DOCSLIB.ORG

Mouse Uaca Conditional Knockout Project (CRISPR/Cas9)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mouse Uaca Conditional Knockout Project (CRISPR/Cas9) https://www.alphaknockout.com Mouse Uaca Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Uaca conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Uaca gene (NCBI Reference Sequence: NM_028283 ; Ensembl: ENSMUSG00000034485 ) is located on Mouse chromosome 9. 19 exons are identified, with the ATG start codon in exon 1 and the TAG stop codon in exon 19 (Transcript: ENSMUST00000050183). Exon 2 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Uaca gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-339F10 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Homozygous mice display swelling of and inflammatory lesions in the preputial gland. Exon 2 starts from about 2.01% of the coding region. The knockout of Exon 2 will result in frameshift of the gene. The size of intron 1 for 5'-loxP site insertion: 46147 bp, and the size of intron 2 for 3'-loxP site insertion: 5019 bp. The size of effective cKO region: ~634 bp. The cKO region does not have any other known gene. Page 1 of 8 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele gRNA region 5' gRNA region 3' 1 2 19 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Uaca Homology arm cKO region loxP site Page 2 of 8 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the GC Content Distribution Window size: 300 bp Sequence 12 Summary: Full Length(7134bp) | A(25.55% 1823) | C(21.0% 1498) | T(30.64% 2186) | G(22.81% 1627) Note: The sequence of homologous arms and cKO region is analyzed to determine the GC content. No significant high GC-content region is found. So this region is suitable for PCR screening or sequencing analysis. Page 3 of 8 https://www.alphaknockout.com BLAT Search Results (up) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr9 + 60837591 60840590 3000 browser details YourSeq 160 1883 2135 3000 91.3% chr4 - 149978536 150002972 24437 browser details YourSeq 140 1952 2136 3000 91.7% chr2 + 60266426 60266618 193 browser details YourSeq 134 1962 2135 3000 90.5% chr11 - 80186176 80186361 186 browser details YourSeq 130 1947 2135 3000 90.9% chr4 - 133336288 133336671 384 browser details YourSeq 130 1984 2143 3000 95.3% chr15 + 78766193 79189726 423534 browser details YourSeq 130 1947 2123 3000 90.7% chr14 + 54542855 54543035 181 browser details YourSeq 129 1952 2135 3000 83.6% chr5 + 53220817 53220997 181 browser details YourSeq 129 1715 2134 3000 85.3% chr11 + 115635907 115636838 932 browser details YourSeq 126 1969 2140 3000 87.3% chr1 + 134951352 135173171 221820 browser details YourSeq 125 1947 2132 3000 89.9% chr18 - 39017365 39017550 186 browser details YourSeq 121 1968 2135 3000 88.6% chr5 - 73049524 73049700 177 browser details YourSeq 121 1953 2135 3000 86.6% chr3 + 138040957 138041146 190 browser details YourSeq 120 1955 2135 3000 90.0% chr11 + 101490645 101490825 181 browser details YourSeq 120 1972 2135 3000 87.1% chr1 + 191046855 191047222 368 browser details YourSeq 114 1945 2135 3000 85.1% chr12 - 28499371 28499554 184 browser details YourSeq 113 1971 2131 3000 87.6% chrX - 52871730 52871900 171 browser details YourSeq 113 1970 2140 3000 89.6% chr11 - 31483182 31483356 175 browser details YourSeq 113 1948 2135 3000 90.7% chr10 - 85619520 85619709 190 browser details YourSeq 112 1963 2124 3000 90.6% chr17 - 42993275 42993437 163 Note: The 3000 bp section upstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. BLAT Search Results (down) QUERY SCORE START END QSIZE IDENTITY CHROM STRAND START END SPAN ----------------------------------------------------------------------------------------------- browser details YourSeq 3000 1 3000 3000 100.0% chr9 + 60841225 60844224 3000 browser details YourSeq 130 1463 2101 3000 81.8% chr7 - 109930073 109930593 521 browser details YourSeq 111 1455 1605 3000 91.3% chr9 - 56601265 56846305 245041 browser details YourSeq 111 1464 1696 3000 92.4% chr7 - 15891823 15892396 574 browser details YourSeq 106 1441 1830 3000 89.5% chr8 - 70355159 70355743 585 browser details YourSeq 106 1449 1596 3000 87.5% chr7 + 19720185 19720331 147 browser details YourSeq 104 825 1759 3000 92.7% chr16 + 33291355 33754916 463562 browser details YourSeq 101 2070 2242 3000 85.8% chr10 - 107438085 107438242 158 browser details YourSeq 99 1441 1593 3000 84.0% chr8 - 14248370 14248514 145 browser details YourSeq 98 1460 1594 3000 89.3% chr6 - 84346286 84346416 131 browser details YourSeq 98 1444 1595 3000 88.3% chr5 + 150435632 150435781 150 browser details YourSeq 94 1453 1593 3000 87.5% chr15 - 74971781 74971917 137 browser details YourSeq 92 2079 2232 3000 92.7% chr8 - 44364626 44364955 330 browser details YourSeq 92 1441 1599 3000 90.4% chr14 - 74142639 74142810 172 browser details YourSeq 92 1453 1589 3000 88.0% chr16 + 34060159 34060294 136 browser details YourSeq 92 1453 1589 3000 91.9% chr1 + 28345764 28345903 140 browser details YourSeq 91 1441 1598 3000 85.0% chr4 - 86646380 86646531 152 browser details YourSeq 91 1453 1587 3000 85.8% chr2 - 29118983 29119113 131 browser details YourSeq 91 1443 1593 3000 88.9% chr13 + 77781438 77781586 149 browser details YourSeq 90 2079 2236 3000 94.2% chr5 - 117026754 117026974 221 Note: The 3000 bp section downstream of Exon 2 is BLAT searched against the genome. No significant similarity is found. Page 4 of 8 https://www.alphaknockout.com Gene and protein information: Uaca uveal autoantigen with coiled-coil domains and ankyrin repeats [ Mus musculus (house mouse) ] Gene ID: 72565, updated on 24-Oct-2019 Gene summary Official Symbol Uaca provided by MGI Official Full Name uveal autoantigen with coiled-coil domains and ankyrin repeats provided by MGI Primary source MGI:MGI:1919815 See related Ensembl:ENSMUSG00000034485 Gene type protein coding RefSeq status VALIDATED Organism Mus musculus Lineage Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus Also known as nucling; 2700059D02Rik Expression Ubiquitous expression in placenta adult (RPKM 12.9), CNS E11.5 (RPKM 8.3) and 25 other tissues See more Orthologs human all Genomic context Location: 9; 9 B See Uaca in Genome Data Viewer Exon count: 23 Annotation release Status Assembly Chr Location 108 current GRCm38.p6 (GCF_000001635.26) 9 NC_000075.6 (60793206..60880431) Build 37.2 previous assembly MGSCv37 (GCF_000001635.18) 9 NC_000075.5 (60642355..60728177) Chromosome 9 - NC_000075.6 Page 5 of 8 https://www.alphaknockout.com Transcript information: This gene has 5 transcripts Gene: Uaca ENSMUSG00000034485 Description uveal autoantigen with coiled-coil domains and ankyrin repeats [Source:MGI Symbol;Acc:MGI:1919815] Gene Synonyms 2700059D02Rik, nucling Location Chromosome 9: 60,794,542-60,880,370 forward strand. GRCm38:CM001002.2 About this gene This gene has 5 transcripts (splice variants), 193 orthologues, 2 paralogues, is a member of 1 Ensembl protein family and is associated with 16 phenotypes. Transcripts Name Transcript ID bp Protein Translation ID Biotype CCDS UniProt Flags Uaca-201 ENSMUST00000050183.6 4428 1413aa ENSMUSP00000062047.6 Protein coding CCDS23259 A0A0R4J0S7 TSL:1 GENCODE basic APPRIS P2 Uaca-202 ENSMUST00000214354.1 4417 1411aa ENSMUSP00000151172.1 Protein coding - A0A1L1SVG0 TSL:5 GENCODE basic APPRIS ALT2 Uaca-205 