DOCSLIB.ORG

Effect of Starvation on Gene Expression of Regulatory Enzymes of Glycolysis= Gluconeogenesis in Genetically Obese (Fa=Fa) Zucker Rats

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effect of Starvation on Gene Expression of Regulatory Enzymes of Glycolysis= Gluconeogenesis in Genetically Obese (Fa=Fa) Zucker Rats International Journal of Obesity (1998) 22, 667±672 ß 1998 Stockton Press All rights reserved 0307±0565/98 $12.00 http://www.stockton-press.co.uk/ijo Effect of starvation on gene expression of regulatory enzymes of glycolysis= gluconeogenesis in genetically obese (fa=fa) Zucker rats JX PeÂrez, A Manzano, A Tauler and R Bartrons Unitat de BioquõÂmica, Departament de CieÁncies FisioloÁgiques Humanes i de la NutricioÂ, Campus de Bellvitge, Universitat de Barcelona, Spain OBJECTIVE: To study the mechanism that controls fructose-2,6-bisphosphate (Fru-2,6-P2) accumulation, as well as the mRNAs levels of the glycolytic=gluconeogenic regulatory enzymes in the livers of fed and starved lean ( fa=-) and obese ( fa=fa) Zucker rats. DESIGN: Rats were fed a standard chow or deprived of food for 24 h. SUBJECTS: Male lean (fa=-) and genetically obese ( fa=fa) rats (nine weeks old). MEASUREMENTS: Fru-2,6-P2 concentration, 6-phosphofructo-2-kinase (PFK-2), glucokinase (GK), pyruvate kinase (PK) activities and the mRNA levels of GK, PFK-2, L-type pyruvate kinase, fructose-1,6-bisphosphatase (FBPase-1) and phosphoenolpyruvate carboxykinase (PEPCK) were analyzed. RESULTS: PFK-2=FBPase-2 mRNA decreased during starvation in both fa=- and fa=fa animals. Although PFK- 2=FBPase-2 mRNA levels were similar in fed lean and obese rats, PFK-2 concentration and activity were higher in fed obese than in fed lean animals, which might explain the high concentration of Fru-2,6-P2 observed in obese animals. During starvation, PFK-2 protein concentration decreased, correlating with the enzymatic activity and Fru- 2,6-P2 levels. The activities of GK and L-pyruvate kinase (L-PK) also increased in fed obese (fa=fa) rats compared with fed lean (fa=-) animals, but decreased during starvation. The mRNA levels of glycolytic enzymes in fed obese rats were similar (PFK-2) or higher than (GK, L-PK) in fed lean animals. During starvation, they decreased in lean and obese rats with one important exception, GK mRNA remained high in obese animals. The mRNA of gluconeogenic enzymes remained constant (FBPase-1) or increased (PEPCK) during fasting. CONCLUSION: The changes observed might be explained by the hyperinsulinaemia observed in the liver of obese rats, which might lead to the stimulation of glycolysis and lipogenesis. Keywords: obese; gene expression; glycolysis; gluconeogenesis; starvation Introduction expenditure, severe insulin resistance, and genetic background-dependent diabetes.4 Enhanced lipogenesis has been observed in livers of Obese ( fa=fa) Zucker rats have a recessive gene obese rats.5,6 This might be one of the mechanisms mutation, localized in chromosome 5 producing total responsible for the increased fat deposition which inability to respond to leptin.1 The fa locus, linked to occurs in these animals. Liver glycolysis provides obesity in the rat, has been mapped to a region C3 units for the synthesis of lipids and is an syntenic with the mouse db locus,2,3 implying that important component of the control of lipogenesis. the fa mutation lies within the rat ob-receptor. The hepatic gluconeogenic=glycolytic pathway is The products of the ob and db genes, constitute a regulated by allosteric modulators, and phosphoryla- hormone-receptor pair (leptin and leptin receptor, tion=dephosphorylation and control of gene expres- respectively) that provides molecular identity to one sion of several regulatory enzymes.7,8 These enzymes system, through which the status of energy stores is control hepatic glucose production and utilization signalled to the brain. Total inability to produce leptin through regulation of three major substrate cycles: (ob=ob) or to respond to it (db=db) result in early glucose=glucose 6-phosphate, fructose 6-phosphate= obesity with excessive food intake, a decreased energy fructose-1,6-bisphosphate and phosphoenolpyruvate= pyruvate. The fructose 6-phosphate=fructose-1,6-bis- phosphate substrate cycle is also regulated by a Correspondence: Ramon Bartrons, Unitat de BioquõÂmica, Facultat subcycle in which the amount of the regulatory d'Odontologia, Universitat de Barcelona, Campus