Thuja Plicata)

Home , Thujaplicin

MOLECULAR GENETIC, BIOCHEMICAL &

ANATOMICAL CHARACTERIZATION OF

MONOTERPENOID SYNTHESIS IN WESTERN

REDCEDAR (THUJA PLICATA)

Adam John Foster M.Sc., University of Guelph, 2006 B.Sc. (Hons.), Simon Fraser University, 2003

THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

In the Department of Biological Sciences Faculty of Science

All rights reserved. However, in accordance with the Copyright Act of Canada, this work may be reproduced, without authorization, under the conditions for Fair Dealing. Therefore, limited reproduction of this work for the purposes of private study, research, criticism, review and news reporting is likely to be in accordance with the law, particularly if cited appropriately.

APPROVAL

Name: Adam John Foster Degree: Doctor of Philosophy Title of Thesis: Molecular genetic, biochemical & anatomical characterization of monoterpenoid synthesis in western redcedar (Thuja plicata) Examining Committee: Chair: Ron Ydenburg Professor

______Jim Mattsson Senior Supervisor Associate Professor

______Aine Plant Supervisor Associate Professor

______John Russell Supervisor Adjunct Associate Professor BC Ministry of Forests and Ranges

______Sherryl Bisgrove Internal Examiner Assistant Professor

______

Peter Constabel External Examiner Professor University of Victoria

Date Defended/Approved: ______

Declaration of Partial Copyright Licence

The author, whose copyright is declared on the title page of this work, has granted to Simon Fraser University the right to lend this thesis, project or extended essay to users of the Simon Fraser University Library, and to make partial or single copies only for such users or in response to a request from the library of any other university, or other educational institution, on its own behalf or for one of its users.

The author has further granted permission to Simon Fraser University to keep or make a digital copy for use in its circulating collection (currently available to the public at the “Institutional Repository” link of the SFU Library website at: ) and, without changing the content, to translate the thesis/project or extended essays, if technically possible, to any medium or format for the purpose of preservation of the digital work.

The author has further agreed that permission for multiple copying of this work for scholarly purposes may be granted by either the author or the Dean of Graduate Studies.

It is understood that copying or publication of this work for financial gain shall not be allowed without the author’s written permission.

Permission for public performance, or limited permission for private scholarly use, of any multimedia materials forming part of this work, may have been granted by the author. This information may be found on the separately catalogued multimedia material and in the signed Partial Copyright Licence.

While licensing SFU to permit the above uses, the author retains copyright in the thesis, project or extended essays, including the right to change the work for subsequent purposes, including editing and publishing the work in whole or in part, and licensing other parties, as the author may desire.

The original Partial Copyright Licence attesting to these terms, and signed by this author, may be found in the original bound copy of this work, retained in the Simon Fraser University Archive.

Simon Fraser University Library Burnaby, BC, Canada

Last revision: Spring 09 ABSTRACT

Western redcedar (Thuja plicata) is an economically and culturally important tree species to

British Columbia (BC). Wood from T. plicata is highly valued for being light weight, dimensionally stable and resistant to rot. However, T. plicata silviculture is not without problems. Reforestation with T. plicata is expensive due to extensive browsing of seedlings by ungulates. Also, woody stems of mature trees can be susceptible to heartwood rotting fungi. Resistance to ungulate browsing positively correlates with the overall abundance of monoterpenoids in foliage, notably the oxygenated monoterpenoid α-thujone, while heartwood rot resistance is relative to the amount of tropolones, a class of compounds derived from monoterpenes, in the wood. To better understand factors that affect monoterpenoid content in young T. plicata foliage, leaves were examined for ontogenetic changes in morphology, anatomy and monoterpenoid content during the first year of growth. The two morphologically different leaf types, needles and scales, possess different monoterpenoid storage structures and very different chemical contents, punctuated by the absence of α-thujone in needles. To determine the genetic basis for the production of foliar monoterpenoids, a transcriptome database was generated from which to draw candidate genes.

Complementary DNA profiling was used to determine the differential gene expression between a natural variant lacking foliar monoterpenoids and wild type tree. This analysis yielded more than 600 genes with low or undetectable expression in foliage of the variant, and up to 10000-fold higher transcript abundance in foliage with resin glands. Amongst the candidate genes was a single monoterpene synthase gene that produced sabinene, the likely monoterpene precursor to α-thujone, as its major product in vitro. A second, more comprehensive, transcriptome was generated to identify additional monoterpene synthases from other tissues. Eleven terpene synthase gene fragments were identified, one of which was found to produce terpinolene, the likely precursor of the tropolone β-thujaplicin. The transcriptome datasets together with the characterization of monoterpene synthases represents a major first step into understanding the genetics of T. plicata terpenoid based defenses.

Keywords: Western redcedar; Thuja plicata; monoterpenoid; leaf ontogeny; resin gland; α-thujone; sabinene; terpinolene; tropolone; thujaplicin; monoterpene synthase; ungulate browsing; heartwood rot resistance; molecular marker; transcriptome; tag profiling; next generation sequencing; Illumina; 454/Roche

iii

ACKNOWLEDGEMENTS

The work in this thesis would not have been possible without the contributions and support of my colleagues, friends and family. First, I would like to thank my senior supervisor Jim Mattsson for his support in obtaining financing, experimental ideas and editorial review. I would next like to thank my advisory committee. Thanks to John Russell for supplying his knowledge of western redcedar as well as genetic lines that were essential to this work. Thanks also go to Aine Plant for providing guidance and access to equipment needed to conduct QPCR. I also give my thanks to the members of my examination committee Peter Constabel, Sherryl Bisgrove and Ron Ydenberg. Much of the work presented here was conducted in collaboration with other researchers. The start of each research chapters lists the co-authors to the work that will be submitted for publication. Thanks to Regine and Gerhard Gries for their assistance and expertise on monoterpene quantification. Thanks to Jörg Bohlmann for graciously allowing me to conduct protein assays in his lab and to Dawn Hall for her assistance with functionally characterization of the monoterpene synthase genes. Thanks to Roni Aloni for mentoring me in plant anatomy and providing beautiful images for this work. I also obtained valuable guidance from postdoctoral fellows at SFU. I would like to give my thanks to Carol Wetzel for her mentorship and guidance with a number of experiments and to Kamal Biswas for all his help. The support of my fellow grad students and lab members is greatly appreciated. Thanks to Mathias Schuetz and Muhammad Arshad for all their assistance. Within my lab, I obtained valuable assistance from a number of talented undergraduate students and technicians. Thanks to Leanne Mortimer, Shelley Abercromby, Kathy Bayat, Michelle Langlois and Derek Tanner for all their contributions. And thanks to the technicians Afsaneh Haghighi-Kia and Lotta Pellonpera for all their help with taking care of plants, sectioning, examining tissues and generally keeping the lab in working order. Thanks also to all the past and current members of the Mattsson Lab. The SFU Biological Sciences administration staff, Marlene Nguyen and Amelia Shu, has been invaluable in ensuring the progress and timely completion of my studies. I truly appreciated your vigilant reminders and attention to detail. Thank you Marlene and Amelia. I thank all who have financially contributed to my graduate studies. Thanks to British Columbia Forest Science Program, the Natural Sciences and Engineering Research Council of Canada for funding my research and SFU for providing me with both scholarships and a teaching assistantship. I would also like to thank my family for all the support they provided me. Thanks to my brother Mark Foster who always lent me a sympathetic ear, and my little sister Nadia Foster. I am forever indebted to my father, Terry Foster, for all his support and guidance. My most heartfelt thanks, love and respect go to my soon to be wife Vicki Tse. She helped me both emotionally and technically, and her expertise in language and literature has greatly improved my writing skills. This work would likely have not been possible without all of your support and to all, I give my deepest thanks.

TABLE OF CONTENTS

Approval ...... ii Abstract ...... iii Acknowledgements ...... iv Table of Contents ...... v List of Figures ...... viii List of Supplemental Figures ...... xi List of Tables ...... xii List of Supplemental Tables ...... xiii 1. Introduction & Literature Review ...... 1 1.1 Thuja plicata Donn ex Don ...... 1 1.1.1 Ecology and morphology ...... 1 1.1.2 Herbivores of T. plicata ...... 2 1.1.3 Diseases of T. plicata ...... 3 1.1.4 Culture and economic importance of T. plicata ...... 5 1.2 Problems with the utilization of T. plicata related to monoterpenoid content ...... 6 1.2.1 Ungulate browsing deterrence ...... 6 1.2.2 Heartwood rot resistance ...... 7 1.3 Terpenoids ...... 8 1.3.1 Evolution and features of terpene synthases ...... 9 1.3.2 Production of terpenoid precursors ...... 10 1.3.3 Biosynthesis of monoterpenes ...... 12 1.3.4 Terpene storage in plants ...... 14 1.3.5 Biosynthesis of α- & β-thujone ...... 14 1.3.6 Biosynthesis of β-thujaplicin ...... 15 1.4 Gene discovery in conifers ...... 16 1.5 Formulation of research goals ...... 20 1.5.1 Major hypotheses ...... 20 1.5.2 Objectives relevant to hypothesis 1 ...... 20 1.5.3 Objectives relevant to hypothesis 2 ...... 21 1.5.4 Objectives relevant to hypothesis 3 ...... 21 1.6 References ...... 23 1.7 Figures ...... 30 2. Foliar phase changes are coupled with changes in storage and biochemistry of monoterpenoids in western redcedar (Thuja plicata) ...... 33 2.1 Abstract ...... 34 2.2 Introduction ...... 35

2.3 Materials and Methods ...... 37 2.4 Results ...... 39 2.4.1 Leaf morphology phase changes in young T. plicata plants ...... 39 2.4.2 Phase changes in the anatomy of resin storage structures ...... 40 2.4.3 Suberization of resin storage structures ...... 41 2.4.4 Terpene profiles of needles and scales ...... 43 2.5 Discussion ...... 43 2.6 Conclusions ...... 47 2.7 References ...... 48 2.8 Figures ...... 51 2.9 Tables ...... 57 3. Identification of key genes in the synthesis of foliar terpenoids in western redcedar (Thuja plicata) ...... 58 3.1 Abstract ...... 59 3.2 Introduction ...... 60 3.3 Results ...... 62 3.3.1 Characterization of wild type and variant T. plicata genotypes ...... 62 3.3.2 Generation of a de novo leaf transcriptome ...... 64 3.3.3 Genes with expression associated with the presence of foliar resin glands ..... 64 3.3.4 Identification of potential thujone candidate genes by phylogenetic analysis . 65 3.3.5 Confirmation of tag profiling results by QPCR ...... 68 3.3.6 Localized gene expression of thujone biosynthesis candidate genes ...... 68 3.3.7 Identification of monoterpene synthase enzymatic activity ...... 69 3.4 Discussion ...... 70 3.4.1 Terpene based defenses in T. plicata ...... 70 3.4.2 Identification of candidate thujone biosynthesis genes ...... 71 3.4.3 Genes with potential roles in defense ...... 73 3.4.4 Transcriptome dataset for T. plicata ...... 74 3.5 Materials and Methods ...... 75 3.5.1 Characterization of wild type and variant T. plicata lines ...... 75 3.5.2 Leaf transcriptome construction ...... 76 3.5.3 Illumina tag profiling ...... 77 3.5.4 Quantitative real time PCR ...... 77 3.5.5 Selection of candidate thujone biosynthesis genes ...... 78 3.5.6 Rapid amplification of cDNA ends (RACE) ...... 79

3.5.7 Localized expression of a monoterpene synthase by in situ hybridization ...... 79 3.5.8 Functional characterization of a monoterpene synthase ...... 80 3.6 References ...... 82 3.7 Figures ...... 87 3.8 Tables ...... 95 3.9 Supplemental Figures ...... 96 3.10 Supplemental Tables ...... 104 4. Identification and characterization of three monoterpene synthases active in foliage and wood differentiation zone of western redcedar (Thuja plicata) ...... 109 4.1 Abstract ...... 110 4.2 Introduction ...... 111 4.3 Results ...... 114 4.3.1 454/Roche sequencing of cDNA ...... 114 4.3.2 Identification of enzymatic activity ...... 115 4.3.3 Localization of gene expression ...... 116 4.3.4 Characterization of monoterpenoid content ...... 117 4.3.5 Phylogenetic analysis ...... 118 4.4 Discussion ...... 118 4.5 Materials and Methods ...... 122 4.5.1 cDNA library construction and screening ...... 122 4.5.2 Rapid amplification of cDNA ends (RACE) ...... 122 4.5.3 Functional characterization of monoterpene synthases ...... 123 4.5.4 Quantitative PCR Analyses ...... 124 4.5.5 Gas chromatography-mass spectrometry (GC-MS) ...... 125 4.5.6 Phylogenetic analysis ...... 126 4.6 References ...... 126 4.7 Figures ...... 131 4.8 Tables ...... 138 4.9 Supplemental Figures ...... 139 4.10 Supplementary Tables ...... 140 5. Conclusions and General Discussion ...... 141 5.1 References ...... 145 5.2 Figures ...... 146

vii

LIST OF FIGURES

Figure 1.1. Biosynthesis of mono-, sesqui- and diterpenes...... 30

Figure 1.2. Biosynthesis of monoterpenes from geranyl diphosphate...... 31

Figure 1.3. Proposed biosynthesis pathway of β-thujaplicin (Bentley, 2008) and α-thujone (Croteau 1996)...... 32

Figure 2.1. T. plicata with foliage at different ontogenetic ages. (a) Early stage with needles only. (b) Transitional stage with needles and scales. (c) 1-year-old T. plicata with late stage foliage at the top of the plant. (d) Needle leaf. (e) Scale leaf showing a central scale (cs) flanked by lateral scales (ls). A fourth scale is also present on the adaxial side of the stem...... 51

Figure 2.2. Cross and longitudinal sections of needle leaves. (a) Cross section through cleared needle showing a single resin duct (rd) below the vascular bundle at the early stage. (b) Longitudinal section though a fresh needle showing the continuous resin duct at the early stage. (c) Cleared cross section through the stem at the early stage showing resin ducts in the portion of a needle fused to the stem. (d) Cross section of stem the transitional stage showing the presence of both resin ducts (rd) and resin glands (rg) in the portion of the needle fused to the stem...... 52

Figure 2.3. Resin glands in scale leaves. (a) Central scale with visible resin gland. (b) Longitudinal section of an individual scale at the transitional ontogenetic stage with a single resin gland (rg) visible. (c) Longitudinal section of a scale at the transitional stage with a resin gland extends to the tip of the scale. (d) Cross section of the primary shoot at the late stage with resin glands in both the fused leaves (upper glands) and the stem (lower gland). (e) Intact scale leaves at the late stage showing primary (pg) and secondary (sg) resin glands...... 53

Figure 2.4. Morphological change from the needles to scales in the transitional stage. (a) Needle with a single resin duct that is continuous with the stem. (b) Shortened needle with a resin duct that is not continuous with the stem. (c) Further shortened needle with an elongated resin gland. (d) Typical central scale with a predominant medial resin gland...... 54

Figure 2.5. Cross sections of resin storage structures of T. plicata foliage viewed under fluorescent microscopy. (a) Resin duct (rd) from a newly formed needle showing no cell wall fluorescence. (b) Resin duct from a needle that was formed in the early stage in a 1- year-old plant with cell walls showing autofluorescence compared to the cell of the surrounding parenchyma and epidermal tissue. (c) Scale from late stage stained with phloroglucinol-HCL to quench lignin autofluorescence showing a resin gland (rg) with strong cell wall autofluorescence compared to the surrounding lignin autofluoresce of the xylem in the vascular tissue (vt) indicative of the presence of suberin. (d) Stem section from transitional stage showing autofluorescence from the cell walls of resin gland cells, but not from the resin duct cells...... 55

viii

Figure 2.6. Monoterpene content of needles and scales of T. plicata. Total ion chromatograms of monoterpenes extracted from 1-year-old (a) scales and (b) needles. Arabic numeral on peaks represents the following compound: 1 = α-thujene, 2 = α- pinene, 3 = sabinene, 4 = myrcene, 5 = limonene, 6 = α-thujone, and 7 = β-thujone. Nonyl acetate served as an internal standard (IS). (c) Monoterpenes in needles and scales as a percentage of total monoterpenes. (d) Abundance of monoterpenes in needles and scales per g fresh weight. Scales were found to have a significantly higher monoterpene content than needles. In pairs of bars (3 replicates for each pair), an asterisk (*) indicates a statistically significant difference (Student’s paired t-test; ** = p < 0.01, * = p < 0.05)...... 56

Figure 3.2. Anatomical and chemical differences between wild type and variant T. plicata genotypes...... 88

Figure 3.3. Annotations of contigs with tenfold upregulation in the tag profiling dataset...... 89

Figure 3.4. TpSS1 expression localized to the epithelial cells of scale leaf resin glands. . 93

Figure 3.5. GC-MS analysis of products formed in vitro by recombinant contig 788 protein...... 94

Figure 4.1. Proposed biosynthesis pathway of b-thujaplicin (Bentley, 2008) and α-thujone (Croteau 1996)...... 131

Figure 4.2. Terpene synthases from T. plicata identified from the sequenced 454/Roche GS-FLX cDNA library. Reads are the total number of reads that make up the contigs from the 454/Roche cDNA library. T. plicata sabinene synthase-1 (TpSS-1) was represented by a single contig containing 17 read. A, Typical terpene synthases from conifers compared with B, Terpene synthases isolated from T. plicata. Motif depictions adapted from Keeling and Bohlmann (2006)...... 132

Figure 4.3. Partial amino acid alignments of monoterpene synthases from conifer species aligned with TPSS-1, TPS-1, and TPS-2. Ag-Pin is Abies grandis pinene synthase (accession U87909), Co-LIM/BOR is limonene/borneol synthase from Chamaecyparis obtusa (accession AB120957). A, The RRx8W region is common to nearly all monoterpene synthases. B, The DDxxD is common for all mono-, sesqui-, and diterpene synthases. Conserved similarity shading is based on 100% (black), 60% (dark gray), and 30% (light gray)...... 133

Significantly more (p < 0.01) linalool was produced in C as compared to B. Isobutylbenzene (IBB) were added as internal standards...... 134

Figure 4.5. Relative gene expression of A, T. plicata sabinene synthase-1, B, T. plicata terpinolene synthase-1 and C, T. plicata linalool synthase-1 in T. plicata tissues. Mature scale leaves from 1-year-old trees; juvenile needle leaves from 2-4 month old trees; stem from 1-year-old trees; roots from 1-year-old trees; sapwood 1.0-1.5 cm beneath vascular cambium from mature trees with base diameter of 0.8-1m; and wood-forming region from 10-15 years old trees (WFR). Relative gene expression of linalool synthase (LS), terpinolene synthase (TS) and sabinene synthase (SS) in D, mature scale leaves and E, wood-forming region...... 135

Figure 4.6. Total ion chromatograms of monoterpenes extracted from mature T. plicata A, foliage and B, woody stem aeration. Arabic numeral on peaks represents the following compound: 1 = thujene, 2 = α-pinene, 3 = sabinene, 4 = myrcene, 5 = limonene 6 = β- phellendrene, 7 = terpinolene, 8 = α-thujone and 9 = β-thujone. An internal standard (100ng, 10-carbon acetate) was added and detected at 21 minutes for each chromatograph...... 136

Figure 4.7. Phylogenetic tree of the TPS-d family displaying evolutionary relatedness of T. plicata monoterpene synthases to known conifer terpene synthases from Genbank. TpSS-1, TpTS-1 and TpTS-1 group into a new proposed subgroup of TPS-d1 we refer to as TPSd1b. Five letter codes are used for terpene synthesis in the tree. The first two letters show species as follows: Abies bracteata – Ab; Abies grandis – Ag; Chamaecyparis formosensis – Cf; Chamaecyparis obtusa – Co; Picea abies – Pa; Picea sitchensis – Ps; Pinus taeda – Pt; Pseudotsuga menziesii – Pm. The next three letters show terpene product as follows: pinene – PIN; limonene – LIM; linalool – LIN; camphene – CAM; myrcene – MYR; terpinolene – TER; phellodrene – PHE; carene – CAR; farnesene – FAR; longifoliene – LON; selinene – SEL; germacradien-4-ol – GER; longifolene – LON; humulene – HUM; abietadiene – ABI; levopimaradiene – LEV. Branch lengths are a measure of the amount of divergence between two nodes in the tree. The unit of measure for the branches and the scale bar is the number of amino acid substitutions per site...... 137

LIST OF SUPPLEMENTAL FIGURES

Supplemental Figure 3.1. Thujone biosynthesis pathway from Artemisia absinthium, Tanacetum vulgare, and Salvia officinalis (Croteau, 1996)...... 96

Supplemental Figure 3.2. Summary flowchart for terpenoid biosynthesis gene discovery in T. plicata...... 97

Supplemental Figure 3.3. Nucleic acid and predicted amino acid sequence for contig 788 (Thuja plicata (-)-sabinene synthase-1)...... 98

Supplemental Figure 3.4. Nucleic acid and predicted amino acid sequence for contig 9309 (TpP450-L1). The region underlined in black shows QPCR amplified sequence. .. 99

Supplemental Figure 3.5. Nucleic acid and predicted amino acid sequence for contig 33366 (TpP450-L2). The region underlined in black shows QPCR amplified sequence...... 100

Supplemental Figure 3.6. Nucleic acid and predicted amino acid sequence for contig 1534 (TpP450-L3). The region underlined in black shows QPCR amplified sequence. 101

Supplemental Figure 3.7. Nucleic acid and predicted amino acid sequence for contig 5345 putative short chain alcohol dehydrogenase. The region underlined in black shows QPCR amplified sequence...... 102

Supplemental Figure 3.8. Nucleic acid and predicted amino acid sequence for contig 44628 a putative short chain reductase. The region underlined in black shows QPCR amplified sequence. The region highlighted in red shown above the nucleic acid sequence is the primary site for tag alignment...... 103

Supplemental Figure 4.1. Amino acid comparison of Thuja plicata terpinolene synthase-1 (TpTS-1) and Chamaecyparis obtusa terpinolene synthase (CoTS; BAI53108.1). Amino acid identities are 87% matched. Alignment performed using Clustal X2. Black residues show match, white residues show mis-matched amino acids...... 139

LIST OF TABLES

Table 2.1. Summary of leaf phases with respect to ontogeny, predominant monoterpenoid and terpene storage structure in 1-year-old T. plicata...... 57

Table 3.1. Summary of de novo assembled of paired end Illumina sequenced leaf transcriptome from a total of 65 million reads...... 95

Table 4.1. Summary of obtained sequences with similarity to terpene synthase genes. BLASTN results for T. plicata terpene synthase contigs against the NCBI nr data base showing the closest annotated match which associated total bit score and E value. Reads is the number of individual reads for each contig from the 454/Roche cDNA library. .. 138

xii

LIST OF SUPPLEMENTAL TABLES

Supplemental Table 3.1. Primers used in QPCR validation of tag profiling ...... 104

Supplemental Table 3.2. Annotated contig function based on BLAST2GO results...... 105

Supplemental Table 4.1. Genbank accession numbers for select genes shown in the phylogenetic analysis...... 140

xiii

1. INTRODUCTION & LITERATURE REVIEW

1.1 Thuja plicata Donn ex Don

1.1.1 Ecology and morphology

T. plicata, commonly known as western redcedar, is an ecologically, culturally, and economically important tree species in the Pacific Northwest region of the United

States of America and the province of British Columbia in Canada. Knowledge of T. plicata’s anatomy, range, associated plants, herbivorous animals, and forest management practices were extensively reviewed by Minroe (1983) and Gonzalez (2004), and these works should be viewed for further information on this species. These trees can grow to heights in excess of 65 m and base diameters in excess of 4 m, and live over 1000 years

(Farjon, 2005). T. plicata is often observed with multiple associated tree and herb species in its natural ecosystem (Minroe, 1983). There are two distinct regions within the range of T. plicata, a coastal population from California to Alaska that includes island populations on all major coastal islands and a disconnected interior population that ranges from eastern Montana and northern Idaho to eastern British Columbia near the Alberta border (Minroe, 1990). This species grows at altitudes from sea level to as high as 2300 m, but the elevation is more limited at the northern extent of the range (Minroe, 1983).

The natural range of T. plicata stretches from south eastern Alaska to northern California

(Minroe, 1983; Minroe, 1990). In Oregon and Washington states, the range widens inland into the cascade mountain range. The most closely related species to T. plicata is Thuja occidentalis, which has a natural distribution in the northeast region of North America

(Johnston, 1990).

T. plicata is a member of the family Cupressaceae and shares many morphological traits in common with other species in this family. Following seed germination, T. plicata produces two cotyledons followed by the formation of needle-like foliage that grows in groups of 4. All members of the family Cupressaceae are known to produce awl-shaped (subulate) needle-like leaves early in development (Suzuki, 1979).

After a short period of needle production, T. plicata trees transition to produce smaller scale-like leaves from the primary and secondary shoots, which become the dominant type of foliage (Minroe, 1983). Each unit of scales is flattened and characterized by a darker sun side and a lighter coloured shade side (Minroe, 1983). The woody stems of mature trees have long straight grey coloured thin bark that can be easily torn off in long strips (Minroe, 1983; Turner, 2010). Mature stems possess two types of wood: sapwood and heartwood. Heartwood is easily identified in wood by strong colour variations in the wood ring patterns (Minroe, 1983; Gonzalez, 2004). The inner heartwood has a much lower moisture saturation point than sapwood (Gonzalez, 2004). Heartwood of T. plicata contains deposits of antibacterial compounds referred to generally as tropolones and lignans that are known to contribute to the wood’s natural durability (DeBell et al., 1999).

1.1.2 Herbivores of T. plicata

Insect damage in T. plicata is typically not an issue in silviculture, although several insect species do feed on its seeds, foliage and wood. Seeds of T. plicata are not commonly fed upon by birds or small mammals, which seem to prefer seed food sources from other associated tree species (Gashwiler, 1967). The insect pest Mayetiola thujae, commonly known as the western redcedar cone midge, is a major pest infecting seed

2 cones in both wild stands and T. plicata nurseries (Hedlin, 1964). Without appropriate control measures and management strategies, M. thujae is known to infect up to 100% of

T. plicata seed cones in nurseries (Hedlin, 1964). The bark beetles, Phoesosinus punctatus and P. sequiae have been reported to cause extensive damage to T. plicata trees, but typically only weaken or kill trees growing at non-optimal locations. The western redcedar wood borer, Trachykele blondeli, can damage heartwood of T. plicata trees, lowering the value of the harvested wood (Minroe, 1983). Defoliating insects can also cause limited damage to T. plicata stands, and different defoliating species have been observed to cause damage in different parts of the geographical range (Minroe, 1983).

Foliage of T. plicata acts as a major food sources for some mammals, especially ungulate species such as deer and elk (Martin and Daufresne, 1999; Vourc’h et al., 2001;

Martin and Baltzinger, 2002; Vourc’h et al., 2002a; Vourc’h et al., 2002c). The introduction of Sitka black-tailed deer (Odocoileus hemionus sitkensis) to Haida Gwaii

(formerly the Queen Charlotte Islands) has played a primary role in preventing the regeneration of T. plicata in forested stands (Stroh et al., 2008). Also, black bear (Ursus americanus) are known to feed on the sapwood of mature trees after stripping off the tree’s bark (Radwan, 1969). Breeding of T. plicata trees for improved resistance to ungulate browsing is a major ongoing goal of the British Colombia Ministry of Forests plant improvement program (Russell, 2008).

