DOCSLIB.ORG

Effect of Low Doses of Estradiol and Tamoxifen on Breast Cancer Cell Karyotypes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effect of Low Doses of Estradiol and Tamoxifen on Breast Cancer Cell Karyotypes 238 M Rondón-Lagos et al. Breast cancer cell karyotypes, 23:8 635–650 Research E2 and tamoxifen Effect of low doses of estradiol and tamoxifen on breast cancer cell karyotypes Milena Rondón-Lagos1, Nelson Rangel1,2, Ludovica Verdun Di Cantogno3, Laura Annaratone1, Isabella Castellano1, Rosalia Russo1, Tilde Manetta4, Caterina Marchiò1,* and Anna Sapino1,5,* 1Department of Medical Sciences, University of Turin, Turin, Italy Correspondence 2Natural and Mathematical Sciences Faculty, Universidad del Rosario, Bogotá, Colombia should be addressed 3Pathology Division, Azienda Ospedaliera Città della Salute e della Scienza di Torino, Turin, Italy to C Marchiò or A Sapino 4Department of Public Health and Pediatrics, University of Turin, Turin, Italy Email 5Candiolo Cancer Institute, FPO-IRCCS, Candiolo, Italy [email protected] or *(C Marchiò and A Sapino contributed equally to this work) [email protected] Abstract Evidence supports a role of 17β-estradiol (E2) in carcinogenesis and the large majority Key Words of breast carcinomas are dependent on estrogen. The anti-estrogen tamoxifen (TAM) f breast cancer cells is widely used for both treatment and prevention of breast cancer; however, it is also f estradiol carcinogenic in human uterus and rat liver, highlighting the profound complexity of its f tamoxifen actions. The nature of E2- or TAM-induced chromosomal damage has been explored using f chromosomal relatively high concentrations of these agents, and only some numerical aberrations abnormalities Endocrine-Related Cancer Endocrine-Related and chromosomal breaks have been analyzed. This study aimed to determine the effects f chromosomal instability −8 −1 −6 −1 of low doses of E2 and TAM (10 mol L and 10 mol L respectively) on karyotypes of MCF7, T47D, BT474, and SKBR3 breast cancer cells by comparing the results of conventional karyotyping and multi-FISH painting with cell proliferation. Estrogen receptor (ER)-positive (+) cells showed an increase in cell proliferation after E2 treatment (MCF7, T47D, and BT474) and a decrease after TAM treatment (MCF7 and T47D), whereas in ER− cells (SKBR3), no alterations in cell proliferation were observed, except for a small increase at 96 h. Karyotypes of both ER+ and ER− breast cancer cells increased in complexity after treatments with E2 and TAM leading to specific chromosomal abnormalities, some of which were consistent throughout the treatment duration. This genotoxic effect was higher in HER2+ cells. The ER−/HER2+ SKBR3 cells were found to be sensitive to TAM, exhibiting an increase in chromosomal aberrations. These in vitro results provide insights into the potential role of low doses of E and TAM in inducing 2 Endocrine-Related Cancer chromosomal rearrangements in breast cancer cells. (2016) 23, 635–650 Introduction 17β-estradiol (E2) is the main estrogenic hormone development at puberty and during sexual maturity. E2 that through the estrogen receptors (ER) acts on the may be procancerogenic by inducing (i) ER-mediated cell mammary gland regulating a wide variety of biological proliferation, (ii) gene mutation through a cytochrome processes including differentiation, cell proliferation, and P450-mediated metabolic activation, and (iii) aneuploidy http://erc.endocrinology-journals.org © 2016 Society for Endocrinology This work is licensed under a Creative Commons DOI: 10.1530/ERC-16-0078 Published by Bioscientifica Ltd. Attribution 3.0 Unported License. Printed in Great Britain Downloaded from Bioscientifica.com at 09/24/2021 09:50:02PM via free access 10.1530/ERC-16-0078 Research M Rondón-Lagos et al. Breast cancer cell karyotypes, 23:8 636 E2 and tamoxifen (Russo & Russo 2006), through overexpression of (ER+/PR+/HER2+), and SKBR3 (ER−/PR−/HER2+) were Aurora-A (Aur-A), a centrosome kinase, and centrosome obtained from the American Type Culture Collection amplification (Li et al. 2004). In addition, in both ER+ and (ATCC) in March 2010. Cell lines were expanded and ER− breast cancer cells, E2 may induce chromatin structural stocked at −80°C and cells obtained from these stocks changes through the estrogen-related receptors (ERR) (Hu were thawed and used for the experiments. At the end et al. 2008). Although high levels of E2 are implicated in of experiments, short tandem repeat (STR) profiles were breast cancer in postmenopausal women (Bernstein & performed to confirm the authentication of the