de Bellvitge, 08907-Hospitalet, Spain. molecule fructose-2,6-bisphosphate (Fru-2,6-P2)is Received 15 December 1997; accepted 23 February 1998 controlled by the bifunctional enzyme 6-phospho- Gene expression in obese (fa=fa) Zucker rats JX PeÂrez et al 668 fructo-2-kinase=fructose-2,6-bisphosphatase (PFK-2= EcoRI fragment from cDNA for PFK-2=FBPase-2;17 a FBPase-2).7±10 0.65 kb EcoRI fragment from cDNA for fructose 2,6- 11±14 18 It has been shown that the Fru-2,6-P2 concen- biphosphate (FBPase-1); a 2.8 kb PstI fragment tration and the PFK-2 activity in livers of genetically from cDNA clone (pPCK10) for phosphoenolpyruvate obese ( fa=fa) rats are greater than in livers of control carboxykinase (PEPCK);19 a 2.4 kb EcoRI fragment 20 lean animals. Fru-2,6-P2 stimulates phosphofructo- from cDNA for GK; and a 1.8 kb PstI fragment from kinase7±10 and since that phosphofructokinase activity cDNA clone (G4) for L-pyruvate kinase (L-PK).21 A is increased,11 this may contribute to keeping glyco- cDNA for 18S ribosomal RNA was also used as a lysis active. Since the activities of other glycolytic probe.22 All DNA probes were generated by labelling enzymes, such as glucokinase (GK) and L-pyruvate with [a-32P]dCTP to a speci®c radioactivity of kinase, have also been found to have increased,11±13 it 1.5Â109 cpm=mg of DNA by random priming with was our purpose to study the mechanism that controls Klenow DNA polymerase. The levels of mRNAs were Fru-2,6-P2 accumulation, as well as the mRNAs levels measured by densitometric scanning of the autoradio- of the glycolytic=gluconeogenic regulatory enzymes grams with a Vilbert Lourmat densitometer and cor- in the livers of fed and starved lean ( fa=-) and obese rected for the amount of 18S rRNA that was used as a ( fa=fa) Zucker rats. control. Materials and methods Metabolite and enzyme assays Fru-2,6-P2 was extracted and measured as described by Van Schaftingen et al.23 Total and active PFK-2 Materials 32 activities were measured as described by Bartrons et [a- P]dCTP (3000 Ci=mmol) was from Amersham al.24 In the conditions of the assay, the active form (London, UK). The random primed DNA labelling corresponds to the activity of the non-phosphorylated kit and restriction endonucleases were from Boehrin- form of the enzyme measured.24 L-PK activity was ger Mannheim (Mannheim, Germany). N-hybond determined at saturating concentrations of phospho- membranes and ECL kit were from Amersham. Nitro- enolpyruvate (5 mM), as previously described by cellulose membranes were from Millipore Corpora- FelõÂu et al25 and GK as described by Davidson and tion (Bedford, MA). Rat albumin antiserum was from Arion.26 The protein concentration was determined Nordic (Tilburg, The Netherlands). Anti-rabbit anti- according to Bradford,27 using bovine serum albumin body was from DAKO A=S, (Glostrup, Denmark). as standard. Other enzymes and biochemical reagents were either from Boehringer Mannheim (Mannheim, Germany) or Sigma (St Louis, MO). All chemicals were of analy- tical grade. Western blot analysis Immunoblot analysis was performed by a modi®cation of the method described by Burnette.28 Previous to Animals and dietary manipulations Western blot analysis, the concentration of protein Male lean ( fa=-) and genetically obese ( fa=fa) rats was determined by the method of Bradford.27 For were obtained from Iffa Credo EspanÄa SA (Barcelona, PFK-2=FBPase-2 analysis we used a 1:2000 dilution Spain). The rats were nine weeks old at the time of the of polyclonal antibody raised against rat liver pro- experiments. They were fed a standard chow tein.29 Albumin, using a 1:2000 dilution of polyclonal (PANLAB A04, Barcelona, Spain) and water ad antibody raised against rat albumin. After Western libitum. Animals were subjected to a 12 h light=12 h blots with the anti-PFK-2=FBPase-2 antibody, mem- dark cycle (light starting at 08.00 h). Starved rats were branes were dehybridizated with stripping buffer con- deprived of food for 24 h. All the animals were killed taining 100 mM 2-mercaptoethanol, 4% SDS, 125 mM at 10.00 h by decapitation and the livers were freeze- TrisHCl pH 6.8. After dehybridization, the same clamped in liquid nitrogen and stored at 780C prior membranes were used with the antibody against to extraction of Fru-2,6-P2, enzymes or RNA. albumin, that was used to correct. Bound antibody was detected by the ECL (enhanced chemilumines- RNA analyses and DNA-hybridation probes