DOCSLIB.ORG

Volume 18 - Number 10 October 2014

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Volume 18 - Number 10 October 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Volume 18 - Number 10 October 2014 The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Scope The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences. Editorial correspondance Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected] Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director (Gustave Roussy Institute – Villejuif – France). The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008. The Atlas is hosted by INIST-CNRS (http://www.inist.fr) http://AtlasGeneticsOncology.org © ATLAS - ISSN 1768-3262 The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Editor Jean-Loup Huret (Poitiers, France) Editorial Board Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections Adriana Zamecnikova (Kuwait) Leukaemia Section Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Volume 18, Number 10, October 2014 Table of contents Gene Section BAG3 (Bcl-2 associated athanogene 3) 704 Morena d'Avenia, Luana Guerriero, Alessandra Rosati, Maria Caterina Turco CADM4 (cell adhesion molecule 4) 709 Takeshi Ito, Yoshinori Murakami GRPR (Gastrin-Releasing Peptide Receptor) 711 Terry W Moody GUCY2C (guanylate cyclase 2C (heat stable enterotoxin receptor)) 715 Erik S Blomain, Scott A Waldman MIR135A1 (microRNA 135a-1) 718 Alfons Navarro, Marina Díaz-Beyá, Mariano Monzó MIR143 (MicroRNA 143) 724 Ava Kwong, Vivian Y Shin, John C W Ho POU1F1 (POU class 1 homeobox 1) 728 Jean-Louis Franc, Denis Becquet, Anne-Marie François-Bellan RAD52 (RAD52 homolog (S. cerevisiae)) 731 Benjamin H Lok, Simon N Powell TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) 737 Vadakke Peringode Sivadas, S Kannan IL1RN (interleukin 1 receptor antagonist) 746 Liliana Gómez-Flores-Ramos, Jorge Torres-Flores, Martha Patricia Gallegos-Arreola Leukaemia Section t(10;17)(p15;q21) ZMYND11/MBTD1 754 Etienne De Braekeleer, Nathalie Douet-Guilbert, Audrey Basinko, Marie-Josée Le Bris, Frédéric Morel, Marc De Braekeleer t(9;12)(p24;p13) ETV6/JAK2 757 Jean-Loup Huret t(9;9)(p13;p24) PAX5/JAK2 760 Jean-Loup Huret Deep Insight Section Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) 763 Peter C McKeown Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST -CNRS Case Report Section AML with t(7;21)(p22;q22) and 5q abnormality, a case report 784 Jianling Ji, Eric Loo, Carlos A Tirado Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) Atlas of Genetics and Cytogenetics in Oncology and Haematology INIST -CNRS OPEN ACCESS JOURNAL Gene Section Review BAG3 (Bcl-2 associated athanogene 3) Morena d'Avenia, Luana Guerriero, Alessandra Rosati, Maria Caterina Turco Department of Pharmaceutical and Biomedical Sciences (FARMABIOMED), University of Salerno, Fisciano (SA), Italy (MdA, LG, AR, MCT) Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/BAG3ID43160ch10q26.html DOI: 10.4267/2042/54128 This article is an update of : Leone A, Rosati A, Ammirante M, Turco MC. BAG3 (Bcl-2 associated athanogene 3). Atlas Genet Cytogenet Oncol Haematol 2008;12(2):87-88. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology organization and autophagy, thereby mediating cell Abstract adaptive responses to stressful stimuli. In normal Bcl2-associated athanogene 3 (BAG3) protein is a cells, BAG3 is constitutively present in a very few member of BAG family of co-chaperones that cell types, including cardiomyocytes and skeletal interacts with the ATPase domain of the heat shock muscle cells, in which the protein appears to protein (Hsp) 70 through BAG domain. BAG3 is contribute to cell resistance to mechanical stress. induced by stressful stimuli, mainly through the BAG3 is expressed also in several tumor types activity of heat shock factor 1 on bag3 gene where it sustains cell survival, resistance to therapy, promoter. and/or motility and metastatization (Rosati et al., In addition to the BAG domain, BAG3 contains 2011). also a WW domain and a proline-rich (PXXP) repeat, that mediate binding to partners different Identity from Hsp70. Other names: BAG-3, BIS, CAIR-1, MFM6 These multifaceted interactions underlie BAG3 ability to modulate major biological processes, that HGNC (Hugo): BAG3 is, apoptosis, development, cytoskeleton Location: 10q26.11 Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 704 BAG3 (Bcl-2 associated athanogene 3) d'Avenia M, et al. Green: gene; blue: transcript mRNA; red: coding sequence; black: exons. evolutionary
Load more

Recommended publications
  • AVILA-DISSERTATION.Pdf
    LOGOS EX MACHINA: A REASONED APPROACH TOWARD CANCER by Andrew Avila, B. S., M. S. A Dissertation In Biological Sciences Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved Lauren Gollahon Chairperson of the Committee Rich Strauss Sean Rice Boyd Butler Richard Watson Peggy Gordon Miller Dean of the Graduate School May, 2012 c 2012, Andrew Avila Texas Tech University, Andrew Avila, May 2012 ACKNOWLEDGEMENTS I wish to acknowledge the incredible support given to me by my major adviser, Dr. Lauren Gollahon. Without your guidance surely I would not have made it as far as I have. Furthermore, the intellectual exchange I have shared with my advisory committee these long years have propelled me to new heights of inquiry I had not dreamed of even in the most lucid of my imaginings. That their continual intellectual challenges have provoked and evoked a subtle sense of natural wisdom is an ode to their efficacy in guiding the aspirant to the well of knowledge. For this initiation into the mysteries of nature I cannot thank my advisory committee enough. I also wish to thank the Vice President of Research for the fellowship which sustained the initial couple years of my residency at Texas Tech. Furthermore, my appreciation of the support provided to me by the Biology Department, financial and otherwise, cannot be understated. Finally, I also wish to acknowledge the individuals working at the High Performance Computing Center, without your tireless support in maintaining the cluster I would have not have completed the sheer amount of research that I have.