ENSMUST00000217656.1 3824 1236aa ENSMUSP00000150547.1 Protein coding - A0A1L1STY4 CDS 5' incomplete TSL:1 Uaca-203 ENSMUST00000214997.1 4493 No protein - Retained intron - - TSL:1 Uaca-204 ENSMUST00000216574.1 866 No protein - Retained intron - - TSL:2 Page 6 of 8 https://www.alphaknockout.com 105.83 kb Forward strand 60.80Mb 60.82Mb 60.84Mb 60.86Mb 60.88Mb Genes (Comprehensive set... Uaca-202 >protein coding Uaca-201 >protein coding Uaca-205 >protein coding Uaca-203 >retained intron Uaca-204 >retained intron Contigs < AC156940.1 < AC160562.2 Genes < Gm9869-202lncRNA (Comprehensive set... < Gm9869-201lncRNA Regulatory Build 60.80Mb 60.82Mb 60.84Mb 60.86Mb 60.88Mb Reverse strand 105.83 kb Regulation Legend CTCF Enhancer Open Chromatin Promoter Promoter Flank Transcription Factor Binding Site Gene Legend Protein Coding Ensembl protein coding merged Ensembl/Havana Non-Protein Coding RNA gene processed transcript Page 7 of 8 https://www.alphaknockout.com Transcript: ENSMUST00000050183 85.82 kb Forward strand Uaca-201 >protein coding ENSMUSP00000062... MobiDB lite Low complexity (Seg) Coiled-coils (Ncoils) Superfamily Ankyrin repeat-containing domain superfamily SSF90257 SMART Ankyrin repeat Prints Ankyrin repeat Pfam Ankyrin repeat-containing domain PROSITE profiles Ankyrin repeat Target SNARE coiled-coil homology domain Ankyrin repeat-containing domain PANTHER PTHR24173 Protein Nucling Gene3D Ankyrin repeat-containing domain superfamily All sequence SNPs/i... Sequence variants (dbSNP and all other sources) Variant Legend missense variant synonymous variant Scale bar 0 200 400 600 800 1000 1200 1413 We wish to acknowledge the following valuable scientific information resources: Ensembl, MGI, NCBI, UCSC. Page 8 of 8.
Load more

Recommended publications
  • Genome-Scale Single-Cell Mechanical Phenotyping Reveals Disease-Related Genes Involved in Mitotic Rounding
    ARTICLE DOI: 10.1038/s41467-017-01147-6 OPEN Genome-scale single-cell mechanical phenotyping reveals disease-related genes involved in mitotic rounding Yusuke Toyoda 1,2, Cedric J. Cattin3, Martin P. Stewart 3,4,5, Ina Poser1, Mirko Theis6, Teymuras V. Kurzchalia1, Frank Buchholz1,6, Anthony A. Hyman1 & Daniel J. Müller 3 To divide, most animal cells drastically change shape and round up against extracellular confinement. Mitotic cells facilitate this process by generating intracellular pressure, which the contractile actomyosin cortex directs into shape. Here, we introduce a genome-scale microcantilever- and RNAi-based approach to phenotype the contribution of > 1000 genes to the rounding of single mitotic cells against confinement. Our screen analyzes the rounding force, pressure and volume of mitotic cells and localizes selected proteins. We identify 49 genes relevant for mitotic rounding, a large portion of which have not previously been linked to mitosis or cell mechanics. Among these, depleting the endoplasmic reticulum-localized protein FAM134A impairs mitotic progression by affecting metaphase plate alignment and pressure generation by delocalizing cortical myosin II. Furthermore, silencing the DJ-1 gene uncovers a link between mitochondria-associated Parkinson’s disease and mitotic pressure. We conclude that mechanical phenotyping is a powerful approach to study the mechanisms governing cell shape. 1 Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany. 2 Division of Cell Biology, Life Science Institute, Kurume University, Hyakunen-Kohen 1-1, Kurume, Fukuoka 839-0864, Japan. 3 Department of Biosystems Science and Engineering (D-BSSE), Eidgenössische Technische Hochschule (ETH) Zurich, Mattenstrasse 26, 4058 Basel, Switzerland.
