SUPPLEMENTARY DATA Index of Contents • Author
Total Page：16
File Type：pdf, Size：1020Kb
Load more
Recommended publications
-
Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Epistasis-Driven Identification of SLC25A51 As a Regulator of Human
ARTICLE https://doi.org/10.1038/s41467-020-19871-x OPEN Epistasis-driven identification of SLC25A51 as a regulator of human mitochondrial NAD import Enrico Girardi 1, Gennaro Agrimi 2, Ulrich Goldmann 1, Giuseppe Fiume1, Sabrina Lindinger1, Vitaly Sedlyarov1, Ismet Srndic1, Bettina Gürtl1, Benedikt Agerer 1, Felix Kartnig1, Pasquale Scarcia 2, Maria Antonietta Di Noia2, Eva Liñeiro1, Manuele Rebsamen1, Tabea Wiedmer 1, Andreas Bergthaler1, ✉ Luigi Palmieri2,3 & Giulio Superti-Furga 1,4 1234567890():,; About a thousand genes in the human genome encode for membrane transporters. Among these, several solute carrier proteins (SLCs), representing the largest group of transporters, are still orphan and lack functional characterization. We reasoned that assessing genetic interactions among SLCs may be an efficient way to obtain functional information allowing their deorphanization. Here we describe a network of strong genetic interactions indicating a contribution to mitochondrial respiration and redox metabolism for SLC25A51/MCART1, an uncharacterized member of the SLC25 family of transporters. Through a combination of metabolomics, genomics and genetics approaches, we demonstrate a role for SLC25A51 as enabler of mitochondrial import of NAD, showcasing the potential of genetic interaction- driven functional gene deorphanization. 1 CeMM Research Center for Molecular Medicine of the Austrian Academy of Sciences, Vienna, Austria. 2 Laboratory of Biochemistry and Molecular Biology, Department of Biosciences, Biotechnologies and Biopharmaceutics, -
Genome-Scale Single-Cell Mechanical Phenotyping Reveals Disease-Related Genes Involved in Mitotic Rounding
ARTICLE DOI: 10.1038/s41467-017-01147-6 OPEN Genome-scale single-cell mechanical phenotyping reveals disease-related genes involved in mitotic rounding Yusuke Toyoda 1,2, Cedric J. Cattin3, Martin P. Stewart 3,4,5, Ina Poser1, Mirko Theis6, Teymuras V. Kurzchalia1, Frank Buchholz1,6, Anthony A. Hyman1 & Daniel J. Müller 3 To divide, most animal cells drastically change shape and round up against extracellular confinement. Mitotic cells facilitate this process by generating intracellular pressure, which the contractile actomyosin cortex directs into shape. Here, we introduce a genome-scale microcantilever- and RNAi-based approach to phenotype the contribution of > 1000 genes to the rounding of single mitotic cells against confinement. Our screen analyzes the rounding force, pressure and volume of mitotic cells and localizes selected proteins. We identify 49 genes relevant for mitotic rounding, a large portion of which have not previously been linked to mitosis or cell mechanics. Among these, depleting the endoplasmic reticulum-localized protein FAM134A impairs mitotic progression by affecting metaphase plate alignment and pressure generation by delocalizing cortical myosin II. Furthermore, silencing the DJ-1 gene uncovers a link between mitochondria-associated Parkinson’s disease and mitotic pressure. We conclude that mechanical phenotyping is a powerful approach to study the mechanisms governing cell shape. 1 Max Planck Institute of Molecular Cell Biology and Genetics, Pfotenhauerstrasse 108, 01307 Dresden, Germany. 2 Division of Cell Biology, Life Science Institute, Kurume University, Hyakunen-Kohen 1-1, Kurume, Fukuoka 839-0864, Japan. 3 Department of Biosystems Science and Engineering (D-BSSE), Eidgenössische Technische Hochschule (ETH) Zurich, Mattenstrasse 26, 4058 Basel, Switzerland. -
Frontiersin.Org 1 April 2015 | Volume 9 | Article 123 Saunders Et Al
ORIGINAL RESEARCH published: 28 April 2015 doi: 10.3389/fnins.2015.00123 Influx mechanisms in the embryonic and adult rat choroid plexus: a transcriptome study Norman R. Saunders 1*, Katarzyna M. Dziegielewska 1, Kjeld Møllgård 2, Mark D. Habgood 1, Matthew J. Wakefield 3, Helen Lindsay 4, Nathalie Stratzielle 5, Jean-Francois Ghersi-Egea 5 and Shane A. Liddelow 1, 6 1 Department of Pharmacology and Therapeutics, University of Melbourne, Parkville, VIC, Australia, 2 Department of Cellular and Molecular Medicine, University of Copenhagen, Copenhagen, Denmark, 3 Walter and Eliza Hall Institute of Medical Research, Parkville, VIC, Australia, 4 Institute of Molecular Life Sciences, University of Zurich, Zurich, Switzerland, 5 Lyon Neuroscience Research Center, INSERM U1028, Centre National de la Recherche Scientifique UMR5292, Université Lyon 1, Lyon, France, 6 