    [Show full text]
  • Supplementary Materials For
    www.sciencemag.org/cgi/content/full/science.1230422/DC1 Supplementary Materials for Genomic Diversity and Evolution of the Head Crest in the Rock Pigeon Michael D. Shapiro,* Zev Kronenberg, Cai Li, Eric T. Domyan, Hailin Pan, Michael Campbell, Hao Tan, Chad D. Huff, Haofu Hu, Anna I. Vickrey, Sandra C. A. Nielsen, Sydney A. Stringham, Hao Hu, Eske Willerslev, M. Thomas P. Gilbert, Mark Yandell, Guojie Zhang, Jun Wang* *To whom correspondence should be addressed. E-mail: [email protected] (M.D.S.); [email protected] (J.W.) Published 31 January 2013 on Science Express DOI: 10.1126/science.1230422 This PDF file includes: Materials and Methods Supplementary Text Figs. S1 to S27 Tables S1 to S28 References (26–72) Materials and Methods Genome assembly The DNA sample for sequencing of the reference genome was extracted from blood obtained from a single, male Danish Tumbler, bred by Anders and Hans Ove Christiansen (Danmarks Racedueforeninger, Næstved, Denmark). This breed was chosen because it is an old breed that is believed to have changed little in recent history. Seven paired-end sequencing libraries were constructed, with insert sizes of 170 bp, 500 bp, 800 bp, 2 kb, 5 kb, 10 kb and 20 kb. The libraries were sequenced using Illumina HiSeq2000 platform, yielding a total of 127.17 Gb raw data (Table S1). The raw sequences were filtered for low quality, adapter sequence, paired-end read overlap, and PCR duplicates. We also performed an error correction step on the raw reads before assembling. Filtering and error correction resulted in 81.57 Gb of clean data for genome assembly with the genome with SOAPdenovo (26).
    [Show full text]
  • Epigenetics Page 1
    Epigenetics esiRNA ID Gene Name Gene Description Ensembl ID HU-13237-1 ACTL6A actin-like 6A ENSG00000136518 HU-13925-1 ACTL6B actin-like 6B ENSG00000077080 HU-14457-1 ACTR1A ARP1 actin-related protein 1 homolog A, centractin alpha (yeast) ENSG00000138107 HU-10579-1 ACTR2 ARP2 actin-related protein 2 homolog (yeast) ENSG00000138071 HU-10837-1 ACTR3 ARP3 actin-related protein 3 homolog (yeast) ENSG00000115091 HU-09776-1 ACTR5 ARP5 actin-related protein 5 homolog (yeast) ENSG00000101442 HU-00773-1 ACTR6 ARP6 actin-related protein 6 homolog (yeast) ENSG00000075089 HU-07176-1 ACTR8 ARP8 actin-related protein 8 homolog (yeast) ENSG00000113812 HU-09411-1 AHCTF1 AT hook containing transcription factor 1 ENSG00000153207 HU-15150-1 AIRE autoimmune regulator ENSG00000160224 HU-12332-1 AKAP1 A kinase (PRKA) anchor protein 1 ENSG00000121057 HU-04065-1 ALG13 asparagine-linked glycosylation 13 homolog (S. cerevisiae) ENSG00000101901 HU-13552-1 ALKBH1 alkB, alkylation repair homolog 1 (E. coli) ENSG00000100601 HU-06662-1 ARID1A AT rich interactive domain 1A (SWI-like) ENSG00000117713 HU-12790-1 ARID1B AT rich interactive domain 1B (SWI1-like) ENSG00000049618 HU-09415-1 ARID2 AT rich interactive domain 2 (ARID, RFX-like) ENSG00000189079 HU-03890-1 ARID3A AT rich interactive domain 3A (BRIGHT-like) ENSG00000116017 HU-14677-1 ARID3B AT rich interactive domain 3B (BRIGHT-like) ENSG00000179361 HU-14203-1 ARID3C AT rich interactive domain 3C (BRIGHT-like) ENSG00000205143 HU-09104-1 ARID4A AT rich interactive domain 4A (RBP1-like) ENSG00000032219 HU-12512-1 ARID4B AT rich interactive domain 4B (RBP1-like) ENSG00000054267 HU-12520-1 ARID5A AT rich interactive domain 5A (MRF1-like) ENSG00000196843 HU-06595-1 ARID5B AT rich interactive domain 5B (MRF1-like) ENSG00000150347 HU-00556-1 ASF1A ASF1 anti-silencing function 1 homolog A (S.
