Historical Mitochondrial Diversity in African Leopards (Panthera Pardus) Revealed by Archival Museum Specimens

Mitochondrial DNA Part A DNA Mapping, Sequencing, and Analysis

ISSN: 2470-1394 (Print) 2470-1408 (Online) Journal homepage: http://www.tandfonline.com/loi/imdn21

Historical mitochondrial diversity in African leopards (Panthera pardus) revealed by archival museum specimens

Corey Anco, Sergios-Orestis Kolokotronis, Philipp Henschel, Seth W. Cunningham, George Amato & Evon Hekkala

To cite this article: Corey Anco, Sergios-Orestis Kolokotronis, Philipp Henschel, Seth W. Cunningham, George Amato & Evon Hekkala (2017): Historical mitochondrial diversity in African leopards (Panthera pardus) revealed by archival museum specimens, Mitochondrial DNA Part A, DOI: 10.1080/24701394.2017.1307973 To link to this article: http://dx.doi.org/10.1080/24701394.2017.1307973

Published online: 19 Apr 2017.

Submit your article to this journal

View related articles

View Crossmark data

Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=imdn21

Download by: [American Museum of Natural History], [Evon Hekkala] Date: 20 April 2017, At: 06:33 MITOCHONDRIAL DNA PART A, 2017 http://dx.doi.org/10.1080/24701394.2017.1307973

RESEARCH ARTICLE Historical mitochondrial diversity in African leopards (Panthera pardus) revealed by archival museum specimens

Corey Ancoa,b , Sergios-Orestis Kolokotronisb,c , Philipp Henscheld, Seth W. Cunninghama, George Amatob and Evon Hekkalaa,b aDepartment of Biological Sciences, Fordham University, Bronx, USA; bSackler Institute for Comparative Genomics, American Museum of Natural History, New York, USA; cDepartment of Epidemiology and Biostatistics, School of Public Health, SUNY Downstate Medical Center, Brooklyn, USA; dPanthera, New York, USA

ABSTRACT ARTICLE HISTORY Once found throughout Africa and Eurasia, the leopard (Panthera pardus) was recently uplisted from Received 30 December 2016 Near Threatened to Vulnerable by the International Union for the Conservation of Nature (IUCN). Accepted 14 March 2017 Historically, more than 50% of the leopard’s global range occurred in continental Africa, yet sampling ’ from this part of the species distribution is only sparsely represented in prior studies examining pat- KEYWORDS terns of genetic variation at the continental or global level. Broad sampling to determine baseline pat- ’ Panthera pardus; African terns of genetic variation throughout the leopard s historical distribution is important, as these leopard; museum measures are currently used by the IUCN to direct conservation priorities and management plans. By collections; genetic including data from 182 historical museum specimens, faecal samples from ongoing field surveys, and diversity; phylogeography published sequences representing sub-Saharan Africa, we identify previously unrecognized genetic diversity in African leopards. Our mtDNA data indicates high levels of divergence among regional populations and strongly differentiated lineages in West Africa on par with recent studies of other large vertebrates. We provide a reference benchmark of genetic diversity in African leopards against which future monitoring can be compared. These findings emphasize the utility of historical museum collections in understanding the processes that shape present biodiversity. Additionally, we suggest future research to clarify African leopard taxonomy and to differentiate between delineated units requiring

monitoring or conservation action.

Introduction species exhibiting discontinuity within their range may also exhibit variation at the molecular level; variation tends to cor- Africa’s complex and diverse biogeographic history has had respond to geographic regions and major climatic events and profound impacts on its ecosystems. Savannas emerged for is well documented in African taxa (Measey & Channing 2003; the first time and glaciers began to form in Antarctica in Moodley & Bruford 2007; Hekkala et al. 2011; Ishida et al. response to gradually cooling temperatures in the Pliocene 2011; Lorenzen et al. 2012; Smitz et al. 2013; Menegon et al. (Futuyma 2013). Global cooling accelerated in the Pleistocene 2014; Dowell & Hekkala 2016; Dowell et al. 2016; Fennessy triggering the most recent ice age, or Last Glacial Maximum et al. 2016) and across felids (Luo et al. 2004; McRae et al. (LGM) (Steele 2007). Prolonged exposure to cool, dry condi- 2005; Haag et al. 2010; Charruau et al. 2011; Barnett et al. tions expanded more arid ecosystems (deserts and savannas) 2014; Bertola et al. 2015). A review of two African felids, the to the north and south and contracted forested regions, lion (Panthera leo) and the cheetah (Acinonyx jubatus) demon- while shifts to warm, moist conditions gave rise to expansive strate this pattern and the importance of revisiting conclu- rainforests across the equator, woodlands to the north and sions drawn from previous research reliant on limited south, and the contraction of arid zones (Steele 2007). numbers and spatial extent of samples. Repeated expansion and contraction of ecosystems frag- Africa’s biogeographic history of expanding and contract- mented refugium distributions of habitat specialists (Futuyma ing habitats has generated disjunct distributions among 2013), particularly in parts of Central and East Africa where biota, including lions (Barnett et al. 2014). Due to severe ecosystems responded drastically to fluctuating climates human persecution, habitat loss and loss of prey, lions dra- (Lorenzen et al. 2012). matically declined and many populations became geographi- Recent genetic studies using the biogeographic history of cally isolated throughout the species’ range (Riggio et al. African species have overturned previously held assumptions 2013). Recent studies have found the African lion to harbour about population linkages in widespread vertebrates. greater genetic diversity than formerly recognized (Barnett Increasingly, research supports the theory that wide-ranging et al. 2006; Bertola et al. 2011; Dubach et al. 2013;

CONTACT Corey Anco [email protected] Department of Biological Sciences, Fordham University, 441 East Fordham Road, Bronx, NY 10458, USA Supplemental data for this article can be accessed here. ß 2017 Informa UK Limited, trading as Taylor & Francis Group 2 C. ANCO ET AL.

Barnett et al. 2014), largely due to the limited spatial extent livestock and game animals, harvest for traditional and global of earlier studies (O’Brien et al. 1987). These recent studies all trade in parts, habitat loss, the loss of prey populations, and contributed to a gradual taxonomic revision of the lion, with unsustainable trophy hunting (Nowell & Jackson 1996; the most comprehensive study by Bertola et al. (2015) using Henschel et al. 2011; Packer et al. 2011; Raza et al. 2012; nuclear (nuDNA) and mitochondrial (mtDNA) markers. The Swanepoel et al. 2013). Compounded over time these threats authors confirmed deeply rooted phylogeographic breaks have resulted in a 63–75% contraction of their global distri- within the African continent with West and Central African bution, while in Africa, 48–67% of leopard range has been populations clustering with Indian lions (formerly recognized lost, with leopards in North and West Africa suffering the as a separate subspecies; P. l. persica), and being genetically most catastrophic range reductions (99% and 86-95%, distinct from East and Southern African lions. The results of respectively) (Jacobson et al. 2016). Remnant populations in their analyses contested the recognized taxonomic status of these regions may be geographically disconnected and are lions by confirming the existence and clustering of independ- potentially at risk of genetic isolation, as has been speculated ent genetic lineages into several distinct geographic regions. for lions (Bjorklund€ 2003; Riggio et al. 2013). Given the high Other recent phylogeographic studies are revealing of sub- rates of leopard range loss, it is critical for the species’ man- regional genetic differentiation among wide-ranging African agement that we lack historical genetic data for leopards and taxa (Moodley & Bruford 2007; Kadu et al. 2011; Demos et al. are therefore unable to adequately assess the impacts range 2014; Cunningham et al. 2016; Fennessy et al. 2016). fragmentation already had on extant populations. Early genetic analyses suggested the cheetah suffered a Prior taxonomic hypotheses for the African leopard genetic bottleneck around ten thousand years ago (Ka) dur- included descriptions of more than 20 subspecies (Table 1) ing the LGM rendering surviving populations depauperate at (Stein & Hayssen 2013) spanning all major biomes except the the immunogenetic level (O’Brien et al. 1983, 1985; Menotti- extreme arid landscape of the Saharan Desert (Figure 1) Raymond & O’Brien 1993). However, Charruau et al. (2011) (Olson et al. 2001). While these subspecific designations likely revealed distinct geographic clustering and divergence in overestimated the actual number of genetically distinct leop- extant populations predating the LGM using 94 samples from ard lineages, it is worth noting that descriptive characteristics most of the cheetah’s historical range. Additionally, Castro- (e.g. pelage morphology) are often associated with unique Prieto et al. (2011) attributed the decreased diversity geographic features including the near fixation of melanism observed by O’Brien et al. (1983) in the MHC class I alleles of in Asiatic leopards south of the Isthmus of Kra (Kawanishi cheetahs to small sample sizes. Furthermore, Caro and et al. 2010). With the advent and application of genetic analy-

Laurenson's (1994) critique largely dismissed linking genetic ses, we are better able to evaluate the taxonomic hypotheses impoverishment and juvenile mortality in cheetahs using proposed by previous researchers within the context of phy- strong supporting evidence from ecological studies to explain logeography (Avise 2000). mortality rates (predation was responsible for 73% of cub The International Union for the Conservation of Nature deaths). Together, these reports highlight the importance in (IUCN) recognizes nine subspecies based on molecular analy- revisiting previous findings with increased sample sizes and ses (Miththapala et al. 1996; Uphyrkina et al. 2001)(Table 1). geographic breadth and in recognizing data limitations while With the exception of the African (P. p. pardus) and Indian considering complementary fields of research. Recent atten- leopard (P. p. fusca), the IUCN lists or proposes all other sub- tion and revisions to genetic studies focusing on the African species as Endangered or Critically Endangered (Stein et al. lion and cheetah bring into question the status of Africa’s 2016). Previous genetic studies of the African leopard were remaining big cat, the leopard (Panthera pardus). limited by small sample size and a geographic bias The leopard is a large, solitary carnivore once contiguous (Miththapala et al. 1996; Uphyrkina et al. 2001), and suffer throughout Africa and Eurasia, and possesses the greatest his- from large gaps in geographic representation from the major- torical distribution (34,850,000 km2) of any felid (Nowell & ity of Africa (Table S1), increasing the likelihood that previous Jackson 1996; Sunquist & Sunquist 2002; Hunter et al. 2013; assessments may have failed to capture the full spectrum of Jacobson et al. 2016). It is a habitat generalist (Nowell & genetic diversity harboured in the African leopard. Jackson 1996) and inhabits nearly every habitat type includ- Furthermore, we observed conflicting information in samples ing savannas, woodlands, shrublands, temperate and tropical shared between the Miththapala et al. (1996) and Uphyrkina forests, montane habitats, swamps, and semi-arid deserts et al. reports (2001) (Table S2). As a result, it is critical to reas- (Sunquist & Sunquist 2002; Dutta et al. 2013; Hunter et al. sess African leopards using larger sample sizes and wider 2013) and ranges from sea level to 4500 m above sea level geographic coverage. (a.s.l.) (Aryal & Kreigenhofer 2009). Relative to other members In this study, we use DNA sequence data from 182 individ- of the Panthera genus, the leopard is comparatively adapt- uals including museum specimens (pre-1970, also referred to able, partly owing to its broader diet, one of the broadest of as archival or historical in this study) and contemporary any mammalian carnivore (Bailey 1993; Hayward et al. 2006) (post-1990) faecal and tissue samples to provide a practical and given prey is abundant can develop a high tolerance to reference benchmark of genetic diversity in African leopards human disturbance in the absence of intense direct persecu- across sub-Saharan Africa against which future monitoring tion (Mondol et al. 2009; Athreya et al. 2013; Swanepoel et al. can be compared. We (a) determine if genetic diversity of 2013; Odden et al. 2014). leopards found in museum collections is adequately repre- Leopards are vulnerable to numerous ongoing threats sented in previously published literature, (b) assess popula- including persecution for perceived and realized threats to tion structure and discuss phylogeographic patterns in the MITOCHONDRIAL DNA PART A 3