cence) method. The levels of protein were measured Total RNA was extracted from frozen rat tissues by by densitometric scanning of the autoradiograms with the LiCl=urea method.15 Previous to Northern blot a Vilbert Lourmat densitometer and corrected for the analysis, the concentration of the RNA was deter- amount of albumin that was used as a control. mined by measuring the OD260 of an aliquot of the ®nal preparation.16 The integrity of the RNA was veri®ed by observing the rRNA bands in the ethidium Statistical analysis bromide gel under uv irradiation. Northern blot ana- Statistical comparisons were performed using analysis lyses were performed by standard procedures.16 The of variance (ANOVA) with a post-hoc test (Fischer following fragments were used as probes: a 1.4 kb PLSD). Gene expression in obese (fa=fa) Zucker rats JX PeÂrez et al 669 Results Effect of starvation on Fru-2,6-P2 levels Fed genetically obese ( fa=fa) Zucker rats contained higher levels of Fru-2,6-P2 than fed lean animals (32 and 14 nmol=g liver, respectively).
Load more

Recommended publications
  • Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1
    [CANCER RESEARCH 34, 1439-1446, June 1974] Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1 Francis A. Farina,2 Jennie B. Shatton, Harold P. Morris, and Sidney Weinhouse The Fels Research Institute and the Department of Biochemistry, Temple University School oj Medicine, Philadelphia. Pennsylvania IV140 (F. A. F., J. B. S.. S. W.\, and the Department of Biochemistry. Howard University School of Medicine. Washington. D. C. 20001 [H. P. M .\ SUMMARY 23, 32, 41, 57). These alterations involve the replacement of those isozymes that are under dietary and hormonal control Pyruvate kinase (PK) (EC 2.7.1.40) isozymes were assayed by the host, and that have important metabolic functions in in normal rat liver and a series of transplantable rat the adult differentiated liver by other isozymes which are hepatomas ranging widely in growth rate and degree of normally either low in, or absent from, the adult tissue. As differentiation, with the use of gradient elution by chloride part of an ongoing study of this phenomenon, we have ion from columns of DEAE-cellulose. In agreement with examined the alteration of PK3 (EC 2.7.1.40) isozymes in other studies, three noninterconvertible forms were found in the Morris hepatomas (30. 31), a series of chemically rat tissues: isozyme I, the major form in adult rat liver: induced, transplantable rat hepatomas ranging widely in isozyme II, the sole form in heart and skeletal muscle: and growth rate and degree of differentiation. This enzyme isozyme III, the sole form in poorly differentiated hepato occupies a key position in the metabolism of cells and, as we mas, the major form in normal kidney and lung, and the pointed out previously (27, 28.
    [Show full text]
  • Pyruvate Kinase: Function, Regulation and Role in Cancer
    Pyruvate kinase: Function, regulation and role in cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Israelsen, William J., and Matthew G. Vander Heiden. “Pyruvate Kinase: Function, Regulation and Role in Cancer.” Seminars in Cell & Developmental Biology 43 (2015): 43–51. As Published http://dx.doi.org/10.1016/j.semcdb.2015.08.004 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/105833 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptSemin Cell Author Manuscript Dev Biol. Author Author Manuscript manuscript; available in PMC 2016 August 13. Published in final edited form as: Semin Cell Dev Biol. 2015 July ; 43: 43–51. doi:10.1016/j.semcdb.2015.08.004. Pyruvate kinase: function, regulation and role in cancer William J. Israelsena,1,* and Matthew G. Vander Heidena,b,* aKoch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA bDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA Abstract Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate and ADP to pyruvate and ATP in glycolysis and plays a role in regulating cell metabolism. There are four mammalian pyruvate kinase isoforms with unique tissue expression patterns and regulatory properties. The M2 isoform of pyruvate kinase (PKM2) supports anabolic metabolism and is expressed both in cancer and normal tissue. The enzymatic activity of PKM2 is allosterically regulated by both intracellular signaling pathways and metabolites; PKM2 thus integrates signaling and metabolic inputs to modulate glucose metabolism according to the needs of the cell.
