Volume 18 - Number 10 October 2014

Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

The PDF version of the Atlas of Genetics and Cytogenetics in Oncology and Haematology is a reissue of the original articles published in collaboration with the Institute for Scientific and Technical Information (INstitut de l’Information Scientifique et Technique - INIST) of the French National Center for Scientific Research (CNRS) on its electronic publishing platform I-Revues. Online and PDF versions of the Atlas of Genetics and Cytogenetics in Oncology and Haematology are hosted by INIST-CNRS. Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Scope

The Atlas of Genetics and Cytogenetics in Oncology and Haematology is a peer reviewed on-line journal in open access, devoted to genes, cytogenetics, and clinical entities in cancer, and cancer-prone diseases. It presents structured review articles (“cards”) on genes, leukaemias, solid tumours, cancer-prone diseases, and also more traditional review articles (“deep insights”) on the above subjects and on surrounding topics. It also present case reports in hematology and educational items in the various related topics for students in Medicine and in Sciences.

Editorial correspondance

Jean-Loup Huret Genetics, Department of Medical Information, University Hospital F-86021 Poitiers, France tel +33 5 49 44 45 46 or +33 5 49 45 47 67 [email protected] or [email protected]

Staff Mohammad Ahmad, Mélanie Arsaban, Marie-Christine Jacquemot-Perbal, Vanessa Le Berre, Anne Malo, Carol Moreau, Catherine Morel-Pair, Laurent Rassinoux, Alain Zasadzinski. Philippe Dessen is the Database Director (Gustave Roussy Institute – Villejuif – France).

The Atlas of Genetics and Cytogenetics in Oncology and Haematology (ISSN 1768-3262) is published 12 times a year by ARMGHM, a non profit organisation, and by the INstitute for Scientific and Technical Information of the French National Center for Scientific Research (INIST-CNRS) since 2008.

The Atlas is hosted by INIST-CNRS (http://www.inist.fr)

http://AtlasGeneticsOncology.org

OPEN ACCESS JOURNAL INIST -CNRS

Editor Jean-Loup Huret (Poitiers, France) Editorial Board

Sreeparna Banerjee (Ankara, Turkey) Solid Tumours Section Alessandro Beghini (Milan, Italy) Genes Section Anne von Bergh (Rotterdam, The Netherlands) Genes / Leukaemia Sections Judith Bovée (Leiden, The Netherlands) Solid Tumours Section Vasantha Brito-Babapulle (London, UK) Leukaemia Section Charles Buys (Groningen, The Netherlands) Deep Insights Section Anne Marie Capodano (Marseille, France) Solid Tumours Section Fei Chen (Morgantown, West Virginia) Genes / Deep Insights Sections Antonio Cuneo (Ferrara, Italy) Leukaemia Section Paola Dal Cin (Boston, Massachussetts) Genes / Solid Tumours Section Brigitte Debuire (Villejuif, France) Deep Insights Section François Desangles (Paris, France) Leukaemia / Solid Tumours Sections Enric Domingo-Villanueva (London, UK) Solid Tumours Section Ayse Erson (Ankara, Turkey) Solid Tumours Section Richard Gatti (Los Angeles, California) Cancer-Prone Diseases / Deep Insights Sections Ad Geurts van Kessel (Nijmegen, The Netherlands) Cancer-Prone Diseases Section Oskar Haas (Vienna, Austria) Genes / Leukaemia Sections Anne Hagemeijer (Leuven, Belgium) Deep Insights Section Nyla Heerema (Colombus, Ohio) Leukaemia Section Jim Heighway (Liverpool, UK) Genes / Deep Insights Sections Sakari Knuutila (Helsinki, Finland) Deep Insights Section Lidia Larizza (Milano, Italy) Solid Tumours Section Lisa Lee-Jones (Newcastle, UK) Solid Tumours Section Edmond Ma (Hong Kong, China) Leukaemia Section Roderick McLeod (Braunschweig, Germany) Deep Insights / Education Sections Cristina Mecucci (Perugia, Italy) Genes / Leukaemia Sections Fredrik Mertens (Lund, Sweden) Solid Tumours Section Konstantin Miller (Hannover, Germany) Education Section Felix Mitelman (Lund, Sweden) Deep Insights Section Hossain Mossafa (Cergy Pontoise, France) Leukaemia Section Stefan Nagel (Braunschweig, Germany) Deep Insights / Education Sections Florence Pedeutour (Nice, France) Genes / Solid Tumours Sections Elizabeth Petty (Ann Harbor, Michigan) Deep Insights Section Susana Raimondi (Memphis, Tennesse) Genes / Leukaemia Section Mariano Rocchi (Bari, Italy) Genes Section Alain Sarasin (Villejuif, France) Cancer-Prone Diseases Section Albert Schinzel (Schwerzenbach, Switzerland) Education Section Clelia Storlazzi (Bari, Italy) Genes Section Sabine Strehl (Vienna, Austria) Genes / Leukaemia Sections Nancy Uhrhammer (Clermont Ferrand, France) Genes / Cancer-Prone Diseases Sections Dan Van Dyke (Rochester, Minnesota) Education Section Roberta Vanni (Montserrato, Italy) Solid Tumours Section Franck Viguié (Paris, France) Leukaemia Section José Luis Vizmanos (Pamplona, Spain) Leukaemia Section Thomas Wan (Hong Kong, China) Genes / Leukaemia Sections Adriana Zamecnikova (Kuwait) Leukaemia Section

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Volume 18, Number 10, October 2014

Table of contents

Gene Section

BAG3 (Bcl-2 associated athanogene 3) 704 Morena d'Avenia, Luana Guerriero, Alessandra Rosati, Maria Caterina Turco CADM4 (cell adhesion molecule 4) 709 Takeshi Ito, Yoshinori Murakami GRPR (Gastrin-Releasing Peptide Receptor) 711 Terry W Moody GUCY2C (guanylate cyclase 2C (heat stable enterotoxin receptor)) 715 Erik S Blomain, Scott A Waldman MIR135A1 (microRNA 135a-1) 718 Alfons Navarro, Marina Díaz-Beyá, Mariano Monzó MIR143 (MicroRNA 143) 724 Ava Kwong, Vivian Y Shin, John C W Ho POU1F1 (POU class 1 homeobox 1) 728 Jean-Louis Franc, Denis Becquet, Anne-Marie François-Bellan RAD52 (RAD52 homolog (S. cerevisiae)) 731 Benjamin H Lok, Simon N Powell TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) 737 Vadakke Peringode Sivadas, S Kannan IL1RN (interleukin 1 receptor antagonist) 746 Liliana Gómez-Flores-Ramos, Jorge Torres-Flores, Martha Patricia Gallegos-Arreola

Leukaemia Section t(10;17)(p15;q21) ZMYND11/MBTD1 754 Etienne De Braekeleer, Nathalie Douet-Guilbert, Audrey Basinko, Marie-Josée Le Bris, Frédéric Morel, Marc De Braekeleer t(9;12)(p24;p13) ETV6/JAK2 757 Jean-Loup Huret t(9;9)(p13;p24) PAX5/JAK2 760 Jean-Loup Huret

Deep Insight Section

Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) 763 Peter C McKeown

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section

AML with t(7;21)(p22;q22) and 5q abnormality, a case report 784 Jianling Ji, Eric Loo, Carlos A Tirado

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10)

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

BAG3 (Bcl-2 associated athanogene 3) Morena d'Avenia, Luana Guerriero, Alessandra Rosati, Maria Caterina Turco Department of Pharmaceutical and Biomedical Sciences (FARMABIOMED), University of Salerno, Fisciano (SA), Italy (MdA, LG, AR, MCT)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/BAG3ID43160ch10q26.html DOI: 10.4267/2042/54128 This article is an update of : Leone A, Rosati A, Ammirante M, Turco MC. BAG3 (Bcl-2 associated athanogene 3). Atlas Genet Cytogenet Oncol Haematol 2008;12(2):87-88.

organization and autophagy, thereby mediating cell Abstract adaptive responses to stressful stimuli. In normal Bcl2-associated athanogene 3 (BAG3) protein is a cells, BAG3 is constitutively present in a very few member of BAG family of co-chaperones that cell types, including cardiomyocytes and skeletal interacts with the ATPase domain of the heat shock muscle cells, in which the protein appears to protein (Hsp) 70 through BAG domain. BAG3 is contribute to cell resistance to mechanical stress. induced by stressful stimuli, mainly through the BAG3 is expressed also in several tumor types activity of heat shock factor 1 on bag3 gene where it sustains cell survival, resistance to therapy, promoter. and/or motility and metastatization (Rosati et al., In addition to the BAG domain, BAG3 contains 2011). also a WW domain and a proline-rich (PXXP) repeat, that mediate binding to partners different Identity from Hsp70. Other names: BAG-3, BIS, CAIR-1, MFM6 These multifaceted interactions underlie BAG3 ability to modulate major biological processes, that HGNC (Hugo): BAG3 is, apoptosis, development, cytoskeleton Location: 10q26.11

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 704 BAG3 (Bcl-2 associated athanogene 3) d'Avenia M, et al.

Green: gene; blue: transcript mRNA; red: coding sequence; black: exons.

evolutionary conserved family of BAG domain- DNA/RNA containing proteins. Description Expression The gene encompasses 33450 bases, 4 exons. Under physiological conditions, BAG3 expression Transcription appears to be restricted to few cell types including 2608 nucleotides mRNA. skeletal muscle cells and cardiomyocytes (Hishiya et al., 2010; De Marco et al., 2011; De Marco et al., Pseudogene 2013). Chromosome 10: 121442639-121443335 reverse Its expression, however, can be induced in different strand. Name: RP11-179H18.7-001; transcript: normal cell types (leukocytes, epithelial, glial and ENST00000441872. retinal cells) by a variety of stressors, such as Chromosome 10: 121435973-121436791 forward oxidants, high temperature, serum deprivation, and strand. Name: PGOHUM00000238940; parent it is thought to contribute to stress resistance protein: ENSP00000358081; parent gene: (Rosati et al., 2007; Pagliuca et al., 2003; Rosati et ENSG00000151929. al., 2009; Ammirante et al., 2010). In contrast to Variant: OTTHUMT00000050663. Exons: 5. normal cells, BAG3 expression is abundant in Transcript length: 1146 bps. Translation length: 325 several primary tumors or tumor cell lines, where it residues. is thought to give a survival advantage (Rosati et al., 2011). Among those melanoma cells, pancreatic Protein adenocarcinoma cells, colon cancer, liver cancer, T- lynph Jurkat cancer, leukemias, kidney HEK-293, Description Lung A549, prostate cancer LnCap, cervix cancer 575 amino acids. 74 kDa protein, belonging to the Hela, bone cancer U20S, breast cancer cells MCF7.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 705 BAG3 (Bcl-2 associated athanogene 3) d'Avenia M, et al.

Localisation cardiomyopathy and a severe and progressive muscle weakess (Selcen et al., 2009). Non- BAG3 is mainly a cytoplasmatic protein, synonymous BAG3 SNPs or others truncated particularly concentrated in the rough endoplasmic BAG3 forms were reported to correlate with reticulum; a slightly different molecular weight, a familiar dilated cardiomyopathy (Villard et al., doublet form or a nuclear localisation can be 2011) and stress-cardiomyopathy also known as observed in some cell types and/or following cell Takotsubo cardiomyopathy (Citro et al., 2013). exposure to stressors. BAG3 protein is also released Finally, two heterozygous BAG3 gene mutations, from stressed cardiomyocytes and Pancreatic which cause abnormal Z-disc assembly and Adeno Carcinoma cells (PDAC) and can be increased sensitivity to apoptosis in cultured detected in sera of patients with chronic heart cardiomyocytes, were identified in patients with failure (HF) or PDAC (De Marco et al., 2013; Falco familial DCM (Arimura et al., 2011). et al., 2013), as well as in cells surnatants. Function Implicated in Through its BAG domain, BAG3 protein binds with high affinity to the ATPase domain of Hsc70 and B-chronic lymphocytic leukaemia regulates its chaperone activity in a Hip-modulated Disease manner; through its PXXP region, BAG3 binds to Expression of BAG3 gene in leukaemic cell the SH3 domain of PLC-gamma and forms an samples from a study on 24 B-CLL-affected epidermal growth factor (EGF)-regulated ternary patients was detected by RT-PCR and complex; the proline-rich repeat appears to be immunofluorescence. Downmodulation of its levels involved in regulating cell adhesion and migration, by antisense ODNs resulted in enhancing through an indirect effect on focal adhesion kinase cytochrome c release, caspase 3 activation and (FAK) and its downstream partners; BAG3 appearance of hypodiploid elements in response to knockout mice develop a fulminant myopathy; fludarabine (Romano et al., 2003). downmodulation of BAG3 protein levels enhance Childhood acute lymphoblastic cell apoptotic response to several inducers, while hyperexpression protects cells from apoptosis. leukemia BAG3 levels increase during myoblast Disease differentiation, suggesting that its biological role is Expression of BAG3 gene in leukaemic cell relevant for differentiated myocytes and not for samples from a study on 11 ALL- affected patients immature cells. This is in agreement with the was detected by immunofluorescence. observation that BAG3 deletion causes a lethal Downmodulation of its levels by antisense ODNs cardiomyopathy not in embryos, but in postnatal resulted in stimulating caspase 3 activity and mice. BAG3 mutations may cause abnormal Z-disc enhancing by more than 100% the percentages of assembly and sensitization to apoptosis in cultured apoptotic elements in primary cultures, either cardiomyocytes. More recently it has been shown untreated or incubated with cytosine arabinoside that BAG3 is essential for homeostasis of (Romano et al., 2003). mechanically stressed cells. BAG3 is in fact an Thyroid carcinomas important component of the chaperone-assisted autophagy (CASA) pathway leading to selective Disease lysosomal degradation of unfolded proteins. In BAG3 was expressed in human thyroid carcinoma muscle cells the CASA machinery is located at the cell lines; small interfering RNA-mediated Z-disk and appears to be essential for disposal of downmodulation of its levels significantly unfolded mechano-sensors and cytoskeleton enhanced NPA cell apoptotic response to TRAIL. proteins resulting from mechanical tension. The protein was not detectable in 19 of 20 Impairment of the CASA machinery results in z- specimens of normal thyroid or goiters, whereas 54 disk disruption in contracting muscles (Ulbricht et of 56 analyzed carcinomas (15 follicular al., 2013; Ulbricht and Höhfeld, 2013). carcinomas, 28 papillary carcinomas, and 13 anaplastic carcinomas) were clearly positive for Homology BAG3 expression (Li et al., 2013). Other members of BAG family. Pancreatic adenocarcinomas Mutations Disease BAG3 protein is expressed in PDACs, but is not Note expressed in the surrounding nonneoplastic tissue. Several reports associate BAG3 mutations with Survival is significantly shorter in patients with myopathy. A mutated form of BAG3, i.e. high BAG3 expression than in those with low heterozygous Pro209Leu, causes childhood BAG3 expression. Furthermore, BAG3 expression

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 706 BAG3 (Bcl-2 associated athanogene 3) d'Avenia M, et al.

in PDAC-derived cell lines protects from apoptosis Hishiya A, Kitazawa T, Takayama S. BAG3 and Hsc70 and confers resistance to gemcitabine, offering a interact with actin capping protein CapZ to maintain myofibrillar integrity under mechanical stress. Circ Res. partial explanation for the survival data. Indeed 2010 Nov 12;107(10):1220-31 BAG3 has a relevant role in PDAC biology, and Arimura T, Ishikawa T, Nunoda S, Kawai S, Kimura A. BAG3 expression level might be a potential marker Dilated cardiomyopathy-associated BAG3 mutations impair for prediction of patient outcome (Falco et al., Z-disc assembly and enhance sensitivity to apoptosis in 2013; Rosati et al., 2012). cardiomyocytes. Hum Mutat. 2011 Dec;32(12):1481-91 De Marco M, Turco MC, Rosati A. BAG3 protein is induced Colorectal carcinomas during cardiomyoblast differentiation and modulates Disease myogenin expression. Cell Cycle. 2011 Mar 1;10(5):850-2 Bag3 is distinctly expressed in Colo201, Colo205, Rosati A, Graziano V, De Laurenzi V, Pascale M, Turco DLD-1, HCT-15, HCT-116, HT-29, KM-12, MC. BAG3: a multifaceted protein that regulates major cell SW480, SW620, and WiDr at both mRNA and pathways. Cell Death Dis. 2011 Apr 7;2:e141 protein levels. Villard E, Perret C, Gary F, Proust C, Dilanian G, Carcinoma shows stronger Bag-3 expression than Hengstenberg C, Ruppert V, Arbustini E, Wichter T, adjacent NNM by IHC and Western blot. Metastatic Germain M, Dubourg O, Tavazzi L, Aumont MC, DeGroote P, Fauchier L, Trochu JN, Gibelin P, Aupetit JF, Stark K, carcinoma more frequently expressed Bag-3 mRNA Erdmann J, Hetzer R, Roberts AM, Barton PJ, Regitz- in lymph node and liver than in primary carcinoma. Zagrosek V, Aslam U, Duboscq-Bidot L, Meyborg M, Immunohistochemically, Bag-3 expression is seen Maisch B, Madeira H, Waldenström A, Galve E, Cleland to gradually decrease from carcinoma, adenoma to JG, Dorent R, Roizes G, Zeller T, Blankenberg S, Goodall AH, Cook S, Tregouet DA, Tiret L, Isnard R, Komajda M, NNM. Charron P, Cambien F. A genome-wide association study There is a positive correlation between Bag-3 identifies two loci associated with heart failure due to expression and TNM staging and GRP94 dilated cardiomyopathy. Eur Heart J. 2011 expression, but no relationship to patient age or sex, May;32(9):1065-76 tumor size, depth of invasion, lymphatic or venous Rosati A, Bersani S, Tavano F, Dalla Pozza E, De Marco invasion, lymph node metastasis, differentiation or M, Palmieri M, De Laurenzi V, Franco R, Scognamiglio G, prognosis of colorectal carcinomas. Aberrant Bag-3 Palaia R, Fontana A, di Sebastiano P, Donadelli M, Dando I, Medema JP, Dijk F, Welling L, di Mola FF, Pezzilli R, expression might be involved in colorectal Turco MC, Scarpa A. Expression of the antiapoptotic adenoma-adenocarcinoma sequence and subsequent protein BAG3 is a feature of pancreatic adenocarcinoma progression (Yang et al., 2013). and its overexpression is associated with poorer survival. Am J Pathol. 2012 Nov;181(5):1524-9 Citro R, d'Avenia M, De Marco M, Giudice R, Mirra M, References Ravera A, Silverio A, Farina R, Silvestri F, Gravina P, Villa Pagliuca MG, Lerose R, Cigliano S, Leone A. Regulation F, Puca AA, De Windt L, De Laurenzi V, Bossone E, Turco by heavy metals and temperature of the human BAG-3 MC, Piscione F. Polymorphisms of the antiapoptotic gene, a modulator of Hsp70 activity. FEBS Lett. 2003 Apr protein bag3 may play a role in the pathogenesis of tako- 24;541(1-3):11-5 tsubo cardiomyopathy. Int J Cardiol. 2013 Sep 30;168(2):1663-5 Romano MF, Festa M, Petrella A, Rosati A, Pascale M, Bisogni R, Poggi V, Kohn EC, Venuta S, Turco MC, Leone De Marco M, Falco A, Basile A, Rosati A, Festa M, A. BAG3 protein regulates cell survival in childhood acute d'Avenia M, Pascale M, Dal Piaz F, Bisogni R, Barcaroli D, lymphoblastic leukemia cells. Cancer Biol Ther. 2003 Sep- Coppola G, Piscione F, Gigantino A, Citro R, De Rosa R, Oct;2(5):508-10 Vitulano G, Virtuoso N, Manganelli F, Palermo E, Siano F, Rosato G, Hahne M, Tiberti C, De Laurenzi V, Turco MC. Rosati A, Leone A, Del Valle L, Amini S, Khalili K, Turco Detection of soluble BAG3 and anti-BAG3 antibodies in MC. Evidence for BAG3 modulation of HIV-1 gene patients with chronic heart failure. Cell Death Dis. 2013 transcription. J Cell Physiol. 2007 Mar;210(3):676-83 Feb 14;4:e495 Rosati A, Di Salle E, Luberto L, Quinto I, Scala G, Turco Falco A, Rosati A, Festa M, Basile A, De Marco M, MC, Pascale M. Identification of a Btk-BAG3 complex d'Avenia M, Pascale M, Dal Piaz F, Tavano F, Di Mola FF, induced by oxidative stress. Leukemia. 2009 di Sebastiano P, Berloco PB, Nudo F, Caraglia M, Apr;23(4):823-4 Febbraro A, Barcaroli D, Scarpa A, Pezzilli R, De Laurenzi V, Turco MC. BAG3 is a novel serum biomarker for Selcen D, Muntoni F, Burton BK, Pegoraro E, Sewry C, pancreatic adenocarcinomas. Am J Gastroenterol. 2013 Bite AV, Engel AG. Mutation in BAG3 causes severe Jul;108(7):1178-80 dominant childhood muscular dystrophy. Ann Neurol. 2009 Jan;65(1):83-9 Li N, Du ZX, Zong ZH, Liu BQ, Li C, Zhang Q, Wang HQ. PKC δ-mediated phosphorylation of BAG3 at Ser187 site Ammirante M, Rosati A, Arra C, Basile A, Falco A, Festa induces epithelial-mesenchymal transition and enhances M, Pascale M, d'Avenia M, Marzullo L, Belisario MA, De invasiveness in thyroid cancer FRO cells. Oncogene. 2013 Marco M, Barbieri A, Giudice A, Chiappetta G, Vuttariello Sep 19;32(38):4539-48 E, Monaco M, Bonelli P, Salvatore G, Di Benedetto M, Deshmane SL, Khalili K, Turco MC, Leone A. IKK{gamma} Ulbricht A, Eppler FJ, Tapia VE, van der Ven PF, Hampe protein is a target of BAG3 regulatory activity in human N, Hersch N, Vakeel P, Stadel D, Haas A, Saftig P, tumor growth. Proc Natl Acad Sci U S A. 2010 Apr Behrends C, Fürst DO, Volkmer R, Hoffmann B, Kolanus 20;107(16):7497-502 W, Höhfeld J. Cellular mechanotransduction relies on

