DOCSLIB.ORG

POLYACRYLAMIDE GEL ENTRAPMENT of ADENYLATE KINASE and ACETATE KINASE Summary the Factors That Limit the Stability of Adenylate K

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
POLYACRYLAMIDE GEL ENTRAPMENT of ADENYLATE KINASE and ACETATE KINASE Summary the Factors That Limit the Stability of Adenylate K Journal of MolecularCatalysis, 6 (1979) 177 - 198 177 O ElsevierSequoia S.A., Lausanne- Printed in the Netherlands POLYACRYLAMIDE GEL ENTRAPMENT OF ADENYLATE KINASE AND ACETATE KINASE GEORGE M. WHITESIDES, ANDRE L. LAMOTTE, ORN ADALSTEINSSON, RAY- MOND F. BADDOUR. ALAN C. CHMURNY. CLARK K. COLTON and ALFRED POLLAK Departments of Chemistry and Chemical Engineering, MassachusettsInstitute of Tech- nology, Cambridge,Mass. 02 I 39 (U.S.A.) (Receivedin revisedform July 14, 1978) Summary The factors that limit the stability of adenylate kinaseand acetate kinasein solution have been examined and compared with those that deter- mine stability under conditions encounteredduring photochemically initi- ated polymer gel formation in solutions of acrylamide and N,N'-methylene- bisacrylamide.Both adenylatekinase (from rabbit and pig muscle) and ace- tate kinase (from E. Coli) contain cysteineresidues close to their active sites. In solutionsexposed to air, the rate of deactivationof theseenzymes is de- termined by the rate of autoxidation (probably transition metal-catalyzed) of thbir cysteinesulfhydryl groups. Both enzymesare very stableif protected againstautoxidation. At least four types of reactionscontribute to deacti- vation during polyacrylamide gel formation: autoxidation of cysteine sulf- hydryl groups by molecular oxygen; Michael addition of cysteinethiolate anion to acrylamidemonomer and relatedelectrophilic species;reaction of cysteine and of other amino acids with singlet oxygen (generatedby energy transfer from excited riboflavin to ground-statemolecular oxygen during irradiation);reaction of severalamino acid residueswith free radicals (pre- sumably SOl or buffer-derivedradicals). To avoid deactivation during acrylamide polymerization, it is helpful to exclude molecular oxygen, to work at low temperature and low pH, and to add thiols to the solution as radical scavengers.Both enzymesare lesssus- ceptible to deactivation in solutions having high concentrationsof substrates. Aciditional protection againstsinglet oxygen is afforded by using a tertiary amine buffer, and by adding pcarotene to the solution; both are effective quenchersfor singlet oxygen. Adenylate kinaseand acetatekinase have been modified by converting their cysteine- SH groups to - SSCH3moieties by reaction with S-methyl methanethiosulfonate;this blocking is completely reversedby treatment with DTT. Thesemodified proteins show 70% and \OVo,respectively, of the activity of the native enzymes.They are much more resistantto autoxida- tion and Michael addition than are the native proteins;their resistanceto 178 singlet oxygen is slightly better than these proteins; their resistanceto de- activation by SO; radical is indistinguishablefrom that of the fully reduced precursors.By taking advantageof a detailed accounting of the courseof deactivation during polyacrylamide gel formation, it is possibleto design experimental proceduresthat allow cross-linkedpolyacrylamide gelsto be formed by free-radicalpolymerization in solutions containing adenylate kinasewith preservationof 50 - 90% of the activity of the enzyme, and in solutions containing acetatekinase with preservationof 25 - 60% of the activity of the enzyme. If protected from atmosphericoxygen, the enzymes remain active in contact with these gelsover periods of many months. Lebk- ageof enzymesfrom the gelson washingis, however,rapid. Introduction Cross-linkedpolyacrylamide gelsare widely used as insoluble matrices for the immobilization of biochemicalst1 - 4l . The simplestenzyme gel immobilization procedureinvolves free radical polymertzation