    [Show full text]
  • Prevalence of Pyruvate Kinase Deficiency
    P3513 Prevalence of Red Cell Pyruvate Kinase Deficiency: A Systematic Literature Review Mike Storm1, Matthew H Secrest2*, Courtney Carrington2, Deb Casso2, Keely Gilroy1, Leanne Pladson1, Audra N Boscoe1 1Agios Pharmaceuticals Inc., Cambridge, MA, USA; 2IQVIA Epidemiology & Drug Safety, Seattle, WA and Cambridge, MA, USA; *Affiliation at the time research was conducted BACKGROUND METHODS (continued) RESULTS (continued) RESULTS (continued) • Pyruvate Kinase (PK) deficiency is a rare congenital hemolytic anemia Exclusion Criteria The remaining 34 studies were grouped based on methods and study Among these 4 studies, an important distinction was made between studies characterized by diminished activity of the PK enzyme in red blood population (Table 1). reporting diagnosed prevalence (n=3) and overall disease prevalence cells (RBC).1 • Non-human studies; (diagnosed and undiagnosed PK deficiency; n=1). Table 1. Distribution of extracted studies by type of study (n=34) • Low PK enzyme activity can lead to lifelong chronic hemolysis with • Publications that were not the primary report of the data • Two studies estimated diagnosed PK deficiency prevalence as 3.2 per associated symptoms and complications such as anemia, jaundice, (e.g., literature reviews); Type of study Number million4 and 8.5 per million5 by identifying diagnosed PK deficiency cases of studies gallstones, splenectomy and associated thrombosis, iron overload, and • Studies of PK deficiency prevalence/incidence conducted within a source from source populations of known size. liver cirrhosis.2 Population-based prevalence 2 population of patients with symptoms of PK deficiency such as anemia • We estimated the prevalence of diagnosed PK deficiency in a general • PK deficiency is caused by compound heterozygosity or homozygosity for or jaundice; Molecular PKLR screening in a general population 5 population to be 6.5 per million6 using data from another high-quality study 3 one or more of the >300 known mutations to the PKLR gene.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Pyruvate Kinase, Rbc
    Lab Dept: Chemistry Test Name: PYRUVATE KINASE, RBC General Information Lab Order Codes: PYKI Synonyms: Pyruvate Kinase, Erythrocytes CPT Codes: 84220 – Pyruvate kinase Test Includes: Pyruvate kinase RBC level reported in U/g Hb. Logistics Test Indications: Useful for the workup of cases of nonspherocytic hemolytic anemia, for a family workup to determine inheritance pattern (pyruvate kinase deficiency is autosomal recessive), and for genetic counseling. Lab Testing Sections: Chemistry - Sendouts Referred to: Mayo Medical Laboratories (MML Test: PK) Phone Numbers: MIN Lab: 612-813-6280 STP Lab: 651-220-6550 Test Availability: Daily, 24 hours Turnaround Time: 1 - 4 days, test set up Monday - Saturday Special Instructions: N/A Specimen Specimen Type: Whole blood Container: Yellow top (ACD- Solution B) tube Alternate tube: Lavender (EDTA) top tube Draw Volume: 6 mL (Minimum: 1 mL) blood Processed Volume: Same as Draw Volume Collection: Routine blood collection Special Processing: Lab Staff: Do Not centrifuge. Send whole blood refrigerated in original collection container. Do Not transfer blood to other containers. Store and ship at refrigerated temperatures. Forward promptly. Patient Preparation: None Sample Rejection: Specimen cannot be frozen; mislabeled or unlabeled specimens; gross hemolysis Interpretive Reference Range: ≥12 months: 6.7 – 14.3 U/g Hb Reference values have not been established for patients <12 months of age. Interpretation: Most hemolytic anemias due to pyruvate kinase (PK) deficiency are associated with activity levels less than 40% of mean normal. However, some patients with clinically significant hemolysis can have normal or only mildly decreased PK enzyme activity, which paradoxically may occur in individuals with most severe symptoms.