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 707 BAG3 (Bcl-2 associated athanogene 3) d'Avenia M, et al.

tension-induced and chaperone-assisted autophagy. Curr pathogenesis and progression of colorectal carcinomas. Biol. 2013 Mar 4;23(5):430-5 Histol Histopathol. 2013 Sep;28(9):1147-56

Ulbricht A, Höhfeld J. Tension-induced autophagy: may the This article should be referenced as such: chaperone be with you. Autophagy. 2013 Jun 1;9(6):920-2 d'Avenia M, Guerriero L, Rosati A, Turco MC. BAG3 (Bcl-2 Yang X, Tian Z, Gou WF, Takahashi H, Yu M, Xing YN, associated athanogene 3). Atlas Genet Cytogenet Oncol Takano Y, Zheng HC. Bag-3 expression is involved in Haematol. 2014; 18(10):704-708.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 708

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

CADM4 (cell adhesion molecule 4) Takeshi Ito, Yoshinori Murakami Division of Molecular Pathology, Institute of Medical Science, The University of Tokyo, Japan (TI, YM)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/CADM4ID46066ch19q13.html DOI: 10.4267/2042/54129 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

transmembrane domain, and a short cytoplasmic Abstract domain with a protein 4.1-binding motif and a PDZ Short communication on CADM4, with data on II-binding motif. DNA/RNA, on the protein encoded and where the The cytoplasmic domain is bound to the actin gene is implicated. cytoskeleton through protein 4.1 such as 4.1B/DAL-1. CADM4 protein is 388 amino acids Identity long and its molecular weight ranges from approximately 50 to 55 kDa dependent on N- Other names: IGSF4C, NECL4, Necl-4, TSLL2, glycosylation in the extracellular domain synCAM4 (deglycosylated form: 45 kDa). HGNC (Hugo): CADM4 Expression Location: 19q13.31 Brain, peripheral nerve, lung, large and small DNA/RNA intestines, kidney, bladder, and prostate. Loss of expression is frequently observed in various Description cancers. DNA contains 17470 bases composed of 9 coding Localisation exons. Cell membrane (type I transmembrane protein); Transcription Cell-cell contact site in epithelial tissues. 2176 bp mRNA transcribed in telomeric to Function centromeric orientation; 1164 bp open reading frame. CADM4 forms homophilic cis-dimers on the cell surface and mediates Ca2 +-independent cell-cell Protein adhesion in a heterophilic manner with CADM2/Necl-3 or CADM3/Necl-1. CADM4 associates with 4.1B in the kidney. Homology Pan troglodytes - CADM4; Canis lupus familiaris - CADM4; Bos taurus - CADM4; Mus musculus - Cadm4; Rattus norvegicus - Cadm4; Danio rerio - cadm4. Description Mutations CADM4 encodes an immunoglobulin (Ig) superfamily cell adhesion molecule containing three Note Ig-like loops in their extracellular domain, a single No reports.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 709 CADM4 (cell adhesion molecule 4) Ito T, Murakami Y

Implicated in Breast cancer (ductal carcinoma) Prognosis Prostate cancer CADM4 expression was higher in ductal carcinoma Oncogenesis in situ cases (82%) than invasive ductal CADM4 protein is lost or markedly reduced in nine adenocarcinoma cases (68%). Loss or reduced of nine primary prostate cancers and two of four expression of CADM4 was significantly correlated prostate cancer cell lines, PPC-1 and Du145, in with higher histological grade, overexpression of comparison with that in normal human prostate. ErbB2 and absence of estrogen and/or progesterone The tumorigenicity of PPC-1 was strongly receptors. CADM4 expression is associated with suppressed by restoration of CADM4 expression longer disease-free survival in stages I and II without inducing significant cell death or growth invasive ductal adenocarcinoma cases. inhibition in vitro, suggesting that the inactivation Oncogenesis of CADM4 would be involved not in the direct cell Loss or reduced expression of CADM4 may play an growth but in the aberrant cell-cell contact in the important role in breast cancer invasiveness. prostate carcinogenesis. Renal clear cell carcinoma References Prognosis Fukuhara H, Kuramochi M, Nobukuni T et al.. Isolation of The expression of CADM4 is lost or markedly the TSLL1 and TSLL2 genes, members of the tumor suppressor TSLC1 gene family encoding transmembrane reduced in 70% of primary renal clear cell proteins. Oncogene. 2001 Aug 30;20(38):5401-7 carcinoma (RCCC), where loss of CADM4 in RCCC correlates with vascular infiltration. Fukami T, Satoh H, Williams YN, Masuda M, Fukuhara H, Maruyama T, Yageta M, Kuramochi M, Takamoto S, Oncogenesis Murakami Y. Isolation of the mouse Tsll1 and Tsll2 genes, CADM4 and its binding partner 4.1B are orthologues of the human TSLC1-like genes 1 and 2 (TSLL1 and TSLL2). Gene. 2003 Dec 24;323:11-8 specifically expressed along the cell membrane in the proximal convoluted tubules, from which Biederer T. Bioinformatic characterization of the SynCAM RCCC is derived. family of immunoglobulin-like domain-containing adhesion molecules. Genomics. 2006 Jan;87(1):139-50 Approximately 80% of primary RCCC showed loss or marked reduction of either CADM4 or 4.1B, Williams YN, Masuda M, Sakurai-Yageta M, Maruyama T, Shibuya M, Murakami Y. Cell adhesion and prostate indicating that disruption of the CADM4-4.1B tumor-suppressor activity of TSLL2/IGSF4C, an cascade is one of the most frequent events in immunoglobulin superfamily molecule homologous to RCCC. TSLC1/IGSF4. Oncogene. 2006 Mar 9;25(10):1446-53 The CADM4 gene in human renal cell carcinoma Spiegel I, Adamsky K, Eshed Y, Milo R, Sabanay H, Sarig- cell 786-O was inactivated by promoter Nadir O, Horresh I, Scherer SS, Rasband MN, Peles E. A methylation, while restoration of CADM4 central role for Necl4 (SynCAM4) in Schwann cell-axon expression strongly suppressed subcutaneous tumor interaction and myelination. Nat Neurosci. 2007 Jul;10(7):861-9 formation in nude mice by 786-O cells. Raveh S, Gavert N, Spiegel I, Ben-Ze'ev A. The cell Colorectal adenocarcinoma adhesion nectin-like molecules (Necl) 1 and 4 suppress Prognosis the growth and tumorigenic ability of colon cancer cells. J Cell Biochem. 2009 Sep 1;108(1):326-36 CADM4 expression is lost or reduced in 23% or 36% of colorectal adenocarcinoma, respectively. Jang SM, Han H, Jun YJ, Jang SH, Min KW, Sim J, Ahn HI, Lee KH, Jang KS, Paik SS. Clinicopathological Loss or down-regulation of CADM4 is correlated significance of CADM4 expression, and its correlation with with larger tumor size, mucinous tumor type, expression of E-cadherin and Ki-67 in colorectal poorer differentiation, lymph node metastasis, and adenocarcinomas. J Clin Pathol. 2012 Oct;65(10):902-6 higher Dukes stage. Nagata M, Sakurai-Yageta M, Yamada D, Goto A, Ito A, Oncogenesis Fukuhara H, Kume H, Morikawa T, Fukayama M, Homma Y, Murakami Y. Aberrations of a cell adhesion molecule Loss or down-regulation of CADM4 expression CADM4 in renal clear cell carcinoma. Int J Cancer. 2012 was positively correlated with low E-cadherin Mar 15;130(6):1329-37 expression and high Ki-67 expression in colorectal Jang SM, Sim J, Han H, Ahn HI, Kim H, Yi K et al.. adenocarcinoma. Clinicopathological significance of CADM4 expression in The restoration of CADM4 expression in LS174T invasive ductal carcinoma of the breast. J Clin Pathol. human colon cancer cells suppressed cell growth, 2013 Aug;66(8):681-6 colony formation, motility, and tumorigenic This article should be referenced as such: capacity. These results suggest that CADM4 may be involved in the maintenance of epithelial Ito T, Murakami Y. CADM4 (cell adhesion molecule 4). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10):709- structure and suppression of tumor growth. 710.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 710

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

GRPR (Gastrin-Releasing Peptide Receptor) Terry W Moody National Cancer Institute, Center for Cancer Research, 9609 Medical Center Drive, Room 2W-130, Bethesda, MD 20892, USA (TWM)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/GRPRID40759chXp22.html DOI: 10.4267/2042/54130 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract The GRP-R gene has 1155 bp. Bombesin (BB) and gastrin-releasing peptide Protein (GRP) bind with high affinity to the GRP-receptor (GRP-R) which regulates release of gastrointestinal Note hormones, smooth muscle contraction and Bombesin, a 14 amino acid peptide (Anastasi et al., proliferation of epithelial as well as cancer cells. 1974) and gastrin-releasing peptide (GRP), a 27 The GRP-R is a G-protein coupled receptor amino acid peptide (McDonald et al., 1979), bind (GPCR) which activates phospholipase C signaling with high affinity to receptors initially characterized pathways. The GRP-R is expressed in numerous in the rat brain (Moody et al., 1978) and guinea pig cancers including breast, colon, lung and prostate pancreatic acini (Jensen et al., 1978). cancer. The GRP-R was cloned (Battey et al., 1991; Spindel et al., 1990) and found to be a G-protein Identity coupled receptor (GPCR) containing 384 amino acids. HGNC (Hugo): GRPR The human GRP-R gene is localized to the X Location: Xp22.2 chromosome and the GRP-R has 7 transmembrane (TM) domains, an extracellular N-terminal and DNA/RNA intracellular C-terminal. Exon 1 codes for TM 1, 2 and 3 domains with Note splice site in IC loop 2 (Asp 137 ). Exon 2 codes for The human GRP-R gene has 3 exons and is TM 4 and 5 with a Gln 255 splice site. Exon 3 codes localized to chromosome Xp22.2. for TM 6-7 domains and the cytoplasmic C- Description terminal. Exon 1, 2 and 3 have 413 bp, 352 bp and The gene has 3 exons. The GRP-R gene spans 390 bp respectively whereas introns 1 and 2 are 23 30218 bases. kb and 1.6 kb respectively (Xiao et al., 2001). The human GRP-R is glycosylated at Asn 20 , Transcription palmitoylated at Cys 339 and has a disulfide between The GRP-R gene has 9 and 3.1 kb transcripts in Cys 113 and Cys 196 (Jensen et al., 2008). For GRP-R human stomach as well as NCI-H345 lung cancer agonist binding Gln 120 , Pro 198 , Arg 287 and Ala 307 are cells, T47D breast cancer cells and HuTu 80 essential (Akeson et al., 1997). For GRP-R duodenal carcinoma cells. antagonist binding Thr 296 , Phe 301 and Ser 304 are The pancreas has 9, 4.6, 3.1 and 2.1 kb transcripts. essential (Tokita et al., 2001). GRP-R antagonists Polymorphisms are observed at 794 (G-A), 851 (C- include (Psi 13,14 , Leu 14 )BB, (D-Phe 6)BB 6- T) and 1061 (C-T) but these do not alter the GRP-R 13 propylamide and PD176,252 (Gonzalez et al., sequence (Xiao et al., 2001). 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 711 GRPR (Gastrin-Releasing Peptide Receptor) Moody TW

acids (Wada et al., 1991) and has 55% sequence homology with the GRP-R. An orphan receptor named BB receptor subtype 3 (BRS-3) was cloned which contains 399 amino acids and has 51% sequence homology with the GRP-R (Fathi et al., 1993). The GRP receptor binds BB and GRP with high affinity whereas the NMB receptor binds NMB with high affinity. BRS-3 does not bind BB, GRP or NMB with high affinity (Jensen et al., 2008).

Mutations Human GRP-R protein. The GRP-R, which is a glycoprotein embedded in the plasma membrane, contains Note 384 amino acids with 7 TM domains, an extracellular N- The GRP-R gene has 4 point mutations in biopsy terminal and intracellular C-terminal. The amino acids at the N- and C-terminal are indicated. The amino acids before specimens from patients with autism spectrum and after each of the 7 TM domains are indicated. disorders, 2 of which result in amino acid changes Numerous amino acids in or near TM 2, 3, 4, 6 and 7 (C6S and L181F). domains are essential for agonist binding, whereas amino The mutated GRP-R had normal agonist binding acids in or near TM 6 and 7 domains are important for antagonist binding. and second messenger production (Seidita et al., 2008). Description Also an X-8 translocation occurs in intron 1 of the The GRP-R interacts with Gq causing GRP-R gene in a patient with infantile autism phosphatidylinositol turnover (Rozengurt, 1998). (Ishikawa-Brush et al., 1997). As a result, BB addition to small cell lung cancer (SCLC) cells causes increased protein kinase C Implicated in activity and elevation of cytosolic Ca 2+ (Moody et al., 1987). Also, BB causes tyrosine Lung cancer phosphorylation of EGFR, ERK, FAK, paxillin, and Note Src leading to increased cellular proliferation High densities of GRP-R are present in SCLC and (Jensen et al., 2008). NSCLC biopsy specimens and cell lines (Mattei et Expression al., 2014). BB stimulates whereas GRP-R antagonists such as PD176252 inhibit lung cancer The GRP-R is localized to the normal brain cellular proliferation (Moody et al., 2003). especially the periventricular nucleus (PVN) of the hypothalamus (Wolf et al., 1983) where activation Prostate cancer by BB causes satiety (Gibbs et al., 1979). The GRP- Note R, which regulates insulin secretion, is present in Numerous radioligands have been developed to the pancreatic islets (Persson et al., 2002). The image the GRP-R in prostate cancer patients (Mansi GRP-R is present in colonic villi and may play a et al., 2013; Sancho et al., 2011). GRP-R role in villi development (Carroll et al., 2002). The antagonists have been radiolabeled with (111)In, GRP-R is present on small cell lung cancer (SCLC) 13,14 14 (99m)Tc, (68)Ga or (64)Cu (Abiraj et al., 2011). cells and BB stimulates whereas (Psi , Leu )BB High tumor/background ratios were obtained as or PD176252 inhibits cellular proliferation PET and SPECT images. (Mahmoud et al., 1991; Moody et al., 2003). The GRP-R is present on squamous cell carcinoma of Breast cancer the head and neck cancer cells and PD176252 Note inhibits the growth of these cells (Zhang et al., Cytotoxic BB conjugates of 2-pyrrolinodoxorubicin 2007). In colon cancer the transcription factor inhibit the growth of breast cancer xenografts in CREB is a regulator of GRP-R expression nude mice (Engel et al., 2005). The GRP-R was (Chinnappan et al., 2008). detected in 41/57 breast carcinoma biopsy Localisation specimens (Reubi et al., 2002). The GRP-R is localized to the plasma membrane of Colon cancer normal and cancer cells. Note Homology The GRPR regulates colon cancer cellular Other receptors of the BB family include differentiation and impairs cellular metastasis neuromedin B (NMB) which contains 390 amino (Carroll et al., 1999).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 712 GRPR (Gastrin-Releasing Peptide Receptor) Moody TW

Head and neck cancer for bombesin-like peptides. Eur J Pharmacol. 1983 Jan 28;87(1):163-4 Note Moody TW, Murphy A, Mahmoud S, Fiskum G. Bombesin- The GRP-R regulates transactivation of the like peptides elevate cytosolic calcium in small cell lung epidermal growth factor receptor in head and neck cancer cells. Biochem Biophys Res Commun. 1987 Aug squamous cell carcinoma (Lui et al., 2003). The 31;147(1):189-95 mitogenic effects of GRP require the activation of Spindel ER, Giladi E, Brehm P, Goodman RH, Segerson an EGFR-dependent MEK/ERK-dependent TP. Cloning and functional characterization of a pathway. complementary DNA encoding the murine fibroblast bombesin/gastrin-releasing peptide receptor. Mol Diabetes Endocrinol. 1990 Dec;4(12):1956-63 Note Battey JF, Way JM, Corjay MH, Shapira H, Kusano K, GRP-R knockout mice had impaired glucose Harkins R, Wu JM, Slattery T, Mann E, Feldman RI. Molecular cloning of the bombesin/gastrin-releasing tolerance due to a defect in insulin release (Persson peptide receptor from Swiss 3T3 cells. Proc Natl Acad Sci et al., 2000). U S A. 1991 Jan 15;88(2):395-9 Satiety Mahmoud S, Staley J, Taylor J, Bogden A, Moreau JP, Coy D, Avis I, Cuttitta F, Mulshine JL, Moody TW. [Psi Note 13,14] bombesin analogues inhibit growth of small cell lung GRP-R blockade antagonizes feeding suppression cancerin vitro and in vivo. Cancer Res. 1991 Apr by peripherally administered GRP (Ladenheim et 1;51(7):1798-802 al., 1996). Wada E, Way J, Shapira H, Kusano K, Lebacq-Verheyden AM, Coy D, Jensen R, Battery J. cDNA cloning, Hormone secretion characterization, and brain region-specific expression of a Note neuromedin-B-preferring bombesin receptor. Neuron. 1991 Mar;6(3):421-30 The GRP-R regulates the secretion of numerous hormones including gastrin, glucagon, insulin, Fathi Z, Corjay MH, Shapira H, Wada E, Benya R, Jensen pancreatic polypeptide, prolactin and somatostatin R, Viallet J, Sausville EA, Battey JF. BRS-3: a novel bombesin receptor subtype selectively expressed in testis (Westendorf and Schonbrunn, 1982; Jensen et al., and lung carcinoma cells. J Biol Chem. 1993 Mar 2008). 15;268(8):5979-84 Pruritus Ladenheim EE, Taylor JE, Coy DH, Moore KA, Moran TH. Hindbrain GRP receptor blockade antagonizes feeding Note suppression by peripherally administered GRP. Am J GRP-R containing spinal cord neurons, which are Physiol. 1996 Jul;271(1 Pt 2):R180-4 present in lamina I, mediate itch sensation (Sun et Akeson M, Sainz E, Mantey SA, Jensen RT, Battey JF. al., 2009). Addition of GRP-R antagonists inhibited Identification of four amino acids in the gastrin-releasing scratching behavior in 3 mouse models of itching. peptide receptor that are required for high affinity agonist binding. J Biol Chem. 1997 Jul 11;272(28):17405-9 References Ishikawa-Brush Y, Powell JF, Bolton P, Miller AP, Francis F, Willard HF, Lehrach H, Monaco AP. Autism and multiple Anastasi A, Erspamer V, Bucci M. Isolation and structure exostoses associated with an X;8 translocation occurring of bombesin and alytesin, 2 analogous active peptides within the GRPR gene and 3' to the SDC2 gene. Hum Mol from the skin of the European amphibians Bombina and Genet. 1997 Aug;6(8):1241-50 Alytes. Experientia. 1971 Feb 15;27(2):166-7 Rozengurt E. Signal transduction pathways in the Jensen RT, Moody T, Pert C, Rivier JE, Gardner JD. mitogenic response to G protein-coupled neuropeptide Interaction of bombesin and litorin with specific membrane receptor agonists. J Cell Physiol. 1998 Dec;177(4):507-17 receptors on pancreatic acinar cells. Proc Natl Acad Sci U S A. 1978 Dec;75(12):6139-43 Carroll RE, Matkowskyj KA, Chakrabarti S, McDonald TJ, Benya RV. Aberrant expression of gastrin-releasing Moody TW, Pert CB, Rivier J, Brown MR. Bomebesin: peptide and its receptor by well-differentiated colon specific binding to rat brain membranes. Proc Natl Acad cancers in humans. Am J Physiol. 1999 Mar;276(3 Pt Sci U S A. 1978 Nov;75(11):5372-6 1):G655-65 Gibbs J, Fauser DJ, Rowe EA, Rolls BJ, Rolls ET, Persson K, Gingerich RL, Nayak S, Wada K, Wada E, Maddison SP. Bombesin suppresses feeding in rats. Ahrén B. Reduced GLP-1 and insulin responses and Nature. 1979 Nov 8;282(5735):208-10 glucose intolerance after gastric glucose in GRP receptor- deleted mice. Am J Physiol Endocrinol Metab. 2000 McDonald TJ, Jörnvall H, Nilsson G, Vagne M, Ghatei M, Nov;279(5):E956-62 Bloom SR, Mutt V. Characterization of a gastrin releasing peptide from porcine non-antral gastric tissue. Biochem Tokita K, Katsuno T, Hocart SJ, Coy DH, Llinares M, Biophys Res Commun. 1979 Sep 12;90(1):227-33 Martinez J, Jensen RT. Molecular basis for selectivity of high affinity peptide antagonists for the gastrin-releasing Westendorf JM, Schonbrunn A. Bombesin stimulates peptide receptor. J Biol Chem. 2001 Sep prolactin and growth hormone release by pituitary cells in 28;276(39):36652-63 culture. Endocrinology. 1982 Feb;110(2):352-8 Xiao D, Wang J, Hampton LL, Weber HC. The human Wolf SS, Moody TW, O'Donohue TL, Zarbin MA, Kuhar gastrin-releasing peptide receptor gene structure, its tissue MJ. Autoradiographic visualization of rat brain binding sites

