914 NM_001144915 NM_001144916 SOURCE (Stanford) NM_001144917 NM_001144918 NM_001144919 NM_022970 Genomic and cartography FGFR2 - 10q26.13 chr10:123227834-123347962 - 10q25.3- GoldenPath (UCSC) q26 [Description] (hg18-Mar_2006) Ensembl FGFR2 - 10q25.3-q26 [CytoView] Mapping of FGFR2 [Mapview] homologs : NCBI 101200 101400 101600 123150 123500 123790 137215 149730 OMIM 176943 207410 609579 Gene and transcription Gene : Genbank AB030073 AB030074 AB030075 AB030076 AB030077 (Entrez) Reference sequence NM_000141 NM_001144913 NM_001144914 NM_001144915 NM_001144916 (RefSeq NM_001144917 NM_001144918 NM_001144919 NM_022970 transcript) :SRS Reference transcript : NM_000141 NM_001144913 NM_001144914 NM_001144915 NM_001144916 Entrez NM_001144917 NM_001144918 NM_001144919 NM_022970 RefSeq genomic : AC_000053 AC_000142 NC_000010 NT_030059 NW_001838006 NW_924884 SRS RefSeq genomic : AC_000053 AC_000142 NC_000010 NT_030059 NW_001838006 NW_924884 Entrez Consensus coding sequences : CCDS FGFR2 NCBI Cluster EST : Unigene Hs.533683 [ SRS ] Hs.533683 [ NCBI ] Alternative Splicing : 16936 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : P21802 (SRS) P21802 (Expasy) P21802 (Uniprot) UniProt/SwissProt With graphics : P21802 InterPro Splice isoforms : P21802(VarSplice FASTA) VarSplice FASTA Domaine pattern : IG_LIKE (PS50835) PROTEIN_KINASE_ATP (PS00107) Prosite (SRS) PROTEIN_KINASE_DOM (PS50011) PROTEIN_KINASE_TYR (PS00109) Domain pattern : IG_LIKE (PS50835) PROTEIN_KINASE_ATP (PS00107) Prosite (Expaxy) PROTEIN_KINASE_DOM (PS50011) PROTEIN_KINASE_TYR (PS00109) Domains : Interpro Fibroblast_GF_rcpt Ig Ig-like Ig-like_fold Ig_sub2 Prot_kinase_core (SRS) Protein_kinase_ATP_bd_CS Tyr_pkinase Tyr_pkinase_AS Domains : Interpro Fibroblast_GF_rcpt Ig Ig-like Ig-like_fold Ig_sub2 Prot_kinase_core (EBI) Protein_kinase_ATP_bd_CS Tyr_pkinase Tyr_pkinase_AS Related proteins : P21802 CluSTr Domain families : ig (PF00047) Pkinase_Tyr (PF07714) Pfam SRS Domain families : ig (PF00047) Pkinase_Tyr (PF07714) Pfam Sanger

Atlas Genet Cytogenet Oncol Haematol 2009; 6 791 Domain families : pfam00047 pfam07714 Pfam NCBI Domain families : IGc2 (SM00408)TyrKc (SM00219) Smart EMBL Domain structure : Prot_kinase (PD000001) Prodom (Prabi Lyon) Blocks (Seattle) P21802 1DJS 1E0O 1EV2 1GJO 1II4 1IIL 1NUN 1OEC 1WVZ 2FDB Crystal structure of 2PSQ 2PVF 2PVY 2PWL 2PY3 2PZ5 2PZP 2PZR 2Q0B protein : PDB SRS 3B2T 3DAR 1DJS 1E0O 1EV2 1GJO 1II4 1IIL 1NUN 1OEC 1WVZ 2FDB Crystal structure of 2PSQ 2PVF 2PVY 2PWL 2PY3 2PZ5 2PZP 2PZR 2Q0B protein : PDBSum 3B2T 3DAR 1DJS 1E0O 1EV2 1GJO 1II4 1IIL 1NUN 1OEC 1WVZ 2FDB Crystal structure of 2PSQ 2PVF 2PVY 2PWL 2PY3 2PZ5 2PZP 2PZR 2Q0B protein : IMB 3B2T 3DAR 1DJS 1E0O 1EV2 1GJO 1II4 1IIL 1NUN 1OEC 1WVZ 2FDB Crystal structure of 2PSQ 2PVF 2PVY 2PWL 2PY3 2PZ5 2PZP 2PZR 2Q0B protein : PDB RSDB 3B2T 3DAR HPRD 01492 Protein Interaction databases DIP (DOE-UCLA) P21802 IntAct (EBI) P21802 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : FGFR2 dbSNP NCBI SNP : GeneSNP Utah FGFR2 SNP : HGBase FGFR2 Genetic variants : FGFR2 HAPMAP Somatic Mutations in FGFR2 Cancer : COSMIC Mutations and FGFR2 Diseases : HGMD Hereditary diseases : 101200 101400 101600 123150 123500 123790 137215 149730 OMIM 176943 207410 609579 Hereditary diseases : 101200 101400 101600 123150 123500 123790 137215 149730 GENETests 176943 207410 609579 Diseases : Genetic FGFR2 Association General knowledge Homologs : FGFR2 HomoloGene Homology/Alignments : Family Browser FGFR2 UCSC Phylogenetic Trees/Animal Genes : FGFR2 TreeFam Catalytic activity : 2.7.10.1 [ Enzyme-Expasy ] 2.7.10.1 [ Enzyme-SRS ] 2.7.10.1 [ IntEnz- Enzyme EBI ] 2.7.10.1 [ BRENDA ] 2.7.10.1 [ KEGG ] Chemical/Protein 2263 Interactions : CTD nucleotide binding receptor activity fibroblast growth factor receptor Keywords Ontology : activity protein binding ATP binding extracellular region plasma AmiGO membrane plasma membrane protein amino acid phosphorylation heparin

Atlas Genet Cytogenet Oncol Haematol 2009; 6 792 binding fibroblast growth factor receptor signaling pathway cell surface integral to membrane cell growth transferase activity nucleotide binding receptor activity fibroblast growth factor receptor activity protein binding ATP binding extracellular region plasma Keywords Ontology : membrane plasma membrane protein amino acid phosphorylation heparin EGO-EBI binding fibroblast growth factor receptor signaling pathway cell surface integral to membrane cell growth transferase activity Pathways : KEGG MAPK signaling pathway Regulation of actin cytoskeleton Other databases Probes Probes : Imagenes FGFR2 Related clones (RZPD - Berlin) Literature PubMed 213 Pubmed reference(s) in Entrez PubGene FGFR2 Bibliography Characterization of the receptor for keratinocyte growth factor. Evidence for multiple fibroblast growth factor receptors. Bottaro DP, Rubin JS, Ron D, Finch PW, Florio C, Aaronson SA. PMID 2165484

Cloning and expression of two distinct high-affinity receptors cross-reacting with acidic and basic fibroblast growth factors. Dionne CA, Crumley G, Bellot F, Kaplow JM, Searfoss G, Ruta M, Burgess WH, Jaye M, Schlessinger J. EMBO J. 1990 Sep;9(9):2685-92. PMID 1697263

Related fibroblast growth factor receptor genes exist in the human genome. Houssaint E, Blanquet PR, Champion-Arnaud P, Gesnel MC, Torriglia A, Courtois Y, Breathnach R. Proc Natl Acad Sci U S A. 1990 Oct;87(20):8180-4. PMID 2172978

BEK and FLG, two receptors to members of the FGF family, are amplified in subsets of human breast cancers. Adnane J, Gaudray P, Dionne CA, Crumley G, Jaye M, Schlessinger J, Jeanteur P, Birnbaum D, Theillet C. Oncogene. 1991 Apr;6(4):659-63. PMID 1851551

Multiple mRNAs code for proteins related to the BEK fibroblast growth factor receptor. Champion-Arnaud P, Ronsin C, Gilbert E, Gesnel MC, Houssaint E, Breathnach R. Oncogene. 1991 Jun;6(6):979-87. PMID 1648704

PCR-based identification of new receptors: molecular cloning of a receptor for fibroblast growth factors. Raz V, Kelman Z, Avivi A, Neufeld G, Givol D, Yarden Y. Oncogene. 1991 May;6(5):753-60. PMID 1711190

Expression cDNA cloning of the KGF receptor by creation of a transforming autocrine loop. Miki T, Fleming TP, Bottaro DP, Rubin JS, Ron D, Aaronson SA. Science. 1991 Jan 4;251(4989):72-5. PMID 1846048

A novel form of fibroblast growth factor receptor 2. Alternative splicing of the third immunoglobulin-like domain confers ligand binding specificity. Dell KR, Williams LT. J Biol Chem. 1992 Oct 15;267(29):21225-9.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 793 PMID 1400433

BEK, a receptor for multiple members of the fibroblast growth factor (FGF) family, maps to human chromosome 10q25.3-q26. Dionne CA, Modi WS, Crumley G, O'Brien SJ, Schlessinger J, Jaye M. Cytogenet Cell Genet. 1992;60(1):34-6. PMID 1582255

K-sam gene encodes secreted as well as transmembrane receptor tyrosine kinase. Katoh M, Hattori Y, Sasaki H, Tanaka M, Sugano K, Yazaki Y, Sugimura T, Terada M. Proc Natl Acad Sci U S A. 1992 Apr 1;89(7):2960-4. PMID 1313574

Expression of basic fibroblast growth factor, FGFR1 and FGFR2 in normal and malignant human breast, and comparison with other normal tissues. Luqmani YA, Graham M, Coombes RC. Br J Cancer. 1992 Aug;66(2):273-80.

A confined variable region confers ligand specificity on fibroblast growth factor receptors: implications for the origin of the immunoglobulin fold. Yayon A, Zimmer Y, Shen GH, Avivi A, Yarden Y, Givol D. EMBO J. 1992 May;11(5):1885-90. PMID 1316275

Control of BEK and K-SAM splice sites in alternative splicing of the fibroblast growth factor receptor 2 pre-mRNA. Gilbert E, Del Gatto F, Champion-Arnaud P, Gesnel MC, Breathnach R. Mol Cell Biol. 1993 Sep;13(9):5461-8. PMID 8355693

DNA amplification in human gastric carcinomas Mor O, Ranzani GN, Ravia Y, Rotman G, Gutman M, Manor A, Amadori D, Houldsworth J, Hollstein M, Schwab M, Shiloh Y. Cancer Genet Cytogenet. 1993 Feb;65(2):111-4. PMID 8453595

Exon switching and activation of stromal and embryonic fibroblast growth factor (FGF)-FGF receptor genes in prostate epithelial cells accompany stromal independence and malignancy. Yan G, Fukabori Y, McBride G, Nikolaropolous S, McKeehan WL. Mol Cell Biol. 1993 Aug;13(8):4513-22. PMID 7687739

Jackson-Weiss and Crouzon syndromes are allelic with mutations in fibroblast growth factor receptor 2. Jabs EW, Li X, Scott AF, Meyers G, Chen W, Eccles M, Mao JI, Charnas LR, Jackson CE, Jaye M. Nat Genet. 1994 Nov;8(3):275-9. PMID 7874170

Mutations in the fibroblast growth factor receptor 2 gene cause Crouzon syndrome. Reardon W, Winter RM, Rutland P, Pulleyn LJ, Jones BM, Malcolm S. Nat Genet. 1994 Sep;8(1):98-103. PMID 7987400

Characteristics of FGF-receptors expressed by stromal and epithelial cells cultured from normal and hyperplastic prostates. Story MT, Hopp KA, Molter M, Meier DA. Growth Factors. 1994;10(4):269-80. PMID 7528517

Expression of FGF and FGFR genes in human breast cancer.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 794 Penault-Llorca F, Bertucci F, Adelaide J, Parc P, Coulier F, Jacquemier J, Birnbaum D, deLapeyriere O. Int J Cancer 1995; 61: 170-176. PMID 7705943

Keratinocyte growth factor as a cytokine that mediates mesenchymal-epithelial interaction (Review). Rubin JS, Bottaro DP, Chedid M, Miki T, Ron D, Cunha GR, Finch PW. EXS. 1995;74:191-214. PMID 8527895

Apert syndrome results from localized mutations of FGFR2 and is allelic with Crouzon syndrome. Wilkie AO, Slaney SF, Oldridge M, Poole MD, Ashworth GJ, Hockley AD, Hayward RD, David DJ, Pulleyn LJ, Rutland P, Malcolm S, Winter RM, Reardon W. Nat Genet. 1995 Feb;9(2):165-72. PMID 7719344

Expression of FGFR2 BEK and K-SAM mRNA variants in normal and malignant human breast. Luqmani YA, Bansal GS, Mortimer C, Buluwela L, Coombes RC. Eur J Cancer. 1996 Mar;32A(3):518-24. PMID 8814701

Receptor specificity of the fibroblast growth factor family. Ornitz DM, Xu J, Colvin JS, McEwen DG, MacArthur CA, Coulier F, Gao G, Goldfarb M. J Biol Chem. 1996 Jun 21;271(25):15292-7. PMID 8663044

Alternative splicing of fibroblast growth factor receptor 2 (FGF-R2) in human prostate cancer. Carstens RP, Eaton JV, Krigman HR, Walther PJ, Garcia-Blanco MA. Oncogene. 1997 Dec 18;15(25):3059-65. PMID 9444954

Decreased expression of keratinocyte growth factor receptor in a subset of human transitional cell bladder carcinomas. Diez de Medina SG, Chopin D, El Marjou A, Delouvee A, LaRochelle WJ, Hoznek A, Abbou C, Aaronson SA, Thiery JP, Radvanyi F. Oncogene. 1997 Jan 23;14(3):323-30. PMID 9018118

Craniosynostosis: genes and mechanisms (Review). Wilkie AO Hum Mol Genet. 1997;6(10):1647-56. PMID 9300656

An intronic sequence element mediates both activation and repression of rat fibroblast growth factor receptor 2 pre-mRNA splicing. Carstens RP, McKeehan WL, Garcia-Blanco MA. Mol Cell Biol. 1998 Apr;18(4):2205-17. PMID 9528792

Inhibition of growth of malignant rat prostate tumor cells by restoration of fibroblast growth factor receptor 2. Matsubara A, Kan M, Feng S, McKeehan WL. Cancer Res. 1998 Apr 1;58(7):1509-14. PMID 9537256

Genetic heterogeneity of Saethre-Chotzen syndrome, due to TWIST and FGFR mutations. Paznekas WA, Cunningham ML, Howard TD, Korf BR, Lipson MH, Grix AW, Feingold M, Goldberg R, Borochowitz Z, Aleck K, Mulliken J, Yin M, Jabs EW.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 795 Am J Hum Genet. 1998 Jun;62(6):1370-80. PMID 9585583

Clinical spectrum of fibroblast growth factor receptor mutations (Review). Passos-Bueno MR, Wilcox WR, Jabs EW, Sertie AL, Alonso LG, Kitoh H. Hum Mutat. 1999;14(2):115-25. PMID 10425034

Tumour suppressive properties of fibroblast growth factor receptor 2-IIIb in human bladder cancer. Ricol D, Cappellen D, El Marjou A, Gil-Diez-de-Medina S, Girault JM, Yoshida T, Ferry G, Tucker G, Poupon MF, Chopin D, Thiery JP, Radvanyi F. Oncogene. 1999 Dec 2;18(51):7234-43. PMID 10602477

An intronic splicing silencer causes skipping of the IIIb exon of fibroblast growth factor receptor 2 through involvement of polypyrimidine tract binding protein. Carstens RP, Wagner EJ, Garcia-Blanco MA. Mol Cell Biol. 2000 Oct;20(19):7388-400. PMID 10982855

Negative autoregulation of fibroblast growth factor receptor 2 expression characterizing cranial development in cases of Apert (P253R mutation) and Pfeiffer (C278F mutation) syndromes and suggesting a basis for differences in their cranial phenotypes. Britto JA, Moore RL, Evans RD, Hayward RD, Jones BM. J Neurosurg. 2001 Oct;95(4):660-73. PMID 11596961

CGH, cDNA and tissue microarray analyses implicate FGFR2 amplification in a small subset of breast tumors. Heiskanen M, Kononen J, Barlund M, Torhorst J, Sauter G, Kallioniemi A, Kallioniemi O. Anal Cell Pathol. 2001;22(4):229-34. PMID 11564899

Fibroblast growth factor receptor 2 (FGFR2): genomic sequence and variations. Ingersoll RG, Paznekas WA, Tran AK, Scott AF, Jiang G, Jabs EW. Cytogenet Cell Genet. 2001;94(3-4):121-6. PMID 11856867

Mutations in fibroblast growth factor receptor 2 and fibroblast growth factor receptor 3 genes associated with human gastric and colorectal cancers. Jang JH, Shin KH, Park JG. Cancer Res. 2001 May 1;61(9):3541-3. PMID 11325814

Uncoupling fibroblast growth factor receptor 2 ligand binding specificity leads to Apert syndrome-like phenotypes. Yu K, Ornitz DM. Proc Natl Acad Sci U S A. 2001 Mar 27;98(7):3641-3. PMID 11274381

Genomic screening of fibroblast growth factor receptor 2 reveals a wide spectrum of mutations in patients with syndromic craniosynostosis. Kan SH, Elanko N, Johnson D, Cornejo-Roldan L, Cook J, Reich EW, Tomkins S, Verloes A, Twigg SR, Rannan-Eliya S, McDonald-McGinn DM, Zackai EH, Wall SA, Muenke M, Wilkie AO. Am J Hum Genet. 2002 Feb;70(2):472-86. PMID 11781872

WNT and FGF gene clusters (Review). Katoh M.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 796 Int J Oncol. 2002 Dec;21(6):1269-73. PMID 12429977

FGFs, their receptors, and human limb malformations: clinical and molecular correlations (Review). Wilkie AOM, Patey SJ, Kan SH. van den Ouweland AMW, Hamel BCJ. Am J Med Genet. 2002 Oct 15;112(3):266-78. PMID 12357470

FGFR2 and WDR11 are neighboring oncogene and tumor suppressor gene on human chromosome 10q26. Katoh M, Katoh M. Int J Oncol. 2003 May;22(5):1155-9. PMID 12684685

Beare-Stevenson syndrome: two South American patients with FGFR2 analysis. Vargas RA, Maegawa GH, Taucher SC, Leite JC, Sanz P, Cifuentes J, Parra M, Munoz H, Maranduba CM, Passos-Bueno MR. Am J Med Genet A. 2003 Aug 15;121A(1):41-6. PMID 12900900

Structural basis by which alternative splicing confers specificity in fibroblast growth factor receptors. Yeh BK, Igarashi M, Eliseenkova AV, Plotnikov AN, Sher I, Ron D, Aaronson SA, Mohammadi M. Proc Natl Acad Sci U S A. 2003 Mar 4;100(5):2266-71. PMID 12591959

Transforming potential of alternatively spliced variants of fibroblast growth factor receptor 2 in human mammary epithelial cells. Moffa AB, Tannheimer SL, Ethier SP. Mol Cancer Res. 2004 Nov;2(11):643-52. PMID 15561780

Cellular signaling by fibroblast growth factor receptors (Review). Eswarakumar VP, Lax I, Schlessinger J. Cytokine Growth Factor Rev. 2005 Apr;16(2):139-49. PMID 15863030

Bad bones, absent smell, selfish testes: the pleiotropic consequences of human FGF receptor mutations (Review). Wilkie AOM. Cytokine Growth Factor Rev. 2005 Apr;16(2):187-203. PMID 15863034

Connerney J, Andreeva V, Leshem Y, Muentener C, Mercado MA, Spicer DB. Dev Dyn. 2006 May;235(5):1345-57. PMID 16502419

Somatic mutations of the protein kinase gene family in human lung cancer. Davies H, Hunter C, Smith R, Stephens P, Greenman C, Bignell G, Teague J, Butler A, Edkins S, Stevens C, Parker A, O'Meara S, Avis T, Barthorpe S, Brackenbury L, Buck G, Clements J, Cole J, Dicks E, Edwards K, Forbes S, Gorton M, Gray K, Halliday K, Harrison R, Hills K, Hinton J, Jones D, Kosmidou V, Laman R, Lugg R, Menzies A, Perry J, Petty R, Raine K, Shepherd R, Small A, Solomon H, Stephens Y, Tofts C, Varian J, Webb A, West S, Widaa S, Yates A, Brasseur F, Cooper CS, Flanagan AM, Green A, Knowles M, Leung SY, Looijenga LH, Malkowicz B, Pierotti MA, Teh BT, Yuen ST, Lakhani SR, Easton DF, Weber BL, Goldstraw P, Nicholson AG, Wooster R, Stratton MR, Futreal PA. Cancer Res. 2005 Sep 1;65(17):7591-5. PMID 16140923

Atlas Genet Cytogenet Oncol Haematol 2009; 6 797 FGF signaling network in the gastrointestinal tract (Review). Katoh M, Katoh M. Int J Oncol. 2006 Jul;29(1):163-8.

Receptor specificity of the fibroblast growth factor family. The complete mammalian FGF family. Zhang X, Ibrahimi OA, Olsen SK, Umemori H, Mohammadi M, Ornitz DM. J Biol Chem. 2006 Jun 9;281(23):15694-700. PMID 16597617

Aberrant fibroblast growth factor receptor signaling in bladder and other cancers. (Review) Chaffer CL, Dopheide B, Savagner P, Thompson EW, Williams ED Differentiation. 2007 Nov;75(9):831-42. PMID 17697126

A molecular brake in the kinase hinge region regulates the activity of receptor tyrosine kinases. Chen H, Ma J, Li W, Eliseenkova AV, Xu C, Neubert TA, Miller WT, Mohammadi M. Mol Cell. 2007 Sep 7;27(5):717-30. PMID 17803937

Genome-wide association study identifies novel breast cancer susceptibility loci. Easton DF, Pooley KA, Dunning AM, Pharoah PD, Thompson D, Ballinger DG, Struewing JP, Morrison J, Field H, Luben R, Wareham N, Ahmed S, Healey CS, Bowman R; SEARCH collaborators, Meyer KB, Haiman CA, Kolonel LK, Henderson BE, Le Marchand L, Brennan P, Sangrajrang S, Gaborieau V, Odefrey F, Shen CY, Wu PE, Wang HC, Eccles D, Evans DG, Peto J, Fletcher O, Johnson N, Seal S, Stratton MR, Rahman N, Chenevix-Trench G, Bojesen SE, Nordestgaard BG, Axelsson CK, Garcia-Closas M, Brinton L, Chanock S, Lissowska J, Peplonska B, Nevanlinna H, Fagerholm R, Eerola H, Kang D, Yoo KY, Noh DY, Ahn SH, Hunter DJ, Hankinson SE, Cox DG, Hall P, Wedren S, Liu J, Low YL, Bogdanova N, Schurmann P, Dork T, Tollenaar RA, Jacobi CE, Devilee P, Klijn JG, Sigurdson AJ, Doody MM, Alexander BH, Zhang J, Cox A, Brock IW, MacPherson G, Reed MW, Couch FJ, Goode EL, Olson JE, Meijers-Heijboer H, van den Ouweland A, Uitterlinden A, Rivadeneira F, Milne RL, Ribas G, Gonzalez-Neira A, Benitez J, Hopper JL, McCredie M, Southey M, Giles GG, Schroen C, Justenhoven C, Brauch H, Hamann U, Ko YD, Spurdle AB, Beesley J, Chen X; kConFab; AOCS Management Group, Mannermaa A, Kosma VM, Kataja V, Hartikainen J, Day NE, Cox DR, Ponder BA Nature. 2007 Jun 28;447(7148):1087-93. PMID 17529967

Clinical correlates of low-risk variants in FGFR2, TNRC9, MAP3K1, LSP1 and 8q24 in a Dutch cohort of incident breast cancer cases. Huijts PE, Vreeswijk MP, Kroeze-Jansema KH, Jacobi CE, Seynaeve C, Krol-Warmerdam EM, Wijers- Koster PM, Blom JC, Pooley KA, Klijn JG, Tollenaar RA, Devilee P, van Asperen CJ. Breast Cancer Res. 2007;9(6):R78. PMID 17997823

A genome-wide association study identifies alleles in FGFR2 associated with risk of sporadic postmenopausal breast cancer. Hunter DJ, Kraft P, Jacobs KB, Cox DG, Yeager M, Hankinson SE, Wacholder S, Wang Z, Welch R, Hutchinson A, Wang J, Yu K, Chatterjee N, Orr N, Willett WC, Colditz GA, Ziegler RG, Berg CD, Buys SS, McCarty CA, Feigelson HS, Calle EE, Thun MJ, Hayes RB, Tucker M, Gerhard DS, Fraumeni JF Jr, Hoover RN, Thomas G, Chanock SJ. Nat Genet. 2007 Jul;39(7):870-4. PMID 17529973

Dysregulation of stem cell signaling network due to germline mutation, SNP, Helicobacter pylori infection, epigenetic change and genetic alteration in gastric cancer (Review). Katoh M. Cancer Biol Ther. 2007 Jun;6(6):832-9. PMID 17568183

Atlas Genet Cytogenet Oncol Haematol 2009; 6 798

Frequent activating FGFR2 mutations in endometrial carcinomas parallel germline mutations associated with craniosynostosis and skeletal dysplasia syndromes. Pollock PM, Gartside MG, Dejeza LC, Powell MA, Mallon MA, Davies H, Mohammadi M, Futreal PA, Stratton MR, Trent JM, Goodfellow PJ. Oncogene. 2007 Nov 1;26(50):7158-62. PMID 17525745

Involvement of fibroblast growth factor receptor 2 isoform switching in mammary oncogenesis. Cha JY, Lambert QT, Reuther GW, Der CJ. Mol Cancer Res. 2008 Mar;6(3):435-45. PMID 18337450

Drug-sensitive FGFR2 mutations in endometrial carcinoma. Dutt A, Salvesen HB, Chen TH, Ramos AH, Onofrio RC, Hatton C, Nicoletti R, Winckler W, Grewal R, Hanna M, Wyhs N, Ziaugra L, Richter DJ, Trovik J, Engelsen IB, Stefansson IM, Fennell T, Cibulskis K, Zody MC, Akslen LA, Gabriel S, Wong KK, Sellers WR, Meyerson M, Greulich H. Proc Natl Acad Sci U S A. 2008 Jun 24;105(25):8713-7.

Cancer genomics and genetics of FGFR2 (Review). Katoh M. Int J Oncol. 2008 Aug;33(2):233-7. PMID 18636142

Fibroblast growth factor receptor 2 phosphorylation on serine 779 couples to 14-3-3 and regulates cell survival and proliferation. Lonic A, Barry EF, Quach C, Kobe B, Saunders N, Guthridge MA. Mol Cell Biol. 2008 May;28(10):3372-85. PMID 18332103

Allele-specific up-regulation of FGFR2 increases susceptibility to breast cancer. Meyer KB, Maia AT, O'Reilly M, Teschendorff AE, Chin SF, Caldas C, Ponder BA. PLoS Biol. 2008 May 6;6(5):e108. PMID 18462018

FGFR2 is a breast cancer susceptibility gene in Jewish and Arab Israeli population Raskin L, Pinchev M, Arad C, Lejbkowicz F, Tamir A, Rennert HS, Rennert G, Gruber SB. Cancer Epidemiol Biomarkers Prev. 2008 May;17(5):1060-5. PMID 18483326

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Masaru Katoh Genetics and Cell Biology Section, National Cancer Center, Japan Citation This paper should be referenced as such : Katoh M . FGFR2 (fibroblast growth factor receptor 2). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/FGFR2ID40570ch10q26.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 799 Atlas of Genetics and Cytogenetics in Oncology and Haematology

MAPK6 (mitogen-activated protein kinase 6)

Identity Other names ERK3 PRKM6 p97MAPK HGNC (Hugo) MAPK6 Location 15q21.2 Location_base_pair Starts at 50098703 and ends at 50145753 bp from pter ( according to hg18- Mar_2006) [Mapping] The MAPK6 gene is located between the genes LEO1 and BCL2L10 on Local_order chromosome 15. DNA/RNA

Genomic organization of the MAPK6 gene on chromosome 15. Description The MAPK6 gene spans 47.01 kb on the long arm of chromosome 15 and is transcribed in the centromere-to-telomere orientation. The gene is composed of 6 exons with the translation initiation codon located in exon 2. The first two exons are separated by a long intron of 26.45 kb. Transcription The MAPK6 transcribed mRNA has 4,186 bp. No splice variants have been reported. Pseudogene Database analysis reveals the presence of six MAPK6 pseudogenes localized on four different chromosomes: MAPK6PS1 (8q11.23), MAPK6PS2 (21q21.1), MAPK6PS3 (13q14.13), MAPK6PS4 (8q11.1), MAPK6PS5 (8q23.1) and MAPK6PS6 (10q11.23). All six loci contain intronless copies of MAPK6 and display the features of processed pseudogenes. Protein

Schematic representation of the ERK3 protein structure. Kinase, catalytic kinase domain; C34 conserved region in ERK3 and ERK4; SEG, activation loop motif containing the regulatory phosphorylation residue Ser189. Description Extracellular signal-regulated kinase 3 (ERK3) is an atypical member of the mitogen- activated protein (MAP) kinase family of serine/threonine kinases. The human ERK3 protein is made of 721 amino acids and contains a typical kinase domain located at the N-terminal extremity. Another region with homology to the MAP kinase ERK4 (C34 domain) has been identified after the kinase domain. The function of the C34 domain is unknown. Expression MAPK6 mRNA is expressed ubiquitously. The highest levels of expression are observed in the skeletal muscle and brain. ERK3 is a highly unstable protein, with a half-life of less than one hour, that is constitutively degraded by the ubiquitin- proteasome pathway. Notably, oncogenic B-Raf signaling markedly up-regulates MAPK6 mRNA and protein levels. Localisation ERK3 localizes to the cytoplasm and nucleus of a variety of cultured cells. Function Little is known about the regulation and functions of ERK3. Overexpression of ERK3 in fibroblasts inhibits S-phase entry, suggesting that ERK3 may act as a negative regulator of cell proliferation in certain cellular contexts. The only known physiological substrate of ERK3 is the protein kinase MK5.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 800 Homology ERK3 display 73% amino acid identity with ERK4 in the kinase domain. ERK4 and ERK3 define a distinct subfamily of MAP kinases that is found exclusively in vertebrates. Mutations Note No mutation reported yet. Implicated in Entity Cancer Note DNA microarray studies have yielded conflicting data about the regulation of MAPK6 expression in cancer. Studies have shown that expression of MAPK6 mRNA is downregulated in brain tumors, ovarian carcinoma and cutaneous melanoma, and upregulated in leukemias, adrenocortical carcinoma, squamous cell lung carcinoma, salivary adenoid cystic carcinoma , tongue squamous cell carcinoma and cervical cancer. In prostate cancer, one study reported an inverse correlation between MAPK6 mRNA levels and the stage of the disease. External links Nomenclature HGNC (Hugo) MAPK6 6879 Entrez_Gene (NCBI) MAPK6 5597 mitogen-activated protein kinase 6 Cards Atlas MAPK6ID43349ch15q21 GeneCards MAPK6 (Weizmann) Ensembl (Hinxton) ENSG00000069956 [Gene_View] MAPK6 [Vega] AceView (NCBI) MAPK6 Genatlas (Paris) MAPK6 euGene (Indiana) 5597 SOURCE (Stanford) NM_002748 Genomic and cartography MAPK6 - 15q21.2 chr15:50098703-50145753 + 15q21 [Description] GoldenPath (UCSC) (hg18-Mar_2006) Ensembl MAPK6 - 15q21 [CytoView] Mapping of MAPK6 [Mapview] homologs : NCBI OMIM 602904 Gene and transcription Gene : Genbank AB451301 AF420474 AK313633 BC035492 CR749401 (Entrez) Reference sequence (RefSeq NM_002748 transcript) :SRS Reference transcript : NM_002748 Entrez RefSeq genomic : AC_000058 AC_000147 NC_000015 NT_010194 NW_001838218 NW_925884 SRS RefSeq genomic : AC_000058 AC_000147 NC_000015 NT_010194 NW_001838218 NW_925884 Entrez Consensus coding sequences : CCDS MAPK6 NCBI Cluster EST : Unigene Hs.411847 [ SRS ] Hs.411847 [ NCBI ] Alternative Splicing : 5343 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : Q16659 (SRS) Q16659 (Expasy) Q16659 (Uniprot) UniProt/SwissProt With graphics : Q16659

Atlas Genet Cytogenet Oncol Haematol 2009; 6 801 InterPro Splice isoforms : Q16659(VarSplice FASTA) VarSplice FASTA Domaine pattern : PROTEIN_KINASE_ATP (PS00107) PROTEIN_KINASE_DOM (PS50011) Prosite (SRS) PROTEIN_KINASE_ST (PS00108) Domain pattern : PROTEIN_KINASE_ATP (PS00107) PROTEIN_KINASE_DOM (PS50011) Prosite (Expaxy) PROTEIN_KINASE_ST (PS00108) Domains : Interpro Erk_3_4_MAPK Prot_kinase_core Protein_kinase_ATP_bd_CS (SRS) Se/Thr_pkinase-rel Ser_thr_pkin_AS Ser_thr_pkinase Domains : Interpro Erk_3_4_MAPK Prot_kinase_core Protein_kinase_ATP_bd_CS (EBI) Se/Thr_pkinase-rel Ser_thr_pkin_AS Ser_thr_pkinase Related proteins : Q16659 CluSTr Domain families : Pkinase (PF00069) Pfam SRS Domain families : Pkinase (PF00069) Pfam Sanger Domain families : pfam00069 Pfam NCBI Domain families : S_TKc (SM00220) Smart EMBL Domain structure : Prot_kinase (PD000001) Prodom (Prabi Lyon) Blocks (Seattle) Q16659 Crystal structure of 2I6L protein : PDB SRS Crystal structure of 2I6L protein : PDBSum Crystal structure of 2I6L protein : IMB Crystal structure of 2I6L protein : PDB RSDB HPRD 04213 Protein Interaction databases DIP (DOE-UCLA) Q16659 IntAct (EBI) Q16659 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : MAPK6 dbSNP NCBI SNP : GeneSNP Utah MAPK6 SNP : HGBase MAPK6 Genetic variants : MAPK6 HAPMAP Somatic Mutations in MAPK6 Cancer : COSMIC Mutations and MAPK6 Diseases : HGMD Hereditary diseases : 602904 OMIM Hereditary diseases : 602904 GENETests Diseases : Genetic MAPK6 Association General knowledge Homologs : MAPK6

Atlas Genet Cytogenet Oncol Haematol 2009; 6 802 HomoloGene Homology/Alignments : Family Browser MAPK6 UCSC Phylogenetic Trees/Animal Genes : MAPK6 TreeFam Catalytic activity : 2.7.11.24 [ Enzyme-Expasy ] 2.7.11.24 [ Enzyme-SRS ] 2.7.11.24 [ IntEnz- Enzyme EBI ] 2.7.11.24 [ BRENDA ] 2.7.11.24 [ KEGG ] Chemical/Protein 5597 Interactions : CTD nucleotide binding protein serine/threonine kinase activity MAP kinase Keywords Ontology : activity protein binding ATP binding cytoplasm protein amino acid AmiGO phosphorylation cell cycle signal transduction transferase activity nucleotide binding protein serine/threonine kinase activity MAP kinase Keywords Ontology : activity protein binding ATP binding cytoplasm protein amino acid EGO-EBI phosphorylation cell cycle signal transduction transferase activity Pathways : MAPKinase Signaling Pathway [Genes] BIOCARTA Other databases Probes Probes : Imagenes MAPK6 Related clones (RZPD - Berlin) Literature PubMed 16 Pubmed reference(s) in Entrez PubGene MAPK6 Bibliography ERKs: a family of protein-serine/threonine kinases that are activated and tyrosine phosphorylated in response to insulin and NGF. Boulton TG, Nye SH, Robbins DJ, Ip NY, Radziejewska E, Morgenbesser SD, DePinho RA, Panayotatos N, Cobb MH, Yancopoulos GD. Cell. 1991 May 17;65(4):663-75. PMID 2032290

Cloning and characterization of p97MAPK, a novel human homolog of rat ERK-3. Zhu AX, Zhao Y, Moller DE, Flier JS. Mol Cell Biol. 1994 Dec;14(12):8202-11. PMID 7969157

Primary structure, expression and chromosomal locus of a human homolog of rat ERK3. Meloche S, Beatty BG, Pellerin J. Oncogene. 1996 Oct 3;13(7):1575-9. PMID 8875998

Cloning and characterization of mouse extracellular-signal-regulated protein kinase 3 as a unique gene product of 100 kDa. Turgeon B, Saba-El-Leil MK, Meloche S. Biochem J. 2000 Feb 15;346 Pt 1:169-75. PMID 10657254

The protein kinase ERK3 is encoded by a single functional gene: genomic analysis of the ERK3 gene family. Turgeon B, Lang BF, Meloche S. Genomics. 2002 Dec;80(6):673-80. PMID 12504858

Rapid turnover of extracellular signal-regulated kinase 3 by the ubiquitin-proteasome pathway defines a novel paradigm of mitogen-activated protein kinase regulation during cellular differentiation.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 803 Coulombe P, Rodier G, Pelletier S, Pellerin J, Meloche S. Mol Cell Biol. 2003 Jul;23(13):4542-58. PMID 12808096

Induction of p97MAPK expression regulates collagen mediated inhibition of proliferation and migration in human squamous cell carcinoma lines. Crowe DL. Int J Oncol. 2004 May;24(5):1159-63. PMID 15067337

Activation of MK5/PRAK by the atypical MAP kinase ERK3 defines a novel signal transduction pathway. Seternes OM, Mikalsen T, Johansen B, Michaelsen E, Armstrong CG, Morrice NA, Turgeon B, Meloche S, Moens U, Keyse SM. EMBO J. 2004 Dec 8;23(24):4780-91. Epub 2004 Dec 2. PMID 15577943

Scaffolding by ERK3 regulates MK5 in development. Schumacher S, Laass K, Kant S, Shi Y, Visel A, Gruber AD, Kotlyarov A, Gaestel M. EMBO J. 2004 Dec 8;23(24):4770-9. Epub 2004 Nov 11. PMID 15538386

Regulation of ERK3/MAPK6 expression by BRAF. Hoeflich KP, Eby MT, Forrest WF, Gray DC, Tien JY, Stern HM, Murray LJ, Davis DP, Modrusan Z, Seshagiri S. Int J Oncol. 2006 Oct;29(4):839-49. PMID 16964379

Atypical mitogen-activated protein kinases: structure, regulation and functions. Coulombe P, Meloche S. Biochim Biophys Acta. 2007 Aug;1773(8):1376-87. Epub 2006 Nov 7. PMID 17161475

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Sylvain Meloche Institut de Recherche en Immunologie et Cancerologie, Universite de Montreal, Montreal, Quebec H3C 3J7, Canada Citation This paper should be referenced as such : Meloche S . MAPK6 (mitogen-activated protein kinase 6). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/MAPK6ID43349ch15q21.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 804 Atlas of Genetics and Cytogenetics in Oncology and Haematology

MIRN125A (microRNA 125a)

Identity Other names hsa-mir-125a miR-125a HGNC (Hugo) MIR125A Location 19q13.33 Location_base_pair Starts at 56888319 and ends at 56888404 bp from pter Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR- 125a oriented from centromere to telomere on 19q13.33 are: SIGLEC5 (19q13.3): Sialic acid binding Ig-like lectin 5 SIGLEC14 (19q13.4): Sialic acid binding Ig-like lectin 14 miR-99B (19q13.33): microRNA 99b miR-LET7E (19q13.33): microRNA let-7e Local_order miR-125a (19q13.33): microRNA 125a LOC147650 (19q13.33): Hypothetical protein LOC147650 HAS1 (19q13.4): Hyaluronan Synthase 1 FPR1 (19q13.4): Formyl Peptide Receptor 1 FPRL1 (19q13.3-q13.4): Formyl Peptide Receptor-like 1 FPRL2 (19q13.3-q13.4): Formyl peptide receptor-like 2 DNA/RNA

Stem-loop structure of miR-125a Description miR-125a gene is located in an intergenic region and it is close to let-7e and miR-99B. The gene cluster coordinates are: miR-99B 19: 56887677-56887746 [+] let-7e 19: 56887851-56887929 [+] miR-125a 19: 56888319-56888404 [+] Transcription MicroRNA genes are generally transcribed by RNA Pol II but can also be transcribed by RNA Pol III, if located downstream of repetitive Alu elements, 5S rRNA, tRNA and U6 snRNA genes. Transcription start site is not known for this microRNA. miR-125a is transcribed as a cluster with let-7e and miR-99b.