    [Show full text]
  • Supplementary Information – Postema Et Al., the Genetics of Situs Inversus Totalis Without Primary Ciliary Dyskinesia
    1 Supplementary information – Postema et al., The genetics of situs inversus totalis without primary ciliary dyskinesia Table of Contents: Supplementary Methods 2 Supplementary Results 5 Supplementary References 6 Supplementary Tables and Figures Table S1. Subject characteristics 9 Table S2. Inbreeding coefficients per subject 10 Figure S1. Multidimensional scaling to capture overall genomic diversity 11 among the 30 study samples Table S3. Significantly enriched gene-sets under a recessive mutation model 12 Table S4. Broader list of candidate genes, and the sources that led to their 13 inclusion Table S5. Potential recessive and X-linked mutations in the unsolved cases 15 Table S6. Potential mutations in the unsolved cases, dominant model 22 2 1.0 Supplementary Methods 1.1 Participants Fifteen people with radiologically documented SIT, including nine without PCD and six with Kartagener syndrome, and 15 healthy controls matched for age, sex, education and handedness, were recruited from Ghent University Hospital and Middelheim Hospital Antwerp. Details about the recruitment and selection procedure have been described elsewhere (1). Briefly, among the 15 people with radiologically documented SIT, those who had symptoms reminiscent of PCD, or who were formally diagnosed with PCD according to their medical record, were categorized as having Kartagener syndrome. Those who had no reported symptoms or formal diagnosis of PCD were assigned to the non-PCD SIT group. Handedness was assessed using the Edinburgh Handedness Inventory (EHI) (2). Tables 1 and S1 give overviews of the participants and their characteristics. Note that one non-PCD SIT subject reported being forced to switch from left- to right-handedness in childhood, in which case five out of nine of the non-PCD SIT cases are naturally left-handed (Table 1, Table S1).
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Regulation of Gene Expression Dynamics During Developmental Transitions by the Ikaros Transcription Factor
    Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Regulation of gene expression dynamics during developmental transitions by the Ikaros transcription factor Teresita L. Arenzana,1 Hilde Schjerven,2 and Stephen T. Smale1 1Department of Microbiology, Immunology, and Molecular Genetics, University of California at Los Angeles, Los Angeles, California 90095, USA; 2Department of Laboratory Medicine, University of California at San Francisco, San Francisco, California 94143, USA The DNA-binding protein Ikaros is a potent tumor suppressor and hematopoietic regulator. However, the mecha- nisms by which Ikaros functions remain poorly understood, due in part to its atypical DNA-binding properties and partnership with the poorly understood Mi-2/NuRD complex. In this study, we analyzed five sequential stages of thymocyte development in a mouse strain containing a targeted deletion of Ikaros zinc finger 4, which exhibits a select subset of abnormalities observed in Ikaros-null mice. By examining thymopoiesis in vivo and in vitro, diverse abnormalities were observed at each developmental stage. RNA sequencing revealed that each stage is characterized by the misregulation of a limited number of genes, with a strong preference for stage-specific rather than lineage- specific genes. Strikingly, individual genes rarely exhibited Ikaros dependence at all stages. Instead, a consistent feature of the aberrantly expressed genes was a reduced magnitude of expression level change during developmental transitions. These results, combined with analyses of the interplay between Ikaros loss of function and Notch sig- naling, suggest that Ikaros may not be a conventional activator or repressor of defined sets of genes.