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 713 GRPR (Gastrin-Releasing Peptide Receptor) Moody TW

expression and promoter. Gene. 2001 Feb 7;264(1):95- Jensen RT, Battey JF, Spindel ER, Benya RV. 103 International Union of Pharmacology. LXVIII. Mammalian bombesin receptors: nomenclature, distribution, Carroll RE, Matkowskyj K, Saunthararajah Y, Sekosan M, pharmacology, signaling, and functions in normal and Battey JF, Benya RV. Contribution of gastrin-releasing disease states. Pharmacol Rev. 2008 Mar;60(1):1-42 peptide and its receptor to villus development in the murine and human gastrointestinal tract. Mech Dev. 2002 Seidita G, Mirisola M, D'Anna RP, Gallo A, Jensen RT, May;113(2):121-30 Mantey SA, Gonzalez N, Falco M, Zingale M, Elia M, Cucina L, Chiavetta V, Romano V, Cali F. Analysis of the Persson K, Pacini G, Sundler F, Ahrén B. Islet function gastrin-releasing peptide receptor gene in Italian patients phenotype in gastrin-releasing peptide receptor gene- with autism spectrum disorders. Am J Med Genet B deficient mice. Endocrinology. 2002 Oct;143(10):3717-26 Neuropsychiatr Genet. 2008 Sep 5;147B(6):807-13 Reubi JC, Wenger S, Schmuckli-Maurer J, Schaer JC, González N, Mantey SA, Pradhan TK, Sancho V, Moody Gugger M. Bombesin receptor subtypes in human cancers: TW, Coy DH, Jensen RT. Characterization of putative detection with the universal radioligand (125)I-[D-TYR(6), GRP- and NMB-receptor antagonist's interaction with beta-ALA(11), PHE(13), NLE(14)] bombesin(6-14). Clin human receptors. Peptides. 2009 Aug;30(8):1473-86 Cancer Res. 2002 Apr;8(4):1139-46 Sun YG, Zhao ZQ, Meng XL, Yin J, Liu XY, Chen ZF. Lui VW, Thomas SM, Zhang Q, Wentzel AL, Siegfried JM, Cellular basis of itch sensation. Science. 2009 Sep Li JY, Grandis JR. Mitogenic effects of gastrin-releasing 18;325(5947):1531-4 peptide in head and neck squamous cancer cells are mediated by activation of the epidermal growth factor Abiraj K, Mansi R, Tamma ML, Fani M, Forrer F, Nicolas receptor. Oncogene. 2003 Sep 18;22(40):6183-93 G, Cescato R, Reubi JC, Maecke HR. Bombesin antagonist-based radioligands for translational nuclear Moody TW, Leyton J, Garcia-Marin L, Jensen RT. imaging of gastrin-releasing peptide receptor-positive Nonpeptide gastrin releasing peptide receptor antagonists tumors. J Nucl Med. 2011 Dec;52(12):1970-8 inhibit the proliferation of lung cancer cells. Eur J Pharmacol. 2003 Aug 1;474(1):21-9 Sancho V, Di Florio A, Moody TW, Jensen RT. Bombesin receptor-mediated imaging and cytotoxicity: review and Engel JB, Schally AV, Halmos G, Baker B, Nagy A, Keller current status. Curr Drug Deliv. 2011 Jan;8(1):79-134 G. Targeted cytotoxic bombesin analog AN-215 effectively inhibits experimental human breast cancers with a low Mansi R, Fleischmann A, Mäcke HR, Reubi JC. Targeting induction of multi-drug resistance proteins. Endocr Relat GRPR in urological cancers--from basic research to clinical Cancer. 2005 Dec;12(4):999-1009 application. Nat Rev Urol. 2013 Apr;10(4):235-44 Zhang Q, Bhola NE, Lui VW, Siwak DR et al.. Antitumor Mattei J, Achcar RD, Cano CH, Macedo BR, Meurer L, mechanisms of combined gastrin-releasing peptide Batlle BS, Groshong SD, Kulczynski JM, Roesler R, Dal receptor and epidermal growth factor receptor targeting in Lago L, Brunetto AT, Schwartsmann G. Gastrin-releasing head and neck cancer. Mol Cancer Ther. 2007 peptide receptor expression in lung cancer. Arch Pathol Apr;6(4):1414-24 Lab Med. 2014 Jan;138(1):98-104

Chinnappan D, Qu X, Xiao D, Ratnasari A, Weber HC. This article should be referenced as such: Human gastrin-releasing peptide receptor gene regulation requires transcription factor binding at two distinct CRE Moody TW. GRPR (Gastrin-Releasing Peptide Receptor). sites. Am J Physiol Gastrointest Liver Physiol. 2008 Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10):711- Jul;295(1):G153-G162 714.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 714

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

GUCY2C (guanylate cyclase 2C (heat stable enterotoxin receptor)) Erik S Blomain, Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia, PA, USA (ESB, SAW)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/GUCY2CID43303ch12p13.html DOI: 10.4267/2042/54131 This article is an update of : Schulz S, Waldman SA. GUCY2C (guanylate cyclase 2C (heat stable enterotoxin receptor)). Atlas Genet Cytogenet Oncol Haematol 2012;16(1):18-19.

Abstract Local order ATF7IP - PLBD1 - GUCY2C - H2AFJ - Abstract HIST4H4. Short communication on GUCY2C, with data on DNA/RNA, on the protein encoded and where the DNA/RNA gene is implicated. Keywords Description GUCY2C, guanylin, uroguanylin, guanylyl cyclase The GUCY2C gene is approximately 84 kb in C, cyclic GMP length and has 27 exons. Identity Transcription An approximately 3.8 mRNA is transcribed from Other names: DIAR6, GC-C, GUC2C, hSTAR, the gene. MECIL, MUCIL, STAR HGNC (Hugo): GUCY2C Pseudogene Location: 12p12.3 None known.

Image adapted from NCBI.

Image adapted from Ensembl.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 715 GUCY2C (guanylate cyclase 2C (heat stable enterotoxin receptor)) Blomain ES, Waldman SA

SP: signal peptide; ECD: extracellular ligand binding domain; TM: transmembrane domain; KHD: regulatory kinase-homology domain; CAT: guanylyl cyclase catalytic domain; TAIL: C-terminal tail, interacts with scaffolding proteins.

GUCY2C-mediated fluid secretion. The role of this Protein mutation in cancer susceptibility remains unclear Note (Romi et al., 2012). GUCY2C encodes a guanylyl cyclase. Implicated in Description 1073 amino acid protein with guanylyl cyclase Colorectal cancer catalytic activity (4.6.1.2). Note Expression The endogenous GUCY2C ligands, guanylin and uroguanylin, are lost early in the neoplastic process, Primarily intestinal epithelial cells. Also expressed resulting in inactivation of downstream tumor in hypothalamus and midbrain neurons. suppressive GUCY2C signaling. Targeted deletion Localisation of GUCY2C in mice results in a phenotype of Apical membrane. intestinal cancer susceptibility in the context of predisposing genetic mutations (apc min ) or exposure Function to carcinogen (azoxymethane). GUCY2C has a In response to binding endogenous hormones wide range of homeostatic functions in preventing guanylin and uroguanylin, or the exogenous ligand tumorigenesis, including regulation of crypt E. coli heat-stable enterotoxin, GUCY2C proliferation, DNA damage repair and oncogenic synthesizes cyclic GMP. Cyclic GMP activates signaling such as PI3K/Akt (Li et al., 2007a; Li et downstream signaling pathways via cGMP- al., 2007b; Lin et al., 2010). dependent protein kinases, phosphodiesterases and cGMP-gated ion channels. Obesity Homology Note GUCY2C is expressed in the hypothalamus, and Adenylyl cyclase. targeted deletion in mice results in an obese phenotype which has been attributed to increased Mutations food consumption and dysregulated satiety. Note Importantly, the GUCY2C hormone ligand uroguanylin has been shown to mediate this effect. - c.2519G →T The uroguanylin peptide is released into the This dominant missense mutation was identified in circulation postprandially and travels to the brain 32 members of a Norwegian family, and was where it induces satiety in the hypothalamus, thus characterized as an activating mutation. Affected comprising a gut-brain neuroendocrine axis which patients had mild chronic diarrhea and an increased regulates feeding (Valentino et al., 2011). risk for several GI disorders. The role of this mutation in cancer susceptibility remains unclear Irritable bowel syndrome with (Fiskerstrand et al., 2012). constipation (IBS-C), and associated - c.1160A>G This recessive missense mutation was identified in abdominal pain a Bedouin family, and was characterized as an Note inactivating mutation. Affected patients had GUCY2C is a known mediator of intestinal fluid perinatal meconium ileus secondary to impaired secretion. Work in mice and humans has GUCY2C-mediated fluid secretion. The role of this demonstrated that the bacterial heat stable mutation in cancer susceptibility remains unclear enterotoxin (ST) causes GI fluid secretion, motility (Romi et al., 2012). and diarrhea via GUCY2C activation in the - c.2270dupA intestine. Recently, an oral GUCY2C ligand This recessive nonsense mutation was identified in linaclotide (Linzess Ironwood Pharmaceuticals) a Bedouin family, and resulted in a premature stop was approved by the FDA for treatment of codon two amino acids following the insertion constipation-predominant irritable bowel syndrome which resulted in a truncated GUCY2C protein (IBS). Further work has revealed a role for lacking its catalytic domain. Affected patients had linaclotide in preventing GI pain associated with perinatal meconium ileus secondary to impaired IBS. The mechanism for this effect is believed to be

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 716 GUCY2C (guanylate cyclase 2C (heat stable enterotoxin receptor)) Blomain ES, Waldman SA

release of cGMP by enterocytes from their formation by inhibiting AKT signaling. Gastroenterology. basolateral membrane following ligand activation. 2010 Jan;138(1):241-54 This cGMP then inhibits nociception in adjacent Gong R, Ding C, Hu J, Lu Y, Liu F, Mann E, Xu F, Cohen visceral neurons, relieving pain (Chey et al., 2012; MB, Luo M. Role for the membrane receptor guanylyl cyclase-C in attention deficiency and hyperactive behavior. Castro et al., 2013). Science. 2011 Sep 16;333(6049):1642-6 Inflammatory bowel disease (IBD) / Valentino MA, Lin JE, Snook AE, Li P, Kim GW, colitis Marszalowicz G, Magee MS, Hyslop T, Schulz S, Waldman SA. A uroguanylin-GUCY2C endocrine axis Note regulates feeding in mice. J Clin Invest. 2011 Work in mice has identified a possible role for Sep;121(9):3578-88 GUCY2C in preventing colitis. Targeted deletion of Chey WD, Lembo AJ, Lavins BJ, Shiff SJ, Kurtz CB, Currie GUCY2C results in more severe disease in a MG, MacDougall JE, Jia XD, Shao JZ, Fitch DA, Baird MJ, chemical model of colitis. Additionally, oral Schneier HA, Johnston JM. Linaclotide for irritable bowel administration of GUCY2C ligand improved colitis syndrome with constipation: a 26-week, randomized, double-blind, placebo-controlled trial to evaluate efficacy in wild-type mice in the same model. These and safety. Am J Gastroenterol. 2012 Nov;107(11):1702- findings suggest a role for GUCY2C in regulating 12 intestinal inflammation and associated disorders Fiskerstrand T, Arshad N, Haukanes BI, Tronstad RR, (Lin et al., 2012). Pham KD, Johansson S, Håvik B, Tønder SL, Levy SE, Brackman D, Boman H, Biswas KH, Apold J, Hovdenak N, Attention deficit hyperactivity Visweswariah SS, Knappskog PM. Familial diarrhea disorder (ADHD) syndrome caused by an activating GUCY2C mutation. N Engl J Med. 2012 Apr 26;366(17):1586-95 Note Work in mice has demonstrated the presence of Lin JE, Snook AE, Li P, Stoecker BA, Kim GW, Magee MS, Garcia AV, Valentino MA, Hyslop T, Schulz S, Waldman GUCY2C in midbrain neurons, and targeted SA. GUCY2C opposes systemic genotoxic tumorigenesis deletion of GUCY2C resulted in a phenotype of by regulating AKT-dependent intestinal barrier integrity. hyperactivity, which was reversible by treating with PLoS One. 2012;7(2):e31686 either ADHD therapeutics or an activator of Romi H, Cohen I, Landau D, Alkrinawi S, Yerushalmi B, downstream GUCY2C signaling (PKG activator) Hershkovitz R, Newman-Heiman N, Cutting GR, Ofir R, (Gong et al., 2011). Sivan S, Birk OS. Meconium ileus caused by mutations in GUCY2C, encoding the CFTR-activating guanylate References cyclase 2C. Am J Hum Genet. 2012 May 4;90(5):893-9 Castro J, Harrington AM, Hughes PA, Martin CM, Ge P, Li P, Lin JE, Chervoneva I, Schulz S, Waldman SA, Pitari Shea CM, Jin H, Jacobson S, Hannig G, Mann E, Cohen GM. Homeostatic control of the crypt-villus axis by the MB, MacDougall JE, Lavins BJ, Kurtz CB, Silos-Santiago I, bacterial enterotoxin receptor guanylyl cyclase C restricts Johnston JM, Currie MG, Blackshaw LA, Brierley SM. the proliferating compartment in intestine. Am J Pathol. Linaclotide inhibits colonic nociceptors and relieves 2007a Dec;171(6):1847-58 abdominal pain via guanylate cyclase-C and extracellular cyclic guanosine 3',5'-monophosphate. Gastroenterology. Li P, Schulz S, Bombonati A, Palazzo JP, Hyslop TM, Xu 2013 Dec;145(6):1334-46.e1-11 Y, Baran AA, Siracusa LD, Pitari GM, Waldman SA. Guanylyl cyclase C suppresses intestinal tumorigenesis by This article should be referenced as such: restricting proliferation and maintaining genomic integrity. Gastroenterology. 2007b Aug;133(2):599-607 Blomain ES, Waldman SA. GUCY2C (guanylate cyclase 2C (heat stable enterotoxin receptor)). Atlas Genet Lin JE, Li P, Snook AE, Schulz S, Dasgupta A, Hyslop TM, Cytogenet Oncol Haematol. 2014; 18(10):715-717. Gibbons AV, Marszlowicz G, Pitari GM, Waldman SA. The hormone receptor GUCY2C suppresses intestinal tumor

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 717

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MIR135A1 (microRNA 135a-1) Alfons Navarro, Marina Díaz-Beyá, Mariano Monzó Molecular Oncology and Embryology Laboratory, Human Anatomy Unit, School of Medicine, University of Barcelona, Barcelona, Spain (AN, MM), Hematology Department, Hospital Clinic, IDIBAPS, Barcelona, Spain (MDB)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR135A1ID50328ch3p21.html DOI: 10.4267/2042/54132 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

- GLYCTK: glycerate kinase, 3p21.1 Abstract - TCONS_00006853; lnc-GLYCTK-1, 3p21.1 Review on MIR135A1, with data on DNA/RNA - WDR82: WD repeat domain 82, 3p21.2 and where the gene is implicated. - MIRLET7G: microRNA let-7g, 3p21.1. Identity DNA/RNA Other names: MIRN135-1, MIRN135A1 Description HGNC (Hugo): MIR135A1 The gene is located in the intron 1 of GLYCTK- Location: 3p21.1 AS1/RP11 gene (sense) and in the exon 4 of GLYCTK (antisense). The precursor length is 90 Local order: Genes flanking MIR135A1 oriented nt. from centromere to telomere on 3p21.1: - PHF7: PHD finger protein 7, 3p21.1 Transcription - BAP1: BRCA1 associated protein-1 (ubiquitin The transcription of miR-135a is regulated by carboxy-terminal hydrolase), 3p21.31-p21.2 FOXM1 in hepatocellular carcinoma (Liu et al., - DNAH1: dynein, axonemal, heavy chain 1, 2012). BMP2 inhibits miR-135a expression during 3p21.1 osteoblast differentiation (Li et al., 2008). - MIR135A1 - GLYCTK-AS1: GLYCTK Antisense RNA 1 Pseudogene (Non-protein coding), 3p21.1 No reported pseudogenes.

Stem-loop structure of hsa-mir-135a-1.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 718 MIR135A1 (microRNA 135a-1) Navarro A, et al.

Genomic location of MIR135A 1 and its host genes.