Table 1. Description of classically described leopard subspecies adapted from Stein and Hayssen (2013). Subspecies name Locality Region Source Notes Panthera pardus – See below Felis pardus Linnaeus, 1758 IUCN status: Near Threatened pardus North North Africa Felis pardus Linnaeus, 1758 IUCN status: Near Threatened (nomi- nate form for continental Africa) adersi Zanzibar East Africa P[anthera] p[ardus]adersi Pocock, 1932a: 33. Type locality ‘Zanzibar,’ restricted to ‘near Chuaka’ (Pocock 1932b:563). adusta Abyssinia, Ethiopia East Africa Panthera pardus adusta Pocock, 1927: 214. Type locality ‘unknown.’ antinorii Somalia East Africa (Felis pardus) antinorii de Beaux, 1923: 276, 278. Type locality ‘Keren, paese dei Bogos,’ Somalia. barbarus d’Algerie North Africa F(elis) pardus barbarus de Blainville, 1843: 186. Type locality ‘d’Algerie’. chui Northern Uganda East Africa Felis pardus chui Heller, 1913: 6. Type locality ‘Gondokoro, northern Uganda’. fortis Kenya East Africa Felis pardus fortis Heller, 1913: 5. Type locality ‘Loita Plains, Southern Guaso Nyiro district, British East Africa’. iturensis Belgian Congo Central Africa Panthera pardus iturensis J. A. Allen, 1924: 259. Type locality ‘Niapu, Belgium Congo’. leopardus (Gunther)€ Grahamstown Southern Africa Felis leopardus melanot[ica].Gunther,€ 1885: plate xvi. Type locality ‘Grahamstown,’ clarified to ‘about 20 miles from Grahams-town’ by Gunther€ (1886:205). leopardus (Scheber) Senegal West Africa Felis leopardus Schreber, 1775:plate CI; Schreber, 1777: 387. Type locality ‘Senegal’. melanosticta Unknown Southern Africa F(elis) pardus melanosticta Lydekker, 1908: 430. Unjustified emendation of Felis melanotica Gunther,€ 1885. melanotica Unknown Southern Africa F(elis) pardus melanotica: Pocock, 1907: 677. Name combination. minor Sudan, South Sudan East Africa (Leopardus) pardus minor Matschie, 1895: 199. Nomen nudum. nanopardus Somalia East Africa Felis pardus nanopardus Thomas, 1904: 94.

Type locality ‘40 miles west of Gorahai,’ Somaliland. palearia Algeria North Africa Felis palearia F. G. Cuvier, 1832: 3 for plate of panthere male. Type locality ‘Alger’. panthera Algeria North Africa Felis panthera Schreber, 1775: plate XCIX; Schreber, 1777:384–385. Type locality ‘Africa,’ restricted to ‘Algeria’ by Ellerman and Morrison-Scott (1951:316). poecilura Gabon Central-West Felis poecilura Valenciennes, 1856: 1036. Type locality ‘Gabon’. puella Namibia Southern Africa P[anthera] p[ardus]puella Pocock, 1932a: 33. Type locality ‘Kaokoveld’, Namibia. reichenowi Kamerun Central-West Panthera pardus reichenowi Cabrera, 1918: 481. Type locality ‘‘Yoko(K amerun)’.’ ruwenzorii Camerano Central-West F(elis) p(ardus) ruvenzorii de Beaux, 1923: 275. Unjustified emendation of Felis pardus ruwenzorii Camerano, 1906. shortridgei Namibia Southern Africa P[anthera] p[ardus] shortridgei Pocock, 1932a: 33. Type locality ‘Damaraland,’ restricted to ‘Gangongo, 3560 ft. alt. on the Okavango River some 120 miles above the Okavango swamp in Western Caprivi’ (Pocock 1932b: 584). suahelicus Uganda East Africa Felis leopardus suahelicus Neumann, 1900: 551. Type locality ‘Tanga, am Manjara-See und in den Loita-Bergen … In Nai (Nord-Ugogo), in Usandawe und in Uganda’. varia Unknown ? Felis leopardus varia Schreber, 1777: 387, plates CI and CIb. Vide Wagner 1841:479. Type locality unknown. vulgaris Unknown ? Panthera vulgaris Oken, 1816: 1052. Unavailable name (International Commission on Zoological Nomenclature 1956: Opinion 417). nimr Saudi Arabia Arabian Peninsula Felis nimr Hemrich and Ehrenberg, IUCN status: Critically Endangered 1833:plate xvii. Type locality ‘Arabia.’ (continued) 4 C. ANCO ET AL.

Table 1. Continued Subspecies name Locality Region Source Notes Type specimen: ‘Arabian skin from the mountains in the vicinity of Qunfida, Asir, Saudi Arabia’ (Spalton and Al Hikmani 2006). saxicolor Iran Southwest Asia P[anthera] p[ardus] saxicolor Pocock, IUCN status: Endangered 1927:213. Type locality ‘Asterabad in southern Iran’ (Spalton and Al Hikmani 2006). fusca India Indian subcontinent Felis fusca Meyer, 1794. Type locality ‘India IUCN status: Near Threatened orientali’. kotiya Ceylon Sri Lanka Panthera pardus kotiya Deraniyagala, IUCN status: Endangered 1956:116. Type locality ‘Ceylon’. delacouri Annam Southeast Asia Panthera pardus delacouri Pocock, IUCN status: Near Threateneda 1930b:325. Type locality ‘Hue in Annam’. melas Java Indonesia Felis melas G. Cuvier, 1809:152. Type locality IUCN status: Critically Endangered ‘Java’. japonensis Japan North-Central China Leopardus japonensis Gray, 1862:262, plate IUCN status: Near Threateneda XXXIII. Alleged type locality ‘Japan’. orientalis Korea Northeast Asia Felis orientalis Schlegel, 1857:23, figure 13. IUCN status: Critically Endangered Type locality ‘Korea’. aRecent assessments by Laguardia et al. (2017) and Rostro-Garcıa et al. (2016) recommend uplisting of Indochinese and North Chinese leopards from ‘Near Threatened’ to ‘Critically Endangered’ and ‘Endangered’, respectively. context of wide-ranging African taxa, and (c) explore a prob- K were added and the incubation was repeated. All process- able geographic origin and distribution of genetic diversity of ing of archival samples was conducted in a PCR-free room, African leopards across sub-Saharan Africa. We also discuss used specifically for degraded or low-quality DNA. Negative

the role of DNA damage, and deamination in particular, controls were used throughout the process. regarding use and analysis of museum samples. We targeted a 611 bp region of the ND-5 mitochondrial gene, corresponding to positions 12,632–13,242 in the mito- Materials and methods chondrial genome sequence of the leopard (GenBank acces- sion EF551002.1) (Wei et al. 2011), known to harbour Sample origin intraspecific variation specifically in leopards (Miththapala Sample origin and locality data are detailed in Table 2. For et al. 1996; Uphyrkina et al. 2001; Farhadinia et al. 2015; archival specimens we sampled bone and tissue fragments Ropiquet et al. 2015). Due to the age and quality of the sam- from 94 leopard skulls (Department of Mammalogy, American ples used in this analysis, we generated amplicons <250 bp Museum of Natural History [AMNH]), obtained 15 faecal sam- using eight primer pairs (Table S3). We used a 25 lL reaction ples from field surveys, and retrieved an additional 126 volume for PCR of archival specimens consisting of 11.5 lLof mtDNA sequences from NCBI GenBank (Ropiquet et al. 2015). AmpliTaq Gold 360 (Thermo Fisher, Waltham, MA), 10 lM for-

Only archival samples where the entire ND-5 locus was ward and reverse primer (0.7 lL each), 2 lL of MgCl2, 8.6 lLof sequenced were included in our analyses. Faecal samples for molecular grade water, and 1.5 lL of template DNA. Gabon, Nigeria, Senegal, and the Republic of Congo (n ¼ 15) Contemporary samples followed the same recipe but used were provided by collaborators, including Panthera (New 1 lL of DNA template and 9.1 lL of molecular grade water. York, NY) and the Leibniz Institute for Zoo and Wildlife PCR was performed on Applied Biosystems 2720 (Thermo Research (Berlin, Germany). Samples were collected between Fisher, Waltham, MA) and Mastercycler ep gradient S 1905 and 2013. Samples from two earlier studies (Miththapala (Eppendorf, Hamburg, Germany) thermal cyclers. Sanger et al. 1996; Uphyrkina et al. 2001) were excluded due to con- sequencing was carried out on an Applied Biosystems 3730xl flicting sample origin and/or sequence discrepancies. DNA Analyzer (Thermo Fisher, Waltham, MA). Sequence chro- matograms were inspected and assembled in Sequencher 5.2. Laboratory work 4 (Gene Codes Corp., Ann Arbor, MI). We then used BLAST on DNA was isolated using the DNeasy Blood and Tissue Kit NCBI GenBank (Johnson et al. 2008; http://blast.ncbi.nlm.nih. (Qiagen, Hilden, Germany) with the following modifications gov/Blast.cgi) to confirm the genetic identity of the samples. for archival samples. Sterilized samples were covered in l 200 l, of 1 Phosphate Buffer Saline (PBS) solution and incu- Data analysis bated at room temperature for 48 h until tissues softened prior to digestion according to the manufacturer’s protocol. If The final dataset was composed of 182 consensus DNA tissues remained undigested, an additional 20 ll of proteinase sequences: 41 archival, 15 contemporary faecal, and 126 from MITOCHONDRIAL DNA PART A 5

Figure 1. Distribution of 12 African leopard subspecies as described by Miththapala et al. (1996) and Uphyrkina et al. (2001). Hypothetical distributions displayed over biomes following Olson et al. (2001). Additionally described subspecies are listed in Table 1. For interpretation of terrestrial biomes the reader is referred to the online version of this article.

GenBank. PopART (Leigh & Bryant 2015; http://popart.otago. together as one haplotype group. Haplotypes characterizing ac.nz) was used to construct a median-joining haplotype net- the CSA population are represented by a cluster of leopard work with default parameters (e ¼ 0) (Bandelt et al. 1999) range countries primarily located south of equatorial Africa. edited and annotated with InkScape (free open-source SVG With the exception of two individuals, all samples graphics editor; Bah 2007). We retrieved additional ND-5 comprising the haplotype cluster designated as SA were from sequences from GenBank for Arabian and Persian leopards South Africa. (AY035277-79) used as outgroups. Haplotypes were assigned We generated a geographical distribution map of the hap- to one of the five populations using a combination of geo- lotypes using a binary matrix in ArcGIS 10.3 (ESRI, Redlands, graphic origin, haplotype clustering on network, and genetic CA) and displayed haplotypes over the historical leopard dis- similarity criteria (Figure 2). The five populations are: West tribution layer from Jacobson et al. (2016)(Figure 3). We used Africa (WA), Coastal West-Central Africa (CWCA), Central-East exact localities and coordinate data where available. DNA Africa (CEA), Central-Southern Africa (CSA), and Southern sequences were aligned in MEGA 6.06 (Tamura et al. 2013) Africa (SA). Assignment of haplotypes to WA and CWCA was using ClustalW (Larkin et al. 2007). Geographical partitioning based on haplotype clustering and genetic divergence from of haplotypes was quantified via analysis of molecular var- neighbouring haplotype clusters. For CEA, the occurrence of iance (AMOVA) (Excoffier et al. 1992). Populations were a dominant haplotype and multiple connections to other placed into one of the three continental regions associated haplotypes representing leopard range countries predomi- with African phylogeography: (1) West Africa composed of nantly in equatorial Africa supports clustering these samples the WA population representing the western extent of the 6 C. ANCO ET AL.