cell lines Ross 1993), constant low E2 concentrations, in the range used. All experiments were carried out in each cell line at of picograms, are sufficient to increase breast cancer risk in passages (P) below 30. premenopausal women (Chetrite et al. 2000). MCF7 (P19), T47D (P20), and SKBR3 (P16) were Tamoxifen (TAM) is a non-steroidal anti-estrogen with cultured in RPMI-1640 medium (Sigma), whereas BT474 partial agonistic activity, extensively used in the treatment (P18) was cultured in DMEM medium (Sigma). All culture of ERα-positive breast cancer. Response to TAM is frequently media were supplemented with 10% fetal bovine serum of limited duration due to the development of resistance (FBS) (Sigma), antibiotic–antimycotic solution (1X) (Pearce & Jordan 2004, International Breast Cancer Study (Sigma), and L-glutamine (2 mM) (Invitrogen GmbH). Cells et al. 2006). Although ERα positivity is a well-established growing in 75 cm2 flasks were maintained at 37°C and 5% predictor of response to TAM and ERα-negative patients CO2. The absence of contamination with mycoplasma are considered nonresponders, it is known that 5–10% of was demonstrated by PCR assay. ERα-negative tumors do benefit from adjuvant TAM treatment (McGuire 1975, Early Breast Cancer Trialists’ E2 and TAM treatment Collaborative Group 1992, 1998, Early Breast Cancer Trialists’ Collaborative Group et al. 2011, Gruvberger-Saal et al. 2007). In order to remove endogenous serum steroids and Paradoxically, it has been reported that TAM possesses exclude the weak estrogen agonistic activity of phenol red a high mutagenic potential causing chromosome ruptures (Berthois et al. 1986), 48 h before the addition of E2 (E2758; in animal models (Mizutani et al. 2004). However, data on Sigma) and TAM (T5648; Sigma) cells were washed with type and frequency of chromosome abnormalities induced 5 mL phosphate-buffered saline (PBS) and then switched by TAM are scant (Mizutani et al. 2004). In particular, to phenol red-free RPMI-1640 (Sigma) containing 10% cytogenetic studies about the effects of low doses of TAM, charcoal-stripped FBS (Sigma). E2 and TAM were dissolved Endocrine-Related Cancer Endocrine-Related as it is suggested for treatment of pre-invasive low-grade in absolute ethanol and diluted in the media at 10−8 mol L−1 breast lesions (e.g., low-grade ductal carcinomas in situ and 10−6 mol L−1, respectively, and then added to the or lobular intraepithelial neoplasia), are limited (Kedia- culture medium at 24, 48, and 96 h. These concentrations have been demonstrated to be the lowest to induce an Mokashi et al. 2010). The nature of E2- or TAM-induced chromosomal damage has been explored using relatively effect on the architecture of the cytoskeleton in breast high concentrations of these agents, and only some cancer cells in vitro (Sapino et al. 1986). numerical aberrations and chromosomal breaks have Cells without treatment at 24 h (T24 h) and at 96 h been analyzed (Tsutsui & Barrett 1997, Mizutani et al. (T96 h) were used as controls. 2004, Quick et al. 2008, Kedia-Mokashi et al. 2010). The aim of this study was to determine the effects of Proliferation assay low doses of E2 and TAM on chromosomal rearrangements Cells were seeded at a density of 2.5–5 × 103 cells per by comparing the results of conventional karyotyping 100 L of phenol red-free medium in a 96 multi-well and multicolor fluorescencein situ hybridization (M-FISH) μ plate and after 24 h were treated with E and TAM painting with cell proliferation activity of human breast 2 for 24, 48, and 96 h. At the end of each treatment, cell cancer cells with differential expression of ER and HER2. proliferation was assessed using the cell proliferation ELISA kit, BrdU (Roche Diagnostics Deutschland GmbH). Materials and methods Measurement of absorbance was performed by using a MultiSkan Bichromatic reader (Labsystems, Midland, Cell lines Canada) against a background control as blank. Each The human breast cancer cell lines MCF7 and T47D treatment was performed in 24 replicates and expressed as (ER+/progesterone receptor (PR)+/HER2−), BT474 means ± standard deviation (S.D.). http://erc.endocrinology-journals.org © 2016 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/ERC-16-0078 Printed in Great Britain Downloaded from Bioscientifica.com at 09/24/2021 09:50:02PM via free access Research M Rondón-Lagos et al. Breast cancer cell karyotypes, 23:8 637 E2 and tamoxifen Metaphase spreads and G-banding series, air-dried, covered with 10 μL of probe cocktail (denatured), and hybridized for 2 days at 37°C. Slides To determine whether E and TAM treatment resulted 