Pre-miRNA MicroRNAs are first transcribed as primary microRNAs (pri-miR) which then are processed by RNase III enzyme Drosha and by dsRNA binding protein DGCR8 to form the precursor microRNA (pre-miR). Through Exportin5 mediated transfer mechanism, pre-miR is transferred to the cytoplasm. In the cytoplasm, microRNAs are further processed by Dicer, another RNase III enzyme, finally producing the mature microRNA of around 20 nucleotides.

Pre-miR Length: 86 bases Sequence: 5'- UGCCAGUCUCUAGGUCCCUGAGACCCUUUAACCUGUGAGGA CAUCCAGGGUCACAGGUGAGGUUCUUGGGAGCCUGGCGUCUGG

Atlas Genet Cytogenet Oncol Haematol 2009; 6 805 CC-3'

Mature miR-125a The miR-125a gene has two mature miRNAs in its precursor structure: hsa-mir-125a- 5p and hsa-mir-125a-3p hsa-mir-125a-5p is 24 nucleotides long. 15 - ucccugagacccuuuaaccuguga - 38 hsa-mir-125a-3p is 22 nucleotides long. 53 - acaggugagguucuugggagcc - 74 Pseudogene No reported pseudogenes. Protein Note miRNAs are not translated into amino acids. Implicated in Entity Breast Cancer Note miR-125a and its homolog miR-125b were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR- 125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR-125b in non-transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage- dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells. Entity Prostate Cancer Note MicroRNA levels were examined by microarrays in 10 benign peripheral zone tissues and 16 prostate cancer tissues. Widespread downregulation of miR-125b was shown in prostate cancer tissues. These results were also verified by qRT-PCR. Among 328 known and 152 novel human microRNAs, miR-125b was one of the most downregulated microRNAs in prostate cancer. Some bioinformatically predicted targets of miR-125b were found to be upregulated in prostate cancer, shown by microarray analysis ( EIF4EBP1, RPL29, MGC16063 and PAPB) and immunohistochemistry ( RAS, E2F3, BCL-2 and MCL-1). Increased expression EIF4EBP1 was also confirmed through qRT-PCR, in 61 human prostate tumors and 19 normal tissues. Several microRNA paralogous groups, having high levels of sequence similarity, were also found to be downregulated in prostate cancer. Along with miR-125a, and miR-125b, other members of let-7 family microRNAs were also downregulated. This finding indicated that these microRNAs with similar sequences might potentially target similar mRNAs. Entity Neuroblastoma Note miR-125a and miR-125b transcription was elevated in response to retinoic acid (RA) treatment in human neuroblastoma cell line (SK-N-BE), confirmed by Northern blot and qRT-PCR. Neurotrophin Receptor Tropomyosin-Related Kinase C ( NTRK3 ) is a key regulator protein of the neuroblastoma cell proliferation. Only the truncated form of NTRK3 was found to be a target of both miR-125a and miR-125b. Downregulation of tNTRK3 is critical for growth of neuroblastoma cells. Ectopic expression of miR-125a and miR-125b in primary neuroblastoma cells, (SK-N-BE), resulted in the downregulation of tNTRK3. Downregulation of these microRNAs in neuroblastoma cells resulted in tumor formation whereas upregulation of them resulted in in-vitro neuronal differentiation. External links Nomenclature HGNC (Hugo) MIR125A 31505 Entrez_Gene (NCBI) MIR125A 406910 microRNA 125a Cards Atlas MIRN125AID44325ch19q13 GeneCards MIR125A (Weizmann)

Atlas Genet Cytogenet Oncol Haematol 2009; 6 806 Ensembl (Hinxton) ENSG00000182707 [Gene_View] MIR125A [Vega] AceView (NCBI) MIR125A Genatlas (Paris) MIR125A euGene (Indiana) 406910 SOURCE (Stanford) Genomic and cartography MIR125A - 19q13.33 chr19:56888319-56888404 19 hg18- GoldenPath (UCSC) Mar_2006 [Description] () Ensembl MIR125A - hg18-Mar_2006 [CytoView] Mapping of MIR125A [Mapview] homologs : NCBI OMIM 611191 Gene and transcription RefSeq genomic : NT_011109 SRS RefSeq genomic : NT_011109 Entrez Consensus coding sequences : CCDS MIR125A NCBI Protein : pattern, domain, 3D structure Protein Interaction databases Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : MIR125A dbSNP NCBI SNP : GeneSNP Utah MIR125A SNP : HGBase MIR125A Genetic variants : MIR125A HAPMAP Mutations and MIR125A Diseases : HGMD Hereditary diseases : 611191 OMIM Hereditary diseases : 611191 GENETests Diseases : Genetic MIR125A Association General knowledge Homologs : MIR125A HomoloGene Homology/Alignments : Family Browser MIR125A UCSC Phylogenetic Trees/Animal Genes : MIR125A TreeFam Chemical/Protein 406910 Interactions : CTD Other databases Probes Probes : Imagenes MIR125A Related clones (RZPD - Berlin) Literature PubMed 3 Pubmed reference(s) in Entrez PubGene MIR125A Bibliography

Atlas Genet Cytogenet Oncol Haematol 2009; 6 807 RNA polymerase III transcribes human microRNAs. Borchert GM, Lanier W, Davidson BL. Nat Struct Mol Biol. 2006 Dec;13(12):1097-101. Epub 2006 Nov 12. PMID 17099701

The interplay between microRNAs and the neurotrophin receptor tropomyosin-related kinase C controls proliferation of human neuroblastoma cells. Laneve P, Di Marcotullio L, Gioia U, Fiori ME, Ferretti E, Gulino A, Bozzoni I, Caffarelli E. Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62. Epub 2007 May 1. PMID 17483472

Coordinate suppression of ERBB2 and ERBB3 by enforced expression of micro-RNA miR-125a or miR-125b. Scott GK, Goga A, Bhaumik D, Berger CE, Sullivan CS, Benz CC. J Biol Chem. 2007 Jan 12;282(2):1479-86. Epub 2006 Nov 16. PMID 17110380

Widespread deregulation of microRNA expression in human prostate cancer. Ozen M, Creighton CJ, Ozdemir M, Ittmann M. Oncogene. 2008 Mar 13;27(12):1788-93. Epub 2007 Sep 24. PMID 17891175

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Serkan Tuna, Ayse Elif Erson Department of Biology, Middle East Technical University, Ankara, Turkey Citation This paper should be referenced as such : Tuna S, Erson AE . MIRN125A (microRNA 125a). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/MIRN125AID44325ch19q13.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 808 Atlas of Genetics and Cytogenetics in Oncology and Haematology

MIRN125B1 (microRNA 125b-1)

Identity Other names MIR125B1 hsa-mir-125b-1 HGNC (Hugo) MIR125B1 Location 11q24.1 Location_base_pair Starts at 121475675 and ends at 121475762 bp from pter Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR- 125b1 oriented from centromere to telomere on 11q24.1 are: SC5DL (11q23.3): Sterol-C5-Desaturase (ERG3 delta-5-desaturase homolog, S.cerevisiae)-like LOC283155 (11q24.1): Hypothetical LOC283155 Local_order LOC645470 (11q24.1): Similar to programmed cell death 2 isoform 1 SORL1 (11q23.2-q24.2): Sortilin-Related Receptor, L(DLR class) miR-125b1 (11q24.1): microRNA 125b-1 BLID (11q24.1): BH3-like motif containing, cell death inducer Let-7a2 (11q24.1): microRNA let-7a-2 miR-100 (11q24.1): microRNA 100 DNA/RNA

Stem-loop structure of miR-125b1. Description The gene is located in an intergenic region. Transcription Transcription start site is not known for this microRNA.

Pre-miRNA Pre-miR Length: 88 bases Sequence: 5'-UGCGCUCCUCUCAGUCCCUGAGACCCUAACUUGUGAUGUUUA CCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGUGCU-3'

Mature miR-125b Mature miR-125b can originate from two precursor structures: pre-miR-125b1 and pre - miR-125b2. The mature microRNA resides between the 15th and 36th nucleotides of precursor miR-125b1. Mature miR-125b is 22 nucleotides long. Sequence: miR-125b (from miR-125B1): 15 - ucccugagacccuaacuuguga - 36 Pseudogene No reported pseudogenes. Protein Note miRNAs are not translated into amino acids. Implicated in Entity Breast Cancer Note Among differentially expressed microRNAs in cancers, miR-125b is one of the most consistently deregulated microRNAs in breast cancer. Downregulation of miR-125b suggested that it may potentially act as a tumor suppressor gene. Microarray analysis of

Atlas Genet Cytogenet Oncol Haematol 2009; 6 809 10 normal and 76 neoplastic breast tissues showed downregulation of miR-125 in breast tumors. Although the miR-125b levels in MDA-MB-231 breast cancer cells were comparable to normal breast tissue, in MCF-7, T47D, SK-BR3, BT20 and MDA-MB-175 breast cancer cells showed downregulation of miR-125b. Both microarray analysis and Northern blotting demonstrated low levels of miR-125b transcript in breast cancer cell lines and tumors. In another study, miR-125b along with its homolog; miR-125a were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR-125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR- 125b in non- transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage-dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells. Entity Prostate Cancer Note MicroRNA levels were examined by microarrays in 10 benign peripheral zone tissues and 16 prostate cancer tissues. Widespread downregulation of miR-125b was shown in prostate cancer tissues. These results were also verified by qRT-PCR. Among 328 known and 152 novel human microRNAs, miR-125b was one of the most downregulated microRNAs in prostate cancer. Some bioinformatically predicted targets of miR-125b were found to be upregulated in prostate cancer, shown by microarray analysis ( EIF4EBP1, RPL29, MGC16063 and PAPB) and immunohistochemistry ( RAS, E2F3, BCL-2 and MCL-1). Increased expression EIF4EBP1 was also confirmed through qRT- PCR, in 61 human prostate tumors and 19 normal tissues. Several microRNA paralogous groups, having high levels of sequence similarity, were also found to be downregulated in prostate cancer. Along with miR-125a, and miR-125b, other members of let-7 family microRNAs were also downregulated. This finding indicated that these microRNAs with similar sequences might potentially target similar mRNAs. Interestingly in another study, according to Northern blot analysis in 9 prostatic cell lines, miR-125b was found to be upregulated. 5 fold increase was found in 2 androgen positive prostate cell lines (AI cds1 and AI cds2) compared to androgen negative prostate cell line (AD LN CaP). Moreover, TATA box and Androgen Responsive Elements (AREs) were found in the 5' of the miR-125b gene. Upregulation of miR-125b was also confirmed in response to androgen. Finally, one target of miR-125b, BAK1 (BCL2-antagonist/killer1) was confirmed initially by microarrays and then by luciferase assays. Thus, upregulation of miR-125b in response to androgen resulted with decreased levels of BAK1, an apoptotic protein. Entity Ovarian Cancer Note Through microarray analysis, several microRNAs were found to be deregulated in human ovarian cancer. Among several microRNAs, miR-214, miR-199a and miR-200a were found to be upregulated whereas MIR-100, let-7 family members and miR-125b were the most significantly downregulated microRNAs in ovarian cancer. Downregulation of miR-125b was further confirmed by Northern blotting. 5.5 fold downregulation of miR-125b in primary ovarian tumor compared to normal ovary was shown. Entity Neuroblastoma Note miR-125a and miR-125b transcription was elevated in response to retinoic acid (RA) treatment in human neuroblastoma cell line (SK-N-BE), confirmed by Northern blot and qRT-PCR. Neurotrophin Receptor Tropomyosin-Related Kinase C ( NTRK3) is a key regulator protein of the neuroblastoma cell proliferation. Only the truncated form of NTRK3 was found to be a target of both miR-125a and miR-125b. Downregulation of tNTRK3 is critical for growth of neuroblastoma cells. Ectopic expression of miR-125a and miR-125b in primary neuroblastoma cells, (SK-N-BE), resulted in the downregulation of tNTRK3. Downregulation of these microRNAs in neuroblastoma cells resulted in tumor formation whereas upregulation of them resulted in in-vitro neuronal differentiation.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 810 Entity Squamous Cell Carcinoma Note Expression levels of 156 human mature microRNAs were analyzed by using real-time quantitative PCR in 20 paired tongue squamous cell carcinoma (SCC) and normal tissues. Apart from the upregulated microRNAs in SCC, miR-125b was one of the downregulated microRNAs. It was found that miR-125b was downregulated 4.7 fold in SCC compared to normal tissue. Entity Other cancers/Immune System Note Deregulation of miR-125b2 in differentiated cancer cells was shown by primer extension assays through comparison of transcript levels. Depletion of miR-125b2 by siRNA in PC-3 (prostate cancer) and HeLa cells ( cervical cancer) inhibited cell proliferation. Further, upregulation of miR-125b was shown in response to retinoic acid treatment during differentiation of cells in culture. Thus, it was concluded that miR-125b was essential for proliferation of differentiated cells. miR-125b was also reported to have a role in innate immunity. Downregulation of miR- 125b was observed in response to lipopolysaccharide (LPS), an endotoxin, stimulation in mouse Raw 264.7 macrophages. Moreover, miR-125b level oscillated in response to TNF-alpha. miR-125b was shown to target 3' UTR of TNF-alpha, thus interfered with the cellular levels of TNF-alpha. Downregulation of miR-125b in response to LPS was required to increase the cellular levels of TNF-alpha. Entity Osteoblastic Differentiation Note According to microRNA microarray analysis, miR-125b expression level was found to be weakly downregulated in mouse mesenchymal stem cells. This finding indicated that miR-125b could have a role in osteoblastic differentiation. Expression level of miR-125b was found to be time dependent in ST2 cells (mesenchymal stem cell). Ectopic expression of miR-125b inhibited the proliferation of ST2 cells during differentiation and thus, inhibited the osteoblastic cell differentiation. On the other hand, silencing of miR- 125b promoted osteoblastic differentiation. External links Nomenclature HGNC (Hugo) MIR125B1 31506 Entrez_Gene (NCBI) MIR125B1 406911 microRNA 125b-1 Cards Atlas MIRN125B1ID44326ch11q24 GeneCards MIR125B1 (Weizmann) Ensembl (Hinxton) ENSG00000182707 [Gene_View] MIR125B1 [Vega] AceView (NCBI) MIR125B1 Genatlas (Paris) MIR125B1 euGene (Indiana) 406911 Genomic and cartography MIR125B1 - 11q24.1 chr11:121475675-121475762 11 hg18- GoldenPath (UCSC) Mar_2006 [Description] () Ensembl MIR125B1 - hg18-Mar_2006 [CytoView] Mapping of MIR125B1 [Mapview] homologs : NCBI OMIM 610104 Gene and transcription RefSeq genomic : NT_033899 SRS RefSeq genomic : NT_033899 Entrez Consensus coding sequences : CCDS MIR125B1 NCBI Protein : pattern, domain, 3D structure Protein Interaction databases Polymorphism : SNP, mutations, diseases

Atlas Genet Cytogenet Oncol Haematol 2009; 6 811 Single Nucleotide Polymorphism (SNP) : MIR125B1 dbSNP NCBI SNP : GeneSNP Utah MIR125B1 SNP : HGBase MIR125B1 Genetic variants : MIR125B1 HAPMAP Mutations and MIR125B1 Diseases : HGMD Hereditary diseases : 610104 OMIM Hereditary diseases : 610104 GENETests Diseases : Genetic MIR125B1 Association General knowledge Homologs : MIR125B1 HomoloGene Homology/Alignments : Family Browser MIR125B1 UCSC Phylogenetic Trees/Animal Genes : MIR125B1 TreeFam Chemical/Protein 406911 Interactions : CTD Other databases Probes Probes : Imagenes MIR125B1 Related clones (RZPD - Berlin) Literature PubMed 3 Pubmed reference(s) in Entrez PubGene MIR125B1 Bibliography MicroRNA gene expression deregulation in human breast cancer. Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Menard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM. Cancer Res. 2005 Aug 15;65(16):7065-70. PMID 16103053

Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cells but not for the down-regulation of putative targets during differentiation. Lee YS, Kim HK, Chung S, Kim KS, Dutta A. J Biol Chem. 2005 Apr 29;280(17):16635-41. Epub 2005 Feb 18. PMID 15722555

RNA polymerase III transcribes human microRNAs. Borchert GM, Lanier W, Davidson BL. Nat Struct Mol Biol. 2006 Dec;13(12):1097-101. Epub 2006 Nov 12. PMID 17099701

Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha

Atlas Genet Cytogenet Oncol Haematol 2009; 6 812 stimulation and their possible roles in regulating the response to endotoxin shock. Tili E, Michaille JJ, Cimino A, Costinean S, Dumitru CD, Adair B, Fabbri M, Alder H, Liu CG, Calin GA, Croce CM. J Immunol. 2007 Oct 15;179(8):5082-9. PMID 17911593

An androgen-regulated miRNA suppresses Bak1 expression and induces androgen- independent growth of prostate cancer cells. Shi XB, Xue L, Yang J, Ma AH, Zhao J, Xu M, Tepper CG, Evans CP, Kung HJ, deVere White RW. Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19983-8. Epub 2007 Dec 3. PMID 18056640 miR-125b inhibits osteoblastic differentiation by down-regulation of cell proliferation. Mizuno Y, Yagi K, Tokuzawa Y, Kanesaki-Yatsuka Y, Suda T, Katagiri T, Fukuda T, Maruyama M, Okuda A, Amemiya T, Kondoh Y, Tashiro H, Okazaki Y. Biochem Biophys Res Commun. 2008 Apr 4;368(2):267-72. Epub 2008 Jan 28. PMID 18230348

Widespread deregulation of microRNA expression in human prostate cancer. Ozen M, Creighton CJ, Ozdemir M, Ittmann M. Oncogene. 2008 Mar 13;27(12):1788-93. Epub 2007 Sep 24. PMID 17891175

Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue. Wong TS, Liu XB, Wong BY, Ng RW, Yuen AP, Wei WI. Clin Cancer Res. 2008 May 1;14(9):2588-92. PMID 18451220

MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. Yang H, Kong W, He L, Zhao JJ, O'Donnell JD, Wang J, Wenham RM, Coppola D, Kruk PA, Nicosia SV, Cheng JQ. Cancer Res. 2008 Jan 15;68(2):425-33. PMID 18199536

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Serkan Tuna, Ayse Elif Erson Department of Biology, Middle East Technical University, Ankara, Turkey Citation This paper should be referenced as such : Tuna S, Erson AE . MIRN125B1 (microRNA 125b-1). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/MIRN125B1ID44326ch11q24.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 813 Atlas of Genetics and Cytogenetics in Oncology and Haematology

MIRN125B2 (microRNA 125b-2)

Identity Other names MIR125B2 hsa-mir-125b-2 miR-125b-2 HGNC (Hugo) MIR125B2 Location 21q21.1 Location_base_pair Starts at 16884428 and ends at 16884516 bp from pter Based on Mapviewer (Master Map: Genes on sequence), genes flanking miR- 125b2 oriented from centromere to telomere on 21q21.1 are: LOC100131399 (21q21.1): Hypothetical LOC100131399 USP25 (21q11.2): Ubiquitin Specific Peptidase 25 VDAC2P (21q11.2): Voltage-Dependent Anion Channel 2 pseudogene C21orf34 (21q21.1): Chromosome 21 open reading frame 34 miR-99A (21q21.1): microRNA 99a Local_order miR-LET7C (21q21.1): microRNA let-7c miR-125b2 (21q21.1): microRNA 125b-2 TRNAG-GCC (21q21.1): Transfer RNA Glycine (anticodon GCC) LOC100131401 (21q21.1): Similar to hCG2008008 CXADR (21q21.1): Coxsackie virus and Adenovirus receptor BTG3 (21q21.1-q21.2): BTG family, member 3 C21orf91 (21q21.1): Chromosome 21 open reading frame 91 DNA/RNA

Stem-loop structure of miR-125b2 Description The gene is located in the intronic region of C21orf34. Transcription Transcription start site for this microRNA is not known.

Pre-miRNA Pre-miR Length: 89 bases Sequence: 5'-ACCAGACUUUUCCUAGUCCCUGAGACCCUAACUUGUGAGGUA UUUUAGUAACAUCACAAGUCAGGCUCUUGGGACCUAGGCGGA GGGGA-3'

Mature miR-125b Mature miR-125b can originate from two precursor structures: pre-miR-125b1 and pre- miR-125b2. The mature microRNA resides between the 17th and 38th nucleotides of precursor miR-125b2. Mature miR-125b is 22 nucleotides long. Sequence: miR-125b (from miR-125B2): 17 - ucccugagacccuaacuuguga - 38 Pseudogene No reported pseudogenes. Protein Note miRNAs are not translated into amino acids.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 814 Implicated in Entity Breast Cancer Note Among differentially expressed microRNAs in cancers, miR-125b is one of the most consistently deregulated microRNAs in breast cancer. Downregulation of miR-125b suggested that it may potentially act as a tumor suppressor gene. Microarray analysis of 10 normal and 76 neoplastic breast tissues showed downregulation of miR-125 in breast tumors. Although the miR-125b levels in MDA-MB-231 breast cancer cells were comparable to normal breast tissue, in MCF-7, T47D, SK-BR3, BT20 and MDA-MB-175 breast cancer cells showed downregulation of miR-125b. Both microarray analysis and Northern blotting demonstrated low levels of miR-125b transcript in breast cancer cell lines and tumors. In another study, miR-125b along with its homolog; miR-125a were identified to be significantly downregulated in ERBB2-amplified and overexpressing breast cancers. Ectopic expression of miR-125a and miR-125b in the ERBB2 dependent human breast cancer line, SKBR3, caused suppression of its anchorage-dependent growth and inhibition of its mobility and invasive capabilities. Ectopic expression miR-125a and miR- 125b in non- transformed and ERBB2-independent MCF10a cells produced inhibitory effects on its anchorage-dependent growth and no significant impact on the mobility of these non-invasive human breast epithelial cells. Furthermore, miR-125a and miR-125b targets, ERBB2 and ERBB3, were downregulated when these two microRNAs were expressed in SKBR3 cells. Downregulation of ERBB2 and ERBB3 decreased the motility and invasiveness features of SKBR3 cells. Entity Prostate Cancer Note MicroRNA levels were examined by microarrays in 10 benign peripheral zone tissues and 16 prostate cancer tissues. Widespread downregulation of miR-125b was shown in prostate cancer tissues. These results were also verified by qRT-PCR. Among 328 known and 152 novel human microRNAs, miR-125b was one of the most downregulated microRNAs in prostate cancer. Some bioinformatically predicted targets of miR-125b were found to be upregulated in prostate cancer, shown by microarray analysis ( EIF4EBP1, RPL29, MGC16063 and PAPB) and immunohistochemistry ( RAS, E2F3, BCL-2 and MCL-1). Increased expression EIF4EBP1 was also confirmed through qRT- PCR, in 61 human prostate tumors and 19 normal tissues. Several microRNA paralogous groups, having high levels of sequence similarity, were also found to be downregulated in prostate cancer. Along with miR-125a, and miR-125b, other members of let-7 family microRNAs were also downregulated. This finding indicated that these microRNAs with similar sequences might potentially target similar mRNAs. Interestingly in another study, according to Northern blot analysis in 9 prostatic cell lines, miR-125b was found to be upregulated. 5 fold increase was found in 2 androgen positive prostate cell lines (AI cds1 and AI cds2) compared to androgen negative prostate cell line (AD LN CaP). Moreover, TATA box and Androgen Responsive Elements (AREs) were found in the 5' of the miR-125b gene. Upregulation of miR-125b was also confirmed in response to androgen. Finally, one target of miR-125b, BAK1 (BCL2-antagonist/killer1) was confirmed initially by microarrays and then by luciferase assays. Thus, upregulation of miR-125b in response to androgen resulted with decreased levels of BAK1, an apoptotic protein. Entity Ovarian Cancer Note Through microarray analysis, several microRNAs were found to be deregulated in human ovarian cancer. Among several microRNAs, miR-214, miR-199a and miR-200a were found to be upregulated whereas miR-100, let-7 family members and miR-125b were the most significantly downregulated microRNAs in ovarian cancer. Downregulation of miR-125b was further confirmed by Northern blotting. 5.5 fold downregulation of miR-125b in primary ovarian tumor compared to normal ovary was shown. Entity Neuroblastoma Note miR-125a and miR-125b transcription was elevated in response to retinoic acid (RA) treatment in human neuroblastoma cell line (SK-N-BE), confirmed by Northern blot and qRT-PCR. Neurotrophin Receptor Tropomyosin-Related Kinase C ( NTRK3) is a key regulator protein of the neuroblastoma cell proliferation. Only the truncated form of NTRK3 was found to be a target of both miR-125a and miR-125b. Downregulation of

Atlas Genet Cytogenet Oncol Haematol 2009; 6 815 tNTRK3 is critical for growth of neuroblastoma cells. Ectopic expression of miR-125a and miR-125b in primary neuroblastoma cells, (SK-N-BE), resulted in the downregulation of tNTRK3. Downregulation of these microRNAs in neuroblastoma cells resulted in tumor formation whereas upregulation of them resulted in in-vitro neuronal differentiation. Entity Squamous Cell Carcinoma Note Expression levels of 156 human mature microRNAs were analyzed by using real-time quantitative PCR in 20 paired tongue squamous cell carcinoma (SCC) and normal tissues. Apart from the upregulated microRNAs in SCC, miR-125b was one of the downregulated microRNAs. It was found that miR-125b was downregulated 4.7 fold in SCC compared to normal tissue. Entity Other cancers/Immune System Note Deregulation of miR-125b2 in differentiated cancer cells was shown by primer extension assays through comparison of transcript levels. Depletion of miR-125b2 by siRNA in PC-3 (prostate cancer) and HeLa cells ( cervical cancer) inhibited cell proliferation. Further, upregulation of miR-125b was shown in response to retinoic acid treatment during differentiation of cells in culture. Thus, it was concluded that miR-125b was essential for proliferation of differentiated cells. miR-125b was also reported to have a role in innate immunity. Downregulation of miR- 125b was observed in response to lipopolysaccharide (LPS), an endotoxin, stimulation in mouse Raw 264.7 macrophages. Moreover, miR-125b level oscillated in response to TNF-alpha. miR-125b was shown to target 3' UTR of TNF-alpha, thus interfered with the cellular levels of TNF-alpha. Downregulation of miR-125b in response to LPS was required to increase the cellular levels of TNF-alpha. Entity Osteoblastic Differentiation Note According to microRNA microarray analysis, miR-125b expression level was found to be weakly downregulated in mouse mesenchymal stem cells. This finding indicated that miR-125b could have a role in osteoblastic differentiation. Expression level of miR-125b was found to be time dependent in ST2 cells (mesenchymal stem cell). Ectopic expression of miR-125b inhibited the proliferation of ST2 cells during differentiation and thus, inhibited the osteoblastic cell differentiation. On the other hand, silencing of miR- 125b promoted osteoblastic differentiation. External links Nomenclature HGNC (Hugo) MIR125B2 31507 Entrez_Gene (NCBI) MIR125B2 406912 microRNA 125b-2 Cards Atlas MIRN125B2ID44327ch21q21 GeneCards MIR125B2 (Weizmann) Ensembl (Hinxton) ENSG00000182707 [Gene_View] MIR125B2 [Vega] AceView (NCBI) MIR125B2 Genatlas (Paris) MIR125B2 euGene (Indiana) 406912 Genomic and cartography MIR125B2 - 21q21.1 chr21:16884428-16884516 21 hg18- GoldenPath (UCSC) Mar_2006 [Description] () Ensembl MIR125B2 - hg18-Mar_2006 [CytoView] Mapping of MIR125B2 [Mapview] homologs : NCBI OMIM 610105 Gene and transcription RefSeq genomic : NT_011512 SRS Consensus coding MIR125B2 sequences : CCDS NCBI

Atlas Genet Cytogenet Oncol Haematol 2009; 6 816 Protein : pattern, domain, 3D structure Protein Interaction databases Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : MIR125B2 dbSNP NCBI SNP : GeneSNP Utah MIR125B2 SNP : HGBase MIR125B2 Genetic variants : MIR125B2 HAPMAP Mutations and MIR125B2 Diseases : HGMD Hereditary diseases : 610105 OMIM Hereditary diseases : 610105 GENETests Diseases : Genetic MIR125B2 Association General knowledge Homologs : MIR125B2 HomoloGene Homology/Alignments : Family Browser MIR125B2 UCSC Phylogenetic Trees/Animal Genes : MIR125B2 TreeFam Chemical/Protein 406912 Interactions : CTD Other databases Probes Probes : Imagenes MIR125B2 Related clones (RZPD - Berlin) Literature PubMed 2 Pubmed reference(s) in Entrez PubGene MIR125B2 Bibliography MicroRNA gene expression deregulation in human breast cancer. Iorio MV, Ferracin M, Liu CG, Veronese A, Spizzo R, Sabbioni S, Magri E, Pedriali M, Fabbri M, Campiglio M, Menard S, Palazzo JP, Rosenberg A, Musiani P, Volinia S, Nenci I, Calin GA, Querzoli P, Negrini M, Croce CM. Cancer Res. 2005 Aug 15;65(16):7065-70. PMID 16103053

RNA polymerase III transcribes human microRNAs. Borchert GM, Lanier W, Davidson BL. Nat Struct Mol Biol. 2006 Dec;13(12):1097-101. Epub 2006 Nov 12. PMID 17099701

Atlas Genet Cytogenet Oncol Haematol 2009; 6 817 Proc Natl Acad Sci U S A. 2007 May 8;104(19):7957-62. Epub 2007 May 1. PMID 17483472

Modulation of miR-155 and miR-125b levels following lipopolysaccharide/TNF-alpha stimulation and their possible roles in regulating the response to endotoxin shock. Tili E, Michaille JJ, Cimino A, Costinean S, Dumitru CD, Adair B, Fabbri M, Alder H, Liu CG, Calin GA, Croce CM. J Immunol. 2007 Oct 15;179(8):5082-9. PMID 17911593

Widespread deregulation of microRNA expression in human prostate cancer. Ozen M, Creighton CJ, Ozdemir M, Ittmann M. Oncogene. 2008 Mar 13;27(12):1788-93. Epub 2007 Sep 24. PMID 17891175

Mature miR-184 as Potential Oncogenic microRNA of Squamous Cell Carcinoma of Tongue. Wong TS, Liu XB, Wong BY, Ng RW, Yuen AP, Wei WI. Clin Cancer Res. 2008 May 1;14(9):2588-92. PMID 18451220

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Serkan Tuna, Ayse Elif Erson Department of Biology, Middle East Technical University, Ankara, Turkey Citation This paper should be referenced as such : Tuna S, Erson AE . MIRN125B2 (microRNA 125b-2). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/MIRN125B2ID44327ch21q21.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 818 Atlas of Genetics and Cytogenetics in Oncology and Haematology