    [Show full text]
  • Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde by ANTONI R
    Biochem. J. (1976) 153, 613-619 613 Printed in Great Britain Inhibition of Spinach Phosphoribulokinase by DL-Glyceraldehyde By ANTONI R. SLABAS and DAVID A. WALKER Department ofBotany, University ofSheffield, Sheffield S1O 2TN, U.K. (Received 10 September 1975) Spinach chloroplast phosphoribulokinase is inhibited by DL-glyceraldehyde. The in- hibition is non-competitive with respect to ribulose 5-phosphate (Ki 19mM) and ATP (Ki 20mM). The inhibition is discussed in relation to a previously reported inhibition of CO2 assimilation in intact and envelope-free chloroplasts by DL-glyceraldehyde. It is concluded that the inhibition of phosphoribulokinase is insufficient to account for the inhibition, by DL-glyceraldehyde, of 02 evolution with ribose 5-phosphate as substrate and that a further site of inhibition is also present in this system. DL-Glyceraldehyde inhibits photosynthetic carbon glycylglycine buffer, pH7.4, in a total volume of assiniilation by intact chloroplasts and by the re- 13 ml. The reaction was terminated by the addition constituted chloroplast system (Stokes & Walker, of 2ml of 50 % (w/v) trichloroacetic acid and the pH 1972). The inhibition is most pronounced with intact was adjusted to pH8.0 with KOH. After the addition chloroplasts, a concentration of 1OmM being sufficient of Sml of 1.OM-barium acetate the solution was to suppress 02 evolution completely. It is important centrifuged and the precipitate discarded after because DL-glyceraldehyde is the only known inhibi- washing with Sml of water. Cold ethanol (4vol.) was tor of photosynthesis that is entirely without detect- added to the combined supernatants (total volume able effect on photophosphorylation or photo- 25.4ml); the new precipitate was recovered by synthetic electron transport.
    [Show full text]
  • Structure-Function Studies of Enzymes from Ribose Metabolism
    Comprehensive Summaries of Uppsala Dissertations from the Faculty of Science and Technology 939 Structure-Function Studies of Enzymes from Ribose Metabolism BY C. EVALENA ANDERSSON ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2004 !"" #$"" % & % % ' ( ) * + &( , +( !""( - . - % + / % 0 ( , ( 1#1( ( ( 2-3 1. 45 ." 2 * & & * % * &( , % . * % % ( ) % / ( 0 6 / % ,)' & % % & ( )* % 6 % 6 * ( 0 6 * * % ( - % & 7 % & % & && ( ' && ,)' % /( 2 8 * ,)' & ,'.'' ( ) * % / % * 6 & & / 6 ( 0 . . . ( - * & * % %% & ( 9 * 6 / %% % ( -: % & * . & . , /( , & % * /( ) % / % & % ( ! 6 . . & / 6 % " # $ % # %& '()# %$# # *+',-. # ; ( + , !"" 2--3 ".!#!< 2-3 1. 45 ." $ $$$ .#111 = $>> (6(> ? @ $ $$$ .#111A List of Papers This thesis is based on the following papers, which are referred to in the text by their Roman numerals: I Andersson, C. E. & Mowbray, S. L. (2002). Activation of ribokinase by monovalent cations. J. Mol. Biol. 315, 409-19 II Zhang, R., Andersson, C. E., Savchenko,
    [Show full text]
  • Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J
    Biochemistry 2007, 46, 14845-14853 14845 Swiveling Domain Mechanism in Pyruvate Phosphate Dikinase†,‡ Kap Lim,§ Randy J. Read,| Celia C. H. Chen,§ Aleksandra Tempczyk,§ Min Wei,⊥ Dongmei Ye,⊥ Chun Wu,⊥ Debra Dunaway-Mariano,⊥ and Osnat Herzberg*,§ Center for AdVanced Research in Biotechnology, UniVersity of Maryland Biotechnology Institute, RockVille, Maryland 20850, Department of Haematology, Cambridge Institute for Medical Research, UniVersity of Cambridge, Cambridge, United Kingdom, and Department of Chemistry, UniVersity of New Mexico, Albuquerque, New Mexico ReceiVed September 10, 2007; ReVised Manuscript ReceiVed October 17, 2007 ABSTRACT: Pyruvate phosphate dikinase (PPDK) catalyzes the reversible conversion of phosphoenolpyruvate (PEP), AMP, and Pi to pyruvate and ATP. The enzyme contains two remotely located reaction centers: the nucleotide partial reaction takes place at the N-terminal domain, and the PEP/pyruvate partial reaction takes place at the C-terminal domain. A central domain, tethered to the N- and C-terminal domains by two closely associated linkers, contains a phosphorylatable histidine residue (His455). The molecular architecture suggests a swiveling domain mechanism that shuttles a phosphoryl group between the two reaction centers. In an early structure of PPDK from Clostridium symbiosum, the His445-containing domain (His domain) was positioned close to the nucleotide binding domain and did not contact the PEP/pyruvate- binding domain. Here, we present the crystal structure of a second conformational state of C. symbiosum PPDK with the His domain adjacent to the PEP-binding domain. The structure was obtained by producing a three-residue mutant protein (R219E/E271R/S262D) that introduces repulsion between the His and nucleotide-binding domains but preserves viable interactions with the PEP/pyruvate-binding domain.