2 were then washed with post-hybridization buffers, in the induction of chromosomal abnormalities, we dehydrated in ethanol series, and counterstained with performed conventional and molecular cytogenetic 10 μL of DAPI/antifade. Signal detection and subsequent analysis in parallel with the evaluation of cell proliferation. metaphase analysis were done using the Metafer system Metaphases were obtained by using standardized and Metasytems’ ISIS software (software for spectral harvesting protocols in order to perform conventional karyotypes) (Carl Zeiss, Metasystems, GmbH, Germany) and molecular cytogenetic analysis (multi-FISH and (Rondon-Lagos et al. 2014a,b). FISH). Briefly, colcemid solution (0.03 μg/mL) (Sigma) was added to cultures 2.5 h before cell harvesting; cells were then treated with hypotonic solution, fixed three times Immunohistochemistry (IHC) with Carnoy’s fixative (3:1 methanol to acetic acid), and spread on glass. For analysis of chromosomal alterations, Immunohistochemistry for ER and PR was carried out the slides were banded with G-banding.
Load more

Recommended publications
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins
    International Journal of Molecular Sciences Article Bioinformatic Analysis of Structure and Function of LIM Domains of Human Zyxin Family Proteins M. Quadir Siddiqui 1,† , Maulik D. Badmalia 1,† and Trushar R. Patel 1,2,3,* 1 Alberta RNA Research and Training Institute, Department of Chemistry and Biochemistry, University of Lethbridge, 4401 University Drive, Lethbridge, AB T1K 3M4, Canada; [email protected] (M.Q.S.); [email protected] (M.D.B.) 2 Department of Microbiology, Immunology and Infectious Disease, Cumming School of Medicine, University of Calgary, 3330 Hospital Drive, Calgary, AB T2N 4N1, Canada 3 Li Ka Shing Institute of Virology, University of Alberta, Edmonton, AB T6G 2E1, Canada * Correspondence: [email protected] † These authors contributed equally to the work. Abstract: Members of the human Zyxin family are LIM domain-containing proteins that perform critical cellular functions and are indispensable for cellular integrity. Despite their importance, not much is known about their structure, functions, interactions and dynamics. To provide insights into these, we used a set of in-silico tools and databases and analyzed their amino acid sequence, phylogeny, post-translational modifications, structure-dynamics, molecular interactions, and func- tions. Our analysis revealed that zyxin members are ohnologs. Presence of a conserved nuclear export signal composed of LxxLxL/LxxxLxL consensus sequence, as well as a possible nuclear localization signal, suggesting that Zyxin family members may have nuclear and cytoplasmic roles. The molecular modeling and structural analysis indicated that Zyxin family LIM domains share Citation: Siddiqui, M.Q.; Badmalia, similarities with transcriptional regulators and have positively charged electrostatic patches, which M.D.; Patel, T.R.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Alpha;-Actinin-4 Promotes Metastasis in Gastric Cancer
    Laboratory Investigation (2017) 97, 1084–1094 © 2017 USCAP, Inc All rights reserved 0023-6837/17 α-Actinin-4 promotes metastasis in gastric cancer Xin Liu and Kent-Man Chu Metastasis increases the mortality rate of gastric cancer, which is the third leading cause of cancer-associated deaths worldwide. This study aims to identify the genes promoting metastasis of gastric cancer (GC). A human cell motility PCR array was used to analyze a pair of tumor and non-tumor tissue samples from a patient with stage IV GC (T3N3M1). Expression of the dysregulated genes was then evaluated in GC tissue samples (n = 10) and cell lines (n =6) via qPCR. Expression of α-actinin-4 (ACTN4) was validated in a larger sample size (n = 47) by qPCR, western blot and immunohistochemistry. Knockdown of ACTN4 with specific siRNAs was performed in GC cells, and adhesion assays, transwell invasion assays and migration assays were used to evaluate the function of these cells. Expression of potential targets of ACTN4 were then evaluated by qPCR. Thirty upregulated genes (greater than twofold) were revealed by the PCR array. We focused on ACTN4 because it was upregulated in 6 out of 10 pairs of tissue samples and 5 out of 6 GC cell lines. Further study indicated that ACTN4 was upregulated in 22/32 pairs of tissue samples at stage III & IV (P = 0.0069). Knockdown of ACTN4 in GC cells showed no significant effect on cell proliferation, but significantly increased cell-matrix adhesion, as well as reduced migration and invasion of AGS, MKN7 and NCI-N87 cells.
