Bacillus Lentimorbus ATCC 14707T

International Journal of Systematic Bacteriology (1 999), 49, 53 1-540 Printed in Great Britain Transfer of Bacillus lentimorbus and Bacillus popilliae to the genus Paenibacillus with emended descriptions of Paenibacillus lentirnorbus comb. nov. and Paenibacillus popilliae comb. nov. Bertil Pettersson,' Karen E. Rippere,' Allan A. Yousten* and Fergus G. Priest3 Author for correspondence : Fergus G.Priest. Tel : + 44 131 45 1 3464. Fax : + 44 13 1 45 1 3009. e-mail: [email protected] Department of Almost complete 165 rRNA gene sequences were generated for the type Biochemistryand strains of the obligate insect pathogens Bacillus lentimorbus and Bacillus Biotechnology, Royal Institute of Technology, 5- popilliae and a second strain of Bacillus popilliae (NRRL B-4081) received as 100 44 Stockholm, Sweden 'Bacillus popilliae var. melolonthae I.A phylogenetic tree was constructed * Biology Department, which grouped these strains into a well defined subcluster within the genus Virginia Polytechnic Paenibacillus. Bacillus popilliae NRRL B-4081 occupied an intermediate position Institute and State between the type strains of Bacillus lentimonbus and Bacillus popilliae but University, Blacksburg, VA 24061, USA with a marked clustering to the latter. The phylogenetic assignment of these strains to Paenibacillus is in contrast to earlier studies which placed these 3 Department of Biological Sciences, Heriot Watt bacteria in the genus Bacillus, close to Bacillus subtilis. Indeed, the rRNA University, Edinburgh EH14 sequences generated in this study share less than 88% similarity to the 4AS, UK deposited sequences for Bacillus popilliae ATCC 14706Tand Bacillus lentimorbus ATCC 14707T.The results obtained by using different tree algorithms, bootstrap analysis, branch lengths and verification by signature nucleotide analysis supported the reclassification of these species in the genus Paenibacillus as Paenibacillus /entimorbus comb. nov. and Paenibacillus popilliae comb. nov. Keywords: Paenibacillus lentimorbus comb. nov., Paenibacillus popilliae comb. nov., insect pathogens, 16s rRNA INTRODUCTION mycin or 2 % NaCl is generally associated with strains of Bacillus popilliae (Rippere et al., 1998). The two Bacillus lentimorbus and Bacillus popilliae were first species are responsible for slightly different forms of described by Dutky (1940) as the causative agents of milky disease. Bacillus popilliae causes type A milky milky disease in Japanese beetle and related scarab disease and Bacillus lentimorbus is associated with type larvae (Klein & Kaya, 1995). Although there have B milky disease (Dutky, 1940). The latter is charac- been suggestions in the past that Bacillus popilliae and terized by the appearance of brown clots which block Bacillus lentimorbus may be varieties of a single species, the circulation of haemolymph in the larva and lead to DNA hybridization and RAPD analysis have shown gangrenous conditions in the affected parts (Stahly et that the two taxa are closely related but distinct and al., 1992). appropriately placed in separate species (Rippere et al., In a comparative analysis of 16s RNA sequences of 5 1 1998). Physiologically, differences between the Bacillus, et al. species are few, but growth in the presence of vanco- species of the genus Ash (1 99 1) described five principal groups of strains of which two, rRNA groups 3 and 4, have since been afforded generic status The GenBank accession numbers for the 165 rRNA gene sequences of as Paenibacillus (Ash et al., 1993) and Brevibacillus Bacillus Ientimorbus ATCC 14707T, and Bacillus popilliae ATCC 14706Tand (Shida et al., 1996), respectively. In this original study, NRRL 6-4081 are AF071861, AF071859 and AF071860, respectively. the type strains of Bacillus popilliae and Bacillus 00907 0 1999 IUMS 53 1 B. Pettersson and others lentimorbus were recovered in rRNA group 1, a large DNA preparation and amplification for identification. DNA group containing the type species of the genus, Bacillus was prepared from 1 litre MYPGP broth as described subtilis (Ash et al., 199 1). However, Bacillus popilliae previously (Rippere et al., 1998). The specific primers PAEN515F (Shida et al., 1997) and PAEN862F were used in Bacillus lentimorbus have physiological and numerous conjunction with a reverse primer (RNA1484R) to the distal and ecological traits in common with various species of end of the 16s rRNA gene (Table 2) in PCR amplifications Paenibacillus, including poor sporulation in vitro, for presumptive identification of strains of the genus swollen sporangia, a requirement for complex media, Paenibacillus. As a control, the forward primer (RNA3 1F), variable Gram stain reaction and lack of catalase (in which recognizes the proximal end of the 16s rRNA gene, common