RAC2 (ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2))

Identity Other names EN-7 GX Gx HSPC022 p21-Rac2 HGNC (Hugo) RAC2 Location 22q13.1 Location_base_pair Starts at 35951256 and ends at 35970251 bp from pter ( according to hg18- Mar_2006) [Mapping] DNA/RNA Description The Rac2 gene sequence contains 7 exons (Courjal et al., 1997) and is expressed specifically in hematopoietic cells. Human Rac2 gene locus is silenced in nonhematopoietic cells by a mechanism that involves DNA methylation (Ladd et al., 2004). Cells that lack Rac2 expression exhibit increased cytosine methylation in the sequences flanking the gene, whereas cells that express Rac2 exhibit increased cytosine methylation within the body of the Rac2 gene. Transcription The human Rac2 gene promoter lacks TATA and CCAAT boxes, utilizes multiple transcription initiation sites, and contains several putative Sp1 binding sites, which is common in promoters that lack TATA boxes (Ladd et al., 2004). The transcript length is of 1471 nt translated to a 192 residues protein. Protein Description Rac2 protein belongs to the GTP-binding proteins of the Rho family and cycles between an active GTP-bound form and an inactive GDP-bound form. This regulatory cycle is exerted by three distinct families of proteins: guanine exchange factors (GEFs), GTPase-activating proteins (GAPs), and guanine nucleotide dissociation inhibitors (GDIs). Several GEFs have been shown to activate Rac2 selectively, Vav1 (Ming et al., 2007), Tiam1 (Haeusler et al., 2003), P-Rex1 (Welch et al., 2002), Swap70 (Sivalenka and Jessberger, 2004) and Dock2 (Nishihara et al., 2002). Two GAPs that act on Rac2 are Abr and Bcr (Chuang et al., 1995), as well as others found in leukocytes. Rac2 function depends on association of the GTPase with membranes and subcellular localization, properties influenced by C-terminal lipid modifications, specifically is modified by the C20 GG isoprenoid. Upon GTP loading, a conformational change takes place that allows Rac2 protein to interact with several downstream effectors that ultimately process the information and propagate the signal within the cell, causing changes in the actin cytoskeleton, release of inflammatory modulators and innate immunity. The signaling of active Rac2 is mediated by its interaction with effector proteins such as p67phox and cytochrome b- 558 (Diebold and Bokoch, 2001), PLCbeta2 (Piechulek et al., 2005), nitric oxide synthase 2 (NOS2) (Kuncewicz et al., 2001) and Pak1 (Carstanjen et al., 2005). Expression Expression is restricted to hematopoietic cells and exhibits the highest expression in myeloid cells. Rac2 expression is regulated during the differentiation of hematopoietic and myeloid cells. There is some data suggesting that Rac2 might be expressed in tumors. Localisation Once activated Rac2 is mainly localized in endomembranes. Function As suggested by its restricted expression, Rac2 has a specialized role in many hematopoietic and immunological processes. Rac2 deficient mice show defects in stem cells, mast cells as well as B and T cells. Role in hematopoietic stem-cell progenitor engraftment The contribution of the GTPase Rac2 to the normal functioning of hematopoietic stem-

Atlas Genet Cytogenet Oncol Haematol 2009; 6 819 cell progenitors (HSC/Ps) was addressed based on the phenotype of Rac2-/- mice (Gu et al., 2003). HSC/Ps from these mice showed normal short-term engraftment, but decreased adhesion, suggesting a key role for Rac2 in integrin-mediated stem-cell adhesion. In addition, Rac2-/- HSC/Ps formed colonies with both impaired growth and migration, and showed an increased rate of apoptosis. In response to stromal derived factor 1, Rac2-/- cells failed in cortical F-actin assembly, and presented reduced cell spreading and actin-based membrane protrusion. Role in neutrophils function Several reports point out Rac2 is the predominant Rac GTPase functioning in neutrophils. These observations came from studies in neutrophils from Rac2-/- mice and a patient with a dominant-negative Rac2 mutation in which these cells showed decreased motility, adhesion, major defects in cortical F-actin assembly, and accordingly, chemotaxis and reduced phagocytosis and superoxide production by NAPH oxidase (Williams et al., 2000; Roberts et al., 1999; Li et al., 2002; Gu et al., 2003). Rac2 is required for oxidase activity through its direct interaction with p67-phox and cytochrome b 558. Role in B-cell development Rac2-/- mice exhibit multiple defects in B-cell development, with reduced numbers of peripheral blood B-cells and IgM-secreting plasma cells, a severe reduction in the number of marginal zone and peritoneal B1 cells (Croker et al., 2002). Rac2 participates in the positive selection through the B-cell receptor (BCR), since is activated by BCR cross-linking (Grill and Schrader, 2002). Role in T-cell differentiation Rac2 activity is required for interferon-gamma (IFNgamma) production both in vitro and in vivo during normal T-cell activation and Th1-cell differentiation, through simultaneous activation of both the NFkappaB and p38 pathways (Li et al., 2000). Role in Mast cell survival The absence of Rac2 results in defects growth, survival, chemotaxis, adhesion, and degranulation in mast cell (Yang et al., 2000). Rac2 is critical in regulating the growth factor-induced survival through activation of Akt and a change in expression levels of the Bcl-2 family members BAD and Bcl-XL (Yang et al., 2000). Homology Rac2 share significant sequence identity (~88%) with the other two members of the subfamily Rac: Rac1 and Rac3. The three proteins diverge primarily in the C-terminal 15 residues. Regarding to the biochemical properties, Rac2 shows a slower nucleotide association and is more efficiently activated by the Rac-GEF Tiam1 than Rac1 and Rac3. Mutations Note POLYMORPHISMS Two single nucleotide polymorphisms (SNP) have been observed in gliomas (Idbaih et al., 2008). The SNPs rs2239774 in exon 2 (codon 27, GCC to GCG, Ala to Ala) and rs3179967 in exon 6 (codon 159, GCT to GCC, Ala to Ala) were observed in 15/78 and 7/78 cases, respectively. No association between these two SNPs with phenotype, tumor grade, patient age, and patient gender was seen. Germinal A point mutation has been identified in one allele of the Rac2 gene resulting in the substitution of Asp57 by an Asn (Rac2D57N) in a patient with a primary immunodeficiency syndrome (Ambruso et al., 2000; Williams et al., 2000). Rac2D57N binds GDP but not GTP and inhibits oxidase activation and superoxide production in vitro. Somatic So far only two studies have searched for the presence of somatic mutations, both of them analyzed human brain tumors. Hwang et al. found 26% of cases had Rac2 gene mutation, two cases with decreased Rac2 expression and four cases with normal Rac2 expression. One case showed the mutation site nearby the GTP-binding site, which may affect Rac2 GTPase activity, but the site of Rac2 mutation seems not to concentrate in the effector region. However, Idbaih et al. did not find missense mutations in a series of 78 gliomas. Implicated in Entity Immunodeficiency Disease Lack of Rac2 activity causes immunodeficiency (Ambruso et al., 2000; Williams et al., 2000). A single patient was identified with a primary immunodeficiency syndrome

Atlas Genet Cytogenet Oncol Haematol 2009; 6 820 resulting from a heterozygous mutation in the Rac2 gene. In the first 5 months after birth, the patient presented several bacterial infections, poor wound healing, and absence of pus in the wounds, indicative of a phagocyte defect. The neutrophils had decreased chemotactic motility, polarization, and secretion of azurophilic granules. Rac2 levels were reduced, suggesting a defect in this GTPase. Western blot analysis of lysates from patient neutrophils demonstrated decreased levels of Rac2 protein. Molecular analysis identified a point mutation in one allele of the Rac2 gene resulting in the substitution of Asp57 by an Asn (Rac2D57N). Rac2D57N inhibits oxidase activation and superoxide production in vitro. These data represent the description of an inhibitory mutation in a member of the Rho family of GTPases associated with a human immunodeficiency syndrome. Entity Brain tumors Oncogenesis Expression of Rac2 was examined by RT-PCR and Northern blotting in human brain tumors: 10 astrocytomas, 8 meningiomas, and 8 pituitary adenomas (Hwang et al., 2005). The overexpression of Rac2 was evident in 1/10 astrocytomas and 1/8 meningiomas. No overexpression was found in pituitary adenomas. The decreased expression of Rac2 was found in 15 of 26 brain tumors (8/10 astrocytomas, 2/8 meningiomas and 5/8 pituitary adenomas). Entity Head and neck squamous cell cancer Oncogenesis Western blot analysis showed increased expression of Rac2 in a malignant squamous cell cancer cell line and a premalignant dysplastic cell line compared to the normal human epidermal keratinocytes (Abraham et al., 2001). This observation was confirmed with an immunohistochemical study of 15 moderately to poorly differentiated head and neck squamous cell cancer specimens, where a specific increased expression of Rac2 in areas of squamous cell cancer compared to the normal tissue was observed. Rac2 shows nuclear staining in normal human epidermal keratinocytes increasing sequentially in premalignant and malignant cell lines. In addition, there is specific cytoplasmic staining of the malignant cancer cell line which is absent in the normal and premalignant cell lines. This differential cytoplasmic staining may be able to distinguish invasive squamous cell carcinoma from dysplastic lesions and benign normal mucosa. Consequently it has been proposed that this GTPase could have an important role in the diagnosis and staging of this tumor type. Entity Acute myeloid leukemia (AML) Oncogenesis Activating mutations of KIT, which encodes the receptor for the cytokine stem cell factor, have been described in acute myeloid leukemia. Genetic disruption of Rac2 or pharmacologic evidence through treatment with Rac inhibitor NC23766, implicate Rac2 in regulating KIT-induced transformation in acute myeloid leukaemia (Munugalavadla et al., 2007). These results suggest Rac2 as a potential novel therapeutic target for the treatment of KIT-bearing acute myeloid leukemia. Entity Chronic myelogenous leukemia (CML) Oncogenesis Gene targeting of Rac1 and Rac2 significantly delays or abrogates development of chronic myelogenous leukemia (CML), a clonal myeloproliferative disease (MPD) initiated by expression of the p210-BCR- ABL fusion protein (Thomas et al., 2007). These genetic data were further substantiated experimentally by use of NSC23766, small molecule antagonist of Rac activation, to validate biochemically and functionally Rac as a molecular target in both a relevant animal model and in primary human CML cells in vitro and in a xenograft model in vivo. These findings indicate that Rac GTPases are critical for p210-BCR-ABL-mediated transformation and, therefore, suggest that the Rac GTPases may prove to be useful therapeutically by targeting alternative signaling pathways, which may be responsible for resistance and relapse in CML. External links Nomenclature HGNC (Hugo) RAC2 9802 RAC2 5880 ras-related C3 botulinum toxin substrate 2 (rho family, small GTP Entrez_Gene (NCBI) binding protein Rac2) Cards Atlas RAC2ID42021ch22q13 GeneCards RAC2

Atlas Genet Cytogenet Oncol Haematol 2009; 6 821 (Weizmann) Ensembl (Hinxton) ENSG00000128340 [Gene_View] RAC2 [Vega] AceView (NCBI) RAC2 Genatlas (Paris) RAC2 euGene (Indiana) 5880 SOURCE (Stanford) NM_002872 Genomic and cartography RAC2 - 22q13.1 chr22:35951256-35970251 - 22q13.1 [Description] GoldenPath (UCSC) (hg18-Mar_2006) Ensembl RAC2 - 22q13.1 [CytoView] Mapping of RAC2 [Mapview] homologs : NCBI OMIM 602049 608203 Gene and transcription Gene : Genbank AF077208 AF498965 AK096924 BC001485 BC018735 (Entrez) Reference sequence (RefSeq NM_002872 transcript) :SRS Reference transcript : NM_002872 Entrez RefSeq genomic : AC_000065 AC_000154 NC_000022 NG_007288 NT_011520 NW_001838745 SRS NW_927628 RefSeq genomic : AC_000065 AC_000154 NC_000022 NG_007288 NT_011520 NW_001838745 Entrez NW_927628 Consensus coding sequences : CCDS RAC2 NCBI Cluster EST : Unigene Hs.517601 [ SRS ] Hs.517601 [ NCBI ] Alternative Splicing : 5666 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : P15153 (SRS) P15153 (Expasy) P15153 (Uniprot) UniProt/SwissProt With graphics : P15153 InterPro Splice isoforms : P15153(VarSplice FASTA) VarSplice FASTA Domains : Interpro GTPase_Rho Ras Ras_trnsfrmng Small_GTP_bd (SRS) Domains : Interpro GTPase_Rho Ras Ras_trnsfrmng Small_GTP_bd (EBI) Related proteins : P15153 CluSTr Domain families : Ras (PF00071) Pfam SRS Domain families : Ras (PF00071) Pfam Sanger Domain families : pfam00071 Pfam NCBI Domain families : RHO (SM00174) Smart EMBL Blocks (Seattle) P15153 Crystal structure of 1DS6 protein : PDB SRS Crystal structure of 1DS6

Atlas Genet Cytogenet Oncol Haematol 2009; 6 822 protein : PDBSum Crystal structure of 1DS6 protein : IMB Crystal structure of 1DS6 protein : PDB RSDB HPRD 03628 Protein Interaction databases DIP (DOE-UCLA) P15153 IntAct (EBI) P15153 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : RAC2 dbSNP NCBI SNP : GeneSNP Utah RAC2 SNP : HGBase RAC2 Genetic variants : RAC2 HAPMAP Somatic Mutations in RAC2 Cancer : COSMIC Mutations and RAC2 Diseases : HGMD Hereditary diseases : 602049 608203 OMIM Hereditary diseases : 602049 608203 GENETests Diseases : Genetic RAC2 Association General knowledge Homologs : RAC2 HomoloGene Homology/Alignments : Family Browser RAC2 UCSC Phylogenetic Trees/Animal Genes : RAC2 TreeFam Chemical/Protein 5880 Interactions : CTD nucleotide binding GTPase activity protein binding GTP binding intracellular membrane fraction nuclear Keywords Ontology : envelope cytoplasm chemotaxis signal transduction small GTPase mediated AmiGO signal transduction positive regulation of cell proliferation regulation of hydrogen peroxide metabolic process cell projection assembly actin cytoskeleton organization regulation of respiratory burst nucleotide binding GTPase activity protein binding GTP binding intracellular membrane fraction nuclear Keywords Ontology : envelope cytoplasm chemotaxis signal transduction small GTPase mediated EGO-EBI signal transduction positive regulation of cell proliferation regulation of hydrogen peroxide metabolic process cell projection assembly actin cytoskeleton organization regulation of respiratory burst MAPK signaling pathway Wnt signaling pathway Axon guidance VEGF signaling pathway Focal adhesion Adherens junction Natural killer cell mediated Pathways : KEGG cytotoxicity B cell receptor signaling pathway Fc epsilon RI signaling pathway Leukocyte transendothelial migration Regulation of actin cytoskeleton Colorectal cancer Other databases Probes

Atlas Genet Cytogenet Oncol Haematol 2009; 6 823 Probes : Imagenes RAC2 Related clones (RZPD - Berlin) Literature PubMed 52 Pubmed reference(s) in Entrez PubGene RAC2 Bibliography Abr and Bcr are multifunctional regulators of the Rho GTP-binding protein family. Chuang TH, Xu X, Kaartinen V, Heisterkamp N, Groffen J, Bokoch GM. Proc Natl Acad Sci U S A 1995; 92: 10282-6. PMID 7479768

Structure and chromosomal assignment to 22q12 and 17qter of the ras-related Rac2 and Rac3 human genes. Courjal F, Chuchana P, Theillet C, Fort P. Genomics 1997; 44: 242-246. PMID 9299243

Deficiency of the hematopoietic cell-specific Rho family GTPase Rac2 is characterized by abnormalities in neutrophil function and host defense. Roberts AW, Kim C, Zhen L, Lowe JB, Kapur R, Petryniak B, Spaetti A, Pollock JD, Borneo JB, Bradford GB, Atkinson SJ, Dinauer MC, Williams DA. Immunity 1999; 10: 183-196. PMID 10072071

Human neutrophil immunodeficiency syndrome is associated with an inhibitory Rac2 mutation. Ambruso DR, Knall C, Abell AN, Panepinto J, Kurkchubasche A, Thurman G, Gonzalez-Aller C, Hiester A, deBoer M, Harbeck RJ, Oyer R, Johnson GL, Roos D. Proc Natl Acad Sci USA 2000, 97: 4654-4659. PMID 10758162

Role of the guanosine triphosphatase Rac2 in T helper 1 cell differentiation. Li B, Yu H, Zheng W, Voll R, Na S, Roberts AW, Williams DA, Davis RJ, Ghosh S, Flavell RA. Science 2000; 288: 2219-2222. PMID 10864872

Dominant negative mutation of the hematopoietic-specific Rho GTPase, Rac2, is associated with a human phagocyte immunodeficiency. Williams DA, Tao W, Yang F, Kim C, Gu Y, Mansfield P, Levine JE, Petryniak B, Derrow CW, Harris C, Jia B, Zheng Y, Ambruso DR, Lowe JB, Atkinson SJ, Dinauer MC, Boxer L. Blood 2000; 96: 1646-1654. PMID 10961859

Rac2 stimulates Akt activation affecting BAD/Bcl-XL expression while mediating survival and actin function in primary mast cells. Yang FC, Kapur R, King AJ, Tao W, Kim C, Borneo J, Breese R, Marshall M, Dinauer MC, Williams DA. Immunity 2000; 12: 557-568. PMID 10843388

Motility-related proteins as markers for head and neck squamous cell cancer. Abraham MT, Kuriakose MA, Sacks PG, Yee H, Chiriboga L, Bearer EL, Delacure MD. Laryngoscope 2001;111: 1285-1289. PMID 11568556

Molecular basis for Rac2 regulation of phagocyte NADPH oxidase. Diebold BA, Bokoch GM. Nat Immunol 2001; 2: 211-215. PMID 11224519

Specific association of nitric oxide synthase-2 with Rac isoforms in activated murine macrophages.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 824 Kuncewicz T, Balakrishnan P, Snuggs MB, Kone BC. Am J Physiol Renal Physiol 2001; 281: F326-F336. PMID 11457725

The Rac2 guanosine triphosphatase regulates B lymphocyte antigen receptor responses and chemotaxis and is required for establishment of B-1a and marginal zone B lymphocytes. Croker BA, Tarlinton DM, Cluse LA, Tuxen AJ, Light A, Yang FC, Williams DA, Roberts AW. J Immunol 2002; 168: 3376-3386. PMID 11907095

Activation of Rac-1, Rac-2, and Cdc42 by hemopoietic growth factors or cross-linking of the B- lymphocyte receptor for antigen. Grill B, Schrader JW. Blood 2002; 100: 3183-3192. PMID 12384416

DOCK2 mediates T cell receptor-induced activation of Rac2 and IL-2 transcription. Nishihara H, Maeda M, Tsuda M, Makino Y, Sawa H, Nagashima K, Tanaka S. Biochem Biophys Res Commun 2002; 296: 716-720. PMID 12176041

P-Rex1, a PtdIns(3,4,5)P3- and Gbetagamma-regulated guanine-nucleotide exchange factor for Rac. Welch HC, Coadwell WJ, Ellson CD, Ferguson GJ, Andrews SR, Erdjument-Bromage H, Tempst P, Hawkins PT, Stephens LR. Cell 2002; 108: 809-821. PMID 11955434

Comparative functional analysis of the Rac GTPases. Haeusler LC, Blumenstein L, Stege P, Dvorsky R, Ahmadian MR. FEBS Lett 2003; 555: 556-560. PMID 14675773

Hematopoietic cell regulation by Rac1 and Rac2 guanosine triphosphatases. Gu Y, Filippi MD, Cancelas JA, Siefring JE, Williams EP, Jasti AC, Harris CE, Lee AW, Prabhakar R, Atkinson SJ, Kwiatkowski DJ, Williams DA. Science 2003; 302: 445-449. PMID 14564009

Identification of a genomic fragment that directs hematopoietic-specific expression of Rac2 and analysis of the DNA methylation profile of the gene locus. Ladd PD, Butler JS, Skalnik DG. Gene 2004; 341: 323-333. PMID 15474314

SWAP-70 regulates c-kit-induced mast cell activation, cell-cell adhesion, and migration. Sivalenka RR, Jessberger R. Mol Cell Biol 2004; 24: 10277-10288. PMID 15542837

Rac2 regulates neutrophil chemotaxis, superoxide production, and myeloid colony formation through multiple distinct effector pathways. Carstanjen D, Yamauchi A, Koornneef A, Zang H, Filippi MD, Harris C, Towe J, Atkinson S, Zheng Y, Dinauer MC, Williams DA. J Immunol 2005; 174: 4613-4620. PMID 15814684

Rho GTPase expression in tumourigenesis: evidence for a significant link. Gómez del Pulgar T, Benitah SA, Valerón PF, Espina C, Lacal JC. Bioessays 2005; 27: 602-613. (REVIEW)

Atlas Genet Cytogenet Oncol Haematol 2009; 6 825 PMID 15892119

Rac2 expression and mutation in human brain tumors. Hwang SL, Lieu AS, Chang JH, Cheng TS, Cheng CY, Lee KS, Lin CL, Howng SL, Hong YR. Acta Neurochir (Wien) 2005; 147: 551-554. PMID 15812594

Isozyme-specific stimulation of phospholipase C-gamma2 by Rac GTPases. Piechulek T, Rehlen T, Walliser C, Vatter P, Moepps B, Gierschik P. J Biol Chem 2005; 280: 38923-38931. PMID 16172125

The Rac effector p67phox regulates phagocyte NADPH oxidase by stimulating Vav1 guanine nucleotide exchange activity. Ming W, Li S, Billadeau DD, Quilliam LA, Dinauer MC. Mol Cell Biol 2007; 27: 312-323. PMID 17060455

Genetic and pharmacologic evidence implicating the p85 alpha, but not p85 beta, regulatory subunit of PI3K and Rac2 GTPase in regulating oncogenic KIT-induced transformation in acute myeloid leukemia and systemic mastocytosis. Munugalavadla V, Sims EC, Borneo J, Chan RJ, Kapur R. Blood 2007; 110: 1612-1620. PMID 17483298

Rac guanosine triphosphatases represent integrating molecular therapeutic targets for BCR- ABL-induced myeloproliferative disease. Thomas EK, Cancelas JA, Chae HD, Cox AD, Keller PJ, Perrotti D, Neviani P, Druker BJ, Setchell KD, Zheng Y, Harris CE, Williams DA. Cancer Cell 2007; 12: 467-478. PMID 17996650

Mutational analysis of Rac2 in gliomas. Idbaih A, Paris S, Boisselier B, Marie Y, Sanson M, Thillet J, Hoang-Xuan K, Delattre JY. J Neurooncol 2008; 87: 365-366. PMID 18217210

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Teresa Gómez del Pulgar, Juan Carlos Lacal Centro Nacional de Biotecnología (CNB), Darwin 3, 28049 Madrid, Spain Citation This paper should be referenced as such : Gómez del Pulgar T, Lacal JC . RAC2 (ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/RAC2ID42021ch22q13.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 826 Atlas of Genetics and Cytogenetics in Oncology and Haematology

SORBS2 (sorbin and SH3 domain containing 2)

Identity Other names ARGBP2 (Arg/Abl-interacting protein 2) FLJ93447 KIAA0777 PRO0618 HGNC (Hugo) SORBS2 Location 4q35.1 Location_base_pair Starts at 186743592 and ends at 186970386 bp from pter ( according to hg18- Mar_2006) [Mapping] DNA/RNA Transcription Various transcripts. Protein Description The N-term region of the protein contains a sorbin homology (SoHo) domain. Sorbin, a 153 amino acid peptide, was isolated from porcine intestine (Vagne-Descroix et al., 1991). As a matter of fact, human sorbin is spliced from an alternative transcript from the SORBS2/ArgBP2 gene locus (Hand and Eiden, 2005). The sorbin homology domain is a motif for the targeting of proteins to lipid rafts (Kimura et al., 2001); 3 proteins present the SoHo domain: SORBS2/ArgBP2, SORBS1 (also called c-Cbl- associated protein (CAP), or ponsin) (10q24), and SORBS3 (vinexin) (8p21). The C- term region of the three SORBS genes contains 3 SH3 domains. The three genes share the same structural organization and present overlapping functions. Expression Widely expressed; very abundant in heart. Localisation Cytoplasm and nucleus (like its partner ABL1). Function Adaptor protein. Signaling proteins like ABL1 and ABL2 (ARG) (1q25) associate with and phosphorylate SORBS2 (Wang et al., 1997). SORBS2 negatively regulates ABL1 and ABL2 by recruiting CBL (11q23.3) in a complex with ABL1, facilitating phosphorylation of CBL by ABL1 and promoting CBL- directed ubiquitination and degradation of ABL1 and SORBS2 in the proteasome (Soubeyran et al., 2003). Role in AKT/PAK1 cell survival pathway: ArgBP2gamma (another SORBS2 splice) interacts with AKT and PAK1. Expression of ArgBP2gamma induces PAK1 activity and overrides apoptosis induced by ectopic expression of BAD or DNA damage (Yuan et al., 2005). Cytoskeletal proteins: SORBS2 also binds VCL (vinculin) (10q22) a protein which plays an important role in cell adhesion and migration, and MLLT4 (also called AF6 or afadin) (6q27), another component of cell membranes at specialized sites of cell-cell contact (Kawabe et al., 1999). SORBS2 has been found to localize at the Z-disks of cardiac myofibrils, indicating that ArgBP2 has a specialized function associated with the contractile apparatus of cardiac muscle (Wang et al., 1997). SORBS2 binds alpha actinin, an actin crosslinking protein and a major component of the Z-disks, and PALLD (palladin) (4q32), a protein associated with the alpha actinin network. SORBS2 co-localize with ABL1 in actin stress fibers (bundles of actin filaments which appear/disappear upon stimuli) (Wang et al., 1997). nArgBP2, a spliced form of SORB2 with a zinc finger motif in the central part of the protein, is found in the post-synaptic densities and binds DLGAP1 (SAPAP, 18p11) (Kawabe et al., 1999). SORBS2 also interacts with SPTAN1 (alpha 2-spectrin) (9q34), another component of the membrane-associated cytoskeleton, DNM1 (9q34) and DNM2 (19p13) (dynamins) (GTPases implicated in the regulation of actin dynamics and abundantly found in the

Atlas Genet Cytogenet Oncol Haematol 2009; 6 827 brain), WASF2 (1p36), and SYNJ2 (synaptojanin 2) (6q25), the last two undergo ubiquitination and ABL1-dependent tyrosine phosphorylation (Cestra et al., 2005). ABL1 plays an important role in axonogenesis; ABL1 and ABL2 localize to the pre- and postsynaptic compartments of synapses. SORBS2 binds WASF1 (also called WAVE1) (6q21) and PTPN12 (7q11). PTPN12, a protein tyrosine phosphatase, prevents SORBS2 phosphorylation by ABL1. Phosphorylation of WASF1 induced by the overexpression of ABL1 was enhanced in the presence of SORBS2, and overexpression of PTPN12 abolished the ABL1- mediated phosphorylation of WASF1 (Taieb et al., 2008). SORBS2 inhibits adhesion and migration of pancreatic cells (Taieb et al., 2008). Lipid rafts: SORBS2 links via its SH3 domains with proline-rich motifs of CBL and that of PTK2B (PYK2) (8p21) in a complex that is recruited to lipid rafts (via its SoHo domain) following growth factor stimulation, partially co-localizing with actin, which appears to be critical for cytoskeletal rearrangements in growing neurites (Haglund et al., 2004). Homology SORBS1 and SORBS3. Implicated in Entity t(4;11)(q35;q23) in acute myeloid leukemia --> SORBS2 - MLL Hybrid/Mutated 5' MLL - 3' SORBS2 Gene

Entity Pancreas cancer Oncogenesis SORBS2 is repressed during pancreas carcinogenesis and during progression of the disease. The antitumoral potential of SORBS2 appears to be linked to the control of cell adhesion and migration (inhibition of cell migration) rather than to the regulation of cell proliferation or sensitivity to apoptosis (Taieb et al., 2008). External links Nomenclature HGNC (Hugo) SORBS2 24098 Entrez_Gene (NCBI) SORBS2 8470 sorbin and SH3 domain containing 2 Cards Atlas SORBS2ID693ch4q35 GeneCards SORBS2 (Weizmann) Ensembl (Hinxton) ENSG00000154556 [Gene_View] SORBS2 [Vega] AceView (NCBI) SORBS2 Genatlas (Paris) SORBS2 euGene (Indiana) 8470 NM_001145670 NM_001145671 NM_001145672 NM_001145673 SOURCE (Stanford) NM_001145674 NM_001145675 NM_003603 NM_021069 Genomic and cartography SORBS2 - 4q35.1 chr4:186743592-186970386 - 4q35.1 [Description] GoldenPath (UCSC) (hg18-Mar_2006) Ensembl SORBS2 - 4q35.1 [CytoView] Mapping of SORBS2 [Mapview] homologs : NCBI Gene and transcription Gene : Genbank AA114994 AB018320 AF049884 AF049885 AF090937 (Entrez) Reference sequence NM_001145670 NM_001145671 NM_001145672 NM_001145673 (RefSeq NM_001145674 NM_001145675 NM_003603 NM_021069 transcript) :SRS Reference transcript : NM_001145670 NM_001145671 NM_001145672 NM_001145673 Entrez NM_001145674 NM_001145675 NM_003603 NM_021069 RefSeq genomic : AC_000047 AC_000136 NC_000004 NT_022792 NW_001838921 NW_922217 SRS

Atlas Genet Cytogenet Oncol Haematol 2009; 6 828 RefSeq genomic : AC_000047 AC_000136 NC_000004 NT_022792 NW_001838921 NW_922217 Entrez Consensus coding sequences : CCDS SORBS2 NCBI Cluster EST : Unigene Hs.655143 [ SRS ] Hs.655143 [ NCBI ] Alternative Splicing : 11683 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : O94875 (SRS) O94875 (Expasy) O94875 (Uniprot) UniProt/SwissProt With graphics : O94875 InterPro Splice isoforms : O94875(VarSplice FASTA) VarSplice FASTA Domaine pattern : SH3 (PS50002) SOHO (PS50831) Prosite (SRS) Domain pattern : SH3 (PS50002) SOHO (PS50831) Prosite (Expaxy) Domains : Interpro Neu_cyt_fact_2 SH3 Sorb Spectrin_alpha Znf_C2H2 (SRS) Domains : Interpro Neu_cyt_fact_2 SH3 Sorb Spectrin_alpha Znf_C2H2 (EBI) Related proteins : O94875 CluSTr Domain families : SH3_1 (PF00018) Sorb (PF02208) Pfam SRS Domain families : SH3_1 (PF00018) Sorb (PF02208) Pfam Sanger Domain families : pfam00018 pfam02208 Pfam NCBI Domain families : SH3 (SM00326)Sorb (SM00459) Smart EMBL Domain structure : SH3 (PD000066) (PD000066) Prodom (Prabi Lyon) Blocks (Seattle) O94875 HPRD 12473 Protein Interaction databases DIP (DOE-UCLA) O94875 IntAct (EBI) O94875 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : SORBS2 dbSNP NCBI SNP : GeneSNP Utah SORBS2 SNP : HGBase SORBS2 Genetic variants : SORBS2 HAPMAP Somatic Mutations in SORBS2 Cancer : COSMIC Translocation Breakpoints in Cancer SORBS2 : TICdb Mutations and SORBS2 Diseases : HGMD Diseases : Genetic SORBS2

Atlas Genet Cytogenet Oncol Haematol 2009; 6 829 Association General knowledge Homologs : SORBS2 HomoloGene Homology/Alignments : Family Browser SORBS2 UCSC Phylogenetic Trees/Animal Genes : SORBS2 TreeFam Chemical/Protein 8470 Interactions : CTD structural constituent of cytoskeleton protein Keywords Ontology : binding nucleus cytoplasm cytoskeletal adaptor AmiGO activity biological_process structural constituent of muscle actin cytoskeleton Z disc structural constituent of cytoskeleton protein Keywords Ontology : binding nucleus cytoplasm cytoskeletal adaptor EGO-EBI activity biological_process structural constituent of muscle actin cytoskeleton Z disc Other databases Probes Probes : Imagenes SORBS2 Related clones (RZPD - Berlin) Literature PubMed 29 Pubmed reference(s) in Entrez PubGene SORBS2 Bibliography Isolation and characterisation of porcine sorbin. Vagne-Descroix M, Pansu D, Jornvall H, Carlquist M, Guignard H, Jourdan G, Desvigne A, Collinet M, Caillet C, Mutt V. Eur J Biochem. 1991 Oct 1;201(1):53-9. PMID 1915377

ArgBP2, a multiple Src homology 3 domain-containing, Arg/Abl-interacting protein, is phosphorylated in v-Abl-transformed cells and localized in stress fibers and cardiocyte Z- disks. Wang B, Golemis EA, Kruh GD. J Biol Chem. 1997 Jul 11;272(28):17542-50. PMID 921190 nArgBP2, a novel neural member of ponsin/ArgBP2/vinexin family that interacts with synapse- associated protein 90/postsynaptic density-95-associated protein (SAPAP). Kawabe H, Hata Y, Takeuchi M, Ide N, Mizoguchi A, Takai Y. J Biol Chem. 1999 Oct 22;274(43):30914-8. PMID 10521485

The sorbin homology domain: a motif for the targeting of proteins to lipid rafts. Kimura A, Baumann CA, Chiang SH, Saltiel AR. Proc Natl Acad Sci U S A. 2001 Jul 31;98(16):9098-103. PMID 11481476

Vinexin, CAP/ponsin, ArgBP2: a novel adaptor protein family regulating cytoskeletal organization and signal transduction. Kioka N, Ueda K, Amachi T. Cell Struct Funct. 2002 Feb;27(1):1-7. (Review) PMID 11937713

Cbl-ArgBP2 complex mediates ubiquitination and degradation of c-Abl.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 830 Soubeyran P, Barac A, Szymkiewicz I, Dikic I. Biochem J. 2003 Feb 15;370(Pt 1):29-34. PMID 12475393

Recruitment of Pyk2 and Cbl to lipid rafts mediates signals important for actin reorganization in growing neurites. Haglund K, Ivankovic-Dikic I, Shimokawa N, Kruh GD, Dikic I. J Cell Sci. 2004 May 15;117(Pt 12):2557-68. PMID 15128873

How do Abl family kinases regulate cell shape and movement? Hernandez SE, Krishnaswami M, Miller AL, Koleske AJ. Trends Cell Biol. 2004 Jan;14(1):36-44. (Review) PMID 14729179

The Abl/Arg substrate ArgBP2/nArgBP2 coordinates the function of multiple regulatory mechanisms converging on the actin cytoskeleton. Cestra G, Toomre D, Chang S, De Camilli P. Proc Natl Acad Sci U S A. 2005 Feb 1;102(5):1731-6. PMID 15659545

Human sorbin is generated via splicing of an alternative transcript from the ArgBP2 gene locus. Hand D, Eiden LE. Peptides. 2005 Jul;26(7):1278-82. PMID 15949647

Involvement of palladin and alpha-actinin in targeting of the Abl/Arg kinase adaptor ArgBP2 to the actin cytoskeleton. Ronty M, Taivainen A, Moza M, Kruh GD, Ehler E, Carpen O. Exp Cell Res. 2005 Oct 15;310(1):88-98. PMID 16125169

ArgBP2gamma interacts with Akt and p21-activated kinase-1 and promotes cell survival. Yuan ZQ, Kim D, Kaneko S, Sussman M, Bokoch GM, Kruh GD, Nicosia SV, Testa JR, Cheng JQ. J Biol Chem. 2005 Jun 3;280(22):21483-90. PMID 15784622

ArgBP2, encoding a negative regulator of ABL, is fused to MLL in a case of infant M5 acute myeloid leukemia involving 4q35 and 11q23. Pession A, Lo Nigro L, Montemurro L, Serravalle S, Fazzina R, Izzi G, Nucifora G, Slany R, Tonelli R. Leukemia. 2006 Jul;20(7):1310-3. PMID 16628191

ArgBP2-dependent signaling regulates pancreatic cell migration, adhesion, and tumorigenicity. Taieb D, Roignot J, Andre F, Garcia S, Masson B, Pierres A, Iovanna JL, Soubeyran P. Cancer Res. 2008 Jun 15;68(12):4588-96. PMID 18559503

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers, France Citation

Atlas Genet Cytogenet Oncol Haematol 2009; 6 831 This paper should be referenced as such : Huret JL . SORBS2 (sorbin and SH3 domain containing 2). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/SORBS2ID693ch4q35.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 832 Atlas of Genetics and Cytogenetics in Oncology and Haematology

TIAM1 (T-cell lymphoma invasion and metastasis 1)

Identity Other names FLJ36302 TIAM-1 HGNC (Hugo) TIAM1 Location 21q22.11 Location_base_pair Starts at 31412607 and ends at 31853161 bp from pter ( according to hg18- Mar_2006) [Mapping] The human gene maps to chromosome 21q22.1; between markers D21S298 and Local_order D21S404. Gene orientation: forward strand. Note Rho-like GTPases belong to the Ras superfamily and have crucial roles in many cellular processes, such as regulation of the actin cytoskeleton, cell migration, cell cycle progression, gene transcription and cell adhesion. Rho-like GTPases cycle between a GDP-bound inactive form and a GTP-bound active form and activation is catalysed by guanine nucleotide exchange factors (GNEFs) (Minard et al., 2004). The GNEF Tiam1 has been identified as an invasion- and metastasis-inducing gene in a murine T-lymphoma cell line and specifically activates the Rho-like GTPase Rac. Tiam1/Rac signaling controls the establishment and maintenance of E-cadherin-based cell-cell adhesions and loss of Tiam1 leads to epithelial-mesenchymal transition (EMT). Consequently, Tiam1/Rac signaling affects cell migration, invasion and tumor metastasis, but to some extent these effects seem to be cell type- and tumor type- dependent (Ellenbroek et al., 2007). Moreover, Tiam1 and Rac have been implicated in oncogenic transformation of cells. DNA/RNA Note The ensemble database shows five Tiam1 transcripts, only one of which is encoding for the full length protein. Two transcripts are not translated and two others encode only for parts of the Tiam1 protein.