1.1.3 Diseases of T. plicata

T. plicata is less susceptible to microbial pathogens than most other tree species, but a number of fungal pathogens use this tree as a host (Minroe, 1983). The most

3 damaging disease in T. plicata seedlings is Keithia blight caused by the fungal pathogen

Didymascella thujina (Kope and Sutherland, 1994). This pathogen is known to infect the foliage of T. plicata throughout its geographic range and cause severe damage in nurseries where management practices are not taken. Keithia blight can be adequately controlled in nurseries through management practices and fungicide application (Trotter et al., 1994).

Woody stems of mature T. plicata are resistant to decay by fungi, at least partially, due to the presence of antimicrobial tropolones and lignans within the heartwood (DeBell et al., 1999; Daniels and Russell, 2007). It is believed that successive fungal invasion degrades tropolones and other antimicrobial compounds, eventually resulting in unprotected wood that is degraded from the centre outwards (Van der Kamp,

1986). Some fungi, such as Sporothrix spp., have the ability to degrade these tropolones into non-toxic intermediates. This allows for the colonization of the heartwood by the fungal species Kirsteiniella thujina and Phialophora spp., which in turn facilitate further colonization by Ceriporiopsis rivulosa, the causal agent of wood white rot (Allen et al.,

1996). Wood rooting fungi species are different throughout the geographical range of T. plicata with Poria asiatica implicated as the most damaging species in both coastal and interior British Columbia (Minroe, 1983). Wood rotting fungi can lead to the hollowing of mature wild stand trees, which reduces the available volume of wood for harvest

(Minroe, 1983).

1.1.4 Culture and economic importance of T. plicata

T. plicata is culturally important to the First Peoples in north-western North

America. The dimensionally stability and durability of T. plicata wood made it a highly suitable material for the construction of dugout canoes. T. plicata is also used as building materials for houses and boxes as well as numerous tools. Oils extracted from leaves and wood are also used in traditional medicines (Gonzales, 2004; Turner, 2010). Many of the traditional uses of T. plicata do not involve felling individual trees, but rather removal of needed materials, such as bark for basket weaving or planks for the construction of homes, leaving behind a live, growing, but culturally modified tree (Turner, 2010).

Because of its enourmous cultural value for First Peoples, who have extensively used T. plicata for centuries in all aspects of their lives and because of its important economic and ecological value for BC, T. plicata has been officially named BC’s provincial tree.

Although grown in a limited area, T. plicata is also an economically important timber tree, used for production of lumber that is one of the most highly valued softwood in Canada (Pricing Branch, Ministry of Forests, Mines and Lands 2011). The wood is prized for its aesthetics, dimensional stability and natural durability, making it exceptionally suitable for outdoor applications such as decking, furniture, wall and roof shingles (Gonzales, 2004). T. plicata wood is widely used for shakes and shingles in roofing, and is preferred due to its durability and insulating qualities; and one study found that 2.54 cm of T. plicata wood possessed the insulating qualities of 30 cm of concrete

(O’Hea, 1947). Although T. plicata wood is widely regarded as being highly resistant to wood rotting fungi, the leaching out of natural protective chemical compounds, particularly in second growth trees, can lead to a large reduction in the natural decay

5 resistance. Chemical leaching can be dramatically reduced by pressure treatment of wood with copper, chromium, and arsenic additives that prevent the migration of tannins

(Stirling and Morris, 2010). T. plicata wood is also reported as being termite resistant, but this is highly dependent on the termite species present and micro-environmental conditions (Mannesmann, 1973). Extracted T. plicata leaf and wood oils are also of commercial importance. Leaf oils are used to produce perfumes, insecticides, soaps, deodorants and shoes polishes, while wood oils have medicinal uses due to its antimicrobial and antifungal properties (Minroe, 1983; Sanada et al., 2000).

1.2 Problems with the utilization of T. plicata related to monoterpenoid content

T. plicata silviculture faces two major problems. The first problem is the high level of herbivory by ungulates on replanted T. plicata saplings that add a cost of $20 to

$25 million to T. plicata reforestation efforts each year in BC (Russell, 2008). The second major problem is the susceptibility to wood rot in managed forests because, although old- growth T. plicata was regarded as highly resistant, second growth tree populations appear to have a larger degree of variability in heartwood rot resistance, especially in the interior of BC (DeBell et al., 1999; Daniels and Russell, 2007). The cause of this discrepancy is unknown. Both of these problems are linked to the levels of monoterpenoids in T. plicata plants.

1.2.1 Ungulate browsing deterrence

There is evidence for a strong negative correlation between the overall monoterpenoid content in T. plicata foliage and degree of damage caused by ungulate

6 browsing (Vourc’h et al., 2002a; Vourc’h et al., 2002c). This correlation is the basis for efforts by the BC Ministry of Forests to breed T. plicata to improve ungulate browsing deterrence by increasing the overall foliar terpenoid content (Russell, 2008).

The chemical composition of terpenoids in T. plicata foliage is complex and it is unclear which specific monoterpenes deter deer herbivory. However, a feeding choice experiment, where apples were coated with different monoterpenes present in T. plicata, identified α- and β-thujone as the strongest deterrents to deer feeding (Vourc’h et al.,

2002b). The monoterpenoids, α- and β-thujone, are typically the most abundant monoterpenes in T. plicata foliage (Kimball et al., 2005).

1.2.2 Heartwood rot resistance

Resistance to rot in heartwood of T. plicata is strongly related to the abundance of tropolones, specifically β- and γ-thujaplicin (DeBell et al., 1999; Russell and Daniels,

2007). Tropolones are classified as a group of antimicrobial ten carbon compounds with a seven carbon ring derived from monoterpenes. In T. plicata, five tropolones have been identified with β-thujaplicin, γ-thujaplicin and β-thujaplicinol making up 98% total tropolone content. The tropolones α-thujaplicin and β-dolabrin represent the remaining

2% of the tropolone content (Daniels and Russell, 2007). Tropolones are distributed throughout the heartwood of the tree with the highest amount found adjacent to the sapwood near the base of the tree and the lowest amounts found near the pith (Swan and

Jiang, 1970; DeBell et al., 1999).

1.3 Terpenoids

Terpenoids are the most diverse group of secondary metabolites in plants with well over 36,000 compounds classified to date (Langenheim 1994; Dudareva et al., 2004;

Ashour et al., 2010). Terpenes are produced from C5 isoprene units and classified based on the number of isoprene units they contain into C5 hemiterpenes, C10 monoterpenes, C15 sesquiterpenes, C20 diterpenes, C25 sesterterpenes, C30 triterpenes, C40 tetraterpenes and polyterpenes, which are composed of more than 8 isoprenoid units (Ashour et al., 2010).

The wide variety of these terpenoid compounds is attributed to the subsequent modification of terpenes after their assembly (Ashour et al., 2010). These compounds play important roles in processes such as the attraction of pollinators and other beneficial insects (Sharkey and Yeh, 2001; Pichersky and Gershenzon, 2002), deterrence of herbivory through odour and direct toxicity (Vourc’h et al., 2002a; Vourc’h et al., 2002c;

Unsicker et al., 2009) and protection against abiotic stress (Vickers et al., 2009).

Terpenoids are produced in vegetative, reproductive, root and seed tissues (Dudareva et al., 2004). Extensive review articles and book chapters are available that summarize terpenoid biosynthesis, volatilization and roles in plant growth, flowering, pollination and defense (Croteau, 1987; Langenheim, 1994; Bohlmann et al., 1998; Phillips and Croteau,

1999; Sharkey and Yeh, 2001; Pichersky and Gershenzon, 2002; Dudareva et al., 2004;

Keeling and Bohlmann, 2006; Degenhardt et al., 2009; Unsicker et al., 2009; Vickers et al., 2009; Ashour et al., 2010; Lichtenthaler, 2010). This review focuses on monoterpene biosynthesis and biochemistry as monoterpenes are the precursors to the key T. plicata defensive monoterpenoids: the thujones and thujaplicins.

1.3.1 Evolution and features of terpene synthases

The biosynthetic pathway of mono-, sesqui- and diterpenes in plants is summarized in Figure 1.1 (Keeling and Bohlmann, 2006). Terpenes are formed from their precursors by a related group of enzymes called terpene synthases. Terpene synthases are

550 to 850 amino acid (aa) long peptides that have molecular masses from 50 to 100 kDa

(Bohlmann et al., 1998). Gymnosperm terpene synthases contain two distinct structural domains: an N-terminal domain and a C-terminal active site domain. The N-terminal domain of monoterpene and diterpene synthases contains a 50 to 70 aa plastidial targeting region with a large number of serine and threonine residues, and few acidic aa residues.

The N-terminal region functions in targeting the protein to plastids, such as chloroplasts or leucoplasts, and is not present in sesquiterpene synthases (Bohlmann et al., 1998;

Keeling and Bohlmann, 2006). Diterpene synthases are larger than monoterpene synthases due to a conserved 210 aa N-terminal region of unknown function (Bohlmann et al., 1998; Keeling and Bohlmann, 2006). All gymnosperm terpene synthases contain two highly conserved motifs, a RRX8W motif and a DDXXD motif (Bohlmann et al.,

1998; Keeling and Bohlmann, 2006). The RRX8W is found after the N-terminal targeting region in monoterpene and diterpene synthases and may define the N-terminus of the functional part of the proteins. The DDXXD motif is part of the active site and serves as one of two major divalent cation binding sites on the protein (Bohlmann et al., 1998).

Some diterpene synthases, such as abietadiene synthase in grand fir (Abies grandis), possess two active sites, with an additional conserved DXDD motif at the N-terminal region, which mediates the cyclization of GGPP (Peters et al., 2001).

Gymnosperm and angiosperm monoterpene synthases are similar, but have some important functional differences. Both groups of enzymes contain a hydrophobic pocket made up of six α-helixes that act as the active site in the C-terminal (Bohlmann et al.,

1998; Degenhardt et al., 2009). However, gymnosperm monoterpene synthases also require a monovalent cation and have a higher affinity for Mn2+ over Mg2+ as the divalent cation (Bohlmann et al., 1998). To date, many monoterpene synthases have been cloned and characterized from different species in all major plant groups (Degenhardt et al.,

2009).

The terpene synthase gene family in plants is divided into seven subfamilies, TPS- a to TPS-g, (Bohlmann et al., 1998; Trapp and Croteau, 2001; Martin et al., 2004). All known gymnosperm terpene synthases are grouped into the TPS-d subfamily, which is further subdivided into three evolutionary groups: TPS-d1, made up of monoterpene and sesquiterpene synthases, TPS-d2, made up of sesquiterpene synthases and TPS-d3, made up of diterpene synthases (Martin et al., 2004). Most known gymnosperm terpene synthases are from species in the family Pinaceae, though a few are from species from the families Ginkgoaceae, Taxaceae (Martin et al., 2004) and Cupressaceae (Chu et al.,

2009). Prior to this thesis, no terpene synthases has been reported in T. plicata.

1.3.2 Production of terpenoid precursors

Plant terpenoids are produced from the universal precursors isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP) (Reviewed in Lichtenthaler,

2010). These precursors are produced from both the mevalonate (MVA) pathway and methyl-erithritol phosphate (MEP) pathway. The MVA pathway, present in the

10 cytoplasm of all eukaryotic cells, starts with the condensation of acetyl CoA to form acetoacetyl-CoA, which is catalyzed by thiolase enzymes. 3-hydroxy-3-methylglutaryl-

CoA (HMG-CoA) synthases then catalyzes the formation of HMG-CoA from acetyl CoA and acetoacetyl-CoA. HMG-CoA is thereafter reduced to mevalonate by HMG-CoA reductase using NADPH as an electron donor. Mevalonate is diphosphorylated to form 5- diphosphomevalonate by two reactions catalyzed by mevalonate kinase and phosphomevalonate kinase. IPP is formed from 5-diphosphomevalonate by a reaction catalyzed by mevalonate-5-pyrophosphate decarboxylase.

The first substrates of the MEP pathway are pyruvate and glyceraldehyde 3- phosphate. These two substrates are combined to form 1-deoxy-D-xylulose 5-phosphate

(DOXP) by the enzyme DOXP synthase. DOXP is then reduced by DOXP reductase to form MEP, which is converted to IPP through five additional intermediate steps catalyzed by the enzymes 4-diphosphocytidyl-2-C-methyl-D-erythritol synthase, 4- diphosphocytidyl-2-C-methyl-D-erythritol kinase, 2-C-methyl-D-erythritol 2,4- cyclodiphosphate synthase, 4-hydroxy-3-methyl-but-2-enyl pyrophosphate synthase, and

4-Hydroxy-3-methyl-but-2-enyl pyrophosphate reductase. IPP produced from both the

MVA and MEP pathways can be converted to its isomer DMAPP catalyzed by the enzyme IPP isomerase (Reviewed in Lichtenthaler, 2010).

Experiments using radiolabelling of precursors in the MVA and MEP pathways show significant levels of cross-talk between the two pathways. Mono- and diterpenes were found to be produced in the plastids from IPP produced from the MEP pathway, while sesquiterpenes are produced in the cytosol from MVA pathway-derived IPP

(Lichtenthaler, 2010). However, a significant amount of sesquiterpenes in the cytosol are

11 produced from MEP pathway-derived IPP. A small amount of diterpenes are produced from MVA pathway-derived IPP mediated by the transport of IPP through the plastid envelope (Hemmerlin et al., 2003; Hampel et al., 2005; Lichtenthaler, 2010).

Following production of IPP in the MEP and MVA pathways, prenyl transferases condense IPP and DMAPP into geranyl diphosphate (GPP), farnesyl diphosphate (FPP), and geranylgeranyl diphosphate (GGPP), the precursors of mono-, sesqui- and diterpenes respectively. The three terpene precursors are produced from a different number and composition of isoprene units. GPP is produced from one IPP and one DMAPP, FPP is from one IPP and two DMAPP, and GGPP is produced from three IPP and one DMAPP by geranyl diphosphate synthase, farnesyl diphosphate synthase, and geranylgeranyl diphosphate respectively (Phillips and Croteau, 1999; Trapp and Croteau, 2001).

1.3.3 Biosynthesis of monoterpenes

The natural substrate for monoterpene biosynthesis is GPP, though monoterpene synthases are capable of using the substrates neryl diphosphate and linalyl diphosphate

(LPP) under laboratory conditions (Croteau, 1987). The biosynthesis of monoterpenes from GPP requires both isomerization and cyclization steps (Figure 1.2). The isomerization is required as GPP cannot be directly converted into a six carbon-ringed monoterpene because of the C2-C3 double bond adjacent to the diphosphate group

(Croteau, 1987; Degenhardt et al., 2009). Monoterpene synthases utilize free divalent metal ion cations, such as Mn2+, to disrupt the C2-C3 double bond resulting in the formation of monoterpene synthase bound 3R (clockwise)- or 3S (sinister; counter clockwise)-LPP. This enzyme-bound molecule is rotated to a cisoid conformation,

12 allowing LPP to be ionized and be cyclized into either 4R or 4S terpinyl cations. The terpinyl cations then serve as the intermediate for most of the varieties of monoterpene structures that are present in plants (Bohlmann et al., 1998; Degenhardt et al., 2009).

Structural variations between different monoterpene synthases can allow an additional cyclization of the terpinyl cation structure through the second C6-C7 double bond, or hydride shifts to form terpinene-3-yl or terpinene-4-yl. Oxygenated monoterpenes, such as α-terpineol, can form from water capture of the terpinyl cations (Croteau, 1987;

Bohlmann et al., 1998). Figure 1.2A shows an example of the biosynthesis of multiple monoterpenes from GPP due to modifications of the terpinyl cations. The monoterpene sabinene is produced from a 6,7-hydride shift of the α-terpinyl cation to form the terpenen-4-yl cation, that undergoes 2,6 closure to form the bicyclic thujyl cation, which undergoes deprotonation to form the final sabinene product (Degenhardt et al., 2009).

Some monoterpene synthases produce acyclic monoterpene products such as linalool and myrcene. Acylic monoterpenes can form from either geranyl or linalyl cations (Figure

1.2B; Degenhardt et al., 2009). Non-oxygenated acyclic monoterpenes, such as myrcene can form through deprotonation, while oxygenated monoterpenes such as linalool can form through water capture (Degenhardt et al., 2009). A number of monoterpenes synthases have the capability to produce multiple products, for example bornyl diphosphate synthase from sage (Salvia officinalis), which in addition to bornyl diphosphate also produces α-pinene, camphene, and limonene in significant amounts

(Wise et al., 1998; Degenhardt et al., 2009).

1.3.4 Terpene storage in plants

A wide variety of terpenoid storage structures exist in different plant species, including peltate glandular trichomes, resin ducts and resin glands (Fahn, 1979). The site of monoterpene and diterpene biosynthesis is the unpigmented leucoplasts of the secretory cells present within the storage structures (Gleizes et al., 1983; Cheniclet and

Carde, 1985; Charon et al., 1986; Tuner et al., 1999). Following production in leucoplasts, monoterpenes are transferred to the endoplasmic reticulum through connection points between the two cellular components (Turner et al., 2000). In the endoplasmic reticulum, the monoterpenes can be further modified by enzymes, such as cytochrome P450 hydroxylases, before being secreted into secretory storage cavities

(Croteau et al., 2005).

1.3.5 Biosynthesis of α- & β-thujone

The key foliar monoterpenoids implicated in the deterrence of ungulate browsing in T. plicata are α-thujone and its isomer β-thujone (Vourc’h et al., 2002b). There is no information currently available on the biosynthesis of thujones in gymnosperm species.

However, the biosynthetic pathway of α- and β-thujone is resolved in sage, though the individual genes are yet to be identified. In sage, the monoterpene sabinene is the precursor to α- and β-thujone (Figure 1.3; Dehal and Croteau, 1987). Following sabinene biosynthesis, three additional steps are needed to generate α-thujone. Partial purification of proteins from leaf tissue microsomes catalyze the NADPH and O2 dependent hydroxylation of (+)-sabinene to (+)-cis-sabinol (Karp et al., 1987). The enzyme, (+)-cis- sabinol dehydrogenase, catalyzes the formation of sabinone, which then undergo

NADPH-dependent stereoselective reduction, catalyzed by a reductase enzyme, to form either α- or β-thujone (Figure 1.3; Dehal and Croteau, 1987).

1.3.6 Biosynthesis of β-thujaplicin

There is no published information about the biosynthesis of thujaplicins in T. plicata, but work on cell cultures from a Mexican cypress (Cupressus lusitanica) pinpointed the monoterpene terpinolene as the precursor for β-thujaplicin, one of the three major tropolones in T .plicata (Bentley, 2008). Similarly, experiments with radiolabelled glucose showed that the GPP precursor is primarily produced from the MEP pathway (Zhoa et al., 2001). The monoterpenoid (1S,2S,6S)-(+)-1,6-epoxy-4(8)-p- menthen-2-ol, identified in cell cultures of C. lusitanica, is a likely intermediate in β- thujaplicin biosynthesis (Matsunaga et al., 2003). The 7 carbon ring of tropolone compounds is formed by expansion of the 6 carbon ring from a monoterpene precursor

(Xin and Bugg, 2010). Treatment of monoterpenes with the non-haem iron(II)-dependent extradiol catechol dioxygenase enzyme from E. coli resulted in the formation of a tropolone ring-expansion (Xin and Bugg, 2010). A putative pathway for the biosynthesis of β-thujaplicin from GPP was generated, where GPP is cyclized to terpinolene and modified by an unknown number of steps to (1S,2S,6S)-(+)-1,6-epoxy-4(8)-p-menthen-2- ol, which undergoes ring expansion and an unknown number of steps to form β- thujaplicin (Figure 1.3; Dehal and Croteau, 1987; Bentley, 2008). No published information on the biosynthesis of γ-thujaplicin or β-thujaplicinol was found for this review.

1.4 Gene discovery in conifers

The identification of genes in conifers is challenging. To date, no conifer genome has been sequenced, making rapid gene identification difficult. Gymnosperm genomes are large making them problematic to sequence (6.5 to 37 gigabases depending on the species; Ahuja and Neale, 2005). Moreover, these genomes are estimated to be composed of approximately 75% repeat regions (Ahuja and Neale, 2005), which poses problems for shotgun based genome assembly (Venter et al., 1998). The genome sequencing of the conifers Pinus taeda and Picea abies are currently underway, but results are not expected for many years (Neale and Kremer, 2011). Even when these genome sequencing projects are complete, the data may only have minimal use in the identification of genes in T. plicata and other members of the Cupressaceae family.

A more realistic approach for the identification of genes in conifers is sequencing of RNA-derived complementary DNA (cDNA). A standard approach to cDNA sequencing is to produce random double stranded cDNA from messenger RNA (mRNA) extracted from a target tissue. This cDNA is then ligated into an appropriate plasmid and clonally propagated in Escherichia coli. Plasmids containing random cDNA inserts are isolated from E. coli and sequenced using a Sanger sequencing approach (Sanger et al.,

1977; Allona et al., 1998). Typically, only the cDNA ends are sequenced, as this sequence usually provide enough information for a first annotation based on similarity to genes with known functions (Cairney et al., 2006; Ralph et al., 2008).

In Pinaceae, cDNA sequencing was used to identify hundreds of thousands of expressed sequenced tags (EST) in a number of species. Conifer EST sequencing projects have typically focused on identifying genes in wood-forming tissues, and genes involved

16 in abiotic stress, insect defense, seed embryogenesis, and root development (Kirst et al.,

2003, Lorenz et al., 2006, Cairney et al., 2006, Ralph et al., 2006, Ralph et al., 2008).

Over 6000 full length cDNA sequences have also been sequenced in Picea sitchensis, which are more useful for gene discovery than ESTs as they contain the sequence from the entire mRNA (Ralph et al., 2008). In Cupressaceae, ESTs were generated from

Cyrtomeria japonica and Chamaecyparis obtusa with over 5000 and 3000 unique gene sequences identified respectively (Ujino-Ihara et al., 2005). However, no EST projects have been conducted on T. plicata, and prior to this work, only 16 cDNA sequences were publicly available (accessions: AF487405, AY699211, AF210070, AF210069,

AF210068, AF210067, AF210066, AF210065, AF210064, AF210063, AF242500,

AF242506, AF242505, AF242504, AF242503, X64833).

The ability to discover genes in non-model organisms greatly improved with the development of next generation sequencing technologies (NGS). The first advancement came with the development of real time pyrosequencing (Ronaghi et al., 1998) in picoliter volume plates with millions of individual wells by 454 Life Sciences, commercially released in 2004 (now a subsidiary of Roche Applied Sciences; Margulies et al., 2005). This technology was closely followed by the 2005 release of another sequence by synthesis method using reversible terminators by Solexa Inc. (now Illumina

Inc.; Bennet, 2004). In 2007, Applied Biosystems commercially released the Sequencing by Oligonucleotide Ligation and Detection (SOLiD) platform that uses ligation of fluorescently labelled oligonucleotides to target single-stranded DNA sequences as a method to determine the DNA sequence (reviewed in Mardis, 2008). NGS technologies provide high-throughput sequencing by running millions of parallel automated, PCR-

17 based cloning reactions followed by simultaneous automated recording of equally numerous sequencing-by-synthesis events. Sequencing technologies have recently been improved further by modifications allowing sequencing from both ends of DNA fragments. In addition to doubling the amount of obtained DNA sequence, the use of paired-end reads allow for improved sequence assembly with short read length technologies as non-overlapping reads can be grouped together (Morozova and Marra,

2008).

To date, gene discovery through transcriptome analysis utilizing NGS technology have been published for over forty five non-model eukaryotic species (Ekblom and

Galindo, 2010). Among these different organisms are several tree species including Taxus cuspidata, a species that had very few ESTs previously characterized like T. plicata. In the transcriptome dataset of T. cuspidata, over 20,000 unique gene sequences were identified and of these, 70% were assigned functional annotations (Wu et al., 2011).

Large scale differential gene expression analysis can be used to identify genes being expressed in different tissues or as a consequence of various stress treatments.

Microarray hybridization is currently the standard approach to large scale differential gene expression analysis. One example in conifer research is the identification of genes involved in insect herbivory responses in P. sitchensis (Ralph et al., 2006). The P. sitchensis microarray contains many thousands of specific DNA spots that are used to hybridize with and interrogate RNA-derived cDNA populations. However, microarrays require prior knowledge of target genes, which is not available for T. plicata.

A newer method of gene expression profiling using NGS is referred to as ribonucleic acid sequencing (RNA-Seq). Fragmented cDNA can be sequenced using the

NGS platforms, and then the sequenced reads are aligned to a reference sequence or assembled de novo to form a gene expression library (Wang et al., 2009). Expression differences between genes are determined by comparing the number of reads that map to each gene in a reference library or each de novo assembled contiguous sequence (contig).

This method can provide accurate expression levels of a large variety of genes simultaneously. RNA-Seq does not require previous knowledge of the target species genome or microarray resources, making this method useful for studying gene expression in non-model organisms (Wang et al., 2009).

A modified version of RNA-Seq involves the sequencing of individual unique short tags from each transcript and is referred to as tag profiling. cDNAs are cleaved with specific endonucleases, which are frequent DNA cutters. Following fragmentation, an adapter that contains an endonuclease recognition site, is ligated to the 5’ end of the cut cDNA. The enzyme is used to cut 16 base pairs downstream of this recognition site, generating a short tag 21bp, which NGS adapters are ligated to for sequencing. This method produces a single unique tag close to the 3’ end of each cDNA sequence, which can be aligned to genes in a reference library and counted to quantify expression. This method allows for much deeper transcript profiling than RNA-Seq and requires less sequencing information for accurate quantification, but requires prior knowledge of the target species genome or transcriptome to determine tag identities (Matsumura et al.,

2010).

1.5 Formulation of research goals

1.5.1 Major hypotheses

1. There may be ontogenetic changes in T. plicata foliar terpenoid biology.

2. Genes involved in thujone biosynthesis can be identified by differential gene

expression analysis of cDNA from T. plicata plants with large differences in foliar

terpenoid profiles.

3. Terpene synthase encoding genes from T. plicata can be identified by high-

throughput NGS of RNA-derived cDNA from different tissues.

1.5.2 Objectives relevant to hypothesis 1

Rationale: T. plicata has two different resin storage structures: resin ducts in needle-like foliage and resin glands in scale-like foliage (Suzuki, 1979). There is a large gap in the literature regarding the differences both structurally and chemically between these tissues. An understanding of the dynamics of terpene biology in developing T. plicata plants may aid the planned molecular genetic analysis of terpene synthase-encoding genes and avoid confusion caused by misinformed sampling.

Major Objectives

1. Identify and characterize terpenoid storage structures in leaves of T. plicata at

different ontogenetic ages.

2. Determine terpenoid profiles associated with different ontogenetic stages of resin

storage structures.

1.5.3 Objectives relevant to hypothesis 2

Rationale: The BC Ministry of Forests have an established breeding program to enhance the terpenoid content of T. plicata. In their work, they have identified variant T. plicata breeding lines that do not produce foliar monoterpenes. Differential gene expression analysis of cDNA produced from variant and wild-type plants could be useful for identifying terpene synthase genes, and genes involved in terpenoid modification.

Major Objectives

1. Generate a transcriptome for T. plicata foliage by sequencing pooled cDNA

produced from leaves of the variant and wild type plants using Illumina

technology.

2. Assemble contigs from the sequenced reads and use them as templates for

differential gene expression analysis.