    [Show full text]
  • Atlas Journal
    Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Tumors Cancer prone Deep Insight Case Reports Portal Journals Teaching X Y 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 NA Atlas Journal Atlas Journal versus Atlas Database: the accumulation of the issues of the Journal constitutes the body of the Database/Text-Book. TABLE OF CONTENTS Volume 13, Number 7, July 2009 Previous Issue / Next Issue Genes ABL1 (v-abl Abelson murine leukemia viral oncogene homolog 1) (9q34.1) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 757-766. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ABL.html BCL2L12 (BCL2-like 12 (proline-rich)) (19q13.3). Christos Kontos, Hellinida Thomadaki, Andreas Scorilas. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 767-771. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCL2L12ID773ch19q13.html BCR (Breakpoint cluster region) (22q11.2) - updated. Ali G Turhan. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 772-779. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/BCR.html ENAH (enabled homolog (Drosophila)) (1q42.12). Paola Nisticò, Francesca Di Modugno. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 780-785. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/ENAHID44148ch1q42.html FGFR2 (fibroblast growth factor receptor 2) (10q26.13). Masaru Katoh. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 786-799. [Full Text] [PDF] URL : http://atlasgeneticsoncology.org/Genes/FGFR2ID40570ch10q26.html MAPK6 (mitogen-activated protein kinase 6) (15q21.2). Sylvain Meloche. Atlas Genet Cytogenet Oncol Haematol 2009; 13 (7): 800-804.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Downregulation of Glial Genes Involved in Synaptic Function
    RESEARCH ARTICLE Downregulation of glial genes involved in synaptic function mitigates Huntington’s disease pathogenesis Tarik Seref Onur1,2,3†, Andrew Laitman2,4,5†, He Zhao2, Ryan Keyho2, Hyemin Kim2, Jennifer Wang2, Megan Mair1,2,3, Huilan Wang6, Lifang Li1,2, Alma Perez2, Maria de Haro1,2, Ying-Wooi Wan2, Genevera Allen2,7, Boxun Lu6, Ismael Al-Ramahi1,2, Zhandong Liu2,4,5, Juan Botas1,2,3,4* 1Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, United States; 2Jan and Dan Duncan Neurological Research Institute at Texas Children’s Hospital, Houston, United States; 3Genetics & Genomics Graduate Program, Baylor College of Medicine, Houston, United States; 4Quantitative & Computational Biosciences, Baylor College of Medicine, Houston, United States; 5Department of Pediatrics, Baylor College of Medicine, Houston, United States; 6State Key Laboratory of Medical Neurobiology and MOE Frontiers Center for Brain Science, Fudan University, Shanghai, China; 7Departments of Electrical & Computer Engineering, Statistics and Computer Science, Rice University, Houston, United States Abstract Most research on neurodegenerative diseases has focused on neurons, yet glia help form and maintain the synapses whose loss is so prominent in these conditions. To investigate the contributions of glia to Huntington’s disease (HD), we profiled the gene expression alterations of *For correspondence: Drosophila expressing human mutant Huntingtin (mHTT) in either glia or neurons and compared [email protected] these changes to what is observed in HD human and HD mice striata. A large portion of conserved genes are concordantly dysregulated across the three species; we tested these genes in a high- †These authors contributed throughput behavioral assay and found that downregulation of genes involved in synapse assembly equally to this work mitigated pathogenesis and behavioral deficits.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name breast cancer anti-estrogen resistance protein 3 Gene Symbol Bcar3 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.7383 Ensembl Gene ID ENSRNOG00000013737 Entrez Gene ID 310838 Assay Information Unique Assay ID qRnoCIP0035724 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000065111 Amplicon Context Sequence GCAAGGTTGCTAGGATACTGGAAGTCTCTGAAGACATGAAGAGGAGCATGGGC GTGAGCTCGGGACTGGAACTCATTACCTTGCCTCACGGACGCCAGCTGCGCCT GGACATTATTGAAAGACACAACACCATGGCCATTG Amplicon Length (bp) 111 Chromosome Location 2:246024723-246034495 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 103 R2 0.9986 cDNA Cq 21.98 cDNA Tm (Celsius) 85.5 gDNA Cq 37.5 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Bcar3, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Molecular Cloning of Hmena (ENAH)