Localisation of the Tiam1 gene on human chromosome 21 and exon structure. Description The Tiam1 gene constist of 29 exons encoding for a 7200 bp transcript. Transcription Tiam1 is expressed in almost all adult tissues with highest expression levels in brain and testis. Tiam1 is also expressed during embryogenesis as Tiam1 mRNA is detectable from day 10 onwards in mice. Protein Note The human Tiam1 gene encodes a protein of 1,591 amino acids with a predicted molecular mass of 177 kD and several distinct domains.

Domain structure of the Tiam1 protein. Myr, myristoylation site; P, PEST sequence; PHn, N-terminal Pleckstrin homology domain; CC, coiled-coil region; Ex, extended structure; RBD, Ras-binding domain; PDZ, PSD-95/DlgA/ZO-1 domain; DH, Dbl homology domain; PHc, C-terminal Pleckstrin homology domain. PI, phospho-inositides. Description The Tiam1 protein is myristoylated at its N-terminus and contains 2 N-terminal PEST

Atlas Genet Cytogenet Oncol Haematol 2009; 6 833 domains, an N-terminal pleckstrin homology domain (PHn), a coiled-coil region with adjacent sequence (CC-Ex), a Ras-binding domain (RBD), a PSD-95/DlgA/ZO-1 domain (PDZ) and a catalytic Dbl homology (DH)-PH (PHc) combination. While the PHn-CC-Ex domain of Tiam1 is crucial for membrane localisation of the protein, the DH-PHc combination is characteristic for all members of the Dbl-like family of guanine nucleotide exchange factors (GNEFs) (Engers, 2009). Expression Tiam1 is ubiquitously expressed with highest expression levels in brain and testis. Accordingly, many different cell lines have been shown to express Tiam1 on the RNA and/or protein level. Localisation Tiam1 is primarily located in the cytoplasm of cells, but upon activation it is translocated to the plasma membrane. The activity of Tiam1 is regulated by different mechanisms: relief of intramolecular inhibition, post-translational modifications (e.g. threonine phosphorylation) and interaction with other proteins, including Nm23-H1, c-Myc, CD44, Ankyrin, Spinophilin, JIP2/IB2, Par3, Arp2/3, Ras, Trk-B, Rac, phospho-inositides (Mertens et al., 2003; Minard et al., 2004; Engers, 2009). Function Tiam1 is a specific activator of the Rho-like GTPase Rac and is implicated in the regulation of different cell biological functions, including cell polarity, adhesion, migration, invasion, metastasis and carcinogenesis. Originally, Tiam1 has been identified as a gene that confers an invasive and metastatic phenotype to otherwise noninvasive murine T-lymphoma cells. In contrast, Tiam1 inhibits migration and invasion of epithelial cells by promoting E-cadherin-mediated cell-cell adhesion and by shifting the balance between distinct invasion-promoting matrix metalloproteinases (MMP-2 and -9) and invasion-inhibiting tissue inhibitors of metalloproteinases (TIMP-1 and -2) towards the TIMPs. However, in other studies Tiam1 was shown to promote migration and invasion of epithelial cells. These seemingly opposing effects of Tiam1 on migration and invasion in epithelial cells depend at least partly on the cell type studied, the fact as to whether or not the cell substrate used affects the formation of E-cadherin- mediated cell-cell adhesion, and the relative levels of Rac and Rho. Aside from these functions Tiam1 has also been implicated in the development of malignant tumors either as a mediator of oncogenic Ras-signaling (in skin tumors) or as a Wnt-responsive gene (in intestinal tumors) (Engers, 2009). Morphologically, overexpression of Tiam1 in different cell types induces a distinct phenotype, characterised by large flat cells with epithelioid or sickle-shaped morphology and extensive membrane ruffling. In addition, many of these Tiam1-transfected cells are either polynucleated or contain large numbers of pinocytic vesicles (Minard et al., 2004). Mutational analysis revealed that the PHn-CC-Ex domain is required for membrane localisation of the protein and Tiam1-induced membrane ruffling.

Characteristic phenotype of Tiam1-transfected cells as determined by confocal laser scanning microscopy: In comparison to untransfected control cells (left) Tiam1-transfected cells (right) are large, epithelioid and exhibit pronounced membrane ruffling (green, Tiam1; red, F-actin; yellow, colocalisation of Tiam1 with the actin cytoskeleton). Homology 95 % identical to the mouse homolog, Tiam1 is conserved among vertrebrates. Still life (SIF) is the Drosophila homologue of Tiam1. Mutations Note Investigations on mutations in the Tiam1 gene have only been reported in human renal- cell carcinomas.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 834

Domain structure of the Tiam1 protein and localisation of observed mutations (courtesy Engers et al., 2000). Germinal None reported. Somatic A study on human renal cell carcinomas (RCCs) reported up to five different point mutations in RCC cell lines (Engers et al., 2000). One of these mutations (A441G) was located in the N-terminal PH domain, which is essential for membrane localisation and functional activity of Tiam1. This mutation was found in 11.5 % of primary human RCCs, but not in the corresponding normal kidney tissues. Stable overexpression of A441G-Tiam1 proved to be sufficient for oncogenic transformation of NIH 3T3 cells in vitro. Implicated in Entity Prostate Cancer Disease Tiam1 protein expression was investigated by immunohistochemistry in prostate carcinomas. Tiam1 was found to be significantly stronger expressed in preneoplastic high grade prostate intraepithelial neoplasia (HG-PIN) and prostate carcinomas when compared to corresponding benign secretory epithelial cells (Engers et al., 2006). Prognosis Strong overexpression of Tiam1 in prostate cancer is significantly correlated with disease recurrence, the presence of lymph vessel invasion and high Gleason scores. In univariate analysis strong overexpression (e.g. ≥ 3.5-fold) of Tiam1 in prostate cancer predicted significantly decreased disease-free survival as compared to prostate cancer with weak (e.g. <3.5-fold) Tiam1 overexpression. Most importantly, this prognostic effect of strong Tiam1 overexpression remained significant in multivariate analysis, in which all well established prognostic factors in prostate cancer (e.g. preoperative PSA levels, pT stage, Gleason score) were included. Oncogenesis Observations that significantly increased Tiam1 expression was not only found in prostate cancer, but also in almost all analysed preneoplastic HG-PIN lesions, suggest that increased Tiam1 expression occurs early in prostate carcinoma development. As a consequence increased Tiam 1 expression might induce transcription of oncogenes or inhibit transcription of tumour suppressor genes, thus contributing to oncogenic transformation. Entity Colon Carcinoma Disease Malliri et al. (2006) identified that Tiam1 is a Wnt-responsive gene which is upregulated in human colon adenomas and implicated in intestinal tumorigenesis. By comparing APC mutant Min (multiple intestinal neoplasia) mice expressing or lacking Tiam1, they found that Tiam1 deficiency significantly reduces the formation and growth of polyps in vivo. In line with this, knock-down of Tiam1 in human colorectal cancer cells inhibited cell proliferation as well as the ability of these cells to form E-cadherin-based adhesions. In already established tumors, the role of Tiam1 still has to be clarified. On the one hand Tiam1 appears to have protective effects as adenocarcinomas arisen in Tiam1-deficient mice were found to be more aggressive than those arisen in Tiam1 wild-type mice (Malliri et al., 2006). On the other hand overexpression of Tiam1 in SW480 colon cancer cells induced a metastatic phenotype, hence more aggressive behaviour of these cells (Minard et al., 2005). Oncogenesis Malliri et al. (2006) report a cross-talk between Tiam1/Rac and the canonical Wnt- signaling pathway that affects intestinal tumor formation and progression. Entity Renal cell carcinoma Disease In renal cell carcinoma (RCC) cell lines Tiam1 expression was shown to be inversely correlated with in vitro invasiveness (Engers et al., 2000). In line with this, overexpression of Tiam1 or overexpression of constitutively active V12-Rac1

Atlas Genet Cytogenet Oncol Haematol 2009; 6 835 significantly inhibited migration and invasion of human RCC cells. While the effects on migration were largely dependent on E-cadherin-mediated cell-cell adhesion, inhibition of invasion resulted mainly from selective upregulation of TIMP-1 and TIMP-2 (Engers et al., 2001). Oncogenesis In a cohort of different human RCC cell lines and primary RCCs up to 5 different point mutations of the Tiam1 gene were found (Engers et al., 2000). One of these mutations (A441G) was found in 11.5 % of primary human RCCs, but not in the corresponding normal kidney tissues. By overexpression of mutated A441G-Tiam1 in NIH 3T3 cells this mutation was shown to be sufficient for oncogenic transformation in vitro. These data suggest that distinct mutations of the Tiam1 gene might be implicated in the development of a subset of human RCCs. Entity Skin tumors Disease Malliri et al. (2002) investigated the role of the Rac activator Tiam1 in Ras-induced skin tumours in mice. Similar to their reports about the implication of Tiam1 in colon cancer, they found a reduced tumour burden and growth in Tiam1-deficient mice. The reduced tumor growth rate in Tiam1-deficient mice may be a result of increased apoptosis and reduced cell proliferation during initiation. Studies in Tiam1 heterozygous mice suggested that the Tiam1 gene dose affects the efficiency of Ras-dependent tumor initiation. These findings indicate the implication of Tiam1 in Ras-induced skin tumour initiation. However, similar to colon cancer, after tumour initiation Tiam1 expression seems to protect from malignant progression. Thus, the small number of tumours that arose in Tiam1-deficient mice acquired a more aggressive phenotype than tumours arisen in wild-type mice. In line with this, Uhlenbrock et al. (2004) reported inhibition of migration and invasion by Tiam1 in metastatic melanoma cells. Tiam1 overexpression resulted in gain of cell-cell junctions that counteracted cell motility and invasion. Oncogenesis A role for Tiam1 in Ras-induced skin tumour formation has been described by Malliri et al. (2002) (see above). Entity Retinoblastoma Disease Adithi et al. (2006) reported significantly increased Tiam1 expression in invasive retinoblastoma. Entity Breast Cancer Disease Heregulin-beta1 (HRG) promotes motility, scattering and invasiveness of breast cancer cells. Adam et al. (2001) identified Tiam1 as a target of HRG signalling and showed that Tiam1 overexpression mimicks several HRG-induced phenotypic changes in breast cancer cells. In line with these observations, the migratory capacities of several breast cancer cell lines were found to correlate with Tiam1 expression levels (Minard et al., 2004). Moreover, in a small number of breast cancer tissue samples Tiam1 expression was found to correlate with a high tumor grade (Adam et al., 2001). Entity Pancreatic adenocarcinoma Disease In a recent study Cruz-Monserrate et al. (2008) provide evidence that integrin alpha6beta4 promotes the migratory and invasive phenotype of pancreatic carcinoma cells through the Tiam1/Rac pathway in part through upregulation of Tiam1. Entity Increased vascular permeability Disease Reorganization of the cytoskeleton and adhesive complexes provides the basis for increased vascular permeability implicated in various diseases. A recent study of Birukova et al. (2007) demonstrated a role for Tiam1/Rac in HGF-induced endothelial cell barrier protection. External links Nomenclature HGNC (Hugo) TIAM1 11805 Entrez_Gene (NCBI) TIAM1 7074 T-cell lymphoma invasion and metastasis 1 Cards Atlas TIAM1ID42557ch21q22 GeneCards TIAM1 (Weizmann) Ensembl (Hinxton) ENSG00000156299 [Gene_View] TIAM1 [Vega] AceView (NCBI) TIAM1

Atlas Genet Cytogenet Oncol Haematol 2009; 6 836 Genatlas (Paris) TIAM1 euGene (Indiana) 7074 SOURCE (Stanford) NM_003253 Genomic and cartography TIAM1 - 21q22.11 chr21:31412607-31853161 - 21q22.1| GoldenPath (UCSC) 21q22.11 [Description] (hg18-Mar_2006) Ensembl TIAM1 - 21q22.1|21q22.11 [CytoView] Mapping of TIAM1 [Mapview] homologs : NCBI OMIM 600687 Gene and transcription Gene : Genbank AB209101 AK093621 AK124647 BC117192 BC117196 (Entrez) Reference sequence (RefSeq NM_003253 transcript) :SRS Reference transcript : NM_003253 Entrez RefSeq genomic : AC_000064 AC_000153 NC_000021 NT_011512 NW_001838706 NW_927384 SRS RefSeq genomic : AC_000064 AC_000153 NC_000021 NT_011512 NW_001838706 NW_927384 Entrez Consensus coding sequences : CCDS TIAM1 NCBI Cluster EST : Unigene Hs.517228 [ SRS ] Hs.517228 [ NCBI ] Alternative Splicing : 1577 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : Q13009 (SRS) Q13009 (Expasy) Q13009 (Uniprot) UniProt/SwissProt With graphics : Q13009 InterPro Splice isoforms : Q13009(VarSplice FASTA) VarSplice FASTA Domaine pattern : DH_1 (PS00741) DH_2 (PS50010) PDZ (PS50106) PH_DOMAIN Prosite (SRS) (PS50003) RBD (PS50898) Domain pattern : DH_1 (PS00741) DH_2 (PS50010) PDZ (PS50106) PH_DOMAIN Prosite (Expaxy) (PS50003) RBD (PS50898) Domains : Interpro DH-domain GDS_CDC24_CS PDZ PH PH_type Raf_like_ras_bd (SRS) Domains : Interpro DH-domain GDS_CDC24_CS PDZ PH PH_type Raf_like_ras_bd (EBI) Related proteins : Q13009 CluSTr Domain families : PDZ (PF00595) PH (PF00169) RBD (PF02196) RhoGEF (PF00621) Pfam SRS Domain families : PDZ (PF00595) PH (PF00169) RBD (PF02196) RhoGEF (PF00621) Pfam Sanger Domain families : pfam00595 pfam00169 pfam02196 pfam00621 Pfam NCBI Domain families : PDZ (SM00228)PH (SM00233)RBD (SM00455)RhoGEF (SM00325) Smart EMBL Blocks (Seattle) Q13009 Crystal structure of 2D8I protein : PDB SRS

Atlas Genet Cytogenet Oncol Haematol 2009; 6 837 Crystal structure of 2D8I protein : PDBSum Crystal structure of 2D8I protein : IMB Crystal structure of 2D8I protein : PDB RSDB HPRD 02820 Protein Interaction databases DIP (DOE-UCLA) Q13009 IntAct (EBI) Q13009 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : TIAM1 dbSNP NCBI SNP : GeneSNP Utah TIAM1 SNP : HGBase TIAM1 Genetic variants : TIAM1 HAPMAP Somatic Mutations in TIAM1 Cancer : COSMIC Mutations and TIAM1 Diseases : HGMD Hereditary diseases : 600687 OMIM Hereditary diseases : 600687 GENETests Diseases : Genetic TIAM1 Association General knowledge Homologs : TIAM1 HomoloGene Homology/Alignments : Family Browser TIAM1 UCSC Phylogenetic Trees/Animal Genes : TIAM1 TreeFam Chemical/Protein 7074 Interactions : CTD receptor signaling protein activity guanyl-nucleotide exchange factor activity Rho guanyl-nucleotide exchange factor activity protein Keywords Ontology : binding phospholipid binding intracellular plasma membrane small GTPase AmiGO mediated signal transduction regulation of Rho protein signal transduction ephrin receptor binding ephrin receptor signaling pathway positive regulation of axonogenesis receptor signaling protein activity guanyl-nucleotide exchange factor activity Rho guanyl-nucleotide exchange factor activity protein Keywords Ontology : binding phospholipid binding intracellular plasma membrane small GTPase EGO-EBI mediated signal transduction regulation of Rho protein signal transduction ephrin receptor binding ephrin receptor signaling pathway positive regulation of axonogenesis Pathways : KEGG Regulation of actin cytoskeleton Other databases Probes Probes : Imagenes TIAM1 Related clones (RZPD - Berlin) Literature

Atlas Genet Cytogenet Oncol Haematol 2009; 6 838 PubMed 46 Pubmed reference(s) in Entrez PubGene TIAM1 Bibliography Tiam1 mutations in human renal-cell carcinomas. Engers R, Zwaka TP, Gohr L, Weber A, Gerharz CD, and Gabbert HE. Int J Cancer 2000; 88: 369-376. PMID 11054665

Tiam1 overexpression potentiates heregulin-induced lymphoid enhancer factor-1/beta -catenin nuclear signaling in breast cancer cells by modulating the intercellular stability. Adam L, Vadlamudi RK, McCrea P, and Kumar R. J Biol Chem 2001; 276: 28443-28450. PMID 11328805

Rac affects invasion of human renal cell carcinomas by up-regulating tissue inhibitor of metalloproteinases (TIMP)-1 and TIMP-2 expression. Engers R, Springer E, Michiels F, Collard JG, and Gabbert HE. J Biol Chem 2001; 276: 41889-41897. PMID 11551917

Mice deficient in the Rac activator Tiam1 are resistant to Ras-induced skin tumours. Malliri A, van der Kammen RA, Clark K, van der Valk M, Michiels F, Collard JG.. Nature 2002; 417: 867-871. PMID 12075356

Regulation of Tiam1-Rac signalling. Mertens AE, Roovers RC, and Collard JG. FEBS Lett 2003; 546: 11-16. (Minireview) PMID 12829230

The role of the guanine nucleotide exchange factor Tiam1 in cellular migration, invasion, adhesion and tumor progression. Minard ME, Kim LS, Price JE, and Gallick GE. Breast Cancer Res Treat 2004; 84: 21-32. (Review) PMID 14999151

The RacGEF Tiam1 inhibits migration and invasion of metastatic melanoma via a novel adhesive mechanism. Uhlenbrock K, Eberth A, Herbrand U, Daryab N, Stege P, Meier F, Friedl P, Collard JG, and Ahmadian MR J Cell Sci 2004; 117: 4863-4871. PMID 15340013

The guanine nucleotide exchange factor Tiam1 increases colon carcinoma growth at metastatic sites in an orthotopic nude mouse model. Minard ME, Herynk MH, Collard JG, Gallick GE. Oncogene 2005; 24: 2568-2573. PMID 15735692

Expressions of Rac1, Tiam1 and Cdc42 in retinoblastoma. Adithi M, Venkatesan N, Kandalam M, Biswas J, and Krishnakumar S. Exp Eye Res 2006; 83: 1446-1452. PMID 17027002

Prognostic relevance of TiamI protein expression in prostate carcinomas. Engers R, Mueller M, Walter A, Collard JG, Willers R, and Gabbert HE. Brit J Cancer 2006; 95: 1081-1086. PMID 17003780

The rac activator Tiam1 is a Wnt-responsive gene that modifies intestinal tumor development.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 839 Malliri A, Rygiel TP, van der Kammen RA, Song JY, Engers R, Hurlstone AF, Clevers H, and Collard JG. J Biol Chem 2006; 281: 543-548. PMID 16249175

Tiam1 regulates cell adhesion, migration and apoptosis in colon tumor cells. Minard ME, Ellis LM, and Gallick GE. Clin Exp Metastasis 2006; 23: 301-313. (Review) PMID 17086355

HGF attenuates thrombin-induced endothelial permeability by Tiam1-mediated activation of the Rac pathway and by Tiam1/Rac-dependent inhibition of the Rho pathway. Birukova AA, Alekseeva E, Mikaelyan A, and Birukov KG. FASEB J 2007; 21: 2776-2786. PMID 17428964

Rho GTPases: functions and association with cancer. Ellenbroek SI and Collard JG. Clin Exp Metastasis 2007; 24: 657-672. (Review) PMID 18000759

Integrin alpha 6 beta 4 promotes migration, invasion through Tiam1 upregulation, and subsequent Rac activation. Cruz-Monserrate Z and O'Connor KL. Neoplasia 2008; 10: 408-417. PMID 18472958

Tiam1 Engers R. In Encyclopedia of Cancer, edited by Schwab M, 2009

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Michèle J Hoffmann, Rainer Engers Institute for Pathology, Heinrich-Heine University, Moorenstr. 5, 40225 Duesseldorf, Germany Citation This paper should be referenced as such : Hoffmann MJ, Engers R . TIAM1 (T-cell lymphoma invasion and metastasis 1). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/TIAM1ID42557ch21q22.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 840 Atlas of Genetics and Cytogenetics in Oncology and Haematology

TNFRSF11B (tumor necrosis factor receptor superfamily, member 11b)

Identity Other names MGC29565 OCIF OPG Osteoprotegerin TR1 HGNC (Hugo) TNFRSF11B Location 8q24.12 Location_base_pair Starts at 120004977 and ends at 120033564 bp from pter ( according to hg18- Mar_2006) [Mapping] DNA/RNA

Organization of the human OPG gene. Description START: 120,004,977 BP from PTER END: 120,033,492 BP from PTER SIZE: 28,516 bases ORIENTATION: Minus strand REFSEQ GENOMIC ASSEMBLIES: NC-000008.9 NT-008046.15 Transcription 5 exons; cDNA SIZE 2354 BP (NM-002546); CDS: 1206 nt. Pseudogene No known pseudogenes. Protein Note RefSeq NP-002537.3; Size: 401 amino acids; 46040 Da; Subunit: Homodimer; Subcellular location: Secreted. Osteoprotegerin (OPG) was isolated independently by two laboratories in 1997 (Tsuda et al., 1997; Simonet et al., 1997), as being a protein that exhibits a protective effect on bone. OPG is a member of the TNF-receptor superfamily, which consists of proteins that evoke different signal transduction, mediating several biological responses, such as cytotoxicity, apoptosis and cell survival, proliferation and differentiation. OPG has two known TNF family ligands: receptor activator of NF-kB ligand (RANKL) (Yasuda et al., 1998b) and TRAIL (Emery et al.,1998) (Diagram 1). RANKL normally binds to its membrane receptor RANK inducing differentiation, activation, and survival of osteoclasts. By binding to RANKL, OPG acts as a soluble inhibitor that prevents RANKL/RANK interaction and subsequent osteoclastogenesis (Yasuda et al., 1998b) (Diagram 1). However, it has been reported that also OPG binding to TRAIL inhibits TRAIL/TRAIL-receptors (TR-R1/R2) interaction, as revealed by the inhibition of TRAIL-induced apoptosis (Emery et al.,1998) (Diagram 1). Vice-versa, TRAIL can block the inhibitory activity of OPG on osteoclastogenesis (Emery et al.,1998).

Atlas Genet Cytogenet Oncol Haematol 2009; 6 841

Diagram 1. Schematic representation of OPG/OPG-ligands and cellular processes inhibited from their interactions. Diagram 2. Schematic representation of the structure of OPG protein. Description OPG comprises 401 amino acids of which 21 are a signal peptide which is cleaved, generating a mature form of 380 amino acids. OPG is produced as a monomer (55-62 kDa), but undergoes homodimerization and is secreted as a disulphide-linked homodimeric glycoprotein with four or five potential glycosylation sites, generating a mature form of OPG of 110-120 kDa (Yamaguchi et al., 1998). OPG consists of 7 structural domains, of which the amino-terminal cysteine rich domains 1 to 4 (D1-D4) are necessary for binding to RANKL (Schneeweis et al., 2005) and share some features with the extracellular domains of other members of the TNF-receptor family (Diagram 2) (Baker et al., 1998). The carboxy-terminal portion of the protein contains two putative death domain homologous regions (D5 and D6). Finally, domain 7 (D7) harbors a heparin-binding region, a common feature of peptide growth factors and signal molecules, as well as an unpaired cysteine residue, at position 400, required for disulfide bond formation and dimerization (Diagram 2) (Yamaguchi et al., 1998). It is the dimeric form of the protein, which has the highest heparin-binding capacity and also the highest hypocalcemic ability. Expression OPG is expressed ubiquitously and abundantly in many tissues and cell types. First of all it is produced from osteoblasts (Wada et al., 2006), where its expression is regulated by most of the factors that induce RANKL expression by osteoblasts. Although there are contradictory data, in general upregulation of RANKL is associated with downregulation of OPG, or at least lower induction of OPG, such that the ratio of RANKL to OPG changes in favor of osteoclastogenesis. Many reports have supported the assertion that the RANKL/OPG ratio is a major determinant of bone mass (Hofbauer et al., 2004). Concerning the cellular sources of OPG, it has been shown that besides cells belonging to the osteoblastic lineage, also bone marrow stromal cells (reviewed in Theoleyre et al., 2004), hematopoietic and immune cells (B cells and dendritic cells) (Tan et al., 1997) produce and release OPG. Importantly, OPG is also produced by endothelial (Collin- Osdoby et al., 2001) and vascular smooth muscle cells (Olesen et al., 2005), which likely

Atlas Genet Cytogenet Oncol Haematol 2009; 6 842 represent the major contributors to the circulating pool of OPG. Recent studies on the intracellular localization of OPG in endothelial cells have indicated that OPG protein is found in the Weibel-Palade Bodies (WPB), in physical association with von Willebrand Factor (Zannettino et al., 2005). Finally, OPG is produced by a variety of tissues including the cardiovascular system (heart, arteries, veins), lung, kidney, liver, spleen, intestine, stomach (Simonet et al., 1997; Wada et al., 2006). Localisation OPG, unlike all other receptors of the family, lacks a transmembrane and cytoplasmic domain and is secreted as a soluble protein (Yamaguchi et al., 1998). It has also been detected in a cell surface-associated form with some cell types (Yun et al., 1998), although sequence analysis failed to detect a classical hydrophobic transmembrane domain. Function The best characterized activity of OPG is the inhibition of osteoclast differentiation and activity (Simonet et al., 1997; Yasuda et al., 1998a), by binding to RANKL. Initially, the physiological roles of OPG have been revealed by studies in OPG knockout mice, produced by targeted disruption of the gene (Bucay et al., 1998; Mizuno et al.,1998). OPG (-/-) mice were viable and fertile, but they exhibited severe osteoporosis caused by enhanced osteoclast formation and function. These results have indicated that OPG is a physiological regulator of osteoclast-mediated bone resorption during postnatal bone growth. In the context of vascular system, it has been reported that exposure of both micro and macro-vascular endothelial cells to the inflammatory cytokines elevates OPG expression and release (Collin-Osdoby et al., 2001; Secchiero et al., 2006), and OPG in turn promotes leukocyte adhesion (Zauli et al., 2007; Mangan et al., 2007), acting as a chemotactic factor for monocyte. These observations strongly support a modulatory role of OPG in hemostasis, vascular injury and inflammation, suggesting an involvement of OPG in the inflammatory functions of endothelial cells, with endothelium acting as both cellular source and target of vascular OPG production. In this respect, there are accumulating data in vitro indicating a role for OPG in endothelial cell biology and angiogenesis; in particular in the regulation of endothelial cell survival (Scatena et al., 2002; Pritzker et al., 2004), stimulation of endothelial cell growth, as well as the formation of cord-like structures on a matrigel substrate (Cross et al., 2006), providing the evidence that OPG may modulate also endothelial cell migration and differentiation. In this context, OPG also appears to protect large blood vessels from medial calcification, based on the observation of renal and aortic calcification occurring in OPG knockout mice (Bucay et al., 1998). Furthermore, the absence of OPG in OPG/apolipoprotein E double knockout mice accelerates the calcific atherosclerosis that develops in apolipoprotein E knockout mice, suggesting that OPG protects against this complication of atherosclerosis (Bennett et al., 2006). Moreover, OPG has also been shown to regulate B-cell development and function and dendritic cell function (Yun et al., 1998; Yun et al., 2001), making OPG a paracrine mediator of both bone metabolism and immune functions.

For details see: http://www.ncbi.nlm.nih.gov/sites/entrez?cmd=Retrieve&db=homologene&dopt =AlignmentScores&list_uids=1912 Mutations Note http://www.ncbi.nlm.nih.gov/sites/entrez (look for TNFRSF11B into dbSNP)

11 Esonic variations For details see: http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=4982

Atlas Genet Cytogenet Oncol Haematol 2009; 6 843 Implicated in Entity Cancer Note A potential role of full-lenght OPG in tumor cell biology is supported by different studies that have investigated the OPG serum levels, OPG tissue expression and OPG polymorphisms in cancer patients. In fact, it has been shown that the serum levels of OPG are elevated in a variety of human malignancies, in particular in patients with more advanced cancer. Of note, OPG levels were increased in the serum of patients with prostate or breast cancer metastatized to the bone (Lipton et al., 2001). Surprisingly, OPG serum levels were elevated also in other types of tumors, which do not show a preferential tropism for bone, such as B cell lymphomas (Lipton et al., 2001), but also in patients with bladder carcinoma (Mizutani et al., 2004), where OPG levels were found to be associated with high tumour stage and grade. After a follow up period of 5 years, patients who had low serum OPG levels had a longer post-operative tumour-free interval and increased survival compared with patients with high levels of serum OPG (Mizutani et al., 2004), suggesting that serum OPG correlates with tumour stage and is also predictive of early recurrence of bladder carcinoma. Moreover, in different studies, it was shown that OPG is overexpressed in epithelial carcinomas of the gastroenteric tract (Ito et al., 2003; Pettersen et al., 2005). In particular, it was reported a significant correlation between OPG expression and tumor stage, suggesting that OPG expression may be a marker of aggressive gastric carcinomas. In addition, investigation of various human cancers demonstrated that OPG is highly expressed by endothelial cells in the majority of malignant tumors examined (60% of malignant tumors), although endothelial cells in benign tumors do not express high levels of OPG. In particular, in breast cancers endothelial expression of OPG seems to be associated with increasing tumor grade (Cross et al., 2006). Taken together, these observations suggest that the increased levels of OPG expression may be associated with tumor development and/or progression. Finally, a recent study has addressed the possible role of OPG promoter polymorphisms as genetic modifiers in the etiology of prostate cancer and disease progression (Narita et al., 2008). Patients affected by prostate cancer with TC and TT genotypes in the 950 T/C polymorphism had a significantly increased risk of extraprostatic and metastatic disease compared with those with the CC genotype. In addition, analysis of the metastatic prostatic cancer patients showed that the presence of the T allele of the OPG 950 T/C polymorphism was an independent risk factor, predicting survival by Cox proportional hazard regression analyses (Narita et al., 2008). Entity Vascular diseases Note A growing number of experimental data have demonstrated that the serum levels of OPG are significantly increased in both diabetic and non-diabetic patients affected by coronary artery disease (Jono et al., 2002; Schoppet et al., 2003; Avignon et al., 2005; Rasmussen et al., 2006), with a strong association between levels of OPG and the presence and severity of coronary artery disease (Browner et al., 2001). Serum OPG levels have shown to have prognostic value in heart failure after acute myocardial infarction as well as in patients affected by abdominal aortic aneurysm and peripheral artery disease (Karan et al., 2005; Ziegler et al., 2005). Remarkably, two OPG genetic polymorphisms have been associated with an increased risk of coronary artery disease in Caucasian men, and serum OPG levels correlated with one of these polymorphisms (Soufi et al., 2004). Thus, these studies strongly indicate that serum OPG levels frequently rise in clinical conditions that favor vascular dysfunction or atherosclerosis. In this respect, the presence of OPG has been documented in atherosclerotic lesions (Schoppet et al., 2004). Moreover, in a large observational study, plasma concentrations of OPG were higher in diabetic than in non-diabetic subjects, in particular in diabetic patients with vascular complications (Knudsen et al., 2003), suggesting that elevated levels of OPG may reflect vascular damage among patients with diabetes rather than the diabetic state per se. At present it is unclear whether OPG plays a pathogenetic or compensatory role in the vascular dysfunction and atherosclerosis. However, the ability of recombinant OPG to enhance the recruitment and infiltration of monocyte/macrophages ( Mosheimer et al., 2005) is particularly noteworthy in the hypothesis that an abnormal and prolonged elevation of OPG levels may be involved in the devolopment of vascular dysfunction. External links

Atlas Genet Cytogenet Oncol Haematol 2009; 6 844 Nomenclature

Entrez_Gene (NCBI) TNFRSF11B 4982 tumor necrosis factor receptor superfamily, member 11b Cards Atlas TNFRSF11BID42610ch8q24 GeneCards TNFRSF11B (Weizmann) Ensembl (Hinxton) ENSG00000164761 [Gene_View] TNFRSF11B [Vega] AceView (NCBI) TNFRSF11B Genatlas (Paris) TNFRSF11B euGene (Indiana) 4982 SOURCE (Stanford) NM_002546 Genomic and cartography TNFRSF11B - 8q24.12 chr8:120004977-120033564 - 8q24 [Description] GoldenPath (UCSC) (hg18-Mar_2006) Ensembl TNFRSF11B - 8q24 [CytoView] Mapping of TNFRSF11B [Mapview] homologs : NCBI OMIM 239000 602643 Gene and transcription Gene : Genbank AB002146 AF134187 AK223155 AK308524 AK313710 (Entrez) Reference sequence (RefSeq NM_002546 transcript) :SRS Reference transcript : NM_002546 Entrez RefSeq genomic : AC_000051 AC_000140 NC_000008 NT_008046 NW_001839136 NW_923984 SRS RefSeq genomic : AC_000051 AC_000140 NC_000008 NT_008046 NW_001839136 NW_923984 Entrez Consensus coding sequences : CCDS TNFRSF11B NCBI Cluster EST : Unigene Hs.81791 [ SRS ] Hs.81791 [ NCBI ] Alternative Splicing : 8144 Fast-db (Paris) Protein : pattern, domain, 3D structure Protein : O00300 (SRS) O00300 (Expasy) O00300 (Uniprot) UniProt/SwissProt With graphics : O00300 InterPro Splice isoforms : O00300(VarSplice FASTA) VarSplice FASTA Domaine pattern : DEATH_DOMAIN (PS50017) TNFR_NGFR_1 (PS00652) TNFR_NGFR_2 Prosite (SRS) (PS50050) Domain pattern : DEATH_DOMAIN (PS50017) TNFR_NGFR_1 (PS00652) TNFR_NGFR_2 Prosite (Expaxy) (PS50050) Domains : Interpro Death TNFR_11B TNFR_c6 (SRS) Domains : Interpro Death TNFR_11B TNFR_c6 (EBI) Related proteins : O00300 CluSTr Domain families : Death (PF00531) TNFR_c6 (PF00020) Pfam SRS