of acrylamide monomer and cross-linkingagent in a solution containing protein, and gener- atesa gel containing physically entrapped enzyme.Polyacrylamide gel entrap- ment has both advantagesand disadvantagesrelative to other methods of im- mobilization. On the one hand, polyacrylamideis inexpensive,hydrophilic, and well-characterized[5] ;gel formation is easilycarried out; polyacryl- amide is resistantto biodegradation;the gel network protects incorporated proteins againstattack by microorganismsand proteases.On the other hand, acrylamide monomer is reactivetoward proteins; the gel-forming polymeri- zation often destroys enzymatic activity;leakage of protein from gel usually resultsin loss of activity, and polyacrylamide haspoor mechanicalproperties. As part of an effort to devisetechniques for using cell-freeenzymes as catalystsfor large-scaleorganic synthesisutilizing cofactors, we have devel- oped a coupled enzymatic processfor the regenerationof ATP from AMP or ADP [6 - 11] . The ultimate phosphorylatingagent in this scheme,acetyl phosphate (AcP*), can be synthesizedreadily l1-zl. The synthesisof com- plex organic chemicalsby cell-free,enzyme-catalyzed, reactions will compete AMp+Arp #2ADp K=7-9 + ADP ACP #ATP + ACCIAtC K=50-400 *Abbreviations used are: AdK, adenylate kinase;AcK, acetatekinase; AcP, acetyl phosphate; DTT, dithiothreitol; DTE, dithioerythritol; Tris, 2-amino-2-(hydroxymethyl)- 1,3-propanediol;Hepes, N-2-hydroxyethylpiperazine-M -2-ethanesulfonic acid; Mops, morpholinepropanesulfonic acid; Tea, triethanol amine; TMEDA, N,N,N',N'-tetraethyl- enediamine;NADP, nicotinamide adeninedinucleotide phosphate;Bis, N,N'-methylene- bisacrylamide;G-6-PDH, glucose-6-phosphatedehydrogenase; MMTS, S-methyl methane- thiosulfonate. 179 with conventional chemical and fermentation synthesesonly if enzymescan be immobilized convenientlyand in good yield, if the immobilized enzymes can be used under conditions which retain high activity for long periods of tinie, and if practical schemesfor cofactor regenerationcan be developed. The studiesoutlined here identify the reactionsthat result in loss of enzyma- tic activity during polyacrylamide gel entrapment of adenylate kinase and acetatekinase by free-radicalpolymerization of acrylamide monomer and cross-linkingagent in solutions containing these enzymes.The reactionsthat deactivatethe enzymescan be effectively suppressedby appropriate choices of reaction conditions, with the enzyme-containinggels being formed with good preservationof enzymatic activity. This study, by indicating the processesthat result in loss of activity of these particular enzymesduring gel formation, should be generallyuseful in the preparation of gelscontaining entrapped biochemicals.Relatively rapid leakagefrom the gelsof the physi- cally-entrappedenzymes limits their utility in synthesis:the accompanying paper outlines methods for modifying the gel-forming polymerization to include active ester groups,and for coupling the included proteins to the polymer gel backboneusing these groups t131 . The particularadenylate kinases (AdK, AMP:ATP phosphotransferase, 8.C.2.7.4.3) studiedin this work were derivedeither from porcine or rabbit muscle:these single-subunit enzymes have molecular weights of 27 000, two cysteinegroups per molecule,and very similar structures[14, 15] . The mechanismof phosphatetransfer for the enzyme from rabbit muscle is randombi bi [16], with Michaelisconstants Kor, = 0.3mM,Koro = 0.5mM, and Koop = 1.58mM [L7 - 19].The equilibriumconstant relating ADP to ATP and AMP variesbetween 1 and 9, dependingon pH and pMg [8,20], and the rate is relatively insensitiveto pH between 7 and I [21] . A crystal structure on rabbit muscle myokinase is not available;that of porcine en- zyme placesone of the cysteine SH groups closeto the active site [ 22, 231 and the secondclose to the first [ 241.It is not clearwhether thesetwo SH groups can form an