3. Use Illumina tag profiling to identify genes with higher levels expression in the

wild type over the variant plants.

4. Annotate the differentially expressed genes by comparing them to known gene

databases to identify potential terpene biosynthesis and terpene modifying genes.

1.5.4 Objectives relevant to hypothesis 3

Rationale: At the start of this project, 454/Roche pyrosequencing of cDNA had successfully been used for transcriptome sequencing in a few eukaryotic species including corn (Zea mays), in which a large fraction of known cDNAs and some novel cDNAs were identified (Emrich et al., 2006). Based on these successes, a similar

21 approach was deemed appropriate for large scale discovery of terpene synthase encoding genes in T. plicata.

Major Objectives

1. Generate a transcriptome library for T. plicata by sequencing cDNA produced

from various tissues using 454/Roche pyrosequencing.

2. Identify putative terpene synthase encoding contigs in the library based on

sequence similarity to known terpene synthase genes from other conifers.

3. Obtain full length terpene synthase cDNAs by 5’ and 3’ rapid amplification of

cDNA end.

4. Characterize functional activity of encoded proteins by in vitro functional analysis

of recombinant proteins.

1.6 References

Ahuja M.R., and Neale D.B. (2005). Evolution of genome size in conifers. Silvae Genet. 54: 126-137.

Allen, E.A., Morrison, D.J., and Wallis, G.W. (1996). Common tree diseases of British Columbia. Natural Resources Canada. Canadian Forest Service. p. 178.

Allona, I., Quinn, M., Shoop, E., Swope, K., Cyr, S.S., Carlis, J., Riedl, J., Retzel, E., Campbell, M.M., and Sederoff, R. (1998). Analysis of xylem formation in pine by cDNA sequencing. Proc .Natl. Acad. Sci. 95: 9693-9698.

Ashour, M., Wink, M., and Gershenzon, J. (2010). Biochemistry of Terpenoids: Monoterpenes, Sesquiterpenes and Diterpenes. Annual Plant Reviews Volume 40: Biochemistry of Plant Secondary Metabolism, Second Edition (ed M. Wink), Wiley- Blackwell, Oxford, UK.

Bennett, S. (2004). Solexa Ltd. Pharmacogenomics. 5: 433-438.

Bentley, R. (2008). A fresh look at natural tropolonoids. Nat. Prod. Rep. 25: 118-138.

Bohlmann, J., Meyer-Gauen, G., and Croteau, R. (1998). Plant terpenoid synthases: Molecular biology and phylogenetic analysis. Proc. Natl. Acad. Sci. 95: 4126-4133.

Cairney, J., Zheng, L., Cowels, A., Hsiao, J., Zismann, V., Liu, J., Ouyang, S., Thibaud-Nissen, F., Hamilton, J., Childs, K., Pullman, G.S., Zhang, Y., Oh, T., and Buell, C.R. (2006). Expressed sequence tags from loblolly pine embryos reveal similarities with angiosperm embryogenesis. Plant Mol. Biol. 62: 485-501.

Charon, J., Launay, J., and Vindt-Balguerie, E. (1986). Ontogenèse des canaux sécréteurs d'origine primaire dans le bourgeon de pin maritime. Can. J. Bot. 64: 2955- 2964.

Cheniclet, C., and Carde, J.P. (1985). Presence of leucoplasts in secretory cells and of monoterpenes in the essential oil: a correlative study. Israel J. Bot. 34: 219-238.

Chu, F.H., Kuo, P.M., Chen, Y.R., and Wang, S.Y. (2009). Cloning and characterization of α-pinene synthase from Chamaecyparis formosensis Matsum. Holzforschung. 63: 69-74.

Croteau, R.B., Davis, E.M., Ringer, K.L., and Wildung, M.R. (2005). (−)-Menthol biosynthesis and molecular genetics. Naturwissenschaften. 92: 562-577.

Croteau, R. (1987). Biosynthesis and Catabolism of Monoterpenoids. Chem. Rev. 87: 929-954.

Daniels, B., and Russell, J.H. (2007). Analysis of western redcedar heartwood components by HPLC as a possible screening tool for trees with enhanced natural durability. J. Chromatogr. Sci. 45: 281-285.

DeBell, J.D., Morell, J.J., and Gartner, B.L. (1999). Within stem variation in tropolone content and decay resistance of second-growth western redcedar. Forest Sci. 45: 101- 107.

Degenhardt, J., Köllner, T.G., and Gershenzon, J. (2009). Monoterpene and sesquiterpene synthases and the origin of terpene skeletal diversity in plants. Phytochemistry. 70: 1621-1637.

Dehal, S.S., and Croteau, R. (1987). Metabolism of monoterpenes: specificity of the dehydrogenases responsible for the biosynthesis of camphor, 3-thujone, and 3- isothujone. Arch. Biochem. Biophys. 258: 287-291.

Dudareva, N., Pichersky, E., and Gershenzon, J. (2004). Biochemistry of plant volatiles. Plant Physiol. 135: 1893-1902.

Ekblom, R., and Galindo, J. (2010). Applications of next generation sequencing in molecular ecology of non-model organisms. Heredity. 107: 1-15.

Emrich, S.J., Barbazuk, W.B., Li, L., and Schnable, P.S. (2007). Gene discovery and annotation using LCM-454 transcriptome sequencing. Genome Res. 17: 69–73.

Fahn, A. (1979). Secretory tissues in plants. Academic Press, London, UK.

Farjon, A. (2005). Monograph of Cupressaceae and Sciadopitys. Royal Botanic Gardens, Kew, England.

Gashwiler, J.S. (1967). Conifer seed survival in a western Oregon clearcut. Ecology. 48: 431-438.

Gleizes, M., Pauly, G., Carde, J.P., Marpeau, A., and Bernard-Dagan, C. (1983). Monoterpene hydrocarbon biosynthesis by isolated leucoplasts of Citrofortunella mitis. Planta, 159: 373-381.

Gonzalez, J.S. (2004). Growth Properties and Uses of Western red cedar. Forintek Canada Corp. Special Publication No SP-37R.

Hampel, D., Mosandl, A., and Wust, M. (2005). Biosynthesis of mono- and sesquiterpenes in carrot roots and leaves (Daucus carota L.): metabolic cross talk of cytosolic mevalonate and plastidial methylerythritol phosphate pathways. Phytochemistry. 66: 305-311.

Hedlin, A.F. (1964). Life history and habits of a midge, Phytophaga thujae Hedlin (Diptera: Cecidomyiidae) in western red cedar cones. Can. Entomol. 96: 950-957.

Hemmerlin, A., Hoeffler, J.F., Meyer, O., Tritsch, D., Kagan, I.A., Grosdemange- Billiard, C., Rohmer, M., and Bach, T.J. (2003). Cross-talk between the cytosolic mevalonate and the plastidial methylerythritol phosphate pathways in tobacco Bright Yellow-2 cells. J. Biol. Chem. 278: 26666–26676.

Johnston, W.F. (1990). Thuja occidentalis L. Northern white-cedar. Silvics of North America, 1. Conifers (eds H.M. Burns and B.H. Honkala), pp. 580-589. USDA Forest Service Handbook no. 654. USDA Forest Service, Washington, DC.

Karp, F., Harris, J.L., and Croteau, R. (1987). Metabolism of monoterpenes: demonstration of the hydroxylation of (+)-sabinene to (+)-cis-sabinol by an enzyme preparation from sage (Salvia officinalis) leaves. Arch. Biochem. Biophys. 256: 179- 193.

Keeling, C.I., and Bohlmann, J. (2006). Genes, enzymes and chemicals of terpenoid diversity in the constitutive and indice defence of conifers against insects and pathogens. New Phytol. 170: 657-675.

Kimball, B.A., Russell, J.H., Griffin, D.L., and Johnston, J.J. (2005). Response factor considerations for the quantitative analysis of western redcedar (Thuja plicata) foliar monoterpenes. J. Chromatogr. Sci. 43: 253-258.

Kirst, M., Johnson, A.F., Baucom, C., Ulrich, E., Hubbard, K., Staggs, R., Paule, C., Retzel, E., Whetten, R., and Sederoff, R. (2003). Apparent homology of expressed genes from wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis thaliana. Proc. Natl. Acad. Sci. 100: 7383-7388.

Kope, H.H., and Sutherland, J.R. (1994). Keithia blight: review of the disease, and research on container-grown, western redcedar in British Columbia, Canada. In: Diseases and insects in forest nurseries. R. Perrin and J.R. Sutherland (editors). INRA Editions, Paris, p. 27-44.

Langenheim, J.H. (1994). Higher plant terpenoids: A phytocentric overview of their ecological roles. J. Chem. Ecol. 20: 1223-1280.

Lichtenthaler, H.K. (2010). Biosynthesis and Emission of Isoprene, Methylbutanol and Other Volatile Plant Isoprenoids. In The Chemistry and Biology of Volatiles. A. Herrmann (editor), John Wiley & Sons, Ltd, Chichester.

Lorenz, W.W., Sun, F., Liang, C., Kolychev, D., Wang, H., Zhao, X., Cordonnier- Pratt, M.M., Pratt, L.H., and Dean, J.F.D. (2006). Water stress-responsive genes in loblolly pine (Pinus taeda) roots identified by analyses of expressed sequence tag libraries. Tree Physiol. 26: 1-16.

Mannesmann, R. (1973). Comparison of twenty-one commercial wood species from North America in relation to feeding rates of the Formosan termite Coptotermes formosanus Shiraki. Mater. und Org. 8: 107-120.

Mardis, E.R. (2008). Next Generation Sequencing Methods. Annu. Rev. Genomics Hum. Genet. 9: 387-402.

Margulies, M., et al. (2005). Genome sequencing in microfabricated high-density picolitre reactors. Nature. 437: 376-380.

Martin, D.M., Fäldt J., and Bohlmann J. (2004). Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS- d subfamily. Plant Physiol. 135: 1908-1927.

Martin, J., and Daufresne, T. (1999). Introduced species and their impacts on the forest ecosystem of Haida Gwaii. In: Proceedings of the Cedar Symposium: Growing Western Redcedar and Yellow-Cypress on the Queen Charlotte Islands/Haida Gwaii. Edited by G. Wiggins. Canada, British Columbia South Moresby Forest Replacement Account, BC, Ministry of Forests, Victoria, BC, p. 69-83.

Martin J., and Baltzinger C. (2002). Interaction among deer browsing, hunting and tree regeneration. Can. J. Forest Res. 32: 1254-1264.

Matsumura, H., Yoshida, K., Luo,S., Kimura, E., Fujibe, T., Albertyn, Z., Barrero, R.A., Krüger, D.H., Kahl, G., Schroth, G.P., and Terauchi, R. (2010). High- throughput SuperSAGE for digital gene expression analysis of multiple samples using next generation sequencing. Plos One. 5: e12010.

Matsunaga, Y., Fujita, K., Yamada, J., Ashitani, T., and Sakai, K. (2003). Monoterpenes produced by Cupressus lusitanica cultured cells including a novel monoterpene (1S, 2S, 6S)-(+)-1, 6-epoxy-4(8)-p-menthen-2-ol. Nat. Prod. Res. 17: 441– 443.

Minroe, D. (1990). Thuja plicata Donn ex D. Don. in Burns, R.M. and B. Honkala. 1990. Silvics in North America. Vol. 1, Conifers. USDA, U.S. For. Serv., Wash., D.C. Agric. Handbook. p. 65.

Minroe D. (1983). Western redcedar - a literature review. USDA-Forest Service, Pacific Northwest Forest and Range Experimental Station General Technical Report; PNW- 150.

Morozova, O., and Marra, M.A. (2008). Applications of next generation sequencing technologies in functional genomics. Genomics. 92: 255-264.

Neale D. B., and Kremer, A. (2011). Forest tree genomics: growing resources and applications. Nat. Rev. Genet. 12: 111-122.

O’Hea, I.J. (1947). Performance of red cedar shingles in U.K.B.C. Lumberman. June edition p. 95-100.

Peters, R.J., Ravn, M.M., Coates, R.M., and Croteau, R.B. (2001). Bifunctional abietadiene synthase: free diffusive transfer of the (+)-copalyl diphosphate intermediate between two distinct active sites. J. Am. Chem. Soc. 123: 8974–8978.

Phillips, M.A., and Croteau, R. (1999). Resin based defenses in conifers. Trends Plant Sci. 4: 184-190.

Pichersky, E., and Gershenzon, J. (2002). The formation and function of plant volatiles: perfumes for pollinator attraction and defense. Curr. Opin. Plant Biol. 5: 237- 243.

Pricing Branch, Ministry of Forests, Mines and Lands. (2011). Coast selling price system average log prices for the 3 month period ending 2011-03-31. Ministry of Forests, Mines and Lands. Online: http://www.for.gov.bc.ca/ftp/hva/e xternal/!publish/ web/logreports/coast/2011/3m_Mar11.pdf.

Radwan, M.A. (1969). Chemical compositon of the sapwood of four tree species in relation to feeding by the black bear. For. Sci. 15: 11-16.

Ralph, S.G., Chun, H.J., Kolosova, N., Cooper, D., Oddy, C., Ritland, C.E., Kirkpatrick, R., Moore, R., Barber, S., Holt, R.A., Jones, S.J.M., Marra, M.A., Douglas, C.J., Ritland, K., and Bohlmann, J. (2008). A conifer genomics resource of 200,000 spruce (Picea spp.) ESTs and 6,464 high-quality, sequence-finished full-length cDNAs for Sitka spruce (Picea sitchensis). BMC Genomics. 8: 484.

Ralph, S.G., Yueh, H., Friedmann, M., Aeschliman, D., Zeznik, J.A., Nelson, C.C., Butterfield, Y.S.N., Kirkpatrick, R., Liu, J., Jones, S.J.M., Marra, M.A., Douglas, C.J., Ritland, K., and Bohlmann, J. (2006). Conifer defense against insects: microarray gene expression profiling of Sitka spruce (Picea sitchensis) induced by mechanical wounding or feeding by spruce budworms (Choristoneura occidentalis) or white pine weevils (Pissodes strobi) reveals large-scale changes of the host transcriptome. Plant Cell & Environ. 29: 1545-1570.

Ronaghi, M., Uhlen, M., and Nyren, P. (1998). A sequencing method based on real- time pyrophosphate. Science. 281: 363-365.

Russell, J.H. (2008). Deployment of deer resistant western redcedar (Thuja plicata). USDA Forest Service Proceedings. RMRS-P57: 149-153.

Sanada, K., Kawaguchi, A., Furuya, T., Ishihara, K., Nakajima, N., and Hamada, H. (2000). High production of thujaplicin with Thuja dolabrata var. hondai cells in a semi- continuous culture system. J. Mol. Catal. B-Enzym. 11: 59-61.

Sanger, F., Nicklen, S., and Coulson, A.R. (1977). DNA sequencing with chain- terminating inhibitors. Proc. Natl. Acad. Sci. 74: 5463-5467.

Sharkey, T.D., and Yeh, S. (2001). Isoprene emission from plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 52: 407-436.

Sterling, R., and Morris, P.I. (2010). Reducing depletion of western redcedar extractives from wood in service. in: A Tale of Two Cedars: International Symposium on Western Redcedar and Yellow-cedar USDA Forest Service Proceedings. PNW- GTR-828: 87-92.

Stroh, N., Baltzinger, C., and Martin, J. (2008). Deer prevent western redcedar (Thuja plicata) regeneration in old-growth forests of Haida Gwaii: Is there a potential for recovery? For. Ecol. Manag. 255: 3973-3979.

Suzuki, M. (1979). The course of resin canals in the shoots of conifers II. Araucariaceae, Cupressaceae and Taxodiaceae. J. Plant Res. 92: 253-274.

Swan, E.P., and Jiang, K.S. (1970). Formation of hardwood extractives in western red cedar. Tappi. 53: 844-846.

Trapp, S., and Croteau, R. (2001). Defensive resin biosynthesis in conifers. Annu. Rev. Plant Phys. 52: 689-724.

Trotter, D., Shrimpton, G., and Kope, H. (1994). The effect of Keithia blight on outplanting performance of Western redcedar container seedlings at two reforestation sites in British Columbia: Preliminary results. Pages 196-202 in: National Proceedings, Forest Conservation Nursery Associations. T. D. Landis and R. K. Dumroese, tech. coord. U.S. Dep. Agric. For. Ser. Gen. Tech. Rep. RM-257.

Turner, G.W., Gershenzon, J., and Croteau, R.B. (2000). Development of peltate glandular trichomes of peppermint (Mentha x piperita L.). Plant Physiol. 124: 665-679.

Turner, G.W., Gershenzon, J., Nielson, E.E., Froehlich, J.E., and Croteau, R. (1999). Limonene synthase, the enzyme responsible for monoterpene biosynthesis in peppermint, is localized to leucoplasts of oil gland secretory cells. Plant Physiol. 120: 879-886.

Turner, NJ. (2010). The cultural roles of western redcedar and yellow-cedar for First Peoples of northwestern North America. in: A Tale of Two Cedars: International Symposium on Western Redcedar and Yellow-cedar USDA Forest Service Proceedings. PNW-GTR-828: 3.

Ujino-Ihara, T., Kanamori, H., Yamane, H., Taguchi, Y., Namiki, N., Mukai, Y., Yoshimura, K., and Tsumura, Y. (2005). Comparative analysis of expressed sequence tags of conifers and angiosperms reveals sequences specifically conserved in conifers. Plant Mol. Biol. 59: 895-907.

Unsicker, S.B., Kunert, G., and Gershenzon, J. (2009). Protective perfumes: the role of vegetative volatiles in plant defense against herbivores. Curr. Opin. Plant Biol. 12: 479- 485.

Van der Kamp, B.J. (1986). Effects of heartwood inhabiting fungi on thujaplicin content and decay resistance of western red cedar (Thuja plicata Donn). Wood and Fiber Sc. 18: 421-427.

Venter, J.C., Adams, M.D., Sutton, G.G., Kerlavage, A.R., Smith, H.O., and Hunkapiller, M. (1998). Shotgun sequencing of the human genome. Science. 280: 1540-1542.

Vickers, C.E., Gershenzon, J., Lerdau, M.T., and Francesco, L. (2009). A unified mechanism of action for volatile isprenoids in plant abiotic stress. Nat. Chem. Biol. 5: 283-291.

Vourc'h, G., Martin, J.L., Duncan, P., Escarré, J., and Clausen, T.P. (2001). Defensive adaptations of Thuja plicata to ungulate browsing: a comparative study between mainland and island populations. Oecologia. 126: 84-93.

Vourc’h, G., Russell, J., and Martin, J. (2002a). Linking deer browsing and terpene production among genetic identities in Chamaecyparis nootkatensis and Thuja plicata. Heredity. 93: 370-376.

Vourc’h, G., Garine-Wichatitsky, M., Labbé A., Rosolowski, D., Martin, J., and Fritz, H. (2002b). Monoterpene effect on feeding choice by deer. J. Chem. Ecol. 28: 2411-2427.

Vourc’h, G., Vila, B., Gillon, D., Escarré, J., Guibal, F., Fritz, H., Clausen, T.P., and Martin, J. (2002c). Disentangling the causes of damage variation by deer browsing on long-lived tree saplings: a chemical and dendrochronological approach. Oikos. 98: 271- 283.

Wang, Z., Gerstein, M., and Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nat. Rev. Genet. 10: 57-63.

Wise, M.I., Savage, T.J., Katahira, E., and Croteau, R. (1998). Monoterpene synthases from common sage (Salvia officinalis): cDNA isolation, characterization, and functional expression of (+)-sabinene synthase, 1:8-cineole synthase, and (+)-bornyl diphosphate synthase. J. Biol. Chem. 273: 14891-14899.

Wu, Q., Sun, C., Luo, H., Li, Y., Niu, Y., Sun, Y., Lu, A., and Chen, S. (2011). Transcriptome analysis of Taxus cuspidata needles based on 454 pyrosequencing. Planta Med. 77: 394-400.

Xin, M.T., and Bugg, T.D.H. (2010). Biomimetic formation of 2-tropolones by dioxygenase-catalysed ring expansion of substituted 2,4-cyclohexadienones. Chembiochem. 11: 272-276.

Zhao, J., Fujita, K., and Sakai, K. (2001). Production of β-Thujaplicin in Cupressus lusitanica Suspension Cultures Fed with Organic Acids and Monoterpenes. Biosci. Biotechnol. Biochem. 65: 1027-1032.

1.7 Figures

Figure 1.1. Biosynthesis of mono-, sesqui- and diterpenes. All three terpene classes originate from isopentenyl diphosphate subunits. Reproduced with permission from Keeling and Bohlmann (2006).

Figure 1.2. Biosynthesis of monoterpenes from geranyl diphosphate. A) Biosynthesis of cyclic monoterpenes through deprotonation, hydride shifts, and cyclization. B) Biosynthesis of acyclic monoterpenes from the geranyl and linalyl cations. Figure reproduced with permission from Degenhardt et al. (2009).

Figure 1.3. Proposed biosynthesis pathway of β-thujaplicin (Bentley, 2008) and α- thujone (Croteau 1996).

2. FOLIAR PHASE CHANGES ARE COUPLED WITH CHANGES IN

STORAGE AND BIOCHEMISTRY OF MONOTERPENOIDS IN WESTERN

REDCEDAR (THUJA PLICATA)

Adam J. Foster1, Regine Gries1, Gerhard Gries1, Jim Mattsson1, Roni Aloni2

1Department of Biological Sciences, Simon Fraser University, 8888 University Drive, Burnaby, BC, V5A1S6, Canada. 2Department of Molecular Biology and Ecology of Plants, Tel Aviv University, Tel Aviv 69978, Israel.

This chapter is being presented as a manuscript for submission to the journal ‘Tree Physiology’ and is formatted as such

Contributions of authors AJF: involved in all experimental work and wrote the majority of this paper. RG and GG: Conducted GC-MS and assisted with interpretation of data and writing. JM: Writing and interpretation of results. RA: Sectioning, analysis and interpretation of results.

Keywords: Western redcedar, Thuja plicata, monoterpene, leaf ontogeny, leaf phase, resin ducts, resin glands, α-thujone, reforestation

2.1 Abstract

Western redcedar (Thuja plicata) is a highly valued source of lumber. T. plicata trees planted in reforestations efforts are often heavily damaged by extensive ungulate browsing. Research has shown that high foliar content of monoterpenoids deters browsing, providing an avenue for resistance selection in young plants. It is possible however that selection in young plants could be confounded by potential changes in terpenoid storage as T. plicata foliage undergoes extensive phase changes during early growth. Here, we characterize morphological leaf phases for their monoterpenoid content and anatomy of terpenoid storage structures. Cotyledons lack storage structures for terpenoids. Needles contain a single longitudinal terpenoid duct and have α-pinene as the most prevalent monoterpenoid. In contrast, the scales contain enclosed resin glands and have a monoterpenoid profile that is markedly different from needles, with α-thujone as the most prevalent monoterpenoid. In summary, we show that foliar phase changes are coupled with equally dramatic changes in resin storage structure anatomy and monoterpenoid composition. The findings can be applied to comparative sampling for selection based on foliar monoterpene content and also provide a framework for molecular genetic characterization of foliar terpene biology in this species.

2.2 Introduction

Western redcedar (Thuja plicata Donn ex Don) is native to the Pacific Northwest.

In Canada it is unique to British Columbia (BC). Wood of T. plicata is highly valued due to aesthetics, dimensional stability and natural durability (Gonzalez 2004). On average, 8 million seedlings are planted in BC each year (Gonzalez 2004). The BC forestry industry is facing particular difficulties with T. plicata reforestation because planted seedlings are extensively browsed by ungulates, such as deer, elk and moose (Martin and Daufresne

1999; Martin and Baltzinger 2002; Vourc’h et al. 2002a and 2002c; Stroh et al. 2008).

Sitka black-tailed deer (Odocoileus hemionus sitkensis) populations are the primary factor preventing regeneration of T. plicata on the Haida Gwaii Islands (Stroh et al.

2008). There is, however, evidence that T. plicata has an innate defense against deer browsing, as plants with high foliar monoterpenoid content are browsed less heavily than those with low monoterpenoid content (Vourc'h et al. 2002a; Russell 2008).

Volatile monoterpenoids and sesquiterpenoids as well as non-volatile diterpenoids are key components of stored oleoresins in conifers and function in the chemical defense against insects and microbes (Langenheim 1969; Langenheim 1990; Langenheim 1994;

Unsicker et al. 2009). Monoterpenes are C10 terpene compounds that are derived from geranyl diphosphate produced from the isoprenoid biosynthetic pathway. Geranyl diphosphate is converted into linear or cyclic monoterpenes by a group of proteins termed monoterpene synthases (Bohlmann et al. 1998). These enzymes have been cloned and characterized for many conifers, including an α-pinene synthase from Chamaecyparis formosensis, a member of the family Cupressaceae (Chu et al. 2009). The foliar terpene profile of mature foliage in T. plicata is highly conserved among populations throughout

35 the trees natural range, with the three major monoterpenes being α-thujone, β-thujone and sabinene, with significant but lesser levels of α-thujene, α-pinene, myrcene, and 1R-(+)- limonene (Von Rudolff et al. 1988; Kimball et al. 2005).

Oleoresin-producing structures have been studied in some conifer species. For example, resin ducts of Aleppo pine (Pinus halepensis) were found to originate from the apical meristem and form networks that correlate with the presence of vascular tissues

(Werker and Fahn 1969). These ducts showed variability in number of epithelial cells and overall size relative to the developmental stage of the tissues (Werker and Fahn 1969).

The characteristic features of resin storage ducts were found to be highly heritable in

Norway spruce (Picea abies), and the number of resin ducts showed a strong correlation with monoterpenoid content in needles of Lodgepole pine (Pinus contorta; White and

Nilsson 1984; Rosner and Hannrup 2004). The ontogenetic age of needles is also an important factor in the number of observed resin canals in Pinus sylvestris (Lin et al.

2001).

Suzuki (1979) examined the anatomy of foliage and resin storage structures of many Cupressaceae members and identified that all species studied have subulate or awl- shaped needle-like leaves, with many developing scale-like leaves as they mature. T. plicata was characterized as having large central abaxial resin glands in the scale-like leaves often with multiple smaller glands present at the base of scales (Suzuki 1979).

Here we refer to the subulate needle-like leaves as needles and the scale-like leaves as scales. Although not described as such by Suzuki (1979), the phase change in leaf morphology in T. plicata from needles in an early or juvenile form to radically different scales in a later or adult form is an example of metamorphic heteroblasty (Reviewed by

Zotz et al. 2011). This phenomenon is better known in dicot species such as European ivy

(Hedera helix; Goebel 1913) and some Acacia species (Kaplan 1980). With this in mind, an obvious question is to what extent these phase changes affect the anatomy and biochemistry of terpenoid biology in T. plicata. This is important as studies aiming at identifying genetic variation in terpenoid content could potentially be confounded by changes in terpenoid content due to the phase changes occurring in the early life of young

T. plicata when screens are most conveniently done. Here we show for the first time several anatomical changes in terpenoid storage as well as dramatic qualitative changes in terpenoid content that correlate with the changes in leaf morphology in this species.

2.3 Materials and Methods

Seeds of T. plicata were collected from a single wild stand tree and grown in 11 liter pots at low density (3-4 plants per pot) in an open outdoor area on the Simon Fraser

University Burnaby Mountain campus for circa one year. All plant tissues were examined in July and August (mid-summer) at midday (11:00-14:00) to limit potential seasonal or diurnal differences in terpenoid contents.