Atlas Genet Cytogenet Oncol Haematol 2009; 6 845 Domain families : Death (PF00531) TNFR_c6 (PF00020) Pfam Sanger Domain families : pfam00531 pfam00020 Pfam NCBI Domain families : TNFR (SM00208) Smart EMBL Blocks (Seattle) O00300 HPRD 04032 Protein Interaction databases DIP (DOE-UCLA) O00300 IntAct (EBI) O00300 Polymorphism : SNP, mutations, diseases Single Nucleotide Polymorphism (SNP) : TNFRSF11B dbSNP NCBI SNP : GeneSNP Utah TNFRSF11B SNP : HGBase TNFRSF11B Genetic variants : TNFRSF11B HAPMAP Somatic Mutations in TNFRSF11B Cancer : COSMIC Mutations and TNFRSF11B Diseases : HGMD Hereditary diseases : 239000 602643 OMIM Hereditary diseases : 239000 602643 GENETests Diseases : Genetic TNFRSF11B Association General knowledge Homologs : TNFRSF11B HomoloGene Homology/Alignments : Family Browser TNFRSF11B UCSC Phylogenetic Trees/Animal Genes : TNFRSF11B TreeFam Chemical/Protein 4982 Interactions : CTD skeletal system development receptor activity cytokine activity protein Keywords Ontology : binding extracellular region proteinaceous extracellular AmiGO matrix apoptosis signal transduction negative regulation of odontogenesis of dentine-containing tooth skeletal system development receptor activity cytokine activity protein Keywords Ontology : binding extracellular region proteinaceous extracellular EGO-EBI matrix apoptosis signal transduction negative regulation of odontogenesis of dentine-containing tooth Pathways : KEGG Cytokine-cytokine receptor interaction Other databases Probes Probes : Imagenes TNFRSF11B Related clones (RZPD - Berlin) Literature PubMed 212 Pubmed reference(s) in Entrez PubGene TNFRSF11B Bibliography

Atlas Genet Cytogenet Oncol Haematol 2009; 6 846 Osteoprotegerin: a novel secreted protein involved in the regulation of bone density. Simonet WS, Lacey DL, Dunstan CR, Kelley M, Chang MS, Luthy R, Nguyen HQ, Wooden S, Bennett L, Boone T, Shimamoto G, DeRose M, Elliott R, Colombero A, Tan HL, Trail G, Sullivan J, Davy E, Bucay N, Renshaw-Gegg L, Hughes TM, Hill D, Pattison W, Campbell P, Sander S, Van G, Tarpley J, Derby P, Lee R, Boyle WJ. Cell 1997; 89: 159-161. PMID 9108485

Characterization of a novel TNF-like ligand and recently described TNF ligand and TNF receptor superfamily genes and their constitutive and inducible expression in hematopoietic and nonhematopoietic cells. Tan KB, Harrop J, Reddy M, Young P, Terrett J, Emery J, Moore G, Truneh A. Gene 1997; 204: 35-46. PMID 9434163

Isolation of a novel cytokine from human fibroblasts that specifically inhibits osteoclastogenesis. Tsuda E, Goto M, Mochizuki SI, Yano K, Kobayashi F, Morinaga T, Higashio K. Biochem Biophys Res Commun 1997; 234: 137-142. PMID 9168977

Modulation of life and death by the TNF receptor superfamily. Baker SJ, Reddy EP. Oncogene 1998; 17: 3261-3270. PMID 9916988

Osteoprotegerin deficient mice develop early onset osteoporosis and arterial calcification. Bucay N, Sarosi I, Dunstan CR, Morony S, Tarpley J, Capparelli C, Scully S, Tan HL, Xu W, Lacey DL, Boyle WJ, Simonet WS. Genes Dev 1998; 12: 1260-1268. PMID 9573043

Osteoprotegerin is a receptor for the cytotoxic ligand TRAIL. Emery JG, McDonnell P, Burke MB, Deen KC, Lyn S, Silverman C, Dul E, Appelbaum ER, Eichman C, DiPrinzio R, Dodds RA, James IE, Rosenberg M, Lee JC, Young PR. J Biol Chem 1998; 273; 14363-14367. PMID 9603945

Severe osteoporosis in mice lacking osteoclastogenesis inhibitory factor/osteoprotegerin. Mizuno A, Amizuka N, Irie K, Murakami A, Fujise N, Kanno T, Sato Y, Nakagawa N, Yasuda H, Mochizuki S, Gomibuchi T, Yano K, Shima N, Washida N, Tsuda E, Morinaga T, Higashio K, Ozawa H. Biochem Biophys Res Comm 1998; 247; 610-615. PMID 9647741

Characterization of structural domains of human osteoclastogenesis inhibitory factor. Yamaguchi K, Kinosaki M, Goto M, Kobayashi F, Tsuda E, Morinaga T, Higashio K. J Biol Chem 1998; 273: 5117-5123. PMID 9478964

Identity of osteoclastogenesis inhibitory factor (OCIF) and osteoprotegerin (OPG): a mechanism by which OPG/OCIF inhibits osteoclastogenesis in vitro. Yasuda H, Shima N, Nakagawa N, Mochizuki SI, Yano K, Fujise N, Sato Y, Goto M, Yamaguchi K, Kuriyama M, Kanno T, Murakami A, Tsuda E, Morinaga T, Higashio K. Endocrinology 1998a; 39: 1329-1337. PMID 9492069

Osteoclast differentiation factor is a ligand for osteoprotegerin/osteoclastogenesis inhibitory factor and is identical to TRANCE/RANKL. Yasuda H, Shima N, Nakagawa N, Yamaguchi K, Kinosaki M, Mochizuki S, Tomoyasu A, Yano K,

Atlas Genet Cytogenet Oncol Haematol 2009; 6 847 Goto M, Murakami A, Tsuda E, Morinaga T, Higashio K, Udagawa N, Takahashi N, Suda T. Proc Natl Acad Sci U S A 1998b; 95: 3597-3602. PMID 9520411

OPG/FDCR-1, a TNF receptor family member, is expressed in lymphoid cells and is upregulated by ligating CD40. Yun TJ, Chaudhary PM, Shu GL, Frazer JK, Ewings MK, SSchwartz SM, Pascual V, Hood LE, Clark EA. J Immunol 1998; 161: 6113-6121. PMID 9834095

Associations of serum osteoprotegerin levels with diabetes, stroke, bone density, fractures, and mortality in elderly women. Browner WS, Lui LY, Cummings SR. J Clin Endocrinol Metab 2001; 86: 631-637. PMID 11158021

Receptor activator of NF-kB and osteoprotegerin expression by human microvascular endothelial cells, regulation by inflammatory cytokines, and role in human osteoclastogenesis. Collin-Osdoby P, Rothe L, Anderson F, Nelson M, Maloney W, Osdoby P. J Biol Chem 2001; 276: 20659-20672. PMID 11274143

Osteoprotegerin, a crucial regulator of bone metabolism, also regulates B cell development and function. Yun TJ, Tallquist MD, Aicher A, Rafferty KL, Marshall AJ, Moon JJ, Ewings ME, Mohaupt M, Herring SW, Clark EA. J Immunol 2001; 166: 1482-1491. PMID 11160187

Serum osteoprotegerin levels are associated with the presence and severity of coronary artery disease. Jono S, Ikari Y, Shioi A, Mori K, Miki T, Hara K, Nishizawa Y. Circulation 2002; 106: 1192-1194. PMID 12208791

The alpha(v)beta3 integrin, NF-kappaB, osteoprotegerin endothelial cell survival pathway. Potential role in angiogenesis. Scatena M, Giachelli C. Trends Cardiovasc Med 2002; 12: 83-88. PMID 15064358

Expression of osteoprotegerin correlates with aggressiveness and poor prognosis of gastric carcinoma. Ito R., Nakayama, H., Yoshida, K Kuraoka K, Motoshita J, Oda N, Oue N, Yasui W. Virchows Arch 2003; 443: 146-151. PMID 12838418

Increased plasma concentrations of osteoprotegerin in type 2 diabetic patients with microvascular complications. Knudsen ST, Foss CH, Poulsen PL, Andersen NH, Mogensen CE, Rasmussen LM. Eur J Endocrinol 2003; 149: 39-42. PMID 12824864

Serum osteoprotegerin levels in healthy controls and cancer patients. Lipton A, Ali SM, Leitzel K, Chinchilli V, Witters L, Engle L, Holloway D, Bekker P, Dunstan CR. Clin Cancer Res 2003; 8: 2306-2310. PMID 12114435

Increased osteoprotegerin serum levels in men with coronary artery disease.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 848 Schoppet M, Sattler AM, Juergen R, Schaefer JR, Herzum M, Maisch B, Hofbauer LC. J Clin Endocrinol Metab 2003; 88: 1024-1028. PMID 12629080

Clinical implications of the osteoprotegerin/RANKL/RANK system for bone and vascular diseases. Hofbauer LC, Schoppet M. JAMA 2004, 292: 490-495. PMID 15280347

Prognostic significance of serum osteoprotegerin levels in patients with bladder carcinoma. Mizutani Y, Matsubara H, Yamamoto K, Nan Li Y, Mikami K, Okihara K, Kawauchi A, Bonavida B, Miki T. Cancer 2004; 101: 1794-1802. PMID 15386310

The role of osteoprotegerin and tumor necrosis factor related apoptosis-inducing ligand in human microvascular endothelial cell survival. Pritzker LB, Scatena M, Giachelli CM. Mol Biol Cell 2004; 15: 2834-2841. PMID 15064358

Localization of osteoprotegerin, tumor necrosis factor-related apoptosis-inducing ligand, and receptor activator of nuclear factor-kB in Monckeberg's sclerosis and atherosclerosis. Schoppet M, Al-Fakhri N, Franke F, Katz N, Barth P, Maisch B, Preissner KT, Hofbauer LC. J Clin Endocrinol Metab 2004; 89: 4104-4112. PMID 15292354

Osteoprotegerin gene polymorphisms in men with coronary artery disease. Soufi M, Schoppet M, Sattler AM, Herzum M, Maisch B, Hofbauer LC, Schaefer JR. J Clin Endocrinol Metab 2004; 89: 3764-3768. PMID 15292302

The molecular triad OPG/RANK/RANKL: involvement in the orchestration of pathophysiological bone remodeling. Theoleyre S, Wittrant Y, Tat SK, Fortun Y, Redini F, Heymann D. Cytokine Growth Factor Rev 2004; 15: 457-475. (REVIEW) PMID 15561602

Osteoprotegerin is associated with silent coronary artery disease in high-risk but asymptomatic type 2 diabetic patients. Avignon A, Sultan A, Piot C, Elaerts S, Cristol JP, Dupuy AM. Diabetes Care 2005; 28: 2176-2180. PMID 16123486

Association of osteoprotegerin with human abdominal aortic aneurysm progression. Moran CS, McCann M, Karan M, Normal P, Ketheesan N, Golledge J. Circulation 2005; 111: 3119-3125. PMID 15939823

Syndecan-1 is involved in OPG-induced chemotaxis in human peripheral blood monocytes. Mosheimer BA, Kaneider NC, Feistritzer C, Djanani AM, Sturn DH, Patsch JR, Wiedermann CJ. J Clin Endocrin Metab 2005; 90: 2964-2971. PMID 15728209

Arterial osteoprotegerin: increased amounts in diabetes and modifiable synthesis from vascular smooth muscle cells by insulin and TNF-a. Olesen P, Ledet T, Rasmussen LM. Diabetologia 2005; 48: 561-568. PMID 15700136

Atlas Genet Cytogenet Oncol Haematol 2009; 6 849

Osteoprotegerin is expressed in colon carcinoma cells. Pettersen I, Bakkelund W, Smedsrod B, and Sveinbjornsson B. Anticancer Res 2005; 25: 3809-3816. PMID 16309167

Functional dissociation of osteoprotegerin and its interaction with receptor activator of NF-kB ligand. Schneeweis LA, Willard D, Milla ME. J Biol Chem. 2005 Dec 16;280(50):41155-64. PMID 16215261

Osteoprotegerin (OPG) is localized to the Weibel-Palade bodies of human vascular endothelial cells and is physically associated with von Willebrand factor. Zannettino AC, Holding CA, Diamond P, Atkins GJ, Kostakis P, Farrugia A, Gamble J, To LB, Findlay DM, Haynes DR. J Cell Physiol 2005; 204: 714-723. PMID 15799029

Osteoprotegerin plasma concentrations correlate with severity of peripheral artery disease. Ziegler S, Kudlacek S, Luger A, Minar E. Atherosclerosis 2005; 182: 175-180. PMID 16115489

Osteoprotegerin inactivation accelerates advanced atherosclerotic lesion progression and calcification in older ApoE-/- mice. Bennett BJ, Scatena M, Kirk EA, Rattazzi M, Varon RM, Averill M, Schwartz SM, Giachelli CM, Rosenfeld ME. Arterioscler Thromb Vasc Biol 2006; 26: 2117-2124. PMID 16840715

Osteoprotegerin (OPG)-a potential new role in the regulation of endothelial cell phenotype and tumour angiogenesis? Cross SS, Yang Z, Brown NJ, Balasubramanian SP, Evans CA, Woodward JK, Neville-Webbe HL, Lippitt JM, Reed MW, Coleman RE, Holen I. Int J Cancer 2006; 118: 1901-1908. PMID 16287088

Plasma osteoprotegerin levels are associated with glycaemic status, systolic blood pressure, kidney function and cardiovascular morbidity in type 1 diabetic patients. Rasmussen LM, Tarnow L, Hansen TK, Parving HH, Flyvbjerg A. Eur J Endocrinol 2006; 154: 75-81. PMID 16381994

An increased osteoprotegerin (OPG) serum release characterizes the early onset of diabetes mellitus and may contribute to endothelial cell dysfunction. Secchiero P, Corallini F, Pandolfi A, Consoli A, Candido R, Fabris B, Celeghini C, Capitani S, Zauli G. Am J Pathol 2006; 169: 2236-2244. PMID 17148684

RANKL-RANK signaling in osteoclastogenesis and bone disease. Wada T, Nakashima T, Hiroshi N, Penninger JM. Trends Mol Med 2006; 12: 17-25. PMID 16356770

Osteoprotegerin upregulates endothelial cell adhesion molecule response to tumor necrosis factor-alpha associated with induction of angiopoietin-2. Mangan SH, Campenhout AV, Rush C, Golledge J. Cardiovasc Res 2007; 76: 494-505. PMID 17706953

Atlas Genet Cytogenet Oncol Haematol 2009; 6 850

Osteoprotegerin increases leukocyte adhesion to endothelial cells both in vitro and in vivo. Zauli G, Corallini F, Bossi F, Fischietti F, Durigotto P, Celeghini C, Tedesco F, Secchiero P. Blood 2007; 110: 536-543. PMID 17363729

A genetic polymorphism of the osteoprotegerin gene is associated with an increased risk of advanced prostate cancer. Narita N, Yuasa T, Tsuchiya N, Kumazawa T, Narita S, Inoue T, Ma Z, Saito M, Horikawa Y, Satoh S, Ogawa O, Habuchi T. BMC Cancer. 2008 Aug 6;8:224. PMID 18684318

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed

Search in all EBI NCBI

Contributor(s) Written 08-2008 Maria Grazia Di Iasio, Federica Corallini, Paola Secchiero, Silvano Capitani Department of Morfology and Embryology, Human Anatomy Section - Ferrara University, 44100 ferrara, Italy Citation This paper should be referenced as such : Di Iasio MG, Corallini F, Secchiero P, Capitani S . TNFRSF11B (tumor necrosis factor receptor superfamily, member 11b). Atlas Genet Cytogenet Oncol Haematol. August 2008 . URL : http://AtlasGeneticsOncology.org/Genes/TNFRSF11BID42610ch8q24.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 851 Atlas of Genetics and Cytogenetics in Oncology and Haematology t(6;14)(q25-27;q32)

Clinics and Pathology Disease Haematological malignancies Phenotype / The phenotype is variable, and the translocation may be heterogenous at the level of cell stem origin the genes involved; there was one acute lymphoblastic leukaemia (ALL), four biphenotypic acute leukaemias (BAL), two of which with expression of myeloid and T- cell markers, one acute myeloid leukaemia (AML), one chronic T-cell neoplasm, and one chronic lymphocytic leukaemia (B-CLL) Binet stage B. Epidemiology Only 8 cases to date (5M/2F); there was 3 children and 4 adults (ages were: 12, 14, 28, 41, 54, 62, ?, ?). Prognosis Survival data is available in only 5 cases; patients died: "shortly", at 17 months, 33 mths, 45 mths, and 112 mths after diagnosis. Cytogenetics Additional The t(6;14) was the sole anomaly in five of eight cases; there was del(13q) in two anomalies cases, +12 in one, +21 in one. Genes involved and Proteins Note In only one of the above mentioned cases, BCL11B was detected as being involved in the translocation; the partner is unknown (Bezrookove et al., 2004). The case with BCL11B involvement was a case of M1-AML in a 54 year old male patient who died shortly after diagnosis. The t(6;14) was the sole anomaly. In other cases, data is missing concerning the genes implicated in the translocation. Gene Name BCL11B Location 14q32 Protein Kruppel-like zinc finger protein. Expressed in the immune system and in the brain. Regulates thymic differentiation and survival. To be noted Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. Bibliography Cytogenetics of childhood acute nonlymphocytic leukemia. Raimondi SC, Kalwinsky DK, Hayashi Y, Behm FG, Mirro J Jr, Williams DL. Cancer Genet Cytogenet. 1989 Jul 1;40(1):13-27. PMID 2758395

14q32 translocations are associated with mixed-lineage expression in childhood acute leukemia. Hayashi Y, Pui CH, Behm FG, Fuchs AH, Raimondi SC, Kitchingman GR, Mirro J Jr, Williams DL. Blood. 1990 Jul 1;76(1):150-6. PMID 2364166

Cytogenetic findings in 21 cases of peripheral T-cell lymphoma. Inwards DJ, Habermann TM, Banks PM, Colgan JP, Dewald GW. Am J Hematol. 1990 Oct;35(2):88-95. PMID 2399910

Is t(6;14) a non-random translocation in childhood acute mixed lineage leukemia? Batanian JR, Dunphy CH, Gale G, Havlioglu N. Cancer Genet Cytogenet. 1996 Aug;90(1):29-32. PMID 8780743

Abnormalities of chromosome bands 15q13-15 in childhood acute lymphoblastic leukemia.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 852 Heerema NA, Sather HN, Sensel MG, La MK, Hutchinson RJ, Nachman JB, Reaman GH, Lange BJ, Steinherz PG, Bostrom BC, Gaynon PS, Uckun FM. Cancer. 2002 Feb 15;94(4):1102-10. PMID 11920481

A novel t(6;14)(q25-q27;q32) in acute myelocytic leukemia involves the BCL11B gene. Bezrookove V, van Zelderen-Bhola SL, Brink A, Szuhai K, Raap AK, Barge R, Beverstock GC, Rosenberg C. Cancer Genet Cytogenet. 2004 Feb;149(1):72-6. PMID 15104287

Chromosomal translocations are associated with poor prognosis in chronic lymphocytic leukemia. Mayr C, Speicher MR, Kofler DM, Buhmann R, Strehl J, Busch R, Hallek M, Wendtner CM. Blood. 2006 Jan 15;107(2):742-51. Epub 2005 Sep 22. PMID 16179374

Acute mixed lineage leukemia and a t(6;14)(q25;q32) in two adults. Georgy M, Yonescu R, Griffin CA, Batista DA. Cancer Genet Cytogenet. 2008 Aug;185(1):28-31. PMID 18656690

Contributor(s) Written 07-2008 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers, France Citation This paper should be referenced as such : Huret JL . t(6;14)(q25-27;q32). Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Anomalies/t0614q25q32ID1324.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 853 Atlas of Genetics and Cytogenetics in Oncology and Haematology t(8;11)(p12;p15)

Clinics and Pathology Disease Acute meyloid leukaemia (AML) Epidemiology Two cases to date, two male patients, one was aged 50 yrs, and had a M4-AML (Larson et al., 1983; Sohal et al., 2001). Prognosis One patient died "following chemotherapy", the other one at 19 mths after diagnosis. Cytogenetics Additional +8, i(17q) in one case, del(9q) in the other case. anomalies Genes involved and Proteins Note In one case (Sohal et al., 2001), the genes were studied. FGFR1 was found involved; the breakpoint on the other chromosome fell within or near NUP98, but the involvement of NUP98 could not be proved. Gene Name FGFR1 Location 8p12 Protein Receptor tyrosine kinase; contains an extracellular ligand-binding domain with Ig-like structures, a transmembrane domain, and a cytosolic tyrosine kinase (TK) domain. Involved in signal transduction. External links Other database t(8;11)(p12;p15) Mitelman database (CGAP - NCBI) Other database t(8;11)(p12;p15) CancerChromosomes (NCBI) To be noted Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. Bibliography The predictive value of initial cytogenetic studies in 148 adults with acute nonlymphocytic leukemia: a 12-year study (1970-1982). Larson RA, Le Beau MM, Vardiman JW, Testa JR, Golomb HM, Rowley JD. Cancer Genet Cytogenet. 1983 Nov;10(3):219-36. PMID 6627222

Identification of four new translocations involving FGFR1 in myeloid disorders. Sohal J, Chase A, Mould S, Corcoran M, Oscier D, Iqbal S, Parker S, Welborn J, Harris RI, Martinelli G, Montefusco V, Sinclair P, Wilkins BS, van den Berg H, Vanstraelen D, Goldman JM, Cross NC. Genes Chromosomes Cancer. 2001 Oct;32(2):155-63. PMID 11550283

Contributor(s) Written 07-2008 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers, France Citation This paper should be referenced as such : Huret JL . t(8;11)(p12;p15). Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Anomalies/t0811p12p15ID1521.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 854 Atlas of Genetics and Cytogenetics in Oncology and Haematology t(8;12)(p12;q15)

Clinics and Pathology Disease 8p11 myelopreoliferative syndrome (EMS) Phenotype / Patients with EMS present with a myeloproliferative syndrome (MPS) with eosinophilia cell stem origin and a T-cell non Hodgkin lymphoma (NHL). Epidemiology Only one case to date, a 75 year old female patient (Sohal et al., 2001; Hidalgo-Curtis et al., 2008). Evolution The patient died 2 months after diagnosis, due to her lymphoma. Cytogenetics Additional The t(8;12) was the sole anomaly. anomalies Genes involved and Proteins Gene Name FGFR1 Location 8p12 Protein Receptor tyrosine kinase; contains an extracellular ligand-binding domain with Ig-like structures, a transmembrane domain, and a cytosolic tyrosine kinase (TK) domain. Involved in signal transduction. Gene Name CPSF6 Location 12q15 Protein Contains a RNA recognition motif (RRM), a proline rich domain, and an arginine rich domain. Involved in pre-mRNA processing. Result of the chromosomal anomaly Hybrid gene Description 5' CPSF6-3' FGFR1; fusion of CPSF6 intron 8 to FGFR1 exon 9, at nucleotide 1272 from ATG. Fusion Protein Description 895 amino acids protein (97 kDa) with the RRM domain of CPSF6, fused to the TK domain of FGFR1. External links Other database t(8;12)(p12;q15) Mitelman database (CGAP - NCBI) Other database t(8;12)(p12;q15) CancerChromosomes (NCBI) To be noted Additional cases are needed to delineate the epidemiology of this rare entity: you are welcome to submit a paper to our new Case Report section. Bibliography Identification of four new translocations involving FGFR1 in myeloid disorders. Sohal J, Chase A, Mould S, Corcoran M, Oscier D, Iqbal S, Parker S, Welborn J, Harris RI, Martinelli G, Montefusco V, Sinclair P, Wilkins BS, van den Berg H, Vanstraelen D, Goldman JM, Cross NC. Genes Chromosomes Cancer. 2001 Oct;32(2):155-63. PMID 11550283

The t(1;9)(p34;q34) and t(8;12)(p11;q15) fuse pre-mRNA processing proteins SFPQ (PSF) and CPSF6 to ABL and FGFR1. Hidalgo-Curtis C, Chase A, Drachenberg M, Roberts MW, Finkelstein JZ, Mould S, Oscier D, Cross NC, Grand FH. Genes Chromosomes Cancer. 2008 May;47(5):379-85. PMID 18205209

Contributor(s)

Atlas Genet Cytogenet Oncol Haematol 2009; 6 855 Written 07-2008 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers; CHU Poitiers Hospital, F-86021 Poitiers, France Citation This paper should be referenced as such : Huret JL . t(8;12)(p12;q15). Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Anomalies/t0812p12q15ID1201.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 856 Atlas of Genetics and Cytogenetics in Oncology and Haematology t(14;15)(q32;q11-13)

Clinics and Pathology Disease Diffuse large B-cell lymphoma (DLBCL). DLBCL is a molecularly heterogeneous type of aggressive lymphoma, accounting for approximately 40% of all B-cell non-Hodgkin lymphomas (NHL) of the Western world. Translocations involving the chromosomal region 15q11-13 also have been identified in nonlymphoid tumors. Phenotype / B-cell. The chromosomal translocation t(14;15)(q32;q11-13) can activate BCL8 gene cell stem origin expression in lymphoid tissues, whereas BCL8 expression is not normally found in hematopoietic tissues. Epidemiology Translocations affecting 15q11-q13 and various chromosomal partners occur in about 3-4% of DLBCL. Clinics At present, it is not not yet clear whether chromosomal translocation (t14;15) identifies a homogeneous. Pathology Clinico-pathologic subtype of DLBCL. Prognosis The effect of BCL8 expression on the prognosis of patients has yet to be investigated. Cytogenetics Additional DLBCL is a heterogeneous disease with respect to karyotypic abnormalities. t(14;15) anomalies (q32;q11-13)is a rare chromosomal translocation restricted to 4-5% DLBCL. The most frequent cytogenetic abnormalities detected in DLBCL involve BCL6 t(3;V)(q27;V), BCL2 t(14;18)(q32;q21), and myc t(8;14)(q24;q32), and occur in 25%, 20% and 10% of DLBCL, respectively. Variants In addition to IGHV gene translocation, other translocations of the chromosomal region 15q11-13 involve additional chromosomal sites, including 22q11 (IGLV), 9p13, 1p32,7p13, 12q24, and 15q22. Genes involved and Proteins Gene Name IgH Location 14q32 IgH gene is composed of V (variable), D (diversity), J (joining), and C (constant) Dna / Rna segments. During B cell development, a recombination event at the DNA level creates a rearranged IGHV-D-J gene. Protein Proteins encoded by the IgH gene are the immunoglobulin heavy chains. Gene Name BCL8 Location 15q11-q13 3 exons. The 5'part of exon 1 and the 3'part of exon 3 are non coding. Two alternative Dna / Rna transcripts: a major transcript of 2.6Kb, and a less expressed transcript of 4.5Kb, due to differential polyadenylation. Protein 100 amino acids, predicted molecular weight of 19 kDa; predicted: similar to protein neurobeachin (Lysosomal trafficking regulator 2). Truncated polypeptides with uncertain function are also produced. Result of the chromosomal anomaly Hybrid gene Description The translocation t(14;15)(q32;q11-13) leaves the coding region of BCL8 gene intact, and does not lead to the formation of a hybrid gene. BCL8 is adjacent to the chromosomal breakpoint, that is located upstream of a rearranged VH segment. BCL8 is a part of a large duplicated region within 15q11 containing several pseudogenes, including orphan IGH copies of V and D segments and it's possible that this V/D segments can rearrange with D/J segments on chromosome 14. Fusion Protein Description the chromosomal translocation does not lead to the formation of a fusion protein.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 857 Oncogenesis t(14;15)(q32;q11-13) causes activation of the BCL8 proto-oncogene by deregulated expression of BCL8. This chromosomal translocation may contribuite to lymphomagenesis by alterated expression level of BCL8. Bibliography Bcl8, a novel gene involved in translocations affecting band 15q11-13 in diffuse large-cell lymphoma. Dyomin VG, Rao PH, Dalla Favera R, Chaganti RSK. Proc Natl Acad Sci USA. 1997; 94: 5728-5732. PMID 9159141

Non-Hodgkin's Lymphoma: Molecular Features of B Cell Lymphoma. Macintyre E, Willerford D, Morrsi SW. Hematology Am Soc Hematol Educ Program. 2000; 180-204. PMID 11701542

BCL8 is a novel, evolutionarily conserved human gene family encoding proteins with presumptive protein kinase A anchoring function. Dyomin VG, Chaganti SR, Dyomina K, Palanisamy N, Murty VVVS, Dalla Favera R, Chaganti RSK. Genomics. 2002; 80(2): 158-165. PMID 12160729

Molecular heterogeneity of diffuse large B-cell lymphoma: implications for disease management and prognosis. Rossi D, Gaidano G. Hematology. 2002; 7(4): 239-252. PMID 14972786

Contributor(s) Written 07-2008 Silvia Rasi, Gianluca Gaidano Division of Hematology, Department of Clinical and Experimental Medicine & Center of Biotechnologies for Applied Medical Research, Amedeo Avogadro University of Eastern Piedmont, Via Solaroli 17, 28100 Novara, Italy Citation This paper should be referenced as such : Rasi S, Gaidano G . t(14;15)(q32;q11-13). Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Anomalies/t1415q32q12ID1349.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 858 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Hepatosplenic T-cell lymphoma (HSTCL)

Identity Other names Hepatosplenic Gamma delta T-cell lymphoma Diffuse small cleaved cell lymphoma, unclassified (WF classification) Pleomorphic small cell lymphoma, medium size cell (HTLV-1 negative) (Kiel classification) Clinics and Pathology Phenotype / This lymphoma entity originates from T-lymphocytes expressing the Gamma Delta cell stem origin subunits of the TCR. Rarely, cases expressing the Alpha Beta subunits were reported. Epidemiology Young males are affected predominantly. Clinics The disease presents with hepatosplenomegaly, in the absence of lymphadenopathy. Bone marrow involvement and cytopenias are frequently encountered (Cooke et al., 1996). Pathology The proliferation consists of medium-sized lymphocytes with a rim of pale cytoplasm. The nuclei show condensed chromatin with inconspicuous nucleoli (Feldman et al., 2006). Typically these cells show an intrasinusoidal pattern of growth sparing the portal triads and the white pulp. Intrasinusoidal bone marrow involvement may occur. The neoplastic lymphocytes are CD3+, CD4- and may express CD8 and CD56. These features, along with negativity for granzyme B and for perforin, indicate a proliferation of Gamma delta resting T lymphocyte. Treatment Multiagent chemotherapy, including anthracyclines is the treatment of choice. Autologous or allogeneic transplantation may have a role in selected patients (Cooke et al., 1996). Prognosis The patients usually respond to chemotherapy, but relapses occur frequently and median survival is around three years. Allogeneic BMT may cure some patients. Cytogenetics Cytogenetics Extra-copies of the long arm of chromosome 7q deriving from one or more Morphological isochromosome 7q are frequently found in this lymphoma. Trisomy 8 may also occur. Multiple copies of 7q were also documented by FISH. An increased number of 7q signals was found in cases with cytologic features of progression, indicating a tendency of HSTCL to multiply the i(7)(q10) chromosome during evolution. (Wlodarska et al 2002). Bibliography Hepatosplenic T-cell lymphoma: a distinct clinicopathologic entity of cytotoxic gamma delta T- cell origin. Cooke CB, Krenacs L, Stetler-Stevenson M, Greiner TC, Raffeld M, Kingma DW, Abruzzo L, Frantz C, Kaviani M, Jaffe ES. Blood 1996; 88(11): 4265-4274. PMID 8943863

Fluorescence in situ hybridization study of chromosome 7 aberrations in hepatosplenic T-cell lymphoma: isochromosome 7q as a common abnormality accumulating in forms with features of cytologic progression. Wlodarska I, Martin-Garcia N, Achten R, De Wolf-Peeters C, Pauwels P, Tulliez M, de Mascarel A, Briere J, Patey M, Hagemeijer A, Gaulard P. Genes Chromosomes Cancer. 2002; 33: 243-251. PMID 11807981

Classification and histopathology of the lymphomas. Feldman A, Pittaluga S, Jaffe ES. In: Canellos GP, Lister TA, Young BD: The Lymphomas 2nd edition. Saunders Elsevier, Philadelphia, 2006, pp 2-38

Atlas Genet Cytogenet Oncol Haematol 2009; 6 859

Contributor(s) Written 07-2008 Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin Hematology Section, Dept. Of Biomedical Sciences, University of Ferrara, 44100 Ferrara Italy Citation This paper should be referenced as such : Cuneo A, Cavazzini F, Rigolin GM . Hepatosplenic T-cell lymphoma (HSTCL). Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Anomalies/HepatoTlymphoID2099.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 860 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Intestinal T-cell lymphoma

Identity Other names Enteropathy-type T-cell lymphoma Clinics and Pathology Phenotype / The disease originates from a CD3+, CD7+ T-lymphocyte lacking CD4 and CD8 cell stem origin expression. Epidemiology The disease affects mainly the adult, with male predominance, and it is frequently associated with gluten-sensitive entheropathy. Pathology The disease consists of ulcerated lesions involving the small intestine. Perforation may occur. Small and larger atypical lymphocytes with pale cytoplasm infiltrate the epithelial mucosa of the villi. The TCR-Beta and TCR-Gamma genes are clonally rearranged. Treatment Multiagent chemotherapy (CHOP or CHOP-like regimes) was used. Evolution The disease may derive from patients with coeliac disease not responding to gluten- free diet. The lymphoma may spread to regional lymph nodes. Prognosis Response to chemotherapy is suboptimal and patients are vulnerable to toxicity of treatment due to intestinal symptoms and malnutrition preceding the diagnosis of lymphoma. Survival at 2 years was 28% in a study (Daum et al., 2003). Cytogenetics Cytogenetics Extra copies of chromosome 9q centered around the 9q33-34 region was detected by Molecular CGH and FISH studies (Zettl et al., 2002). 9p deletion with p16 loss was found in 18% of the cases, and loss of heterozygosity at 9p21 with loss of p16 expression was documented in approximately half of those cases with a large cell component (Obermann et al., 2004). DNA gains may involve the 5q33-34 and 7q31 regions, with a 30% frequency. Loss of chromosome material was detected at 6p24; 7p21, 17q23-25 and 17p13 (Baumgartner et al., 2003). Bibliography Chromosomal gains at 9q characterize enteropathy-type T-cell lymphoma. Zettl A, Ott G, Makulik A, Katzenberger T, Starostik P, Eichler T, Puppe B, Bentz M, Muller-Hermelink HK, Chott A. Am J Pathol. 2002; 161: 1635-1645. PMID 12414511

High frequency of genetic aberrations in enteropathy-type T-cell lymphoma. Baumgartner AK, Zettl A, Chott A, Ott G, Muller-Hermelink HK, Starostik P. Lab Invest. 2003; 83: 1509-1516. PMID 14563952

Intestinal non-Hodgkin's lymphoma: a multicenter prospective clinical study from the German Study Group on Intestinal non-Hodgkin's Lymphoma. Daum S, Ullrich R, Heise W, Dederke B, Foss HD, Stein H, Thiel E, Zeitz M, Riecken EO. J Clin Oncol. 2003; 21: 2740-2746. PMID 12860953

Loss of heterozygosity at chromosome 9p21 is a frequent finding in enteropathy-type T-cell lymphoma. Obermann EC, Diss TC, Hamoudi RA, Munson P, Wilkins BS, Camozzi ML, Isaacson PG, Du MQ, Dogan A. J Pathol. 2004; 202: 252-62. PMID 14743509

Contributor(s)

Atlas Genet Cytogenet Oncol Haematol 2009; 6 861 Written 07-2008 Antonio Cuneo, Francesco Cavazzini, Gian Matteo Rigolin Hematology Section, Dept. Of Biomedical Sciences, University of Ferrara, 44100 Ferrara Italy Citation This paper should be referenced as such : Cuneo A, Cavazzini F, Rigolin GM . Intestinal T-cell lymphoma. Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Anomalies/IntestinalTlymphoID2101.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 862 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Bone: Enchondroma

Identity Other names Solitary enchondroma Central chondroma Note Enchondroma is a common benign hyaline cartilaginous neoplasm that develops within the medullary cavity of bone. As the name suggests, it is located within the bone, either centrally (80% of cases) or eccentric (20% of cases). Most affected bones in order of frequency are phalanx of the hand, femur, metacarpal, humerus, tibia and rib. Enchondromas are mostly found in the diaphyseal or meta-diaphyseal region of the long bones while it is rarely observed in epiphyseal location. Thirty-five percent of enchondromas develop in the hand whereas its malignant counterpart is extremely rare at this location. In general, malignant transformation of enchondroma is extremely rare (overall risk <1% of cases). In rare instances, multiple enchondromas are found to occur in a syndrome ( enchondromatosis ). At gross specimen the enchondroma tissue looks white-grey and opalescent while yellow or red foci represent areas of calcification or ossification. Clinics and Pathology Phenotype / The origin of enchondroma is controversial. Previously, it was considered a dysplasia cell stem origin as deformities may be present due to huge masses of unresorbed cartilage. Virchow et al speculated that tissue derived from the epiphyseal plate could be responsible for the formation of enchondroma as they found accumulation of uncalcified cartilaginous tissue in metaphyses. This theory was further supported by Milgram who postulated enchondroma to originate from prolongated columns of epiphyseal cartilage. They also proposed anomalous cartilaginous growth plate sequencing leads to formation of cartilage cell rests, which later on would appear as lesions in patients having enchondromatosis. Weinmann and Sicher initially reported that enchondromas form from the undifferentiated connective tissue as new islands of cartilage. Later on, Aigner proposed the origin of chondrogenic neoplasms presumably to be multipotent mesenchymal precursor cells instead of (remnant) cartilage cells. He showed occurrence of neoplastic cells which show a chondrocytic cell shape and the similar gene expression profile like mature fetal chondrocytes responsible for the formation of characteristic hyaline cartilage like extracellular tumor matrix. Epidemiology Enchondroma accounts for 10-25% of all benign tumours. Both sexes are equally affected and it shows a wide age range from 5-80 years. Clinics The differential diagnosis between enchondroma and low grade chondrosarcoma is difficult and therefore, it is based on a combination of clinical, radiological and histological parameters. Usually, enchondromas of the long bones are asymptomatic and detected incidentally after a fracture or bone scans for other reasons. In case of long bones, calcified enchondromas are found. In contrast, enchondromas of the small bones of the hands and feet lack the calcification and may give palpable swellings, with or without pain. Enchondromas can be easily observed in radiographs since normal bone is replaced by mineralized or unmineralized hyaline cartilage. Radiographically, enchondromas are lytic lesions mostly in the center of the bone, can be mildly expansile with well defined, minimally thickened bony margins, along with intralesional calcification and diaphyseal expansion and minimal scalloping and may lead to cortical thinning. There is evidence of cartilaginous matrix (rings and arcs or popcorn-like calcifications).