Table 2. Origin and collection data of leopard samples. Geographic region Country No. of samples Sample identifier Specific locality Collection date Source West Africa Nigeria 1 NI-17 Gashaka-Gumti NP 2009 Panthera, Philipp Henschel Senegal 10 SEN-01, SEN-03, SEN-08, Niokolo-Koba NP 2011 Panthera, Philipp SEN-10, SEN-21, SEN- Henschel 23, SEN-28, SEN-37, SEN-41, SEN-43 Central Africa Cameroon 13 54334, 87236, 167352, N/A 1923–1946 AMNH 170289, 170293, 170294, 170295, 170296, 170300, 170301, 170302, 170305, 170309 Chad 2 164151 Fort Archambault District 1952 AMNH 165802 N/A 1905 AMNH DRC 9 52038 Akenge 1913 AMNH 52006, 52021, 52023 Faradje 1911–1913 AMNH 52048 Medje 1914 52044 Gamangui 1910 AMNH 189390, 189391 Ubangi District, Karawa 1905 AMNH 208770 Kivu District 1962 AMNH Gabon 3 GAB-10, GAB-24, GAB-26 Lope NP 2011 Panthera, Philipp Henschel Republic of Congo 1 T-Congo Domaine de Chasse de 2013 Leibniz Institute for Zoo Mboko HR and Wildlife Research, Torsten Bohm East Africa Kenya 5 34745, 34746 Cherangangi Hills 1912 AMNH 34747 Elgeyo Forest 1913 AMNH 88628, 88629 N/A 1933 AMNH Tanzania 6 81301, 81302, 81303 Rungwe 1929 AMNH 85161 Serengeti Plains 1928 AMNH 88393 Bamboo Forest 1933 AMNH 42216 N/A 1913 AMNH Southern Africa Angola 1 80610 Chitau 1925 AMNH Botswana 1 169460 Ngamiland, Bushman Pits 1950 AMNH

Mozambique 1 186944 N/A 1948 AMNH 32 leo01, leo03, leo04, leo05, Niassa Province 1998–2008 Ropiquet et al. (2015) leo06, leo08, leo09, leo10, leo11, leo12, leo13, leo14 leo15, leo16, leo17, leo75, leo77, leo79, leo80, leo81, leo82, leo84, leo85, leo88, leo89, leo90, leo91, leo94, leo95, leo97, leo98, leo99 Namibia 1 165112 Kaokoveld 1953 AMNH South Africa 1 81845 Transvaal 1925–1930 AMNH 10 leo18, leo20, leo21, leo22, Eastern Cape 1998–2008 Ropiquet et al. (2015) leo23, leo65, leo66, leo165, leo167, leo168 18 leo34, leo35, leo36, leo37, Kruger NP 1998–2008 Ropiquet et al. (2015) leo38, leo39, leo40, leo41, leo42, leo54, leo55, leo56, leo101, leo102, leo103, leo104, leo105, leo106 43 leo44, leo110, leo121, Mkuze GR, Phinda GR 1998–2008 Ropiquet et al. (2015) leo122, leo123, leo124, leo125, leo126, leo127, leo128, leo129, leo130, leo131, leo132, leo133, leo134, leo135, leo136, leo137, leo138, leo139, leo140, leo141, leo142, leo143, leo144, leo145, leo146, leo147, leo148, leo149, leo150, leo151, leo152, leo153, leo154, leo155, leo156, leo157, leo158, leo159, leo160, leo161 (continued) MITOCHONDRIAL DNA PART A 7

Table 2. Continued Geographic region Country No. of samples Sample identifier Specific locality Collection date Source 23 leo25, leo26, leo27, leo28, Western Cape 1998–2008 Ropiquet et al. (2015) leo31, leo33, leo45, leo47, leo49, leo50, leo53, leo57, leo58, leo61, leo62, leo64, leo68, leo69, leo70, leo71, leo72, leo73, leo74 Zambia 1 89842 N/A 1939 AMNH NP: National Park; N/A: Not Available; AMNH: American Museum of Natural History; DRC: Democratic Republic of Congo; GR: Game Reserve.

Figure 2. Median-joining network of 182 African leopards. Coverage spans 15 countries across sub-Saharan Africa. Three leopard sequences from GenBank are used as outgroups: P. p. nimr (Arabian leopard: Saudi Arabia/Oman?) and P. p. saxicolor (Persian leopard: Afghanistan). Haplotypes are color-coded according to geography. Size of circle is proportional to the number of individuals sharing the same DNA sequence. Hash marks indicate mutations between haplotypes. Pie chart divisions indicate haplotype sharing between countries. Please refer to the online version of this article for interpretation of colored haplotypes. leopard habitat; (2) Central-East-Southern Africa composed of Results the CWCA, CEA, and CSA populations representing equatorial leopard habitat; and (3) Southern Africa composed of the SA We identified 30 distinct haplotypes from 182 sequenced population representing the southern extent of leopard habi- individuals spanning sub-Saharan Africa. Haplotypes generally tat. We assessed portions of genetic variance to divergence fell into five distinguishable clusters as suggested by the either among regions (West, Central-East/Central-Southern, median-joining network with four haplotypes shared by ¼ Southern Africa), among populations within regions (CWCA, 72.5% of the samples (n 132, Figure 2). Archival and mod- CEA, CSA) or within populations. Genetic diversity indices and ern faecal samples accounted for 67% of observed haplotypes ¼ ¼ population statistics (pairwise FST analyses) were calculated in (n 20), with another 10% (n 3) shared between museum, Arlequin 3.5 (Excoffier & Lischer 2010) using the Kimura 2- modern faecal samples, and/or GenBank. GenBank sequences parameter nucleotide substitution model (Kimura 1980)to accounted for the remaining 23% (n ¼ 7) of haplotypes. correct for multiple hits accounting for transitions and trans- Private haplotypes were observed in each population, and versions (Table 3). For population analyses, historical samples H10, the dominant, i.e. most frequent, haplotype in CEA, con- refer to archival or museum specimens collected pre-1970, tained the greatest number of network connections (n ¼ 10), and contemporary samples refer to faecal and tissue samples and had the fewest connections between each other clus- collected after 1990. tered population (Figure 2). H10 was also the most 8 C. ANCO ET AL.

Figure 3. Distribution of leopard haplotypes across sub-Saharan Africa. Haplotypes are displayed over historic and contemporary leopard distribution layers (Jacobson et al. 2016). Haplotypes are color-coded according to geographical origin and grouped into regional groups (see Figure 2). Pie chart divisions indicate presence of more than one haplotype at a given locality. Please refer to the online version of this article for interpretation of colored haplotypes.

geographically widespread of haplotypes spanning 53% Two leopards from Cameroon clustered with three leopards (n ¼ 8) of sampled countries, and likely the ancestral haplo- from Gabon comprising the CWCA population. type among populations. There were 47 substitution sites, with a mean of 11.6 sub-

Haplotype diversity (Hd) exceeded 0.5 for all populations stitutions per population (Table 3). The transition:transversion except CSA (0.29) (Table 3). CWCA and CEA harboured the ratio was 18.33:1, thus indicating a high transition bias for highest nucleotide diversity per site (p) and per gene (k) this locus in Africa. The highest number of substitutions (CWCA: p ¼ 0.0066, k ¼ 4; CEA: p ¼ 0.0051, k ¼ 3), and CWCA occurred within the CEA population (25 transitions and 1 showed the greatest genetic separation (six mutational steps transversion), followed by SA (15 transitions and 1 transver- between H5 and H10) in the network (Figure 2). Similar diver- sion). We also examined incidences of singleton mutations in sity values were found in WA and SA, while CSA exhibited museum and faecal samples across populations (Table S4) to the lowest diversity values. Haplotype distributions exhibited evaluate the potential of DNA sequence damage due to geographic separation, although clinal variation was observed hydrolytic deamination (Hofreiter et al. 2001; Mitchell et al. in every population except WA (Figures 2 and 3). In one 2005; Zimmermann et al. 2008). Singleton mutations resulting instance between CEA and CSA (one leopard from in C!T transitions occurred at a total of five positions Democratic Republic of Congo, DRC, grouped with CSA), between two populations, whereas G!A transitions occurred eight instances between CEA and SA (eight leopards from at a total of three positions between two populations. South Africa grouped with CEA), and four instances between Variable sites are summarized in Table 4. The AMOVA analysis CSA and SA (two leopards from Mozambique grouped with found distinct population structuring at each scale of hier- SA and two leopards from South Africa grouped with CSA). archical partitioning. The greatest amount of variance was MITOCHONDRIAL DNA PART A 9

explained to be between groups, which accounted for 54% of observed variation (Table S5). Differences among popula-

Private tions within groups represented 27% of the observed varia-

substitutions tion, while 19% of the variation was explained within populations.

Pairwise FST values were calculated between all populations and compared to two Asiatic leopard subspecies (the Arabian leopard (P. p. nimr) in the Middle East and the Persian leopard (P. p. saxicolor) in Southwest Asia) mined from GenBank (Table S6). Significant separation (p < .05) was detected between all populations (Figure 4), indicating reduced gene flow and population structuring. Two populations (WA and CWCA) showed almost complete differentiation from CSA (0.97 and 0.96, respectively). Population average pairwise differences for African populations were also calculated between and within populations (Figure 5). The corrected average pairwise differences (Nei’s D) were

largely congruent with results of the pairwise FST matrix (Figure 4). The average number of pairwise differences between CEA and CSA was low (Nei’sD¼ 1.14, uncorrected distance ¼ 2.97) and the average pairwise difference within CSA was the lowest of all populations (0.3) (Figure 5).

sites Transitions Transversions Substitutions Indels Pairwise FST values between African populations vary slightly Parsimony informative when Asiatic sequences are omitted due to missing data (61 bp) in retrieved sequences from GenBank for Persian leopards. We tested for temporal changes by conducting

pairwise FST comparisons between historical (museum) and sites (S)

Segregating contemporary samples (faecal and tissue) from the same pop- )

ulation and found three of the four populations (CWCA, CSA, k and SA) did not significantly differ between time periods (Table S7). WA only contained contemporary samples, and Diversity ¼ ¼ ¼ per gene ( FST[CEAc-CEAh] 0.27 (c contemporary, h historical) was

) significant, however, contemporary samples for CEA were p only represented by the haplotypes: H10 and H17 (Figure 2). Nucleotide diversity ( Discussion Historical diversity of museum specimens

Haplotype This work assembled 182 DNA sequences from 41 archival diversity (Hd) and 15 contemporary faecal samples, as well as 126 GenBank sequences, and represents the most comprehensive mtDNA dataset for leopards. We reveal extensive, cryptic diversity in No. of

haplotypes the ND-5 locus among historical populations and retention of independent genetic lineages in extant populations. Distinct N