    Research Article Molecular Cloning of hMena (ENAH) and Its Splice Variant hMena+11a: Epidermal Growth Factor Increases Their Expression and Stimulates hMena+11a Phosphorylation in Breast Cancer Cell Lines Francesca Di Modugno,1 Lucia DeMonte,5,6 Michele Balsamo,2 Giovanna Bronzi,2 Maria Rita Nicotra,3 Massimo Alessio,6 Elke Jager,7 John S. Condeelis,8 Angela Santoni,4 Pier Giorgio Natali,2 and Paola Nistico`2 1Experimental Chemotherapy and 2Laboratory of Immunology, Regina Elena Cancer Institute; 3Molecular Biology and Pathology Institute, National Research Council; 4Experimental Medicine and Pathology, University ‘‘La Sapienza,’’ Rome, Italy; 5Tumor Immunology and 6Proteome Biochemistry, Dibit, San Raffaele Scientific Institute, Milan, Italy; 7Medizinische Klinik II, Hamatologie-Onkologie, Krankenhaus Nordwest, Frankfurt, Germany; and 8Department of Anatomy, Structural Biology and Analytical Imaging Facility, Albert Einstein College of Medicine, Bronx, New York Abstract (serologic analysis of cDNA expression libraries) technology the hMena (ENAH), an actin regulatory protein involved in the hMena protein (3), the human orthologue of murine Mena, which control of cell motility and adhesion, is modulated during is overexpressed in benign breast lesions with high risk of human breast carcinogenesis. In fact, whereas undetectable in transformation and in >70% of primary breast cancers (4). normal mammary epithelium, hMena becomes overexpressed Mena belongs to the Ena/VASP protein family, which includes key regulatory molecules controlling cell shape (5, 6) and movement (7) in high-risk benign lesions and primary and metastatic tumors. + À by protecting actin filaments from capping proteins at their barbed In vivo, hMena overexpression correlates with the HER-2 /ER / + ends (8). Ena/VASP proteins are constituents of the adherens Ki67 unfavorable prognostic phenotype.
    [Show full text]
  • Protein Annotation of Breast-Cancer-Related Proteins with Machine-Learning Tools
    Makara Journal of Science Volume 24 Issue 2 June Article 6 6-26-2020 Protein Annotation of Breast-cancer-related Proteins with Machine-learning Tools Arli Aditya Parikesit Department of Bioinformatics, School of Life Sciences, Indonesia International Institute for Life Sciences, Jakarta 13210, Indonesia, [email protected] David Agustriawan Department of Bioinformatics, School of Life Sciences, Indonesia International Institute for Life Sciences, Jakarta 13210, Indonesia Rizky Nurdiansyah Department of Bioinformatics, School of Life Sciences, Indonesia International Institute for Life Sciences, Jakarta 13210, Indonesia Follow this and additional works at: https://scholarhub.ui.ac.id/science Recommended Citation Parikesit, Arli Aditya; Agustriawan, David; and Nurdiansyah, Rizky (2020) "Protein Annotation of Breast- cancer-related Proteins with Machine-learning Tools," Makara Journal of Science: Vol. 24 : Iss. 2 , Article 6. DOI: 10.7454/mss.v24i1.12106 Available at: https://scholarhub.ui.ac.id/science/vol24/iss2/6 This Article is brought to you for free and open access by the Universitas Indonesia at UI Scholars Hub. It has been accepted for inclusion in Makara Journal of Science by an authorized editor of UI Scholars Hub. Protein Annotation of Breast-cancer-related Proteins with Machine-learning Tools Cover Page Footnote The authors would like to thank the Institute for Research and Community Services of the Indonesia International Institute for Life Sciences (i3l) for their heartfelt support. Thanks also goes to Direktorat Riset dan Pengabdian Masyarakat, Direktorat Jenderal Penguatan Riset dan Pengembangan Kementerian Riset, Teknologi dan Pendidikan Tinggi Republik Indonesia for providing Hibah Penelitian Dasar DIKTI/ LLDIKTI III 2019 No. 1/AKM/PNT/2019.