    [Show full text]
  • Posttranslational Regulation of Pyruvate, Orthophosphate Dikinase in Developing Rice (Oryza Sativa) Seeds
    Planta (2006) DOI 10.1007/s00425-006-0259-3 ORIGINAL ARTICLE Chris J. Chastain Æ Jarrod W. Heck Thomas A. Colquhoun Æ Dylan G. Voge Xing-You Gu Posttranslational regulation of pyruvate, orthophosphate dikinase in developing rice (Oryza sativa) seeds Received: 16 January 2006 / Accepted: 25 February 2006 Ó Springer-Verlag 2006 Abstract Pyruvate, orthophosphate dikinase (PPDK; (PPDK inactivation) and protein degradation. Immu- E.C.2.7.9.1) is most well known as a photosynthetic noblot analysis of separated seed tissue fractions enzyme in C4 plants. The enzyme is also ubiquitous in (pericarp, embryo + aleurone, seed embryo) revealed C3 plant tissues, although a precise non-photosynthetic that regulatory phosphorylation of PPDK occurs in the C3 function(s) is yet to be validated, owing largely to its non-green seed embryo and green outer pericarp layer, low abundance in most C3 organs. The single C3 organ but not in the endosperm + aleurone layer. The type where PPDK is in high abundance, and, therefore, modestly abundant pool of inactive PPDK (phosphor- where its function is most amenable to elucidation, are ylated + dephosphorylated) that was found to persist the developing seeds of graminaceous cereals. In this in mature rice seeds was shown to remain largely un- report, we suggest a non-photosynthetic function for C3 changed (inactive) upon seed germination, suggesting PPDK by characterizing its abundance and posttrans- that PPDK in rice seeds function in developmental lational regulation in developing Oryza sativa (rice) rather than in post-developmental processes. These and seeds. Using primarily an immunoblot-based approach, related observations lead us to postulate a putative we show that PPDK is a massively expressed protein function for the enzyme that aligns its PEP to pyruvate- during the early syncitial-endosperm/-cellularization forming reaction with biosynthetic processes that are stage of seed development.
    [Show full text]
  • Glucokinase September 15, 2005
    Glucokinase September 15, 2005 Summary Glucokinase phosphorylates glucose into glucose 6-phosphate using ATP as the phosphate group donor, according to the reaction glucose + ATP Æ glucose 6-phosphate + ADP This protocol describes an indirect assay to determine the activity of glucokinase. Glucose 6- phosphate formed by glucokinase is measured by the formation of NADPH in presence of glucose 6-phosphate dehydrogenase. Solutions Required 1. 100 mM tris HCl pH 7.4 Stock solution could be used 2. 100 mM MgSO4·7H2O Stock solution could be used 3. 10 mM glucose Must be prepared fresh 4. 20 mM ATP Must be prepared fresh 5. 10 mM NADP Must be prepared fresh 6. a solution containing 10 U of glucose 6-phosphate dehydrogenase per 50 μL in tris HCl pH 7.4 buffer. This solution is prepared by mixing 40 μL of a 5000 U/mL solution (Sigma G8529) with 960 μL tris buffer. Preparation of Cell Extract Follow general protocol described in Preparation of Cell Extract. The cell extract should be suspended in tris buffer after pelletization. Spectrophotometer Turn on the ultraviolet bulb on the spectrophotometer (Beckman DU50) and wait 10 minutes for warm-up. Select the kinetics-time window on the instrument. Load the method "A:/nadh" ". These methods each have a run-time of 120 s, a temperature of 37°C, a wavelength of 340 nm and use 2 autosamplers. Procedure 1. For each assay, prepare the two cocktails shown in the following table into two separate quartz cuvettes. Keep them on ice. Volume (μL) added to: Solution Control Experimental tris 500 500 DI H2O 200 100 MgSO4 100 100 glucose 0 100 ATP 50 50 NADP 50 50 G6P dehydrogenase 50 50 2.