182 30 0.841 0.0042 2.354haplotypes 12 are 24 geographically 11 (Mean) 0.6 (Mean) 11.6 (Mean) clustered 1.2 (Mean) 7.2 (Mean) indicating a lack of panmixia. Overall haplotype diversity was high (0.84) with moderate levels of nucleotide diversity (p ¼ 0.0042) in leop- locus of leopards across sub-Saharan Africa. ards across sub-Saharan Africa (Table 3). Nucleotide diversity

ND-5 fell between values observed in mtDNA of other large felids group

Population including jaguars (0.0077; Eizirik et al. 2001), lions (0.0066;

sub-Saharan Africa Antunes et al. 2008), pumas (0.0032; Caragiulo et al. 2014), Coastal West-CentralCentral-Southern 5 37 5 3 1 0.291and tigers 0.0066 0.0005 (0.0018; 4 0.303 Luoet 0 10 al. 2004). 2 0 2 9 0 1 2 10 1 0 1 6 While caution must be taken when drawing conclusions from the analyses of individual mitochondrial loci, we have identified a greater degree of genetic diversity in the ND-5 Genetic variation in the locus of the African leopard than previously recognized. Samples of known origin used in previous studies account Region Sub-Saharan AfricaWest All Samples: Central-East-Southern Central-EastSouthern 43 West Southern 12 0.897 10 87 4 0.0051 6 3 0.533 0.602 0.0018 0.0014 7 1.067 0.796 13 3 2 25 1 4 1 4 15 26 0 1 0 4 16 17 0 5 10 2 Table 3. for four countries (Botswana, Mozambique, Namibia, and

Table 4. Polymorphisms in African leopard ND-5 locus: Parsimony-informative sites are shaded for each population (see Figure 2). 10

Sample code Country Population 9 10 16 21 22 25 26 33 34 41 44 59 64 103 124 125 130 131 136 137 143 146 152 164 167 183 184 189 212 215 239 262 266 271 272 284 296 308 320 329 338 339 342 344 356 365 380 390 413 428 437 461 467 473 479 500 518 533 539 548 569 572 573 580 34747 Kenya Central East CTTTTTAGCTTCTACTCCCCCAGCCGCGTCCTCTCTGAGCTTACCCCAGTAACGTTTTCTCCGT 170294 Cameroon Central East ...... T...... AL. ET ANCO C. T-Congo Republic of Congo Central East ...... T....G...... 170301 Cameroon Central East ...... T....R...... 52038 DRC Central East ...... A...... T..... 170300 Cameroon Central East ...... T....G...... 189391 DRC Central East ...... A...... T..... leo106 South Africa (Kruger) Central East ...... A...... T..... 34745 Kenya Central East ...... A...... 34746 Kenya Central East ...... 170293 Cameroon Central East ...... T....G...... 170296 Cameroon Central East ...... T....G...... 52021 DRC Central East ...... A...... T..... 189390 DRC Central East ...... A...... T..... 170309 Cameroon Central East ...... Y....YR..W...T....G...... 88629 Kenya Central East ...... 170295 Cameroon Central East ...... T....G...... NI|17 Nigeria Central East ...... T...... 88393 Tanzania Central East ...... 165802 Chad Central East ...... T...... Y..TT...R....R...... 88628 Kenya Central East ...... leo40 South Africa (Kruger) Central East ...... C...... A...... T..... leo37 South Africa (Kruger) Central East ...... C...... A...... T..... leo38 South Africa (Kruger) Central East ...... C...... A...... T..... leo105 South Africa (Kruger) Central East ...... C...... A...... T..... leo35 South Africa (Kruger) Central East ...... C...... A...... T..... leo102 South Africa (Kruger) Central East ...... C...... A...... T..... 81845 South Africa Central East ...... C...... A...... T..... 164151 Chad Central East ...... T...... C...... 167352 Cameroon Central East ...... T...... C...... 170289 Cameroon Central East ...... T...... C...... 87236 Cameroon Central East ...... T...... C...... 81303 Tanzania Central East .....C...... T...... T...... R.R.Y...... 81301 Tanzania Central East .....C...... T...... T...... 81302 Tanzania Central East .....C...... T...... T...... Y..YY...... 85161 Tanzania Central East ...... T...... T...... 54334 Cameroon Central East ...... T...... A...... C 42216 Tanzania Central East ...... G...... 52048 DRC Central East ...... Y...G..A.C.YT..... 52023 DRC Central East ...... G...... T...... 52006 DRC Central East ...... C...... A.G...... 52044 DRC Central East ....C...... G..TA..AT...... A...... T...G..A.C.CT..T.. 89842 Zambia Central East ....C...... G..TA.AAT...... T...G..A.C.CT..T.. SEN|03 Senegal West ...C...... T....TAT.AT...... A..T...... A...TA.C.CT..... SEN|08 Senegal West ...C...... T....TAT.AT...... A..T...... A...TA.C.CT..... SEN|01 Senegal West ...C...... T....TAT.AT...... A..T...... A...TA.C.CT..... SEN|10 Senegal West ...C...... T....TAT.AT...... A..T...... A...TA.C.CT..... SEN|37 Senegal West ...C...... T....TAT.AT...... A..T...... A...TA.C.CT..... SEN|28 Senegal West ...C...... T....TAT.AT...... A..T...... A...TA.C.CT..... SEN|41 Senegal West ...C...... T....TAT.AT...... A..T...... A...TA.C.CT..... SEN|21 Senegal West ...C...... T....TA..A...... A..T...... AC..TA.C.CT..... SEN|23 Senegal West ...C...... T....TAT.AT...... A..T...... AC..TA.C.CT..... SEN|44 Senegal West ...C...... T....TAT.AT...... A..T...... AC..TA.C.CT...A. GAB|10 Gabon Coastal West Central T.C...G...... T....TA..A...... A.AT..G...... GTA.C.CT..... GAB|24 Gabon Coastal West Central T.C...G...... TT....TA..A...... A.AT..G...... GTA.C.CT..... GAB|26 Gabon Coastal West Central T.C...G.T...... T....TA..A...... A.AT..G...... GTA.C.CTC.... 170302 Cameroon Coastal West Central T.C...G...... T....TA..A...... A.AT..G...... GTA.C.CT.T... 170305 Cameroon Coastal West Central TCC...G...... R.AT..G..T.....GTA.C.YY..... 80610 Angola Central Southern ...... R...... C...... 169460 Botswana Central Southern ...... C...... 208770 DRC Central Southern ...... C...... leo101 South Africa (Kruger) Central Southern ...... C...... leo104 South Africa (Kruger) Central Southern ...... C...... 165112 Namibia Central Southern ...... C...... leo75 Mozambique Central Southern ...... C...... leo88 Mozambique Central Southern ...... C...... leo10 Mozambique Central Southern ...... C...... leo12 Mozambique Central Southern ...... C...... leo99 Mozambique Central Southern ...... C...... leo14 Mozambique Central Southern ...... C...... leo15 Mozambique Central Southern ...... C...... leo80 Mozambique Central Southern ...... C...... leo17 Mozambique Central Southern ...... C...... leo82 Mozambique Central Southern ...... C...... leo84 Mozambique Central Southern ...... C...... leo8 Mozambique Central Southern ...... C...... leo3 Mozambique Central Southern ...... C...... leo79 Mozambique Central Southern ...... C...... leo90 Mozambique Central Southern ...... C...... leo9 Mozambique Central Southern ...... C...... leo11 Mozambique Central Southern ...... C...... leo81 Mozambique Central Southern ...... C...... leo91 Mozambique Central Southern ...... C...... leo1 Mozambique Central Southern ...... C...... leo16 Mozambique Central Southern ...... C...... leo13 Mozambique Central Southern ...... C...... leo77 Mozambique Central Southern ...... C...... leo4 Mozambique Central Southern ...... C...... leo85 Mozambique Central Southern ...... C......

(continued)

leo97 Mozambique Central Southern ...... T...... C...... leo98 Mozambique Central Southern ...... T...... C...... leo94 Mozambique Central Southern ...... G...C...... leo5 Mozambique Central Southern ...... G...C...... leo89 Mozambique Central Southern ...... G...C...... leo6 Mozambique Central Southern ...... G...C...... leo145 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo135 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo154 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo131 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo127 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo130 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo134 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo110 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo126 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo160 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo155 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo143 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo133 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo159 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo152 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo161 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo137 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo149 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo136 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo158 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo150 South Africa (Mkuze) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo138 South Africa (Phinda) Southern ...... C..C...... AAT.ATT.T...... C.....T....G.A.C.CT..... leo65 South Africa (Eastern Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo53 South Africa (Western Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo21 South Africa (Eastern Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo22 South Africa (Eastern Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo20 South Africa (Eastern Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo153 South Africa (Mkuze) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo122 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo121 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo123 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo147 South Africa (Mkuze) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo144 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo23 South Africa (Eastern Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo45 South Africa (Western Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo66 South Africa (Eastern Cape) Southern ...... C...... AAT.AT...... C.....T....G...C.CT..... leo132 South Africa (Phinda) Southern ...... C...... AAY.ATY.Y..Y....Y.....YR...G.A.C.CT..... leo128 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo125 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo44 South Africa (Mkuze) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo146 South Africa (Mkuze) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo140 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo148 South Africa (Mkuze) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo142 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo157 South Africa (Mkuze) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo151 South Africa (Mkuze) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo129 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo141 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo139 South Africa (Phinda) Southern ...... C...... AA..AT.....C...... G...G.A.C.CT..... leo49 South Africa (Western Cape) Southern ...... C....Y..Y...AAY.AT...... T....G.A.C.CN..... leo73 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo70 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo168 South Africa (Eastern Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo74 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo28 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo18 South Africa (Eastern Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo72 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo62 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo47 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo64 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo165 South Africa (Eastern Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo25 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo27 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo50 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo61 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo31 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo167 South Africa (Eastern Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo33 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo26 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo58 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C......

leo71 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... A PART DNA MITOCHONDRIAL leo68 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo69 South Africa (Western Cape) Southern ...... C....T..T...AA..AT...... T....G.A.C.C...... leo156 South Africa (Mkuze) Southern ...... Y...... R.AA..AT...Y..R...... T....G.A.C.CT..... leo42 South Africa (Kruger) Southern ...... A.AA..AT...C...... T....G.A.C.CT..... leo36 South Africa (Kruger) Southern ...... A.AA..AT...C..A...... T....G.A.C.CT..... leo124 South Africa (Phinda) Southern ...... A.AA..AT...C..A...... T....G.A.C.CT..... leo55 South Africa (Kruger) Southern ...... A.AA..AT...C..A...... T....G.A.C.CT..... leo103 South Africa (Kruger) Southern ...... A.AA..AT...C..A...... T....G.A.C.CT..... leo56 South Africa (Kruger) Southern ...... A.AA..AT...C..A...... T....G.A.C.CT..... 186944 Mozambique Southern ...... R....Y...... AA..AT....T...... T....G.A.C.CT..... leo41 South Africa (Kruger) Southern ...... A....C...... AA..AT....T...... T....G.A.C.CTC.... leo54 South Africa (Kruger) Southern ...... A....C...... AA..AT....T...... T....G.A.C.CTC.... leo34 South Africa (Kruger) Southern ...... A....C...... AA..AT....T...... T....G.A.C.CTC.... leo39 South Africa (Kruger) Southern ...... A....C...... AA..AT....T...... T....G.A.C.CTC.... leo95 Mozambique Southern ...... C...... AA..AT.C...C...... G...G.A.C.CT..... leo57 South Africa (Western Cape) Southern ...... G..C....T..T...AA..AT...... T....G.A.C.C...... 11 12 C. ANCO ET AL.