Atlas Genet Cytogenet Oncol Haematol 2009; 6 863

A) Radiograph of left femur demonstrates intramedullary lesion in the diaphysis of the bone with irregular calcification B) MR image shows high signal intensity on T2 weighted images. The bone cortex is intact. Pathology Microscopically, enchondromas are hypocellular, non-vascular tumours with abundant hyaline cartilage matrix. The nuclei are small and round with condensed chromatin. Occasionally, binucleated cells without cytologic atypia are found. There is no mitotic activity. Myxoid matrix and endosteal erosion can be present in few tumors. There is often encasement (deposition of bone at the edges of the lobuli), while entrapment of preexisting host bone is absent and should be regarded a sign of malignancy. More worrisome histological criteria such as increased cellularity, myxoid change, cytological atypia and nuclear hyperchromasia are tolerated in case of 1) location in the small bones of the hands and feet, 2) in the context of enchondromatosis, 3) in young patients in which the growth plates are still open.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 864

C) Cartilaginous tumour with very low cellularity and abundance of chondroid matrix. Atypical cells and mitoses are absent. Treatment A wait-and-see policy is justified for asymptomatic lesions considered benign at radiography. Tumor growth can be determined clinically and by means of periodic radiographic examination. Biopsy can be done when asymptomatic lesions become large and symptomatic. Large or symptomatic tumours or borderline cases in which the distinction with low grade chondrosarcoma can not be made histologically nor radiographically can be treated surgically with margin improvement by means of phenol or cryosurgery. Recurrence of enchondroma is highly uncommon after curettage. Evolution Malignant transformation of solitary enchondroma is extremely rare (<1%). In the context of enchondromatosis ( Ollier disease, Maffucci syndrome ) the risk of malignant transformation is increased up to 35%. While enchondromas are most common at the phalangeal bones, chondrosarcoma of the phalanx is extremely rare. Local recurrence is uncommon. It rarely recurs as a low grade chondrosarcoma. Prognosis Enchondroma is a benign lesion. Recurrence is highly uncommon after curettage. Progression towards malignancy is rare (<1%), unless in the context of enchondromatosis (up to 35%). Extensive endosteal erosion and large size can be suspicious for malignancy. Only those tumors that cause symptoms such as increase in size, pain or swelling should be further investigated and treated. Genetics Note Array CGH was performed using two enchondromas. There was a gain on chromosome 13q and losses were present on chromosome 16p, 17, 19 and 22 in one enchondroma while in another case losses were observed of chromosome 19 and 22. Cytogenetics Note Enchondromas can exhibit a broad range of genetic alteration but chromosome 6 and 12 were found to be more frequently affected. Chromosomal region 12q13-15 was shown to be frequently involved in a subgroup of chondromas. Higher expression of JunB protein was found in low grade chondrosarcoma as compared to enchondromas. Therefore, it can be a potential diagnostic tool in differential diagnosis. The enchondromas that show an abnormal karyotype are shown in table 1.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 865 Table 1: Cytogenetic karyotypes of enchondromas. Bibliography Uber die entstehung des chondro und seine beziehung zur ecchondrosis und exostosis cartilaginea. Virchow R. 1875, p.760, Montasberichte d. Kgl. Preufs. Akad. Wissenschaften.

Ueber multiple exostosen, mit vorlegung von praparaten. Virchow R. 1891, 28;1082, Berl. Klin. Wochenschr.

Bone and Bones. Weinmann JP, Sicher H. 1955, St. Louis, C. V. Mosby.

Maffucci's syndrome: functional and neoplastic significance. Case report and review of the literature. Lewis RJ, Ketcham AS. J Bone Joint Surg Am. 1973 Oct;55(7):1465-79. PMID 4586088

The origins of osteochondromas and enchondromas. A histopathologic study. Milgram JW. Clin Orthop Relat Res. 1983 Apr;(174):264-84. PMID 6600991

Clonal karyotypic aberrations in enchondromas. Bridge JA, Persons DL, Neff JR, Bhatia P. Cancer Detect Prev. 1992;16(4):215-9. PMID 1458512

Biologic and clinical significance of cytogenetic and molecular cytogenetic abnormalities in benign and malignant cartilaginous lesions. Bridge JA, Bhatia PS, Anderson JR, Neff JR. Cancer Genet Cytogenet. 1993 Sep;69(2):79-90. PMID 8402563

Atlas Genet Cytogenet Oncol Haematol 2009; 6 866

The histopathology of fibrodysplasia ossificans progressiva. An endochondral process. Kaplan FS, Tabas JA, Gannon FH, Finkel G, Hahn GV, Zasloff MA. J Bone Joint Surg Am. 1993 Feb;75(2):220-30. PMID 7678595

Radiological Atlas of Bone tumors. Mulder JD, Schutte HE, Kroon HM, Takonis WK. 1993, Amsterdam: Elsevier.

Solitary enchondroma with clonal chromosomal abnormalities. Gunawan B, Weber M, Bergmann F, Wildberger J, Fuzesi L. Cancer Genet Cytogenet. 1998 Jul 15;104(2):161-4. PMID 9666812

Evidence of an association between 6q13-21 chromosome aberrations and locally aggressive behavior in patients with cartilage tumors. Sawyer JR, Swanson CM, Lukacs JL, Nicholas RW, North PE, Thomas JR. Cancer. 1998 Feb 1;82(3):474-83. PMID 9452264

Up-regulation of PTHrP and Bcl-2 expression characterizes the progression of osteochondroma towards peripheral chondrosarcoma and is a late event in central chondrosarcoma. Bovee JV, van den Broek LJ, Cleton-Jansen AM, Hogendoorn PC. Lab Invest. 2000 Dec;80(12):1925-34. PMID 11140704

Cartilaginous lesions of bone. Unni KK. J Orthop Sci. 2001;6(5):457-72. PMID 11845358

Towards a new understanding and classification of chondrogenic neoplasias of the skeleton-- biochemistry and cell biology of chondrosarcoma and its variants. Aigner T. Virchows Arch. 2002 Sep;441(3):219-30. Epub 2002 May 1. PMID 12242518

World Health Organization Classification of Tumors. Pathology and genetics. Tumors of Soft Tissue and Bone. Fletcher CDM, Unni K, Mertens F, (Ed). Lyon: IARC Press; 2002:427.

Diagnosis and prognosis of chondrosarcoma of bone. Rozeman LB, Hogendoorn PC, Bovee JV. Expert Rev Mol Diagn. 2002 Sep;2(5):461-72. PMID 12271817

Cytogenetic findings in benign cartilaginous neoplasms. Buddingh EP, Naumann S, Nelson M, Neffa JR, Birch N, Bridge JA. Cancer Genet Cytogenet. 2003 Mar;141(2):164-8. PMID 12606137

Fusion, disruption, and expression of HMGA2 in bone and soft tissue chondromas. Dahlen A, Mertens F, Rydholm A, Brosjo O, Wejde J, Mandahl N, Panagopoulos I. Mod Pathol. 2003 Nov;16(11):1132-40. PMID 14614053

Updates on the cytogenetics and molecular genetics of bone and soft tissue tumors:

Atlas Genet Cytogenet Oncol Haematol 2009; 6 867 chondrosarcoma and other cartilaginous neoplasms. Sandberg AA, Bridge JA. Cancer Genet Cytogenet. 2003 May;143(1):1-31. PMID 12742153

Comparative genomic hybridization in cartilaginous tumors. Ozaki T, Wai D, Schafer KL, Lindner N, Bocker W, Winkelmann W, Dockhorn-Dworniczak B, Poremba C. Anticancer Res. 2004 May-Jun;24(3a):1721-5. PMID 15274346

Genetics of chondrosarcoma and related tumors. Sandberg AA. Curr Opin Oncol. 2004 Jul;16(4):342-54. PMID 15187889

Cryosurgery in aggressive, benign, and low-grade malignant bone tumours. Veth R, Schreuder B, van Beem H, Pruszczynski M, de Rooy J. Lancet Oncol. 2005 Jan;6(1):25-34. PMID 15629273

Premalignant conditions of bone. Horvai A, Unni KK. J Orthop Sci. 2006 Jul;11(4):412-23. PMID 16897210

Differential expression of runx2 and Indian hedgehog in cartilaginous tumors. Park HR, Park YK. Pathol Oncol Res. 2007;13(1):32-7. Epub 2007 Mar 27. PMID 17387386

Enchondroma protuberans of the hand. An YY, Kim JY, Ahn MI, Kang YK, Choi HJ. AJR Am J Roentgenol. 2008 Jan;190(1):40-4. PMID 18094292

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 07-2008 Twinkal C Pansuriya, Judith VMG Bovée Dept of Pathology, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden, The Netherlands Citation This paper should be referenced as such : Pansuriya TC, Bovée JVMG . Bone: Enchondroma. Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Genes/EnchondromaID5333.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 868 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Enchondromatosis

Identity Other Multiple chondromatosis names Multiple enchondromatosis Note Most enchondromas and/or conventional central chondrosarcomas are solitary but some occur multiple in the context of a syndrome called enchondromatosis. It is rare and both sexes are equally affected. The enchondromatosis syndrome includes Ollier disease, Maffucci syndrome, spondyloenchondromatosis, metachondromatosis and generalized enchondromatosis. In 1978 Spranger et al summarized six different classes of enchondromatosis based on radiographic features. In 2005, Bhargava et al further delineated some of the syndromes and distinguished non-hereditary and hereditary forms. Inheritance Ollier disease and Maffucci syndrome are non-inherited disorders while spondyloenchondromatosis is inherited as an autosomal recessive disorder. However, there was a case reported by Robinson et al which showed autosomal dominant inheritance of spondyloenchondrodysplasia. Metachondromatosis follows an autosomal dominant inheritance pattern. With the exception of Ollier disease, in which PTHR1 mutations are found in a very small subset of patients, the responsible genes for these extremely rare syndromes are so far unknown.

Clinics Note Clinical behaviour is determined by size, number, location and evolution of enchondromas, age of onset and of diagnosis. The diagnosis is mainly based on clinical, histological and radiological evaluation. Usually enchondromas are asymptomatic but in case of symptomatic enchondromas (pain, increase in size), further investigations could be indicated. The clinical features of enchondromatosis

Atlas Genet Cytogenet Oncol Haematol 2009; 6 869 depend upon the extent of disease and ranges from few small lesions to multiple, widely distributed lesions causing marked skeletal deformation. Microscopically, the lesions can be more cellular and cytologically atypical as compared to solitary enchondroma. Macroscopic examination of enchondromas shows marked expansion and cortical attenuation in large bones. Radiographically, the lesions of enchondromatosis typically show multiple, radiolucent or mineralized homogeneous well defined lesions with oval or elongated shape. Phenotype and There are several cases reported in which disease is limited to multifocal involvement clinics of a single bone while in other cases wide spread lesions and crippling deformation can be observed. The common site for development of enchondromas includes hand, foot, femur, humerus and forearm bones. Sometimes in case of severe condition, flat bones are also affected. Neoplastic risk There is an increased risk of development of malignant tumors. In Ollier disease and Maffucci syndrome 25-30% of cases undergo malignant transformation. Treatment Treatment depends on the type of enchondromatosis; it may include surgery, amputation, bone grafting and sclerotherapy. Prognosis The prognosis is dependent on the extent and severity of the disease. Cortical erosion, pathological fracture and extension of the tumor into soft tissues can be considered as a sign of malignancy. Cytogenetics Note Karyotypes of patients with Ollier disease or Maffucci syndrome are normal. External links Orphanet Enchondromatosis Bibliography Metachondromatosis. Maroteaux P. Z Kinderheilkd. 1971;109(3):246-61. PMID 5313319

Maffucci's syndrome: functional and neoplastic significance. Case report and review of the literature. Lewis RJ, Ketcham AS. J Bone Joint Surg Am. 1973 Oct;55(7):1465-79. PMID 4586088

Spondyloenchondrodysplasia. Enchondromatomosis with severe platyspondyly in two brothers. Schorr S, Legum C, Ochshorn M. Radiology. 1976 Jan;118(1):133-9. PMID 1244645

Two peculiar types of enchondromatosis. Spranger J, Kemperdieck H, Bakowski H, Opitz JM. Pediatr Radiol. 1978 Dec 4;7(4):215-9. PMID 733398

Metachondromatosis. Beals RK. Clin Orthop Relat Res. 1982 Sep;(169):167-70. PMID 6980764

Metachondromatosis. Kennedy LA. Radiology. 1983 Jul;148(1):117-8. PMID 6602353

Metachondromatosis. Report of four cases. Bassett GS, Cowell HR. J Bone Joint Surg Am. 1985 Jun;67(5):811-4.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 870 PMID 3873457

The malignant potential of enchondromatosis. Schwartz HS, Zimmerman NB, Simon MA, Wroble RR, Millar EA, Bonfiglio M. J Bone Joint Surg Am. 1987 Feb;69(2):269-74. PMID 3805090

Generalized enchondromatosis. A case report. Paterson DC, Morris LL, Binns GF, Kozlowski K. J Bone Joint Surg Am. 1989 Jan;71(1):133-40. PMID 2912994

Genochondromatosis. Le Merrer M, Fressinger P, Maroteaux P. J Med Genet. 1991 Jul;28(7):485-9. PMID 1895320

Spondyloenchondrodysplasia. A rare cause of short-trunk syndrome. Robinson D, Tieder M, Copeliovitch L, Halperin N. Acta Orthop Scand. 1991 Aug;62(4):375-8. PMID 1882681

Dysspondylochondromatosis. Freisinger P, Finidori G, Maroteaux P. Am J Med Genet. 1993 Feb 15;45(4):460-4. PMID 8465851

Radiological Atlas of Bone tumors. Mulder JD, Schutte HE, Kroon HM, Takonis WK. 1993, Amsterdam: Elsevier.

Enchondromatosis with features of dysspondyloenchondromatosis and Maffucci syndrome. Haga N, Nakamura K, Taniguchi K, Nakamura S. Clin Dysmorphol. 1998 Jan;7(1):65-8. PMID 9546836

Pathological fractures, a consideration with metachondromatosis and differential diagnoses: Osteochondromatosis and Gauchers Disease. Banks RJ. Australas Chiropr Osteopathy. 2002 Nov;10(2):105-10. PMID 17987186

Multiple enchondromatosis: a case report. Benbouazza K, El Hassani S, Hassikou H, Guedira N, Hajjaj-Hassouni N. Joint Bone Spine. 2002 Mar;69(2):236-9. PMID 12027322

Distinctive enchondromatosis with spine abnormality, regressive lesions, short stature, and coxa vara: importance of long-term follow-up. Kozlowski KS, Masel J. Am J Med Genet. 2002 Jan 22;107(3):227-32. PMID 11807904

Bone Dysplasias: An Atlas of Genetic Disorders of Skeletal Development. Spranger JW, Brill PW, Poznanski A. Second edition, 2002, Oxford University Press.

Autosomal dominant inheritance of spondyloenchondrodysplasia. Bhargava R, Leonard NJ, Chan AK, Spranger J. Am J Med Genet A. 2005 Jun 15;135(3):282-8.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 871 PMID 15887273

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 07-2008 Twinkal C Pansuriya, Judith VMG Bovée Dept of Pathology, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden, The Netherlands Citation This paper should be referenced as such : Pansuriya TC, Bovée JVMG . Enchondromatosis. Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Genes/EnchondromatosisID10151.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 872 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Familial platelet disorder with predisposition to acute myelogenous leukemia (FPD/AML)

Identity Other names Familial platelet disorder with predisposition to myeloid malignancy Inheritance Familial platelet disorder with predisposition to acute myelogenous leukemia is a rare autosomal dominant disorder caused by heterozygous germline mutations in transcription factor RUNX1. Only fifteen pedigrees have been reported to date. The disease appears to have complete penetrance and affected individuals are born at the expected frequency for an autosomal dominant trait. There have been no reports of parental consanguinity among the pedigrees described so far, and males and females are equally affected. Together with CEBPA-associated leukemia and familial monosomy 7, FPD/AML represents one of the few identified genetic disorders underlying pure familial leukemia cases. Clinics Phenotype and Familial platelet disorder with predisposition to acute myelogenous leukemia is clinics characterized by inherited thrombocytopenia, platelet function defect and a lifelong risk of myelodysplastic syndrome (MDS) and acute myelogenous leukaemia (AML). Thrombocytopenia is usually mild to moderate and is characterized by normal platelet size. Decreased expression of the thrombopoietin Mpl receptor has been found in these patients, providing a potential explanation for low platelet counts. Bleeding tends to be more severe than expected according to the degree of thrombocytopenia due to the presence of associated platelet dysfunction and results in a significant bleeding diathesis, which, although not severe, might be life-threatening after surgery or child- bearing. Platelet aggregation is abnormal in response to several platelet agonists although the mechanisms underlying this defect are not clear. Both platelet storage pool deficiency and impaired alphaIIbbeta3 integrin (GPIIbIIIa) activation and fibrinogen binding have been described. The presence of platelet dysfunction seems to be a constant feature of this disorder and, although frequently associated to thrombocytopenia, some affected individuals display platelet counts at the lower limit of normal. Neoplastic risk Patients with FPD/AML are predisposed to myeloid malignancies, including AML and MDS. Several AML FAB subtypes have been reported to occur, including M1, M2, M4 and M5, while refractory anemia with excess blasts, chronic myelomonocytic leukemia and hypoplastic MDS with myelofibrosis have been described among the cases with MDS. The rate of myeloid malignancies ranges between 20 to 65% and peaks at the fourth decade of life. Median age of leukemia onset is 37 years old, ranging from 6 to 75. Germline RUNX1 mutations seem to be insufficient by themselves for leukemia development and acquisition of additional cooperating events are required. Several cytogenetic abnormalities have been identified in FPD/AML patients who develop myeloid neoplasms, including del(5q), -7/del(7q), +8, del(11q), 11q23 rearrangements, del (20q) and +21. On the other hand, no mutations have been found in the remaining RUNX1 allele in FPD/AML patients who developed leukemia. The mechanisms by which germline RUNX1 mutations predispose to leukemia remain unclear. RUNX1 deficiency in adult mice (RUNX1 +/- and -/-) is accompanied by an increase in committed myeloid progenitors, which could be explained by alteration in proliferative and/or self-renewal capacity or, alternatively, by partial block in differentiation. These abnormalities result in an expanded pool of progenitors susceptible to second mutations. Besides, there is evidence that RUNX1 functions as a tumor suppressor gene through up-regulation of p14ARF, which enhances p53 tumor- suppressive activity by binding to its negative regulator Mdm3. RUNX1 is believed to be haploinsufficient for tumor suppression, providing an additional explanation for leukemia presdisposition seen in this disorder.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 873 Treatment Recommendations for management of FPD/AML patients are lacking due to the low frequency of this disorder and need to be assessed individually. Bleeding should be managed as for other platelet function disorders, according to severity of bleeding manifestations. Patients with FPD/AML who develop AML or MDS are candidates for hematopoietic stem cell transplantation. As thrombocytopenia in FPD/AML is frequently mild or moderate and may be overlooked, mutational screening of potential sibling donors is required to avoid transplantation of stem cells harbouring the same RUNX1 mutation. Prognosis Platelet counts tend to remain stable throughout lifetime except when development of myeloid malignancy occurs. Prognosis depends on disease transformation to MDS/AML, the risk of which seems to vary according to the type of RUNX1 mutation and its effect on RUNX1 function. Genes involved and Proteins

Gene Name RUNX1 (runt-related transcription factor 1) Location 21q22.12 DNA/RNA Description The RUNX1 gene encompasses 12 exons. Exons 3 to 5 encode the DNA-binding domain, while the transactivation domain is enclosed in exons 7b and 8. Transcription yields several isoforms, which are generated by alternative splicing, different promoter usage and differential usage of polyadenylation sites. Most abundant species include isoforms RUNX1b and RUNX1c, which encode the full- length protein. Transcription of RUNX1c is initiated at the distal promoter and includes exons 1 and 2, while RUNX1b is regulated by the proximal promoter and starts at exon 3, both including exons 4, 5, 6, 7b and 8, according to nomenclature described by Miyoshi and colleagues. Thus, RUNX1b and c differ at their amino (N)-terminal end, being the former 27 amino acids shorter than the latter, although there appears to be no relevant functional differences between them. In contrast, the shorter RUNX1a isoform is a truncated variant spanning exons 3 to 7a with DNA-binding but no transactivation activity which may potentially interfere with RUNX1b and c function, acting as a negative regulator. Protein

Diagram of the RUNX1 gene and the three major mRNA and protein species, according to the nomenclature described by Miyoshi et al. Exons are represented by boxes, solid boxes indicate coding regions, while open boxes represent untranslated regions. RUNX1a differs from RUNX1b and RUNX1c at the C-terminal half of the protein, while RUNX1c differs at the N-terminal end. The DNA-binding runt homology domain (RHD) and the transactivation domain (TAD) of the protein are depicted. Description The RUNX1b protein consists of 453 amino acids with 48 kDa molecular weight, RUNX1c comprises 480 amino acids while RUNX1a is formed by 250 amino acids. RUNX1 belongs to a family of heterodimeric transcription factors which include RUNX2 and RUNX3, all of them forming heterodimers with CBFbeta.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 874 RUNX factors comprise an N-terminal region named the runt homology domain (RHD), because of its homology to Drosophila Runt protein, which mediates both DNA binding and heterodimerization with CBFbeta, and a carboxyl(C)-terminal region responsible for transcriptional regulation. Heterodimerization with CBFbeta enhances its DNA-binding capacity and protects it from proteolytic degradation. RUNX1 binds to the DNA consensus sequence TGTGGT and functions as a transcriptional activator or repressor, depending on promoter structure, the spliced variant expressed and the cellular context. RUNX1 is believed to act as a transcriptional organizer, recruiting other lineage-specific transcription factors to their promoters. Expression During embryogenesis, RUNX1 can be detected in hematopoietic stem cells and endothelial cells of the AGM region, while after organogenesis, RUNX1 is predominantly expressed in the hematopoietic system. Highest levels are found in thymus, bone marrow and peripheral blood. Localisation Nucleus. Function The RUNX1/ CBFbeta transcription complex is critical for normal hematopoiesis, as revealed in RUNX1-null mice, which die during embryonic development due to failure to establish definitive hematopoiesis. Although it is dispensable for the maintenance of adult hematopoietic stem cells, it plays an essential role in the development of the megakaryocytic and lymphoid lineages. The role of RUNX1 in megakaryocytes is beginning to be revealed. In vitro studies suggest that RUNX1 participates in megakaryocyte lineage commitment and divergence from the erythroid pathway. While FPD/AML patients show a decrease in megakaryocyte colony growth, heterozygous or conditional biallelic deletion of RUNX1 in mice leads to increased megakaryocyte growth with a partial arrest in differentiation. Besides, several abnormalities in the lymphoid lineage have been revealed in mouse models, including defects in B- and T-cells. In contrast, despite its expression in monocytes and neutrophils and its regulation of genes specific to these cells, lack of RUNX1 has no apparent effects in monocyte or neutrophil number or function. Known targets of RUNX1 in hematopoietic cells include cytokines, cell receptors and differentiation molecules, such as GM-CSF, IL-3, myeloperoxidase, neutrophil elastase, M-CSF and TCR receptors. Homology Other members of the RUNX family include RUNX2 and RUNX3, which are alternative heterodimeric parterns for CBFbeta. Mutations Note Germline RUNX1 mutations Linkage to chromosome 21q22.12 was established in 1996 in a large FPD/AML pedigree described by Dowton and colleagues. Among genes mapping to this region, RUNX1 emerged as an attractive candidate for this disorder and subsequently, RUNX1 mutations were identified in several FPD/AML patients. Fourteen different mutations have been detected in fifteen pedigrees reported so far, including missense, nonsense and frameshift mutations and a large intragenic deletion. Most mutations are clustered in the RHD, although mutations in the C- terminal region have been found in three cases. Most frequently involved amino acids are those included in the three loops which contact the DNA-interface, comprising amino acids 74-87, 139-145 and 171-177. In vitro functional studies have shown that RHD mutations abrogate the DNA-binding and transactivation capacity while, according to whether they retain or loose their ability to heterodimerize with CBFbeta, they interfere with the wild-type protein in a dominant-negative manner or act through haploinsufficiency, respectively. On the other hand, C-terminal mutants have an enhanced capacity to bind DNA, due to lack of a DNA-binding inhibitory domain, and interact strongly with CBFbeta and are therefore expected to strongly repress the normal allele. Dominant-negative mutations seem to cause higher predisposition to leukemia than those acting via haploinsufficiency. Recently, constitutional microdeletions on 21q encompassing the RUNX1 locus have been reported to cause congenital thrombocytopenia associated with mental retardation, developmental delay and predisposition to leukemia.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 875

Schematic structure of RUNX1b protein and position of germline mutations identified in fifteen FPD/AML pedigrees. Missense mutations are show at the upper side of the panel in pale blue, while nonsense and frameshift mutations are represented in green at the bottom. A large intragenic deletion was found in one case. * indicates this mutation has been identifed in two pedigrees. Somatic RUNX1 is one of the genes most frequently dysregulated in leukemia, mostly through chromosomal translocations, mutations and amplifications. RUNX1 was originally cloned as the target of the t(8;21) chromosomal translocation characteristic of AML which encodes the RUNX1 (AML1) - ETO fusion product, and was subsequently found to be involved in other chromosomal translocations in both myeloid and lymphoblastic neoplasms, such as t(12;21) and t(3;21), which generate TEL - RUNX1 and RUNX1 - MDS1/EVI1 transcripts. Besides, acquired point mutations in the RUNX1 gene have been reported in 5% sporadic leukemia, predominantly in FAB subtype M0, where they are frequently biallelic. Moreover, mutations have been detected in approximately 8% MDS patients and in 45% secondary MDS and AML. While AML mutations occur mainly in the RHD, both N-terminal and C-terminal mutations have been reported in MDS. On the other hand, RUNX1 amplification occurs predominantly in pediatric LLA.

External links Orphanet Familial platelet syndrome Bibliography Studies of a familial platelet disorder. Dowton SB, Beardsley D, Jamison D, Blattner S, Li FP. Blood. 1985 Mar;65(3):557-63. PMID 3855665

Inherited platelet-storage pool deficiency associated with a high incidence of acute myeloid leukaemia. Gerrard JM, Israels ED, Bishop AJ, Schroeder ML, Beattie LL, McNicol A, Israels SJ, Walz D, Greenberg AH, Ray M, et al. Br J Haematol. 1991 Oct;79(2):246-55. PMID 1958483

Alternative splicing and genomic structure of the AML1 gene involved in acute myeloid leukemia. Miyoshi H, Ohira M, Shimizu K, Mitani K, Hirai H, Imai T, Yokoyama K, Soeda E, Ohki M. Nucleic Acids Res. 1995 Jul 25;23(14):2762-9. PMID 7651838

Linkage of a familial platelet disorder with a propensity to develop myeloid malignancies to human chromosome 21q22.1-22.2. Ho CY, Otterud B, Legare RD, Varvil T, Saxena R, DeHart DB, Kohler SE, Aster JC, Dowton SB, Li FP, Leppert M, Gilliland DG. Blood. 1996 Jun 15;87(12):5218-24. PMID 8652836

Atlas Genet Cytogenet Oncol Haematol 2009; 6 876 Evidence for genetic homogeneity in a familial platelet disorder with predisposition to acute myelogenous leukemia (FPD/AML). Arepally G, Rebbeck TR, Song W, Gilliland G, Maris JM, Poncz M. Blood. 1998 Oct 1;92(7):2600-2. PMID 9746808

Molecular basis of tissue-specific gene expression mediated by the Runt domain transcription factor PEBP2/CBF. Ito Y. Genes to Cells. 1999; 4: 685-696. REVIEW. PMID 10620014

Haploinsufficiency of CBFA2 causes familial platelet disorder with propensity to develop acute myelogenous leukaemia. Song WJ, Sullivan MG, Legare RD, Hutchings S, Tan X, Kufrin D, Ratajczak J, Resende IC, Haworth C, Hock R, Loh M, Felix C, Roy DC, Busque L, Kurnit D, Willman C, Gewirtz AM, Speck NA, Bushweller JH, Li FP, Gardiner K, Poncz M, Maris JM, Gilliland DG. Song WJ, Sullivan MG, Legare RD. Nat Genet. 1999 Oct;23(2):166-75. PMID 10508512

A novel CBFA2 single-nucleotide mutation in familial platelet disorder with propensity to develop myeloid malignancies. Bujis A, Poddighe P, vanWijk R van Solinge W, Borst E, Verdonck L, Hagenbeek A, Pearson P, Lokhorst H. Blood. 2001 Nov 1;98(9):2856-8. PMID 11675361

Dimerization with PEBP2B protects RUNX1/AML1 from ubiquitin-proteasome-mediated degradation. Huang G, Shigesada K, Ito K, Wee H, Yokomizo T, Ito Y. EMBO J. 2001; 20: 723-733. PMID 11179217

Architecture and anatomy of the genomic locus encoding the human leukemia-associated transcription factor RUNX1/AML1. Levanon D, Glusman G, Bangsow T, Ben-Asher E, Male DA, Avidan N, Bangsow C, Hattori M, Taylor TD, Taudien S, Blechschmidt K, Shimizu N, Rosenthal A, Sakaki Y, Lancet D, Groner Y. Gene. 2001 Jan 10;262(1-2):23-33. PMID 11179664

In vitro analyses of known and novel RUNX1/AML1 mutations in dominant familial platelet disorder with predisposition to acute myelogenous leukemia: implications for mechanisms of pathogenesis. Michaud J, Wu F, Osato M, Cottles GM, Yanagida M, Asou N, Shigesada K, Ito Y, Benson KF, Raskind WH, Rossier C, Antonarakis SE, Israels S, McNicol A, Weiss H, Horwitz M, Scott HS. Blood. 2002 Feb 15;99(4):1364-72. PMID 11830488

A novel inherited mutation of the transcription factor RUNX1 causes thrombocytopenia and may predispose to acute myeloid leukaemia. Walker LC, Stevens J, Campbell H Corbett R, Spearing R, Heaton D, Macdonald DH, Morris CM, Ganly P. Br J Haematol. 2002 Jun;117(4):878-81. PMID 12060124

The role of a Runt domain transcription factor AML1/RUNX1 in leukemogenesis and its clinical implications. Asou N. Crit Rev Oncol Hematol. 2003; 45: 129-150. REVIEW.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 877 PMID 12604126

Association of CBFA2 mutation with decreased platelet PKC-theta and impaired receptor- mediated activation of GPIIb-IIIa and pleckstrin phosphorylation: proteins regulated by CBFA2 play a role in GPIIb-IIIa activation. Sun L, Mao G, Rao AK. Blood, 2004 Feb 1;103(3):948-54. PMID 14525764

Low Mpl receptor expression in a pedigree with familial platelet disorder with predisposition to acute myelogenous leukemia and a novel AML1 mutation. Heller PG, Glembotsky AC, Gandhi MJ, Cummings CL, Pirola CJ, Marta RF, Kornblihtt LI, Drachman JG, Molinas FC. Blood. 2005 Jun 15;105(12):4664-70. PMID 15741216

Normal and transforming functions of RUNX1: a perspective. Mikhail FM, Sinha KK, Saunthararajah Y, Nucifora G. J Cell Physiol. 2006 Jun;207(3):582-93. REVIEW. PMID 16250015

Clinical phenotype of germline RUNX1 mutations to large genomic deletions. Beri- Dexheimer M, Latger- Cannard V, Philippe C et al. Eur J Hum Genet. 2008 Aug;16(8):1014-8. PMID 18478040

Syndromic thrombocytopenia and predisposition to acute myelogenous leukemia caused by constitutional microdeletions on chromosome 21q. Shinawi M, Erez A, Shardy DL, Lee B, Naeem R, Weissenberger G, Chinault AC, Cheung SW, Plon SE. Blood. 2008 Aug 15;112(4):1042-7 PMID 18487507

REVIEW articles automatic search in PubMed Last year publications automatic search in PubMed Contributor(s) Written 07-2008 Paula G Heller Hematologia Investigacion, Instituto de Investigaciones Medicas Alfredo Lanari, Universidad de Buenos Aires, Unidad Ejecutora IDIM-CONICET, Combatientes de Malvinas 3150 Buenos Aires 1427, Argentina. Citation This paper should be referenced as such : Heller PG . Familial platelet disorder with predisposition to acute myelogenous leukemia (FPD/AML). Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Genes/FamPlateletDisAMLID10079.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 878 Atlas of Genetics and Cytogenetics in Oncology and Haematology

The HLA-G non classical MHC class I molecule is expressed in cancer with poor prognosis. Implications in tumour escape from immune system and clinical applications

Catherine Menier, Nathalie Rouas-Freiss, and Edgardo D. Carosella

Service de Recherche en Hémato-Immunologie Hôpital Saint Louis CEA - Bâtiment Lailler 1, av. Claude Vellefaux 75475 Paris Cedex 10 - France

July 2008

The HLA-G non classical MHC class I protein has been originally described as being selectively expressed on the invasive trophoblast at fetal-maternal interface at the beginning of pregnancy (Kovats et al., 1990). A few years later, HLA-G protein was detected after fertilization as early as oocyte stage (Jurisicova et al., 1996), and its presence was associated with efficient implantation of fertilized oocyte in uterine mucosa (Fuzzi et al., 2002). Its major contribution to successful pregnancy was also pointed out by both following observations : its reduced expression in pregnancy disorders such as preeclampsia and recurrent spontaneous abortion, was associated with fetal loss (Hviid, 2006) and HLA-G expression by trophoblast was shown to protect fetus from decidual NK cell attack (Rouas-Freiss et al., 1997a). Since then, the expression of HLA-G has been extended to other tissues at immune privileged sites such as: thymus (Crisa et al., 1997), cornea (Le Discorde et al., 2003), pancreas (Cirulli et al., 2006), and the erythroid and endothelial precursors (Menier et al., 2004; Menier et al., 2008). Moreover, its ability to inhibit the effectors functions of decidual NK cells has been demonstrated for allogeneic NK, T, and antigen-presenting cells (APC) (Carosella et al., 2003), which has set HLA-G as a molecule of immune tolerance. In this regard, HLA-G protein was suggested to be a way used to evade the host immune reaction in pathological situations such as infectious diseases (Favier et al., 2007), transplantation (Rouas-Freiss et al., 2007a) and cancer (Rouas-Freiss et al., 2007b).