Function: miR-135a and miR-135b inhibits APC Protein translation (independently of mutational status of Note APC) activating downstream Wnt pathway activity MicroRNAs are not translated into amino acids. and induce beta-catenin signaling (Nagel et al., 2008). In CRC cell lines, miR-135a overexpression Mutations increased proliferation and promoted mobility and invasion in part by targeting MTSS1 (Zhou et al., Note 2012). Deletions of miR-135a-1 gene have been described Gastric cancer in medulloblastomas, where 16/48 (33%) of medulloblastoma patients had a deletion of miR- Oncogenesis 135a-1 gene (Lv et al., 2012). Tumor suppressor (Wu H et al., 2012). miRNA expression: Downregulation in gastric Implicated in cancer patient samples in comparison with adjacent normal tissue. Cancer Targets: JAK2 (Janus kinase 2) Colorectal cancer (CRC) Function: miR-135a overexpression produces downregulation of JAK2 levels reducing cell Note proliferation and colony formation. It also reduces Interestingly, treating CRC cell lines with mistletoe p-STAT3 (phospho signal transducer and activator lecitin-I, degrades precursor of some microRNAs, of transcription 3) activation and cyclin D1 and including pre-mir-135a, thus dowregulating miR- Bcl-x (BCL2-like1). 135 and upregulating APC and increasing beta- catenin phosphorylation (Li et al., 2011). Hepatocellular carcinoma (HCC) Prognosis Prognosis A prognostic miRNA signature composed of miR- In a cohort of 50 patients, overexpression of miR- 135a, miR-21, miR-335, miR-206 and let-7a was 135a identified a group of patients with worse OS useful to detect the presence of metastasis (Vickers end DFS among patients with PVTT. et al., 2012). Oncogenesis Oncogenesis Oncogene (Liu et al., 2012). Oncogene. miRNA expression: Overexpression of miR-135a miRNA expression: Overexpression among in samples from HCC with portal vein tumor colorectal adenome and carcinome in comparison thrombus (PVTT) - that is considered a special type with normal tissue. miR-135 family (miR-135a and of HCC metastasis - compared with parenchyma miR-135b) overexpression during CRC progression tumor nodes. (in patients) (Nagel et al., 2008). Consistently, a Targets: MTSS study comparing patient samples, healthy controls Function: miR-135a promotes invasion and and cell lines showed overexpression in CRC metastasis in vitro and in mouse models of HCC. samples (Zhou et al., 2012). Another study also Reducing miR-135a leads to reduced PVTT. The showed overexpression associated with progression transcription of miR-135a is regulated by FOXM1. and metastasis (Vickers et al., 2012). Targets: Adenomatous polyposis coli (APC) Breast cancer (Nagel et al., 2008). Metastasis suppressor 1 Oncogenesis (MTSS1) (Zhou et al., 2012). Oncogene (Chen et al., 2012).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 719 MIR135A1 (microRNA 135a-1) Navarro A, et al.

miRNA expression: Overexpression in metastasic lines through regulation of JAK/STAT pathway and breast tumors in comparison with benign tumor activation BcL-xL expression. patient samples. Upregulation in the highly invasive breast cancer cell line BT 549 in comparison with Acute myeloid leukemia (AML) other breast cancer cell lines. Prognosis Targets: HOXA10 (homeobox A10). In a cohort of 85 intermediate risk AML (IR-AML) Function: miR-135a promotes the migration and patients (later extended to 238 IR-AML patients), invasion of breast cancer cells at least in part low expression of miR-135a identified a group of through HOXA10. patients with a higher risk of relapse - both in the Malignant glioma entire cohort and also within the unfavourable molecular subgroup (FLT3-ITD or wild-type NPM Oncogenesis and CEBPA) (Díaz-Beyá et al., 2014). Tumor suppressor (Wu S et al., 2012). Oncogenesis miRNA expression: Downregulated in glioma in comparison with normal glia. miRNA-135a Tumor suppressor. correlated negatively with the pathological grading Renal cell carcinoma of human glioma tissue samples. Oncogenesis Targets: STAT6 (signal transducer and activator of Tumor suppressor (Hidaka et al., 2012). transcription 6), SMAD5 (SMAD family member miRNA expression: Lower expression of miR- 5), BMPR2 (bone morphogenetic protein receptor, 135a observed in 10 cancer tissue samples type II). compared to 5 adjacent non-cancer tissue samples. Function: miR-135a selectively induces Function: Effect on cell proliferation, where the mitochondria-dependent apoptosis of malignant miR-135a overexpression reduces cell viavility. glioma by targeting various genes (STAT6, SMAD5, BMPR2). Interestingly it doesn't affect Cervival cancer cell normal glia cells. Oncogenesis Lung cancer Oncogene (Leung et al., 2014). Oncogenesis miRNA expression: miR-135a is overexpressed in Tumor suppressor (Cheng et al., 2013; Zhou et al., cervical squamous cell carcinoma in comparison 2013). with cervical intraepithelial neoplasia (precancerous miRNA expression: miR-135a/b downregulated in lesions). the cisplatin-resistant cell line A549R compared Targets: SIAH1 (in cervical cancer cells and with the cisplatin-sensitive A549 cell line (Zhou, cervical epithelial cells). Qiu et al. 2013). Function: Overexpression of miR-135a induced Targets: MCL1 (myeloid cell leukemia sequence increased colony formation, anchorage-independent 1) (Zhou et al., 2013), CD133 (Cheng et al., 2013). growth, and proliferation, cell-invasion and Function: Overexpression of miR-135a/b reduced migration in cervical cancer cell lines. MCL1 and sensitized cell lines to cisplatin by The inhibition of miR-135a on SIAH1 led to modulation of apoptosis (Zhou et al., 2013). miR- upregulation of beta-catenin activity, indicating that 135a/b suppressed CD133 only in CD133 with miR-135a induces transformation and enhances binding polymorphism rs2240688 CC or CA but tumor growth. not in genotype AA (Cheng et al., 2013). The authors analyzed the miR-135a-induced malignant transformation activity in cell lines with Classic Hodgkin lymphoma (cHL) or without human papiloma virus (HPV) proteins Prognosis (E6 and E7) and concluded that these proteins are In a cohort of 89 cHL patients, low miR-135a was necessary for miR-135a oncogenic activity. associated with a higher risk of relapse and worse Also in xenografts, miR-135a improved the growth disease free survival. of cancer cells and the tumorigenic activity of HPV Oncogenesis cells. Tumor suppressor (Navarro et al., 2008; Navarro et Various tumor cell lines (HeLa al., 2009). cervical carcinoma, SW480 colon miRNA expression: Downregulated miR-135a in cancer, A375 melanoma, PANC-1 cHL patient lymph nodes in comparison with reactive non-tumor lymph nodes used as control. pancreatic tumor, and 293 epithelial Targets: JAK2. kidney cells) Function: Overexpression of miR-135a increases Note apoptosis and decreases cellular growth in HL cell FAK is overexpressed in many cancers.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 720 MIR135A1 (microRNA 135a-1) Navarro A, et al.

Oncogenesis Development, congenital disease and Tumor suppressor (Golubovskaya et al., 2014). others Targets: FAK (focal adhesion kinase). Function: miR-135a overexpression decreased Cryptorchid testis FAK mRNA and protein levels, decreased cell Note invasion and increased sensitivity to doxorubicin, miRNA expression: In rat models, low expression 5-fluorouacil and FAK inhibitor Y15. of miR-135a in undescended testis in comparison Various tumor cell lines with that in contralateral normal testis. Higher miR- 135a expression in the testes than in other organs. Oncogenesis miR-135a is detected in spermatogonial stem cells. Oncogene (Holleman et al., 2011). Targets: FoxO1 (forehead box protein O1). miRNA expression: miR-135a levels were Functions: miR-135a contributes to significantly upregulated in paclitaxel-resistant spermatogonial stem cell maintenance through ovarian, lung, uterine, breast and prostate tumor modulation of FoxO1 (Moritoki et al., 2014). cells lines derived from A549, PC-14, MCF-7, PC- 3, SKOV-3 and MES-SA. Endometriosis Targets: APC. Note Function: miR-135a upregulation in vitro and in miRNA expression: Overexpressed in vivo is associated with paclitaxel resistance. Anti- endometriosis in comparison with normal miR-135a treatment in paclitaxel-resistant lung endometrial tissue (50 controls and 32 women with cancer xenografts restored sensitivity to paclitaxel, endometriosis). in part through the direct inhibition of APC Targets: HOXA10 (homeobox A10). expression. Function: miR135a expression in controls was Metabolism increased during the proliferative phase, decreased at the time of ovulation, and increased during the Diabetes luteal phase (Petracco et al., 2011). Note Osteogenesis miRNA expression: Overexpression in diabetic human and mouse skeletal muscle. Note Targets: IRS2 (insulin receptor substrate 2). miRNA expression: Very low levels in Function: miR-135a inhibits IRS2, thus reducing differentiated osteoblast, downregulated during glucose uptake into the cell. miR-135a BMP2-mediated osteogenic differentiation. overexpression attenuates insulin signaling and Targets: SMAD5. glucose uptake in skeletal muscle. In vivo, silencing Function: miR-135a suppresses osteogenesis and miR-135a decreases hyperglicemia (Agarwal et al., inhibits differentiation of osteoprogenitors and the 2013). osteogenic phenotype in pluripotent cells by attenuating SMAD5. BMP2 inhibits miR-135a Essential hypertension, renin- expression and permits osteoblast differentiation angiotensin-aldosteron system (Li et al., 2008). Note Muscle differentiation (myogenesis) Targets: NR3C2 (mineral corticoid receptor). and Duchenne muscular dystrophy Function: In Hela cells, overexpression of miR- (DMD) 135a and miR-124 downregulates NR3C2 protein, indicating a role in the regulation of blood pressure Note (Sõber et al., 2010). miRNA expression: miR-135a is upregulated during myogenic differentiation. Overexpression of Corticoid dependent stress response miR-135a is observed when the myoblasts are Note differentiated in human samples, cell lines and Targets: NR3C2 (mineral corticoid receptor, other mouse model (Greco et al., 2009). miR-135a is part alias MR) of the DMD miRNA signature (Greco et al., 2009) Function: In a mouse model, downregulation of and is overexpressed in Duchenne muscle (Cesana miR-135a and miR-124 in amygdale after two et al., 2011). hours of stress stimulus. Targets: MEF2C (myocyte enhancer factor 2C) Stress reaction by activation of corticosteroid (Cesana et al., 2011). signaling through NR3C2R. miR-135a and miR- Function: Critical in myogenesis by targeting 124 are thus important components of the stress MEF2C. miR-135a inhibits MEF2C, leading to signaling response in the brain (Mannironi et al., inhibition of muscle genes. LincRNA MD1 sponges 2013). miR-135a, allowing transcription of muscle genes.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 721 MIR135A1 (microRNA 135a-1) Navarro A, et al.

LincRNA MD1 is reduced in Duchenne muscle Nagel R, le Sage C, Diosdado B, van der Waal M, Oude cells, so miR-135a is overexpressed and MEFC2 is Vrielink JA, Bolijn A, Meijer GA, Agami R. Regulation of the adenomatous polyposis coli gene by the miR-135 downregulated (Cesana et al., 2011). family in colorectal cancer. Cancer Res. 2008 Jul Preimplantation embryo development 15;68(14):5795-802 Note Navarro A, Gaya A, Martinez A, Urbano-Ispizua A, Pons A, Balagué O, Gel B, Abrisqueta P, Lopez-Guillermo A, miRNA expression: Overexpressed in mouse Artells R, Montserrat E, Monzo M. MicroRNA expression zygote and decreased thereafter, indicating that it is profiling in classic Hodgkin lymphoma. Blood. 2008 Mar a zygote-specific miRNA. 1;111(5):2825-32 Targets: SIAH1A (E3 ubiquitin ligase seven in Greco S, De Simone M, Colussi C, Zaccagnini G, absentia homolog 1A). Fasanaro P, Pescatori M, Cardani R, Perbellini R, Isaia E, Function: miR-135a modulates the first cell Sale P, Meola G, Capogrossi MC, Gaetano C, Martelli F. Common micro-RNA signature in skeletal muscle damage cleavage through regulation of Siah1a. When miR- and regeneration induced by Duchenne muscular 135a is inhibited, first cell cleavage is suppressed. dystrophy and acute ischemia. FASEB J. 2009 mir-135a regulates proteosomal degradation (Pang Oct;23(10):3335-46 et al., 2011). Navarro A, Diaz T, Martinez A, Gaya A, Pons A, Gel B, Codony C, Ferrer G, Martinez C, Montserrat E, Monzo M. Mouse embryonic stem cells Regulation of JAK2 by miR-135a: prognostic impact in Note classic Hodgkin lymphoma. Blood. 2009 Oct miRNA expression: Upregulated during mouse 1;114(14):2945-51 embryonic stem cell differentiation. Gonsalves CS, Kalra VK. Hypoxia-mediated expression of Targets: SIRT1 (sirtuin 1). 5-lipoxygenase-activating protein involves HIF-1alpha and NF-kappaB and microRNAs 135a and 199a-5p. J Function: Together with miR-181a, miR-181b, Immunol. 2010 Apr 1;184(7):3878-88 miR-9, miR-204 and miR-199b, miR-135a suppressed SIRT1 protein expression during mouse Saunders LR, Sharma AD, Tawney J, Nakagawa M, Okita K, Yamanaka S, Willenbring H, Verdin E. miRNAs regulate embryonic stem cell differentiation (Saunders et al., SIRT1 expression during mouse embryonic stem cell 2010). differentiation and in adult mouse tissues. Aging (Albany Bovine blastocyst development NY). 2010 Jul;2(7):415-31 Sõber S, Laan M, Annilo T. MicroRNAs miR-124 and miR- Note 135a are potential regulators of the mineralocorticoid miRNA expression: miR-135a is part of a receptor gene (NR3C2) expression. Biochem Biophys Res downregulated miRNA signature in more mature Commun. 2010 Jan 1;391(1):727-32 stage (Goossens et al., 2013). Cesana M, Cacchiarelli D, Legnini I, Santini T, Sthandier O, Chinappi M, Tramontano A, Bozzoni I. A long Megakaryocytopoiesis noncoding RNA controls muscle differentiation by Note functioning as a competing endogenous RNA. Cell. 2011 Oct 14;147(2):358-69 miRNA expression: A comparison between differentiated megakaryocytes with AML Holleman A, Chung I, Olsen RR, Kwak B, Mizokami A, megakaryocytic cell lines found miR-135a higher in Saijo N, Parissenti A, Duan Z, Voest EE, Zetter BR. miR- 135a contributes to paclitaxel resistance in tumor cells AML samples (Garzon et al., 2006). both in vitro and in vivo. Oncogene. 2011 Oct Hypoxia 27;30(43):4386-98 Li LN, Zhang HD, Zhi R, Yuan SJ. Down-regulation of Note some miRNAs by degrading their precursors contributes to miRNA expression: Downregulation of miR-135a anti-cancer effect of mistletoe lectin-I. Br J Pharmacol. (and miR199a-5p) in response to hypoxia. 2011 Jan;162(2):349-64 Targets: FLAP (5-lipoxygenase activating protein) Pang RT, Liu WM, Leung CO, Ye TM, Kwan PC, Lee KF, (Gonsalves and Kalra, 2010). Yeung WS. miR-135A regulates preimplantation embryo development through down-regulation of E3 Ubiquitin Ligase Seven In Absentia Homolog 1A (SIAH1A) References expression. PLoS One. 2011;6(11):e27878 Garzon R, Pichiorri F, Palumbo T, Iuliano R, Cimmino A, Petracco R, Grechukhina O, Popkhadze S, Massasa E, Aqeilan R, Volinia S, Bhatt D, Alder H, Marcucci G, Calin Zhou Y, Taylor HS. MicroRNA 135 regulates HOXA10 GA, Liu CG, Bloomfield CD, Andreeff M, Croce CM. expression in endometriosis. J Clin Endocrinol Metab. MicroRNA fingerprints during human 2011 Dec;96(12):E1925-33 megakaryocytopoiesis. Proc Natl Acad Sci U S A. 2006 Mar 28;103(13):5078-83 Chen Y, Zhang J, Wang H, Zhao J, Xu C, Du Y, Luo X, Zheng F, Liu R, Zhang H, Ma D. miRNA-135a promotes Li Z, Hassan MQ, Volinia S, van Wijnen AJ, Stein JL, breast cancer cell migration and invasion by targeting Croce CM, Lian JB, Stein GS. A microRNA signature for a HOXA10. BMC Cancer. 2012 Mar 23;12:111 BMP2-induced osteoblast lineage commitment program. Proc Natl Acad Sci U S A. 2008 Sep 16;105(37):13906-11 Hidaka H, Seki N, Yoshino H, Yamasaki T, Yamada Y,

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 722 MIR135A1 (microRNA 135a-1) Navarro A, et al.

Nohata N, Fuse M, Nakagawa M, Enokida H. Tumor Goossens K, Mestdagh P, Lefever S, Van Poucke M, Van suppressive microRNA-1285 regulates novel molecular Zeveren A, Van Soom A, Vandesompele J, Peelman L. targets: aberrant expression and functional significance in Regulatory microRNA network identification in bovine renal cell carcinoma. Oncotarget. 2012 Jan;3(1):44-57 blastocyst development. Stem Cells Dev. 2013 Jul 1;22(13):1907-20 Liu S, Guo W, Shi J, Li N, Yu X, Xue J, Fu X, Chu K, Lu C, Zhao J, Xie D, Wu M, Cheng S, Liu S. MicroRNA-135a Mannironi C, Camon J, De Vito F, Biundo A, De Stefano contributes to the development of portal vein tumor ME, Persiconi I, Bozzoni I, Fragapane P, Mele A, Presutti thrombus by promoting metastasis in hepatocellular C. Acute stress alters amygdala microRNA miR-135a and carcinoma. J Hepatol. 2012 Feb;56(2):389-96 miR-124 expression: inferences for corticosteroid dependent stress response. PLoS One. 2013;8(9):e73385 Lv SQ, Kim YH, Giulio F, Shalaby T, Nobusawa S, Yang H, Zhou Z, Grotzer M, Ohgaki H. Genetic alterations in Zhou L, Qiu T, Xu J, Wang T, Wang J, Zhou X, Huang Z, microRNAs in medulloblastomas. Brain Pathol. 2012 Zhu W, Shu Y, Liu P. miR-135a/b modulate cisplatin Mar;22(2):230-9 resistance of human lung cancer cell line by targeting MCL1. Pathol Oncol Res. 2013 Oct;19(4):677-83 Vickers MM, Bar J, Gorn-Hondermann I, Yarom N, Daneshmand M, Hanson JE, Addison CL, Asmis TR, Díaz-Beyá M, Brunet S, Nomdedéu J, Tejero R, Díaz T, Jonker DJ, Maroun J, Lorimer IA, Goss GD, Dimitroulakos Pratcorona M, Tormo M, Ribera JM, Escoda L, Duarte R, J. Stage-dependent differential expression of microRNAs Gallardo D, Heras I et al.. MicroRNA expression at in colorectal cancer: potential role as markers of metastatic diagnosis adds relevant prognostic information to disease. Clin Exp Metastasis. 2012 Feb;29(2):123-32 molecular categorization in patients with intermediate-risk cytogenetic acute myeloid leukemia. Leukemia. 2014 Wu H, Huang M, Cao P, Wang T, Shu Y, Liu P. MiR-135a Apr;28(4):804-12 targets JAK2 and inhibits gastric cancer cell proliferation. Cancer Biol Ther. 2012 Mar;13(5):281-8 Golubovskaya VM, Sumbler B, Ho B, Yemma M, Cance WG. MiR-138 and MiR-135 directly target focal adhesion Wu S, Lin Y, Xu D, Chen J, Shu M, Zhou Y, Zhu W, Su X, kinase, inhibit cell invasion, and increase sensitivity to Zhou Y, Qiu P, Yan G. MiR-135a functions as a selective chemotherapy in cancer cells. Anticancer Agents Med killer of malignant glioma. Oncogene. 2012 Aug Chem. 2014 Jan;14(1):18-28 23;31(34):3866-74 Leung CO, Deng W, Ye TM, Ngan HY, Tsao SW, Cheung Zhou W, Li X, Liu F, Xiao Z, He M, Shen S, Liu S. MiR- AN, Pang RT, Yeung WS. miR-135a leads to cervical 135a promotes growth and invasion of colorectal cancer cancer cell transformation through regulation of β-catenin via metastasis suppressor 1 in vitro. Acta Biochim Biophys via a SIAH1-dependent ubiquitin proteosomal pathway. Sin (Shanghai). 2012 Oct;44(10):838-46 Carcinogenesis. 2014 Feb 25; Agarwal P, Srivastava R, Srivastava AK, Ali S, Datta M. Moritoki Y, Hayashi Y, Mizuno K, Kamisawa H, Nishio H, miR-135a targets IRS2 and regulates insulin signaling and Kurokawa S, Ugawa S, Kojima Y, Kohri K. Expression glucose uptake in the diabetic gastrocnemius skeletal profiling of microRNA in cryptorchid testes: miR-135a muscle. Biochim Biophys Acta. 2013 Aug;1832(8):1294- contributes to the maintenance of spermatogonial stem 303 cells by regulating FoxO1. J Urol. 2014 Apr;191(4):1174- Cheng M, Yang L, Yang R, Yang X, Deng J, Yu B, Huang 80 D, Zhang S, Wang H, Qiu F, Zhou Y, Lu J. A microRNA- 135a/b binding polymorphism in CD133 confers decreased This article should be referenced as such: risk and favorable prognosis of lung cancer in Chinese by Navarro A, Díaz-Beyá M, Monzó M. MIR135A1 (microRNA reducing CD133 expression. Carcinogenesis. 2013 135a-1). Atlas Genet Cytogenet Oncol Haematol. 2014; Oct;34(10):2292-9 18(10):718-723.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 723

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

MIR143 (MicroRNA 143) Ava Kwong, Vivian Y Shin, John C W Ho Department of Surgery, The University of Hong Kong, Hong Kong, China (AK, VYS, JCWH)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/MIR143ID50848ch5q32.html DOI: 10.4267/2042/54133 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract DNA/RNA Review on MIR143, with data on DNA/RNA and Description where the gene is implicated. hsa-miR-143 is clustered with miR-145, which are separated by approximately 1.6 kb, and are located Identity within an intergenic region on chromosome 5 Other names: MIRN143 (5q32). Positions of the clustered miRNAs are: HGNC (Hugo): MIR143 - hsa-mir-143: chr5: 148808481-148808586 [+] - hsa-mir-145: chr5: 148810209-148810296 [+]. Location: 5q32 Local order: According to RefSeq, hsa-miR-143 is Transcription clustered together with hsa-miR-145, and this The miR-143/145 cluster was demonstrated to be microRNA-143/145 cluster is located in the non- transcribed from a non-protein coding host gene protein coding MIR143 host gene (MIR143HG). (MIR143HG; GenBank: NR_027180) into an 11 kb Genes flanking hsa-miR-143 are: PCYOX1L primary miRNA transcript (pri-miRNA), which was (prenylcysteine oxidase 1 like; + strand), IL17B then processed into the mature microRNAs (Iio et (interleukin 17B; - strand), MIR143 host gene (+ al., 2010). Expression of the cluster host gene and strand), CSNK1A1 (casein kinase 1 alpha 1; - mature miR-143 were found to be reduced in strand), and RPL29P14 (ribosomal protein L29 various human cancer tissues and cell lines (Iio et pseudogene 14; - strand). al., 2010).

