Genetic Assessment of the Subspecies Status of Eurasian Magpies (Pica Pica)Innorway
Total Page：16
File Type：pdf, Size：1020Kb
Ornis Fennica 93: 146–158. 2016 Genetic assessment of the subspecies status of Eurasian Magpies (Pica pica)inNorway Sang-im Lee, Woohjung Kim, Jae Chun Choe & Magne Husby* S. Lee, Institute of Advance Machines and Design, Seoul National University, Seoul 151- 742, Korea S. Lee, W. Kim, Laboratory of Behavioral Ecology and Evolution, Seoul National Univer- sity, Seoul 151-742, Korea J.C. Choe, Laboratory of Behavior and Ecology, Interdisciplinary Program of EcoCreative, Ewha Woman’s University, Seoul 120-750, Korea M. Husby, Section of Science, Nord University, 7600 Levanger,Norway. * Corresponding author’s e-mail: [email protected] Received 17 August 2015, accepted 6 April 2016 Based on phenotypes, two subspecies of Eurasian Magpies (Pica pica) are recognized in Norway, with nominate P. p. pica in southern Norway, and P. p. fennorum in northern Norway. In this study, we investigated whether there are genetically distinct groups of Magpies in Norway, which can be considered in the discussion of the subspecies status. We collected DNA from 61 Magpies from seven locations in Norway, and measured ge- netic diversity using two types of markers: mitochondrial DNA sequences and microsatellites. Genetic differentiation among the Magpies was extremely low. Most of the variance was within populations, and the population identity and the putative subspe- cies border did not explain the genetic variance among the samples. Although microsatellite markers indicated genetic differentiation, the pattern was not consistent with the geographic locations of the sampling sites. Mismatch analysis suggested that the Magpie populations in Norway were formed by rapid expansion. Our results suggest that all the Magpies in Norway have originated from the same refugia after the last glaciation, their colonization in Norway happened quickly, and that the subspecies status of Magpies in Norway needs to be reconsidered. 1. Introduction 1991). Although classification at subspecies level can be subjective, currently 11 subspecies of Mag- There are three different species of Magpies in the pies are recognized in the Eurasian continent world. The Black-billed Magpie (Pica hudsonia) (Birkhead 1991, Gill & Donsker 2016). and the Yellow-billed Magpie (P. nutalli) live in In many cases, subspecies are defined based on North America, and the Eurasian Magpie (P. p ic a ) the morphology, probably because many subspe- lives in the old world (Sibley & Ahlquist 1990). cies were described before molecular methods be- The distribution of Eurasian Magpie is continuous came common in systematics studies (Haig & in large parts of Europe and Asia, except for sev- Winker 2010). The validity of subspecies has been eral isolated populations in north-west Africa, controversial (e.g., Mayr 1982; Frost & Hillis Arabian Peninsula and Kamchatka (Birkhead 1990), but currently it is recognized as a discrete Lee et al.: Genetic assessment of the subspecies status of European Magpies in Norway 147 taxonomic category below species that addresses Perrins 1998). Earlier classification of subspecies the geographic component of variation and differ- was based on morphological differences. P. p . entiation (Haig & Winker 2010). Arecent proposal fennorum is slightly larger, has more white on the made by Haig & Winker (2010) finds a general wings and its tail exhibits more bronze and less consensus among researchers that a reexamination green on the tail than P. p. pica (Coombs 1978). of subspecies status using modern methods is However, clinal variation towards larger size and needed. Thus, although the definition of subspe- more white on the wings from south-west to north- cies may not be necessarily based on the genetic east is also recognized (Coombs 1978). von data, the importance of genetic data on defining Zedlitz (1925) concluded that the subspecies P. p . subspecies is currently well recognized. pica is distributed throughout Sweden, but that Subspecies can be particularly useful when there were some mixtures of the subspecies P. p . there is genetic differentiation that may lead to pica and P. p. germanica (from central Europe) in speciation. However, dispersal and gene flow southern Sweden based on the variation in grey among adjacent populations can prevent the estab- and white on the rump. Later, Lönnberg examined lishment of subspecies, and genetic analysis can be 101 Magpies from different parts of Sweden, five used to estimate the amount of gene flow between Magpies from Norway and 55 from Finland, and different populations (Genovart et al. 2013). The found that wing length gradually increased north- temperate regions have periodically been covered wards (Lönnberg 1927). However, a similar gradi- by extensive ice sheets over the last two million ent in tail length was not evident. Rump color did years. Evidence that Magpies survived all these ice not vary geographically in a systematic