    [Show full text]
  • Essential Genes and Their Role in Autism Spectrum Disorder
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality.
    [Show full text]
  • Noelia Díaz Blanco
    Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Supplementary Materials and Tables a and B
    SUPPLEMENTARY MATERIAL 1 Table A. Main characteristics of the subset of 23 AML patients studied by high-density arrays (subset A) WBC BM blasts MYST3- MLL Age/Gender WHO / FAB subtype Karyotype FLT3-ITD NPM status (x109/L) (%) CREBBP status 1 51 / F M4 NA 21 78 + - G A 2 28 / M M4 t(8;16)(p11;p13) 8 92 + - G G 3 53 / F M4 t(8;16)(p11;p13) 27 96 + NA G NA 4 24 / M PML-RARα / M3 t(15;17) 5 90 - - G G 5 52 / M PML-RARα / M3 t(15;17) 1.5 75 - - G G 6 31 / F PML-RARα / M3 t(15;17) 3.2 89 - - G G 7 23 / M RUNX1-RUNX1T1 / M2 t(8;21) 38 34 - + ND G 8 52 / M RUNX1-RUNX1T1 / M2 t(8;21) 8 68 - - ND G 9 40 / M RUNX1-RUNX1T1 / M2 t(8;21) 5.1 54 - - ND G 10 63 / M CBFβ-MYH11 / M4 inv(16) 297 80 - - ND G 11 63 / M CBFβ-MYH11 / M4 inv(16) 7 74 - - ND G 12 59 / M CBFβ-MYH11 / M0 t(16;16) 108 94 - - ND G 13 41 / F MLLT3-MLL / M5 t(9;11) 51 90 - + G R 14 38 / F M5 46, XX 36 79 - + G G 15 76 / M M4 46 XY, der(10) 21 90 - - G NA 16 59 / M M4 NA 29 59 - - M G 17 26 / M M5 46, XY 295 92 - + G G 18 62 / F M5 NA 67 88 - + M A 19 47 / F M5 del(11q23) 17 78 - + M G 20 50 / F M5 46, XX 61 59 - + M G 21 28 / F M5 46, XX 132 90 - + G G 22 30 / F AML-MD / M5 46, XX 6 79 - + M G 23 64 / M AML-MD / M1 46, XY 17 83 - + M G WBC: white blood cell.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Supplemental Figure 1 Characterization of Lung Tumors In
    Supplemental Figure 1 Characterization of lung tumors in KC mice. (A) Scatter plots of visible spontaneous tumors counted on the lung surfaces at necropsy. Each dot represents a value from a single mouse, and the bars and whiskers show the mean SD for each cohort from a single experiment. P value, two-tailed Student’s t-test. (B) Histologic analysis of spontaneous lung tumors in (A). Results indicate the numbers of lung lesions per histologic subtype per genotype. N, cohort sample sizes. P values, Fisher's exact test. Supplemental Figure 2 Surfactant protein C (SPC) expression in p21-deficient (KC) and –replete (K) tumor cell lines. Immunofluorescence staining with anti-surfactant protein C antibody (green) or normal IgG as a negative control. DAPI, blue. SPC/DAPI and IgG/DAPI are merged images. Scale bar, 20 µm. Supplemental Figure 3 Somatic recombination of latent KrasG12D allele and detection of p21 protein in p21-deficient (KC) and –replete (K) tumor cell lines. (A) PCR analysis of the K-rasLA1 and K-rasWT alleles in genomic DNA. Somatic recombination of the K-rasLA1 allele leads to loss of the PCR product (upper band, arrow). Wild-type K-ras allele detected (250 bp). Tail DNAs from KrasLA1 mice (KrasLA1/+) and wild-type mice (Kras+/+) were used as positive and negative controls, respectively, for the presence of the germline K-rasLA1 allele. (B) Immunoblot analysis of p21 expression. Actin was used as a loading control. Supplemental Figure 4 Growth and metastasis of p21-deficient (KC) tumor cell lines in Cdkn1a-null or –wild-type mice.