Figure 4. Heatmap matrix of pairwise FST values between African, Arabian (P. p. nimr), and Persian leopards (P. p. saxicolor). WA: West Africa, CWCA: Coastal West- Central Africa, CEA: Central-East Africa, CSA: Central-Southern Africa, SA: Southern Africa. Dotted line separates populations of African leopards from Asiatic subspecies (P. p. nimr and P. p. saxicolor) along the y-axis.

Figure 5. Average number of pairwise differences between African leopard populations. WA: West Africa. CWCA: Coastal West-Central Africa; CEA: Central-East Africa; CSA: Central-Southern Africa; SA: Southern Africa. Values above the diagonal represent the average number of pairwise differences between populations (pXY). Diagonal values represent the average number of pairwise differences within populations (pX). Values below the diagonal represent the corrected average number of pairwise differences between populations (pXY – (pX þ pY)/2). Please refer to the online version of this article for interpretation. MITOCHONDRIAL DNA PART A 13

South Africa) represented in this analysis (Kenya excluded from Pleistocene-era subfossils (Hofreiter et al. 2001; Paabo from count because of ambiguous sample origin, see Table et al. 2004; Mitchell et al. 2005; Binladen et al. 2006). The S1). This study includes samples from 11 additional countries accumulation of mutations due to oxidative and hydrolytic unrepresented in previous research (Table 2). Novel samples deamination occurs more slowly in museum specimens col- account for 67% of all the observed haplotypes (n ¼ 20), lected in the past couple hundred years than in archaeologi- while uniquely sampled countries represent 63% of all the cal specimens (P€a€abo 1989; Burrell et al. 2015), the latter of observed haplotypes (n ¼ 19) (Figure 2). Haplotypes recovered which are described in the aforementioned studies. The old- only from the museum specimens accounted for 43.33% of est samples used in this analysis are <115 years old thus, all the haplotypes (n ¼ 13) highlighting extensive genetic DNA miscoding lesions associated with senescence are diversity in historical leopard populations unrepresented unlikely. However, DNA fragmentation commonly associated in contemporary populations sampled for this analysis with museum specimens (Paabo et al. 2004; Binladen et al. (Figure 2). 2006; Burrell et al. 2015) was observed in our museum Precautions were taken in sample preparation, extraction, samples. and handling to minimize the risk of contamination from exogenous DNA (P€a€abo 1989). However, degradation and Population structure and phylogeographic patterns fragmentation due to age, preservation method, storage conditions, and sample composition are known to impact the Leopards exhibited population structuring at large geo- quality and amplification of DNA (Mitchell et al. 2005; Burrell graphic scales (West, Central-East/Central-Southern, and et al. 2015). DNA repair mechanisms routinely identify and Southern Africa), suggesting strong evidence against pan- remove misincorporated lesions (Zimmermann et al. 2008), mixia in this species. AMOVA and pairwise FST analyses sup- but repair ceases after organismal death resulting in struc- port differentiation in the ND-5 locus spanning five major tural destabilization and the accumulation of damage (P€a€abo haplogroups: West Africa, Coastal West-Central Africa, Central- 1989; Mitchell et al. 2005). Soft tissue is prone to oxidative East-Africa, Central-Southern Africa, and Southern Africa. damage and degradation (P€a€abo 1989) whereas hard tissue Distinction between CEA and CSA as two independent

(e.g. bone), which we primarily recovered during destructive regional populations is supported by pairwise FST analyses sampling of museum specimens, limits the risk of exogenous (Figure 4). Although still high, FST[CEA-CSA] ¼ 0.40, was the DNA contamination and preserves the integrity of intact lowest among all African leopard population comparisons. endogenous DNA (Burrell et al. 2015). Still, DNA damage, CSA showed higher levels of differentiation from WA and

especially hydrolytic deamination of cytosine, could have CWCA leopard populations, than the latter two did to CEA, resulted in C!T and G!A transitions, which are predomi- indicating that CSA leopards are reproducing in isolation nant substitutions associated with senescence (Hofreiter et al. from neighbouring populations (Figure 4). Furthermore, CSA 2001; Mitchell et al. 2005; Burrell et al. 2015). exhibited the highest levels of differentiation when compared

We evaluated the incidence of singleton substitutions in with the two selected Asiatic subspecies: FST[CSA-nimr] ¼ 0.98 museum and faecal samples across populations to assess if and FST[CSA-saxicolor] ¼ 0.97 (Figure 4). DNA damage due to cytosine deamination was present in The haplotype network (Figure 2) and subsequent analyses our samples (Table S4) and found C!T transitions at five revealed deep divergence between WA and CWCA popula- positions: one position in CEA and four positions in CWCA. tions and between all other defined population groups. Both Removal of C!T singletons in CEA did not affect network groups yielded near absolute differentiation from CSA (0.97 topology or the number of haplotypes; however, removal of and 0.96, respectively) and very high differentiation from C!T singletons in CWCA caused H6 and H9 to merge with CEA, the ancestral population (0.86 and 0.85, respectively) H5. This decreased the number of haplotypes in CWCA from (Figure 4). Differentiation of West African leopards from five to three, but network topology was unaffected with Central and East African leopards is expected, as similar pat- respect to neighbouring population groups. G!A transitions terns exhibiting decreased gene flow across this region of occurred at three positions: two positions in CEA and one in Africa are well documented in other taxa (Arctander et al. WA. Removal of G!A singletons in CEA did not affect net- 1999; Alpers et al. 2004; Won & Hey 2005; Kadu et al. 2011; work topology or the number of haplotypes; however, Dobigny et al. 2013; Dowell et al. 2016). Contemporary sam- removal of G!A singletons in WA resulted in merging H1 ples from Nigeria and the Republic of Congo (2009 and 2013, and H2. This decreased the number of haplotypes in WA respectively) retain the ancestral haplotype observed from from four to three, but network topology was otherwise historic samples collected from Central and East Africa unaffected. between 1905 and 1962, whereas the contemporary samples Cytosine deamination is a common issue reported in the of leopards collected from Senegal in 2011 show significant recovery of sequence data from ancient DNA (aDNA) genetic differentiation (FST[WA-CEA] ¼ 0.86) (Figure 4). (Binladen et al. 2006). Here, we have used the terms archival The CWCA population exhibited strong evidence for and historical interchangeably to refer to DNA recovered genetic differentiation from CEA (FST [CWCA-CEA] ¼ 0.85) from museum specimens. In other studies, ‘historical’ DNA despite the two populations residing in close geographic refers to aDNA. While there is no precisely defined chronolog- proximity (Figures 2 and 3). CWCA consists of three contem- ical marker delimiting aDNA, aDNA generally refers to DNA porary samples from Gabon collected in 2011 and two histor- recovered from specimens dating hundreds to thousands of ical samples from Cameroon collected in 1934–1936. This years before present and has more recently included DNA indicates that highly divergent populations of leopards in 14 C. ANCO ET AL.

Cameroon (and possibly surrounding countries of Gabon and had additional impacts on resources (e.g. prey distributions Equatorial Guinea) were present prior to earliest sampling and availability) and thereby may explain observed patterns efforts retrieved for this analysis and further suggests that of diversity in leopard haplotypes recovered from the DRC. this region may have acted as a refugial habitat for leopards. Distribution of CEA haplotypes were primarily restricted to It is difficult to assess the historical and current geographic equatorial Africa with the exceptions South Africa and expanse of the highly divergent locus observed in the CWCA Zambia (Figures 2 and 3). South of equatorial Africa, the population. We lack historical specimens from the surround- emergence of another dominant haplotype (H20) of the CSA ing countries of Nigeria, the Central African Republic, population group was observed in both historical and con- Equatorial Guinea, Gabon, and the Republic of Congo. temporary samples. With the exception of H27 (museum Additionally, historical mtDNA diversity of leopard popula- specimen), all Mozambique samples were obtained from tions from West Africa is not represented in this dataset. leopards from the Niassa province between 1998 and 2008 Increased sampling efforts throughout the CWCA region and (Ropiquet et al. 2015). Two samples from Mozambique, H26 in West Africa may reveal similar patterns in clinal variation (leo95) and H27 (M-186944), clustered with SA. Inclusion of (as observed in CEA and CSA), particularly along the West H26 (leo95) with haplotypes from South Africa is consistent African rainforest belt. with Ropiquet et al. (2015). Locality data beyond country of Haplotypes from Cameroon, DRC, Mozambique, and South origin was not recorded for H27. South Africa represented Africa were observed in more than one population group. This the most frequently sampled country in this analysis (n ¼ 95). is not entirely unexpected, as these were also the four most Clustering of the two samples from South Africa (leo101 and frequently sampled countries. Samples from Cameroon are leo104) with haplotypes from Mozambique is also consistent exclusively represented by museum specimens and constitute with Ropiquet et al. (2015). Our analysis also clustered a five haplotypes. No locality data for the Cameroon samples museum specimen (M-81845) and seven contemporary leop- were available in the museum records, which makes identifica- ard samples from South Africa with CEA haplotypes. Inclusion tion of a potential environmental barrier to gene flow delimit- of South Africa samples with haplotypes of equatorial Africa ing CWCA from WA and CEA more difficult to assess. However, is curious. In some instances, clustering or admixture of indi- insights from phylogeographic analyses of primates indicate a viduals from varying geographic origins can be explained by likely genetic barrier of interest. Preliminary analyses using translocation (Bertola et al. 2015), though this is not likely to mtDNA and microsatellite data identified two deeply divergent be the explanation in all observed cases. Another possible lineages of chimpanzees in western Africa and in central and explanation could be that H10, the ancestral haplotype is