intramolecular disulfide linkage. Their orientation in the porcine enzyme suggeststhat some strain would be involved, but oxidation of rabbit enzymeis reported not to increaseits molecularweight [15] . Acetatekinase (AcK, ATP:acetatephosphotransferase, E.C.2 .7 .2.1,) from E. CoIi hasa molecularweight of 46 000 [ 251, and one cysteineSH group per molecule [ 261.Catalysis proceedsby a random sequentialmechanism with Michaelisconstants KNrg^rp = 1.1mM, Ko", = 0.34mM, Kraearp= 0.02mM, and K o. = 5.8mM [27 , 281. The observedequilibrium constant lies between 50 and 400, depending on pH 2 6 and pMg; the rate is relative- ly insensitiveto pH between6.5 and I 1251. Experimental Materialswere reagentgrade, and were obtained from these sources: Ttis, Hepes,Tea, Mops, DTT, DTE, 2-mercaptoethanol,ADP, AcP, NADP, 180 (Sigma);potassium and ammonium persulfate,acrylamide (ultra-pure), Bis (ultra-pure), TMEDA, riboflavin (Polysciences).The nitrogen and argon used as inert gaseswere purified grade.Water was deionized and distilled using a Corning Model 38 still. Apparatus The glasswareused with enzymeswas washedwith distilled water. Volumetric transferswere accomplishedusing Hamilton syringes,Eppendorf pipettes, and Boralex micropipettes (Fisher Scientific). Dialysis was under- taken using a Bio-Fiber 50 Minibeaker (Biorad) with an 80 cm2 fiber surface area and a nominal molecular weight cutoff of 5 000. Spectrophotometric determinations employed a Gilford Model 240 spectrophotometerequipped with a thermostatted cell compartment. The u.v. sourceused to initiate polymerizations was a high-intensity lamp (PolysciencesCatalog No. 0222) delivering 8 400 microwatts/cm2 (measuredat 18 in. distance) in the active region for initiation (360 nm). Enzymes Adenylate kinase (porcine muscle) was purchasedas a suspensionin 3.2M ammonium sulfate (Sigma). Its specific activity after treatment with DTT or DTE was 2050 U/mg (1U = l trrmole/min):further purification did not increasethis activity. Activation was carried out by centrifuging
Load more

Recommended publications
  • Katalog 2015 Cover Paul Lin *Hinweis Förderung.Indd
    Product List 2015 WE LIVE SERVICE Certificates quartett owns two productions sites that are certified according to EN ISO 9001:2008 Quality management systems - Requirements EN ISO 13485:2012 + AC:2012 Medical devices - Quality management systems - Requirements for regulatory purposes GMP Conformity Our quality management guarantees products of highest quality! 2 Foreword to the quartett product list 2015 quartett Immunodiagnostika, Biotechnologie + Kosmetik Vertriebs GmbH welcomes you as one of our new business partners as well as all of our previous loyal clients. You are now member of quartett´s worldwide customers. First of all we would like to introduce ourselves to you. Founded as a family-run company in 1986, quartett ensures for more than a quarter of a century consistent quality of products. Service and support of our valued customers are our daily businesses. And we will continue! In the end 80´s quartett offered radioimmunoassay and enzyme immunoassay kits from different manufacturers in the USA. In the beginning 90´s the company changed its strategy from offering products for routine diagnostic to the increasing field of research and development. Setting up a production plant in 1997 and a second one in 2011 supported this decision. The company specialized its product profile in the field of manufacturing synthetic peptides for antibody production, peptides such as protease inhibitors, biochemical reagents and products for histology, cytology and immunohistology. All products are exclusively manufactured in Germany without outsourcing any production step. Nowadays, we expand into all other diagnostic and research fields and supply our customers in universities, government institutes, pharmaceutical and biotechnological companies, hospitals, and private doctor offices.