way either, ages is found in fossils of a prehistoric Magpie but was whiter in older birds than in young birds. species (P. mourerae) that was present on Mallor- The characteristic difference in the size of the ca, Balearic Islands (Western Mediterranean) 2.5 black tip on the primary feathers between young million years ago (Segui 2001). These expanding and old Magpies (which can be used to age the and retreating ice sheets can generate isolated pop- birds; Stegmann 1927, Erpino 1968, Lee et al. ulations that may further develop into separate 2007) did not vary with latitude. Based mainly on subspecies (Burg et al. 2005, McCormack et al. the gradual increase in wing length northwards, 2008, Burg et al. 2014). Refugia during the ice Lönnberg concluded that there were two subspe- ages and their roles in creating genetic variation is cies: P. p. pica in southern Sweden and P. p . evident both in Europe (Hewitt 2004) and Asia (Li fennorum in northern Sweden, with a mixture in et al. 2009). Biological processes during and be- between. Although it was argued 45 years ago that tween the ice ages may be the reason why there are further investigations were needed to establish the so many subspecies of Magpies in Eurasia. range of the two subspecies in Norway (Haftorn The Magpies in Norway are very sedentary all 1971), no such clarification has been made. Pre- year round (Collett 1921, Husby 2006), as they are vious studies of the genetic divergence among the in most of their range (Birkhead 1991). Although subspecies of Eurasian Magpies found an east– it has been reported that some Magpies migrate west split, but within east and west clades no ge- south in harsh winters (Stegmann 1927, Flint & netic differentiation was found (Zink et al. 1995, Stewart 1983), this has not been observed in Nor- Lee et al. 2003, Kryukov et al. 2004, Haring et al. way and Magpies are rare or not observed on is- 2007, Zhang et al. 2012). These studies included lands, even on islands near the mainland (Baines & the nominate subspecies pica but not fennorum. Anker-Nilssen 1991, Pennington et al. 2004, Tveit In this study, we attempt to assess genetic dif- et al. 2004, Williams 2007). Therefore, Magpie ferentiation among the Magpies in Norway; spe- populations isolated by fiords or mountains may cifically we aim to discern whether there are genet- diverge, and it has been assumed that two subspe- ically distinct groups of Magpies, which can be cies of Magpies exist in Norway, the nominate P. p . used to determine their subspecies status in Nor- pica in the south and P. p. fennorum in the north way. Mitochondrial DNA is an important marker (Collett 1907, Lönnberg 1927). However, classifi- used to detect historical patterns (Pulgarin-R & cation of magpies at the subspecies level is diffi- Burg 2012), and has been successfully used in the cult because of their clinal variation (Snow & classification of species and subspecies of Mag- 148 ORNIS FENNICA Vol. 93, 2016 Fig. 1. Location of the sampling sites: Horda- land (HO), Buskerud (BU), Sør-Trøndelag (ST), Nord-Trøndelag (NT), Nordland (NO), Troms (TR) and Finnmark (FI). The subspecies border be- tween pica and fenno- rum in Norway sug- gested by Lönnberg (1927) is marked with a dotted line. pies globally (Zink et al. 1995, Lee et al. 2003, collected from four areas south of the border be- Kryukov et al. 2004, Haring et al. 2007, Zhang et tween the subspecies (Lönnberg 1927), and 26 al. 2012). However, when the divergence among birds were collected from three areas north of the the populations is small and the range expansion border. Of the 61 birds, 58 were shot in gardens or was fast, mitochondrial DNA might not provide on rubbish dumps, and three were killed by colli- sufficient resolution to detect genealogical rela- sions with cars. Nine hunters delivered the Mag- tionships among the populations. Thus, we ana- pies that were still frozen upon arrival. The distri- lyzed two genetic markers, mitochondrial DNA bution of the collected Magpies is not random, but and microsatellites, to investigate the population rather adjusted so that both of the possible subspe- divergence in Norway. cies are represented in the dataset. 2.2. Genetic analyses 2. Material and methods We obtained tissue from liver and pectoral muscle 2.1. Sample collection and extracted DNA from the tissue using QIAamp DNA Minikit (QIAGEN) following the protocol We collected Magpies from seven different parts provided by the manufacturer. of Norway as described in Fig. 1. 35 birds were For mitochondrial DNA, we amplified the D- Lee et al.: Genetic assessment of the subspecies status of European Magpies in Norway 149 Table 1. Information of the microsatellite markers used in this study. No. means number of alleles. Marker Primer sequence Size No. Source Ase18 F: ATCCAGTCTTCGCAAAAGCC 223–272 23 Richardson et al. 2000 R: TGCCCCAGAGGGAAGAAG Ppi2 F: CACAGACCATTCGAAGCAGA 257–293 18 Martínez et al. 1999 R: GCTCCGATGGTGAATGAAGT Ppi3 F: CCAAACACAAGTACAGCTGCA 222–272 21 Martínez et al.