eastern Africa formed a suture zone located in central more widely distributed than currently represented in the Cameroon (Gonder & Disotell 2006; Gonder et al. 2006). network. With the exception of Mozambique and South Specifically, the Sanaga River or another historically proximal Africa, all other leopard range countries characterizing CSA environmental discontinuity is hypothesized to be responsible are only represented by museum specimens. The ancestral for limiting distribution and restricting gene flow of several haplotype co-occurs in the DRC and may also occur in species (Gonder & Disotell 2006; Anthony et al. 2007; Nicolas Angola, Botswana, and Namibia in which case, the clustering et al. 2011). These findings were supported by Bowden et al. of samples from South Africa with the predominant and most (2012) using high-throughput sequencing techniques to widespread haplotype in spanning the majority of Central unambiguously confirm the division of Cameroonian chimpan- and East Africa is not unexpected. The Arabian leopard zees into two genetically distinct populations separated most (P. p. nimr) in the Middle East, is geographically, the closest probably by the Sanaga River. recognized genetically independent lineage to the African We recovered mtDNA from nine museum samples repre- leopard, and is proximal to Persian leopard (P. p. saxicolor)in senting six haplotypes in the DRC ranging from 1905 to 1962 Southwest Asia. When sequences from these two subspecies (7.7 leopard generations) primarily collected from the north- of Asiatic leopards were compared to African sequences it western and northeastern parts of the country. Five samples became evident that populations of leopards within Africa recovered from eastern DRC exhibited variation from the exhibit genetic differentiation at levels comparable to, and in ancestral haplotype. These samples were recovered from the some cases exceeding levels observed between Asiatic and eastern edge of the Congo rainforest, and likely from a region African leopards at this locus (Figure 4). FST[saxicolor- characterized by high environmental heterogeneity, including nimr] ¼ 0.91, whereas, FST[WA-CSA] ¼ 0.97 and FST[CWCA- the formation and persistence of major waterways in recent CSA] ¼ 0.96. Additionally, FST[WA-CWCA], FST[WA-CEA], and geologic history. While portions of densely vegetated regions FST[CWCA-CEA] were very similar when compared to P. p. of central Africa are suspected to have maintained forest nimr, and P. p. saxicolor. The results of the AMOVA and subse- cover towards the end of the Pleistocene, these areas may quent pairwise FST analyses with Arabian and Persian leopards not have been as stable as previously hypothesized and were strongly suggest evidence for genetically differentiated popu- surrounded by transitional and heterogeneous landscapes lations and population structuring in the African leopard. across elevations (Nicolas et al. 2011). Mercader et al. (2000) Our use of natural history collections and contemporary use data from phytolith analyses to suggest core areas were samples demonstrates that leopards are more genetically less characteristic of singular forested blocks and more closely diverse across Africa than previously indicated. Here we have resembled a variety of vegetation compositions including for- presented the results from mixed populations (historical and ests (e.g. Ituri forest), forest-grassland mosaics, and ‘parkland contemporary) for descriptive purposes. Pairwise analyses con- environments’. As such, shifts in habitat stability may have ducted temporally between samples from the same MITOCHONDRIAL DNA PART A 15 population found three of the population groups (CWCA, CSA, While the recovery of fossils from lion and leopard predeces- and SA) did not significantly differ between time periods sors in East Africa indicate overlap between these earlier spe- (Table S7). However, it is difficult to draw meaningful conclu- cies (Werdelin et al. 2014), lions predominately inhabit sions from the temporal analyses due to small sample sizes savanna ecosystems whereas leopards are more habitat gen- associated with historical (n ¼ 2) and contemporary samples eralists. Leopards may have initially evolved alongside lions, (n ¼ 3) of the CWCA population, historical samples of the CSA but their adaptability likely enabled the leopard to persist on population (n ¼ 4), and historical samples of the SA population forest-adapted species during moist pluvials, while the distri- (n ¼ 1). There were no historical samples included in the WA bution of lions would have been more dependent on those population. By combining historical and contemporary sam- of savanna-adapted herbivores, which shifted to accommo- ples within the same population, we held temporal changes date changes in vegetation availability (Lorenzen et al. 2012). constant in our FST analyses, highlighting the influence of In the context of leopard phylogeography and in assigning a geography on population dynamics. Temporal partitioning possible geographic origin to leopard diversity a dominant revealed a significant difference in the CEA population, but haplotype in CEA, H10, contains the greatest number of net- additional contemporary samples from CEA countries might work connections, has the largest confirmed geographic dis- more closely resemble the pattern and diversity of haplotypes tribution of all haplotypes, and connects all other clustered found in historic CEA samples. Additional analyses with populations (Figure 2). Collectively, these attributes suggest increased sample size and geographic breadth from both his- that H10, and consequently, the larger geographic region of torical and contemporary leopard populations to corroborate Central-East Africa is the likely origin of diversity in the ances- findings should be a point of focus in further studies. tral haplotype for the ND-5 locus in leopards. Studying a widespread species spanning numerous political borders can present challenges to sample coverage and Central-East Africa and origin of the ancestral haplotype retrieval. The remoteness and physical geography of some The distribution and evolutionary patterns of African carni- regions (e.g. Ahaggar Massif, Algeria) can make accessibility vores during the Pleistocene remains a subject of continued difficult (Busby et al. 2009). Secondly, expenses and bureau- debate due to the rarity of fossils and incomplete records cratic difficulties associated with organizing expeditions and (Turner 1990; Turner 1999; Werdelin & Lewis 2005; Werdelin collection can impede timely recovery of samples (Burrell et al. 2010). Fossils of two pantherines representing primitive et al. 2015). Political instability can prohibit sampling in lion and leopard lineages were recovered from Laetoli regions of species’ extant range, due to restricted access and

(Tanzania) dating 3.8–3.4 Ma (Werdelin & Lewis 2005; Werdelin safety concerns (Dudley et al. 2002). In addition to risks posed et al. 2010). The first confirmed fossils of P. pardus in Africa to researchers, prolonged political turmoil intensifies the were recovered from the Olduvai, Bed I site in Tanzania and extraction of natural resources (e.g. Sudan) leading to habitat date back 2 Ma to the Pleistocene (Werdelin & Lewis 2005; loss and decimated wildlife populations (UNEP 2007). Lastly, Werdelin et al. 2010). Using 3.5 Ma and 2 Ma as fossil dates for rapid urbanization and growth of developing countries in calibration, Uphyrkina et al. (2001) estimated an African origin Africa has led to a 48–67% contraction in leopard range, for the modern leopard between 470 and 825 Ka, but did not localized extinction events (Mauritania, Togo, and Zanzibar), speculate a geographic region of origination. and questionable status in four countries (Burundi, Gambia, Present-day habitat conditions in Central and East Africa Lesotho, and Mali) (Jacobson et al. 2016). Archival specimens are dictated primarily by rainfall. South of the Sahara desert like those in the collections of the American Museum of to the west and extending to Uganda moist, lush rainforests Natural History, thus become highly valuable and potentially, are surrounded by savannas, wetlands, and deciduous wood- the only sources to study population demographics of a spe- lands, while grasslands, savanna, and mixed open canopy cies from observed and possible extinction events. woodlands are more characteristic of East Africa (Olson et al. Genetic diversity is recognized as a vital component to 2001; Steele 2007; Lorenzen et al. 2012; Riggio et al. 2013). ensuring the long-term preservation and biodiversity of wild- Vegetation zones have undergone major shifts in climate and life populations (Diversity 2010). Combining both temporal ecosystem structure over the past several epochs with some and spatial components to genetic analyses is necessary to regions offering refugium for biota during the Plio- aid conservation efforts. In doing so, wildlife managers can Pleistocene (Steele 2007; Futuyma 2013; Demos et al. 2014). make informed management decisions based on patterns of Moist pluvials of the Pleistocene expanded forested habitats how gene flow and genetic diversity have changed over time along the equatorial belt fragmenting savanna-adapted spe- and space (Mondol et al. 2013; Sharma et al. 2013). Archival cies, while dry interpluvials reconnected these semi-arid land- collections when used in conjunction with samples of extant scapes (Dupont 2011; Lorenzen et al. 2012). leopard populations help us to fill in genetic gaps caused by Central and East Africa are considered areas of high anthropogenic disturbance of habitats and populations, illu- endemism and speciation due to the repeated expansion and minate patterns of variation, and better understand the role contraction of forest and savanna habitats and active history historical processes have in shaping biodiversity. of geologic activity (Anthony et al. 2007; Diamond & Hamilton 2009; Tolley et al. 2011; Lorenzen et al. 2012). The Conclusion combined phylogeographic signatures from these taxa, including lions (Bertola et al. 2015; Bertola et al. 2016) high- Archival specimens, like those in the collections of the light Central and East Africa as regions of high diversity. American Museum of Natural History (AMNH) have frequently 16 C. ANCO ET AL. been used to infer relationships among historical populations of a haplotype network using novel samples of African leop- (P€a€abo 1989; Hekkala et al. 2011; Caragiulo et al. 2014; ards has reopened a >15-year-old conversation regarding Dowell et al. 2016). Leopard collections from AMNH provided African leopard diversity and taxonomy. We acknowledge that broad spatial coverage of Central, East, and Southern Africa, our results are limited by the use of mtDNA, and consequently and we supplemented coverage in West and Central Africa single locus data. We therefore, strongly recommend multi- with faecal samples collected during field surveys and locus sampling to investigate whether African leopards exhibit Southern Africa with sequences ported from NCBI GenBank. evidence of discordance between mitochondrial and nuclear This work represents the most comprehensive mtDNA dataset markers (Toews & Brelsford 2012). These findings will provide of leopards comprising data from 182 wild individuals repre- the foundation for our ongoing analysis of temporal changes senting sub-Saharan Africa. We reveal extensive, cryptic diver- in phylogeographic patterns using sequence capture from his- sity in the ND-5 locus among historical populations and torical collections, which will contribute to management and retention of independent genetic lineages in extant popula- planning strategies to conserve remaining genetic diversity in tions. Distinct African leopard haplotypes are geographically the African leopard. clustered indicating African leopards represent several genetically differentiated populations. Our findings generally agree with Miththapala et al. (1996) and Uphyrkina et al. (2001) that Acknowledgements leopards harbour high levels of genetic diversity, but illustrate additional evidence of regional structure within Africa. The authors thank Panthera, the Global Felid Genetics Program, and Torsten Bohm for sample contributions from Gabon, Nigeria, Senegal, The African leopard harbours a greater degree of genetic and Republic of Congo. All samples were collected with the authorization diversity than previously indicated and is partitioned in a pat- and assistance of the respective statutory wildlife authorities in those tern providing strong support for significant genetic subdivi- countries, for which we are extremely grateful. Special thanks to Eileen sion. Our pairwise FST analyses using mtDNA revealed leopard Westwig, the Department of Mammalogy, and the American Museum of populations throughout sub-Saharan Africa retain highly Natural History. We are extremely grateful for the assistance of the divergent copies of the ND-5 locus on levels approaching, Sackler Institute for Comparative Genomics including Angelica Menchaca Rodriguez, Ashley Yang, Melina Giakoumis, Stephen Gaughran, Rebecca and in some instances exceeding, F values observed ST Hersch, Mohammad Faiz, Dr. Anthony Caragiulo, Dr. Claudia Wultsch, and between Asiatic populations (Arabian and Persian leopards) Dr. Mark Siddall. presently recognized by the IUCN as separate subspecies (Figure 4). AMOVA revealed population structuring indicating

a lack of gene flow between larger geographic regions (West Africa, Central-East/Central-Southern Africa, and Southern Disclosure statement Africa) and among all the populations within regions. Two The authors report no declarations of interest. populations, CEA and CSA showed decreased pairwise differ- Support for this work was provided by Fordham University, the ences relative to other populations, which could be an arti- American Museum of Natural History, and the Wildlife Conservation fact of decreased sampling. Lastly, the star-like phylogeny, Society. Sequence data generated in support for this publication have been widespread distribution, and connectedness of the H10 hap- deposited to GenBank with accessions KY292222-77. lotype points to a likely origin of diversity for the ancestral haplotype of this locus in Central and East Africa. We caution this work may not fully express the degree of genetic diver- ORCID sity present in African leopards, especially given sampling Corey Anco http://orcid.org/0000-0001-8132-2009 deficiencies in North Africa, parts of West Africa, and in Sergios-Orestis Kolokotronis http://orcid.org/0000-0003-3309-8465 Northeastern Africa. This study has raised important questions regarding the taxonomic status of leopards in Africa. First, these findings support a distinction between African populations and References Arabian and Persian leopard populations. We found additional Alpers DL, Van Vuuren BJ, Arctander P, Robinson TJ. 2004. Population strong support for an East-West split in African leopards, which genetics of the roan antelope (Hippotragus equinus) with suggestions may correspond to previously hypothesized taxonomic group- for conservation. Mol Ecol. 13:1771–1784. ings (Figure 1, Table 1) and is congruent with numerous recent Anthony NM, Johnson-Bawe M, Jeffery K, Clifford SL, Abernethy KA, Tutin phylogeographic analyses of widespread African taxa CE, Lahm SA, White LJT, Utley JF, Wickings EJ, et al. 2007. The role of Pleistocene refugia and rivers in shaping gorilla genetic diversity in (Moodley & Bruford 2007; Lorenzen et al. 2012; Dobigny et al. central Africa. Proc Natl Acad Sci USA. 104:20432–20436. 2013; Smitz et al. 2013; Bertola et al. 2016; Fennessy et al. Antunes A, Troyer JL, Roelke ME, Pecon-Slattery J, Packer C, Winterbach 2016). More sampling is needed to accurately delineate geo- C, Winterbach H, Hemson G, Frank L, Stander P, et al. 2008. The evolu- graphic features acting as potential barriers to gene flow (e.g. tionary dynamics of the lion Panthera leo revealed by host and viral Sanaga River in Central Cameroon), while a suture zone has population genomics. PLoS Genet. 4:3–4. been identified between CWCA and CEA populations (Figures Arctander P, Johansen C, Coutellec-Vreto MA. 1999. Phylogeography of three closely related African bovids (tribe Alcelaphini). Mol Biol Evol. 2 and 3). In addition, we have identified previously unrecog- 16:1724–1739. nized levels of genetic diversity in historical collections of Aryal A, Kreigenhofer B. 2009. Summer diet composition of the Common African leopards not represented in contemporary leopard Leopard Panthera pardus (Carnivora: Felidae) in Nepal. J Threat Taxa. populations. While only based on mtDNA, the reconstruction 1:562–566. MITOCHONDRIAL DNA PART A 17