    [Show full text]
  • Breast Cancer Antiestrogen Resistance-3 (BCAR3) in Mammary Gland Development and Breast Cancer
    Breast Cancer Antiestrogen Resistance-3 (BCAR3) in mammary gland development and breast cancer Allison Margarethe Cross Royersford, PA B.S. Lycoming College 2010 A Dissertation presented to the Graduate Faculty of the University of Virginia in Candidacy for the Degree of Doctor of Philosophy Department of Microbiology, Immunology, and Cancer University of Virginia May, 2016 i Abstract Despite increased early detection and improved treatment options, breast cancer remains the second leading cause of cancer deaths among women. The majority of breast cancer mortalities are the consequence of therapeutic-resistant metastatic disease. A better understanding of the genetic alterations and signaling pathways involved in breast cancer progression and therapeutic resistance is required to identify new and better therapeutic targets to combat this disease. Breast Cancer Antiestrogen-3 (BCAR3) has been identified as an adaptor molecule that is upregulated in aggressive breast cancer cell lines, where it contributes to increased proliferation, migration, and invasion. The work presented in this thesis focuses on understanding BCAR3 signaling in breast cancer progression as well as mammary gland morphogenesis. The data presented demonstrate that BCAR3 controls adhesion turnover, migration, and invasion through interactions with the adaptor molecule p130Cas (Cas). In addition, BCAR3 was found to be upregulated and differentially expressed during tumor progression in the MMTV-polyoma middle T (PyMT) mouse model of spontaneous breast cancer. Preliminary xenograft studies in mice reveal that BCAR3 expression accelerates tumor formation and controls total tumor burden in MDA-MB-231 breast tumors. Future studies are needed to determine if BCAR3 can regulate the growth of established tumors and promote metastasis, and if interactions with Cas are required for its functions in vivo.
    [Show full text]
  • Native Proline-Rich Motifs Exploit Sequence Context to Target Actin-Remodeling Ena/VASP Proteins
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.22.436451; this version posted June 18, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Native proline-rich motifs exploit sequence context to target actin-remodeling Ena/VASP proteins Theresa Hwang1, Robert A. Grant1, Meucci W. Ilunga1, Venkatesh Sivaraman1, and Amy E. Keating1,2* 1. Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 2. Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA *correspondence to [email protected] Abstract The human proteome is replete with short linear motifs (SLiMs) of 4-6 residues that are critical for protein-protein interactions, yet the importance of the sequence surrounding such motifs is underexplored. We devised a proteomic screen to systematically examine the influence of SLiM sequence context on protein-protein interactions. Focusing on the EVH1 domain of ENAH, an actin regulator that is upregulated in invasive cancers, we screened 36-residue proteome-derived peptides for binding. We discovered a pocket on the ENAH EVH1 domain that diverged from its orthologs to recognize extended SLiMs, and we found that proteins with two EVH1-binding SLiMs can wrap around a single domain. We also found that the ciliary protein PCARE uses an extended 23-residue region to obtain higher affinity than any known ENAH EVH1-binding motif. Our screen provides a way to uncover the effects of broader proteomic context on motif-mediated interactions, revealing diverse mechanisms of contextual control over EVH1 interactions and establishing that SLiMs can’t be fully understood outside of their native context.
    [Show full text]