    [Show full text]
  • Nucleotide Sequence and Analysis of the 58.3 to 65.5-Kb Early Region of Bacteriophage T4
    Volume 14 Number 21 1986 Nucleic Acids Research Nucleotide sequence and analysis of the 58.3 to 65.5-kb early region of bacteriophage T4 Kristoffer Valerie 13.4, John Stevens', Mark Lynch'5, Earl E.Henderson12 and Jon K.de Riel1 'Fels Research Institute, and 2Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140, USA and 3Department of Biochemistry and Biotechnology, Royal Institute of Technology, S-100 44 Stockholm, Sweden Received 21 July 1986; Revised and Accepted 30 September 1986 ABSTRACT The complete 7.2-kb nucleotide sequence from the 58.3 to 65.5-kb early region of bacteriophage T4 has been determined by Maxam and Gilbert sequencing. Computer analysis revealed at least 20 open reading frames (ORFs) within this sequence. All major ORFs are transcribed from the left strand, suggesting that they are expressed early during infection. Among the ORFs, we have identified the pIIII, II, denV and tk genes. The ORFs are very tightly spaced, even over Lapping in some instances, and when ORF interspacing occurs, promoter-like sequences can be implicated. Several of the sequences preceding the ORFs, in particular those at ipIII, ipII, denV, and orf6l.9, can potentially form stable stem-loop structures. INTRODUCTION Recently, considerable progress has been made studying the bacteriophage T4 genome at the molecular level due to the development of T4 strains with unmod- ified DNA suitable for digestion with restriction endonucleases (1). Many T4 genes have since been cloned, sequenced, and their gene products overproduced in Escherichia coli (for review see ref. 2). A majority of the T4 genes studied so far have been essential and non-essential genes with well-characterized pheno- types.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Acrylamide Polymerization — a Practical Approach
    electrophoresis tech note 1156 Acrylamide Polymerization — A Practical Approach Paul Menter, Bio-Rad Laboratories, 2000 Alfred Nobel Drive, Polyacrylamide Gel Polymerization Hercules, CA 94547 USA AcrylamideBis Polyacrylamide Introduction The unparalleled resolution and flexibility possible with CH2 CH + CH2 CH CH2 CH CH2 CH CH2 CH polyacrylamide gel electrophoresis (PAGE) has led to its CO CO CO CO CO widespread use for the separation of proteins and nucleic NH2 NH NH2 NH2 NH acids. Gel porosity can be varied over a wide range to meet CH2 CH2 specific separation requirements. Electrophoresis gels and NH NH NH NH buffers can be chosen to provide separation on the basis of CO 2 2 CO CO C O charge, size, or a combination of charge and size. CH2 CH CH2 CH CH2 CH CH2 CH The key to mastering this powerful technique lies in the polymerization process itself. By understanding the important Purity of Gel-Forming Reagents parameters, and following a few simple guidelines, the novice Acrylamide can become proficient and the experienced user can optimize Gel-forming reagents include the monomers, acrylamide and bis, separations even further. as well as the initiators, usually ammonium persulfate and TEMED or, occasionally, riboflavin and TEMED. On a molar This bulletin takes a practical approach to the preparation of basis, acrylamide is by far the most abundant component in the polyacrylamide gels. Its purpose is to provide the information monomer solution. As a result, acrylamide may be the primary required to achieve reproducible, controllable polymerization. source of interfering contaminants (Dirksen and Chrambach For those users interested only in the “bare essentials,” the 1972).