Forty whole plants were removed from soil, treated with 70% ethanol for 48 h to remove chlorophyll, and then boiled in lactic acid for 2-10 min for complete clearing.

Foliage was also embedded in paraffin, and sectioned as described in Brewer et al.

(2006). Plant tissue, specifically roots, juvenile needles and mature leaves, were excised from seedlings, hand-sectioned to a thickness of ~ 50-100 µm, and examined under a compound microscope with differential interference contrast filters and mercury vapor fluorescence. Sections of leaf tissue were stained in phloroglucinol-HCl as a means to

37 detect the presence of lignin and to quench its autofluorescence (Biggs 1985), allowing suberin to be detected using UV fluorescence (Nikon HB 10103AF). All digital images were captured with a Canon Rebel XSi camera.

Monoterpenes from leaves were extracted following a procedure modified from

Kimball et al. (2005). For each plant, 250 mg of tissue were frozen in liquid nitrogen and ground to a fine powder using a mortar and pestle. Tissue was transferred to a 10-mL glass tube and extracted with 5 mL of ethyl acetate on a horizontal shaker for 30 min. To remove solid tissue, the extract was passed through a glass wool filter. Extracts were then concentrated under a nitrogen stream, and aliquots were analyzed by coupled gas chromatography-mass spectrometry (GC-MS) , employing a Varian Saturn 2000 Ion Trap

GC-MS and a Varian workstation version 6.9.1 (Agilent Technologies, Mississauga, ON,

Canada). The GC-MS was fitted with a DB-5MS column [30 m × 0.25 mm (length × inner diam.), 0.25 µm (film)], using the following temperature program: 5 min at 50 °C,

10 °C per min to 280 °C. Monoterpenes were identified by comparing their retention indices (Van den Dool and Kratz 1963) and mass spectra with those reported in the literature (Adams 1989) and with those of authentic standards (α-pinene, myrcene, limonene α- and β-thujone: Sigma-Aldrich, Oakville, ON, Canada; sabinene: Indofine,

Hillsborough, NJ, USA; α-thujene: available from previous research in Gries-laboratory).

Differences in monoterpene content between 3 replicates of extracts from needles and scales were determined by Student’s paired t-test in Statistix 8 (Analytical Software).

2.4 Results

T. plicata foliage undergoes distinct morphological phase changes. Here we will briefly summarize those phases, followed by a more extensive analysis of parallel changes in the anatomy of resin storage structures and monoterpenoid content.

2.4.1 Leaf morphology phase changes in young T. plicata plants

The leaves of T. plicata plants undergo several phase changes within the first few months of growth (Figure 2.1). During this period, the plants progress through three stages of vegetative leaf ontogeny: early needle, transitional and late scale (Figure 2.1a, b, c). The first phase of leaves is the cotyledon of germinated seedlings, of which there are two. The cotyledons lack petioles and are needle-shaped, tapering into a blunt end. The germinated seedlings go on to produce a number of phytomers with needle-shaped leaves in whorls of four with opposite pattern of phyllotaxy. Although these needles are morphologically similar to the cotyledons, they differ from the cotyledons in their internal anatomy, and we therefore we define needles as a separate phase. An excised needle is shown in Figure 2.1d. Each needle has a basal portion that is continuous with the stem, running from the previous internode to the portion of the free needle. As a result, the four needles per whorl generate internodes with four parallel ridges. As the plants mature further, larger needles are produced and their density decreases as internodes become longer. We refer to the ontogenetic period where the plant only produces needles as the early stage (Figure 2.1a). While the primary shoot apical meristem continues to produce needles, secondary shoots, developing from lateral meristems in the needle axils, produce scales rather than needles (Figure 2.1b). The scales

39 appear pair wise in opposite phyllotaxy with indiscernible internodes. The two pairs of scales are morphologically distinct, generating shoots with bilateral rather than previous radial symmetry, with central scales generating two comparatively flat and large surfaces relative to the narrow and pointed lateral scales. The lateral scales wrap in part around the central scales, generating distinct, segment-like units of foliage. This stage with both juvenile needles and adult scales being produced represents a transitional stage from the early to the late stages of vegetative growth. At a height of 10-20 cm, the primary shoot also switches to scale production, completing the transition to the adult phase of vegetative growth. As lateral branches develop regular secondary and tertiary branches, the new branches adopt the same bilateral symmetry, resulting in extended collective sheaths of foliage typical of T. plicata. When only scales are produced from the primary stem, we define this as the late ontogenic stage.

2.4.2 Phase changes in the anatomy of resin storage structures

In germinated seedlings, no resin storage structures were detected in the root, hypocotyl, or cotyledons. The subsequent needles have a single longitudinal medial resin duct on the abaxial side (Figure 2.2a-b). The resin duct of the needle continues into the basal portion that is fused with the stem (Figure 2.2c). Curiously, the same stem-bound portion of late-formed needles in the transitional stage may contain two lateral resin storage structures with approximately the same diameter as the resin duct (Figure 2.2d).

We refer to these structures as glands as they are short, spindle-shaped structures rather than ducts. The subsequent scales as a rule produce resin glands rather than ducts. Each central scale has a prominent medial resin gland (Figure 2.3), while lateral scales

40 typically have two glands, one for each ridge in the basal part of a lateral scale. There is, however, an exception to the rule in that the first few scales formed in lateral branches may have a resin gland that narrows and extends all the way to the tip of the scale (Figure

2.3c), similar to the medial longitudinal resin duct of needles. This is indicative of a gradual ontogenetic transition from a medial longitudinal resin duct to a resin gland. We found further support for a gradual transition from duct to gland in the zones where needles gradually transitioned into scales (Figure 2.4). In this series, the first needles possess a resin duct that runs from the apex of the needle into the stem at the basal end

(Figure 2.4a). The following distal needles are shorter and possess a resin duct that narrows and ends blindly at the base of the needle (Figure 2.4b). Even shorter needles contain a single elongated resin gland that widens in the middle (Figure 4c). The shortest needles have a central resin gland (Figure 2.4d), reminiscent of scales (Figure 2.3a).

While smaller scales tend to have a limited number of glands, typically one for each central scale, and two for each lateral scale (see above), larger scales have additional smaller resin glands (Figure 2.3e). In central scales, this is visible as multiple smaller glands in various asymmetric positions (Figure 2.3e). A similar pattern can be seen in lateral scales.

2.4.3 Suberization of resin storage structures

The walls of cells surrounding the epithelial cells of resin storage structures in conifers are suberized in some species (Werker and Fahn 1969; LaPasha and Wheeler

1990). As suberin is impervious to fluid diffusion, these walls are thought to be involved in confining resin to the secretion cavities (LaPasha and Wheeler 1990). We examined the cells walls surrounding resin storage structures in T. plicata to determine whether ducts

41 and glands differed with respect to potential diffusion barriers. Autofluorescence is a useful indicator of polyphenolics, such as suberin and lignin (Biggs 1985).

When we examined sections of needles and scales by fluorescence microscopy, we found large differences in autofluorescence between resin ducts and resin glands.

Fluorescence intensity also differed based on the maturity of the resin storage structures.

The cell walls of epithelial cells surrounding the resin ducts in newly formed needles show little to no autofluorescence (Figure 2.5a). As the needle matures, we observed a gradual increase in fluorescence in the resin duct cell walls of the oldest needles in a 1- year-old plant, showing a strong level of autofluorescence relative to the nearby xylem cell walls (Figure 2.5b). The same trend in autofluorescence increasing with age was apparent with resin glands. In newly formed scales, resin glands do not show autofluorescence, but as the leaf elongates, gland autofluorescence rapidly increases

(Figure 2.5c). There are strong differences in resin structure fluorescence in the transitional stage needles that possess both resin ducts and glands (Figure 2.5d). Glands show strong autofluorescence while ducts do not autofluoresce in these tissues, rendering fluorescence microscopy useful in discriminating between similar-sized glands and ducts in tissue cross-sections (Figure 2.5d).

A combination of phloroglucinol-HCL staining and fluorescence microscopy helped us determine whether the observed autofluorescence was due to extensive incorporation of lignin. Xylem tissues were strongly stained by the phloroglucinol-HCL reaction, but no staining took place in either resin glands or resin ducts. When we examined phloroglucinol-stained tissue for cell wall autofluorescence, we observed a large decrease in lignin autofluorescence in the vascular bundle, but observed no

42 quenching of the fluorescence from the resin gland tissue (Figure 2.5C), indicating that this tissue is likely suberized (Biggs 1985).

2.4.4 Terpene profiles of needles and scales

The monoterpenoid profiles of needles and scales differed markedly. In needles, the most and second most abundant hydrocarbon monoterpenes were α-pinene and sabinene, respectively. Neither α- nor β-thujone were detectable (Figure 2.6a). In scales, the dominant monoterpenes were α-thujone, sabinene, and β-thujone (Figure 2.6b). Both needles and scales contained the hydrocarbon monoterpenes α-thujene, myrcene, and limonene. As a percentage of the total observed monoterpenes, α-pinene and myrcene were present at a significantly higher ratio in needles above scales, while sabinene and limonene were present at a significantly higher ratio in scales above needles (Figure

2.6c). Based on absolute abundance of monoterpenes per g fresh weigh of tissue, only α- pinene was significantly more abundant in needles than in scales (Figure 2.6d).

2.5 Discussion

This study was triggered by a realization that we needed to understand the anatomical and ontogenetic basis of monoterpenoid production in order to identify genetic differences in foliar monoterpenoid content between provenances of T. plicata.

We also had an interest in identifying genes involved in the production of these compounds, which makes it important to know where and when the corresponding genes could be expected to be expressed. As part of this molecular genetic effort, we have evidence that the great majority of foliar monoterpenoids are confined to resin glands

(Chapter 3; Figure 3.1). Suzuki (1979) presents a drawing on resin gland distribution in young T. plicata scales, but there is to our knowledge, no description mapping the ontogeny and distribution of resin storage structures in this or any closely related species.

T. plicata leaves undergo several phase changes, starting with the embryonic cotyledons, followed by needles and scales. Here we show that the anatomy of resin storage changes dramatically during these phase changes. Briefly, cotyledons lack resin storage structures, needles have a resin duct, with the exception of needles formed soon before the transition to scales, which may also have lateral glands at the base of needles.

Scales, on the other hand, have only short resin glands, which become more numerous in later-formed larger scales (summarized in Table 2.1). In addition, we found evidence for a gradual ontogenetic transition of resin duct in the needle to scale transition zones (Figure

2.4), supporting a postulation by Suzuki (1979) on this issue. Despite their similar origin, ducts and glands differ greatly both chemically and anatomically. Needle tissue with resin ducts was found to contain primarily hydrocarbon monoterpenes and to lack the oxygenated monoterpenes α- and β-thujone, which are the dominant terpenoids in scale tissue. The presence of α- and β-thujone positively correlates with the suberization of the cell walls surrounding the resin glands. The role of the suberin layer surrounding the resin storage structures is thought to confine resin to the secretory cavity of the storage structure and to prevent resin from diffusing into surrounding tissues, where it could cause damage (LaPasha and Wheeler 1990). The lack of a suberin layer surrounding ducts may be due to a reduced need to prevent diffusion of the resin contents as hydrocarbon monoterpenes are generally less phytotoxic than oxygenated monoterpenes

(Vaughn and Spencer 1993).

Differences in terpenoid profiles of leaf tissues at different ontogenetic stages have been reported previously for other tree species. In the cypress species

Sequidoiadendron giganteum and Juniperus scopulorum, the terpenoid profile of scale- like mature foliage had a significantly higher percentage of oxygenated monoterpenes than that of juvenile needle-like tissue which had a high percentage of hydrocarbon monoterpenes (Adams and Hagerman 1977; Levinson et al. 1971). This is comparable to the occurrence of oxygenated α- and β-thujones only in scales of T. plicata. This trend of higher levels of oxygenated terpenes in mature needles is not true for all trees, however, as juvenile and mature foliage of Juniperus horizontalis (Cupressaceae) had similar leaf resin compositions (Adams et al. 1980).

Both morphologically and chemically, needles of T. plicata resemble those of other species in the family Pinaceae. However, T. plicata plants transitions after a few months from needle to scale production, which is characteristic of many species in the family Cupressaceae (Suzuki 1979). Developmental changes in needle anatomy regarding terpene storage structures have been reported for Douglas-fir (Pseudotsuga menziesii), where needle size and numbers of resin ducts generally decreased after plants reached 10 years of age (Apple et al. 2002). With such a distinct change in T. plicata leaf structure over a short time, we hypothesize substantial differences in overall terpenoid content based on leaf ontogenetic age, particularly in light of the supplementary glands which appeared in the scales of the newly late stage foliage.

The absence of thujones in T. plicata resin ducts may be due to the absence of enzymes or other cellular components required for their biosynthesis. The biosynthesis of

α- and β-thujone have been well studied in sage (Salvia officinalis), where sabinene,

45 present in T. plicata needle resin ducts, serves as their biosynthetic precursor (Dehal and

Croteau 1987).

This work focused on the development of leaves and associated terpenoid storage structures of 1-year-old T. plicata trees. However, terpenoid storage structures likely change further throughout the life cycle of a tree. For examples, terpenoid content of conifer foliage and terpene emissions differed in spring and fall seasons (Powell and

Adams 1973; Nerg et al. 1994; Staudt et al. 2000), and even diel emissions of volatile monoterpene from Juniperus scopulorum varied according to diurnal factors (Adam and

Hagerman 1977). Seasonal and/or diurnal variations in leaf terpenoid content of T. plicata should be examined as they may have important implications in deterring seasonal browsing by ungulates.

Monoterpenes are involved in deterring ungulate browsing on T. plicata (Vourc’h et al. 2002a) but the effect depends upon their molecular structure. The oxygenated monoterpenes α- and β-thujone were highly effective feeding deterrents for three species of deer (O. hemionus sitkensis; Capreolus capreolus; Cervus timorensis russa), whereas the hydrocarbon monoterpenes α-pinene, sabinene, limonene and myrcene were only marginally effective (Vourc’h et al. 2002b). With α- and β-thujone being exclusively produced in scales, this brings into question the role of α-pinene as the major monoterpene in needles. In different tree species, α-pinene can attract insects that feed on plants (Hofstetter et al. 2008) and recruit beneficial insects (Chilocorus kuwanae; Zhang et al. 2009). This monoterpene has also been implicated in deterring feeding by sheep

(Ovis aries; Estell et al. 1998). The production of α-pinene as the major terpenoid in needles may deter other insects or mammals that were not examined in the Vourc’h

(2002b) feeding choice study from T. plicata herbivory.

2.6 Conclusions

Here we anatomically and chemically characterized the two primary vegetative leaf morphology phases with respect to terpene storage structures. This work produced a greater understanding of the leaf phase morphology on leaf terpene content and may yield important information for reforestation managers. Trees used in replantation might benefit from being examined to ensure they are of an appropriate maturity, such that the majority leaves are in the scale phase as the needles of the earlier phase lack α- and β- thujone, the monoterpenoids with the strongest ability to deter ungulate herbivory

(Vourc’h 2002b).

2.7 References

Adams, R.P., E. von Rudloff, L. Hogge and T. A. Zanoni. 1980. The volatile terpenoids of Juniperus monticola f. monticola, f. compacta, and f. orizabensis. J. Nat. Prod. 43:4- 17.

Adams, R.P. 1989. Identification of Essential oils by ion trap mass spectrometry. Academic, San Diego, California.

Adams, R.P. and A. Hagerman. 1977. Diurnal variation in the volatile terpenoids of Juniperus scopulorum (Cupressaceae). Am. J. Bot. 64:278-285.

Apple, M., K. Tiekotter, M. Snow, J. Young, A. Soeldner, D. Phillips, D. Tingey and B.J. Bond. 2002. Needle anatomy changes with increasing tree age in Douglas-fir. Tree Physiol. 22:129-136.

Biggs, A.R. 1985. Detection of impervious tissue in tree bark with selective histochemistry and fluorescence microscopy. Stain Technol. 60:299-304.

Bohlmann, J., J. Steele, and R. Croteau. 1998. Monoterpene synthases from grand fir (Abies grandis). cDNA isolation, characterization, and functional expression of myrcene synthase, (-)-(4S)-limonene synthase, and (-)-(1S, 5S)-pinene synthase. J. Biol. Chem. 272:21784-21792.

Brewer, P.B., M.G. Heisle, J. Hejatko and E. Benkova. 2006. In situ hybridization for mRNA detection in Arabidopsis tissue sections. Nat. Protoc. 1:1462-1467.

Chu, F.H., P.M. Kuo, Y.R. Chen and S.Y. Wang. 2009. Cloning and characterization of α- pinene synthase from Chamaecyparis formosensis Matsum. Holzforschung. 63:69-74.

Dehal, S.S. and R. Croteau. 1987. Metabolism of monoterpenes: specificity of the dehydrogenases responsible for the biosynthesis of camphor, 3-thujone, and 3- isothujone. Arch. Biochem. Biophys. 258:287-291.

Estell, R.E., E.L. Fredrickson, M.R. Tellez, K.M. Havstad, W.L. Shupe., D.M. Anderson and M.D. Remmenga. 1998. Effects of volatile compounds on consumption of alfalfa pellets by sheep. J. Anim. Sci. 76:228-233.

Goebel, K. 1913. Organographie der Pflanzen. 1. Teil: Allgemeine Organographie. Jena, Gustav Fischer.

Gonzalez, J.S. 2004. Growth properties and uses of western red cedar. Forintek Canada Corp. Special Publication, No SP-37R.

Hofstetter, R.W., Z. Chen, M.L. Gaylord, J.D. McMillin and M.R. Wagner. 2008. Synergistic effects of α-pinene and exo-brevicomin on pine bark beetles and associated insects in Arizona. J. Appl. Entomol. 132:387-397.

Kaplan, D.R. 1980. Heteroblastic leaf development in Acacia—Morphological and morphogenetic implications. Cellule 73:135-203.

Kimball, B.A., J.H. Russell, D.L. Griffin and J.J. Johnston. 2005. Response factor considerations for the quantitative analysis of western redcedar (Thuja plicata) foliar monoterpenes. J. Chromatogr. Sci. 43:253-258.

Langenheim, J.H. 1969. Amber: A botanical inquiry. Science 163:1157-1169.

Langenheim, J.H. 1990. Plant resins. Am. Sci. 78:16–24.

Langenheim, J.H. 1994. Higher plant terpenoids: A phytocentric overview of their ecological roles. J. Chem. Ecol. 20:1223-1280.

Lapasha, C.A. and E.A. Wheeler. 1990. Longitudinal canal lengths and interconnections between longitudinal and radial canals. IAWA Bull. 11:227-238.

Levinson, A.S., G. Lemone and E.C. Smart. 1971. Volatile oil from foliage of Sequiadendron giganteun: change in composition during growth, Phytochem. 10:1087- 1094.

Lin, J., M.E. Jack and R. Ceulemans. 2001. Stomatal density and needle anatomy of Scots pine (Pinus sylvestris) are affected by elevated CO2. New Phytol. 150:665-674.

Martin, J. and C. Baltzinger. 2002. Interaction among deer browsing, hunting and tree regeneration. Can. J. Forest Res. 32:1254-1264.

Martin, J. and T. Daufresne. 1999. Introduced species and their impacts on the forest ecosystem of Haida Gwaii. In Proceedings of the Cedar Symposium: Growing Western Redcedar and Yellow-Cypress on the Queen Charlotte Islands/Haida Gwaii. Ed. G. Wiggins. British Columbia South Moresby Forest Replacement Account, BC Ministry of Forests and Ranges, Victoria, pp 69-83.

Nerg, A., P. Kainulainen, M. Vuorinen, M. Hanso, J.K. Holopainen and T. Kurkela, 1994. Seasonal and geographical variation of terpenes, resin acids and total phenolics in nursery grown seedlings of Scots pine (Pinus sylvestris L.). New Phytol. 128:703-713.

Powell, R.A. and R.P. Adams. 1973. Seasonal variation in the volatile terpenoids of Juniperus scopulorum (Cupressaceae). Am. J. Bot. 60:1041-1050.

Rosner, S. and B. Hannrup. 2004. Resin canal traits relevant for constitutive resistance of Norway spruce against bark beetles: environmental and genetic variability. Forest Ecol. and Manag. 200:77-87.

Russell, J.H. 2008. Deployment of deer resistant western redcedar (Thuja plicata). USDA Forest Service Proceedings. RMRS-P57:149-153.

Staudt, M., N. Bertin, B. Frenzel and G. Seufert. 2000. Seasonal variation in amount and

composition of monoterpenes emitted by young Pinus pinea trees: implications for emission modeling. J. Atmosph. Chem. 35:77-99.

Stroh, N., C. Baltzinger and J. Martin. 2008. Deer prevent western redcedar (Thuja plicata) regeneration in old-growth forests of Haida Gwaii: Is there a potential for recovery? For. Ecol. Manag. 255:3973-3979.

Suzuki, M. 1979. The course of resin canals in the shoots of conifers II. Araucariaceae, Cupressaceae and Taxodiaceae. J. Plant Res. 92:253-274.

Unsicker, S.B., G. Kunert and J. Gershenzon. 2009. Protective perfumes: the role of vegetative volatiles in plant defense against herbivores. Curr. Opin. Plant Biol. 12:479- 485.

Van den Dool, H. and P.D. Kratz. 1963. A generalization of retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. 2:463-471.

Vaughn, S.F. and G.F. Spenser. 1993. Volatile monoterpenes as potential parent structures for new herbicides. Weed Sci. 41:114-119.

Von Rudloff, E., M.S. Lapp. and F.C. Yeh. 1988. Chemosystematic study of Thuja plicata: Multivariate analysis of leaf oil terpene composition. Biochem. Syst. Ecol. 16:119-125.

Vourc’h, G., J. Russell and J. Martin. 2002a. Linking deer browsing and terpene production among genetic identities in Chamaecyparis nootkatensis and Thuja plicata. Heredity. 93:370-376.

Vourc’h, G., M. Garine-Wichatitsky, A. Labbé, D. Rosolowski, J. Martin and H. Fritz. 2002b. Monoterpene effect on feeding choice by deer. J. Chem. Ecol. 28:2411-2427.

Vourc’h, G., B. Vila, D. Gillon, J. Escarré, F. Guibal., H. Fritz,, T.P. Clausen and J. Martin. 2002c. Disentangling the causes of damage variation by deer browsing on long- lived tree saplings: a chemical and dendrochronological approach. Oikos. 98:271-283.

Werker, E. and A. Fahn. 1969. Resin ducts of Pinus halepensis Mill.-Their structure, development and pattern of arrangement. Bot. J. Lin. Soc. 62:379-411.

White, E.E. and J.E. Nilsson. 1984. Genetic variation in resin canal frequency and relationship to terpene production in foliage of Pinus contorta. Silvae Genet. 22:79-84.

Zhang, Y., Y. Xie, J. Xue, G. Peng and X. Wang. 2009. Effect of volatile emissions, especially α-pinene, from persimmon trees infested by japanese wax scales or treated with methyl jasmonate on recruitment of ladybeetle predators. Environ. Entomol. 38:1439-1445.

Zotz, G., K. Wilhelm and A. Becker. 2011. Heteroblasty-a review. Bot. Rev. 77:109-144.

2.8 Figures

2.9 Tables

Table 2.1. Summary of leaf phases with respect to ontogeny, predominant monoterpenoid and terpene storage structure in 1-year-old T. plicata.

Predominant Ontogenetic Leaf Phase Terpene Storage Structure Monoterpenoid Stage Cotyledon n.d. Embyonic n.d.

Early Central Duct Needle α-Pinene Transitional Duct and glands in fused section

Transitional Central gland Scale α-Thujone Late Central and basal glands n.d. = not detected in leaf phase

3. IDENTIFICATION OF KEY GENES IN THE SYNTHESIS OF FOLIAR

TERPENOIDS IN WESTERN REDCEDAR (THUJA PLICATA)

Adam J. Foster1, Dawn Hall2, Shelley Abercromby1, Leanne Mortimer1, Regine Gries1, Gerhard Gries1, Jörg Bohlmann2, John Russell3 and Jim Mattsson1

1Department of Biological Sciences, Simon Fraser University, 8888 University Drive, Burnaby, BC, V5A1S6, Canada 2Michael Smith Laboratories, University of British Columbia, 2185 East Mall, Vancouver, BC, Canada V6T 1Z4 3 Research Branch, British Columbia Ministry of Forests and Lands, Cowichan Lake Research Station, P.O. Box 335, Mesachie Lake, BC, Canada V0R 2N0

This chapter is being presented as a manuscript for submission to the journal ‘The Plant Cell’ and is formatted as such

Contributions of co-authors AJF: involved in all experimental work and wrote the majority of this paper. DH: Assisted and conducted protein functional analysis. SA: Assisted in QPCR. LM: Conducted in situ hybridization. RG and GG: Conducted GC-MS and assisted with interpretation of data and writing. JB: provided assistance in protein functional analysis. JR: provided plant genotypes and expertise on forest tree species. JM: Writing and interpretation of results.

Keywords: Western redcedar, Thuja plicata, monoterpene synthase, sabinene, resin gland, thujone, ungulate browsing, molecular marker, transcriptome, tag profiling

3.1 Abstract

Western redcedar (Thuja plicata) is a long lived tree that uses chemical defence to great effect. T. plicata has a high foliar monoterpenoid content with the most abundant being α-thujone. However, the genetic basis of these defences is unknown. To this end, we first generated a transcriptome database from which to draw candidate genes. We took advantage of a natural variant lacking foliar resin glands to identify genes whose expression as quantified by Illumina tag profiling was associated with the presence of glands. This analysis yielded more than 600 genes with low or undetectable expression in foliage without resin glands, and between 10 and 10000-fold higher transcript abundance in foliage with resin glands. The differential expression was confirmed for the majority of tested genes by quantitative PCR (QPCR). One of the most differentially expressed genes encodes a sabinene synthase that produces multiple minor monoterpene products. In situ

RNA hybridization showed that this gene is expressed in the epithelium of foliar resin glands. The transcriptome results were successful in identifying putative genes in the biosynthesis of thujone and a wide range of other genes potentially involved in resin gland functions.

3.2 Introduction

Western redcedar (Thuja plicata Donn ex D. Don) grows along the coast from south-eastern Alaska to north-western California, and inland in the Rocky Mountains from British Columbia (BC) to Idaho and Montana (Chambers, 1993). Although grown in a limited area, T. plicata is an economically important timber tree, used for production of lumber that at times is the most highly valued softwood in North America (Gonzalez,

2004; Pricing Branch, Ministry of Forests, Mines and Lands, 2011). The wood is prized for its dimensional stability and natural durability, making it exceptionally suitable for outdoor applications such as decking, furniture, wall and roof shingles (Gonzales, 2004).

For indigenous peoples of the north-west coast, T. plicata is of extraordinary cultural significance as it has been used for thousands of years for the making of housing, canoes, totem poles, textiles and ropes from the bark, and for extraction of resin oils (Gonzales,

2004).

T. plicata has effective chemical defences and is known to be highly resistant to insect and fungal damage (Minroe, 1983). However, ungulate browsing can cause significant damage to juvenile trees (Stroh et al., 2008; Martin and Daufresne, 1999;

Martin and Baltzinger, 2002; Vourc’h et al., 2002a and 2002c). Reforestation efforts typically utilize physical tree guards to protect newly planted T. plicata trees from ungulate browsing at a cost of $20 to $25 million a year (Russell, 2008). Ungulate browsing deterrence has been linked to high levels of modified monoterpenes referred to as monoterpenoids. Ungulates selectively feed on individuals with low levels of foliar monoterpenoids, while avoiding plantlets with higher levels (Vourc’h et al., 2002a).