    [Show full text]
  • Oxidative Stress-Responsive Microrna-320 Regulates Glycolysis in Diverse Biological Systems
    The FASEB Journal • Research Communication Oxidative stress-responsive microRNA-320 regulates glycolysis in diverse biological systems ʈ ʈ ʈ ʈ Huibin Tang,*, Myung Lee,*, Orr Sharpe,†,‡, Louis Salamone,† Emily J. Noonan,§, ʈ ʈ Chuong D. Hoang,*, Sanford Levine,¶ William H. Robinson,†,‡, ʈ and Joseph B. Shrager*, ,1 *Division of Thoracic Surgery, Department of Cardiothoracic Surgery, †Department of Surgery, and ‡Division of Immunology and Rheumatology and §Division of Hematology; Department of Medicine, ʈ Stanford University School of Medicine, Stanford, California, USA; Veterans Affairs Palo Alto Healthcare System, Palo Alto, California, USA; and ¶Department of Surgery, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA ABSTRACT Glycolysis is the initial step of glucose glycolysis in diverse biological systems. FASEB J. 26, catabolism and is up-regulated in cancer cells (the 4710–4721 (2012). www.fasebj.org Warburg Effect). Such shifts toward a glycolytic phenotype have not been explored widely in other Key Words: phosphofructokinase ⅐ muscle ⅐ diaphragm ⅐ biological systems, and the molecular mechanisms mechanical ventilation ⅐ Warburg effect ⅐ Ets underlying the shifts remain unknown. With pro- teomics, we observed increased glycolysis in disused Cells use glucose to generate the energy [adeno- human diaphragm muscle. In disused muscle, lung sine triphosphate (ATP)] that fuels all cellular pro- cancer, and H O -treated myotubes, we show up- 2 2 cesses. Glycolysis is the initial step in glucose catabo- regulation of the rate-limiting glycolytic enzyme mus- lism, and its end products, in most tissues under most cle-type phosphofructokinase (PFKm, >2 fold, circumstances, are fed into mitochondrial oxidative P<0.05) and accumulation of lactate (>150%, phosphorylation.
    [Show full text]
  • Mechanisms of Mycobacterium Tuberculosis Serine/Threonine Protein Kinase Activation by Christina Elizabeth Baer a Dissertation S
    Mechanisms of Mycobacterium tuberculosis Serine/Threonine Protein Kinase Activation by Christina Elizabeth Baer A dissertation submitted in partial satisfaction of the requirements for the degree of Doctor of Philosophy in Biophysics in the Graduate Division of the University of California, Berkeley Committee in charge: Professor Tom Alber, Chair Professor Carolyn Bertozzi Professor Ehud Isacoff Professor Bryan Krantz Fall 2010 Mechanisms of Mycobacterium tuberculosis Serine/Threonine Protein Kinase Activation © 2010 Christina Elizabeth Baer Abstract Mechanisms of Mycobacterium tuberculosis Serine/Threonine Protein Kinase Activation by Christina Elizabeth Baer Doctor of Philosophy in Biophysics University of California, Berkeley Professor Tom Alber, Chair Mycobacterium tuberculosis (Mtb) coordinates a wide variety of metabolic and cellular responses to changing external environments throughout the multiple stages of infection. Signaling kinases are critical for these responses. The Mtb genome encodes 11 Serine/Threonine Protein Kinases (STPKs) that function as important nodes of this sensing and response network, but the chemical and structural changes that mediate kinase activation have not been elucidated. Autophosphorylation activates several of the Mtb STPKs, and kinase dimerization can activate receptor kinases for autophosphorylation through an allosteric dimer interface. Inter- kinase phosphorylation has been reported, but the function and specificity of these interactions remain unknown. In this study, a biochemical approach was used to comprehensively map the cross-kinase trans-phosphorylation activity of the Mtb STPKs. The results reveal a pattern of kinase interactions that suggests each protein plays a distinct regulatory role in controlling cellular processes by phosphorylating other kinases. The PknB and PknH STPKs act in vitro as master regulators that are activated only through autophosphorylation and also phosphorylate other STPKs.
    [Show full text]