    [Show full text]
  • Recombinant Escheichia Coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate
    J. Ind. Eng. Chem., Vol. 12, No. 5, (2006) 757-761 Recombinant Escheichia coli-Catalyzed Production of Cytidine 5′-Triphosphate from Cytidine 5′-Monophosphate Sun-Gu Lee† and Byung-Gee Kim* Department of Chemical and Biochemical Engineering, Pusan National University, Busan 609-735, Korea *School of Chemical Engineering, and Institute of Molecular Biology and Genetics, Seoul National University, Seoul 151-742, Korea Received April 24, 2006; Accepted May 22, 2006 Abstract: A recombinant Escherichia coli overexpressing CMP-kinase was constructed and employed as a whole cell biocatalyst for the conversion of cytidine 5′-monophosphate to cytidine 5′-triphosphate. In the whole cell biocatalysis, recombinant CMP kinase catalyzed the conversion of CMP to CDP, and endogenous acetate kinase of the E. coli was utilized for the ATP regeneration as well as for the conversion of CDP to CTP. A conversion yield of ca. 88 % CTP was obtained when starting with 20 mM CMP, 1 mM ATP, and 80 mM acetyl phosphate based on the initial CMP concentration. Endogenous pyruvate kinase and poly- phosphate kinase were inefficient in the process. The CTP production system was applied to the production of CMP-NeuAc by additionally introducing the CMP-NeuAc synthetase gene into the recombinant E. coli. Keywords: CMP-kinase, whole cell biocatalysis, ATP regeneration, cytidine 5′-monophosphate Introduction employing enzymes [4]. They applied various enzymatic 1) methods and chemical methods and concluded that the As glycosyltransferase-catalyzed synthetic techniques enzymatic method based on adenylate kinase/pyruvate are becoming recognized as powerful methods for the kinase provided the most convenient route to CTP. In the preparation of biologically important oligosaccharides, process, CTP was generated efficiently from an inexpen- the development of cost-efficient production methods for sive substrate, CMP.
    [Show full text]
  • (Ph.D.) Environmental Engineering
    UNIVERSITY OF CINCINNATI Date: June 15, 2005 I, Georgios Anipsitakis , hereby submit this work as part of the requirements for the degree of: Doctorate of Philosophy (Ph.D.) in: Environmental Engineering It is entitled: Cobalt/Peroxymonosulfate and Related Oxidizing Reagents for Water Treatment This work and its defense approved by: Chair: Dr. Dionysios Dionysiou Dr. Paul Bishop Dr. George Sorial Dr. Souhail Al-Abed COBALT/PEROXYMONOSULFATE AND RELATED OXIDIZING REAGENTS FOR WATER TREATMENT A dissertation submitted to the Division of Research and Advanced Studies of the University of Cincinnati in partial fulfillment of the requirements for the degree of DOCTORATE OF PHILOSOPHY (Ph.D.) in the Department of Civil and Environmental Engineering of the College of Engineering 2005 by Georgios P. Anipsitakis Diploma (B.S./M.S.), Chemical Engineering, Nat. Technical Univ. Athens, 2000 Committee Chair: Dr. Dionysios D. Dionysiou ii Abstract This dissertation explores the fundamentals of a novel advanced oxidation technology, the II cobalt/peroxymonosulfate (Co /KHSO5) reagent, for the treatment of persistent and hazardous II substances in water. Co /KHSO5 is based on the chemistry of the Fenton Reagent and proceeds via the generation of sulfate radicals, which similarly to hydroxyl radicals, readily attack and degrade organic and microbial contamination in water. Very few studies have exploited the reactivity of sulfate radicals for environmental applications. Compared to the extensively investigated hydroxyl radicals, sulfate radicals are not fully understood. Following this approach, the coupling of nine transition metals with hydrogen peroxide (H2O2), potassium peroxymonosulfate (KHSO5) and persulfate (K2S2O8) was also explored. The objective was again the generation of inorganic radicals and the efficient degradation of organic contaminants in water.
    [Show full text]
  • Découverte D'une Nouvelle Famille De Protéine Kinases Bactériennes
    Découverte d’une nouvelle famille de protéine kinases bactériennes : mécanismes de fonctionnement et rôle cellulaire de YdiB, un archétype chez Baccillus subtilis Hien-Anh Nguyen To cite this version: Hien-Anh Nguyen. Découverte d’une nouvelle famille de protéine kinases bactériennes : mécanismes de fonctionnement et rôle cellulaire de YdiB, un archétype chez Baccillus subtilis. Sciences agricoles. Université de Grenoble, 2012. Français. NNT : 2012GRENV017. tel-00721757 HAL Id: tel-00721757 https://tel.archives-ouvertes.fr/tel-00721757 Submitted on 30 Jul 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. THÈSE Pour obtenir le grade de DOCTEUR DE L’UNIVERSITÉ DE GRENOBLE Spécialité : Chimie-Biologie Arrêté ministériel : 7 août 2006 Présentée par Hien-Anh NGUYEN Thèse dirigée par le Dr. Jean-Michel JAULT préparée au sein de l’Institut de Biologie Structurale J.-P. Ebel, et du CEA de Grenoble dans l'École Doctorale Chimie et Sciences du Vivant Découverte d’une nouvelle famille de protéines kinases bactériennes : Mécanisme de fonctionnement et rôle cellulaire de YdiB, un représentant chez B. subtilis Thèse soutenue publiquement le 23 mai 2012 devant le jury composé de : Mme. Patricia DOUBLET Rapporteur Prof.