Vourc’h et al. (2002b) have found that the two most important monoterpenoids for

60 deterring ungulate feeding are α- and β-thujones, which are typically the most abundant monoterpenoids in T. plicata foliage (Chapter 2). T. plicata foliage consists of scale-like needles, where each scale has a prominent central resin gland. In addition, smaller glands can be found at the base of the scales (Suzuki, 1979). It is however unclear where in the foliage highly volatile monoterpenoids such as thujones are produced or stored.

Studies in sage (Salvia officinalis) found that the monoterpene sabinene is a precursor to α- and β-thujone (Dehal and Croteau, 1987). Microsomal preparations from leaf tissue catalyze the nicotinamide adenine dinucleotide phosphate (NADPH) and oxygen dependent hydroxylation of (+)-sabinene to (+)-cis-sabinol (Karp et al., 1987).

(+)-cis-sabinol dehydrogenase catalyze the formation of sabinone, which then undergo

NADPH-dependent stereoselective reduction to form either α- or β-thujone (Dehal and

Croteau, 1987). Based on these findings, a putative pathway for the modifications of sabinene into thujones has been suggested (Dehal and Croteau, 1987; Supplemental

Figure 3.1). It is therefore likely that a sabinene synthase plays a similar role in T. plicata foliar tissues.

Monoterpenes are produced by a group of enzymes called monoterpene synthases, which in turn are closely related to sesqui- and diterpene- synthases (reviewed in Keeling and Bohlmann, 2006). Monoterpene synthases convert geranyl diphosphate into a large variety of cyclic or linear monoterpenes. Many terpene synthases have been functionally characterized and several conserved motifs have been identified as absolutely necessary for enzymatic function; these include DDXXD motifs that bind metal cofactors and

RRX8W motifs of unknown function found near the N-terminus (Keeling and Bohlmann,

2006; Keeling et al., 2008). Encoded monoterpene synthase proteins harbour signal

61 peptides that result in plastid import where monoterpene synthesis takes place. There is extensive documentation that the levels of transcripts of terpene synthase-encoding genes correlate well with enzyme levels as well as levels of specific monoterpenes or monoterpenoids (Bohlmann et al., 1997; Martin et al., 2002; Byun McKay et al., 2003;

Miller et al., 2005).

Molecular genetic information is limited for T. plicata with only a handful of cDNA sequences present in Genbank. Recent development of next generation sequencing technologies however now allows extensive sequencing and de novo assembly as a relatively rapid method for gene discovery (Morozova and Marra, 2008). Here we used

Illumina sequencing to generate a T. plicata transcriptome as well as to identify more than 600 genes whose expression correlated with the presence of foliar monoterpenoids and terpenoid storage glands. We also identified candidate genes for enzymes in the conversion of sabinene into thujones as well as a sabinene synthase-encoding gene. In situ hybridization studies further showed that this sabinene synthase gene is expressed in the epithelial cells lining foliar resin glands.

3.3 Results

3.3.1 Characterization of wild type and variant T. plicata genotypes

While it is known that T. plicata foliage contains high levels of sabinene and thujones (Kimball et al., 2005), the internal site or sites of production and storage are unknown. The limited literature available on T. plicata foliage anatomy describes the presence of resin glands in the scale-like leaves (Suzuki, 1979), suggesting that these compounds could be synthesized and possibly stored in these structures, just as

62 terpenoids are stored in needle resin ducts in Pinaceae species (Wooding and Northcoate,

1965; Manninen et al., 2002). Figure 3.1 shows a cross section of the central scales, revealing the presence of a central resin gland on the adaxial side (B arrow) and one on the abaxial side (C arrow). We used syringe needles to collect samples from the central glands (B arrow) and lateral positions (A arrow) and assessed the terpenoid profiles of samples by gas chromatography mass spectrometry (GC-MS). This simple procedure revealed no detectable terpenes in the samples from non-gland positions (Figure 3.1A).

Samples from the glands, on the other hand, revealed a terpenoid profile dominated by the monoterpenoids α-thujone, β-thujone, and sabinene (Figure 3.1B). The terpenoid profile obtained from the glands is qualitatively the same as that published for whole foliage (Kimball et al., 2005). Thus, it appears that the majority of stored foliar terpenoids are confined to the resin glands.

We tested this notion further by characterizing a T. plicata variant genotype that lacks monoterpenoids. Microscopy showed that foliage from the variant lacked resin glands (Figure 3.2A, B). The lack of resin storage structures in the variant was confirmed by hand sectioning of leaf samples (not shown). Chemical analysis of leaf terpenoid extracts by GC-MS from variant confirmed previous tests (John Russell, unpublished) that the foliage does not contain monoterpenoids (Figure 3.2D), while the presence of the major T. plicata monoterpenoids was confirmed in the wild type with GC-MS (Figure

3.2C). In summary, multiple lines of evidence link monoterpene storage to foliar resin glands also in T. plicata.

3.3.2 Generation of a de novo leaf transcriptome

As there are no genomic resources available for T. plicata or any closely related plant in the Cupressaceae family, we extracted RNA from multiple scale-like leaves from a single branch of wild type and variant trees. RNA was from the genotypes pooled into a single sample and converted into cDNA. This cDNA was sequenced on an Illumina

GAIIx machine at the BC Genome Science Centre. The sequencing resulted in >

65,000,000 paired-end reads, of which 55,761,915 could be assembled de novo into

74,999 contiguous sequences (contigs) with an average contig length of 681bp. The

BLASTX application was able to find sequence similarities for 33,207 contigs in the

NCBI database. The contigs with BLASTX matches represented 49,002,907 of the total reads, with mean lengths of 1039bp and mean coverage per base of 85.9 times (Table

3.1). This transcriptome represent approximately 34.5Mbp of new sequence information for T. plicata. BLAST2GO software was used to assign annotations to each contig with

BLASTX matches.

3.3.3 Genes with expression associated with the presence of foliar resin glands

The gland-less T. plicata variant provided us with the opportunity to screen for genes that are expressed at elevated levels in foliage with glands relative to foliage without glands and thereby indirectly identifying genes that are expressed in gland tissues. To this end, we extracted RNA from scale-like leaves of the two genotypes and utilized Illumina Tag profiling to identify genes whose expression differed between the two samples. cDNA tags generated from both the wild type and variant plant RNA samples were aligned against the leaf transcriptome using different levels of required

64 base pair match lengths and SNP allowances. Approximately 5 million of 16 million tags from each library aligned to the transcriptome. Using a conservative criteria for tag to template alignment, a total of 604 contigs with expression greater than tenfold difference in expression between wild type and variant trees. Over 300 of these contigs showed a complete absence in tag matches from the variant tag profiling library (Figure 3.3A). The genes with the highest representation within this dataset are summarized in Supplemental

Table 3.3. The top 10 gene ontology annotations for cellular component, molecular function and biological process is summarized in Figure 3.3B-E. Annotations related to terpenoid biosynthesis, such as targeting to plastids and transmembrane transport, are strongly represented in the gene ontogeny results. We identified a number of genes with predicted gene products that are potentially involved in terpenoid production including eight terpene synthases, four cytochrome p450s, two dehydrogenases and two reductases.

Of the eight terpene synthase contigs, only four were over 1000bp and of these, only three were represented by more than 10 tags in the wild type tag profiling dataset. We were unable to amplify one of the cytochrome P450 contigs by PCR.

3.3.4 Identification of potential thujone candidate genes by phylogenetic analysis

Phylogenetic analysis and identification of characteristic protein motifs were used to further narrow our list of potential thujone biosynthesis genes. We examined the candidate genes in three ways. First, BLASTX was used to identify the closest possible protein match in Genbank to the translated contig sequences and the phylogeny of the closest matching genes was examined. Next, phylogenic trees were constructed for each contig and sequences obtained from Genbank using ClustalX 2.0. In the case of the

65 terpene synthases, functional motifs were used to characterize genes as mono-, sesqui- or diterpenes as phylogenetic analysis alone may be ineffective in differentiating between mono- and sesquiterpene synthases (Keeling and Bohlmann, 2006).

Plant terpene synthases are subdivided into seven subfamilies (TPS-a to TPS-g), with gymnosperm terpene synthases exclusively falling into subfamily TPS-d (Keeling and Bohlmann, 2006). Based on BLASTX similarities, contig 788 was found to closely match two known monoterpene synthases, Chamaecyparis obtusa limonene/borneol synthase and Chamaecyparis formosensis α-pinene synthase. ClustalX phylogenetic analysis showed that the monoterpene synthases from the family Cupressaceae forms a separate branch from the remaining monoterpene synthases, all from the family Pinaceae, in the TSP-d1 subfamily (Figure 3.4). The closest BLASTX matches for the other two putative terpene synthases was a diterpenes synthase for contig 37952 and a sesquiterpene synthase for contig 14670, and examination of the functional motifs of the predicted open reading frames of these sequences supported these functions, thus these genes were not examined further as thujone biosynthesis genes. The cDNA and amino acid sequence for the monoterpene synthase contig 788 is shown in Supplemental Figure

3.3.

The tag profiling and quantitative PCR (QPCR) datasets identified three candidate cytochrome P450’s with high levels of differential expression between wild type and variant trees. The predicted open reading frames (ORFs) of two of these contigs were incomplete, and 5’ RACE was used to obtain full-length ORFs based on similarity related proteins. The three genes from contigs 9309, 33366 and 444 were renamed T. plicata-

P450-L1, L2 and L3 (TpP450L1-3) respectively (Supplemental Figures 3.4-3.6).

Phylogenetic analysis of the candidate cytochrome P450s found all three contigs to fall into different cytochrome P450 subfamilies (Figure 3.5). TpP450-L1 is unique and does not share a close similarity to a known conifer cytochrome P450. The closest amino acid identity match for TpP450-L1 is a 34% amino acid identity match with a cytochrome

P450 from Eschscholzia californica in the subfamily CYP719A which catalyzes methylenedioxy bridge formation in isoquinoline alkaloid biosynthesis (Ikezawa et al.,

2009). TpP450-L2 groups into the CYP720B subfamily, which contains CYP720B1 and

CYP720B4, known to be involved in the oxidation of diterpenes to generate diterpene resin acids in Pinus taeda (Hamberger and Bohlmann, 2006; Zulak and Bohlmann, 2010).

TpP450-L3 was found to belong to the CYP75 subfamily, which contain cytochrome

P450s involved in mono-, sesqui- and diterpene metabolism (Ro et al., 2005). Genes in the CYP75 family of cytochrome P450s are also speculated to be involved in B-ring hydroxylation during flavonoid biosynthesis (Ayabe and Akashi, 2006).

Tag profiling identified candidates for both the dehydrogenase and reductase steps in the thujone biosynthesis pathway (Supplemental Figures 3.7 and 3.8). Both contigs contain approximately 90% of the predicted ORFs based on the length of the closest

BLASTX match. Contig 4118 was identified as the strongest candidate sabinol dehydrogenase as the predicted amino acid sequence of this contig has a high identity to a putative short chain alcohol dehydrogenase from Ricinus communis (castor bean) and groups into the short chain alcohol dehydrogenase superfamily.

The proposed thujone biosynthesis pathway shares similarities to menthone biosynthesis in Mentha spp., as both pathways require the action of terpene synthases, cytochrome P450’s, dehydrogenases and reductases and the dehydrogenases responsible

67 for the conversion of (-)-trans-isopiperitenol to (-)-isopiperitenone in peppermint (Mentha x piperita), which belongs to the same short chain alcohol dehydrogenase superfamily

(Croteau et al., 2005). Contig 44628 is the strongest candidate for the final step in thujone production as it shares similarity with (-)-isopiperitenone reductase from peppermint, known to be involved in menthone biosynthesis (Croteau et al., 2005). The cDNA and amino acid sequence for contig 44628 is shown in Supplemental Figure 3.8.

3.3.5 Confirmation of tag profiling results by QPCR

As the tag profiling dataset had no biological replicates, we validated the gene expression by QPCR. Nineteen genes with at least tenfold higher tag counts in wild type compared to variant datasets and with potential roles in thujone biosynthesis or biotic stress responses were selected for QPCR (Supplemental Table 3.2). In total, 15 genes tested with QPCR showed presence of expression in wild type and absence in the natural variants, while three genes showed significantly higher expression in the wild type genotype over the variant (Figure 3.6). Most target genes for each step in the thujone biosynthesis pathway showed either complete absence of detectable expression in the variant, or at least 100 fold greater expression in the wild type trees than in the variants.

3.3.6 Localized gene expression of thujone biosynthesis candidate genes

We used in situ RNA hybridization to sectioned leaf tissues to localize the expression of a monoterpene synthase, contig 788, to resin gland epithelial cells. The negative control sense probes revealed no signal in the epithelial cells (Figure 3.7A). On the other hand, the monoterpene synthase-Contig788 antisense probe produced a strong

68 hybridization signal in the gland epithelial cells (Figure 3.7B). This hybridization signal was very consistent and present in resin glands in both central and lateral scales (Figure

3.7C) throughout the foliage, including early stages of gland development (Figure 3.7D).

These in situ hybridizations give support to the hypothesis that the differentially expressed genes between the wild type and variant genotype found through tag profiling include genes that are expressed specifically in resin gland tissues.

3.3.7 Identification of monoterpene synthase enzymatic activity

While the motif signature of contig 788 suggests it is a monoterpene synthase, it does not provide evidence of specificity of monoterpene synthase activity. To assess the specific activity of the encoded protein, we cloned a fragment containing the complete

ORF into an expression vector, and produced recombinant protein in E .coli (see material and methods). The poly-histidine tagged proteins were partially purified on affinity columns, and combined with the monoterpene synthase substrate geranyl diphosphate for assessment of monoterpene synthase activity. The product profile was assessed by GC-

MS using authentic standards for comparison. Contig 788 proteins produced sabinene as the primary products (87%) and low quantities of the monoterpenes α-pinene (5.5%), myrcene (6.0%), terpinolene (4.2%) limonene (1.5%) and α-thujene (0.4%) (Figure 3.8).

Contig 788 proteins did not show any sesqui- or diterpene synthase activity when combined with farnesyl diphosphate or geranylgeranyl diphosphate substrates, respectively.

3.4 Discussion

3.4.1 Terpene based defenses in T. plicata

Amongst forest trees, T. plicata is known for having exceptionally strong defenses against pests and pathogens (Minroe, 1983). These trees, however, are still susceptible to damage by a number of insects, fungi and mammals, especially on trees growing in sub- optimal environments. Browsing of foliage by ungulates represents one of the highest causes of juvenile tree mortality, but ungulates tend to avoid feeding on trees with abundant leaf monoterpene contents (Strohl et al., 2008; Vourc’h et al., 2002a and

2002c). Populations of T. plicata from parts of its natural range were found to have relatively uniform terpenoid profiles (Von Rudloff et al., 1988), although there is substantial tree to tree variation in the overall abundance of these defense compounds

(Vourc’h et al., 2002a and 2002c). For examples, trees from regions with minimal or absent Sitka black-tailed deer (Odocoileus hemionus sitkensis) populations, such as island populations, tend to have less abundant foliar monoterpenoids (Vourc’h et al., 2002c).

Efforts are currently being made to improve the leaf terpene content in nursery stock T. plicata trees, and this work led to the identification of a variant genotype that lacks both the easily visualized foliage resin glands as well as foliar terpenoids. In Sitka spruce

(Picea sitchensis), resistance to the white pine weevil (Pissodes strobi) was found to be related to the kinetic activities of these three enzymes in the (+)-3-carene synthase gene family (Hall et al., 2011). This study utilizes two genotypes with different monoterpene profiles with great success.

Our main goal was to gain an understanding of the genetics basis of monoterpenoid based defense in T. plicata. We constructed a transcriptome database to

70 identify gene expression differences between the variant and a wild type tree. In total,

604 genes were identified with differential expression, including three putative terpene synthases, one of which matched a monoterpene synthase. This monoterpene synthase gene encodes a multi-product sabinene synthase (TpSS-1) with consistently high foliar expression in the wild type and a complete lack of expression in the variant determined by tag profiling and QPCR. Sabinene is typically the most abundant non-modified monoterpene in T. plicata foliage (Kimball et al., 2005), which is consistent with the high expression level of TpSS-1. This gene also produced all the non-modified monoterpenes that represent at least 1% of the total T. plicata foliar monoterpene profile. This could indicate that this gene is an important contributor to the overall defense response in T. plicata. Differences in the abundance of monoterpenes in the foliage of individual trees could be related to the overall expression of this gene or differences in the encoded proteins kinetics similar to the (+)-carene synthase gene family of Sitka spruce (Hall et al., 2011). Further work should be conducted to explore the use of TpSS-1 as a genetic marker for monoterpene content in T. plicata.

3.4.2 Identification of candidate thujone biosynthesis genes

TpSS-1 may be involved in thujone biosynthesis. In sage, (+)-sabinene was identified as the monoterpene precursor to α-thujone (Croteau, 1996). Sabinene was also hypothesized to be the precursor to α-thujone and β-thujone in T. plicata based on an indirect multivariate analysis of leaf terpenes in 55 Western redcedar populations where a negative correlation between sabinene and α- and β-thujone was observed (Von Rudloff et al., 1988). Based on our study, we found the only differentially expressed monoterpene

71 synthase gene was TpSS-1. If another monoterpene synthase was responsible for the production of the very abundant thujone monoterpenes, it likely would have been detected in abundance in the tag profiling dataset.

Based on the proposed thujone biosynthesis pathway, following the production of sabinene, there are three additional steps in the production of thujone. We identified candidate genes in the tag profiling dataset by examining functional annotations and similarities to known genes involved in the modification of terpenoids. Three putative cytochrome P450 genes were identified in the tag profiling dataset with expression that was absent or very low in the variant. The phylogeny of TpP450-L1 speaks against a role in thujone biosynthesis, except that this gene matches no known conifer terpene synthase and shares only a weak similarity to member of the CYP719A subfamily. TpP450-L1 could be a member of an uncharacterized subfamily of cytochrome P450s that modify monoterpenes. Thujone is produced by few conifers, primarily members of the family

Cupressaceae, and with little genetic information from these plants within public databases to compare with, it is possible that this gene may belong to a previously uncharacterized group of monoterpene modifying cytochrome P450s. TpP450-L2 is a strong thujone biosynthesis candidate gene as it falls within the CYP720 gene family with member known to modify diterpenoids (Zulak and Bohlmann, 2010). This cytochrome

P450 may alternatively be involved in the biosynthesis of diterpene resin acids, as present with T. plicata foliage (Vourc’h et al., 2001), and similar to genes in the same subfamily.

The final cytochrome P450 we identified, TpP450-L3, grouped in the CYP75 subfamily with members known to modify terpenoids and flavonoids (Ro et al., 2005; Ayabe and

Akashi, 2006). Two partial mRNA’s matching a short chain alcohol dehydrogenase and

Rossman superfamily reductase were also identified, however very few similar genes have been isolated and characterized from any conifer. As such, it is difficult to speculate further on their potential in thujone biosynthesis.

3.4.3 Genes with potential roles in defense

The tag profiling dataset identified a number of potential genes that could directly be involved in terpenoid biosynthesis, as well as genes that may play important roles in terpenoids production within foliar resin glands of T. plicata. Gene ontology annotations identified some of these genes as transcription factors, genes involved in lipid transfer, proteases, catalases, kinases, phospholipases, and several other protein families such as dirigent-like proteins, disease resistant proteins and a number of proteins that had high similarity to Picea sitchensis ESTs with no gene ontology annotations. MYB family transcription factors are involved in the regulation of multiple genes in plants (Martin and

Paz-Ares, 1997), and some have been found to be involved in the shikimate pathway regulating flavonoid biosynthesis (Tohge et al., 2005; van Schie et al., 2006). Many of the target genes also had gene ontology annotations pointing towards flavonoid biosynthesis pathways, however the role of these compounds in T. plicata foliar resin is currently unknown. Two AP2 ethylene response factor transcription factor matching genes were also present within tag profiling dataset; a member of this gene family, ORCA3, is known to be involved in the jasmonic acid mediated expression of genes involved in terpene alkaloids biosynthesis in Catharanthus roseusbio. One of the genes closely matched a phospholipase A, which was proposed to be involved in a signal transduction network for defence response through the up-regulation of terpene synthases, the mevalonate

73 pathway, the methyl-erithritol phosphate pathway, prenyl transferases, and the phenylpropanoid pathway in conifers (reviewed in Philips, et al., 2006). These genes should be analyzed further for their potential roles in thujone or resin acid production in

T. plicata foliage and tested for their potential usefulness as selectable markers.

3.4.4 Transcriptome dataset for T. plicata

This study represents the first attempt at a large-scale transcriptome assembly for

T. plicata. The transcriptome is composed of 33215 unique contigs and 34.5 Mbp of new sequence information. Within the transcriptome, we identified thousands of new sequences as well as previously characterized T. plicata genes, such as members of the dirigent gene family (Kim et al., 2002). While this transcriptome cannot be considered comprehensive for all possible transcripts, it does represent the constitutive expression in the foliage for a mix of two T. plicata genotypes.

Tag profiling using high throughput sequencing technology is known to be a sensitive method to detect individual transcripts expressed at low levels (Liu et al., 2009;

Wang et al., 2010; Mizrachi et al., 2010). Our tag profiling results were successful in identifying differentially expressed genes that may be expressed in resin gland epithelial cells of T. plicata foliar resin gland. In situ hybridization of TpSS-1 found transcripts to be localized to epithelial cells of resin glands in foliage and gives evidence that other genes may also be expressed in these cells.

3.5 Materials and Methods

3.5.1 Characterization of wild type and variant T. plicata lines

Wild type and variant T. plicata trees in this study were obtained from Western

Forest Products and the BC Ministry of Forests respectively. Monoterpenes from upper leaves of both the wild type and variant trees were extracted following a procedure modified from Kimball et al. (2005). For each tree, 1 g of scale leaves was ground in liquid nitrogen. Half the ground sample was stored for RNA extraction and the other 0.5 g was transferred to a 10 mL glass tube and extracted with 5 mL of ethyl acetate on a horizontal shaker for 30 min. To remove solid tissue, the extract was passed through a glass wool filter and 9-carbon acetate was added as an internal standard. Extracts were then concentrated under a nitrogen stream, and aliquots were analyzed by coupled gas chromatography-mass spectrometry (GC-MS), employing a Varian Saturn 2000 Ion Trap

GC-MS and a Varian workstation version 6.9.1 (Agilent Technologies, Mississauga, ON,

Canada). The GC-MS was fitted with a DB-5MS column [30 m × 0.25 mm (length × inner diam.), 0.25 µm (film)], using the following temperature program: 5 min at 50 °C,

10 °C per min to 280 °C. Monoterpenes were identified by comparing their retention indices (Van den Dool and Kratz, 1963) and mass spectra with those reported in the literature (Adams, 1989) and with those of authentic standards (α-pinene, myrcene, α- and β-thujone: Sigma-Aldrich, Oakville, ON, Canada; sabinene: Indofine, Hillsborough,

NJ, USA; α-thujene: available from previous research in Gries-laboratory).

To determine the storage location of monoterpenes in T. plicata scale leaves, 100 resin glands and 100 locations surrounding the resin glands in the wild type genotype were pierced with a sterile needle. Following penetration of tissue, needles were dipped

75 into 0.5 ml of ethyl acetate to remove any foliar resin, then washed with 70% ethanol and dried prior to piercing another part of tissue. Because of the volatile nature of monoterpenes, resin gland and surrounding tissue needle extractions were performed at different times and on different leaves to prevent cross-contamination of samples.

3.5.2 Leaf transcriptome construction

RNA was extracted from 1 g foliage of T. plicata as described previously by

Kolosova et al. (2004). Foliage was harvested at midday from the top 1/3 of 2-year-old wild type and variant plants grown in a growth chamber at 20 °C with day length of 16 hr and relative humidity of 50 to 70%. RNA from both trees was pooled together at an equal ratio and sent to the Canada’s Michael Smith BC Genome Science Center for construction of a full length cDNA library and subsequent sequencing. The cDNA library was fragmented with the final size of approximately 180-380 bp, and prepared for

Illumina paired-end sequencing. Sequencing was conducted on an Illumina Genome

Analyzer IIx (GAIIx) with an average read length of 75 bp.

The Illumina sequencing reads were assembled into a transcriptome library using the DNASTAR SeqMan Pro NGen software package. Reads were first screened to remove expected Illumina paired-end adapter and primer sequences then de novo assembled with a mer length of 21 bp and expected match rate of 85%. Contigs with fewer than ten reads were removed from the final transcriptome. BLASTX was used to compare sequences with the NCBI nr database. Only contigs having a BLASTX match with significance value 1e10-3 were further annotated, and used as a template for Illumina tag profiling. BLAST2GO (Conesa et al., 2005; Gotz et al., 2008; Conesa and Gotz,

2008) was used to determine functional gene ontology annotations using the default parameters.

3.5.3 Illumina tag profiling

Total RNA was used for cDNA library synthesis. RNA from both the wild type and variant tree trees was individually prepared for the digital gene expression analysis at the Canada’s Michael Smith Genome Science Center. cDNA was generated and treated using the Illumina Tag Profiling DPNII Sample Prep Kit. Tags were then sequenced using the Illumina GAIIx with an average read length of 35 bp by Canada's Michael

Smith Genome Sciences Centre (Vancouver).

Contigs from the transcriptome with BLASTX matches were used as the template for aligning tags using DNASTAR NGen2 software. Each tag library was analyzed individually against the template transcriptome with alignment accuracy set at 90% for 17 bp mer matches, which allowed one single nucleotide polymorphism (SNP) between the template and tag. Expression patterns between wild type and the variant were compared by calculating the number of tags aligned to each contig in the transcriptome. Expression between the two tag profiling libraries was normalized based on the ratio between the total amounts of tags in each library.

3.5.4 Quantitative real time PCR

QPCR was used to quantify gene expression and validate tag profiling data by confirming expression differences. Nineteen genes up-regulated in wild type T. plicata were selected from the dataset based on their similarity to genes in the dicot thujone

77 biosynthesis pathway and a range of genes involved in a variety of cellular processes and amplified using QPCR to quantify gene expression. Primers listed in Supplemental Table

3.1 were used to amplify gene sequences which aligned closely to the major tag sites.

Each set of primers was tested against three wild type and three variant line biologically replicated cDNA templates with three technical replicates per sample using Dynamo

Flash SYBR Green QPCR Kit (Finnzymes). In addition to the nineteen candidate genes tested with QPCR, the geometric mean CT values for three housekeeping genes with

BLASTX results matching an elongation factor, a poly-ubiquitin and an actin-like protein were chosen from the transcriptome to provide values for normalizing QPCR results.

Gene expression was determined by the ∆CT method and expression differences between the wild type and variant plants were determined by the ∆∆CT method (Tsai et al., 2006).

Statistical analysis was conducted using JMP 8 (SAS Institute).