    [Show full text]
  • Transdifferentiation of Human Mesenchymal Stem Cells
    Transdifferentiation of Human Mesenchymal Stem Cells Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Tatjana Schilling aus San Miguel de Tucuman, Argentinien Würzburg, 2007 Eingereicht am: Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Martin J. Müller Gutachter: PD Dr. Norbert Schütze Gutachter: Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am: Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbstständig angefertigt und keine anderen als die von mir angegebenen Hilfsmittel und Quellen verwendet habe. Des Weiteren erkläre ich, dass diese Arbeit weder in gleicher noch in ähnlicher Form in einem Prüfungsverfahren vorgelegen hat und ich noch keinen Promotionsversuch unternommen habe. Gerbrunn, 4. Mai 2007 Tatjana Schilling Table of contents i Table of contents 1 Summary ........................................................................................................................ 1 1.1 Summary.................................................................................................................... 1 1.2 Zusammenfassung..................................................................................................... 2 2 Introduction.................................................................................................................... 4 2.1 Osteoporosis and the fatty degeneration of the bone marrow..................................... 4 2.2 Adipose and bone
    [Show full text]
  • WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/040794 Al 17 March 2016 (17.03.2016) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 1/19 (2006.01) C12Q 1/02 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 15/81 (2006.01) C07K 14/47 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, (21) International Application Number: KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, PCT/US20 15/049674 MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (22) International Filing Date: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, 11 September 2015 ( 11.09.201 5) SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every (26) Publication Language: English kind of regional protection available): ARIPO (BW, GH, (30) Priority Data: GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, 62/050,045 12 September 2014 (12.09.2014) US TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, (71) Applicant: WHITEHEAD INSTITUTE FOR BIOMED¬ DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, ICAL RESEARCH [US/US]; Nine Cambridge Center, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, Cambridge, Massachusetts 02142-1479 (US).
    [Show full text]
  • Entrez ID Gene Name Fold Change Q-Value Description
    Entrez ID gene name fold change q-value description 4283 CXCL9 -7.25 5.28E-05 chemokine (C-X-C motif) ligand 9 3627 CXCL10 -6.88 6.58E-05 chemokine (C-X-C motif) ligand 10 6373 CXCL11 -5.65 3.69E-04 chemokine (C-X-C motif) ligand 11 405753 DUOXA2 -3.97 3.05E-06 dual oxidase maturation factor 2 4843 NOS2 -3.62 5.43E-03 nitric oxide synthase 2, inducible 50506 DUOX2 -3.24 5.01E-06 dual oxidase 2 6355 CCL8 -3.07 3.67E-03 chemokine (C-C motif) ligand 8 10964 IFI44L -3.06 4.43E-04 interferon-induced protein 44-like 115362 GBP5 -2.94 6.83E-04 guanylate binding protein 5 3620 IDO1 -2.91 5.65E-06 indoleamine 2,3-dioxygenase 1 8519 IFITM1 -2.67 5.65E-06 interferon induced transmembrane protein 1 3433 IFIT2 -2.61 2.28E-03 interferon-induced protein with tetratricopeptide repeats 2 54898 ELOVL2 -2.61 4.38E-07 ELOVL fatty acid elongase 2 2892 GRIA3 -2.60 3.06E-05 glutamate receptor, ionotropic, AMPA 3 6376 CX3CL1 -2.57 4.43E-04 chemokine (C-X3-C motif) ligand 1 7098 TLR3 -2.55 5.76E-06 toll-like receptor 3 79689 STEAP4 -2.50 8.35E-05 STEAP family member 4 3434 IFIT1 -2.48 2.64E-03 interferon-induced protein with tetratricopeptide repeats 1 4321 MMP12 -2.45 2.30E-04 matrix metallopeptidase 12 (macrophage elastase) 10826 FAXDC2 -2.42 5.01E-06 fatty acid hydroxylase domain containing 2 8626 TP63 -2.41 2.02E-05 tumor protein p63 64577 ALDH8A1 -2.41 6.05E-06 aldehyde dehydrogenase 8 family, member A1 8740 TNFSF14 -2.40 6.35E-05 tumor necrosis factor (ligand) superfamily, member 14 10417 SPON2 -2.39 2.46E-06 spondin 2, extracellular matrix protein 3437
    [Show full text]
  • Cell Cycle Arrest Through Indirect Transcriptional Repression by P53: I Have a DREAM
    Cell Death and Differentiation (2018) 25, 114–132 Official journal of the Cell Death Differentiation Association OPEN www.nature.com/cdd Review Cell cycle arrest through indirect transcriptional repression by p53: I have a DREAM Kurt Engeland1 Activation of the p53 tumor suppressor can lead to cell cycle arrest. The key mechanism of p53-mediated arrest is transcriptional downregulation of many cell cycle genes. In recent years it has become evident that p53-dependent repression is controlled by the p53–p21–DREAM–E2F/CHR pathway (p53–DREAM pathway). DREAM is a transcriptional repressor that binds to E2F or CHR promoter sites. Gene regulation and deregulation by DREAM shares many mechanistic characteristics with the retinoblastoma pRB tumor suppressor that acts through E2F elements. However, because of its binding to E2F and CHR elements, DREAM regulates a larger set of target genes leading to regulatory functions distinct from pRB/E2F. The p53–DREAM pathway controls more than 250 mostly cell cycle-associated genes. The functional spectrum of these pathway targets spans from the G1 phase to the end of mitosis. Consequently, through downregulating the expression of gene products which are essential for progression through the cell cycle, the p53–DREAM pathway participates in the control of all checkpoints from DNA synthesis to cytokinesis including G1/S, G2/M and spindle assembly checkpoints. Therefore, defects in the p53–DREAM pathway contribute to a general loss of checkpoint control. Furthermore, deregulation of DREAM target genes promotes chromosomal instability and aneuploidy of cancer cells. Also, DREAM regulation is abrogated by the human papilloma virus HPV E7 protein linking the p53–DREAM pathway to carcinogenesis by HPV.Another feature of the pathway is that it downregulates many genes involved in DNA repair and telomere maintenance as well as Fanconi anemia.