    [Show full text]
  • Two-Dimensional Isobutyl Acetate Production Pathways to Improve Carbon Yield
    ARTICLE Received 23 Apr 2015 | Accepted 13 May 2015 | Published 25 Jun 2015 DOI: 10.1038/ncomms8488 OPEN Two-dimensional isobutyl acetate production pathways to improve carbon yield Yohei Tashiro1, Shuchi H. Desai1,2 & Shota Atsumi1,2 For an economically competitive biological process, achieving high carbon yield of a target chemical is crucial. In biochemical production, pyruvate and acetyl-CoA are primary building blocks. When sugar is used as the sole biosynthetic substrate, acetyl-CoA is commonly generated by pyruvate decarboxylation. However, pyruvate decarboxylation during acetyl-CoA formation limits the theoretical maximum carbon yield (TMCY) by releasing carbon, and in some cases also leads to redox imbalance. To avoid these problems, we describe here the construction of a metabolic pathway that simultaneously utilizes glucose and acetate. Acetate is utilized to produce acetyl-CoA without carbon loss or redox imbalance. We demonstrate the utility of this approach for isobutyl acetate (IBA) production, wherein IBA production with glucose and acetate achieves a higher carbon yield than with either sole carbon source. These results highlight the potential for this multiple carbon source approach to improve the TMCY and balance redox in biosynthetic pathways. 1 Department of Chemistry, University of California, Davis, One Shields Avenue, Davis, California 95616, USA. 2 Microbiology Graduate Group, University of California, Davis, One Shields Avenue, Davis, California 95616, USA. Correspondence and requests for materials should be addressed to S.A. (email: [email protected]). NATURE COMMUNICATIONS | 6:7488 | DOI: 10.1038/ncomms8488 | www.nature.com/naturecommunications 1 & 2015 Macmillan Publishers Limited. All rights reserved. ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms8488 iochemical production from biomass, a renewable resource OH synthesized from CO2 and sunlight, may contribute to a 1 Bcarbon-neutral society .
    [Show full text]
  • Electrophoretic Variation in Adenylate Kinase Ofneisseria
    Proc. Natl. Acad. Sci. USA Vol. 92, pp. 10535-10539, November 1995 Genetics Electrophoretic variation in adenylate kinase of Neisseria meningitidis is due to inter- and intraspecies recombination (natural transformation/linkage disequilibrium/mosaic genes/multilocus enzyme electrophoresis/nonclonal population structure) EDWARD FEIL, GILL CARPENTER, AND BRIAN G. SPRATT* Molecular Microbiology Group, School of Biological Sciences, University of Sussex, Falmer, Brighton BN1 9QG, United Kingdom Communicated by John Maynard Smith, University of Sussex, Falmer, Brighton, United Kingdom, August 7, 1995 ABSTRACT In prokaryotic and eukaryotic organisms, their growth cycles and the availability of this mechanism of the electrophoretic variation in housekeeping enzymes from genetic exchange appears to have a profound effect on their natural populations is assumed to have arisen by the accu- evolution and population biology (3, 13-17). mulation of stochastic predominantly neutral mutations. In Caugant et al. (18) carried out an extensive MLEE survey of the naturally transformable bacterium Neisseria meningitidis, meningococci, analyzing variation at 15 enzyme loci in 688 we show that variation in the electrophoretic mobility of isolates recovered predominantly from patients with invasive adenylate kinase is due to inter- and intraspecies recombina- disease. Although the results from this survey appeared to tion rather than mutation. The nucleotide sequences of the imply relatively high levels of linkage disequilibrium, it has adenylate kinase gene (adk) from isolates that express the been pointed out (3, 17) that artificially high levels of linkage predominant slow electrophoretic variant were rather uni- disequilibrium may result from sampling bias, in this case form, differing in sequence at an average of 1.1% of nucleotide through the disproportionately high frequency in the data set sites.