3.5.5 Selection of candidate thujone biosynthesis genes

BLASTX results from contigs with strong tag profiling differentiation expression were screened to find contigs in the same families as genes expected to be involved in thujone biosynthesis. We targeted contigs with BLASTX similarities to terpene synthases, cytochrome P450s, alcohol dehydrogenases and aldo-keto reductases. Within the terpene synthase family, we examined contigs for their conserved plastid targeting sequences, DDXXD motifs and RRX8W motifs (Keeling and Bohlmann, 2006; Keeling et al., 2008). We used the presence or absence of the conserved regions to classify the contigs as monoterpene, sesquiterpene or diterpene synthases. Amino acid sequences for each candidate genes were compared with known amino acid sequences from genes in

78 other conifers and plant species from NCBI Genbank. Phylogenetic trees for each candidate gene family were constructed using ClustalX.

3.5.6 Rapid amplification of cDNA ends (RACE)

Rapid amplification of cDNA ends (RACE) was performed on two candidate cytochrome P450 contigs (9309 and 33366) from the leaf transcriptome that had over 25 tags matching from the wild type dataset but lacked tag matches from the variant tag profiling dataset. To acquire the 5’-terminus missing from the two contigs, the First

Choice Ligase Mediated Rapid Amplification of cDNA Ends kit (RLM-RACE; Ambion) was used. Two CDNA libraries were generated using Superscript III with gene specific primers GSP9309-AAATCTAAATCTACTTTATGTTATGTT and GSP33366-

ACAGTGGA-ACTTCAAACAAC. Forward primer for contig 9309 and contigs 33366 were used in combination with 5’ Ambion Inner RACE primer (Forward9399-GCATGG-

CAACTAGGACGACA; Forward 33366-GGCGAGAGTGATGGGAACAT). PCR was conducted using Phusion polymerase (Finnzymes). PCR products were then gel purified using the QIAquick Gel Extraction Kit (Qiagen). Purified PCR products were cloned into vector ptz57RT using InsTAclone PCR Cloning Kit (Fermentas). Positive colonies were sequenced using standard M13/pUC forward and M13/pUC reverse sequencing primers

(Macrogen Inc.).

3.5.7 Localized expression of a monoterpene synthase by in situ hybridization

Contig 788 was cloned by PCR using wild type template with Phusion polymerase and specific primers (Contig788insituF- CCAATG-GCTCTTTTCTCTGC

79 and Contig788insituR-CCAATGGAATAGGTTCTAGTAGGAT-TTG) to generate an

1814bp product. The PCR product was blunt end ligated into pBluescript SK- using T4

DNA ligase (Fermentas). Orientation of PCR inserts relative to T7 promoter site in the plasmids was determined by sequencing using T7-F universal primers (Macrogen Inc.).

Sense and antisense probes were synthesized using the procedure outlined by

Brewer et al. (2006). Sense and antisense probes were synthesized for each contig by T7

RNA polymerase using DIG labeled UTP (Brewer et al., 2006). Concentration of in situ hybridization probes was determined using the DIG Nucleic Acid Detection Kit (Roche).

Leaves were dehydrated, fixed, embedded in paraffin wax and sectioned following the technique of Brewer et al. (2006). In situ hybridization was performed according to Floyd and Bowman (2006) except 300 µl of Western Blue Stabilized

Substrate for Alkaline Phosphatase (Promega) was pressed between the slide and a glass cover slip and incubated in a dark sealed container overnight at room temperature. The staining procedure was stopped after 30 min to 1 hr by dipping slides into TE buffer and rinsing twice for 3 min each. The Western blue staining allows the hybridized probes to be visualized by staining the alkaline phosphatase attached to the FAB fragment (Brewer et al., 2006).

3.5.8 Functional characterization of a monoterpene synthase

Expression of recombinant terpene synthase enzyme and functional characterization followed the general procedures described in Martin et al. (2004).

Primers (TPS-attb-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGGCTCT-

TTTCTCTGCT and TPS-attb-R: GGGGACCACTTTGTACAAGAAAGCTGGGTA-

AAATTACAATGGAATAGG) were designed with attB1 sites to clone the full translated region of the contig 788 into the gateway vector pDONR/Zeo (Invitrogen). Step-wise

PCR was conducted using Phusion polymerase. PCR products were cloned into pDONR/Zeo using BP Clonase II (Invitrogen) following the manufacturer’s instructions.

The recombinant plasmid was cloned into competent E. coli (Lucigen) and selected using zeocin. Plasmid pDONR-contig788 was purified using Wizard SV plus miniprep kit

(Promega). Contig 788 was cloned into pDEST17 expression vector (Invitrogen) in frame with the 6x poly histidine sequence using LR Clonase II (Invitrogen). Positive clones were screened by sequencing using T7 Forward and T7 Reverse universal primers

(Macrogen Inc.).

Recombinant protein expression and partial purification was performed as described by Keeling et al. (2008) and monoterpene synthase functional analysis was performed as described previously by O’Maille et al. (2004), Keeling et al. (2008) and

Hall et al. (2011).

3.6 References

Adams, R.P. (1989). Identification of essential oils by ion trap mass spectrometry. Academic, San Diego, California.

Ayabe, S., and Akashi, T. (2006). Cytochrome P450s in flavonoid metabolism. Phytochem. 5: 271-282.

Bohlmann, J., Steele, J., and Croteau, R. (1997). Monoterpene synthases from grand fir (Abies grandis). cDNA isolation, characterization, and functional expression of myrcene synthase, (-)-(4S)-limonene synthase, and (-)-(1S, 5S)-pinene synthase. J. Biol. Chem. 272: 21784-21792.

Brewer, P. B., Heisle, M. G., Hejatko, J., and Benkova, E. (2006). In situ hybridization for mRNA detection in Arabidopsis tissue sections. Nat. Protoc. 1: 1462-1467.

Byun-McKay A., Godard K.A., Toudefallah M, Martin D.M., Alfaro R., King J., Bohlmann J., and Plant A. (2003). Wound-induced terpene synthase gene expression in sitka spruce that exhibit resistance or susceptibility to attack by the white pine weevil. Plant Physiol. 140: 1009-1021.

Chambers K.L. (1993). Thuja. Flora of North America Editorial Committee (eds.): Flora of North America North of Mexico, Vol. 2. Oxford University Press.

Conesa, A., and Gotz, S. (2008). Blast2GO: A Comprehensive Suite for Functional Analysis in Plant Genomics. Int. J. Plant. Genomics. 2008: 619832.

Conesa, A., Gotz, S., Garcia-Gomez, J. M., Terol, J., Talon, M., and Robles, M. (2005). Blast2GO: a universal tool for annotation, visualization and analysis in functional genomics research. Bioinformatics. 21: 3674-3676.

Croteau, R. (1996). Biochemistry of monoterpenes and sesquiterpenes of the essential oils. In L. E. Craker, & J. E. Simon (Eds.), Herbs, spices, and medicinal plants: Recent advances in botany, horticulture and pharmacology (pp. 110-111) Food Products Press.

Croteau, R.B., Davis, E.M., Ringer, K.L., and Wildung, M.R. (2005). (-)-Menthol biosynthesis and molecular genetics. Naturwissenschaften. 92: 562-577.

Dehal S.S., and Croteau R. (1987). Metabolism of monoterpenes: specificity of the dehydrogenases responsible for the biosynthesis of camphor, 3-thujone, and 3- isothujone. Arch. Biochem. Biophys. 258: 287-291.

Floyd, S.K., and Bowman, J.L. (2006). Distinct developmental mechanisms reflect the independent origins of leaves in vascular plants. Curr. Biol. 16: 1911-1917.

Gonzalez, J.S. (2004). Growth properties and uses of western red cedar. Forintek Canada Corp. Special Publication No SP-37R.

Gotz, S., Garcia-Gomez, J.M., Terol, J., Williams, T.D., Nagaraj, S.H., Nueda, M.J., Robles, M., Talo, M., Dopazo, J., and Conesa, A. (2008). High-throughput functional annotation and data mining with the Blast2GO suite. Nucleic Acids Res. 36: 3420-3435.

Hall, D.E., Robert, J.A., Keeling, C.I., Domanski, D., Quesada, A.L., Jancsik, S., Kuzyk, M.A., Hamberger,B., Borchers, C.H., and Bohlmann, J. (2011). An integrated genomic, proteomic and biochemical analysis of (+)-3-carene biosynthesis in Sitka spruce (Picea sitchensis) genotypes that are resistant or susceptible to white pine weevil. Plant J. 65: 936-948.

Hamberger, B., and Bohlmann, J. (2006). Cytochrome P450 mono-oxygenases in conifer genomes: discovery of members of the terpenoid oxygenase superfamily in spruce and pine. Biochem. Soc. Trans. 34: 1209-1214.

Ikezawa, N., Iwasa, K., and Sato, F. (2009). CYP719A subfamily of cytochrome P450 oxygenases and isoquinoline alkaloid biosynthesis in Eschscholzia californica. Plant Cell Rep. 28: 123-133.

Keeling, C.I., and Bohlmann, J. (2006). Genes, enzymes and chemicals of terpenoid diversity in the constitutive and induced defence of conifers against insects and pathogens. New Phytol. 170: 657-675.

Keeling, C.I., Weisshaar, S., Lin, R.P.C., and Bohlmann, J. (2008). Functional plasticity of paralogous diterpene synthases involved in conifer defense. PNAS. 105: 1085-1090.

Kim, M.K., Jeon, J.-H., Fujita, M., Davin, L., and Lewis, N.G. (2002). The western red cedar (Thuja plicata) 8-8' DIRIGENT family displays diverse expression patterns and conserved monolignol coupling specificity. Plant. Mol. Biol. 49: 199-214.

Kimball B.A., Russell J.H., Griffin D.L., and Johnston J.J. (2005). Response factor considerations for the quantitative analysis of western redcedar (Thuja plicata) foliar monoterpenes. J. Chromatogr. Sci. 43: 253-258.

Kolosova, N., Miller, B., Ralph, S., Ellis, B.E., Douglas, C., Ritland, K., and Bohlmann, J. (2004). Isolation of high-quality RNA from gymnosperm and angiosperm trees. Biotechniques 36: 821-824.

Liu, X., Jiang J., Shao J., Yiu, Y., and Ma, Z. (2010). Gene transcription profiling of Fusarium graminearum treated with an azole fungicide tebuconazole. Appl. Microbiol. Biotechnol. 85: 1105-1114.

Manninen, A.-M., Tarhanen, S., Vuorinen, M., and Kainulainen, P. (2002). Comparing the variation of needle and wood terpenoids in Scots pine provenances. J. Chem. Ecol. 28: 211-228.

Martin, C., and Paz-Ares, J. (1997). MYB transcription factors in plants. Trends Genet. 13: 67-73.

Martin J., and Baltzinger C. (2002). Interaction among deer browsing, hunting and tree regeneration. Can. J. Forest Res. 32: 1254-1264.

Martin J., and Daufresne T. (1999). Introduced species and their impacts on the forest ecosystem of Haida Gwaii. In: Proceedings of the Cedar Symposium: Growing Western Redcedar and Yellow-Cypress on the Queen Charlotte Islands/Haida Gwaii. Edited by G. Wiggins. Canada, British Columbia South Moresby Forest Replacement Account, BC, Ministry of Forests, Victoria, BC, p. 69-83.

Martin D., Tholl D., Gerhenzon J., and Bohlmann J. (2002). Methyl jasmonate induces traumatic resin ducts, terpenoid biosynthesis, and terpenoid accumulation in developing xylem of Norway spruce stems. Plant Physiol. 129: 1003-1018.

Martin, D.M., Fäldt, J., and Bohlmann J. (2004). Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS- d subfamily. Plant Physiol. 135: 1908-1927.

Miller, B., Madilao, L.L., Ralph, S., and Bohlmann, J. (2005). Insect-induced conifer defense: White pine weevil and methyl jasmonate induce traumatic resinosis, de novo formed volatile emissions, and accumulation of terpenoid synthase and octadecanoid pathway transcripts in Sitka spruce. Plant Physiol. 137: 369-382.

Minroe D. (1983). Western redcedar - a literature review. USDA-Forest Service, Pacific Northwest Forest and Range Experimental Station General Technical Report; PNW- 150.

Mizrachi, E., Hefer, C.A., Ranik, M., Joubert, F., and Myburg, A.A. (2010). De novo assembled expressed gene catalog of a fast-growing Eucalyptus tree produced by Illumunia mRNA-Seq. BMC Genomics. 11: 681.

Morozova, O., and Marra, M.A. (2008). Applications of next generation sequencing technologies in functional genomics. Genomics. 92: 255-264.

O’Maille, P.E., Chappell, J., and Noel, J.P. (2004). A single-vial analytical and quantitative gas chromatography–mass spectrometry assay for terpene synthases. Anal. Biochem. 335: 210–217.

Philips, M.A., Bohlmann, J., and Gershenzon, J. (2006). Molecular regulation of induced terpenoid biosynthesis in conifers. Phytochem. Rev. 5: 179-189.

Pricing Branch, Ministry of Forests, Mines and Lands. (2011). Coast selling price system average log prices for the 3 month period ending 2011-03-31. Ministry of Forests, Mines and Lands. Online:http://www.for.gov.bc.ca/ftp/hva/external/!publish/ web/logreports/coast/2011/3m_Mar11.pdf.

Ro, D-K., Arimura, G-I., Lau, S.Y.W., Piers, E., and Bohlmann, J. (2005). Loblolly pine abietadienol/abietadienal oxidase PtAO (CYP720B1) is a multifunctional, multisubstrate cytochrome P450 monooxygenase. PNAS. 102: 8060-8065.

Russell, J.H. (2008). Deployment of deer resistant western redcedar (Thuja plicata). USDA Forest Service Proceedings. RMRS-P57: 149-153.

Stroh N., Baltzinger C., and Martin J. (2008). Deer prevent western redcedar (Thuja plicata) regeneration in old-growth forests of Haida Gwaii: Is there a potential for recovery? For. Ecol. Manag. 255: 3973-3979.

Suzuki, M. (1979). The course of resin canals in the shoots of conifers II. Araucariaceae, Cupressaceae and Taxodiaceae. J. Plant Res. 92: 253-274.

Tohge, T., Nishiyama, Y., Hirai, M.Y., Yano, M., Nakajima, J.-I., Awazuhara, M., Inoue, E., Takahashi, H., Goodenowe, D.B., Kitayama, M., Noji, M., Yamazaki, M., and Saito, K. (2005). Functional genomics by integrated analysis of metabolome and transcriptome of Arabidopsis plants over-expressing an MYB transcription factor. Plant J. 42: 218-235.

Tsai, C-J., Harding, S.A., Tschaplinski, T.J., Lindroth, R.L., and Yuan, Y. (2006). Genome-wide analysis of the structural genes regulating defense phenylpropanoid metabolism in Populus. New Phytol. 172: 42-62.

Van den Dool, H., and Kratz, P.D. (1963). A generalization of retention index system including linear temperature programmed gas-liquid partition chromatography. J. Chromatogr. 2: 463-471.

Van Schie, C.C.N., Haring, M.A., and Schuurink, R.C. (2006). Regulation of terpenoid and benzenoid productions in flowers. Curr. Opin. Plant Biol. 9: 203-208.

Von Rudloff, E., Lapp, M.S., and Yeh, F.C. (1988). Chemosystematic study of Thuja plicata: Multivariate analysis of leaf oil terpene composition. Biochem. Syst. Ecol. 16: 119-125.

Vourc’h G., Russell, J., and Martin, J. (2002a). Linking deer browsing and terpene production among genetic identities in Chamaecyparis nootkatensis and Thuja plicata. Heredity. 93: 370-376.

Vourc’h, G., Garine-Wichatitsky, M., Labbé A., Rosolowski, D., Martin, J., and, Fritz, H. (2002b). Monoterpene effect on feeding choice by deer. J. Chem. Ecol. 28: 2411-2427.

Vourc'h, G., Martin, J.-L., Duncan, P., Escarré, J., and Clausen, T.P. (2001). Defensive adaptations of Thuja plicata to ungulate browsing: a comparative study between mainland and island populations. 126: 84-93.

Wang, Q.Q., Liu, F., Chen, X.S., Ma, X.J., Zeng, H.Q., and Yang, Z.M. (2010). Transcriptome profiling of early developing cotton fibers by deep-sequencing reveals significantly differential expression of genes in a fuzzless/lintless mutant. Genomics. 96: 369-376.

Wooding, F.B.P., and Northcote, D.H. (1965). The fine structure of the mature resin canal cells of Pinus pinea. J. Ultrastruct. Res. 13: 233-244.

Zulak, K.G., and Bohlmann, J. (2010). Terpenpoid Biosynthesis and Specialized Vascular Cells of Conifer Defense. J. Integr. Plant Biol. 52: 86-97.

3.7 Figures

Figure 3.1. Comparison of monoterpene content in mature foliage between resin glands and surrounding area. Letters indicate location of monoterpene extraction and the monoterpene profile of the extracts. A) No monoterpenes were detected by GC-MS from tissue extracted from areas surrounding the resin glands. B) Monoterpenes were detected in resin glands by GC-MS. Arabic numeral on peaks represents the following compound: 1 = thujene, 2 = α-pinene, 3 = sabinene, 4 = myrcene, 5 = α- thujone, 6 = β-thujone, and IS = internal standard (9-carbon acetate). C) Resin gland on the abaxial side of the leaf.

Figure 3.2. Anatomical and chemical differences between wild type and variant T. plicata genotypes. A) Wild type genotype foliage with a visible resin gland. B) Variant genotype foliage without visible resin glands. C) Wild type GC-MS. Gas chromatograph of monoterpenes extracted from the foliage of 2 -year-old trees. Arabic numeral on peaks represents the following compound: 1 = thujene, 2 = α-pinene, 3 = sabinene, 4 = myrcene, 5 = α-thujone, 6 = β-thujone, and IS = internal standard (9-carbon acetate). D) GC-MS of monoterpenes extracted from variant foliage. Variant GC-MS shown displays a maximum of 350 KCounts to show that no traces of monoterpenes were detected.

Figure 3.3. Annotations of contigs with tenfold upregulation in the tag profiling dataset. A) Distribution of contigs with greater than 10 fold upregulation in wild type compared to variant genotypes. Top ten GO term assignments for the differentially expressed contigs in the categories of B) cellular component, C) molecular function and D) biological process.

Figure 3.4. Phylogenetic tree of TPS-d terpene synthases displaying evolutionary relatedness of T. plicata contig 788 to other conifer terpene synthases. TPS-d is subdivided into TPS-d1 which contain mono and sesquiterpene synthases, TPS-d2 which contains sesquiterpene synthases and TPS-d3 which contains diterpene synthases. Five letter codes are used for terpene synthesis in the tree. The first two letters show species as follows: Abies bracteata – Ab; Abies grandis – Ag; Chamaecyparis formosensis – Cf; Chamaecyparis obtusa – Co; Ginkgo biloba – Gb; Picea abies – Pa; Picea glauca – Pg; Picea sitchensis – Ps; Pinus taeda – Pt; Pseudotsuga menziesii – Pm; Taxus brevifolia – Tb; Taxus wallichiana – Tw. The next three letters show terpene product as follows: pinene – PIN; limonene – LIM; linalool – LIN; camphene – CAM; myrcene – MYR; terpinolene – TER; phellodrene – PHE; carene – CAR; farnesene – FAR; longifoliene – LON; selinene – SEL; germacradien-4-ol – GER; longifolene – LON; bisabolene – BIS; humulene – HUM; taxadiene – TAX; abietadiene; ABI; levopimaradiene – LEV; borneol – BOR; isopimara-7,15-diene – ISO. Also shown is a terpene synthase from the TPSa subfamily Nicotiana attenuata 5-epi-aristolochene synthase (NaARI). Branch lengths are a measure of the amount of divergence between two nodes in the tree. The unit of measure for the branches and the scale bar is the number of amino acid substitutions per site.

Figure 3.5. Phylogenetic tree of gymnosperm cytochrome P450’s from Genbank showing the evolutionary relatedness of Thuja plicata P450-L1, P450-L2 and P450-L3. The CYP90 subfamily is highlighted in red and the CYP720 subfamily is highlighted in blue. P450-L1 does not group with any known conifer cytochrome P450 and is highlighted in green. Branch lengths are a measure of the amount of divergence between two nodes in the tree. The unit of measure for the branches and the scale bar is the number of amino acid substitutions per site.

Figure 3.6. Quantitative PCR results for genes expressed in the leaves of wild type and variant T. plicata trees. A) Contigs matching terpene synthases, B) cytochrome P450s, C) dehydrogenases, D) reductases, E) other gene families. Mean RTA is the relative transcript abundance between the wild type and variant genotypes. (Student’s paired t-test; ** = shows absence of detectable levels of transcript in the variant genotype with 35 QPCR cycles, * = a significant difference in expression between the wild type and the variant (p < 0.05)).

Figure 3.4. TpSS1 expression localized to the epithelial cells of scale leaf resin glands. A) Cross-section of leaf hybridized with sense strand. B) Cross-section of leaf hybridized with anti-sense strand. C) Longitudinal section of leaf primordium hybridized with anti-sense stand. D) Longitudinal section of leaf hybridized with anti-sense stand.

Figure 3.5. GC-MS analysis of products formed in vitro by recombinant contig 788 protein. Recombinant protein from contig 788 produced sabinene as the major product. Arabic numeral on peaks represents the following compound: 1 = α- pinene, 2 = α-thujene, 3 = sabinene, 4 = myrcene, 5 = unknown monoterpene, 6 = limonene, 7 = β- ocimene and 8 = terpinolene. Mass spectrometry was used to determine the identity of each peak by comparison to pure standards.

3.8 Tables

Table 3.1. Summary of de novo assembled of paired end Illumina sequenced leaf transcriptome from a total of 65 million reads. Contigs with BLASTX results have at least one match from the NCBI nr database with E > 10-3.

3.9 Supplemental Figures

Supplemental Figure 3.1. Thujone biosynthesis pathway from Artemisia absinthium, Tanacetum vulgare, and Salvia officinalis (Croteau, 1996).

Supplemental Figure 3.2. Summary flowchart for terpenoid biosynthesis gene discovery in T. plicata.

)

(

Thuja plicata

Nucleic Nucleic acid and predicted amino acid sequence for contig 788 (

1). 1).

Supplemental Supplemental Figure synthase sabinene The region underlined in black shows QPCR amplified sequence. The region tag alignment. for site primary the is acid sequence nucleic highlighted in red shown above the

). The ). region

TpP450

the primary site for tag tag alignment. for site the primary

Nucleic acid and predicted amino acid sequence for contig 9309 (

Supplemental Supplemental Figure shows black in QPCR sequence. underlined amplified is sequence acid nucleic the above shown highlighted red in region The

). ). The

TpP450

sequence. sequence.

Nucleic Nucleic acid and predicted amino acid sequence for contig 33366 (

Supplemental Supplemental Figure black in underlined QPCR shows region amplified tag the is alignment. for site sequence primary acid nucleic the above shown highlighted red in region The

100

). ). The region

TpP450

sequence sequence for contig 1534 (

Nucleic Nucleic acid and predicted amino acid

underlined in black shows QPCR amplified sequence. shows black in QPCR sequence. underlined amplified tag the is alignment. for site sequence primary acid nucleic the above shown highlighted red in region The Supplemental Figure

101

e the nucleic acid sequence is the primary site for tag tag the is alignment. for site sequence primary acid nucleic the e

Nucleic Nucleic acid and predicted amino acid sequence for contig 5345 putative short chain

alcohol dehydrogenase. The region underlined in black shows QPCR amplified sequence. QPCR shows underlined sequence. black in amplified region The dehydrogenase. alcohol abov shows highlighted red in region The Supplemental Figure

102

Nucleic Nucleic acid and predicted amino acid sequence for contig 44628 a putative short chain

. . The region underlined in black shows QPCR amplified sequence. The region highlighted in red shown

Supplemental Supplemental Figure reductase sequence tag primary the is alignment. for site nucleic the acid above

103

3.10 Supplemental Tables

Supplemental Table 3.1. Primers used in QPCR validation of tag profiling

Contig # Left Primer Right Primer 19 GGCCATCCTCCAACTGCTTA CTGGAAGACGGACGCACTTT 678 TTTGGGGTGATGGGACTGAT CCATTGAAGAACTTTGGGATGG 788 GGCAACCATCATCCCAACTT CAAGTGCTTGGGCAATTTCA 1536 ATTCCTTTTGGGGCAGGAAG CCTCGAAGTTGGAATAGCAAAGA 1586 TTGGTGTTATGGCGTGCTTG AACCTCCCAATGTCAACTCCA 2639 TGATGATGGTCACGCTGATTT GCCTACCATGACCGAGGTTG 3214 AATAATGCCCAGTTCAAATCTTCA CCCGGCCCCTACTTATAATCC 4118 ACGTCAGCCATGAAGAAATCAC GTGACGAATCGAAGTATGTGAGC 5211 TCCCGAGTTTGAGGAGTTGC GATTGCCTGTTAAAAAGGAGAATTG 6033 GAAGGTCTTACATTCAAATCTGCATAA AAATGGATGACCGGAGTTGG 8842 TGGAAATGGTGTCTCCATGC CCACGACATATGTGCACTTGAA 9309 CTTGCGATGCTTCACGAGAC CCTCCTTCCTGCTCCAAATG 10157 TTGGCATTGCTCGTAGAGGTT CAGGCCATCGGTAGAAGTTACA 14596 TTTGAAGGCACCCCACAACAA AAAAAGGCAGCAGAGCAAAGG 14670 TTCCTTGAAGAAGCTTTCAAAACA TTGGTTCGAAGGCAATCCAT 16896 CAGTTGGCATCTGCTTGGAG TCTGCATAAACGTGGGATTCA 20925 GGACACAAACAAATGCAACCA TGGGCTTTTACCTCTCTGTCAA 30526 CAAAACTGCTAAGAGCCCCAAT TGTAACCCAAGTCAGGGGAAA 30947 TCATGGGATGGAGGAAAACC AAGCCAGAGCAGGAGCAATC 33366 CCTCCAAATCCCCATCAAAA TGCCATGGTTGTGGAAGAAG 37952 TGCATCACATATCTCCTTTTGATG AAAGGTTCTACAAAGGAGGATGCTT 44628 TGTCAAGGAGCTGCACCAGT CAAGCCCAGCTTTTTGGAAG

104

Supplemental Table 3.2. Annotated contig function based on BLAST2GO results.