    [Show full text]
  • Analyzing the Mirna-Gene Networks to Mine the Important Mirnas Under Skin of Human and Mouse
    Hindawi Publishing Corporation BioMed Research International Volume 2016, Article ID 5469371, 9 pages http://dx.doi.org/10.1155/2016/5469371 Research Article Analyzing the miRNA-Gene Networks to Mine the Important miRNAs under Skin of Human and Mouse Jianghong Wu,1,2,3,4,5 Husile Gong,1,2 Yongsheng Bai,5,6 and Wenguang Zhang1 1 College of Animal Science, Inner Mongolia Agricultural University, Hohhot 010018, China 2Inner Mongolia Academy of Agricultural & Animal Husbandry Sciences, Hohhot 010031, China 3Inner Mongolia Prataculture Research Center, Chinese Academy of Science, Hohhot 010031, China 4State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223, China 5Department of Biology, Indiana State University, Terre Haute, IN 47809, USA 6The Center for Genomic Advocacy, Indiana State University, Terre Haute, IN 47809, USA Correspondence should be addressed to Yongsheng Bai; [email protected] and Wenguang Zhang; [email protected] Received 11 April 2016; Revised 15 July 2016; Accepted 27 July 2016 Academic Editor: Nicola Cirillo Copyright © 2016 Jianghong Wu et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Genetic networks provide new mechanistic insights into the diversity of species morphology. In this study, we have integrated the MGI, GEO, and miRNA database to analyze the genetic regulatory networks under morphology difference of integument of humans and mice. We found that the gene expression network in the skin is highly divergent between human and mouse.
    [Show full text]
  • WO 2015/149034 A2 1 October 2015 (01.10.2015) P O P C T
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2015/149034 A2 1 October 2015 (01.10.2015) P O P C T (51) International Patent Classification: (71) Applicant: LIFE TECHNOLOGIES CORPORATION C12Q 1/68 (2006.01) [US/US]; c/o IP Legal Department Docketing, 5791 Van Allen Way, Carlsbad, California 92008 (US). (21) International Application Number: PCT/US2015/023 197 (72) Inventors: RHODES, Daniel; Life Technologies Corpora tion, c/o IP Legal Department Docketing, 579 1 Van Allen (22) International Filing Date: Way, Carlsbad, California 92008 (US). SADIS, Seth; Life 27 March 2015 (27.03.2015) Technologies Corporation, c/o IP Legal Department Dock (25) Filing Language: English eting, 5791 Van Allen Way, Carlsbad, California 92008 (US). WYNGAARD, Peter; Life Technologies Corpora (26) Publication Language: English tion, c/o IP Legal Department Docketing, 579 1 Van Allen (30) Priority Data: Way, Carlsbad, California 92008 (US). KHAZANOV, 61/971,455 27 March 2014 (27.03.2014) US Nikolay; Life Technologies Corporation, c/o IP Legal De 61/993,732 15 May 2014 (15.05.2014) US partment Docketing, 5791 Van Allen Way, Carlsbad, Cali 62/004,727 29 May 2014 (29.05.2014) us fornia 92008 (US). BANDLA, Santhoshi; Life Technolo 62/092,898 17 December 2014 (17. 12.2014) us gies Corporation, c/o IP Legal Department Docketing, 5791 Van Allen Way, Carlsbad, California 92008 (US). [Continued on nextpage] (54) Title: GENE FUSIONS AND GENE VARIANTS ASSOCIATED WITH CANCER (57) Abstract: The disclosure provides gene fusions, gene variants, and novel as RNASeq sociations with disease states, as well as kits, probes, and methods of using the (.bam) same.