    [Show full text]
  • Microchip Design for Chemiluminesence Detection
    Double spiral detection channel for on-chip chemiluminescence detection Author Lok, Khoi Seng, Kwok, Yien Chian, Nam-Trung, Nguyen Published 2012 Journal Title Sensors and Actuators B: Chemical DOI https://doi.org/10.1016/j.snb.2012.04.047 Copyright Statement © 2012 Elsevier B.V.. This is the author-manuscript version of this paper. Reproduced in accordance with the copyright policy of the publisher. Please refer to the journal's website for access to the definitive, published version. Downloaded from http://hdl.handle.net/10072/50085 Griffith Research Online https://research-repository.griffith.edu.au Lab on a Chip for Chemiluminescence Detection Khoi Seng Lok1, Yien Chian Kwok1* and Nam Trung Nguyen2 1National Institute of Education, Nanyang Technological University, Nanyang Walk, Singapore 637616, Singapore. E-mail: [email protected] 2School of Mechanical and Production Engineering, Nanyang Technological University, 50 Nanyang Avenue, Singapore 639798, Singapore. E-mail: [email protected] Abstracts In this paper reports a three layered device that consists of a double spiral channel design for chemiluminsence (CL) detection and a passive micromixer to facilitate mixing of reagents. Compared to the design with a single spiral channel, the design with two overlapping spiral channels doubled the CL intensity emitted from the reaction. Furthermore, the addition of the passive micromixer improved the signal by 1.5 times. Luminol-based chemiluminescence reaction was used for the characterization of the device. This device was successfully used for the determination of L-cysteine and uric acid. Keywords: chemiluminescence, lab-on-chip, micro total analysis system, luminol, cobalt, L-cysteine, uric acid 1 Introduction Chemiluminescence (CL) detection methods do not require an excitation light source.
    [Show full text]
  • Acetate Activation in Methanosaeta Thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-Coa Synthetase
    Hindawi Publishing Corporation Archaea Volume 2012, Article ID 315153, 10 pages doi:10.1155/2012/315153 Research Article Acetate Activation in Methanosaeta thermophila: Characterization of the Key Enzymes Pyrophosphatase and Acetyl-CoA Synthetase Stefanie Berger, Cornelia Welte, and Uwe Deppenmeier Institute for Microbiology and Biotechnology, University of Bonn, Meckenheimer Allee 168, 53115 Bonn, Germany Correspondence should be addressed to Uwe Deppenmeier, [email protected] Received 16 May 2012; Accepted 30 June 2012 Academic Editor: Francesca Paradisi Copyright © 2012 Stefanie Berger et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The thermophilic methanogen Methanosaeta thermophila uses acetate as sole substrate for methanogenesis. It was proposed that the acetate activation reaction that is needed to feed acetate into the methanogenic pathway requires the hydrolysis of two ATP, whereas the acetate activation reaction in Methanosarcina sp. is known to require only one ATP. As these organisms live at the thermodynamic limit that sustains life, the acetate activation reaction in Mt. thermophila seems too costly and was thus reevaluated. It was found that of the putative acetate activation enzymes one gene encoding an AMP-forming acetyl-CoA synthetase was highly expressed. The corresponding enzyme was purified and characterized in detail. It catalyzed the ATP-dependent formation of acetyl- CoA, AMP, and pyrophosphate (PPi) and was only moderately inhibited by PPi. The breakdown of PPi was performed by a soluble pyrophosphatase. This enzyme was also purified and characterized. The pyrophosphatase hydrolyzed the major part of PPi (KM = 0.27 ± 0.05 mM) that was produced in the acetate activation reaction.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]