Contig # Annotation Length (bp) 19 Polyubiquitin 2415 678 Reductase-1 1546 788 Monoterpene synthase 1857 1536 P450-L3 1725 1586 Actin-like 1682 2639 Protein kinase 3090 3214 Phospholipase A 746 4118 Short chain dehydrogenase 966 5211 Disease resistant protein 2712 6033 N-like protein 3650 8842 Receptor kinase 2499 9309 P450-L1 1782 10157 Unknown protein 1820 14596 Elongation factor 1355 14670 Diterpene synthase 2793 16896 Phosphatase 427 20925 MYB transcription factor-L1 1533 30526 MYB transcription factor-L2 1109 30947 Dehydrogenase 612 33366 P450-L2 1682 37952 Sesquiterpene synthase 1350 44628 Reductase-2 1066

105

Supplemental Table 3.3. List of contigs with over 25 fold higher transcript abundance in the wild type tag profiling dataset than the variant dataset. List shows contigs that had a minimum of 100 tags in the wild type dataset. Contig BP RTA Sequence description Hit Accession E-Value Score 20480 726 n.d. unknown protein ADE77939 6.67E-11 72.0 16896 466 n.d. tyrosine specific protein phosphatase ADE77054 1.44E-06 56.2 37952 1373 n.d. sesquiterpene synthase AAK83561 1.95E-108 397.5 13150 898 n.d. serine acetyltransferase XP_002974520 4.16E-110 402.1 35197 1233 n.d. plant viral-response family protein ABK25181 1.42E-123 447.6 2525 1099 n.d. phloem-specific lectin pp2-like protein ADE77718 1.43E-60 184.1 23477 3384 n.d. n-like protein AAM28917 7.06E-123 423.3 788 1947 n.d. monoterpene synthase BAC92722 0 639.4 31342 539 n.d. lipid binding AAF75825 2.11E-31 139.0 40333 1063 n.d. leucine-rich repeat protein CAN81857 8.14E-13 79.3 18041 731 n.d. leucine-rich repeat protein ADM74416 4.77E-49 198.7 37272 967 n.d. heat shock protein ABK22474 5.85E-60 235.7 44458 612 n.d. initiation factor eif4-like protein XP_002277218 1.89E-09 66.6 7521 499 n.d. ef-hand calcium binding XP_002979697 1.83E-30 135.6 30947 680 n.d. cytosolic aldehyde dehydrogenase ABR16485 6.06E-85 317.8 9309 1615 n.d. cytochrome p450 BAG75115 6.05E-59 233.4 24037 886 n.d. caffeic acid o-methyltransferase ABK24146 9.43E-91 337.8 44628 1116 n.d. anthocyanidin reductase ABR18365 4.00E-66 256.5 18611 1733 n.d. unknown protein XP_002269604 1.93E-159 567.4 11394 925 n.d. 1-cys peroxiredoxin XP_002265597 2.32E-87 326.6 6687 1527 n.d. 10-DBA transferase AAU89980 2.93E-116 423.7 235 746 874 phospholipase a2 NP_001150728 3.10E-27 126.3 16643 782 704 cytochrome p450 ACN40244 1.68E-82 310.1 17849 853 668 unknown protein ABK26187 7.00E-48 195.3 36237 1714 652 chromosome condensation protein XP_002270622 4.60E-121 439.9 13266 1676 562 ubx domain-containing protein CBI27509 3.75E-128 463.4 1536 1725 448 cytochrome p450 ACN39836 4.31E-135 486.5 44625 514 372 non-ltr retroelement reverse transcriptase CAB40051 4.51E-22 107.8 43335 1714 336 unknown protein XP_002280568 8.03E-142 508.8 75134 194 324 translation factor ABK24036 1.04E-20 103.2 6728 2657 235 nbs lrr ACN40032 2.38E-97 253.4 14670 2817 163 diterpene synthase ADB55710 9.64E-93 233.0 62694 402 148 cyanogenic beta-glucosidase XP_002448027 4.06E-40 100.5 29583 998 146 atp-binding cassette Q949G3 9.38E-109 397.9 3444 1287 138 histone-like protein ADE76482 1.71E-18 98.6 3940 2485 129 unknown protein CAN62440 0 666.4 Continued on next page

106

Continued from previous page 409 1569 124 unknown protein ABR18123 9.19E-97 359.0 29779 591 123 f-box family protein ADE76243 1.42E-19 100.1 10943 1491 118 unknown protein ABK24792 3.35E-109 400.2 26837 1348 116 unknown protein XP_002316362 5.38E-87 326.3 6698 4335 115 gag-pol polyprotein P10978 2.72E-156 345.5 10610 2835 105 unknown protein XP_001751813 1.08E-35 157.1 5345 964 82 short chain alcohol ABK24336 4.11E-90 335.9 72350 229 81 unknown protein ABK20915 2.91E-07 58.5 678 1540 70 aldo keto reductase ABK22537 4.12E-126 456.4 8842 2498 59 unknown protein XP_002314568 3.96E-127 460.7 10801 1500 57 unknown protein ADE76605 3.88E-97 360.1 24527 728 57 unknown protein XP_002304735 3.18E-45 186.0 14267 2946 56 oligomeric golgi complex XP_002267721 0 844.0 69890 201 54 metallothionein-like protein ABK20915 7.62E-08 60.5 9386 1339 53 alkaloid o-methyltransferase ABK24146 2.81E-96 357.1 10469 2835 52 nbs-lrr resistance protein ABR16103 7.32E-125 453.4 28006 1536 52 retrotransposon unclassified CAN68769 2.26E-07 62.0 6201 495 49 mitochondrial import receptor subunit XP_002458194 2.59E-08 62.0 12068 1048 42 cytochrome b YP_003795656 6.58E-76 288.9 6883 1416 39 hydrolase-like protein XP_002271124 9.41E-122 441.8 75064 208 39 metallothionein-like protein ABK20915 9.88E-08 60.1 4690 2301 37 pentatricopeptide containing protein ADE76603 4.46E-85 320.9 40397 1361 34 nadh dehydrogenase subunit 5 ADE18216 1.17E-73 282.0 63561 563 33 unknown protein NP_001057752 8.85E-18 94.0 21426 1142 28 desiccation-related protein pcc13-62 XP_002311374 1.77E-93 347.4 30558 1231 28 unknown protein B8LPG7 2.00E-77 294.3 2754 1645 28 methionine-s-oxide reductase ABK21158 3.75E-48 197.6 24591 2892 27 regulated ion channel XP_002278464 0 948.7 966 2579 26 cysteine proteinase ABK24153 1.27E-168 598.6 5184 1688 26 bzip domain class transcription factor ABR16645 6.23E-30 137.1 15745 1051 25 cdpk-like protein AAM29184 1.71E-23 114.8 964 803 25 histone h2a-like protein ADM78341 6.09E-35 152.1 761 1031 25 cyclophilin CAC81066 4.00E-78 296.2 8329 3152 23 nuclear cap-binding protein CBI24208 0 982.6 11538 3350 23 leucine-rich repeat protein AAY78890 0 767.7 42008 518 23 unknown protein CBI32366 4.60E-22 107.8 Continued on next page

107

Continued from previous page 15692 2711 22 feronia receptor-like kinase XP_002877809 7.55E-180 636.0 2941 1200 22 unknown protein XP_001769426 4.03E-67 260.0 7204 2447 21 long chain fatty acid ligase ABR16405 0 816.2 2337 917 19 bundle sheath defective protein ABK21437 7.03E-36 155.6 275 896 18 metallothionein-like protein ABK20915 2.10E-21 107.5 8497 652 17 nuclear cap-binding protein XP_002276868 3.01E-59 232.3 2621 1127 17 chalcone isomerase ABK23299 5.82E-65 252.7 8913 1580 16 cytochrome c oxidase subunit i NP_739611 1.16E-139 501.5 12504 3181 16 heat repeat-containing protein XP_002280870 0 1105.1 9241 1726 16 serine o-acetyltransferase ABK25315 9.91E-140 501.9 5992 890 16 xylem serine proteinase 1 ADE77855 3.63E-50 203.0 7881 1888 16 cytochrome p450 XP_002284806 3.13E-118 430.6 4010 3170 15 unknown protein XP_001753145 2.63E-54 219.2 6422 1188 15 pre-mrna-splicing factor cwc15 ABK23391 4.54E-71 273.1 754 387 14 phosphorylase AAV65286 6.12E-18 94.0 7701 1821 14 tubulin beta chain protein XP_002961071 0 816.6 4964 1590 14 udp-glucosyl transferase ABR17103 2.86E-154 550.1 12442 968 13 unknown protein ABK26314 1.77E-40 171.0 60340 528 13 dna-3-methyladenine glycosylase EEE57891 4.58E-28 127.9 3226 1342 13 molybdenum cofactor sulfurase ABK21688 1.17E-134 484.6 18770 783 13 HMG-CoA reductase AAQ82685 2.61E-75 286.2 74709 212 13 unknown protein ABK20915 5.41E-06 54.3 4444 756 13 dehydrin protein ACA30294 3.32E-24 116.3 74704 187 13 phosphorylase AAV65286 1.23E-13 79.7 9771 436 13 xyloglucan endotransglycosylase BAD93484 8.21E-39 163.3 9838 1724 12 unknown protein XP_002265815 4.24E-74 283.9 2321 270 12 bark protein AAV65286 2.05E-21 105.5 3306 1215 11 cell wall hydrolase ABK22923 2.77E-15 87.8 5283 538 11 pr10 protein AAL50006 4.68E-04 46.2 28136 354 10 cytochrome c oxidase subunit 2 ABX71343 4.75E-26 120.9 6969 2124 10 erd6-like transporter ADE75821 4.99E-160 569.7 10598 1133 10 unknown protein ABK22098 7.25E-31 139.4 6719 1161 10 cathepsin l-like cysteine proteinase ABO26562 2.55E-87 327.0 3038 1928 10 glycosyltransferase ABR17327 8.09E-154 548.9 2378 2132 10 asparagine synthetase ADU02856 0 964.5 5479 3119 10 unknown protein XP_002524004 5.19E-180 636.7 BP = length of contig in base pairs; RTA = the relative abundance of normalized wild type tags/variant tags; n.d. = no tags detected in variant dataset.

108

4. IDENTIFICATION AND CHARACTERIZATION OF THREE

MONOTERPENE SYNTHASES ACTIVE IN FOLIAGE AND WOOD

DIFFERENTIATION ZONE OF WESTERN REDCEDAR (THUJA PLICATA)

Adam Foster1, Dawn Hall2, Regine Gries1, Gerhard Gries1, Jörg Bohlmann2, Aine Plant1, John Russell3, and Jim Mattsson1

1Department of Biological Sciences, Simon Fraser University, 8888 University Drive, Burnaby, BC, V5A1S6, Canada 2 Michael Smith Laboratories, University of British Columbia, 2185 East Mall, Vancouver, BC, Canada V6T 1Z4 3 Research Branch, British Columbia Ministry of Forests and Lands, Cowichan Lake Research Station, P.O. Box 335, Mesachie Lake, BC, Canada V0R 2N0

This chapter is being presented as a manuscript for submission to the journal ‘The Plant Physiology’ and is formatted as such

Contributions of authors AJF: involved in all experimental work and wrote the majority of this paper. DH:

Assisted and conducted protein functional analysis. RG and GG: Conducted GC-MS and assisted with interpretation of data. JB: provided assistance in protein functional analysis.

AP: Assistance with QPCR. JR: provided plant genotypes and expertise on forest tree species. JM: Writing and interpretation of results.

Keywords: Western redcedar, Thuja plicata, monoterpene synthase, sabinene, terpinolene, resin gland, wood-forming region, α-thujone, ungulate browsing, heartwood rot resistance, molecular marker

109

4.1 Abstract

Western redcedar (Thuja plicata), endemic to the North West American coast, grows into giant trees that are used to produce highly valued lumber as well as leaf and wood oils. These oils, rich in the monoterpenoid compounds thujone and thujaplicin, are used for various commercial applications. In T. plicata, thujone and thujaplicin have been linked to resistance to ungulate browsing and heartwood rot respectively. To date, however, the monoterpene synthases involved in their production are unknown. Here we used next generation sequencing technology to identify the most abundantly expressed monoterpene synthase-encoding transcripts in T. plicata leaf and wood-forming tissues.

We found that the most abundant monoterpene transcript encodes an enzyme that produces primarily sabinene in vitro and is expressed primarily in scale foliage and in wood-forming tissues. This enzyme also produces significant levels of other monoterpenes such as terpinolene in vitro. In addition, we also identified two transcripts that generate enzymes with terpinolene and linalool activity, respectively. These genes were expressed primarily in wood-forming tissues. Since there is evidence that thujone and thujaplicin are derived from sabinene and terpinolene respectively, it is plausible that we have identified key monoterpene synthases involved in the synthesis of these important compounds.

110

4.2 Introduction

British Columbia’s (BC) provincial tree, Western redcedar (Thuja plicata Donn ex Don), is an economically and culturally important tree species to this province.

Despite making up only a small percentage of the total stumpage in BC, T. plicata is regarded as an important tree to the BC economy, with a per log value that generally exceeds all other tree species in Western Canada. Wood from T. plicata is highly valued for being lightweight, strong, dimensionally stable and resistant to rot. Also, T. plicata has been utilized by First Nations for centuries in both construction and cultural practices.

The range of this species is restricted to the Pacific Northwest of North America in coastal regions from Northern California to Alaska. A few scattered populations of T. plicata occur in the interior cedar/hemlock biogeoclimatic zone, but are geographically separated from the coastal populations. T. plicata is also often utilized as an ornamental plant throughout North America and around the world (Minroe, 1983).

Forest management of T. plicata faces two major problems. First, black tailed deer (Odocoileus hemionus sitkensis) and other ungulates have been identified as a primary factor preventing the regeneration due to the trees being a preferred food source

(Martin and Daufresne, 1999; Martin and Baltzinger, 2002; Stroh et al., 2008; Vourc’h et al., 2002a and 2002c). The second major problem is the susceptibility to wood rot in managed forests because, although old-growth T. plicata is regarded as highly durable, second growth heartwood can succumb to early rot, especially in the interior of BC

(DeBell et al., 1999; Daniels and Russell, 2007). Both of these problems, deer herbivory and heart wood rot, have been linked to the levels of monoterpenoids within T. plicata.

111

Monoterpenoid content in foliage is involved in deterring ungulates from feeding on T. plicata seedlings. Ungulates selectively feed on individuals with low levels of foliar monoterpenes, while avoiding those seedlings with higher levels (Vourc’h et al., 2002a).

The foliage of T. plicata is known to contain a wide variety of monoterpenoids with α- thujone, β-thujone and sabinene being the most abundant, followed by α-pinene, myrcene and limonene (Von Rudloff et al., 1988; Kimball et al., 2005). Further research into the ability of individual monoterpenoids to deter deer feeding found the oxygenated monoterpenoids α- and β-thujone to be highly effective in preventing deer feeding, while the hydrocarbon monoterpenes sabinene, α-pinene, myrcene and limonene deterred feeding to a lesser degree (Vourc’h et al., 2002b).

The heartwood of T. plicata and related species contains monoterpenoids with seven rather than six carbons in the ring, known as tropolones. Tropolones have strong antibacterial and antifungal activities (Bentley, 2008) and the tropolone content of T. plicata heartwood correlate with wood decay resistance (DeBell et al., 1999). Five tropolones have been identified in T. plicata, of which β-thujaplicin, γ-thujaplicin and β- thujaplicinol make up 98% by weight of the total tropolone content (Daniels and Russell,

2007). Within a tree, the highest amounts of tropolones are found in the heartwood adjacent to the sapwood near the base of the tree (Swan and Jiang, 1970). Newly formed heartwood in young trees contains less tropolones than newly formed heartwood of mature trees, indicating that as the tree ages, its ability to produce tropolones increases

(DeBell et al., 1999). The tissue or cell type that produces tropolones is unknown and there is no obvious candidate since T. plicata, of the coniferous family Cupressaceae, lack the wood resin ducts so commonly found in the species of the Pinaceae family of

112 conifers. Scattered thin-walled parenchymatic cells with dark content found primarily in wood produced late in the season have been hypothesized, but not confirmed, to produce terpenoid compounds (Gonzales, 2004). It is believed that successive fungal invasion degrades tropolones and other antimicrobial compounds, eventually resulting in unprotected wood that is degraded from the centre outwards (Van der Kamp, 1986).

There are, however, considerable differences in tropolone content between trees of the same age (DeBell, 1999; Daniels and Russell, 2007), implying potential natural genetic variation that can be explored for breeding purposes.

Very little genomic information is available for members of the family

Cupressaceae, including T. plicata. Work on cell cultures from a relative of T. plicata,

Cupressus lusitanica, pinpoints terpinolene as the precursor for β-thujaplicin (Bentley,

2008). While the biosynthesis of tropolones is thought to occur by ring expansion from a monoterpene precursor, such a reaction was demonstrated only recently (Xin and Bugg,

2010). Exposure of monoterpenes to the non-haem iron(II)-dependent extradiol catechol dioxygenase enzyme from E. coli resulted in the formation of a tropolone ring-expansion.

Putative pathways for the modifications of sabinene and terpinolene into thujones and thujaplicins have been suggested (Dehal and Croteau, 1987; Bentley, 2008; Fig. 3.1).

Since specific monoterpene synthase activities most likely are the first committed steps in the synthesis of thujone and thujaplicins, we ventured to identify monoterpene synthase encoding transcript in T. plicata. Molecular genetic information is limited for T. plicata with only a handful of cDNA sequences present in Genbank, none of them encoding a terpene synthase. Recent development of next generation sequencing (NGS) technologies however now allows extensive sequencing and de novo assembly as a

113 relatively rapid method for gene discovery (Ekblom and Galindo, 2010). Here we applied this technology to the sequencing of cDNA generated from mRNA samples (referred to as RNA-Seq), and identified 11 new and unique putative terpene synthase-encoding sequences, which we have characterized further with respect to expression and enzymatic activity.

4.3 Results

4.3.1 454/Roche sequencing of cDNA

Several new NGS technologies allow rapid sequencing of complex cDNA samples. We used the NGS technology provided by Roche/454 Life Sciences to sequence cDNA produced from RNA that was extracted from various tissues and tissue treatments as a method for rapid identification of monoterpene synthase encoding transcripts (see material and methods). In total, we generated 16,076 unique contiguous sequences

(contigs) with an average length of 292bp. This approach yielded 12 partial cDNA sequences that encode putative terpene synthase enzymes (Table 4.1), including TpSS1, a previously characterized T. plicata sabinene synthase-1 (TpSS-1) (Foster et al, unpublished; Chapter 3). Among the newly identified transcripts, TPS-1 and TPS-2 stood out as being represented by the largest numbers of sequence reads (Table 4.1; Fig. 4.2), and are therefore prime candidates for the most abundantly expressed terpene synthase- encoding transcripts in the assessed complex sample. We therefore focused our attention on them. Extension of TPS1 and 2 through 5’ and 3’ RACE generated a 1944 bp cDNA with a predicted 610 amino acid, 72 kDa polypeptide (TPS1), and an 1883 bp cDNA with a predicted 602 amino acid, 67 kDa polypeptide (TPS2). Both TPS-1 and -2 predicted

114 peptides contain the highly conserved terpene synthase RRX8W and DDXXD motifs

(Fig. 4.3; Keeling and Bohlmann, 2006). The N-terminal regions also contain a plastidial targeting sequence, characteristic of monoterpene and diterpene synthases but lack the conserved 210 amino acid region typical of diterpene synthases (Keeling and Bohlmann,

2006). Thus, the predicted peptides of TPS-1 and -2 contain the motif combination typical of monoterpene synthases. Based on amino acid sequence comparisons, all three derived polypeptide sequences are most closely related to putative monoterpene synthases from other species of the Cupressaceae family (Table 4.1).

4.3.2 Identification of enzymatic activity

While the motif signature of TPS1 and 2 matched that of monoterpenes, it does not provide evidence of specificity of monoterpene synthase activity. To assess the specific activities of encoded proteins, we cloned fragments containing the complete open reading frames into an expression vector, and produced recombinant protein in E .coli.

The poly-histidine tagged proteins were partially purified on affinity columns and combined with the monoterpene synthase substrate geranyl diphosphate (GPP) for assessment of monoterpene synthase activity. The product profile was assessed by gas chromatography-mass spectrometry (GC-MS) using authentic standards for comparison.

TPS1 produced primarily the monoterpene terpinolene (93.3% ± 2.3%) with minor products α-terpineol (3.1% ± 1.8%) sabinene (2.2% ± 0.7%), and terpinen-4-ol (1.2% ±

0.6%) (Fig. 4.4A). TPS2 produced only the monoterpene linalool (Fig. 4.4C). This activity was partially masked by spontaneous conversion of GPP into linalool, a well know phenomenon (Martin et al., 2004; Shelton et al., 2004), but the amounts produced

115 are significantly different. We renamed TPS1 Thuja plicata Terpinolene Synthase 1

(TpTS1) and TPS2 Thuja plicata linalool Synthase 1 (TpLS1) based on their main activities. The assessed recombinant proteins showed no sesqi- or diterpene synthase activity.

4.3.3 Localization of gene expression

Based on the limited existing literature, we are looking for terpinolene synthase(s) active primarily in the stem, and sabinene synthase(s) active in the foliage (see introduction. We used quantitative RT-PCR to map the expression of TpTS1, TpSS1 and

TpLS1 in different organs and stages of development (Fig. 4.5). The terpinolene- producing TpTS1 is expressed at the highest levels in the wood-forming region of 10-15 - year-old trees, and at lower levels in the stem sections of 1-year-old trees, roots of one- year-old trees, and in sapwood of mature trees. TpTS1 was also expressed in the needle- shaped juvenile leaves of seedlings, but expression was undetectable in mature foliage.

The sabinene-producing TpSS1 was also expressed at the highest levels in the wood- forming region of 10-15 year-old trees, but differently from TpTS1. It was also expressed at high levels in mature foliage. TpSS1 expression was also high in the stem of one -year- old trees relative to that of juvenile needle leaves, root, and sapwood. The linalool- producing TpLS1 was also expressed at the highest levels in the wood-forming region of

10-15 -year-old trees with much lower levels of expression in the other samples and undetectable expression in roots. As indicated by the different scales of expression in Fig.

4.5, the three genes showed considerable differences in maximal expression between different tissues. We therefore compared the relative levels of expression in two tissues.

116

This comparison shows that the expression of TpTS1 and TpLS1 is very low relative to that of TpSS1 in mature foliage and wood-forming region of 10-15 -year-old trees. In summary, and among the tested tissues, all three genes are expressed at their highest levels in the wood-forming region of 10-15 -year-old trees, albeit at very different levels.

4.3.4 Characterization of monoterpenoid content

We characterized the monoterpenoid profiles in extracts of mature leaves and volatile release of monoterpenoids from woody stem of 15 -year-old T. plicata. Leaf monoterpene extractions identified α-thujone and sabinene to be the dominant leaf monoterpenes with only trace levels of terpinolene and linalool present (Fig. 4.6A). The monoterpene extraction correlated well with the gene expression analysis where TpSS-1 had over 100 fold higher transcript level than the genes producing terpinolene and linalool. Attempts were made to identify resin storage structures within the woody tissues, but no organized resin storage tissues were observed, which is consistent with the findings of Lewinsohn et al. (1991). Captured volatiles from woody stems however showed a wide variety of terpenes being produced and a very different terpene profile

(Fig. 4.6B). Here the dominant monoterpenoid is α-pinene (47% ± 10%) followed by terpinolene (20% ± 10%), α-thujone (17% ± 3%), myrcene (8.6% ± 1.1%), β-thujone

(2.7% ± 0.7%) and sabinene (1.39% ± 0.1%). Only trace levels of linalool were detected from the wood volatile captures. These results also correspond to the tissue-specific expression analysis data where TpTS-1 and TpSS-1 were found to have high expression in woody tissues. The linalool synthase-encoding TpLS-1 had relatively low expression

117 compared to TpSS-1 and TpTS-1 in all tissues, and this is consistent with the low levels of linalool found in the chemical analyses.

4.3.5 Phylogenetic analysis

A phylogenetic tree derived from amino acid sequences for all known conifer terpene synthases obtained from Genbank and the T. plicata terpene synthases was produced using ClustalX2.1 and FigTree version 1.3.1. The terpene synthase gene family is divided into subfamilies TPS-a to TPS-g with all known conifer terpene synthases grouping into the TPS-d subfamily (Keeling and Bohlmann, 2006). Based on the phylogenetic tree, we found all three T. plicata monoterpene synthases to be more similar to other known genes than to each other with TpSS-1 most similar to Chamaecyparis obtusa limonene/borneol synthase (accession AB120957), TpTS-1 most similar to

Chamaecyparis obtusa terpinolene synthase (accession AB537375), and TpLS-1 most similar to Chamaecyparis formosensis α-pinene synthase (accession EU099434). All monoterpene synthases grouped into the TPS-d1 subfamily, but the monoterpene synthases from Cupressaceae species formed a separate evolutionary branch that we named TPS-d1b (Fig. 4.7; Supplemental Table 4.2).

4.4 Discussion

T. plicata possesses many qualities that makes it ideal among trees for selected breeding, particularly the ability of T. plicata to self-fertilize, withstand inbreeding depression and be induced to flower in less than 1 year from germination (Russell and

Hak, 2007; Russell and Fergusson, 2008). Selective breeding to increasing the content of

118 thujone in foliage and tropolones in heartwood faces difficulties. While variation in foliar monoterpenoid content can be scored within a year of growth, wood tropolones reach quantifiable levels after approximately 10-15 years and even older trees may be required to score natural genetic variation for this trait (Daniels and Russell, 2007). Since both thujone and thujaplicin biosynthesis requires a series of enzymatic conversions, it is likely that the levels of these compounds depend on the activity of several of the corresponding genes as well as upstream regulatory genes. Thus, there is a need to score not only multiple genes but, in the case of thujaplicins, also a need for genetic markers that allow early prediction of the trait. It is also likely that molecular polymorphisms in key candidate genes such as monoterpene synthases described above are related to phenotypic variation in thujones and tropolone content. First, however, candidate genes need to be identified.

For the monoterpene synthases implicated in the biosynthesis pathways of thujone and tropolones, we used NGS technology to begin identification of candidate genes. This approach generated more than 16,000 unique cDNA fragments, including 12 fragments with high similarity to known terpene synthases. While this is unlikely to be the full complement of terpene synthase-encoding genes in T. plicata, the scale of the method suggests that we have identified the most highly expressed terpene synthases in the assessed complex RNA sample. Indeed, there are many publications demonstrating NGS based RNA-Seq as an alternative method to microarray technology for simultaneous assessment of the relative expression of a large number of genes, including plants (Wang et al., 2009; Wilhelm and Landry, 2009; González-Ballester et al., 2010). The strong association between expression of individual terpene synthase genes and levels of

119 corresponding terpenes similarly suggest that we may have identified some of the key synthases involved in the production of the most abundant terpenoids in T. plicata, namely α-thujone, β-thujone and β-thujaplicin, γ-thujaplicin and β-thujaplicinol.

Conclusive evidence is not easily obtained, as neither transformation technologies nor mutant populations are available for this species. Nevertheless, the terpinolene and sabinene synthase activities that we identified by heterologous expression in E. coli point in the right direction as terpinolene has been identified as a substrate for β-thujaplicin biosynthesis and sabinene as a substrate for α- and β-thujone biosynthesis in other species. Sabinene synthase is also expressed at high levels in the wood-forming tissues of the stem. This expression is enigmatic since sabinene is not known to accumulate in wood and there are no known terpenoid storage structures in this region. We speculate that the highly volatile sabinene produced in the stem evaporate into airspaces of the stem cork and out of the stem via lenticels. Monoterpene synthase activities are known to correlate with volatilized rather than stored monoterpenes in stems of Norway spruce

(Picea abies; Martin et al., 2003), so a similar scenario may occur in T. plicata. There is evidence that T. plicata plants give off sabinene as well as thujones into the surrounding air, and that deer avoid eating apples sprayed with α- and β-thujone (Vourc’h et al.,

2002b). Thus it is possible that stem and foliage play somewhat different roles in biotic defence, with stems producing monoterpenes primarily for volatilization, and foliage, monoterpenes for both storage and volatilization. Volatile monoterpenes may have a more important role in deterring ungulate browsing than stored monoterpenes.

The terpinolene synthase is expressed at highest levels in the wood-forming region of stems that are approximately at the age at which wood tropolones are detected.