Genes flanking hsa-miR-143 on chromosome 5q32. The red arrow indicates the position and orientation of miR-143.

The stem-loop structure of hsa-miR-143, with sequences of mature miR-143-5p and miR-143-3p highlighted in red.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 724 MIR143 (MicroRNA 143) Kwong A, et al.

DEAD-box RNA helicase 6 (DDX6) was reported Colorectal cancer to post-transcriptionally down-regulate miR- Note 143/145 levels by increasing the instability of miR-143 level was found to be down-regulated in MIR143 host gene RNA product (Iio et al., 2013). colorectal cancer patients' blood and tumour tissues. Moreover, tumour suppressor protein p53 was Over-expression of miR-143 inhibited tumour reported to enhance the miR-143 maturation in a growth and angiogenesis, and increased the transcription-independent manner (Suzuki et al., chemosensitivity to oxaliplatin treatment (Qian et 2009). al., 2013). Pre-mir-143: miR-143 was also reported to reduce the invasion - Accession no.: MI0000459 and migration of colorectal carcinoma cells by - Length: 106 nt targeting the Toll-like receptor 2 (TLR2) signalling - Sequence: pathway (Guo et al., 2013). GCGCAGCGCCCUGUCUCCCAGCCUGAGGU GCAGUGCUGCAUCUCUGGUCAGUUGGGAG Pancreatic cancer UCUGAGAUGAAGCACUGUAGCUCAGGAAG Note AGAGAAGUUGUUCUGCAGC Mature hsa-miR-143-5p: miR-143 was reported to modulate the - Accession no.: MIMAT0004599 prostaglandin E 2 (PGE 2) production and PGE 2- - Length: 22 nt mediated cellular proliferation, in pancreatic cancer - Sequence: cells, by targeting the COX-2 mRNA stability and 27- GGUGCAGUGCUGCAUCUCUGGU -48 expression (Pham et al., 2013). Mature hsa-miR-143-3p: Esophageal squamous cell - Accession no.: MIMAT0000435 carcinoma - Length: 21 nt - Sequence: Note 61- UGAGAUGAAGCACUGUAGCUC -81 miR-143 expression was reduced in esophageal squamous cell carcinoma (ESCC) tissues as Pseudogene compared with the adjacent normal tissues. No pseudogenes were reported for miR-143. Restoration of the miR-143 expression was demonstrated to induce ESCC cells apoptosis and Protein suppress the cell migration and invasion (Ni et al., 2013). Note miRNAs are not translated into amino acids. Prostate cancer cells Note Mutations miR-143 and miR-145 were reported to inhibit the Note cell viability and tumorigenicity of the bone metastatic prostate cancer cells, PC-3. No mutations have been reported within the They were suggested to play an important role in precursor or mature miR143 sequences. the bone metastasis of prostate cancer by regulating However, several single nucleotide variations the cancer stem cell characteristics (Huang et al., (SNVs), including rs41291957, rs4705343, 2012). rs353292, rs353293, rs17796757, rs4705341, rs3733845, rs3733846, rs353286 and rs17796714, Cervical cancer have been reported within the MIR143 host gene Note sequence, upstream of the miR-143/145 cluster. miR-143 level was deregulated in cervical cancer tissues, as demonstrated by miRNA microarray Implicated in (Liu et al., 2012). Non-small cell lung cancer Over-expression of miR-143 in HeLa cells was reported to promote apoptosis and suppress Note xenograft tumour formation, by targeting the Bcl-2 miR-143 has been found to be down-regulated in gene. non-small cell lung cancer (NSCLC) tissues and was negatively correlated with PKC ε expression. Bladder cancer cells It was shown to regulate PKC ε expression and was Note associated with apoptosis in NSCLC cells (Zhang et miR-143 and miR-145 co-treatment on bladder al., 2013b). cancer cell lines, T24 and NKB1, was showed to

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 725 MIR143 (MicroRNA 143) Kwong A, et al.

synergistically inhibit cell growth by suppressing in the head and neck squamous cell carcinomas the PI3K/Akt and MAPK signalling pathways (Zhang et al., 2013a). (Noguchi et al., 2013). Liposarcoma References Note Suzuki HI, Yamagata K, Sugimoto K, Iwamoto T, Kato S, miR-143 expression was found to be reduced in Miyazono K. Modulation of microRNA processing by p53. both well-differentiated (WDLS) and Nature. 2009 Jul 23;460(7254):529-33 dedifferentiated liposarcomas (DDLS). Re- Iio A, Nakagawa Y, Hirata I, Naoe T, Akao Y. Identification expression of miR-143 inhibited DDLS cell of non-coding RNAs embracing microRNA-143/145 cluster. Mol Cancer. 2010 Jun 2;9:136 proliferation, induced apoptosis, and suppressed the expression of a module of genes including Bcl-2, Ugras S, Brill E, Jacobsen A, Hafner M, Socci ND, Decarolis PL, Khanin R, O'Connor R, Mihailovic A, Taylor topoisomerase 2A (TOP2A), polo-like kinase BS, Sheridan R, Gimble JM, Viale A, Crago A, Antonescu 1(PLK1), and protein regulator of cytokinesis 1 CR, Sander C, Tuschl T, Singer S. Small RNA sequencing (PRC1) (Ugras et al., 2011). and functional characterization reveals MicroRNA-143 tumor suppressor activity in liposarcoma. Cancer Res. Breast cancer 2011 Sep 1;71(17):5659-69 Note Fang R, Xiao T, Fang Z, Sun Y, Li F, Gao Y, Feng Y, Li L, Reduced levels of miR-143 was demonstrated in Wang Y, Liu X, Chen H, Liu XY, Ji H. MicroRNA-143 (miR- different breast cancer cell lines and primary 143) regulates cancer glycolysis via targeting hexokinase 2 gene. J Biol Chem. 2012 Jun 29;287(27):23227-35 tumours. Restoration of the miR-143 expression in breast cancer cells was found to inhibit cell Gregersen LH, Jacobsen A, Frankel LB, Wen J, Krogh A, proliferation and the formation of soft agar Lund AH. MicroRNA-143 down-regulates Hexokinase 2 in colon cancer cells. BMC Cancer. 2012 Jun 12;12:232 colonies. DNA methyltransferase 3A (DNMT3A) was validated as a direct target of miR-143, which Huang S, Guo W, Tang Y, Ren D, Zou X, Peng X. miR-143 and miR-145 inhibit stem cell characteristics of PC-3 resulted in the regulation of phosphatase and tensin prostate cancer cells. Oncol Rep. 2012 Nov;28(5):1831-7 homolog (PTEN) and TNFRSF10C promoter methylation (Ng et al., 2013). Jiang S, Zhang LF, Zhang HW, Hu S, Lu MH, Liang S, Li B, Li Y, Li D, Wang ED, Liu MF. A novel miR-155/miR-143 Ulcerative oesophagitis cascade controls glycolysis by regulating hexokinase 2 in breast cancer cells. EMBO J. 2012 Apr 18;31(8):1985-98 Note Liu L, Yu X, Guo X, Tian Z, Su M, Long Y, Huang C, Zhou Up-regulation of miR-143 expression was reported F, Liu M, Wu X, Wang X. miR-143 is downregulated in in the oesophageal mucosa of ulcerative cervical cancer and promotes apoptosis and inhibits tumor oesophagitis patients. It was suggested to induce formation by targeting Bcl-2. Mol Med Rep. 2012 apoptosis, and regulate the cell proliferation of Mar;5(3):753-60 oesophageal epithelium in response to gastro- Guo H, Chen Y, Hu X, Qian G, Ge S, Zhang J. The oesophageal reflux (Smith et al., 2013). regulation of Toll-like receptor 2 by miR-143 suppresses the invasion and migration of a subset of human colorectal Glucose Metabolism carcinoma cells. Mol Cancer. 2013 Jul 17;12:77 Note Iio A, Takagi T, Miki K, Naoe T, Nakayama A, Akao Y. miR-143 was reported to inhibit glycolysis in a DDX6 post-transcriptionally down-regulates miR-143/145 variety of cancer cells, including breast cancer, expression through host gene NCR143/145 in cancer cells. Biochim Biophys Acta. 2013 Oct;1829(10):1102-10 glioblastoma, colon cancer, head and neck squamous cell carcinoma, and lung cancer (Fang et Ni Y, Meng L, Wang L, Dong W, Shen H, Wang G, Liu Q, Du J. MicroRNA-143 functions as a tumor suppressor in al., 2012; Gregersen et al., 2012; Jiang et al., 2012; human esophageal squamous cell carcinoma. Gene. 2013 Peschiaroli et al., 2013; Zhao et al., 2013). Apr 1;517(2):197-204 Hexokinase 2 (HK2) was validated as a direct target Noguchi S, Yasui Y, Iwasaki J, Kumazaki M, Yamada N, of miR-143, in which their interaction was Naito S, Akao Y. Replacement treatment with microRNA- hypothesized to be an important regulator of 143 and -145 induces synergistic inhibition of the growth of glucose metabolism in cancer cells. human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways. Cancer Lett. 2013 Jan MDM2-p53 pathway 28;328(2):353-61 Note Peschiaroli A, Giacobbe A, Formosa A, Markert EK, miR-143 and miR-145 were reported to negatively Bongiorno-Borbone L, Levine AJ, Candi E, D'Alessandro A, Zolla L, Finazzi Agrò A, Melino G. miR-143 regulates modulate MDM2 expression and were post- hexokinase 2 expression in cancer cells. Oncogene. 2013 transcriptionally activated by tumour suppressor Feb 7;32(6):797-802 protein p53. Together, miR-143/145, MDM2 and Pham H, Rodriguez CE, Donald GW, Hertzer KM, Jung p53 form a regulatory feedback loop that was XS, Chang HH, Moro A, Reber HA, Hines OJ, Eibl G. miR- shown to modulate cell proliferation and apoptosis 143 decreases COX-2 mRNA stability and expression in

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 726 MIR143 (MicroRNA 143) Kwong A, et al.

pancreatic cancer cells. Biochem Biophys Res Commun. Zhang N, Su Y, Xu L. Targeting PKC ε by miR-143 2013 Sep 13;439(1):6-11 regulates cell apoptosis in lung cancer. FEBS Lett. 2013b Nov 15;587(22):3661-7 Qian X, Yu J, Yin Y, He J, Wang L, Li Q, Zhang LQ, Li CY, Shi ZM, Xu Q, Li W, Lai LH, Liu LZ, Jiang BH. MicroRNA- Zhao S, Liu H, Liu Y, Wu J, Wang C, Hou X, Chen X, Yang 143 inhibits tumor growth and angiogenesis and sensitizes G, Zhao L, Che H, Bi Y, Wang H, Peng F, Ai J. miR-143 chemosensitivity to oxaliplatin in colorectal cancers. Cell inhibits glycolysis and depletes stemness of glioblastoma Cycle. 2013 May 1;12(9):1385-94 stem-like cells. Cancer Lett. 2013 Jun 10;333(2):253-60 Smith CM, Michael MZ, Watson DI, Tan G, Astill DS, Ng EK, Li R, Shin VY, Siu JM, Ma ES, Kwong A. Hummel R, Hussey DJ. Impact of gastro-oesophageal MicroRNA-143 is downregulated in breast cancer and reflux on microRNA expression, location and function. regulates DNA methyltransferases 3A in breast cancer BMC Gastroenterol. 2013 Jan 8;13:4 cells. Tumour Biol. 2014 Mar;35(3):2591-8

Zhang J, Sun Q, Zhang Z, Ge S, Han ZG, Chen WT. Loss This article should be referenced as such: of microRNA-143/145 disturbs cellular growth and apoptosis of human epithelial cancers by impairing the Kwong A, Shin VY, Ho JCW. MIR143 (MicroRNA 143). MDM2-p53 feedback loop. Oncogene. 2013a Jan Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10):724- 3;32(1):61-9 727.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 727

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Short Communication

POU1F1 (POU class 1 homeobox 1) Jean-Louis Franc, Denis Becquet, Anne-Marie François-Bellan CRN2M, UMR7286 Aix-Marseille Universite, CNRS, Faculte de Medecine, Bd P. Dramard, Marseille, France (JLF, DB, AMFB)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/POU1F1ID46362ch3p11.html DOI: 10.4267/2042/54134 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Description Short communication on POU1F1, with data on The human POU1F1 gene is composed of 6 exons DNA/RNA, on the protein encoded and where the (Theill et al., 1992). gene is implicated. Transcription Identity Two transcripts have been reported for this gene. Other names: CPHD1, GHF-1, PIT1, POU1F1a, Protein Pit-1 Description HGNC (Hugo): POU1F1 The main protein isoform expressed in pituitary Location: 3p11.2 cells is POU1F1 α. This isoform, also named PIT-1.b or PIT-1α, has DNA/RNA 291 aa. Note The predicted protein corresponding to POU1F1 β, The anterior pituitary-specific transcription factor also named PIT-1.a or PIT-1β, has 317 aa and acts POU1F1 was initially identified and cloned as a as a repressor in pituitary cells (Theill et al., 1992; transactivator of prolactin (PRL), growth hormone Jonsen et al., 2009). POU1F1 is structurally related (GH), and TSH β-subunit genes (Bodner et al., to the POU family of transcriptional regulators, 1988; Ingraham et al., 1988). Transcription containing a characteristic POU domain divided produces 2 alternatively spliced mRNAs α into two regions, the POU-specific and homeo (NM_000306.2) and β (NM_001122757.1). subdomains.

Structure of POU1F1 gene and its transcripts encoded on minus strand of chromosome 3.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 728 POU1F1 (POU class 1 homeobox 1) Franc JL, et al.

The POUs-specific domain consists of 75 amino acids, comprises 4 α-helices, and contributes to the Implicated in DNA binding specificity and protein / protein interactions (Ingraham et al., 1990; Jacobson et al., Pituitary adenoma 1997). The homeodomain is composed of 60 amino Prognosis and contains 3 α-helices. The N-terminal part of POU1F1 is overexpressed in GH, PRL and TSH POU1F1 is involved in the transcriptional activity. pituitary adenomas (Asa et al., 1993; Delhase et al., POU1F1 binds as a dimer to most DNA response 1993; Pellegrini et al., 1994) and the increased elements (for review see Phillips and Luisi, 2000). expression in adenomas is compatible with the role Expression of POU1F1 in cell proliferation. Interestingly, human non-functioning pituitary adenomas also The expression of POU1F1 is largely restricted in express POU1F1, especially it was expressed in all the pituitary gland in somato- thyreo- and lacto- alpha SU positive nonfunctioning adenomas trope cells, but this factor is also expressed in some (Osamura et al., 1999). extrapituitary tissues and cell lines, including the mammary gland (Gil-Puig et al., 2002). Combined pituitary hormone Localisation deficiency (CPHD) The localization of POU1F1 is nuclear. Prognosis In humans, mutation in the POU1F1 gene has been Function shown to be responsible for combined pituitary POU1F1 is a member of the POU family of hormone deficiency. This syndrome is a disease transcription factors. This factor is required for characterized by the lack of PRL, GH, and TSHbeta terminal differentiation of the somatotrope, produced by the somato- lacto- and thyreo-tropes lactotrope and thyrotrope cell types (Ingraham et cells. At least sixteen distinct recessive or dominant al., 1988; Cohen et al., 1996). This factor is also POU1F1 mutations have been described to date implicated in the cell growth and prevents the (Cushman et al., 2002; Dattani, 2005). The apoptotic cell death (Pellegrini et al., 2006). molecular mechanisms underlying their effects can be dominant inhibition of transcription or inability Mutations to bind to DNA. The R271W mutation is the most Note commonly occurring POU1F1 gene defect In humans, mutation in the POU1F1 gene has been (Radovick et al., 1992). Other mutations, such as shown to be responsible for combined pituitary F135C, show a decreased transactivation activity hormone deficiency (for review see Quentien et al., although the DNA binding property is conserved 2006) (see below). (Vallette-Kasic et al., 2001).

Location of the Pit-1 gene mutation.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 729 POU1F1 (POU class 1 homeobox 1) Franc JL, et al.

Breast carcinoma Aggarwal AK. Structure of Pit-1 POU domain bound to DNA as a dimer: unexpected arrangement and flexibility. Prognosis Genes Dev. 1997 Jan 15;11(2):198-212 POU1F1 was expressed in normal human breast Osamura RY, Tahara S, Komatsubara K, Itoh Y, Kajiwara tissue but its mRNA expression levels is H, Kurotani R, Sanno N, Teramoto A. Pit-1 positive alpha- significantly higher in breast adenocarcinoma. This subunit positive nonfunctioning human pituitary adenomas: deregulation promotes tumor growth and metastasis a dedifferentiated GH cell lineage? Pituitary. 1999 May;1(3-4):269-71 (Gil-Puig et al., 2005; Ben-Batalla et al., 2010). Phillips K, Luisi B. The virtuoso of versatility: POU proteins Acute myeloid leukemia that flex to fit. J Mol Biol. 2000 Oct 6;302(5):1023-39 Prognosis Vallette-Kasic S, Pellegrini-Bouiller I, Sampieri F, Gunz G, In acute myeloid leukemia POU1F1 has been Diaz A, Radovick S, Enjalbert A, Brue T. Combined identified as a new fusion partner of NUP98 gene pituitary hormone deficiency due to the F135C human Pit-1 (pituitary-specific factor 1) gene mutation: functional and (Lisboa et al., 2013). structural correlates. Mol Endocrinol. 2001 Mar;15(3):411- 20 References Cushman LJ, Showalter AD, Rhodes SJ. Genetic defects Bodner M, Castrillo JL, Theill LE, Deerinck T, Ellisman M, in the development and function of the anterior pituitary Karin M. The pituitary-specific transcription factor GHF-1 is gland. Ann Med. 2002;34(3):179-91 a homeobox-containing protein. Cell. 1988 Nov Gil-Puig C, Blanco M, García-Caballero T, Segura C, 4;55(3):505-18 Pérez-Fernández R. Pit-1/GHF-1 and GH expression in Ingraham HA, Chen RP, Mangalam HJ, Elsholtz HP, Flynn the MCF-7 human breast adenocarcinoma cell line. J SE, Lin CR, Simmons DM, Swanson L, Rosenfeld MG. A Endocrinol. 2002 Apr;173(1):161-7 tissue-specific transcription factor containing a Dattani MT. Growth hormone deficiency and combined homeodomain specifies a pituitary phenotype. Cell. 1988 pituitary hormone deficiency: does the genotype matter? Nov 4;55(3):519-29 Clin Endocrinol (Oxf). 2005 Aug;63(2):121-30 Ingraham HA, Flynn SE, Voss JW, Albert VR, Kapiloff MS, Gil-Puig C, Seoane S, Blanco M, Macia M, Garcia- Wilson L, Rosenfeld MG. The POU-specific domain of Pit- Caballero T, Segura C, Perez-Fernandez R. Pit-1 is 1 is essential for sequence-specific, high affinity DNA expressed in normal and tumorous human breast and binding and DNA-dependent Pit-1-Pit-1 interactions. Cell. regulates GH secretion and cell proliferation. Eur J 1990 Jun 15;61(6):1021-33 Endocrinol. 2005 Aug;153(2):335-44 Radovick S, Nations M, Du Y, Berg LA, Weintraub BD, Pellegrini I, Roche C, Quentien MH, Ferrand M, Gunz G, Wondisford FE. A mutation in the POU-homeodomain of Thirion S, Bagnis C, Enjalbert A, Franc JL. Involvement of Pit-1 responsible for combined pituitary hormone the pituitary-specific transcription factor pit-1 in deficiency. Science. 1992 Aug 21;257(5073):1115-8 somatolactotrope cell growth and death: an approach Theill LE, Hattori K, Lazzaro D, Castrillo JL, Karin M. using dominant-negative pit-1 mutants. Mol Endocrinol. Differential splicing of the GHF1 primary transcript gives 2006 Dec;20(12):3212-27 rise to two functionally distinct homeodomain proteins. Quentien MH, Barlier A, Franc JL, Pellegrini I, Brue T, EMBO J. 1992 Jun;11(6):2261-9 Enjalbert A. Pituitary transcription factors: from congenital Asa SL, Puy LA, Lew AM, Sundmark VC, Elsholtz HP. Cell deficiencies to gene therapy. J Neuroendocrinol. 2006 type-specific expression of the pituitary transcription Sep;18(9):633-42 activator pit-1 in the human pituitary and pituitary Jonsen MD, Duval DL, Gutierrez-Hartmann A. The 26- adenomas. J Clin Endocrinol Metab. 1993 Nov;77(5):1275- amino acid beta-motif of the Pit-1beta transcription factor is 80 a dominant and independent repressor domain. Mol Delhase M, Vergani P, Malur A, Velkeniers B, Teugels E, Endocrinol. 2009 Sep;23(9):1371-84 Trouillas J, Hooghe-Peters EL. Pit-1/GHF-1 expression in Ben-Batalla I, Seoane S, Garcia-Caballero T, Gallego R, pituitary adenomas: further analogy between human Macia M, Gonzalez LO, Vizoso F, Perez-Fernandez R. adenomas and rat SMtTW tumours. J Mol Endocrinol. Deregulation of the Pit-1 transcription factor in human 1993 Oct;11(2):129-39 breast cancer cells promotes tumor growth and Pellegrini I, Barlier A, Gunz G, Figarella-Branger D, metastasis. J Clin Invest. 2010 Dec;120(12):4289-302 Enjalbert A, Grisoli F, Jaquet P. Pit-1 gene expression in Lisboa S, Cerveira N, Bizarro S, Correia C, Vieira J, Torres the human pituitary and pituitary adenomas. J Clin L, Mariz JM, Teixeira MR. POU1F1 is a novel fusion Endocrinol Metab. 1994 Jul;79(1):189-96 partner of NUP98 in acute myeloid leukemia with Cohen LE, Wondisford FE, Radovick S. Role of Pit-1 in the t(3;11)(p11;p15). Mol Cancer. 2013 Jan 18;12:5 gene expression of growth hormone, prolactin, and thyrotropin. Endocrinol Metab Clin North Am. 1996 This article should be referenced as such: Sep;25(3):523-40 Franc JL, Becquet D, François-Bellan AM. POU1F1 (POU Jacobson EM, Li P, Leon-del-Rio A, Rosenfeld MG, class 1 homeobox 1). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10):728-730.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 730