    [Show full text]
  • Table S1: Gene Symbol Full Gene Name Entrez Gene ID Refseq A2M
    Table S1: Gene Symbol Full Gene Name Entrez Gene ID RefSeq A2M alpha-2-macroglobulin 2 NM_000014 ABHD15 abhydrolase domain containing 15 116236 NM_198147 ACADVL acyl-Coenzyme A dehydrogenase, very long chain 37 NM_000018 ACSS1 acyl-CoA synthetase short-chain family member 1 84532 NM_032501 ACY3 aspartoacylase (aminocyclase) 3 91703 NM_080658 ADAM33 ADAM metallopeptidase domain 33 80332 NM_153202 AFF2 AF4/FMR2 family, member 2 2334 NM_002025 ALX1 ALX homeobox 1 8092 NM_006982 ANGPTL4 angiopoietin-like 4 51129 NM_001039667 ANKRD20A3 ankyrin repeat domain 20 family, member A3 441425 NM_001012419 ANKRD45 ankyrin repeat domain 45 339416 NM_198493 ANXA1 annexin A1 301 NM_000700 ANXA5 annexin A5 308 NM_001154 APBB1IP amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein 54518 NM_019043 ARAP3 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3 64411 NM_022481 ARF3 ADP-ribosylation factor 3 377 NM_001659 ARF5 ADP-ribosylation factor 5 381 NM_001662 ARHGAP1 Rho GTPase activating protein 1 392 NM_004308 ARHGAP6 Rho GTPase activating protein 6 395 NM_006125 ARHGDIA Rho GDP dissociation inhibitor (GDI) alpha 396 NM_004309 ARMC8 armadillo repeat containing 8 25852 NM_014154 ATP2A2 ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 488 NM_170665 ATP6AP2 ATPase, H+ transporting, lysosomal accessory protein 2 10159 NM_005765 ATP6V1B2 ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2 526 NM_001693 B3GNT8 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 8 374907 NM_198540 B4GALNT1 beta-1,4-N-acetyl-galactosaminyl
    [Show full text]
  • Single-Cell Transcriptome Analysis Reveals Mesenchymal Stem Cells In
    bioRxiv preprint doi: https://doi.org/10.1101/2021.09.02.458742; this version posted September 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Single-cell transcriptome analysis reveals mesenchymal stem cells 2 in cavernous hemangioma 3 Fulong Ji1$, Yong Liu2$, Jinsong Shi3$, Chunxiang Liu1, Siqi Fu1 4 Heng Wang1, Bingbing Ren1, Dong Mi4, Shan Gao2*, Daqing Sun1* 5 1 Department of Paediatric Surgery, Tianjin Medical University General Hospital, Tianjin 300052, P.R. China. 6 China. 7 2 College of Life Sciences, Nankai University, Tianjin, Tianjin 300071, P.R. China; 8 3 National Clinical Research Center of Kidney Disease, Jinling Hospital, Nanjing University School of 9 Medicine, Nanjing, Jiangsu 210016, P.R. China; 10 4 School of Mathematical Sciences, Nankai University, Tianjin, Tianjin 300071, P.R. China; 11 12 13 $ These authors contributed equally to this paper. 14 * Corresponding authors. 15 SG：[email protected] 16 DS：[email protected] 17 bioRxiv preprint doi: https://doi.org/10.1101/2021.09.02.458742; this version posted September 3, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 18 Abstract 19 A cavernous hemangioma, well-known as vascular malformation, is present at birth, grows 20 proportionately with the child, and does not undergo regression.
    [Show full text]