with Paenibacillus larvae subsp. larvae). was used. Amplification conditions for both reactions were Indeed, in a numerical analysis of phenotypic features denaturation at 94 "C for 5 min followed by 25 cycles of Bacillus popilliae and Bacillus lentimorbus were denaturation at 94 "C for 1 min, annealing at 58 "C for recovered in a cluster with other paenibacilli associated 1.5 min and extension at 72 "C for 1.5 rnin followed by a final with insects, including Paenibacillus larvae subsp. extension at 72 "C for 5 min. Products were separated in larvae and Paenibacillus larvae subsp. pulvifaciens 1.0% agarose gels in TAE buffer. (Priest et al., 198 1). These physiological and ecological In vitro amplification of the 165 rRNA gene. The 16s rRNA observations suggested to us that Bacillus popilliae and gene from genomic DNA preparations of Bacillus Bacillus lentimorbus may be misclassified in rRNA lentimorbus ATCC 14707T and Bacillus popilliae strains ATCC 1 4706Tand NRRL B-408 1 was amplified with a pair group 1 actually closely the and are more related to of primers complementary to the regions close to the 5' and bacteria of the genus Paenibacillus. Here we report a the 3' termini of the gene. Genomic DNA of the respective phylogenetic analysis based on 16s rRNA sequences strain (10 ng) was used for amplification with the primers of the type strains of Bacilluspopilliae (ATCC 1470fjT) RIT604 and RIT621 B (Table 2). PCR products (1 pl) were and Bacillus lentimorbus (ATCC 14707T) and present subjected to two different semi-nested amplifications. The data consistent with the transfer of these species to the primers RIT604 and RIT390B were used in one of the genus Paenibacillus. amplifications and RIT388 and RIT621B (Table 2) were used in the second semi-nested reaction. Biotinylated PCR products, suitable for solid-phase DNA sequencing, were METHODS generated with 10 pmol of each primer and the following thermocycling profile was used : denaturation at 96 "C for Strains and growth conditions. The strains used are listed in 15 s and a combined primer annealing/extension step at Table 1. Although strain NRRL B-408 1 has been designated 70 "C for 90 s was repeated 30 times. A final extension at 'Bacillus popilliae var. melolonthae ', given its uncertain 72 "C for 10 rnin was also used. et al., et al., varietal status (Stahly 1992; Rippere 1998) we Direct solid-phase 16s rDNA sequencing. Immobilization of Bacillus shall refer to it simply by its species name. the biotinylated PCR products followed by strand sep- lentimorbus and Bacillus popilliae strains were grown in aration and template preparation were performed with MYPGP agar and broth (Dingman & Stahly, 1983) at 30 "C superparamagnetic beads (Dynabeads M-280 Streptavidin ; and stored as described previously (Rippere et al., 1998). All Dynal). The nucleotide sequences from both strands were other strains were grown on nutrient agar and broth at determined by direct solid-phase DNA sequencing 37 "C. (Hultman et al., 1991, 1989) with ALFexpress (Amersham Fatty acid analysis. Fatty acids were extracted from strains Pharmacia Biotech) as described previously (Pettersson ATCC 14706Tand ATCC 14707Tby a single tube method et al., 1996a, b, c). The sequencing primers are listed in as described by Mayberry & Lane (1993). ' Following Table 2. esterification, fatty acids were analysed by GC on a Hewlett Comparison of 165 rRNA genes. The 16s rDNA sequences Packard 5890 using a flame-ionization detector. Microbial from the Bacillus popilliae and Bacillus lentimorbus strains Identification System software (Microbial ID) was used for determined in this study were checked against deposited 16s analysis. rDNA sequences in non-redundant GenBank, EMBL and bble 7. Bacterial strains used in the study Strain rRNA Reaction with Source/description group* Paenibacillus-specific PCR Bacillus subtilis NCIMB 3610T - Priest et al. (1988) Bacillus sphaericus 2362 - Alexander & Priest (1 990) Paenibacillus alvei DSM 29T + Priest et al. (1988) Paenibacillus chibensis NRRL B- 142T + Shida et al. (1997) Bacillus lentimorbus ATCC 14707T + Rippere et al. (1 998) Bacillus popilliae ATCC 14706T + Rippere et al. (1998) ' Bacillus popilliae var. melolonthae' NRRL B-408 1 + Rippere et al. (1998) Brevihacillus borstelensis HRS 23 - De Silva et al. (1998) * rRNA groups as defined by Ash et al. (1991). 532 lnterna tional Journal of Systematic Bacteriology 49 Paenibacillus lentimorbus comb. nov. and P. popilliae comb. nov. Table 2. Primers used for PCR and DNA sequencing Primer” Position? Sequence (5’-3’)$ Application PAEN5 15F 470-494 GCTCGGAGAGTGACGGTACCTGAGA Paenibacillus-specific PA EN862 F 842-862 TCGATACCCTTGGTGCCGAAGT Paenibacillus-specific RNA3 1F 8-3 1 gcgcaagcttAGAGTTTGATCCTGGCTCAGGACG PCR RNA 1484R 1507-1484

Load more