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

RAD52 (RAD52 homolog (S. cerevisiae)) Benjamin H Lok, Simon N Powell Memorial Sloan-Kettering Cancer Center, New York, New York 10065, USA (BHL, SNP)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/RAD52ID349ch12p13.html DOI: 10.4267/2042/54135 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Thorpe and colleagues describe two splice variants Abstract that conferred increased homology-directed repair Review on RAD52, with data on DNA/RNA, on the in the murine RAD52 gene RAD52 ∆exon4 and protein encoded and where the gene is implicated. RAD52+intron8 (Thorpe et al., 2006). Identity Protein HGNC (Hugo): RAD52 Note Location: 12p13.33 The human RAD52 (hRAD52) protein is similar to the Saccharomyces cerevisiae RAD52 protein DNA/RNA (ScRAD52) both structurally and biochemically. However the phenotypic properties of RAD52, Note particularly in mediating homologous The human and murine RAD52 gene is composed recombination varies amongst the evolutionary of 12 exons. spectrum. Kito et al. identified three RAD52 isoforms designated RAD52 β (226 amino acids), RAD52 γ Description (139 amino acids), and RAD52 δ (118 amino acids) hRAD52 protein is comprised of 418 amino acids which were able to bind ssDNA and dsDNA much and forms a heptameric ring (Stasiak et al., 2000), like reference RAD52 (RAD52 α). However, these which is mediated by the N-terminus (Ranatunga et isoforms lacked the ability to associate with al., 2001). This N-terminal portion binds ssDNA RAD52 α (Kito et al., 1999). (Mortensen et al., 1996).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 731 RAD52 (RAD52 homolog (S. cerevisiae)) Lok BH, Powell SN

Secondary structure of the hRAD52 protein. From Uniprot.org (Creative Commons License).

The well-studied hRAD52 1-212 is the N-terminal hRAD52 sub-nuclear foci formation after exposure portion which forms an undecameric ringed to ionizing radiation is dependent on c-Abl- polymer (Kagawa et al., 2002). mediated phosphorylation (Kitao and Yuan, 2002). DNA binding properties are linked to various amino acids, including, Arg-55, Tyr-65, Lys-152, Arg-153, Arg-156. Arg-55 and Lys-152 are necessarily for ssDNA binding, whereas Tyr-65, Arg-152, and Arg-156 are essential for binding both ssDNA and dsDNA (Kagawa et al., 2002). Phe-79 and Lys-102 have also shown a role in ssDNA and dsDNA binding, respectively (Lloyd et al., 2005). Interfering with the Phe-79 of hRAD52 was recently demonstrated to disrupt the RAD52-DNA interaction leading to an accumulation of DNA double-strand breaks (DSBs) particularly in BRCA1/2 deficient cells (Cramer-Morales et al., 2013). Further study is required to decipher the hierarchy of these respective sites and study additional novel binding sites. Please see the following diagram for the location of several of these amino acid sites. Localisation

ScRAD52 is a nuclear protein and predominantly recruited into sub-nuclear foci during the S-phase of Secondary structure of the hRAD52 protein. From Kagawa the cell cycle (Lisby et al., 2001). et al. 2002, with permission from Elsevier.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 732 RAD52 (RAD52 homolog (S. cerevisiae)) Lok BH, Powell SN

The hRAD52 1-212 undecameric polymer with principal DNA binding amino acid residues labeled residing in the predominantly positively charged groove. From Kagawa et al. 2002, with permission from Elsevier.

Function al., 2010), under certain conditions, hRAD52 does promote RAD51-mediated homologous DNA ScRAD52 mediates RAD51 recombination activity pairing (Baumann and West, 1999). and thus homology-directed repair (Milne and hRAD52 mediates RAD51 recombination function Weaver, 1993). hRAD52 also demonstrates this in human cancer cells deficient in BRCA1 (Cramer- ability to stimulate homologous pairing by hRAD51 Morales et al., 2013; Lok et al., 2013), PALB2 (Lok (Benson et al., 1998). The interaction of ScRAD52 et al., 2013) or BRCA2 (Feng et al., 2011). RAD52 and hRAD52 with replication protein A (RPA) is is able to mediate RAD51-mediated homology- important for the binding with ssDNA by RAD52 directed repair when the predominant BRCA1- (Hays et al., 1998; Shinohara et al., 1998; Jackson PALB2-BRCA2 homologous recombination et al., 2002). hRAD52 binds directly to DSBs, pathway is perturbed (see figure below). The protects them from exonuclease resection, and RAD52-RAD51 pathway also appears to function facilitates end-to-end interaction (Van Dyck et al., independently of the RAD51 paralogs 1999). Furthermore, capture of the second DNA RAD51B/RAD51C/RAD51D-XRCC2 (Chun et al., end in homologous recombination appears to 2013). involve RAD52-mediated annealing of RPA- ScRAD52 is required for RAD51-independent ssDNA strands in biochemical reactions (Sugiyama single-strand annealing (SSA) (Singleton et al., et al., 2006). 2002; Symington, 2002) and break-induced Although, ScRAD52 and hRAD52 does not replication (BIR) (Malkova et al., 1996; Ira and stimulate RAD51 DNA strand exchange with RPA- Haber, 2002; McEachern and Haber, 2006). ssDNA complexes in biochemical assays (Jensen et

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 733 RAD52 (RAD52 homolog (S. cerevisiae)) Lok BH, Powell SN

The BRCA and RAD52 pathways of DNA double-strand break repair. *There is currently no well-defined evidence that single-end DSBs or daughter-strand gaps are repaired by single strand annealing. From Lok and Powell, 2012.

Modified from HomoloGene.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 734 RAD52 (RAD52 homolog (S. cerevisiae)) Lok BH, Powell SN

Stasiak AZ, Larquet E, Stasiak A, Müller S, Engel A, Van Mutations Dyck E, West SC, Egelman EH. The human Rad52 protein exists as a heptameric ring. Curr Biol. 2000 Mar Note 23;10(6):337-40 Currently, there are no known mutations of RAD52 Lisby M, Rothstein R, Mortensen UH. Rad52 forms DNA that lead to human disease, including none repair and recombination centers during S phase. Proc associated with breast cancer (Bell et al., 1999), Natl Acad Sci U S A. 2001 Jul 17;98(15):8276-82 ovarian cancer (Tong et al., 2003; Beesley et al., Ranatunga W, Jackson D, Lloyd JA, Forget AL, Knight KL, 2007) or chronic lymphocytic leukemia (Sellick et Borgstahl GE. Human RAD52 exhibits two modes of self- al., 2008). association. J Biol Chem. 2001 May 11;276(19):15876-80 Ira G, Haber JE. Characterization of RAD51-independent Implicated in break-induced replication that acts preferentially with short homologous sequences. Mol Cell Biol. 2002 Resistance to platinum-based Sep;22(18):6384-92 chemotherapy Jackson D, Dhar K, Wahl JK, Wold MS, Borgstahl GE. Analysis of the human replication protein A:Rad52 Prognosis complex: evidence for crosstalk between RPA32, RPA70, There is a report of uncertain significance by Shi et Rad52 and DNA. J Mol Biol. 2002 Aug 2;321(1):133-48 al. that may link certain RAD52 variants and Kagawa W, Kurumizaka H, Ishitani R, Fukai S, Nureki O, RAD52 protein expression levels to resistance to Shibata T, Yokoyama S. Crystal structure of the platinum-based chemotherapy (Shi et al., 2012), homologous-pairing domain from the human Rad52 however no other published studies have recombinase in the undecameric form. Mol Cell. 2002 Aug;10(2):359-71 demonstrated a similar association. Kitao H, Yuan ZM. Regulation of ionizing radiation-induced Rad52 nuclear foci formation by c-Abl-mediated References phosphorylation. J Biol Chem. 2002 Dec Milne GT, Weaver DT. Dominant negative alleles of 13;277(50):48944-8 RAD52 reveal a DNA repair/recombination complex Singleton MR, Wentzell LM, Liu Y, West SC, Wigley DB. including Rad51 and Rad52. Genes Dev. 1993 Structure of the single-strand annealing domain of human Sep;7(9):1755-65 RAD52 protein. Proc Natl Acad Sci U S A. 2002 Oct Malkova A, Ivanov EL, Haber JE. Double-strand break 15;99(21):13492-7 repair in the absence of RAD51 in yeast: a possible role for Symington LS. Role of RAD52 epistasis group genes in break-induced DNA replication. Proc Natl Acad Sci U S A. homologous recombination and double-strand break 1996 Jul 9;93(14):7131-6 repair. Microbiol Mol Biol Rev. 2002 Dec;66(4):630-70, Mortensen UH, Bendixen C, Sunjevaric I, Rothstein R. table of contents DNA strand annealing is promoted by the yeast Rad52 Tong D, Volm T, Eberhardt E, Krainer M, Leodolter S, protein. Proc Natl Acad Sci U S A. 1996 Oct Kreienberg R, Zeillinger R. Rad52 gene mutations in 1;93(20):10729-34 breast/ovarian cancer families and sporadic ovarian Benson FE, Baumann P, West SC. Synergistic actions of carcinoma patients. Oncol Rep. 2003 Sep-Oct;10(5):1551- Rad51 and Rad52 in recombination and DNA repair. 3 Nature. 1998 Jan 22;391(6665):401-4 Lloyd JA, McGrew DA, Knight KL. Identification of residues Hays SL, Firmenich AA, Massey P, Banerjee R, Berg P. important for DNA binding in the full-length human Rad52 Studies of the interaction between Rad52 protein and the protein. J Mol Biol. 2005 Jan 14;345(2):239-49 yeast single-stranded DNA binding protein RPA. Mol Cell McEachern MJ, Haber JE. Break-induced replication and Biol. 1998 Jul;18(7):4400-6 recombinational telomere elongation in yeast. Annu Rev Shinohara A, Shinohara M, Ohta T, Matsuda S, Ogawa T. Biochem. 2006;75:111-35 Rad52 forms ring structures and co-operates with RPA in Sugiyama T, Kantake N, Wu Y, Kowalczykowski SC. single-strand DNA annealing. Genes Cells. 1998 Rad52-mediated DNA annealing after Rad51-mediated Mar;3(3):145-56 DNA strand exchange promotes second ssDNA capture. Baumann P, West SC. Heteroduplex formation by human EMBO J. 2006 Nov 29;25(23):5539-48 Rad51 protein: effects of DNA end-structure, hRP-A and Thorpe PH, Marrero VA, Savitzky MH, Sunjevaric I, hRad52. J Mol Biol. 1999 Aug 13;291(2):363-74 Freeman TC, Rothstein R. Cells expressing murine RAD52 Bell DW, Wahrer DC, Kang DH, MacMahon MS, splice variants favor sister chromatid repair. Mol Cell Biol. FitzGerald MG, Ishioka C, Isselbacher KJ, Krainer M, 2006 May;26(10):3752-63 Haber DA. Common nonsense mutations in RAD52. Beesley J, Jordan SJ, Spurdle AB, Song H, Ramus SJ, Cancer Res. 1999 Aug 15;59(16):3883-8 Kjaer SK, Hogdall E, DiCioccio RA, McGuire V, Kito K, Wada H, Yeh ET, Kamitani T. Identification of novel Whittemore AS, Gayther SA, Pharoah PD, Webb PM, isoforms of human RAD52. Biochim Biophys Acta. 1999 Chenevix-Trench G. Association between single- Dec 23;1489(2-3):303-14 nucleotide polymorphisms in hormone metabolism and DNA repair genes and epithelial ovarian cancer: results Van Dyck E, Stasiak AZ, Stasiak A, West SC. Binding of from two Australian studies and an additional validation double-strand breaks in DNA by human Rad52 protein. set. Cancer Epidemiol Biomarkers Prev. 2007 Nature. 1999 Apr 22;398(6729):728-31 Dec;16(12):2557-65

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 735 RAD52 (RAD52 homolog (S. cerevisiae)) Lok BH, Powell SN

Sellick G, Fielding S, Qureshi M, Catovsky D, Houlston R. Chun J, Buechelmaier ES, Powell SN. Rad51 paralog Germline mutations in RAD51, RAD51AP1, RAD51B, complexes BCDX2 and CX3 act at different stages in the RAD51C,RAD51D, RAD52 and RAD54L do not contribute BRCA1-BRCA2-dependent homologous recombination to familial chronic lymphocytic leukemia. Leuk Lymphoma. pathway. Mol Cell Biol. 2013 Jan;33(2):387-95 2008 Jan;49(1):130-3 Cramer-Morales K, Nieborowska-Skorska M, Scheibner K, Jensen RB, Carreira A, Kowalczykowski SC. Purified Padget M, Irvine DA, Sliwinski T, Haas K, Lee J, Geng H, human BRCA2 stimulates RAD51-mediated Roy D, Slupianek A, Rassool FV, Wasik MA, Childers W, recombination. Nature. 2010 Oct 7;467(7316):678-83 Copland M, Müschen M, Civin CI, Skorski T. Personalized synthetic lethality induced by targeting RAD52 in Feng Z, Scott SP, Bussen W, Sharma GG, Guo G, Pandita leukemias identified by gene mutation and expression TK, Powell SN. Rad52 inactivation is synthetically lethal profile. Blood. 2013 Aug 15;122(7):1293-304 with BRCA2 deficiency. Proc Natl Acad Sci U S A. 2011 Jan 11;108(2):686-91 Lok BH, Carley AC, Tchang B, Powell SN. RAD52 inactivation is synthetically lethal with deficiencies in Lok BH, Powell SN. Molecular pathways: understanding BRCA1 and PALB2 in addition to BRCA2 through RAD51- the role of Rad52 in homologous recombination for mediated homologous recombination. Oncogene. 2013 Jul therapeutic advancement. Clin Cancer Res. 2012 Dec 25;32(30):3552-8 1;18(23):6400-6 Shi TY, Yang G, Tu XY, Yang JM, Qian J, Wu XH, Zhou This article should be referenced as such: XY, Cheng X, Wei Q. RAD52 variants predict platinum Lok BH, Powell SN. RAD52 (RAD52 homolog (S. resistance and prognosis of cervical cancer. PLoS One. cerevisiae)). Atlas Genet Cytogenet Oncol Haematol. 2012;7(11):e50461 2014; 18(10):731-736.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 736

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Vadakke Peringode Sivadas, S Kannan Division of Cancer Research, Regional Cancer Centre, Thiruvananthapurm - 695011, Kerala, India (VPS, SK)

Published in Atlas Database: February 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/TGFBR2ID372ch3p24.html DOI: 10.4267/2042/54136 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

mRNA length: 4605 bps; Translation length: 592 Abstract amino acid residues. Review on TGFBR2, with data on DNA/RNA, on the protein encoded and where the gene is Protein implicated. Description Identity The TGFBR2 gene encodes two proteins through alternative splicing (592 aa and 567 aa long Other names: AAT3, FAA3, LDS1B, LDS2B, respectively); both can convey TGF β signals. MFS2, RIIC, TAAD2, TGFR-2, TGFbeta-RII TGFBR2 is a transmembrane Serine/Threonine HGNC (Hugo): TGFBR2 kinase. It has a molecular weight of 70/80kD. Location: 3p24.1 TGFBR2 consist of an N-terminal extra-cellular ligand binding ectodomain, a transmembrane Note region, and a C-terminal serine/threonine kinase Ensembl version: ENSG00000163513 domain. The ectodomain is formed by nine beta- SwissProt ID: P37173 strands and a single helix stabilised by a network of ENZYME entry: EC=2.7.11.30 six intra strand disulphide bonds (Hart et al., 2002). DNA/RNA Expression This protein is ubiquitously expressed in all cell Description types. Loss of TGFBR2 expression is linked with Length of TGFBR2 gene is 87641 bases. TGFBR2 many pathological conditions involving cancer. The gene encodes 8 exons. Orientation: plus strand. level of expression may vary depending up on cell- Transcription type. The TGFBR2 gene encodes two well-known Localisation protein coding transcripts: Primarily, it is a transmembrane protein, involved - TGFBR2-001 (Ensembl version in extra-cellular TGF β ligand binding. However, ENST00000295754.5): Encoded by 7 exons; ligand binding can trigger internalization of both mRNA length: 4621 bps; Translation length: 567 ligand and receptors. Receptors internalized in amino acid residues; endosomes can either be targeted to lysosomes for - TGFBR2-002 (Ensembl version degradation or be recycled back to the cell surface ENST00000359013.4): Encoded by 8 exons; for re-use (Chen et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 737 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

Structure and the mechanism of TGFBR2 activation: The TGFBR2 consists of an N-terminal extra-cellular ligand binding domain, a transmembrane region, and a cytoplasmic, C-terminal serine/threonine kinase domain. On TGF β ligand mediated activation, TGFBR2 forms hetero tetramers with TGFBR1 and triggers TGFBR1 kinase activity by phosphorylating the GS domain. The activated TGFBR1 kinase can phosphorylate downstream SMAD transcription factors and there by mediate the expression of TGF β-responsive genes.