Department of Neurobiology, Stanford University, Stanford, CA, USA The transcriptome of embryonic and adult rat lateral ventricular choroid plexus, using a combination of RNA-Sequencing and microarray data, was analyzed by functional groups of influx transporters, particularly solute carrier (SLC) transporters. RNA-Seq Edited by: Joana A. Palha, was performed at embryonic day (E) 15 and adult with additional data obtained at University of Minho, Portugal intermediate ages from microarray analysis. The largest represented functional group Reviewed by: in the embryo was amino acid transporters (twelve) with expression levels 2–98 times Fernanda Marques, University of Minho, Portugal greater than in the adult. In contrast, in the adult only six amino acid transporters Hanspeter Herzel, were up-regulated compared to the embryo and at more modest enrichment levels Humboldt University, Germany (<5-fold enrichment above E15). -
Supplementary Information – Postema Et Al., the Genetics of Situs Inversus Totalis Without Primary Ciliary Dyskinesia
1 Supplementary information – Postema et al., The genetics of situs inversus totalis without primary ciliary dyskinesia Table of Contents: Supplementary Methods 2 Supplementary Results 5 Supplementary References 6 Supplementary Tables and Figures Table S1. Subject characteristics 9 Table S2. Inbreeding coefficients per subject 10 Figure S1. Multidimensional scaling to capture overall genomic diversity 11 among the 30 study samples Table S3. Significantly enriched gene-sets under a recessive mutation model 12 Table S4. Broader list of candidate genes, and the sources that led to their 13 inclusion Table S5. Potential recessive and X-linked mutations in the unsolved cases 15 Table S6. Potential mutations in the unsolved cases, dominant model 22 2 1.0 Supplementary Methods 1.1 Participants Fifteen people with radiologically documented SIT, including nine without PCD and six with Kartagener syndrome, and 15 healthy controls matched for age, sex, education and handedness, were recruited from Ghent University Hospital and Middelheim Hospital Antwerp. Details about the recruitment and selection procedure have been described elsewhere (1). Briefly, among the 15 people with radiologically documented SIT, those who had symptoms reminiscent of PCD, or who were formally diagnosed with PCD according to their medical record, were categorized as having Kartagener syndrome. Those who had no reported symptoms or formal diagnosis of PCD were assigned to the non-PCD SIT group. Handedness was assessed using the Edinburgh Handedness Inventory (EHI) (2). Tables 1 and S1 give overviews of the participants and their characteristics. Note that one non-PCD SIT subject reported being forced to switch from left- to right-handedness in childhood, in which case five out of nine of the non-PCD SIT cases are naturally left-handed (Table 1, Table S1). -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) -
Antagonistic Epistasis of Hnf4α and Foxo1 Networks Through Enhancer Interactions
bioRxiv preprint doi: https://doi.org/10.1101/2020.07.04.187864; this version posted July 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Kuo et al, Hnf4a and FoxO1 in b-cell function Antagonistic epistasis of Hnf4α and FoxO1 networks through enhancer interactions in β-cell function Taiyi Kuo1,3,*, Wen Du1, Yasutaka Miyachi1, Prasanna K. Dadi2, David A. Jacobson2, Domenico Accili1 1Department of Medicine and Berrie Diabetes Center, Columbia University College of Physicians and Surgeons, New York, NY 2Department of Molecular Physiology and Biophysics, Vanderbilt University, Nashville, TN 3Lead Contact *Correspondence: Taiyi Kuo, Department of Medicine and Berrie Diabetes Center, Columbia University College of Physicians and Surgeons, 1150 St. Nicholas Avenue, Room 237, New York, New York 10032, USA. Phone: 1-212-851-5333. Email: [email protected]. 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.04.187864; this version posted July 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Kuo et al, Hnf4a and FoxO1 in b-cell function Abstract Genetic and acquired abnormalities contribute to pancreatic β-cell failure in diabetes. Transcription factors Hnf4α (MODY1) and FoxO1 are respective examples of these two components, and are known to act through β-cell-specific enhancers. -
Supporting Information