Athreya V, Odden M, Linnell JDC, Krishnaswamy J, Karanth U. 2013. Big Diversity C. 2010. The Strategic Plan for Biodiversity 2011-2020 and the cats in our backyards: persistence of large carnivores in a human Aichi Biodiversity Targets. Nagoya, Aichi Prefecture, Japan. dominated landscape in India. PLoS One. 8:2–9. Dobigny G, Tatard C, Gauthier P, Ba K, Duplantier JM, Granjon L, Kergoat Avise JC. 2000. Phylogeography: the history and formation of species. GJ. 2013. Mitochondrial and nuclear genes-based phylogeography of Cambridge, MA: Harvard University Press. Arvicanthis niloticus (Murinae) and sub-saharan open habitats pleisto- Bah T. 2007. Inkscape: guide to a vector drawing program. Upper Saddle cene history. PLoS One. 8:e77815. River, NJ, USA: Prentice Hall Press. Dowell SA, Hekkala ER. 2016. Divergent lineages and conserved niches: Bailey T. 1993. The African leopard: ecology and behavior of a solitary using ecological niche modeling to examine the evolutionary patterns felid. New York: Columbia University Press. of the Nile monitor (Varanus niloticus). Evol Ecol. 53:1–15. Bandelt HJ, Forster P, Rohl€ A. 1999. Median-joining networks for inferring Dowell SA, Portik DM, de Buffrenil V, Ineich I, Greenbaum E, Kolokotronis intraspecific phylogenies. Mol Biol Evol. 16:37–48. S-O, Hekkala ER. 2016. Molecular data from contemporary and histori- Barnett R, Yamaguchi N, Barnes I, Cooper A. 2006. The origin, current cal collections reveal a complex story of cryptic diversification in the diversity and future conservation of the modern lion (Panthera leo). Varanus (Polydaedalus) niloticus Species Group. Mol Phylogenet Evol. Proc Biol Sci. 273:2119–2125. 94:591–604. Barnett R, Yamaguchi N, Shapiro B, Ho SYW, Barnes I, Sabin R, Werdelin Dubach JM, Briggs MB, White PA, Ament BA, Patterson BD. 2013. Genetic L, Cuisin J, Larson G. 2014. Revealing the maternal demographic his- perspectives on “Lion Conservation Units” in Eastern and Southern tory of Panthera leo using ancient DNA and a spatially explicit genea- Africa. Conserv Genet. 14:741–755. logical analysis. BMC Evol Biol. 14:70. Dudley JP, Ginsberg JR, Plumptre AJ, Hart JA, Campos LC. 2002. Effects of Bertola LD, van Hooft WF, Vrieling K, Uit de Weerd DR, York DS, Bauer H, War and Civil Strife on Wildlife and Wildlife Habitats. Conserv Biol. Prins HHT, Funston PJ, Udo de Haes HA, Leirs H, et al. 2011. Genetic 16:319–329. diversity, evolutionary history and implications for conservation of the Dupont L. 2011. Orbital scale vegetation change in Africa. Quat Sci Rev. lion (Panthera leo) in West and Central Africa. J Biogeogr. 38:1356–1367. 30:3589–3602. Bertola LD, Jongbloed H, van der Gaag KJ, de Knijff P, Yamaguchi N, Dutta T, Sharma S, Maldonado JE, Wood TC, Panwar HS, Seidensticker J. Hooghiemstra H, Bauer H, Henschel P, White PA, Driscoll CA, et al. 2013. Fine-scale population genetic structure in a wide-ranging carni- 2016. Phylogeographic patterns in Africa and high resolution delinea- vore, the leopard (Panthera pardus fusca) in central India. Austin J, edi- tion of genetic clades in the lion (Panthera leo). Sci Rep. 6:30807. tor. Divers Distrib. 19:760–771. Bertola LD, Tensen L, Van Hooft P, White PA, Driscoll CA, Henschel P, Eizirik E, Kim JH, Menotti-Raymond M, Crawshaw PG, O’Brien SJ, Johnson Caragiulo A, Dias-Freedman I, Sogbohossou EA, Tumenta PN, et al. WE. 2001. Phylogeography, population history and conservation 2015. Autosomal and mtDNA markers affirm the distinctiveness of genetics of jaguars (Panthera onca, Mammalia, Felidae). Mol Ecol. lions in West and Central Africa. PLoS One. 10:1–15. 10:65–79. Binladen J, Wiuf C, Gilbert MTP, Bunce M, Barnett R, Larson G, Excoffier L, Lischer HEL. 2010. Arlequin suite ver 3.5: A new series of pro- Greenwood AD, Haile J, Ho SYW, Hansen AJ, et al. 2006. Assessing the grams to perform population genetics analyses under Linux and fidelity of ancient DNA sequences amplified from nuclear genes. Windows. Mol Ecol Resour. 10:564–567. Genetics. 172:733–741. Excoffier L, Smouse PE, Quattro JM. 1992. Analysis of molecular variance Bjorklund€ M. 2003. The risk of inbreeding due to habitat loss in the lion inferred from metric distances among DNA haplotypes: application to (Panthera leo). Conserv Genet. 4:515–523. human mitochondrial DNA restriction data. Genetics. 131:479–491. Bowden R, MacFie TS, Myers S, Hellenthal G, Nerrienet E, Bontrop RE, Farhadinia MS, Farahmand H, Gavashelishvili A, Kaboli M, Karami M, Freeman C, Donnelly P, Mundy NI. 2012. Genomic tools for evolution Khalili B, Montazamy S. 2015. Molecular and craniological analysis of and conservation in the chimpanzee: Pan troglodytes ellioti is a genet- leopard, Panthera pardus (Carnivora: Felidae) in Iran: support for a ically distinct population. PLoS Genet. 8:1–10. monophyletic clade in Western Asia. Biol J Linn Soc. 114:721–736. Burrell AS, Disotell TR, Bergey CM. 2015. The use of museum specimens Fennessy J, Bidon T, Reuss F, Vamberger M, Fritz U, Janke with high-throughput DNA sequencers. J Hum Evol. 79:35–44. Correspondence A, Kumar V, Elkan P, Nilsson MA, Janke A. 2016. Busby GBJ, Gottelli D, Wacher T, Marker L, Belbachir F, De Smet K, Multi-locus Analyses Reveal Four Giraffe Species Instead of One. Curr Belbachir-Bazi A, Fellous A, Belghoul M, Durant SM. 2009. Genetic Biol. 26:1–7. analysis of scat reveals leopard Panthera pardus and cheetah Acinonyx Futuyma DJ. 2013. Evolution. 3rd ed. Sunderland (MA): Sinauer jubatus in southern Algeria. Oryx. 43:412. Associates, Inc. Caragiulo A, Dias-Freedman I, Clark JA, Rabinowitz S, Amato G. 2014. Gonder KM, Disotell TR. 2006. Contrasting Phylogeographic Histories of Mitochondrial DNA sequence variation and phylogeography of Chimpanzees in Nigeria and Cameroon: A Multi-Locus Genetic Neotropic pumas (Puma concolor). J DNA Mapping, Seq Anal. Analysis. In: Primate Biogeogr. [place unknown]: Springer US; p. 25:304–312. 135–168. Caro TM, Laurenson MK. 1994. Ecological and genetic factors in conserva- Gonder MK, Disotell TR, Oates JF. 2006. New genetic evidence on the tion: a cautionary tale. Science (80-). 263:485–486. evolution of chimpanzee populations and implications for taxonomy. Castro-Prieto A, Wachter B, Sommer S. 2011. Cheetah paradigm revisited: Int J Primatol. 27:1103–1127. MHC diversity in the world's largest free-ranging population. Mol Biol Haag T, Santos AS, Sana DA, Morato RG, Cullen L, Crawshaw PG, De Evol. 28:1455–1468. Angelo C, Di Bitetti MS, Salzano FM, Eizirik E. 2010. The effect of habi- Charruau P, Fernandes C, Orozco-Terwengel P, Peters J, Hunter L, Ziaie H, tat fragmentation on the genetic structure of a top predator: Loss of Jourabchian A, Jowkar H, Schaller G, Ostrowski S, et al. 2011. diversity and high differentiation among remnant populations of Phylogeography, genetic structure and population divergence time of Atlantic Forest jaguars (Panthera onca). Mol Ecol. 19:4906–4921. cheetahs in Africa and Asia: evidence for long-term geographic iso- Hayward MW, Henschel P, O’Brien J, Hofmeyr M, Balme G, Kerley GIH. lates. Mol Ecol. 20:706–724. 2006. Prey preferences of the leopard (Panthera pardus). J Zool. Cunningham SW, Shirley MH, Hekkala ER. 2016. Fine scale patterns of 270:298–313. genetic partitioning in the rediscovered African crocodile, Crocodylus Hekkala E, Shirley MH, Amato G, Austin JD, Charter S, Thorbjarnarson J, suchus (Saint-Hilaire 1807). PeerJ. 4:e1901. Vliet KA, Houck ML, Desalle R, Blum MJ. 2011. An ancient icon reveals Demos TC, Kerbis Peterhans JC, Agwanda B, Hickerson MJ. 2014. new mysteries: mummy DNA resurrects a cryptic species within the Uncovering cryptic diversity and refugial persistence among small Nile crocodile. Mol Ecol. 20:4199–4215. mammal lineages across the Eastern Afromontane biodiversity hot- Henschel P, Hunter LTB, Coad L, Abernethy KA, Muhlenberg€ M. 2011. spot. Mol Phylogenet Evol. 71:41–54. Leopard prey choice in the Congo Basin rainforest suggests exploita- Diamond AW, Hamilton AC. 2009. The distribution of forest passerine tive competition with human bushmeat hunters. J Zool. 285:11–20. birds and Quaternary climatic change in tropical Africa. J Zool. Hofreiter M, Jaenicke V, Serre D, von Haeseler A, P€a€abo S. 2001. DNA 191:379–402. sequences from multiple amplifications reveal artifacts induced by 18 C. ANCO ET AL.