Function bind to and sequester this latent complex to extra cellular matrix (ECM) (Derynck et al., 2001). The TGFBR2 is an important member of the latent TGF β is activated by plasmins and MMP2 Transforming Growth Factor Beta (TGF β) and MMP9 through proteolytic processing that signaling pathway. The TGF β signaling controls leads to removal of LAP. The active form of TGF-β important cellular activities like cytostasis, is a 25 KDa disulphide linked homodimer. apoptosis, epithelial to mesenchymal transition (Derynck et al., 2001; Padua and Massague, 2009). (EMT), migration, etc. in a context dependent TGFBR2 is a constitutively active kinase that manner (Massague et al., 2005; Feng and Derynck, occurs as homodimer (Hart et al., 2002; Shi and 2005). These pleiotropic cytokines are encoded by Massague, 2003). On ligand binding mediated 42 open reading frames in human. They are divided activation, TGFBR2 forms heteromeric complex into two subfamilies, the TGF β/Activin/Nodal with type I TGF β receptor (TGFBR1) (Luo and subfamily and the BMP(bone morphogenetic Lodish, 1997). protein)/GDF(growth and differentiation TGFBR2 kinase mediated phosphorylation of factor)/MIS(Muellerian inhibiting substance) Glycine/Serine-rich GS domain of TGFBR1 leads subfamily, as defined by sequence similarity and to activation of type I receptor kinase. Activated the specific signaling pathways that they activate TGFBR1 then phosphorylates downstream SMAD (Shi and Massague, 2003). These cytokines are transcription factors. known to convey cellular signals through the The pathway restricted SMADs-SMAD2 and serine/threonine kinase family receptors - 7 type I SMAD3- are involved in signaling through and 5 type II receptors - that are dedicated to TGFβ TGFBR2/TGFBR1 receptor complexes. They are signaling (Manning et al., 2002). TGFBR2 is the commonly called receptor regulated SMADs or R- most important and well-characterized type II SMADs. They bind directly to TGFBR1 and are receptor of TGF β family. phosphorylated at a C-terminal SSXS motif, that is The TGF β-SMAD signaling cascade gets activated exclusive and conserved for R-SMADs (Feng and when TGF β ligand binds to the TGFBR2 Derynck, 2005; Schmierer and Hill, 2007). SMAD4 (Massague, 1998; Shi and Massague, 2003). The lacks a C-terminal SSXS motif and does not TGF β ligand is secreted as latent complex in which interact directly with TGFBR1. SMAD4 is the TGF β dimer is bound to the latency-associated commonly referred to as co-SMAD and serves as a peptide (LAP) (Young and Murphy-Ullrich, 2004). common partner for all R-SMADs (Shi and Many latent TGF β binding proteins (LTBPs) can Massague, 2003).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 738 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

The binding of the R-SMAD to the type I receptor respectively. Furthermore, 72 organisms have is mediated by adaptor proteins like SARA (SMAD orthologs with human gene TGFBR2. anchor for receptor activation), a zinc double finger FYVE domain containing protein. Mutations They restrict SMAD2/3 proteins to the plasma membrane and early endosomes and thus facilitate Note the interaction of SMAD2/3 proteins with activated Somatic mutations of TGFBR2 is a common event TGFBR1 (Panopoulou et al., 2002; Chen, 2009). in various cancers (Seoane, 2006), Loeys-Dietz The phosphorylated R-SMADs can form syndrome, Marfan syndrome, etc. (Loeys et al., heteromeric complex with the common mediator 2006; Singh et al., 2006; Stheneur et al., 2008). SMAD (Co-SMAD, SMAD4) and this enables the Deletion of the chromosomal region 3p, that carries nuclear translocation of the complex (Wrighton et TGFBR2 is reported in many solid tumors (Kok et al., 2009). al., 1997). In the nucleus, the SMAD transcription factors orchestrate the expression of various target genes; Implicated in depending on the DNA binding partners they associate (Massague, 2008). Lung cancer The DNA binding partners are responsible for the Disease context dependency exhibited by TGF β signaling Lung cancer is the leading cancer in terms of (Inman, 2005). Many protein phosphatases are incidence and death world-wide. responsible for switching off TGF β signaling The most important subtype of lung cancer is non- through R-SMAD dephosphorylation and dictate small cell lung cancer (NSCLC), which accounts the strength and duration of TGF β signaling for ~ 87%, of all lung cancers. (Wrighton et al., 2009). The inhibitory SMADs (SMAD 6 and SMAD 7) are Prognosis responsible for feedback repression of this signaling The five year survival rate (~15%) is very poor for pathway (Xu, 2006). SMAD7 acts through lung cancer. In the case of advanced lung cancers, competition for receptor mediated phosphorylation, the 5-year survival rate is as low as 2%. Moreover, and through the recruitment of SMAD no effective screening strategy is available. ubiquitination regulatory Factors1 or 2 Cytogenetics (Smurf1/Smurf2) to R- SMADs (Lönn et al., 2009). Cytogenetic abnormalities to chromosomes 3p, 5q, In addition to the canonical signaling through the 13q, and 17p are particularly common in small-cell SMADs, TGFBR2 can activate many non-SMAD lung carcinoma (Salgia and Skarin, 1998). pathways like PI3K-Akt, JNK, p38MAPK, ROCK, Oncogenesis PKC, PP2A, Ras, Erk1/Erk2 and Rho-like GTPases TGFBR2 is regarded as an important tumor including RhoA, Rac and Cdc42 (Zhang, 2009). suppressor that is altered in lung cancers. These non-SMAD signaling pathways add greatly Microdeletions in the TGFBR2 gene are reported in towards the context-dependent nature of TGF β non-small cell lung carcinoma (Wang et al., 2007). signaling. Further, studies showed decreased expression of Many studies consider TGF β alterations as a key TGFBR2, which is associated with the reason for tumorigenesis (Derynck et al., 2001; histopathological grading of NSCLCs (Xu et al., Seoane, 2006). 2007). These alterations arise at genetic as well as at Furthermore, reduced TGFBR2 expression in epigenetic level. human NSCLC was found to be associated with While mutations are responsible for major share of smoking, reduced differentiation, increased tumor genomic level TGF β aberrations, the microRNA stage, increased nodal metastasis, and most alterations contribute towards a fair share of the importantly, reduced survival (Malkoski et al., epigenetic alterations (Sivadas and Kannan, 2013). 2012). These results suggest that loss of this tumor Besides, loss of integration of TGF β signaling with suppressor is an important event in lung other important pathways such as p53 signaling is tumorigenesis. an important reason for tumorigenesis (Massague, 2008). Breast cancer Homology Disease The TGFBR2 gene is conserved in human, Breast cancer is the second leading cancer in terms chimpanzee, Rhesus monkey, dog, cow, mouse, rat, of incidence and is at fifth position with regards to chicken and zebra fish. Notably, TGFBR2 of cancer-associated mortality. human beings and chimpanzee shows 100% and The important sub-types of breast cancer are ductal 99.6% identity, at protein and DNA level carcinoma in situ (DCIS), lobular carcinoma in situ

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 739 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

(LCIS), and invasive or infiltrating ductal Oncogenesis carcinoma (IDC). Mutations in at least one member of the TGF β Prognosis signaling are demonstrated in ~50% colorectal There is a good five year survival rate (>80%) for cancers, there by confirming the tumor suppressor breast cancer. This scenario is primarily due to activity of this pathway in these cancers (Seoane, world-wide awareness programmes and 2006). improvement of early screening strategies. Mutational inactivation of TGFBR2 in microsatellite unstable colon cancer is a frequent Cytogenetics event. Further, in vivo experiments also confirmed The most consistent chromosomal regions that the role of TGFBR2 inactivation in the show gain are on 1q, 20q and 8q, while the most establishment and progression of colorectal cancers common regions of loss are on 3p and 6q. (Biswas et al., 2004; Biswas et al., 2008). These chromosomal changes were more frequently found in high grade ductal breast carcinomas with Stomach cancers overexpression of c-erbB-2 oncoprotein (Malamou- Disease Mitsi et al., 1999). Notably, gain of 3q is reported Gastric cancer is the fourth most common cancer to be a stronger predictor of recurrence than grade, worldwide, with ~988000 cases per year and mitotic activity index (MAI) and other features in second among mortality with ~737000 deaths per invasive breast cancers (Janssen et al., 2003). year. Oncogenesis Prognosis The TGF β signaling shows a dual role in breast The 5-year survival rate of gastric cancer is poor. cancers. Even though it is tumor suppressor Even in developed countries like USA, the five- initially, this signaling cascade can trigger lung year survival is only 24%. metastasis of advanced breast cancers by inducing This is due to the lack of early screening strategies. angiopoietin-like 4 (Padua et al., 2008). However, mutations in the kinase domain of Cytogenetics TGFBR2 are reported in recurrent breast cancers. The recurrent chromosomal abnormalities includes Since no mutations were observed in the primary gains at 17q, 20q, 1p, 22q, 17p, 16p, 6p, 20p, 7p, 3q tumors, TGFBR2 mutations might have a role in and 13q4 while losses at 18q, 3p, 5q and 9p are breast cancer recurrence (Lucke et al., 2001). common (Wu et al., 2002). Furthermore, TGFBR2 positivity is an independent In gastric cancers gain of 1q32.3 has a correlation prognostic factor for good disease-free survival and with lymph node status while loss of 18q22.1 was overall survival in human epidermal growth factor associated with poor survival (Weiss et al., 2004). receptor-2 (HER2)-negative patients (Paiva et al., Oncogenesis 2010). Frameshift mutations in the 10bp poly(A) repeat of TGFBR2 coding regions is frequent in gastric Colorectal cancers cancers with microsatellite instability (MSI). Disease In contrast, gastric adenomas without MSI seldom Colon and rectal cancers account for around 9.4% exhibit TGFBR2 mutations. of all cancer cases. This suggest that TGFBR2 is the main target of These cancers are at third position in terms of genomic instability during the development of incidence and are at fourth position with regards to MSI(+) gastric cancers (Song et al., 2010). cancer-associated mortality. Prostate cancers Prognosis There is a good five year survival rate (>80%) for Disease stage 1 2 cases. However, the 5-year survival rate is With ~0.9 million incident cases all over the world, only about 10% in stage IV colorectal cancers. prostate cancers are fifth common cancer in the world. Globally it is the sixth leading cause of Cytogenetics cancer-related death in men, but it ranks second in Colorectal cancers show frequent gains at 7p, 7q, the United States. 8q, 16p, 20p and 20q, while losses are often at 18q. Interestingly, metastatic tumors show frequent Prognosis gains at 8q and 20q and loss at 18q, suggesting The survival rates of prostate cancer vary among these chromosomal aberrations are linked to the region to region; overall the 5-year survival rate is progression of colorectal cancer (Aragane et al., >90%. 2001). DNA copy number loss at 18q12.2, Cytogenetics involving BRUNOL4 that encodes a splicing factor, The most common aberrations are losses in is an independent prognostic indicator for colon chromosomes 5q, 6q, 8p, 10q, 13q, 16q, 17p, and cancers (Poulogiannis et al., 2010). 18q and gains in 7p/q, 8q, 9p, and Xq.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 740 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

Moreover, a chromosomal rearrangement in 21q is accounting for 7% of the total cancers diagnosed in observed in over 50% of prostate cancers (Saramaki this region. and Visakorpi, 2007). Further, recurrent The most common type of oral cancer is squamous breakpoints at 5q11, 8p11, and 10q22 were cell carcinoma, which accounts for more than 90% observed in prostate cancer cell lines, suggesting of the cancers of the oral cavity. the importance of tumor suppressor/oncogenes in Prognosis these regions (Pan et al., 2001). The overall 5-year disease-specific survival rate for Oncogenesis patients is approximately 50% throughout the world The in vivo experiments have demonstrated that the and is unchanged over past two decades. conditional loss of TGFBR2 in prostatic stromal Cytogenetics cells can trigger prostate cancer initiation, Recurrent loss of chromosomes 9, 13, 18 and Y are progression, and invasion (Bhowmick et al., 2004). reported in oral cancers whereas the most frequent Silencing of TGFBR2 through CpG methylation at chromosomal imbalances involves deletions at site -140 is a common event in prostate cancers chromosome arms 3p, 7q, 8p, 11q, 17p. (Zhao et al., 2005). However, TGF β signaling has The chromosomal breakpoints in structural been shown to induce vicious cycles of prostate rearrangements frequently involve the centromeric cancer bone metastases by inducing parathyroid regions of chromosomes 1, 3, 8, 14 and 15 as well hormone-related protein (PTHrP) via Gli2 as bands 1p22, 11q13 and 19p13 (Jin and Mertens, (Kingsley et al., 2007). 1993). Liver cancers Oncogenesis Disease TGFBR2 mutations are frequent in oral cancers, Liver cancer is the third leading cause of cancer kinase domain mutations being common. death after lung and stomach cancers. It causes The loss of TGFBR2 expression in the tumor is ~754000 deaths per year. The most common sub- associated with significantly reduced overall type of liver cancer is hepatocellular carcinoma, survival among oral cancer patients (Sivadas et al., which accounts for approximately 75% of all 2013). Further, metastatic oral cancers show primary liver cancers. significantly lower TGFBR2 expression as Prognosis compared to primary tumour, indicating its anti- metastatic activity in oral cancers (Paterson et al., The 5-year survival rate of liver cancer is just above 2001). 50%. This scenario is mainly due to the delay in diagnosis. Because of this delay, less than 40% of Pancreatic cancer individuals with hepatocellular carcinoma are Disease eligible for surgery and transplant. th Even though pancreatic cancer is at 13 position, Cytogenetics contributing only 2% of cancer incidence, it is at Studies suggest deletions are frequent at 8t th position in terms of mortality and causes 4% of chromosomal arms 1p, 4q, 6q, 8p, 9p, 11q, 12q and cancer associated deaths. The most common form is 13q, whereas gains are common at 1q, 6p, 8q, 11q pancreatic ductal adenocarcinoma. and 17q in samples positive for Hepatitis B and C Prognosis virus (Tornillo et al., 2000). Pancreatic cancer shows an extremely poor Oncogenesis prognosis. The 5-year relative survival rate is only In hepatic cancers, TGFBR2 downregulation is 6%. reported to be correlated with larger tumor size, Cytogenetics poor differentiation, portal vein invasion, The chromosomal region 18q21 that bears SMAD4 intrahepatic metastasis and shorter recurrence-free gene is homozygously deleted in 30% to 37% survival (Mamiya et al., 2010). Further, in vivo pancreatic ductal adenocarcinomas. Other important experiments revealed that TGFBR2 loss along with alterations involve genomic gains of 3q, 8q, 11q, TGF-alpha over expression can cooperate in 17q, and frequent loss of chromosome 17p, 6q, and hepatocarcinogenesis (Baek et al., 2010). 8p (Hahn et al., 1996; Griffin et al., 2007). Oral cancers Oncogenesis Disease Even though mutations in TGFBR2 occur at lower With an estimated 263000 cases, cancers of the oral rate, the downstream molecule SMAD4 mutation cavity account for 2% of the cancer burden rates are as high as 50% in pancreatic cancers worldwide. (Venkatasubbarao et al., 1998; Cowgill and But they are the second most common cancer in Muscarella, 2003). This signifies the importance of males and the fourth most common cancer in TGF β-signaling in preventing pancreatic females in Melanesia and South-Central Asia, tumorigenesis.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 741 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

Cervical cancers neoplasms (Rooke et al., 1999; Kim and Letterio, 2003). Disease The high-risk Human papillomavirus types 16, 18, Ovarian cancers 31 and 45 are the cause of ~90% of the cervical Disease cancer globally. Majority of ovarian cancers arise in the epithelial These cancers are at 7 th and 8 th position in terms of surface of the ovary. They comprise ~2% of global global cancer incidence and deaths respectively. cancer incidence and cancer-associated deaths. Prognosis Prognosis There is a better 5-year survival rate for cervical Because more than 60% of ovarian cancers are cancers. The 5-year survival rate for the early stages diagnosed at a later stage, ovarian cancer has a of cervical cancer is ~92% while the overall 5-year relatively poor 5-year survival rate of ~47%. survival rate is about 72%. Cytogenetics Cytogenetics The deletion of chromosome 3p region carrying Studies have reported abnormalities of chromosome TGFBR2 is a frequent event in ovarian cancers 1 in up to 95% of cervical cancer samples. The (Lounis et al., 1998). main alterations included are the deletions of Further, abnormalities of chromosomes 1, 3, 6, and chromosome 1 at bands q32, p34, q42, p32, and 11 were found in metastatic effusions of ovarian p22. cancer (Ioakim-Liossi et al., 1999). Further, abnormality of chromosome 4 occurs in The breakpoints in regions 1p3 and 11p1 are 92% cases (Sreekantaiah et al., 1988, Sherwood et important early events in ovarian cancers. al., 2000). Particularly, the ovarian cancers with breakpoints at Oncogenesis 1p1, 3p1 and 11p1 present poor prognosis (Simon Though TGFBR2 mutations happen at lower rate in et al., 2000). cervical cancers (Chen et al., 1999), in vivo Oncogenesis experiments provided evidence that estrogen and Kinase domain mutations of TGFBR2 in up to 25% HPV E7 proteins cooperate to silence TGFBR2 of ovarian cancers are reported. expression during the induction and progression of Added, loss of TGFBR2 expression was found in cervical neoplasms (Diaz-Chavez et al., 2008). >40% of samples (Lynch et al., 2004). Leukemias Epigenetic silencing of TGFBR2 through promoter Disease methylation could be the reason for the loss of The haematological neoplasms can be broadly TGFBR2 expression, which is a common event in classified into four sub-types: Acute lymphoblastic ovarian cancers (Matsumura et al., 2011). leukemia (ALL), Chronic lymphocytic leukemia Renal carcinomas (CLL), Acute myelogenous leukemia (AML) and Chronic myelogenous leukemia (CML). Disease Kidney cancers are generally originated in the Prognosis lining of the proximal convoluted tubule. Renal cell Prognosis varies from subtype to subtype. carcinoma (RCC) is the most common type of Cytogenetics kidney cancer, causing for 80% of cases. The well-known chromosomal aberration in CML Prognosis is a reciprocal translocation between chromosome 9 Even though the five year survival rate among stage and 22 designated as t(9;22)(q34;q11). This I patients is around 90%, while the 5-year survival translocation generates the oncogenic Bcr-Abl rate is less than 10% for patients presenting with fusion protein. Other important translocations stage IV disease. involves t(4;11); t(11;14); and t(1;3). Cytogenetics Oncogenesis The deletion of the chromosome 3p region is the Mutations in TGFBR2 associated with hallmark of nonpapillary/clear cell RCC (Siebert et microsatellite instability were observed in 20% of al. 1998). cell lines derived from hematologic malignancies. Though alterations of the microsatellite regions in Oncogenesis the TGFBR2 are not common in CML, but The downregulation of TGFBR3 and TGFBR2 are TGFBR2 downregulation was evident in CML cells the important events during renal carcinogenesis as compared with the hematopoietic cells of normal and acquisition of metastatic phenotype donors. respectively (Copland et al., 2003). The reason for Furthermore, decreased TGFBR2 expression was the loss of TGFBR2 expression could be due to also observed in the other haematological promoter hypermethylation (Zhang et al., 2005).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 742 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