120

However, the resolution of tissue and cell specificity of both terpinolene synthase expression and tropolone production need to be improved before a strong correlation can be made. Since the expression of the sabinene synthase in wood-forming tissues is so much higher than that of the terpinolene synthase, it is possible that secondary activities of this sabinene synthase produce significant amounts of monoterpenes other than sabinene. In the context of tropolone production, the observed ~4% of terpinolene in the

GC spectrum from TpSS1 in vitro assay (Chapter 3, Fig. 3.8) suggest that this gene may be at least equally as important as TpTS-1 in the production of the terpinolene substrate for thujaplicin production. The expression of TpSS-1 in the wood-forming region of the stem is in agreement with such a function.

Extensive analysis of genes in the terpene synthase family allowed for the subdivision of genes into the sub-families TPS-a and TPS-g subfamilies with all known conifer terpene synthases falling into the TPS-d subfamily (Bohlmann et al., 1998; Trapp and Croteau, 2001; Martin et al., 2004). The TPS-d subfamily was further subdivided into

TPS-d1, made up of monoterpene and sesquiterpene synthases, TPS-d2, made up of sesquiterpene synthases and TPS-d3, made up of diterpene synthases (Martin et al.,

2004). The monoterpene synthases for T. plicata characterized here all grouped into the

TPS-d1 family, which is consistent with other conifer monoterpene synthases. Each T. plicata monoterpene synthase most closely matched a terpene synthase from another species in the family Cupressaceae. TpTS-1 most closely matched a terpinolene synthase from C. obtusa and had a high 87%, amino acid identity match suggesting that these two genes may be orthologues between the two species (Supplemental Fig. 4.1).

121

4.5 Materials and Methods

4.5.1 cDNA library construction and screening

RNA was extracted from roots, leaves, and stems of 2 to 3 week old seedlings, 1- year-old saplings, vascular cambium of mature trees, and seeds with protruding radicles.

Seedlings and saplings were grown under greenhouse conditions without supplementary lighting. Tissues were harvested for RNA extraction 16 hr after being treated with a number of hormones and stress conditions to maximize differential gene expression. A specific emphasis was placed on the treatment of foliage and cambium with 10 mM methyl jasmonate and 2% yeast extract as these treatments are known to induce the expression of monoterpene synthases (Martin et al., 2002; Byun McKay et al., 2003;

Martin et al., 2003; Miller et al., 2005). PolyATract System 1000 kit (Promega) was used to purify mRNA and double stranded cDNA was produced using SMART cDNA synthesis kit (Clontech). The cDNA library was sequenced by Roche/454 Life Sciences on the GSFLX machine. To identify putative monoterpene synthases from the cDNA library, protein sequences from known monoterpene synthases from other conifer species were compared to the library using TBLASTN.

4.5.2 Rapid amplification of cDNA ends (RACE)

RNA was extracted from 1 g of young foliage from a two -year-old T. plicata tree as described in Kolosova et al. (2004). The 3’ and 5’-termini of truncated ESTs were cloned by rapid amplification of cDNA ends (RACE) using the RLM-RACE kit

(Ambion). 5’ RACE primers for TPS-1 (TPS-1-5RACE: GCAAAGGCTTTA-

GCTTCATCCA) and TPS-2 (TPS-2-5RACE: TAGCGTGGGAGAGAGTTTGTCG) was

122 used in combination with the Ambion 5’ Outer RACE primer. 3’ RACE primers for TPS-

1 (TPS-1-3RACE: GGTGAGGTAGATCGAGGCGAAA) and TPS-2 (TPS-2-3RACE:

GCGGTGCTCGAATTGTTATT) was used in combination with the Ambion 3’ Outer

RACE primer. PCR was conducted using Phusion polymerase (Finnzymes). PCR products were cloned into the plasmid pTZ57R/T using InsTAclone PCR cloning Kit

(Fermentas) and sequenced by Macrogen Inc. (Korea).

4.5.3 Functional characterization of monoterpene synthases

Expression of recombinant TPS enzyme and functional characterization followed the general procedures described in Martin et al. (2004). Primers were designed with attB1 cloning sites to clone the full translated region of TPS-1 and TPS-2 into gateway vector pDONR/Zeo (Invitrogen) (TPS-1-attb-F: GGGGACAAGTTTGTACAAAAAA-

GCAGGCTTATGCCTCAAATCTCAGCCT, TPS-1-attb-R: GGGGACCACTTTGTA-

CAAGAAAGCTGGGTATTACATCGAGATAGGTTC, TPS-2-attb-F: GGGGACAAG-

TTTGTACAAAAAAGCAGGCTTAATGGCAGCTTCCATCTCT and TPS-2-attb-R:

GGGGACCACTTTGTACAAGAAAGCTGGGTATTACATTGTAACAGGTTG. PCR was conducted using Phusion polymerase. PCR products were cloned into pDONR/Zeo using BP Clonase II (Invitrogen) following the manufacturer’s instructions. TPS-1 and

TPS-2 were cloned into pDEST17 expression vector in frame with the 6x poly histidine tag (Invitrogen) using LR Clonase II (Invitrogen).

Recombinant protein expression and partial purification was performed as described by Keeling et al. (2008), except plasmids were cloned into pLysS cells

(EMDbioscience). Monoterpene, sesquiterpene and diterpene synthase functional assays

123 were conducted as described by Hall et al. (2011).

4.5.4 Quantitative PCR Analyses

Relative levels of gene expression in tissues were characterized by QPCR. RNA was extracted from the stored homogenized tissues from the roots, needles and leaves of three 2-year-old T. plicata trees. RNA was also extracted from the wood-forming region surrounding the vascular cambium, containing the differentiating xylem, and from xylem samples 2 cm from the cambium region from three 15 -year-old T. plicata trees. RNA was extracted using Purelink RNA Reagent (Invitrogen). 2 µg of total RNA was DNase treated then cDNA was generated with Revert-aid H-minus MMULV (Fermentas) using an oligo dT primer. Dynamo SYBR Green QPCR kit (Finnzymes) was used for the real- time PCR analysis following the manufacturer’s specifications. A reference gene, contig

14596, was chosen from the sequenced cDNA library. BLASTN of this EST against the

NCBI database shows that contig 14596 share close homology with elongation factor 1-β from Arabidopsis (Genbank accession: NM121956). Primers QPCR-TpSS-1-F

(AAAAGGCAGCAGAGC-AAAGG) and QPCR-TpSS-1-R

(TAAGGCTGAGGCAAATCGT), QPCR-TpTS-1-F

(ATTGGATGAGCGACACAAAGAAT) and QPCR-TpTS-1-R (GGACAATGGTTG-

ATTACATCGAGA), and QPCR-TpLS-1-F (TTTGGATTATGGTTGGCACA) and

QPCR-TpLS-1-R (TGCGAAGCATCTAGATTGGA) were used to amplify the monoterpene synthases and QPCR-14596-F (TTTGAAGGCACCCCACAACAA) and

QPCR-14596-R (AAAAAGGCAGCAGAGCAAAGG) were used to amplify the reference gene. Relative QPCR protocols were followed as described by Livak and

124

Schmittgen (2001). For each sample, three technical replicates were performed. Statistical analysis of the data was carried out using Statistix 8 (Analytical Software).

4.5.5 Gas chromatography-mass spectrometry (GC-MS)

To detect the presence in monoterpenes in leaves, the scale leaves of three 2-year- old T. plicata trees were extracted following a procedure modified from Kimball et al.

(2005). Approximately 1 g of tissue was frozen with liquid nitrogen and ground using a mortar and pestle to a fine powder. Half the ground sample was stored for RNA extraction and the other 0.5 g was transferred to a 10mL glass tube and extracted with 5 mL of ethyl acetate on a horizontal shaker for 30 min. To remove solid tissue, the extract was passed through a glass wool filter then 10-carbon acetate was added as an internal standard.

As woody stems are not known to contain resin storage structures in T. plicata, we quantified the volatile release of monoterpenes from stems to determine the production of monoterpenes. To collect airborne volatile monoterpenes from woody tissue, three woody stems from 15 -year-old T. plicata, approximately 23 cm long, with a diameter of 4cm, were placed in a cylindrical Pyrex glass chambers (15.5×26 cm) with the base immersed in water. A pump was setup to draw air through the chambers at a rate of 1.25 l/min through a glass column (14×1.3 cm OD) containing 0.5 g of Porapak Q

(50–80 mesh; Waters Associates, Inc.). Chambers were maintained at 22 °C with a day length of 16 hr for a total of 96 hr. Volatiles were eluted from the Porapak Q trap with

2 ml of pentane.

125

Extracts were then concentrated under a nitrogen stream, and aliquots were analyzed by coupled gas chromatography-mass spectrometry (GC-MS), employing a

Varian Saturn 2000 Ion Trap GC-MS and a Varian workstation version 6.9.1 (Agilent

Technologies, Mississauga, ON, Canada). The GC-MS was fitted with a DB-5MS column

[30 m × 0.25 mm (length × inner diam.), 0.25 µm (film)], using the following temperature program: 5 min at 50 °C, 10 °C per min to 280 °C. Monoterpenes were identified by comparing their retention indices (Van den Dool and Kratz, 1963) and mass spectra with those reported in the literature (Adams, 1989) and with those of authentic standards (α-pinene, myrcene, limonene, α-phellendrene, terpinolene, α- and β-thujone:

Sigma-Aldrich, Oakville, ON, Canada; sabinene: Indofine, Hillsborough, NJ, USA; α- thujene: available from previous research in Gries-laboratory).

4.5.6 Phylogenetic analysis

Sequence alignment of translated amino acid sequences of terpene synthases for phylogenetic analysis was conducted using ClustalX2.1 using the Blossom protein matrix

(Larkin et al., 2007). Protein sequences for all known conifer terpene synthases were obtained from Genbank. A phylogenetic tree for a representative list of terpene synthases was produced using FigTree version 1.3.1 (Andrew Raumbaut, University of Edinburgh; http://tree.bio.ed.ac.uk/).

4.6 References

Adams RP (1989) Identification of essential oils by ion trap mass spectrometry. Academic, San Diego, California

Bentley R (2008) A fresh look at natural tropolonoids. Nat Prod Rep 25: 118-138

Bohlmann J, Meyer-Gauen G, Croteau R (1998) Plant terpenoid synthases: Molecular biology and phylogenetic analysis. Proc Natl Acad Sci 95: 4126-4133

126

Byun-McKay A, Godard KA, Toudefallah M, Martin DM, Alfaro R, King J, Bohlmann J, Plant A (2003) Wound-induced terpene synthase gene expression in sitka spruce that exhibit resistance or susceptibility to attack by the white pine weevil. Plant Physiol 140: 1009-1021

Croteau R (1996) Biochemistry of monoterpenes and sesquiterpenes of the essential oils. In E Craker, & JE Simon, eds, Herbs, spices, and medicinal plants: Recent advances in botany, horticulture and pharmacology, Food Products Press, New York, pp 110-111

Daniels B, Russell JH (2007) Analysis of western redcedar heartwood components by HPLC as a possible screening tool for trees with enhanced natural durability. J Chromatogr Sci 45: 281-285

DeBell JD, Morell JJ, Gartner BL (1999) Within stem variation in tropolone content and decay resistance of second-growth western redcedar. Forest Sci 45: 101-107

Dehal SS, Croteau R (1987) Metabolism of monoterpenes: specificity of the dehydrogenases responsible for the biosynthesis of camphor, 3-thujone, and 3- isothujone. Arch Biochem Biophys 258: 287-291

Ekblom R, Galindo J (2010) Applications of next generation sequencing in molecular ecology of non-model organisms. Heredity. doi: 10.1038/hdy.2010.152

Gonzalez JS (2004) Growth Properties and Uses of Western red cedar. Forintek Canada Corp, Special Publication, No SP-37R

González-Ballester D, Camargo A, Fernández E (2004) Ammonium transporter genes in Chlamydomonas: the nitrate-specific regulatory gene Nit2 is involved in Amt1;1 expression. Plant Mol Biol 56: 863–878

Hall DE, Robert JA, Keeling CI, Domanski D, Quesada AL, Jancsik S, Kuzyk MA, Hamberger B, Borchers CH, Bohlmann J (2011) An integrated genomic, proteomic and biochemical analysis of (+)-3-carene biosynthesis in Sitka spruce (Picea sitchensis) genotypes that are resistant or susceptible to white pine weevil. Plant J. 65: 936-948

Keeling CI, Bohlmann J (2006) Genes, enzymes and chemicals of terpenoid diversity in the constitutive and indice defence of conifers against insects and pathogens. New Phytol 170: 657-675

Keeling CL, Weisshaar S, Lin RPC, Bohlmann J (2008) Functional plasticity of paralogous diterpene synthases involved in conifer defense. PNAS 105: 1085-1090

Kimball BA, Russell JH, Griffin DL, Johnston JJ (2005) Response factor considerations for the quantitative analysis of western redcedar (Thuja plicata) foliar monoterpenes. J Chromatogr Sci 43: 253-258

127

Kolosova N, Miller B, Ralph S, Ellis BE, Douglas C, Ritland K, Bohlmann J (2004) Isolation of high-quality RNA from gymnosperm and angiosperm trees. Biotechniques 36: 821-824

Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan, PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG (2007) Clustal W and Clustal X version 2.0. Bioinformatics 23: 2947-2948

Lewinsohn E, Gijzen M, Croteau R (1991) Defense-mechanisms of conifers: differences in constitutive and wound-induced monoterpene biosynthesis among species. Plant Physiol 96: 44-49

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real- time quantitative PCR and the 2-ΔΔ CT method. Methods 25: 402–408

Martin D, Gerhenzon J, Bohlmann J (2003) Induction of volatile terpene biosynthesis and diurnal emission by methyl jasmonate in foliage of Norway spruce. Plant Physiol 132: 1586-1599

Martin DM, Fäldt J, Bohlmann J (2004) Functional characterization of nine Norway Spruce TPS genes and evolution of gymnosperm terpene synthases of the TPS-d subfamily. Plant Physiol 135: 1908-1927

Martin J, Daufresne T (1999) Introduced species and their impacts on the forest ecosystem of Haida Gwaii. In G Wiggins, ed, Proceedings of the Cedar Symposium: Growing Western Redcedar and Yellow-Cypress on the Queen Charlotte Islands/Haida Gwaii South Moresby Forest Replacement Account, BC, Ministry of Forests, Victoria, pp 69-83

Martin D, Tholl D, Gershenzon J, and Bohlmann J (2002) Methyl jasmonate induces traumatic resin ducts, terpenoid resin biosynthesis, and terpenoid accumulation in developing xylem of Norway spruce stems. Plant Physiol 129: 1003-1018

Martin J, Baltzinger C (2002) Interaction among deer browsing, hunting and tree regeneration. Can J Forest Res 32: 1254-1264

Miller B, Madilao LL, Ralph S, Bohlmann J (2005) Insect-induced conifer defense. White pine weevil and methyl jasmonate induce traumatic resinosis, de novo formed volatile emissions, and accumulation of terpenoid synthase and putative octadecanoid pathway transcripts in Sitka spruce. Plant Physiol 137: 369-382

Minroe D (1983) Western redcedar - a literature review. USDA-Forest Service, Pacific Northwest Forest and Range Experimental Station General Technical Report; PNW-150

Russell JH, Ferguson DC (2008) Preliminary results from five generations of a western redcedar (Thuja plicata) selection study with self mating. Tree Genet Genomes. 4: 509- 518

128

Russell JH, Hak O (2007) Effect of gibberellin A3 inductions on male and female cone production and seed quality in western redcedar (Thuja plicata). West. J. Appl. Forestry 22: 297-306

Shelton D, Zabaras D, Chohan S, Wyllie SG, Baverstock P, Leach D, Henry R (2004) Isolation and partial characterisation of a putative monoterpene synthase from Melaleuca alternifolia. Plant Phys Biochem 42: 875-882

Stroh N, Baltzinger C, Martin J (2008) Deer prevent western redcedar (Thuja plicata) regeneration in old-growth forests of Haida Gwaii: Is there a potential for recovery? For Ecol Manag 255: 3973-3979

Swan EP, Jiang KS (1970) Formation of hardwood extractives in western red cedar. Tappi: 53: 844-846

Trapp S, Croteau R (2001). Defensive resin biosynthesis in conifers. Annu Rev Plant Phys 52: 689-724

Van den Dool H, Kratz PD (1963) A generalization of retention index system including linear temperature programmed gas-liquid partition chromatography. J Chromatogr 2: 463-471

Van der Kamp BJ (1986). Effects of heartwood inhabiting fungi on thujaplicin content and decay resistance of western red cedar (Thuja plicata Donn). Wood and Fiber Sci 18: 421-427

Von Rudloff E, Lapp MS, Yeh FC (1988) Chemosystematic study of Thuja plicata: Multivariate analysis of leaf oil terpene composition. Biochem Syst Ecol 16: 119-125

Vourc’h G, Russell J, Martin J (2002a) Linking deer browsing and terpene production among genetic identities in Chamaecyparis nootkatensis and Thuja plicata. Heredity 93: 370-376

Vourc’h G, Garine-Wichatitsky M, Labbé A, Rosolowski D, Martin J, Fritz H (2002b) Monoterpene effect on feeding choice by deer. J Chem Ecol 28: 2411-2427

Vourc’h G, Vila B, Gillon D, Escarré J, Guibal F, Fritz H, Clausen TP, Martin J (2002c) Disentangling the causes of damage variation by deer browsing on long-lived tree saplings: a chemical and dendrochronological approach. Oikos 98: 271–283

Wang Z, Gerstein M, Snyder M (2009) RNA-Seq: A revolutionary tool for transcriptomics. Nat Rev Genet 10: 57–63

Wilhelm BT, Landry JR (2009) RNA-Seq-quantitative measurement of expression through massively parallel RNA-sequencing. Methods 48: 249-257

129

Xin MT, Bugg TDH (2010) Biomimetic formation of 2-tropolones by dioxygenase- catalysed ring expansion of substituted 2,4-cyclohexadienones. Chem Biochem 11: 272- 276

130

4.7 Figures

Figure 4.1. Proposed biosynthesis pathway of b-thujaplicin (Bentley, 2008) and α- thujone (Croteau 1996).

131

132

133

Figure 4.4. Total ion chromatograms of products formed in vitro by recombinant Thuja plicata enzymes. A, Protein produced from TPS1 produced terpinolene as the only major product. B, Control reaction with no protein added, C, Linalool produced from TPS3. Significantly more (p < 0.01) linalool was produced in C as compared to B. Isobutylbenzene (IBB) were added as internal standards.

134

135

Figure 4.6. Total ion chromatograms of monoterpenes extracted from mature T. plicata A, foliage and B, woody stem aeration. Arabic numeral on peaks represents the following compound: 1 = thujene, 2 = α- pinene, 3 = sabinene, 4 = myrcene, 5 = limonene 6 = β- phellendrene, 7 = terpinolene, 8 = α-thujone and 9 = β- thujone. An internal standard (100ng, 10-carbon acetate) was added and detected at 21 minutes for each chromatograph.

136

137

4.8 Tables

Contig Reads Length (bp) Closest Annotated Match Bit Score E Value TPS1 22 1944 C. obtusa terpinolene synthase (AB537375.1) 2664 0 TPS2 13 1883 C. formosensis alpha pinene synthase (EU099434.1) 706 0 TPS3 6 451 T. canadensis taxadiene synthase (AY364469.1) 69.8 6E-08 TPS4 3 439 C. formosensis alpha pinene synthase (EU099434.1) 645 0 TPS5 3 441 C. obtusa limonene/borneol synthase (AB120957.1) 214 2E-51 TPS6 3 224 P. abies E,E-alpha-farnesene synthase (AY473627.1) 46.4 7E-01 TPS7 2 229 P. menziesii (E)-beta-farnesene synthase (AY906867.1) 78.8 1E-10 TPS8 2 181 C. obtusa terpinolene synthase (AB537375.1) 156 5E-34 TPS9 2 143 C. obtusa limonene/borneol synthase (AB120957.1) 132 6E-27 TPS10 1 269 C. obtusa limonene/borneol synthase (AB120957.1) 224 1E-54 TPS11 1 201 C. obtusa limonene/borneol synthase (AB120957.1) 147 3E-31

138

4.9 Supplemental Figures

139

4.10 Supplementary Tables

Supplemental Table 4.1. Genbank accession numbers for select genes shown in the phylogenetic analysis. Gene Id Accession Function Species AbMYR O24474.1 myrcene synthase Abies bracteata AgABI Q38710.1 abietadiene synthase Abies grandis AgCAM Q948Z0.1 camphene synthase Abies grandis AgHUM O64405.1 γ-humulene synthase Abies grandis AgLIM AAK83565.1 (-)-4S-limonene synthase Abies grandis AgPHE Q9M7D1.1 β-phellandene synthase Abies grandis AgPIN O24475.1 pinene synthase Abies grandis AgSEL AAK83561.1 δ-selinene synthase Abies grandis AgTER Q9M7D0.1 terpinolene synthase Abies grandis CfPIN ABW80964.1 α-pinene synthase Chamaecyparis formosensis CoLIM BAC92722.1 limonene/borneol synthase Chamaecyparis obtusa CoTER BAI53108.1 terpinolene synthase Chamaecyparis obtusa PaCAR AAO73863.1 (+)-3-carene synthase Picea abies PaFAR AAS47697.1 α-farnesene synthasse Picea abies PaLEV Q675L4.1 levopimaradiene synthase Picea abies PaLIM AAS47694.1 (-)-limonene synthase Picea abies PaLIN AAS47693.1 (-)-linalool synthase Picea abies PaLON AAS47695.1 longifolene synthase Picea abies PaPIN AAS47692.1 (-)-α/β-pinene synthase Picea abies PmTER AAX07264.1 terpinolene synthase Pseudotsuga menziesii PsGER ABV44453.1 1(10),5-germacradien-4-ol synthase Picea sitchensis PtFAR AAO61226.1 α-farnesene synthase Pinus taeda PtPIN AAO61225.1 (-)-α-pinene synthase Pinus taeda TpSS-1 sabinene synthase Thuja plicata TpLS-1 linalool synthase Thuja plicata TpTS-1 terpinolene synthase Thuja plicata

140

5. CONCLUSIONS AND GENERAL DISCUSSION

Western redcedar (Thuja plicata) is a long lived tree with effective chemical defenses (Minroe, 1983; Gonzalez, 2004). Monoterpenoids are important components of this tree’s chemical defense cocktail (Vourc’h et al. 2002; Russell, 2008). Two groups of monoterpenoids, the thujones and thujaplicins, are implicated as essential defensive components against mammalian herbivory and fungal wood rot respectively. To date, there are no publications addressing the genetic basis of the thujones and thujaplicins biosynthesis in T. plicata. This thesis identified genes that may be involved in monoterpenoid biosynthesis and also provided a greater understanding of the anatomy of foliar chemical defense storage structures. Also, this work generated the first large-scale transcriptome databases for T. plicata and one of the first comprehensive cDNA datasets for any species in the family Cupressaceae.

The two transcriptome datasets contain distinctively different expressed genes. With regards to monoterpene synthases, distinctively different genes were isolated from the different databases. TpSS-1 and TpSS-2 were present in both datasets while TpTS-1 was present in only in comprehensive 454 dataset. Between both the 454 and Illumina datasets, an additional 4 genes were identified, with 2 unique genes per sequenced library. Also, two partial non overlapping sequences of putative monoterpene synthases from the 454 dataset (TPS9 and TPS11) were found to match a single monoterpene synthase within the Illumina dataset, which indicates that some of the short contigs may not represent unique genes.

141

An understanding of the genetic basis for T. plicata monoterpene based defenses may lead to improvements in silviculture of this tree species. Candidate genes were identified for steps in the biosynthesis of α-thujone and β-thujaplicin in this thesis (Figure 5.1).

However, before the genes identified can be useful markers in selective breeding, further work must be conducted to identify factors that could lead to increased terpenoid content.

For example, genetic polymorphisms in the TpSS-1 could dictate the overall foliar monoterpene content of the foliage as polymorphisms in the encoded proteins are known to affect the kinetics of monoterpene synthase proteins in Picea sitchensis (Hall et al.,

2011). Tag profiling allowed for the identification of a large set of genes whose expression are associated with the presence of foliar resin glands, including a small subset of genes that may play a role in thujone biosynthesis. In particular, one of the identified genes encodes a protein with strong sabinene synthase activity. Since there is evidence that sabinene is the monoterpene precursor to thujone, this gene is a prime candidate for assessment of potential association between DNA polymorphisms and thujone content. Similarly, the T. plicata terpinolene synthase-1 identified here may provide the precursor monoterpene to thujaplicin biosynthesis in sapwood. While genes involved in reactions downstream of terpinolene formation in the thujaplicin biosynthesis pathway were not identified, a study could be conducted to find these genes following the methods used in the foliar tag profiling study. For example, sapwood samples from trees with considerable differences in tropolone content could be used to identify genes whose expression correlate with tropolone levels. Similarly, since it is known that tropolone production can be induced by elicitor treatment of T. plicata cell cultures (Haluk and

142

Roussel-Bousta, 2003), it may be possible to identify thujaplicin biosynthesis genes based on elevated transcript levels in response to elicitors.

Examination of the anatomy and ontogeny of foliar resin storage structures identified key differences between plants at different stages. The major finding was that the transition from needle to scale foliage correlated with a change from resin ducts to resin glands as the primary terpene storage structure as well as a change from α-pinene to α- thujone as the most predominant monoterpene. These findings highlight the need for consistent tissue harvesting in screens aiming at identifying genetic basis for variation in foliar terpenoid content. A better anatomical understanding of tissues that produce and store resin may also lead to the development of easy to measure structural markers that can be associated with oleoresin content.

The genetic data generated in this thesis may also be applied to topics of research other than those addressed here. For example, the collection of contiguous cDNA sequences may be tapped for orthologues of genes with known functions in processes such as wood quality, growth rate, abiotic stress tolerance and signaling pathways involved in biotic defense responses.

An important area of conifer defense research would be to look at the factors affecting the evolution of monoterpene based defenses. One question to examine would be why thujones are produced in only Cupressaceae family of conifers. The formation of thujone may have played a key role in the defense of this family of trees and may be the key reason that trees of this family are known for being highly resistant to insect herbivory. Thus, understanding the genetic basis for chemical based defense in T. plicata

143 may lead to a better general understanding of the defensive deficiencies of other tree species that live in the same or similar habitats.

144

5.1 References

Gonzalez, J.S. (2004). Growth properties and uses of western red cedar. Forintek Canada Corp. Special Publication No SP-37R.

Haluk J.P., and Roussel-Bousta C. (2003). Biosynthese de tropolones dans les cals et les suspensions cellulaires a partir d'ebauches foliaires de plantules de Thuja plicata Donn. Ann. For. Sci. 60: 271-276.

Minroe, D. (1983). Western redcedar - a literature review. USDA-Forest Service, Pacific Northwest Forest and Range Experimental Station General Technical Report; PNW- 150.

Russell, J.H. (2008). Deployment of deer resistant western redcedar (Thuja plicata). USDA Forest Service Proceedings. RMRS-P57: 149-153.

Vourc’h, G., Vila, B., Gillon, D., Escarré, J., Guibal, F., Fritz, H., Clausen, T.P., and Martin, J. (2002). Disentangling the causes of damage variation by deer browsing on long-lived tree saplings: a chemical and dendrochronological approach. Oikos. 98: 271- 283.

145

5.2 Figures

Figure 5.1. Candidate genes identified in the proposed biosynthesis pathway of β- thujaplicin (Bentley, 2008) and α-thujone (Croteau 1996).

146