cytosine deamination in ancient DNA. Nucleic Acids Res. Nicolas V, Missoup AD, Denys C, Kerbis Peterhans J, Katuala P, Couloux A, 29:4793–4799. Colyn M. 2011. The roles of rivers and Pleistocene refugia in shaping Hunter L, Henschel P, Ray JC. 2013. Panthera pardus. In: Kingdon JS, genetic diversity in Praomys misonnei in tropical Africa. J Biogeogr. Hoffmann M, editors. The Mamm Africa. Amsterdam, the Netherlands: 38:191–207. Academic Press. Nowell K, Jackson P. 1996. Wild cats. Status Survey and Conservation Ishida Y, Oleksyk TK, Georgiadis NJ, David VA, Zhao K, Stephens RM, Action Plan. Gland, Switzerland: IUCN. Kolokotronis S-O, Roca AL. 2011. Reconciling apparent conflicts O’Brien S, Roelke M, Marker L, Newman A, Winkler C, Meltzer D, Colly L, between mitochondrial and nuclear phylogenies in African elephants. Evermann J, Bush M, Wildt D. 1985. Genetic basis for species vulner- PLoS One 6:e20642. ability in the cheetah. Science (80-). 227:1428–1434. Jacobson AP, Gerngross P, Lemeris JRJ, Schoonover RF, Anco C, O’Brien SJ, Martenson JS, Packer C, Herbst L, Devos V, Joslin P, Ottjoslin J, Breitenmoser-Wursten C, Durant SM, Farhadinia MS, Henschel P, Wildt DE, Bush M. 1987. Biochemical genetic-variation in geographic Kamler JF, et al. 2016. Leopard (Panthera pardus) status, distribution, isolates of African and Asiatic Lions. Natl Geogr Res. 3:114–124. and the research efforts across its range. PeerJ. 36:1–28. O’Brien SJ, Wildt DE, Goldman D, Merril CR, Bush M. 1983. The cheetah is Johnson M, Zaretskaya I, Raytselis Y, Merezhuk Y, McGinnis S, Madden TL. depauperate in genetic variation. Science. 221:459–462. 2008. NCBI BLAST: a better web interface. Nucleic Acids Res. Odden M, Athreya V, Rattan S, Linnell J. 2014. Adaptable neighbours: 36:W5–W9. movement patterns of GPS-collared leopards in human dominated Kadu CAC, Schueler S, Konrad H, Muluvi GMM, Eyog-Matig O, Muchugi A, landscapes in India. PLoS One. 9:e112044. Williams VL, Ramamonjisoa L, Kapinga C, Foahom B, et al. 2011. Olson DM, Dinerstein E, Wikramanayake ED, Burgess ND, Powell GVN, Phylogeography of the Afromontane Prunus africana reveals a former Underwood EC, D’amico J. a, Itoua I, Strand HE, Morrison JC, et al. migration corridor between East and West African highlands. Mol Ecol. 2001. Terrestrial ecoregions of the world: a new map of life on earth. 20:165–178. Bioscience. 51:933. Kawanishi K, Sunquist ME, Eizirik E, Lynam AJ, Ngoprasert D, Wan P€a€abo S. 1989. Ancient DNA: extraction, characterization, molecular clon- Shahruddin WN, Rayan DM, Sharma DSK, Steinmetz R. 2010. Near fixa- ing, and enzymatic amplification. Proc Natl Acad Sci USA. tion of melanism in leopards of the Malay Peninsula. J Zool. 86:1939–1943. 282:201–206. Paabo S, Poinar H, Serre D, Svante P, Jaenicke-despr V, Hebler J, Rohland Kimura M. 1980. A simple method for estimating evolutionary rates of N, Kuch M, Krause J, Vigilant L, et al. 2004. Genetic analyses from base substitutions through comparative studies of nucleotide sequen- ancient DNA. Annu Rev Genet. 38:645–679. ces. J Mol Evol. 16:111–120. Packer C, Brink H, Kissui BM, Maliti H, Kushnir H, Caro T. 2011. Effects of Laguardia A, Kamler JF, Li S, Zhang C, Zhou Z, Shi K. 2017. The current trophy hunting on lion and leopard populations in Tanzania. Conserv distribution and status of leopards Panthera pardus in China. Oryx. Biol. 25:142–153. 51:153–159. Raza RH, Chauhan DS, Pasha MKS, Sinha S. 2012. Illuminating the blind Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, spot: A study on illegal trade in leopard parts in India (2001-2010). McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, et al. 2007. New Delhi, India:TRAFFIC India/WWF India. Clustal W and Clustal X version 2.0. Bioinformatics. 23:2947–2948. Riggio J, Jacobson A, Dollar L, Bauer H, Becker M, Dickman A, Leigh JW, Bryant D. 2015. Popart: full-feature software for haplotype net- Funston P, Groom R, Henschel P, de Iongh H, et al. 2013. The work construction. Methods Ecol Evol. 6:1110–1116. size of savannah Africa: A lion’s(Panthera leo) view. Biodivers Lorenzen ED, Heller R, Siegismund HR. 2012. Comparative phylogeogra- Conserv. 22:17–35. phy of African savannah ungulates. Mol Ecol 21:3656–3670. Ropiquet A, Knight AT, Born C, Martins Q, Balme G, Kirkendall L, Hunter L, Luo SJS, Kim JHJ, Johnson WWE, Walt J, Van Der Walt J, Martenson J, Senekal C, Matthee CA. 2015. Implications of spatial genetic patterns Yuhki N, Miquelle DG, Uphyrkina O, Goodrich JM, et al. 2004. for conserving African leopards. Comptes Rendus Biol. 338:728–737. Phylogeography and genetic ancestry of tigers (Panthera tigris). PLoS Rostro-Garcıa S, Kamler JF, Ash E, Clements GR, Gibson L, Lynam A, Biol. 2:e442. McEwing R, Naing H, Paglia S. 2016. Endangered leopards: range col- McRae BH, Beier P, Dewald LE, Huynh LY, Keim P. 2005. Habitat barriers lapse of the Indochinese leopard (Panthera pardus delacouri)in limit gene flow and illuminate historical events in a wide-ranging car- Southeast Asia. Biol Conserv. 201:293–300. nivore, the American puma. Mol Ecol. 14:1965–1977. Sharma S, Dutta T, Maldonado E, Wood C, Panwar HS, Seidensticker J, Measey GJ, Channing A. 2003. Phylogeography of the genus Xenopus in Maldonado JE, Wood TC. 2013. Forest corridors maintain historical southern Africa. Amphibia-Reptilia. 24:321–330. gene flow in a tiger metapopulation in the highlands of central India. Menegon M, Loader SP, Marsden SJ, Branch WR, Davenport TRB, Proc Biol Sci. 280:20131506. Ursenbacher S. 2014. The genus Atheris (Serpentes: Viperidae) in East Smitz N, Berthouly C, Cornelis D, Heller R, van Hooft P, Chardonnet P, Africa: phylogeny and the role of rifting and climate in shaping the Caron A, Prins H, van Vuuren BJ, de Iongh H, et al. 2013. Pan-African current pattern of species diversity. Mol Phylogenet Evol. 79:12–22. genetic structure in the African Buffalo (Syncerus caffer): investigating Menotti-Raymond M, O’Brien SJ. 1993. Dating the genetic bottleneck of intraspecific divergence. PLoS One. 8:e56235. the African cheetah. Proc Natl Acad Sci USA. 90:3172–3176. Spalton JA, Al Hikmani HM. 2006. The leopard in the Arabian Peninsula – Mercader J, Runge F, Vrydaghs L, Doutrelepont H, Ewango C, Juan- distribution and subspecies status. Cat News Special Issue 1 - Arabian Tresseras J. 2000. Phytoliths from Archaeological Sites in the Tropical Leopard: 4–8. Forest of Ituri, Democratic Republic of Congo. Quat Res. 54:102–112. Steele TE. 2007. Late Pleistocene of Africa. In: Elias SA, editor. Mitchell D, Willerslev E, Hansen A. 2005. Damage and repair of ancient Encyclopedia Quat Sci. Amsterdam: Elsevier; p. 3139–3150. DNA. Mutat Res Mol Mech Mutagen. 571:265–276. Stein AB, Athreya V, Gerngross P, Balme G, Henschel P, Karanth U, Miththapala S, Seidensticker J, O’Brien SJ. 1996. Phylogeographic subspe- Miquelle D, Rostro S, Kamler JF, Laguardia A. 2016. Panthera pardus. cies recognition in leopards (Panthera pardus): Molecular genetic varia- IUCN Red List Threat Species. tion. Conserv Biol. 10:1115–1132. Stein AB, Hayssen V. 2013. Panthera pardus (Carnivora: Felidae). Mamm Mondol S, Bruford MW, Ramakrishnan U. 2013. Demographic loss, genetic Species. 900:30–48. structure and the conservation implications for Indian tigers. Proc Biol Sunquist M, Sunquist F. 2002. Wild Cats of the World. Chicago (IL): Sci. 280:1–10. doi: 10.1098/rspb.2013.0496. University of Chicago Press. Mondol S, Navya R, Athreya V. 2009. A panel of microsatellites to individ- Swanepoel LH, Lindsey P, Somers MJ, van Hoven W, Dalerum F. 2013. ually identify leopards and its application to leopard monitoring in Extent and fragmentation of suitable leopard habitat in South Africa. human dominated landscapes. BMC Genet. 10:79. Anim Conserv. 16:41–50. Moodley Y, Bruford MW. 2007. Molecular biogeography: Towards an inte- Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. 2013. MEGA6: grated framework for conserving Pan-African biodiversity. PLoS One. Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2:e454. 30:2725–2729. MITOCHONDRIAL DNA PART A 19

Toews DPL, Brelsford A. 2012. The biogeography of mitochondrial and Wei L, Wu XB, Zhu LX, Jiang ZG. 2011. Mitogenomic analysis of the genus nuclear discordance in animals. Mol Ecol. 21:3907–3930. Panthera. Sci China Life Sci. 54:917–930. Tolley KA, Tilbury CR, Measey GJ, Menegon M, Branch WR, Matthee CA. Werdelin L, Lewis ME. 2005. Plio-Pleistocene Carnivora of eastern Africa: 2011. Ancient forest fragmentation or recent radiation? Testing refu- Species richness and turnover patterns. Zool J Linn Soc. 144:121–144. gial speciation models in chameleons within an African biodiversity Werdelin L, Lewis ME, Haile-Selassie Y. 2014. Mid-Pliocene Carnivora from hotspot. J Biogeogr. 38:1748–1760. the Woranso-Mille Area, Afar Region, Ethiopia. J Mamm Evol. Turner A. 1990. The evolution of the guild of larger terrestrial carnivores 21:331–347. during the Plio-Pleistocene in Africa. Geobios 23:349–368. Werdelin L, Yamaguchi N, Johnson E, Brien SJO. 2010. Phylogeny and Turner A. 1999. Evolution in African Plio-Pleistocene mammalian fauna: evolution of cats (Felidae). In: Biol Conserv Wild Felids. Vol. 12. Oxford: correlation and causation. In: African Biogeogr Clim Chang early Hum Oxford University Press; p. 59–82. Evol. Oxford: Oxford University Press; p. 76–87. Won YJ, Hey J. 2005. Divergence population genetics of chimpanzees. UNEP. 2007. Sudan Post-Conflict Environmental Assessment. Nairobi, Kenya. Mol Biol Evol. 22:297–307. Uphyrkina O, Johnson WE, Quigley H, Miquelle D, Marker L, Bush M, Zimmermann J, Hajibabaei M, Blackburn DC, Hanken J, Cantin E, Posfai J, O’Brien SJ. 2001. Phylogenetics, genome diversity and origin of mod- Evans TC. 2008. DNA damage in preserved specimens and tissue sam- ern leopard, Panthera pardus. Mol Ecol. 10:2617–2633. ples: a molecular assessment. Front Zool. 5:18.