    [Show full text]
  • Assessment of Copy Number Variations in 120 Patients with Poland
    Vaccari et al. BMC Medical Genetics (2016) 17:89 DOI 10.1186/s12881-016-0351-x RESEARCHARTICLE Open Access Assessment of copy number variations in 120 patients with Poland syndrome Carlotta Maria Vaccari1, Elisa Tassano2, Michele Torre3, Stefania Gimelli4, Maria Teresa Divizia2, Maria Victoria Romanini5, Simone Bossi1, Ilaria Musante1, Maura Valle6, Filippo Senes7, Nunzio Catena7, Maria Francesca Bedeschi8, Anwar Baban2,10, Maria Grazia Calevo9, Massimo Acquaviva1, Margherita Lerone2, Roberto Ravazzolo1,2 and Aldamaria Puliti1,2* Abstract Background: Poland Syndrome (PS) is a rare congenital disorder presenting with agenesis/hypoplasia of the pectoralis major muscle variably associated with thoracic and/or upper limb anomalies. Most cases are sporadic, but familial recurrence, with different inheritance patterns, has been observed. The genetic etiology of PS remains unknown. Karyotyping and array-comparative genomic hybridization (CGH) analyses can identify genomic imbalances that can clarify the genetic etiology of congenital and neurodevelopmental disorders. We previously reported a chromosome 11 deletion in twin girls with pectoralis muscle hypoplasia and skeletal anomalies, and a chromosome six deletion in a patient presenting a complex phenotype that included pectoralis muscle hypoplasia. However, the contribution of genomic imbalances to PS remains largely unknown. Methods: To investigate the prevalence of chromosomal imbalances in PS, standard cytogenetic and array-CGH analyses were performed in 120 PS patients. Results: Following the application of stringent filter criteria, 14 rare copy number variations (CNVs) were identified in 14 PS patients in different regions outside known common copy number variations: seven genomic duplications and seven genomic deletions, enclosing the two previously reported PS associated chromosomal deletions. These CNVs ranged from 0.04 to 4.71 Mb in size.
    [Show full text]
  • TIF-IA: an Oncogenic Target of Pre-Ribosomal RNA Synthesis Rui Jin, Emory University Wei Zhou, Emory University
    TIF-IA: An oncogenic target of pre-ribosomal RNA synthesis Rui Jin, Emory University Wei Zhou, Emory University Journal Title: Biochimica et Biophysica Acta Molecular and Cell Biology of Lipids Volume: Volume 1866, Number 2 Publisher: Elsevier: 12 months | 2016-12-01, Pages 189-196 Type of Work: Article | Post-print: After Peer Review Publisher DOI: 10.1016/j.bbcan.2016.09.003 Permanent URL: https://pid.emory.edu/ark:/25593/s6qwz Final published version: http://dx.doi.org/10.1016/j.bbcan.2016.09.003 Copyright information: © 2016 Elsevier B.V. All rights reserved. Accessed September 30, 2021 12:20 AM EDT HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Biochim Manuscript Author Biophys Acta. Manuscript Author Author manuscript; available in PMC 2017 December 01. Published in final edited form as: Biochim Biophys Acta. 2016 December ; 1866(2): 189–196. doi:10.1016/j.bbcan.2016.09.003. TIF-IA: an oncogenic target of pre-ribosomal RNA synthesis Rui Jin1 and Wei Zhou1,2,* 1Department of Hematology and Medical Oncology, The Winship Cancer Institute of Emory University, Atlanta, GA 30322, USA 2Department of Pathology and Laboratory Medicine and Department of Human Genetics Emory University School of Medicine, Atlanta, GA, USA Abstract Cancer cells devote the majority of their energy consumption to ribosome biogenesis, and pre- ribosomal RNA transcription accounts for 30–50% of all transcriptional activity. This aberrantly elevated biological activity is an attractive target for cancer therapeutic intervention if approaches can be developed to circumvent the development of side effects in normal cells. TIF-IA is a transcription factor that connects RNA polymerase I with the UBF/SL-1 complex to initiate the transcription of pre-ribosomal RNA.
    [Show full text]