Tumours employ different strategies to prevent immune responses including tumour-induced impairment of antigen presentation, the activation of negative co-stimulatory signals and the elaboration of immunosuppressive factors. Recently, Schreiber and colleagues (Dunn et al., 2004) propose the cancer immunoediting hypothesis which integrates the different mechanisms of tumour immune escape with the cancer immunosurveillance theory (Burnet, 1957). The cancer immunoediting concept consists of three phases: elimination, equilibrium and escape. The elimination phase corresponds to cancer immunosurveillance and implements cells from innate and adaptative immunity which recognize and destroy tumour cells. In case of partial eradication of tumour cells, equilibrium between the tumour and the immune system develops, that leads to the production of less immunogenic tumour cell clones. Finally, these tumour cell variants escape the antitumour reponse, which results in tumour growth. The expression of the immunotolerant HLA-G protein at tumour site represents one of the immunosuppressive strategies mediated by tumours.

Structural features of HLA-G

In addition to its restricted tissue distribution and its immunotolerant properties, HLA-G has structural particularities. The primary transcript of HLA-G gene is alternatively spliced producing seven mRNA

Atlas Genet Cytogenet Oncol Haematol 2009; 6 879 encoding four membrane-bound protein isoforms: HLA-G1 to -G4 and three soluble ones: HLA-G5 to - G7 (Ishitani and Geraghty, 1992; Kirszenbaum et al., 1994; Paul et al., 2000a) (Figure 1).

At the structural level, HLA-G1 and its soluble counterpart HLA-G5 are similar to classical HLA class I protein as they include three extracellular domains, the third domain being non covalently associated to ß2-microglobulin. Therefore, among the HLA-G protein isoforms, HLA-G1 and -G5 have been the most studied. Numerous monoclonal antibodies recognizing both isoforms in their properly folded conformation have been developed (Menier et al., 2003), which allowed not only to analyze their pattern of tissue distribution but also to demonstrate the direct role of HLA-G in inhibiting immune responses, by blocking the interactions between HLA-G and its receptors (Khalil-Daher et al., 1999; Le Gal et al., 1999; Riteau et al., 2001c; Selmani et al., 2008). To date, three receptors for HLA-G have been described: one member of the killing immunoglobulin-like receptor (KIR) family : KIR2DL4, which is expressed at NK and CD8+ cell-surface (Cantoni et al., 1998; Rajagopalan et al., 1999), and two members of the immunoglobulin-like transcript (ILT) receptor family : ILT-4 (CD85d) present on myeloid cells (Colonna et al., 1998), and ILT-2, on lymphoid and myeloid cells (Colonna et al., 1997) (Figure 1). While KIR2DL4 is specific for HLA-G (Rajagopalan et al., 1999), ILT-2 and ILT-4 also bind some HLA class I alleles but with a much lower affinity than HLA-G (Shiroishi et al., 2003).

In the past few years, it has been highlighted that HLA-G1 forms dimers at cell-surface of transfected cells but also of trophoblast cells (Boyson et al., 2002; Apps et al., 2007). The HLA-G dimers exhibit higher overall affinity to ILT-2 and -4 receptors than the monomers by significant avidity effects (Gonen-Gross et al., 2003; Gonen-Gross et al., 2005; Shiroishi et al., 2006a; Shiroishi et al., 2006b), suggesting that the active conformation of HLA-G is the dimeric form (Apps et al., 2007; Gonen-Gross et al., 2003). In addition, the association of HLA-G heavy chain with ß2m is required for interaction with ILT-2, but not for binding to ILT-4 (Gonen-Gross et al., 2005; Shiroishi et al., 2006). Recently, soluble HLA-G1 (shed HLA-G1) and HLA-G5 proteins were detected in body fluids such as plasma from hepato-renal transplanted patients (Shiroishi et al., 2006b) and malignant effusions (Creput et al., 2003; Davidson et al., 2005), through the development of enzyme-linked immunosorbent assays (ELISA) of which two HLA-G-specific ones were validated during an international workshop (Rebmann et al., 2005; Rebmann et al., 2007).

Atlas Genet Cytogenet Oncol Haematol 2009; 6 880 The other HLA-G isoforms differs from HLA-G1 and -G5 by the lack of one (HLA-G2, -G4, and-G6 ) or two (HLA-G3 and -G7) extracellular domains (Carosella et al., 2003). Their conformational structure remains to be determined. Although their detection is still difficult, the availability of an antibody directed against a peptide in the a1 domain common to all HLA-G isoforms allowed their characterization (McMaster et al., 1998; Paul et al., 2000b; Menier et al., 2000; Lozano et al., 2002). Cell-surface expression of these truncated isoforms is probably dependent on the type of cell in which they are expressed (Mallet et al., 2000; Bainbridge et al., 2000a; Riteau et al., 2001a; Riteau et al., 2001b). Their detection as membranebound proteins was related to the same ability as the full-length HLA-G isoform to inhibit NK and antigen-specific cytotoxic T cell responses (Riteau et al., 2001b).

Functions of HLA-G protein isoforms

Through interaction with the above-described receptors, HLA-G has been shown to inhibit all the actors of the anti-tumour response (Figure 2).

Membrane-bound HLA-G reduces NK cell-mediated cytolysis, whether HLA-G is the only inhibitory ligand present on the surface of target cells (Khalil-Daher et al., 1999; Rouas-Freiss et al., 1997b), or is co-expressed with other inhibitory ligands including classical HLA class I antigens and the non classical HLA-E protein (Rouas-Freiss et al., 1997a; Riteau et al., 2001c) and/or activating ligands like the MHC class I-related chain-A (MICA) (Riteau et al., 2001b; Menier et al., 2002). HLAG also protects these target cells from antigen-specific cytotoxic T lymphocyte (CTL) activity either directly by interaction with the above-mentioned inhibitory receptors (Le Gal et al., 1999; Riteau et al., 2001b), or indirectly, by inhibiting the proliferative response of CD4+ T lymphocytes (Riteau et al., 1999), which thus leads to the decrease of the cooperation between CD4+ with CD8+ T cells. HLA-G1 is also able to exert a direct suppressive effect on CD4+ T cells (Bainbridge et al., 2000b). Furthermore, HLA-G1- expressing antigen presenting cells (APC) render CD4+ T cells anergic and the pre-sensitization of CD4+ T cells by HLA-G1+APC confers them immunosuppressive properties (LeMaoult et al., 2004; Naji et al., 2007). Recently, another mechanism inducing suppressor T or NK cells has been highlighted. These properties are acquired temporary through the rapid transfer of membrane patches (termed trogocytosis) containing HLA-G, from APC or tumour cells to T or NK cells (LeMaoult et al., 2007; Caumartin et al., 2007). Finally, cytokinemediated effects represent a means by which HLA-G can exert immunosuppression. In this regard, HLA-G influences the balance of Th(T helper)1/Th2 cytokines secretion by rather promoting Th2 type responses (Maejima et al., 1997; Kanai et al., 2001).

Atlas Genet Cytogenet Oncol Haematol 2009; 6 881 Like their membrane-bound counterparts, soluble HLA-G proteins (sHLA-G) have immunosuppressive properties through similar mechanisms, but with distinct characteristics. Soluble HLA-G antigens have been shown to inhibit NK cell-mediated cytotoxicity (Selmani et al., 2008; Park et al., 2004; Marchal- Bras-Goncalves et al., 2001; Poehlmann et al., 2006). Recently, following interactions between sHLA- G and the KIR2DL4 receptor on resting NK cell-surface, NK cells were shown to be activated and to release a set of chemokines and cytokines driving a proinflammatory / proangiogenic response (Rajagopalan et al., 2001). An opposite effect on angiogenesis has been observed by inducing endothelial cell apoptosis upon their binding to the CD160 (By55) receptor (Fons et al., 2006). Like soluble HLA class I antigens, through upregulation of FasL following the interactions of sHLA-G with CD8, activated T lymphocytes and NK cells come into apoptosis (Fournel et al., 2000; Contini et al., 2003). Moreover, sHLA-G inhibit the cytotoxic activity of antigen-specific CTL (Contini et al., 2003). They also decrease CD4+ and CD8+ T cell alloproliferation (Selmani et al., 2008; Contini et al., 2003; Lila et al., 2001; Le Friec et al., 2003), by blocking cell cycle progression (Bahri et al., 2006). Like its membrane-bound counterpart, naive T cells pre-sensitized by HLA-G5 differentiate into suppressor T cells (Le Rond et al., 2006). These suppressor T cells are not conventional regulatory T cells. Indeed, they express lower CD4 and CD8 antigens, which belong to the TcR/CD3 complex. Such down- modulated co-receptors T cells are hyporesponsive to allogeneic stimulus (Naji et al., 2007). Lastly, a particular property of sHLA-G is their ability to induce tolerogeneic dendritic cells associated with inhibition of their differentiation (Ristich et al., 2005). Of note, we showed that HLA-G-expressing melanoma cell lines could release exosomes which bear HLA-G together with well-described proteins as Lamp-2 (Riteau et al., 2003). The secretion of exosomes was shown to be another way for tumour to suppress immune responses (Valenti et al., 2007). Whether these HLA-G+ exosomes are immunosuppressive remains to be determined.

HLA-G expression in tumour lesions and malignant effusions

Given that HLA-G is expressed on trophoblast which is defined as a pseudo-malignant tissue, our group was the first to analyze the presence of this protein on malignant lesions. Melanoma was chosen for this study because MAGE antigens and melanoma cell adhesion molecules (Mel-CAM) are expressed in both melanoma and trophoblast cells. Moreover, this tumour was the most studied from an immunological point of view. Thus, in 1998, we described a high level of HLA-G in a skin biopsy from melanoma metastasis and in a melanoma cell line for which presence of HLA-G was related to protection from NK lysis (Paul et al., 1998). Two following studies on two hundred patients melanoma biopsies revealed that: (i) HLA-G protein was expressed in thirty percent of the patients (Paul et al., 1999; Ibrahim el et al., 2004), (ii) HLA-G expression is associated with malignant transformation of melanocyte as this protein was detected in both primary and metastatic tumour sites, but neither in adjacent tumour tissue or in spontaneous tumour regression site or in healthy skin (Paul et al., 1999; Ibrahim el et al., 2004), (iii) higher levels of inflammatory tumour-infiltrating cells were observed in malignant melanoma lesions in comparison to begnin ones (Ibrahim el et al., 2004) and (iv) upregulation of HLA-G in melanocytes is a better predictor of malignancy than classical HLA class I antigens defects, (Ibrahim el et al., 2004) which are often described as an important mechanism of tumour escape from immunosurveillance (Ferrone and Marincola, 1995). This association between the presence of HLA-G and the malignant nature of the tumour suggested that HLA-G was a mechanism for tumours to escape immune surveillance.

Following our first description, HLA-G expression in melanoma lesions was confirmed by other groups and numerous other tumour lesion types of either ectodermic or mesodermic or endodermic origin were studied. Today, in about two thousand patients analyzed, HLA-G protein was found in almost all types of cancer whatever their origin, but in varying proportions ranging between 10% (leukemia) to 95% (esophageal squamous cell carcinoma) (Figure 3).

Atlas Genet Cytogenet Oncol Haematol 2009; 6 882 A recent review summarizes HLA-G protein expression in tumour lesions (Carosella et al., 2008). Since that review, among 140 patients with lung cancer analyzed, approximately 60% of them expressed HLA-G protein. Two other types of cancers were studied: in 175 patients with classical Hodgkin lymphoma, HLA-G protein was found in 50% of cases and in 121 patients with esophageal squamous cell carcinoma, this proportion reached 95%. This heterogeneity may reflect the differences in the biology of individual tumours, in study design and/or the sensitivity of the methods used to detect HLA-G protein in malignant lesions. HLA-G expression is also heterogeneous within a tumour type and within individual lesions. Indeed, HLA-G has been detected in the tumour tissue and/or in the infiltrating lymphocytes in tumours such as melanoma (Ibrahim et al., 2003), breast cancer (Lefebvre et al., 2002), and lung carcinoma (Urosevic et al., 2001). Moreover, HLA-G expression can concern different number of cells within a type of tumour according to the patients (Ibrahim el et al., 2004; Nuckel et al., 2005).

Through the recent development of HLA-G-specific ELISA, high levels of HLA-G in its soluble form have also been detected in the plasma of patients with various cancers (Rebmann et al., 2003), including melanoma (Ugurel et al., 2001), glioma (Wiendl et al., 2002), multiple myeloma (Leleu et al., 2005), lymphoblastic and monocytic acute leukaemia (Amiot et al., 2003; Gros et al., 2006), neuroblastoma (Morandi et al., 2007), and in ascites from breast and ovarian carcinomas (Singer et al., 2003).

Regulation of HLA-G expression in cancer

Up to date, in more than two hundred cell lines derived from malignant tumour biopsies, HLA-G protein was only detected in about ten ones, what contrasts with the proportion of surgically removed malignant tumour lesions which express HLA-G (Rouas-Freiss et al., 2003). This discrepancy shows that in vitro, factors which were maintaining the expression of HLA-G are not present anymore, and that in vivo, HLA-G expression is activated by environmental stimuli such as stress conditions, cytokines and epigenetic variations.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 883 Indeed, like MICA genes, we showed that HLA-G is a stress-inducible gene. Heat shock and arsenite induced an increase of the different HLA-G alternative transcripts without affecting the other MHC class I HLA-A, -B, -C, -E and -F transcripts in melanoma cells (Ibrahim et al., 2000). A stress situation is represented by hypoxia, which exists in the surrounding microenvironment of rapidly growing tumours. Hypoxia was shown to induce the hypoxia-inducible factor-1a (HIF-1a) which can in turn, trigger the transcription and traduction of HLA-G gene in HLA G-tumour cells (Chang and Ferrone, 2003; Mouillot et al., 2007; Gazit et al., 2007). In contrast, HLA-G expression was decreased in HLA- G+ tumour cells (Mouillot et al., 2007). In both up- and down-modulation, HLA-G expression depends on HIF-1a stabilization (Mouillot et al., 2007). Finally, it is well-known that both the depletion of the essential amino acid tryptophan and the accumulation of tryptophan metabolites from the microenvironment provokes an inhibition of immune cells function. This represents another tumour escape mechanism from immune system as some tumours or APC in tumour-draining lymph nodes express the indolamine 2,3-dioxygenase (IDO), an enzyme which metabolizes tryptophan (Friberg et al., 2002; Uyttenhove et al., 2003; Munn and Mellor, 2007; Munn et al., 2004). Searching for a link between HLA-G and IDO molecules, we found that (i) inhibiting the function of IDO up-regulates HLA- G1 cell-surface expression on APC and tumour cell lines (Gonzalez-Hernandez et al., 2005), (ii) IDO induces HLA-G expression during monocyte differentiation into dendritic cells (Lopez et al., 2006), and (iii) IDO and HLA-G inhibit T cell alloproliferation through two independent but complementary pathways (Le Rond et al., 2005). Thus, the recent development of IDO inhibitors as a new immunoregulatory treatment modality for clinical trials (Katz et al., 2008) has to consider the possible stimulation of HLA-G expression.

Numerous studies have investigated the cytokine-mediated induction of HLA-G expression. Particularly, the anti-inflammatory and immunosuppressive IL-10 cytokine secretion by lung carcinoma cells and T and B lymphoma cells has been correlated with concomitant HLA-G expression (Urosevic et al., 2001; Urosevic et al., 2002). Transactivation of HLA-G transcription has also been demonstrated by JEG3 choriocarcinoma cell exposure to leukemia inhibitory factor (LIF) (Bamberger et al., 2000). Furthermore, interferon (IFN)-a, -ß and -γ enhance HLA-G cell-surface expression by tumours or monocytes (Ugurel et al., 2001; Lefebvre et al., 1999; Lefebvre et al., 2001; Wagner et al., 2000; Moreau et al., 1999; Bukur et al., 2003). This up-regulation of HLA-G at the tumour site represents one potential side effect of the administration of IFN for immunotherapy and may confer immunoprotection to tumour cells, thus favouring tumour expansion. In this regard, an association has been established between the lack of clinical response to therapy with IFN-a high doses and HLAG expression in melanoma lesions (Wagner et al., 2000). The expression of inflammatory cytokines such as IFN-γ is under the control of the nuclear factor- κ B (NF-κB), a pivotal transcription factor of innate and adaptative immunity. In addition, NF-κB signaling also plays a critical role in cancer development and progression (Karin and Greten, 2005). Thus, we analyzed whether NF-κB and HLA-G were linked and demonstrated that NF-κB activation enhances HLA-G intracytoplasmic tumour cell content, but promotes the proteolytic shedding of membrane-bound HLA-G (Zidi et al., 2006). Moreover, we showed that HLA-G1+ tumour cells activate NF-κB in NK cells. This activation occurs through interactions between the a1 domain of HLA-G and presumably the KIR2DL4 receptor (Guillard et al., 2008).

Remarkably, cytokines have no effect on HLA-G gene transcription in tumour cells in which this gene is repressed (Frumento et al., 2000). This led us to propose the hypothesis of the existence of epigenetic mechanisms, which may activate the HLA-G gene in some tumours. Global genomic hypomethylation occurs frequently during carcinogenesis and genetic lesions in methyl-chromatin- related genes, such as histone deacetylase, are supposed to influence the epigenetic alterations involved in cancer (Esteller et al., 2002; Esteller and Herman, 2002). We showed that exposure of some tumours cell lines to histone deacetylase inhibitors, or the decitabine DNA demethylating agent, reactivate both HLA-G gene transcription and traduction (Moreau et al., 2003; Mouillot et al., 2005; Yan et al., 2005). Thus, the HLA-G gene derepression must be considered as adverse effect following chemotherapy with drugs such as decitabine, which are currently used to reactivate tumour suppressor genes and other genes involved in invasion and metastasis (Maio et al., 2003).

HLA-G in cancer immunoediting

During the elimination phase which matches with cancer immunosurveillance, classical HLA class I expression at tumour cell-surface is supposed to be unchanged. Tumour-infiltrating lymphocytes and NK cells produce Th1-type cytokines. Particularly, IFN-gamma is one of the cytokines up-regulating

Atlas Genet Cytogenet Oncol Haematol 2009; 6 884 HLA-G expression in tumour cells either directly or indirectly through induction of IDO. Towards its predominant inhibitory role, HLA-G could greatly weaken host anti-tumoural immune responses.

During the equilibrium phase which corresponds to cancer persistence, epigenetic changes take place frequently and contribute to the development of non immunogenic tumour cell clones. At present, in vitro studies showed that demethylation and histone deacetylation reverses HLA-G gene silencing. In addition to its direct inhibitory role on immune cells, HLA-G protein may also play this role indirectly through the plasma membrane stabilization of the non classical CMH class I HLA-E protein (Khalil- Daher et al., 1999; Riteau et al., 2001b; Borrego et al., 1998). HLA-E reaches cell surface through binding of MHC class I leader peptide (Braud et al., 1997; Braud et al., 1998; Lee et al., 1998). Although classical HLA class I molecules can be completely lost, HLA-G can mediate the membrane expression of HLA-E, which confers additional protection of tumour cells to NK cytolysis. Moreover, HLA-G also contributes to the already altered antigen presentation (Wright and Ting, 2006) by down- modulating HLA class II molecules on APC (Ristich et al., 2005).

The escape phase in which cancer progresses, is the phase where HLA-G is preferentially expressed comparatively to initial malignant tumour lesions. Tumours generate an appropriate microenvironment that allows them to prevent their immune cell elimination, thus favouring their growth. The mechanisms to achieve this goal include the modulation of antigen expression that allows preventing activation of the immune system, the induction of peripheral tolerance by induction of anergy or induction of immunosuppressor cells, and the production of immunosuppressive cytokines. HLA-G plays a significant role in these mechanisms because HLA-G remains the almost single-molecule expressed by tumours. In addition to local effects at its site of expression, secreted soluble HLA-G could also have systemic inhibitory activity through its distribution in blood circulation. Among the immunosuppressive cytokines produced by tumours, IL-10 is responsible for HLA-G up-regulation in cancer. Both IL-10 and HLA-G may be produced by tumour cells themselves or by tumour-infiltrating cells. There is an amplification loop since both IL-10-induced decrease of the production of Th1-type cytokine and HLA-G expression are able to increase IL-10 production. Moreover, HLA-G was shown to increase its own inhibitory receptors in NK, APC and T effector cells (LeMaoult et al., 2005), and IL-10 can also modulate the KIR repertoire on NK and T cells, what further contribute to dampen immune responses. During this phase, chronic inflammation is assumed to favour tumour growth through activation of NF-κB, which may enhance systemic inhibitory action through the release of soluble HLA- G1 from proteolytic shedding of membrane HLA-G1. The rapid tumour cell proliferation creates a hypoxic microenvironment, a stress condition which also promotes tumour invasion per se but in addition, by inducing HLA-G expression. Importantly, some therapeutic strategies, as either immunotherapy using IFN-a, or chemotherapy with DNA-demethylating or histone deacetylating agents, or therapeutic vaccination using IDO inhibitors, must be revisited since these treatments were shown to upregulate HLA-G.

Biological relevance of HLA-G expression in cancer

In vitro studies have shown that HLA-G-endogenously expressing melanoma, glioma and renal carcinoma cell lines are protected from lysis by alloreactive NK and lymphokineactivated killer cells and/or antigen-specific CD8+ T cells (Paul et al., 1998; Wiendl et al., 2002; Bukur et al., 2003). This protective effect was directly due to HLA-G expression by tumour cells since the blockade of this molecule restored the cytotoxic activity of effector cells. Since then, two studies have reinforced the role of HLA-G in tumours. In the first study, we derived a HLA-G+ melanoma cell line, called Fon, from a HLA-G+ melanoma biopsy (Rouas-Freiss et al., 2005). The Fon cell line expressed high levels of membrane-bound HLA-G1, which confers resistance to NK cell line lysis through interaction with ILT-2 inhibitory receptor. During the long-term spread of Fon cells in culture, the expression of HLA-G1 has been lost, as was its protection against the NK cell cytotoxicity. Although IFN-ß, -γ or decitabine treatments enhanced HLAG1 expression in the primary Fon cells, neither these cytokines, nor this DNA-demethylating drug brought back HLA-G1 transcription. Altogether, these results emphasize the difficulty using cell lines derived from tumour biopsies to establish the physiopathological relevance of HLA-G in anti-tumour responses since HLA-G expression can be lost during long-term tumour expansion. Moreover, they support the role of HLA-G1 expressed at tumour cellsurface in preventing host innate immune cell responses. As described for other tumour type, the second study showed that neuroblastoma patients had significant higher serum levels of sHLA-G than healthy donors. The source of sHLA-G in neuroblastoma patients was not tumour cells but monocytes in an activated state. The sHLA-G produced was able to inhibit CTL and NK cell-mediated cytotoxicity against tumour cells.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 885 Interestingly, the sHLA-G-secreting monocytes were instructed by neuroblastoma cells through the release of soluble factors that may be IL-10 or TGF-ß1. These monocytes display features of macrophage-like activated cells but shift towards a more anergic phenotype since they secrete higher levels of immunosuppressive sHLA-G and lower IL-12, a cytokine which promotes anti-tumour responses. These findings support an in vivo systemic effect of HLA-G in cancer (Morandi et al., 2007), and provide guidance on a novel mechanism of tumour immune evasion.

Clinical significance of HLA-G expression in cancer

As above described, HLA-G expression has always been detected in malignant tissues or effusions and has never been found neither in healthy tumour surrounded areas, nor in tissues or effusions from patients suffering of begnin disease, nor in the corresponding tissues from healthy individuals (Ibrahim el et al., 2004; Ibrahim et al., 2003; Singer et al., 2003; Aractingi et al., 2003). In melanoma, upregulation of HLA-G molecules in melanocytic cells appears as a better predictor of malignancy than classical HLA class I antigen defects frequently observed in this cancer type (Ibrahim el et al., 2004).

The idea that HLA-G expression could be a prognostic factor has emerged recently. Indeed, HLA-G expression and/or sHLA-G high levels have been significantly correlated with poor prognosis in non- small cell lung cancer, melanoma, glioblastoma, ovarian carcinoma, B-CLL, cutaneous T cell lymphoma, neuroblastoma and digestive cancers (Urosevic et al., 2001; Nuckel et al., 2005; Ugurel et al., 2001; Wiendl et al., 2002; Morandi et al., 2007; Singer et al., 2003; Urosevic et al., 2002; Yie et al., 2007a; Yie et al., 2007b; Ye et al., 2007; Yie et al., 2007c). In particular, in ovarian carcinomas, high levels of soluble HLA-G protein were measured in the effusions produced in late-stage disease which overlaps with the first appearance of metastases (Singer et al., 2003). In digestive cancers and B-CLL, HLA-G expression was shown as being an independent prognostic factor (Nuckel et al., 2005; Yie et al., 2007b; Ye et al., 2007; Yie et al., 2007c). In multivariate analysis of B-CLL patients, HLA-G expression was an even better independent prognostic factor than the zeta-associated protein 70 (ZAP-70) or CD38 status (Nuckel et al., 2005). Finally, the role of HLA-G in tumour escape from host immune cell is emphasized by its involvement of the resistance to IFN therapy observed in some melanoma patients (Wagner et al., 2000).

Conclusion and perspectives

Towards its immunotolerant properties, HLA-G expression is an additional but efficient way for tumour to evade immunosurveillance. In the few last years, the clinical relevance of HLAG has been established in cancer. Indeed, HLA-G was always correlated with higher grade histology and advanced disease stage, and for the most complete studies, increased depth of invasion, more frequent lymph node metastasis, reduced host immune response and shortened survival. However, multicenter studies including larger cohorts of patients are needed to demonstrate the usefulness of HLA-G levels quantification in predicting the clinical outcome of cancer patients. Since clinical studies clearly reveal a negative correlation between HLA-G and patient survival, HLA-G appears an attractive molecular target to develop new anti-tumour therapies. The reverse of tumour growth might be obtained through blockade of HLA-G synthesis by preventing its transcription using silencing RNA or acting on HLA-G alternative splicing (Rouas-Freiss et al., 2005), or through restoration of host immune responses by using antibodies neutralizing interactions between HLA-G and its receptors. Thus, the in vivo validation of the proof-of-concept requires the development of a tumour model in mice since although a true HLA-G homolog is lacking, murine PIR-B can bind HLA-G allowing such model to be evaluated there is a HLAG inhibitory receptor homolog (Liang et al., 2002; Ungchusri et al., 2001; Comiskey et al., 2003; Chiang et al., 2002; Chiang and Stroynowski, 2005).

Bibliography Cancer; a biological approach. I. The processes of control. Burnet M. Br Med J. 1957 Apr 6;1(5022):779-86. PMID 13404306

A class I antigen, HLA-G, expressed in human trophoblasts. Kovats S, Main EK, Librach C, Stubblebine M, Fisher SJ, DeMars R. Science. 1990 Apr 13;248(4952):220-3.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 886 PMID 2326636

Alternative splicing of HLA-G transcripts yields proteins with primary structures resembling both class I and class II antigens. Ishitani A, Geraghty DE. Proc Natl Acad Sci U S A. 1992 May 1;89(9):3947-51. PMID 1570318

An alternatively spliced form of HLA-G mRNA in human trophoblasts and evidence for the presence of HLA-G transcript in adult lymphocytes. Kirszenbaum M, Moreau P, Gluckman E, Dausset J, Carosella E. Proc Natl Acad Sci U S A. 1994 May 10;91(10):4209-13. PMID 8183892

Loss of HLA class I antigens by melanoma cells: molecular mechanisms, functional significance and clinical relevance. Ferrone S, Marincola FM. Immunol Today. 1995 Oct;16(10):487-94. PMID 7576053

Embryonic human leukocyte antigen-G expression: possible implications for human preimplantation development. Jurisicova A, Casper RF, MacLusky NJ, Librach CL. Fertil Steril. 1996 May;65(5):997-1002. PMID 8612864

The human major histocompatibility complex class Ib molecule HLA-E binds signal sequence- derived peptides with primary anchor residues at positions 2 and 9. Braud V, Jones EY, McMichael A. Eur J Immunol. 1997 May;27(5):1164-9. PMID 9174606

A common inhibitory receptor for major histocompatibility complex class I molecules on human lymphoid and myelomonocytic cells. Colonna M, Navarro F, Bellon T, Llano M, Garcia P, Samaridis J, Angman L, Cella M, Lopez-Botet M. J Exp Med. 1997 Dec 1;186(11):1809-18. PMID 9382880

Identification of a thymic epithelial cell subset sharing expression of the class Ib HLA-G molecule with fetal trophoblasts. Crisa L, McMaster MT, Ishii JK, Fisher SJ, Salomon DR. J Exp Med. 1997 Jul 21;186(2):289-98. PMID 9221758

Presence of HLA-G-expressing cells modulates the ability of peripheral blood mononuclear cells to release cytokines. Maejima M, Fujii T, Kozuma S, Okai T, Shibata Y, Taketani Y. Am J Reprod Immunol. 1997 Aug;38(2):79-82. PMID 9272204

Direct evidence to support the role of HLA-G in protecting the fetus from maternal uterine natural killer cytolysis. Rouas-Freiss N, Gon¡Zalves RM, Menier C, Dausset J, Carosella ED. Proc Natl Acad Sci U S A. 1997a Oct 14;94(21):11520-5. PMID 9326642

The alpha1 domain of HLA-G1 and HLA-G2 inhibits cytotoxicity induced by natural killer cells: is HLA-G the public ligand for natural killer cell inhibitory receptors? Rouas-Freiss N, Marchal RE, Kirszenbaum M, Dausset J, Carosella ED. Proc Natl Acad Sci U S A. 1997b May 13;94(10):5249-54.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 887 PMID 9144223

Recognition of human histocompatibility leukocyte antigen (HLA)-E complexed with HLA class I signal sequence-derived peptides by CD94/NKG2 confers protection from natural killer cell- mediated lysis. Borrego F, Ulbrecht M, Weiss EH, Coligan JE, Brooks AG. J Exp Med. 1998 Mar 2;187(5):813-8. PMID 9480992

TAP- and tapasin-dependent HLA-E surface expression correlates with the binding of an MHC class I leader peptide. Braud VM, Allan DS, Wilson D, McMichael AJ. Curr Biol. 1998 Jan 1;8(1):1-10. PMID 9427624 p49, a putative HLA class I-specific inhibitory NK receptor belonging to the immunoglobulin superfamily. Cantoni C, Verdiani S, Falco M, Pessino A, Cilli M, Conte R, Pende D, Ponte M, Mikaelsson MS, Moretta L, Biassoni R. Eur J Immunol. 1998 Jun;28(6):1980-90. PMID 9645380

Human myelomonocytic cells express an inhibitory receptor for classical and nonclassical MHC class I molecules. Colonna M, Samaridis J, Cella M, Angman L, Allen RL, O'Callaghan CA, Dunbar R, Ogg GS, Cerundolo V, Rolink A. J Immunol. 1998 Apr 1;160(7):3096-100. PMID 9531263

HLA-E surface expression depends on binding of TAP-dependent peptides derived from certain HLA class I signal sequences. Lee N, Goodlett DR, Ishitani A, Marquardt H, Geraghty DE. J Immunol. 1998 May 15;160(10):4951-60. PMID 9590243

HLA-G isoforms produced by placental cytotrophoblasts and found in amniotic fluid are due to unusual glycosylation. McMaster M, Zhou Y, Shorter S, Kapasi K, Geraghty D, Lim KH, Fisher S. J Immunol. 1998 Jun 15;160(12):5922-8. PMID 9637505

HLA-G expression in melanoma: a way for tumor cells to escape from immunosurveillance. Paul P, Rouas-Freiss N, Khalil-Daher I, Moreau P, Riteau B, Le Gal FA, Avril MF, Dausset J, Guillet JG, Carosella ED. Proc Natl Acad Sci U S A. 1998 Apr 14;95(8):4510-5. PMID 9539768

Role of HLA-G versus HLA-E on NK function: HLA-G is able to inhibit NK cytolysis by itself. Khalil-Daher I, Riteau B, Menier C, Sedlik C, Paul P, Dausset J, Carosella ED, Rouas-Freiss N. J Reprod Immunol. 1999 Jul;43(2):175-82. PMID 10479053

Molecular mechanisms controlling constitutive and IFN-gamma-inducible HLA-G expression in various cell types. Lefebvre S, Moreau P, Guiard V, Ibrahim EC, Adrian-Cabestre F, Menier C, Dausset J, Carosella ED, Paul P. J Reprod Immunol. 1999 Jul;43(2):213-24. PMID 10479057