Supporting Information Table S1. List of confirmed SLC transporters represented in Canine GeneChip. SLC family Members detected Members not detected SLC1: The high affinity glutamate and neutral amino acid SLC1A1 SLC1A2, SLC1A3, SLC1A6 transporter family SLC2: The facilitative GLUT transporter family SLC2A1, SLC2A8 SLC2A3, SLC2A9 SLC3: The heavy subunits of the heteromeric amino acid SLC3A1 transporters SLC4: The bicarbonate transporter family SLC4A11 SLC4A4, SLC4A8 SLC5: The sodium glucose cotransporter family SLC5A6 SLC5A3, SLC5A10, SLC5A12 SLC6: The sodium- and chloride- dependent SLC6A6, SLC6A12 SLCA18 neurotransmitter transporter family SLC7: The cationic amino acid transporter/glycoprotein- NR associated family SLC8: The Na+/Ca2+ exchanger family SLC8A1 SLC9: The Na+/H+ exchanger family SLC9A1, SLC9A6, SLC9A9 SLC10: The sodium bile salt cotransport family SLC10A2 SLC11: The proton coupled metal ion transporter family NR SLC12: The electroneutral cation-Cl cotransporter family SLC12A3, SLC12A6, SLC12A8 SLC13: The human Na+-sulfate/carboxylate cotransporter SLC13A2 family SLC14: The urea transporter family NR SLC15: The proton oligopeptide cotransporter family SLC15A2, SLC15A4 SLC15A1 SLC16: The monocarboxylate transporter family SLC16A13 SLC16A4 SLC17: The vesicular glutamate transporter family SLC17A3, SLC17A7 SLC18: The vesicular amine transporter family NR SLC19: The folate/thiamine transporter family NR SLC20: The type III Na+-phosphate cotransporter family NR SLC21/SLCO: The organic anion transporting family SLC21A3, SLC21A8, -
Regulation of Gene Expression Dynamics During Developmental Transitions by the Ikaros Transcription Factor
Downloaded from genesdev.cshlp.org on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Regulation of gene expression dynamics during developmental transitions by the Ikaros transcription factor Teresita L. Arenzana,1 Hilde Schjerven,2 and Stephen T. Smale1 1Department of Microbiology, Immunology, and Molecular Genetics, University of California at Los Angeles, Los Angeles, California 90095, USA; 2Department of Laboratory Medicine, University of California at San Francisco, San Francisco, California 94143, USA The DNA-binding protein Ikaros is a potent tumor suppressor and hematopoietic regulator. However, the mecha- nisms by which Ikaros functions remain poorly understood, due in part to its atypical DNA-binding properties and partnership with the poorly understood Mi-2/NuRD complex. In this study, we analyzed five sequential stages of thymocyte development in a mouse strain containing a targeted deletion of Ikaros zinc finger 4, which exhibits a select subset of abnormalities observed in Ikaros-null mice. By examining thymopoiesis in vivo and in vitro, diverse abnormalities were observed at each developmental stage. RNA sequencing revealed that each stage is characterized by the misregulation of a limited number of genes, with a strong preference for stage-specific rather than lineage- specific genes. Strikingly, individual genes rarely exhibited Ikaros dependence at all stages. Instead, a consistent feature of the aberrantly expressed genes was a reduced magnitude of expression level change during developmental transitions. These results, combined with analyses of the interplay between Ikaros loss of function and Notch sig- naling, suggest that Ikaros may not be a conventional activator or repressor of defined sets of genes. -
Transdifferentiation of Human Mesenchymal Stem Cells
Transdifferentiation of Human Mesenchymal Stem Cells Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Julius-Maximilians-Universität Würzburg vorgelegt von Tatjana Schilling aus San Miguel de Tucuman, Argentinien Würzburg, 2007 Eingereicht am: Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Martin J. Müller Gutachter: PD Dr. Norbert Schütze Gutachter: Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am: Hiermit erkläre ich ehrenwörtlich, dass ich die vorliegende Dissertation selbstständig angefertigt und keine anderen als die von mir angegebenen Hilfsmittel und Quellen verwendet habe. Des Weiteren erkläre ich, dass diese Arbeit weder in gleicher noch in ähnlicher Form in einem Prüfungsverfahren vorgelegen hat und ich noch keinen Promotionsversuch unternommen habe. Gerbrunn, 4. Mai 2007 Tatjana Schilling Table of contents i Table of contents 1 Summary ........................................................................................................................ 1 1.1 Summary.................................................................................................................... 1 1.2 Zusammenfassung..................................................................................................... 2 2 Introduction.................................................................................................................... 4 2.1 Osteoporosis and the fatty degeneration of the bone marrow..................................... 4 2.2 Adipose and bone