HLA-G-mediated inhibition of antigen-specific cytotoxic T lymphocytes.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 888 Le Gal FA, Riteau B, Sedlik C, Khalil-Daher I, Menier C, Dausset J, Guillet JG, Carosella ED, Rouas- Freiss N. Int Immunol. 1999 Aug;11(8):1351-6. PMID 10421792

IL-10 selectively induces HLA-G expression in human trophoblasts and monocytes. Moreau P, Adrian-Cabestre F, Menier C, Guiard V, Gourand L, Dausset J, Carosella ED, Paul P. Int Immunol. 1999 May;11(5):803-11. PMID 10330285

Heterogeneity of HLA-G gene transcription and protein expression in malignant melanoma biopsies. Paul P, Cabestre FA, Le Gal FA, Khalil-Daher I, Le Danff C, Schmid M, Mercier S, Avril MF, Dausset J, Guillet JG, Carosella ED. Cancer Res. 1999 Apr 15;59(8):1954-60. PMID 10213506

A human histocompatibility leukocyte antigen (HLA)-G-specific receptor expressed on all natural killer cells. Rajagopalan S, Long EO. J Exp Med. 1999 Apr 5;189(7):1093-100. PMID 10190900

HLA-G inhibits the allogeneic proliferative response. Riteau B, Menier C, Khalil-Daher I, Sedlik C, Dausset J, Rouas-Freiss N, Carosella ED. J Reprod Immunol. 1999 Jul;43(2):203-11. PMID 10479056

The short forms of HLA-G are unlikely to play a role in pregnancy because they are not expressed at the cell surface. Bainbridge DR, Ellis SA, Sargent IL. J Reprod Immunol. 2000a May;47(1):1-16. PMID 10779586

HLA-G suppresses proliferation of CD4(+) T-lymphocytes. Bainbridge DR, Ellis SA, Sargent IL. J Reprod Immunol. 2000b Aug;48(1):17-26. PMID 10996380

Leukemia inhibitory factor (LIF) stimulates the human HLA-G promoter in JEG3 choriocarcinoma cells. Bamberger AM, Jenatschke S, Schulte HM, Loning T, Bamberger MC. J Clin Endocrinol Metab. 2000 Oct;85(10):3932-6. PMID 11061559

Cutting edge: soluble HLA-G1 triggers CD95/CD95 ligand-mediated apoptosis in activated CD8+ cells by interacting with CD8. Fournel S, Aguerre-Girr M, Huc X, Lenfant F, Alam A, Toubert A, Bensussan A, Le Bouteiller P. J Immunol. 2000 Jun 15;164(12):6100-4. PMID 10843658

Melanomas and melanoma cell lines do not express HLA-G, and the expression cannot be induced by gammaIFN treatment. Frumento G, Franchello S, Palmisano GL, Nicotra MR, Giacomini P, Loke YW, Geraghty DE, Maio M, Manzo C, Natali PG, Ferrara GB. Tissue Antigens. 2000 Jul;56(1):30-7. PMID 10958353

Heat shock and arsenite induce expression of the nonclassical class I histocompatibility HLA- G gene in tumor cell lines.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 889 Ibrahim EC, Morange M, Dausset J, Carosella ED, Paul P. Cell Stress Chaperones. 2000 Jul;5(3):207-18. PMID 11005379

The full length HLA-G1 and no other alternative form of HLA-G is expressed at the cell surface of transfected cells. Mallet V, Proll J, Solier C, Aguerre-Girr M, DeRossi M, Loke YW, Lenfant F, Le Bouteiller P. Hum Immunol. 2000 Mar;61(3):212-24. PMID 10689111

HLA-G truncated isoforms can substitute for HLA-G1 in fetal survival. Menier C, Riteau B, Dausset J, Carosella ED, Rouas-Freiss N. Hum Immunol. 2000 Nov;61(11):1118-25. PMID 11137216

Identification of HLA-G7 as a new splice variant of the HLA-G mRNA and expression of soluble HLA-G5, -G6, and -G7 transcripts in human transfected cells. Paul P, Cabestre FA, Ibrahim EC, Lefebvre S, Khalil-Daher I, Vazeux G, Quiles RM, Bermond F, Dausset J, Carosella ED. Hum Immunol. 2000a Nov;61(11):1138-49. PMID 11137219

HLA-G, -E, -F preworkshop: tools and protocols for analysis of non-classical class I genes transcription and protein expression. Paul P, Rouas-Freiss N, Moreau P, Cabestre FA, Menier C, Khalil-Daher I, Pangault C, Onno M, Fauchet R, Martinez-Laso J, Morales P, Villena AA, Giacomini P, Natali PG, Frumento G, Ferrara GB, McMaster M, Fisher S, Schust D, Ferrone S, Dausset J, Geraghty D, Carosella ED. Hum Immunol. 2000b Nov;61(11):1177-95. PMID 11137224

Expression analysis of classic and non-classic HLA molecules before interferon alfa-2b treatment of melanoma. Wagner SN, Rebmann V, Willers CP, Grosse-Wilde H, Goos M. Lancet. 2000 Jul 15;356(9225):220-1. PMID 10963203

Human leukocyte antigen-G-expressing cells differently modulate the release of cytokines from mononuclear cells present in the decidua versus peripheral blood. Kanai T, Fujii T, Unno N, Yamashita T, Hyodo H, Miki A, Hamai Y, Am J Reprod Immunol. 2001 Feb;45(2):94-9. PMID 11216880

A specific interferon (IFN)-stimulated response element of the distal HLA-G promoter binds IFN-regulatory factor 1 and mediates enhancement of this nonclassical class I gene by IFN- beta. Lefebvre S, Berrih-Aknin S, Adrian F, Moreau P, Poea S, Gourand L, Dausset J, Carosella ED, Paul P. J Biol Chem. 2001 Mar 2;276(9):6133-9. Epub 2000 Nov 21. PMID 11087747

Soluble HLA-G protein secreted by allo-specific CD4+ T cells suppresses the allo-proliferative response: a CD4+ T cell regulatory mechanism. Lila N, Rouas-Freiss N, Dausset J, Carpentier A, Carosella ED. Proc Natl Acad Sci U S A. 2001 Oct 9;98(21):12150-5. Epub 2001 PMID 11572934

A soluble HLA-G protein that inhibits natural killer cell-mediated cytotoxicity. Marchal-Bras-Goncalves R, Rouas-Freiss N, Connan F, Choppin J, Dausset J, Carosella ED, Kirszenbaum M, Guillet J. Transplant Proc. 2001 May;33(3):2355-9.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 890 PMID 11377558

Cutting edge: induction of IFN-gamma production but not cytotoxicity by the killer cell Ig-like receptor KIR2DL4 (CD158d) in Rajagopalan S, Fu J, Long EO. J Immunol. 2001 Aug 15;167(4):1877-81. PMID 11489965

Characterization of HLA-G1, -G2, -G3, and -G4 isoforms transfected in a human melanoma cell line. Riteau B, Moreau P, Menier C, Khalil-Daher I, Khosrotehrani K, Bras-Goncalves R, Paul P, Dausset J, Rouas-Freiss N, Carosella ED. Transplant Proc. 2001a May;33(3):2360-4. PMID 11377559

HLA-G2, -G3, and -G4 isoforms expressed as nonmature cell surface glycoproteins inhibit NK and antigen-specific CTL cytolysis. Riteau B, Rouas-Freiss N, Menier C, Paul P, Dausset J, Carosella ED. J Immunol. 2001b Apr 15;166(8):5018-26. PMID 11290782

HLA-G1 co-expression boosts the HLA class I-mediated NK lysis inhibition. Riteau B, Menier C, Khalil-Daher I, Martinozzi S, Pla M, Dausset J, Carosella ED, Rouas-Freiss N. Int Immunol. 2001c Feb;13(2):193-201. PMID 11157852

Soluble human leukocyte antigen--G serum level is elevated in melanoma patients and is further increased by interferon-alpha Ugurel S, Rebmann V, Ferrone S, Tilgen W, Grosse-Wilde H, Reinhold U. Cancer. 2001 Jul 15;92(2):369-76. PMID 11466692

Widespread expression of the nonclassical class I Qa-2 antigens in hemopoietic and nonhemopoietic cells. Ungchusri T, Chiang EY, Brown G, Chen M, Tabaczewski P, Timares L, Stroynowski I. Immunogenetics. 2001 Aug;53(6):455-67. PMID 11685456

Human leukocyte antigen G up-regulation in lung cancer associates with high-grade histology, human leukocyte antigen class I loss and interleukin-10 production. Urosevic M, Kurrer MO, Kamarashev J, Mueller B, Weder W, Burg G, Stahel RA, Dummer R, Trojan A. Am J Pathol. 2001 Sep;159(3):817-24. PMID 11549573

Disulfide bond-mediated dimerization of HLA-G on the cell surface. Boyson JE, Erskine R, Whitman MC, Chiu M, Lau JM, Koopman LA, Valter MM, Angelisova P, Horejsi V, Strominger JL. Proc Natl Acad Sci U S A. 2002 Dec 10;99(25):16180-5. Epub PMID 12454284

The nonclassical major histocompatibility complex molecule Qa-2 protects tumor cells from NK cell- and lymphokine-activated killer cell-mediated cytolysis. Chiang EY, Henson M, Stroynowski I. J Immunol. 2002 Mar 1;168(5):2200-11. PMID 11859106

Cancer epigenetics and methylation. Esteller M, Fraga MF, Paz MF, Campo E, Colomer D, Novo FJ, Calasanz MJ, Galm O, Guo M, Benitez J, Herman JG.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 891 Science. 2002 Sep 13;297(5588):1807-8; discussion 1807-8. PMID 12229925

Cancer as an epigenetic disease: DNA methylation and chromatin alterations in human tumours. Esteller M, Herman JG. J Pathol. 2002 Jan;196(1):1-7. PMID 11748635

Indoleamine 2,3-dioxygenase contributes to tumor cell evasion of T cell-mediated rejection. Friberg M, Jennings R, Alsarraj M, Dessureault S, Cantor A, Extermann M, Mellor AL, Munn DH, Antonia SJ. Int J Cancer. 2002 Sep 10;101(2):151-5. PMID 12209992

HLA-G expression in early embryos is a fundamental prerequisite for the obtainment of pregnancy. Fuzzi B, Rizzo R, Criscuoli L, Noci I, Melchiorri L, Scarselli B, Bencini E, Menicucci A, Baricordi OR. Eur J Immunol. 2002 Feb;32(2):311-5. PMID 11807769

Specific activation of the non-classical class I histocompatibility HLA-G antigen and expression of the ILT2 inhibitory Lefebvre S, Antoine M, Uzan S, McMaster M, Dausset J, Carosella ED, Paul P. J Pathol. 2002 Mar;196(3):266-74. PMID 11857488

HLA-G inhibits the functions of murine dendritic cells via the PIR-B immune inhibitory receptor. Liang S, Baibakov B, Horuzsko A. Eur J Immunol. 2002 Sep;32(9):2418-26. PMID 12207326

Monocytes and T lymphocytes in HIV-1-positive patients express HLA-G molecule. Lozano JM, Gonzalez R, Kindelan JM, Rouas-Freiss N, Caballos R, Dausset J, Carosella ED, Pena J. AIDS. 2002 Feb 15;16(3):347-51. PMID 11834945

MICA triggering signal for NK cell tumor lysis is counteracted by HLA-G1-mediated inhibitory signal. Menier C, Riteau B, Carosella ED, Rouas-Freiss N. Int J Cancer. 2002 Jul 1;100(1):63-70. PMID 12115588

HLA-G protein up-regulation in primary cutaneous lymphomas is associated with interleukin-10 expression in large cell T-cell lymphomas and indolent B-cell lymphomas. Urosevic M, Willers J, Mueller B, Kempf W, Burg G, Dummer R. Blood. 2002 Jan 15;99(2):609-17. PMID 11781245

A functional role of HLA-G expression in human gliomas: an alternative strategy of immune escape. Wiendl H, Mitsdoerffer M, Hofmeister V, Wischhusen J, Bornemann A, Meyermann R, Weiss EH, Melms A, Weller M. J Immunol. 2002 May 1;168(9):4772-80. PMID 11971028

HLA-G and lymphoproliferative disorders. Amiot L, Le Friec G, Sebti Y, Drenou B, Pangault C, Guilloux V, Leleu X, Bernard M, Facon T, Fauchet R. Semin Cancer Biol. 2003 Oct;13(5):379-85.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 892 PMID 14708718

Selective expression of HLA-G in malignant and premalignant skin specimens in kidney transplant recipients. Aractingi S, Kanitakis J, Euvrard S, Le Danff C, Carosella ED. Int J Cancer. 2003 Aug 20;106(2):232-5. PMID 12800199

Functional role of human leukocyte antigen-G up-regulation in renal cell carcinoma. Bukur J, Rebmann V, Grosse-Wilde H, Luboldt H, Ruebben H, Drexler I, Sutter G, Huber C, Seliger B. Cancer Res. 2003 Jul 15;63(14):4107-11. PMID 12874014

HLA-G molecules: from maternal-fetal tolerance to tissue acceptance. Carosella ED, Moreau P, Le Maoult J, Le Discorde M, Dausset J, Rouas-Freiss N. Adv Immunol. 2003;81:199-252. PMID 14711057

HLA-G in melanoma: can the current controversies be solved? Chang CC, Ferrone S. Semin Cancer Biol. 2003 Oct;13(5):361-9. PMID 14708716

Evidence that HLA-G is the functional homolog of mouse Qa-2, the Ped gene product. Comiskey M, Goldstein CY, De Fazio SR, Mammolenti M, Newmark JA, Warner CM. Hum Immunol. 2003 Nov;64(11):999-1004. PMID 14602227

Soluble HLA-A,-B,-C and -G molecules induce apoptosis in T and NK CD8+ cells and inhibit cytotoxic T cell activity through CD8 ligation. Contini P, Ghio M, Poggi A, Filaci G, Indiveri F, Ferrone S, Puppo F. Eur J Immunol. 2003 Jan;33(1):125-34. PMID 12594841

Detection of HLA-G in serum and graft biopsy associated with fewer acute rejections following combined liver-kidney transplantation: possible implications for monitoring patients. Creput C, Le Friec G, Bahri R, Amiot L, Charpentier B, Carosella E, Rouas-Freiss N, Durrbach A. Hum Immunol. 2003 Nov;64(11):1033-8. PMID 14602232

Complexes of HLA-G protein on the cell surface are important for leukocyte Ig-like receptor-1 function. Gonen-Gross T, Achdout H, Gazit R, Hanna J, Mizrahi S, Markel G, Goldman-Wohl D, Yagel S, Horejs¡¦ V, Levy O, Baniyash M, Mandelboim O. J Immunol. 2003 Aug 1;171(3):1343-51. PMID 12874224

Altered pattern of major histocompatibility complex expression in renal carcinoma: tumor- specific expression of the nonclassical human leukocyte antigen-G molecule is restricted to clear cell carcinoma while up-regulation of other major histocompatibility complex antigens is primarily distributed in all subtypes of renal carcinoma. Ibrahim el C, Allory Y, Commo F, Gattegno B, Callard P, Paul P. Am J Pathol. 2003 Feb;162(2):501-8. PMID 12547708

Expression of HLA-G in human cornea, an immune-privileged tissue. Le Discorde M, Moreau P, Sabatier P, Legeais JM, Carosella ED. Hum Immunol. 2003 Nov;64(11):1039-44. PMID 14602233

Atlas Genet Cytogenet Oncol Haematol 2009; 6 893 Soluble HLA-G inhibits human dendritic cell-triggered allogeneic T-cell proliferation without altering dendritic differentiation and maturation processes. Le Friec G, Laupeze B, Fardel O, Sebti Y, Pangault C, Guilloux V, Beauplet A, Fauchet R, Amiot L. Hum Immunol. 2003 Aug;64(8):752-61. PMID 12878353

Epigenetic targets for immune intervention in human malignancies. Maio M, Coral S, Fratta E, Altomonte M, Sigalotti L. Oncogene. 2003 Sep 29;22(42):6484-8. PMID 14528272

Characterization of monoclonal antibodies recognizing HLA-G or HLA-E: new tools to analyze the expression of nonclassical HLA class I molecules. Menier C, Saez B, Horejsi V, Martinozzi S, Krawice-Radanne I, Bruel S, Le Danff C, Reboul M, Hilgert I, Rabreau M, Larrad ML, Pla M, Carosella ED, Rouas-Freiss N. Hum Immunol. 2003 Mar;64(3):315-26. PMID 12590976

HLA-G gene repression is reversed by demethylation. Moreau P, Mouillot G, Rousseau P, Marcou C, Dausset J, Carosella ED. Proc Natl Acad Sci U S A. 2003 Feb 4;100(3):1191-6. Epub 2003 Jan 27. PMID 12552087

Secretion of sHLA-G molecules in malignancies. Rebmann V, Regel J, Stolke D, Grosse-Wilde H. Semin Cancer Biol. 2003 Oct;13(5):371-7. PMID 14708717

Exosomes bearing HLA-G are released by melanoma cells. Riteau B, Faure F, Menier C, Viel S, Carosella ED, Amigorena S, Rouas-Freiss N. Hum Immunol. 2003 Nov;64(11):1064-72. PMID 14602237

HLA-G in cancer: a way to turn off the immune system. Rouas-Freiss N, Moreau P, Menier C, Carosella ED. Semin Cancer Biol. 2003 Oct;13(5):325-36. PMID 14708712

Human inhibitory receptors Ig-like transcript 2 (ILT2) and ILT4 compete with CD8 for MHC class I binding and bind preferentially to HLA-G. Shiroishi M, Tsumoto K, Amano K, Shirakihara Y, Colonna M, Braud VM, Allan DS, Makadzange A, Rowland-Jones S, Willcox B, Jones EY, van der Merwe PA, Kumagai I, Maenaka K. REFERENCE Proc Natl Acad Sci U S A. 2003 Jul 22;100(15):8856-61. Epub 2003 Jul 9. PMID 12853576

HLA-G is a potential tumor marker in malignant ascites. Singer G, Rebmann V, Chen YC, Liu HT, Ali SZ, Reinsberg J, McMaster MT, Pfeiffer K, Chan DW, Wardelmann E, Grosse-Wilde H, Cheng CC, Kurman RJ, Shih IeM. Clin Cancer Res. 2003 Oct 1;9(12):4460-4. PMID 14555519

Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Theate I, Stroobant V, Colau D, Parmentier N, Boon T, Van den Eynde BJ. Nat Med. 2003 Oct;9(10):1269-74. Epub 2003 Sep 21. PMID 14502282

The three Es of cancer immunoediting. Dunn GP, Old LJ, Schreiber RD. Annu Rev Immunol. 2004;22:329-60.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 894 PMID 15032581

Analysis of HLA antigen expression in benign and malignant melanocytic lesions reveals that upregulation of HLA-G expression correlates with malignant transformation, high inflammatory infiltration and HLA-A1 genotype. Ibrahim el C, Aractingi S, Allory Y, Borrini F, Dupuy A, Duvillard P, Carosella ED, Avril MF, Paul P. Int J Cancer. 2004 Jan 10;108(2):243-50. PMID 14639610

HLA-G1-expressing antigen-presenting cells induce immunosuppressive CD4+ T cells. LeMaoult J, Krawice-Radanne I, Dausset J, Carosella ED. Proc Natl Acad Sci U S A. 2004 May 4;101(18):7064-9. Epub 2004 PMID 15103024

Erythroblasts secrete the nonclassical HLA-G molecule from primitive to definitive hematopoiesis. Menier C, Rabreau M, Challier JC, Le Discorde M, Carosella ED, Rouas-Freiss N. Blood. 2004 Nov 15;104(10):3153-60. Epub 2004 Jul 29. PMID 15284117

Expression of indoleamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor-draining lymph nodes. Munn DH, Sharma MD, Hou D, Baban B, Lee JR, Antonia SJ, Messina JL, Chandler P, Koni PA, Mellor AL. J Clin Invest. 2004 Jul;114(2):280-90. PMID 15254595

Soluble HLA-G generated by proteolytic shedding inhibits NK-mediated cell lysis. Park GM, Lee S, Park B, Kim E, Shin J, Cho K, Ahn K. Biochem Biophys Res Commun. 2004 Jan 16;313(3):606-11. PMID 14697234

Protective immunity against disparate tumors is mediated by a nonpolymorphic MHC class I molecule. Chiang EY, Stroynowski I. J Immunol. 2005 May 1;174(9):5367-74. PMID 15843534

HLA-G expression in effusions is a possible marker of tumor susceptibility to chemotherapy in ovarian carcinoma. Davidson B, Elstrand MB, McMaster MT, Berner A, Kurman RJ, Risberg B, Trope CG, Shih IeM. Gynecol Oncol. 2005 Jan;96(1):42-7. PMID 15589578

The CD85J/leukocyte inhibitory receptor-1 distinguishes between conformed and beta 2- microglobulin-free HLA-G molecules. Gonen-Gross T, Achdout H, Arnon TI, Gazit R, Stern N, Horejsi V, Goldman-Wohl D, Yagel S, Mandelboim O. J Immunol. 2005 Oct 15;175(8):4866-74. PMID 16210588

Linking two immuno-suppressive molecules: indoleamine 2,3 dioxygenase can modify HLA-G cell-surface expression. Gonzalez-Hernandez A, LeMaoult J, Lopez A, Alegre E, Caumartin J, Le Rond S, Daouya M, Moreau P, Carosella ED. Biol Reprod. 2005 Sep;73(3):571-8. Epub 2005 May 4. PMID 15878889

NF-kappaB: linking inflammation and immunity to cancer development and progression. Karin M, Greten FR.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 895 Nat Rev Immunol. 2005 Oct;5(10):749-59. PMID 16175180

Total soluble HLA class I and soluble HLA-G in multiple myeloma and monoclonal gammopathy of undetermined significance. Leleu X, Le Friec G, Facon T, Amiot L, Fauchet R, Hennache B, Coiteux V, Yakoub-Agha I, Dubucquoi S, Avet-Loiseau H, Mathiot C, Bataille R, Mary JY; Intergroupe Francophone du Myelome. Clin Cancer Res. 2005 Oct 15;11(20):7297-303. PMID 16243800

HLA-G up-regulates ILT2, ILT3, ILT4, and KIR2DL4 in antigen presenting cells, NK cells, and T cells. LeMaoult J, Zafaranloo K, Le Danff C, Carosella ED. FASEB J. 2005 Apr;19(6):662-4. Epub 2005 Jan 24. PMID 15670976

Indoleamine 2,3 dioxygenase and human leucocyte antigen-G inhibit the T-cell alloproliferative response through two independent pathways. AUTHORS Le Rond S, Gonzalez A, Gonzalez AS, Carosella ED, Rouas-Freiss N. Immunology. 2005 Nov;116(3):297-307. PMID 16236119

HLA-G gene activation in tumor cells involves cis-acting epigenetic changes. Mouillot G, Marcou C, Rousseau P, Rouas-Freiss N, Carosella ED, Moreau P. Int J Cancer. 2005 Mar 1;113(6):928-36. PMID 15514928

HLA-G expression is associated with an unfavorable outcome and immunodeficiency in chronic lymphocytic leukemia. Nuckel H, Rebmann V, Durig J, Duhrsen U, Grosse-Wilde H. Blood. 2005 Feb 15;105(4):1694-8. Epub 2004 Oct 5. PMID 15466928

Report of the Wet Workshop for Quantification of Soluble HLA-G in Essen, 2004. Rebmann V, Lemaoult J, Rouas-Freiss N, Carosella ED, Grosse-Wilde H. Hum Immunol. 2005 Aug;66(8):853-63. Epub 2005 Jul 20. PMID 16216668

Tolerization of dendritic cells by HLA-G. Ristich V, Liang S, Zhang W, Wu J, Horuzsko A. Eur J Immunol. 2005 Apr;35(4):1133-42. PMID 15770701

Switch of HLA-G alternative splicing in a melanoma cell line causes loss of HLA-G1 expression and sensitivity to NK lysis. Rouas-Freiss N, Bruel S, Menier C, Marcou C, Moreau P, Carosella ED. Int J Cancer. 2005 Oct 20;117(1):114-22. PMID 15880415

Induction of HLA-G expression in a melanoma cell line OCM-1A following the treatment with 5- aza-2'-deoxycytidine. Yan WH, Lin AF, Chang CC, Ferrone S. Cell Res. 2005 Jul;15(7):523-31. PMID 16045815

Soluble HLA-G inhibits cell cycle progression in human alloreactive T lymphocytes. Bahri R, Hirsch F, Josse A, Rouas-Freiss N, Bidere N, Vasquez A, Carosella ED, Charpentier B, Durrbach A. J Immunol. 2006 Feb 1;176(3):1331-9. PMID 16424159

Atlas Genet Cytogenet Oncol Haematol 2009; 6 896

The class I HLA repertoire of pancreatic islets comprises the nonclassical class Ib antigen HLA-G. Cirulli V, Zalatan J, McMaster M, Prinsen R, Salomon DR, Ricordi C, Torbett BE, Meda P, Crisa L. Diabetes. 2006 May;55(5):1214-22. PMID 16644675

Soluble HLA-G1 inhibits angiogenesis through an apoptotic pathway and by direct binding to CD160 receptor expressed by endothelial cells. Fons P, Chabot S, Cartwright JE, Lenfant F, L'Faqihi F, Giustiniani J, Herault JP, Gueguen G, Bono F, Savi P, Aguerre-Girr M, Fournel S, Malecaze F, Bensussan A, Plouet J, Le Bouteiller P. Blood. 2006 Oct 15;108(8):2608-15. Epub 2006 Jun 29. PMID 16809620

Soluble HLA-G molecules increase during acute leukemia, especially in subtypes affecting monocytic and lymphoid lineages. Gros F, Sebti Y, de Guibert S, Branger B, Bernard M, Fauchet R, Amiot L. Neoplasia. 2006 Mar;8(3):223-30. PMID 16611416

HLA-G in human reproduction: aspects of genetics, function and pregnancy complications. Hviid TV. Hum Reprod Update. 2006 May-Jun;12(3):209-32. Epub 2005 Nov 9. PMID 16280356

Evidence to support the role of HLA-G5 in allograft acceptance through induction of immunosuppressive/ regulatory T cells. Le Rond S, Azema C, Krawice-Radanne I, Durrbach A, Guettier C, Carosella ED, Rouas-Freiss N. J Immunol. 2006 Mar 1;176(5):3266-76. PMID 16493088

Regulatory role of tryptophan degradation pathway in HLA-G expression by human monocyte- derived dendritic cells. Lopez AS, Alegre E, LeMaoult J, Carosella E, Gonzalez A. Mol Immunol. 2006 Jul;43(14):2151-60. Epub 2006 Feb 21. PMID 16490253

Inhibition of term decidual NK cell cytotoxicity by soluble HLA-G1. Poehlmann TG, Schaumann A, Busch S, Fitzgerald JS, Aguerre-Girr M, Le Bouteiller P, Schleussner E, Markert UR. Am J Reprod Immunol. 2006 Nov-Dec;56(5-6):275-85. PMID 17076671

Structural basis for recognition of the nonclassical MHC molecule HLA-G by the leukocyte Ig- like receptor B2 (LILRB2/LIR2/ILT4/CD85d). Shiroishi M, Kuroki K, Rasubala L, Tsumoto K, Kumagai I, Kurimoto E, Kato K, Kohda D, Maenaka K. Proc Natl Acad Sci U S A. 2006a Oct 31;103(44):16412-7. Epub PMID 17056715

Efficient leukocyte Ig-like receptor signaling and crystal structure of disulfide-linked HLA-G dimer. Shiroishi M, Kuroki K, Ose T, Rasubala L, Shiratori I, Arase H, Tsumoto K, Kumagai I, Kohda D, Maenaka K. J Biol Chem. 2006b Apr 14;281(15):10439-47. Epub 2006 Feb 2. PMID 16455647

Epigenetic regulation of MHC-II and CIITA genes. Wright KL, Ting JP. Trends Immunol. 2006 Sep;27(9):405-12. Epub 2006 Jul 25. PMID 16870508

Atlas Genet Cytogenet Oncol Haematol 2009; 6 897

Increase in HLA-G1 proteolytic shedding by tumor cells: a regulatory pathway controlled by NF-kappaB inducers. Zidi I, Guillard C, Marcou C, Krawice-Radanne I, Sangrouber D, Rouas-Freiss N, Carosella ED, Moreau P. Cell Mol Life Sci. 2006 Nov;63(22):2669-81. PMID 17072500

A homodimeric complex of HLA-G on normal trophoblast cells modulates antigen-presenting cells via LILRB1. Apps R, Gardner L, Sharkey AM, Holmes N, Moffett A. Eur J Immunol. 2007 Jul;37(7):1924-37. PMID 17549736

Trogocytosis-based generation of suppressive NK cells. Caumartin J, Favier B, Daouya M, Guillard C, Moreau P, Carosella ED, LeMaoult J. EMBO J. 2007 Mar 7;26(5):1423-33. Epub 2007 Feb 22. PMID 17318190

Research on HLA-G: an update. Favier B, LeMaoult J, Rouas-Freiss N, Moreau P, Menier C, Carosella ED. Tissue Antigens. 2007 Mar;69(3):207-11. PMID 17493143

HLA-G expression is induced in Epstein-Barr virus-transformed B-cell lines by culture conditions. Gazit E, Sherf M, Balbin E, Muratov A, Goldstein I, Loewenthal R. Hum Immunol. 2007 Jun;68(6):463-8. Epub 2007 Mar 26. PMID 17509445

Immune regulation by pretenders: cell-to-cell transfers of HLA-G make effector T cells act as regulatory cells. LeMaoult J, Caumartin J, Daouya M, Favier B, Le Rond S, Gonzalez A, Carosella ED. Blood. 2007 Mar 1;109(5):2040-8. Epub 2006 Oct 31. PMID 17077329

Human neuroblastoma cells trigger an immunosuppressive program in monocytes by stimulating soluble HLA-G release. Morandi F, Levreri I, Bocca P, Galleni B, Raffaghello L, Ferrone S, Prigione I, Pistoia V. Cancer Res. 2007 Jul 1;67(13):6433-41. PMID 17616704

Hypoxia modulates HLA-G gene expression in tumor cells. Mouillot G, Marcou C, Zidi I, Guillard C, Sangrouber D, Carosella ED, Moreau P. Hum Immunol. 2007 Apr;68(4):277-85. Epub 2006 Nov 27. PMID 17400064

Indoleamine 2,3-dioxygenase and tumor-induced tolerance. Munn DH, Mellor AL. J Clin Invest. 2007 May;117(5):1147-54. PMID 17476344

CD3+CD4low and CD3+CD8low are induced by HLA-G: novel human peripheral blood suppressor T-cell subsets involved in transplant acceptance. Naji A, Le Rond S, Durrbach A, Krawice-Radanne I, Creput C, Daouya M, Caumartin J, LeMaoult J, Carosella ED, Rouas-Freiss N. Blood. 2007 Dec 1;110(12):3936-48. Epub 2007 Sep 5. PMID 17804694

Quantification and identification of soluble HLA-G isoforms.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 898 Rebmann V, LeMaoult J, Rouas-Freiss N, Carosella ED, Grosse-Wilde H. Tissue Antigens. 2007 Apr;69 Suppl 1:143-9. PMID 17445190

Expression of tolerogenic HLA-G molecules in cancer prevents antitumor responses. Rouas-Freiss N, Moreau P, Menier C, LeMaoult J, Carosella ED. Semin Cancer Biol. 2007b Dec;17(6):413-21. Epub 2007 Jul 17. PMID 17881247

Tolerogenic functions of human leukocyte antigen G: from pregnancy to organ and cell transplantation. Rouas-Freiss N, Naji A, Durrbach A, Carosella ED. Transplantation. 2007a Jul 15;84(1 Suppl):S21-5. PMID 17632407

Tumor-released microvesicles as vehicles of immunosuppression. Valenti R, Huber V, Iero M, Filipazzi P, Parmiani G, Rivoltini L. Cancer Res. 2007 Apr 1;67(7):2912-5. PMID 17409393

Human leukocyte antigen G expression: as a significant prognostic indicator for patients with colorectal cancer. Ye SR, Yang H, Li K, Dong DD, Lin XM, Yie SM. Mod Pathol. 2007 Mar;20(3):375-83. Epub 2007 Feb 2. PMID 17277760

Expression of human leucocyte antigen G (HLA-G) is associated with prognosis in non-small cell lung cancer. Yie SM, Yang H, Ye SR, Li K, Dong DD, Lin XM. Lung Cancer. 2007a Nov;58(2):267-74. Epub 2007 Jul 30. PMID 17673327

Expression of human leukocyte antigen G (HLA-G) correlates with poor prognosis in gastric carcinoma. Yie SM, Yang H, Ye SR, Li K, Dong DD, Lin XM. Ann Surg Oncol. 2007b Oct;14(10):2721-9. Epub 2007 Jun 13. PMID 17564748

Expression of HLA-G is associated with prognosis in esophageal squamous cell carcinoma. Yie SM, Yang H, Ye SR, Li K, Dong DD, Lin XM. Am J Clin Pathol. 2007c Dec;128(6):1002-9. PMID 18024326

HLA-G: from biology to clinical benefits. Carosella ED, Moreau P, Lemaoult J, Rouas-Freiss N. Trends Immunol. 2008 Mar;29(3):125-32. Epub 2008 Feb 4. PMID 18249584

Role of HLA-G in innate immunity through direct activation of NF-kappaB in natural killer cells. Guillard C, Zidi I, Marcou C, Menier C, Carosella ED, Moreau P. Mol Immunol. 2008 Jan;45(2):419-27. Epub 2007 Aug 1. PMID 17675239

Indoleamine 2,3-dioxygenase in T-cell tolerance and tumoral immune escape. Katz JB, Muller AJ, Prendergast GC. Immunol Rev. 2008 Apr;222:206-21. PMID 18364004

HLA-G turns off erythropoietin receptor signaling through JAK2 and JAK2 V617F dephosphorylation: clinical relevance in polycythemia vera.

Atlas Genet Cytogenet Oncol Haematol 2009; 6 899 Menier C, Guillard C, Cassinat B, Carosella ED, Rouas-Freiss N. Leukemia. 2008 Mar;22(3):578-84. Epub 2007 Dec 6. PMID 18059484

Human leukocyte antigen-G5 secretion by human mesenchymal stem cells is required to suppress T lymphocyte and natural killer function and to induce CD4+CD25highFOXP3+ regulatory T cells. Selmani Z, Naji A, Zidi I, Favier B, Gaiffe E, Obert L, Borg C, Saas P, Tiberghien P, Rouas-Freiss N, Carosella ED, Deschaseaux F. Stem Cells. 2008 Jan;26(1):212-22. Epub 2007 Oct 11. PMID 17932417

Contributor(s) Written 07-2008 Catherine Menier, Nathalie Rouas-Freiss, Edgardo D Carosella Service de Recherche en Hemato-Immunologie, Hopital Saint Louis, CEA - Batiment Lailler, 1, av. Claude Vellefaux, 75475 Paris Cedex 10 - France Citation This paper should be referenced as such : Menier C, Rouas-Freiss N, Carosella ED . The HLA-G non classical MHC class I molecule is expressed in cancer with poor prognosis. Implications in tumour escape from immune system and clinical applications. Atlas Genet Cytogenet Oncol Haematol. July 2008 . URL : http://AtlasGeneticsOncology.org/Deep/HLAinCancerID20070.html © Atlas of Genetics and Cytogenetics in Oncology and Haematology

Atlas Genet Cytogenet Oncol Haematol 2009; 6 900