Glioblastoma multiforme Siebert R, Jacobi C, Matthiesen P, Zühlke-Jenisch R, Potratz C, Zhang Y, Stöckle M, Klöppel G, Grote W, Disease Schlegelberger B. Detection of deletions in the short arm Glioblastoma is the most aggressive malignant of chromosome 3 in uncultured renal cell carcinomas by interphase cytogenetics. J Urol. 1998 Aug;160(2):534-9 primary brain tumor in humans, involving glial cells and account for more than 50% of all brain Venkatasubbarao K, Ahmed MM, Swiderski C, Harp C, tumor cases. Lee EY, McGrath P, Mohiuddin M, Strodel W, Freeman JW. Novel mutations in the polyadenine tract of the Prognosis transforming growth factor beta type II receptor gene are The survival rates are very poor, most of the found in a subpopulation of human pancreatic adenocarcinomas. Genes Chromosomes Cancer. 1998 patients die within a period of 1-2 years. Jun;22(2):138-44 Cytogenetics Chen T, de Vries EG, Hollema H, Yegen HA, Vellucci VF, Loss of heterozygosity (LOH) at 10q involving Strickler HD, Hildesheim A, Reiss M. Structural alterations PTEN is the most common genetic alteration shown of transforming growth factor-beta receptor genes in by both primary as well as secondary glioblastomas human cervical carcinoma. Int J Cancer. 1999 Jul 2;82(1):43-51 (Ohgaki et al., 2004). Ioakim-Liossi A, Gagos S, Athanassiades P, Oncogenesis Athanassiadou P, Gogas J, Davaris P, Markopoulos C. p53 mutations are the most common event in Changes of chromosomes 1, 3, 6, and 11 in metastatic glioblastomas. More than 30% of the primary and effusions arising from breast and ovarian cancer. Cancer 65% of the secondary glioblastomas show p53 Genet Cytogenet. 1999 Apr;110(1):34-40 mutations (Ohgaki et al., 2004). Mutations in the 10 Malamou-Mitsi VD, Syrrou M, Georgiou I, Pagoulatos G, bp poly(A) tract of TGFBR2 are very common Agnantis NJ. Analysis of chromosomal aberrations in breast cancer by comparative genomic hybridization (71%) in gliomas with genomic instability. (CGH). Correlation with histoprognostic variables and c- However, TGFBR2 mutation rates are less (3%) in erbB-2 immunoexpression. J Exp Clin Cancer Res. 1999 microsatellite stable gliomas (Izumoto et al., 1997). Sep;18(3):357-61 Rooke HM, Vitas MR, Crosier PS, Crosier KE. The TGF- References beta type II receptor in chronic myeloid leukemia: analysis of microsatellite regions and gene expression. Leukemia. Sreekantaiah C, Bhargava MK, Shetty NJ. Chromosome 1 1999 Apr;13(4):535-41 abnormalities in cervical carcinoma. Cancer. 1988 Oct 1;62(7):1317-24 Sherwood JB, Shivapurkar N, Lin WM, Ashfaq R, Miller DS, Gazdar AF, Muller CY. Chromosome 4 deletions are Jin Y, Mertens F. Chromosome abnormalities in oral frequent in invasive cervical cancer and differ between squamous cell carcinomas. Eur J Cancer B Oral Oncol. histologic variants. Gynecol Oncol. 2000 Oct;79(1):90-6 1993 Oct;29B(4):257-63 Simon R, Desper R, Papadimitriou CH, Peng A, Alberts Hahn SA, Hoque AT, Moskaluk CA, da Costa LT, Schutte DS, Taetle R, Trent JM, Schäffer AA. Chromosome M, Rozenblum E, Seymour AB, Weinstein CL, Yeo CJ, abnormalities in ovarian adenocarcinoma: III. Using Hruban RH, Kern SE. Homozygous deletion map at breakpoint data to infer and test mathematical models for 18q21.1 in pancreatic cancer. Cancer Res. 1996 Feb oncogenesis. Genes Chromosomes Cancer. 2000 1;56(3):490-4 May;28(1):106-20 Izumoto S, Arita N, Ohnishi T, Hiraga S, Taki T, Tomita N, Tornillo L, Carafa V, Richter J, Sauter G, Moch H, Minola Ohue M, Hayakawa T. Microsatellite instability and E, Gambacorta M, Bianchi L, Vecchione R, Terracciano mutated type II transforming growth factor-beta receptor LM. Marked genetic similarities between hepatitis B virus- gene in gliomas. Cancer Lett. 1997 Jan 30;112(2):251-6 positive and hepatitis C virus-positive hepatocellular Kok K, Naylor SL, Buys CH. Deletions of the short arm of carcinomas. J Pathol. 2000 Nov;192(3):307-12 chromosome 3 in solid tumors and the search for Aragane H, Sakakura C, Nakanishi M, Yasuoka R, Fujita suppressor genes. Adv Cancer Res. 1997;71:27-92 Y, Taniguchi H, Hagiwara A, Yamaguchi T, Abe T, Luo K, Lodish HF. Positive and negative regulation of type Inazawa J, Yamagishi H. Chromosomal aberrations in colorectal cancers and liver metastases analyzed by II TGF-beta receptor signal transduction by autophosphorylation on multiple serine residues. EMBO J. comparative genomic hybridization. Int J Cancer. 2001 1997 Apr 15;16(8):1970-81 Dec 1;94(5):623-9 Derynck R, Akhurst RJ, Balmain A. TGF-beta signaling in Lounis H, Mes-Masson AM, Dion F, Bradley WE, Seymour RJ, Provencher D, Tonin PN. Mapping of chromosome 3p tumor suppression and cancer progression. Nat Genet. deletions in human epithelial ovarian tumors. Oncogene. 2001 Oct;29(2):117-29 1998 Nov 5;17(18):2359-65 Lücke CD, Philpott A, Metcalfe JC, Thompson AM, Lynch MA, Nakashima R, Song H, DeGroff VL, Wang D, Hughes-Davies L, Kemp PR, Hesketh R. Inhibiting Enomoto T, Weghorst CM. Mutational analysis of the mutations in the transforming growth factor beta type 2 receptor in recurrent human breast cancer. Cancer Res. transforming growth factor beta receptor type II gene in human ovarian carcinoma. Cancer Res. 1998 Oct 2001 Jan 15;61(2):482-5 1;58(19):4227-32 Pan Y, Lui WO, Nupponen N, Larsson C, Isola J, Visakorpi Massagué J. TGF-beta signal transduction. Annu Rev T, Bergerheim US, Kytölä S. 5q11, 8p11, and 10q22 are Biochem. 1998;67:753-91 recurrent chromosomal breakpoints in prostate cancer cell Salgia R, Skarin AT. Molecular abnormalities in lung lines. Genes Chromosomes Cancer. 2001 Feb;30(2):187- 95 cancer. J Clin Oncol. 1998 Mar;16(3):1207-17

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 743 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

Paterson IC, Matthews JB, Huntley S, Robinson CM, Inman GJ. Linking Smads and transcriptional activation. Fahey M, Parkinson EK, Prime SS. Decreased expression Biochem J. 2005 Feb 15;386(Pt 1):e1-e3 of TGF-beta cell surface receptors during progression of human oral squamous cell carcinoma. J Pathol. 2001 Massagué J, Seoane J, Wotton D. Smad transcription Apr;193(4):458-67 factors. Genes Dev. 2005 Dec 1;19(23):2783-810 Hart PJ, Deep S, Taylor AB, Shu Z, Hinck CS, Hinck AP. Zhang Q, Rubenstein JN, Liu VC, Park I, Jang T, Lee C. Crystal structure of the human TbetaR2 ectodomain--TGF- Restoration of expression of transforming growth factor- beta3 complex. Nat Struct Biol. 2002 Mar;9(3):203-8 beta type II receptor in murine renal cell carcinoma (renca) cells by 5-Aza-2'-deoxycytidine. Life Sci. 2005 Jan Manning G, Whyte DB, Martinez R, Hunter T, Sudarsanam 21;76(10):1159-66 S. The protein kinase complement of the human genome. Science. 2002 Dec 6;298(5600):1912-34 Zhao H, Shiina H, Greene KL, Li LC, Tanaka Y, Kishi H, Igawa M, Kane CJ, Carroll P, Dahiya R. CpG methylation Panopoulou E, Gillooly DJ, Wrana JL, Zerial M, Stenmark at promoter site -140 inactivates TGFbeta2 receptor gene H, Murphy C, Fotsis T. Early endosomal regulation of in prostate cancer. Cancer. 2005 Jul 1;104(1):44-52 Smad-dependent signaling in endothelial cells. J Biol Chem. 2002 May 17;277(20):18046-52 Loeys BL, Schwarze U, Holm T, Callewaert BL, Thomas GH, Pannu H, De Backer JF, Oswald GL, Symoens S, Wu CW, Chen GD, Fann CS, Lee AF, Chi CW, Liu JM, Manouvrier S, Roberts AE, Faravelli F, Greco MA, Pyeritz Weier U, Chen JY. Clinical implications of chromosomal RE, Milewicz DM, Coucke PJ, Cameron DE, Braverman abnormalities in gastric adenocarcinomas. Genes AC, Byers PH, De Paepe AM, Dietz HC. Aneurysm Chromosomes Cancer. 2002 Nov;35(3):219-31 syndromes caused by mutations in the TGF-beta receptor. N Engl J Med. 2006 Aug 24;355(8):788-98 Copland JA, Luxon BA, Ajani L, Maity T, Campagnaro E, Guo H, LeGrand SN, Tamboli P, Wood CG. Genomic Seoane J. Escaping from the TGFbeta anti-proliferative profiling identifies alterations in TGFbeta signaling through control. Carcinogenesis. 2006 Nov;27(11):2148-56 loss of TGFbeta receptor expression in human renal cell carcinogenesis and progression. Oncogene. 2003 Sep Singh KK, Rommel K, Mishra A, Karck M, Haverich A, 11;22(39):8053-62 Schmidtke J, Arslan-Kirchner M. TGFBR1 and TGFBR2 mutations in patients with features of Marfan syndrome Cowgill SM, Muscarella P. The genetics of pancreatic and Loeys-Dietz syndrome. Hum Mutat. 2006 cancer. Am J Surg. 2003 Sep;186(3):279-86 Aug;27(8):770-7 Janssen EA, Baak JP, Guervós MA, van Diest PJ, Jiwa M, Xu L. Regulation of Smad activities. Biochim Biophys Acta. Hermsen MA. In lymph node-negative invasive breast 2006 Nov-Dec;1759(11-12):503-13 carcinomas, specific chromosomal aberrations are strongly associated with high mitotic activity and predict outcome Griffin CA, Morsberger L, Hawkins AL, Haddadin M, Patel more accurately than grade, tumour diameter, and A, Ried T, Schrock E, Perlman EJ, Jaffee E. Molecular oestrogen receptor. J Pathol. 2003 Dec;201(4):555-61 cytogenetic characterization of pancreas cancer cell lines reveals high complexity chromosomal alterations. Kim SJ, Letterio J. Transforming growth factor-beta Cytogenet Genome Res. 2007;118(2-4):148-56 signaling in normal and malignant hematopoiesis. Leukemia. 2003 Sep;17(9):1731-7 Kingsley LA, Fournier PG, Chirgwin JM, Guise TA. Molecular biology of bone metastasis. Mol Cancer Ther. Shi Y, Massagué J. Mechanisms of TGF-beta signaling 2007 Oct;6(10):2609-17 from cell membrane to the nucleus. Cell. 2003 Jun 13;113(6):685-700 Saramaki O, Visakorpi T. Chromosomal aberrations in prostate cancer. Front Biosci. 2007 May 1;12:3287-301 Bhowmick NA, Neilson EG, Moses HL. Stromal fibroblasts in cancer initiation and progression. Nature. 2004 Nov Schmierer B, Hill CS. TGFbeta-SMAD signal transduction: 18;432(7015):332-7 molecular specificity and functional flexibility. Nat Rev Mol Cell Biol. 2007 Dec;8(12):970-82 Biswas S, Chytil A, Washington K, Romero-Gallo J, Gorska AE, Wirth PS, Gautam S, Moses HL, Grady WM. Wang JC, Su CC, Xu JB, Chen LZ, Hu XH, Wang GY, Bao Transforming growth factor beta receptor type II Y, Huang Q, Fu SB, Li P, Lu CQ, Zhang RM, Luo ZW. inactivation promotes the establishment and progression of Novel microdeletion in the transforming growth factor beta colon cancer. Cancer Res. 2004 Jul 15;64(14):4687-92 type II receptor gene is associated with giant and large cell variants of nonsmall cell lung carcinoma. Genes Ohgaki H, Dessen P, Jourde B, Horstmann S, Nishikawa Chromosomes Cancer. 2007 Feb;46(2):192-201 T, Di Patre PL, Burkhard C, Schüler D, Probst-Hensch NM, Maiorka PC, Baeza N, Pisani P, Yonekawa Y, Yasargil Xu JB, Bao Y, Liu X, Liu Y, Huang S, Wang JC. Defective MG, Lütolf UM, Kleihues P. Genetic pathways to expression of transforming growth factor beta type II glioblastoma: a population-based study. Cancer Res. 2004 receptor (TGFBR2) in the large cell variant of non-small Oct 1;64(19):6892-9 cell lung carcinoma. Lung Cancer. 2007 Oct;58(1):36-43 Weiss MM, Kuipers EJ, Postma C, Snijders AM, Pinkel D, Biswas S, Trobridge P, Romero-Gallo J, Billheimer D, Meuwissen SG, Albertson D, Meijer GA. Genomic Myeroff LL, Willson JK, Markowitz SD, Grady WM. alterations in primary gastric adenocarcinomas correlate Mutational inactivation of TGFBR2 in microsatellite with clinicopathological characteristics and survival. Cell unstable colon cancer arises from the cooperation of Oncol. 2004;26(5-6):307-17 genomic instability and the clonal outgrowth of Young GD, Murphy-Ullrich JE. Molecular interactions that transforming growth factor beta resistant cells. Genes confer latency to transforming growth factor-beta. J Biol Chromosomes Cancer. 2008 Feb;47(2):95-106 Chem. 2004 Sep 3;279(36):38032-9 Diaz-Chavez J, Hernandez-Pando R, Lambert PF, Gariglio Feng XH, Derynck R. Specificity and versatility in tgf-beta P. Down-regulation of transforming growth factor-beta type signaling through Smads. Annu Rev Cell Dev Biol. II receptor (TGF-betaRII) protein and mRNA expression in 2005;21:659-93 cervical cancer. Mol Cancer. 2008 Jan 9;7:3

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 744 TGFBR2 (Transforming Growth Factor, Beta Receptor II (70/80kDa)) Sivadas VP, Kannan S

Padua D, Zhang XH, Wang Q, Nadal C, Gerald WL, Gomis transforming growth factor-beta type II receptor is RR, Massagué J. TGFbeta primes breast tumors for lung associated with poorer prognosis in HER2-negative breast metastasis seeding through angiopoietin-like 4. Cell. 2008 tumours. Ann Oncol. 2010 Apr;21(4):734-40 Apr 4;133(1):66-77 Poulogiannis G, Ichimura K, Hamoudi RA, Luo F, Leung Stheneur C, Collod-Béroud G, Faivre L, Gouya L, Sultan SY, Yuen ST, Harrison DJ, Wyllie AH, Arends MJ. G, Le Parc JM, Moura B, Attias D, Muti C, Sznajder M, Prognostic relevance of DNA copy number changes in Claustres M, Junien C, Baumann C, Cormier-Daire V, Rio colorectal cancer. J Pathol. 2010 Feb;220(3):338-47 M, Lyonnet S, Plauchu H, Lacombe D, Chevallier B, Jondeau G, Boileau C. Identification of 23 TGFBR2 and 6 Song JH, Lee HS, Yoon JH, Kang YH, Nam SW, Lee JY, TGFBR1 gene mutations and genotype-phenotype Park WS.. TGFBR2 frameshift mutation in gastric tumors investigations in 457 patients with Marfan syndrome type I with microsatellite instability. Mol Cell Toxicol. 2010;6:321- and II, Loeys-Dietz syndrome and related disorders. Hum 26. Mutat. 2008 Nov;29(11):E284-95 Matsumura N, Huang Z, Mori S, Baba T, Fujii S, Konishi I, Chen YG. Endocytic regulation of TGF-beta signaling. Cell Iversen ES, Berchuck A, Murphy SK.. Epigenetic Res. 2009 Jan;19(1):58-70 suppression of the TGF-beta pathway revealed by transcriptome profiling in ovarian cancer. Genome Res. Lönn P, Morén A, Raja E, Dahl M, Moustakas A. 2011 Jan;21(1):74-82. doi: 10.1101/gr.108803.110. Epub Regulating the stability of TGFbeta receptors and Smads. 2010 Dec 14. Cell Res. 2009 Jan;19(1):21-35 Malkoski SP, Haeger SM, Cleaver TG, Rodriguez KJ, Li H, Padua D, Massagué J. Roles of TGFbeta in metastasis. Lu SL, Feser WJ, Baron AE, Merrick D, Lighthall JG, Ijichi Cell Res. 2009 Jan;19(1):89-102 H, Franklin W, Wang XJ.. Loss of transforming growth factor beta type II receptor increases aggressive tumor Wrighton KH, Lin X, Feng XH. Phospho-control of TGF- behavior and reduces survival in lung adenocarcinoma and beta superfamily signaling. Cell Res. 2009 Jan;19(1):8-20 squamous cell carcinoma. Clin Cancer Res. 2012 Apr Zhang YE. Non-Smad pathways in TGF-beta signaling. 15;18(8):2173-83. doi: 10.1158/1078-0432.CCR-11-2557. Cell Res. 2009 Jan;19(1):128-39 Epub 2012 Mar 7. Baek JY, Morris SM, Campbell J, Fausto N, Yeh MM, Sivadas VP, George NA, Kattoor J, Kannan S.. Novel Grady WM. TGF-beta inactivation and TGF-alpha mutations and expression alterations in SMAD3/TGFBR2 overexpression cooperate in an in vivo mouse model to genes in oral carcinoma correlate with poor prognosis. induce hepatocellular carcinoma that recapitulates Genes Chromosomes Cancer. 2013 Nov;52(11):1042-52. molecular features of human liver cancer. Int J Cancer. doi: 10.1002/gcc.22099. Epub 2013 Aug 3. 2010 Sep 1;127(5):1060-71 Sivadas VP, Kannan S.. The microRNA networks of TGFβ Mamiya T, Yamazaki K, Masugi Y, Mori T, Effendi K, Du signaling in cancer. Tumour Biol. 2014 Apr;35(4):2857-69. W, Hibi T, Tanabe M, Ueda M, Takayama T, Sakamoto M. doi: 10.1007/s13277-013-1481-9. Epub 2013 Dec 10. Reduced transforming growth factor-beta receptor II This article should be referenced as such: expression in hepatocellular carcinoma correlates with intrahepatic metastasis. Lab Invest. 2010 Sep;90(9):1339- Sivadas VP, Kannan S. TGFBR2 (Transforming Growth 45 Factor, Beta Receptor II (70/80kDa)). Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10):737-745. Paiva CE, Drigo SA, Rosa FE, Moraes Neto FA, Caldeira JR, Soares FA, Domingues MA, Rogatto SR. Absence of

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 745

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Gene Section Review

IL1RN (interleukin 1 receptor antagonist) Liliana Gómez-Flores-Ramos, Jorge Torres-Flores, Martha Patricia Gallegos-Arreola Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara, Division de Medicina Molecular, Centro de Investigacion Biomedica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco, Mexico (LGFR), Centro Universitario de Ciencias de la Salud, Universidad de Guadalajara, Division de Inmunologia, Centro de Investigacion Biomedica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco, Mexico (JTF), Division de Medicina Molecular, Centro de Investigacion Biomedica de Occidente, Instituto Mexicano del Seguro Social, Guadalajara, Jalisco, Mexico (MPGA)

Published in Atlas Database: March 2014 Online updated version : http://AtlasGeneticsOncology.org/Genes/IL1RNID40953ch2q13.html DOI: 10.4267/2042/54137 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

(interleukin 1 family, member 10 (theta)) genes Abstract (NCBI). Review on IL1RN, with data on DNA/RNA, on the protein encoded and where the gene is implicated. DNA/RNA Identity Note IL1RN (interleukin 1 receptor antagonist) was Other names: DIRA, ICIL-1RA, IL-1RN, IL-1ra, identified in 1990 by Carter and cols (Carter et al., IL-1ra3, IL1F3, IL1RA, IRAP, MVCD4 1990). HGNC (Hugo): IL1RN It codes a protein that binds to interleukin 1 receptor (IL1R1) and inhibits the binding of Location: 2q13 interleukin 1 alpha and beta (IL1A and IL1B), Local order blocking the biological activity of these two IL1RN is located between PSD4 gene (pleckstrin cytokines, this is the first interleukin 1 family and Sec7 domain containing 4) and IL36RN member described that has antagonist function (interleukin 36 receptor antagonist) and IL1F10 (Arend, 1991; Arend and Gabay, 2000).

IL1RN locus is 2q13. The gene length is 22901 bp (starts at 113868692 - ends at 113891592, according NCBI 08-Jul-2013). In this region is located along with IL36RN, IL1F10 and PSD4 and PAX8.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 746 IL1RN (interleukin 1 receptor antagonist) Gómez-Flores-Ramos L, et al.

Linear diagram of IL1RN gene with their 6 exons (pink boxes).

This gene is overexpressed in different infectious The IL1RN gene produces two forms of IL1RN: diseases and immune conditions. intracellular (icIL1RN) and secreted (sIL1RN) The IL1RN gene has a length of 22901 base-pairs, which are controlled by different promoter regions and is constituted by 6 exons; there are four (Redlitz et al., 2004). isoforms described to date that are produced by Description alternative splicing: one isoform is secreted and the other three are cytoplasmic (Gabay et al., 1997; The protein consists of 177 amino acids, and a Arend and Guthridge, 2000). molecular weight of 20KDa. The amino acid sequence homology is 26-30% to IL1 β and 19% to Description IL1 α. The mature protein is a single The IL1RN gene has a length of 22901 base-pairs, nonglycosylated polypeptide of 150 amino acids encodes a member of the interleukin 1 cytokine approximately, further, this protein contains a 25 family. The gene is located on 2q13. amino acids leader sequence (Eisenberg et al., Transcription 1990). 6 exons; mRNA linear (NM_173842.2) with 1794 Expression bp. IL1RN mRNA does not contain the AUUUA Practically, IL1RN is expressed in whole organism, sequence that has been implicated in shortening the in both adult and embryonic stages. IL1RN is half-life of several cytokine mRNAs (Carter et al., expressed physiologically in different tissues like 1990). lymph node, brain, heart, colon, adipocyte, kidney, Pseudogene liver, lung, thyroid, adrenal gland, skin, placenta, ovary, prostate and testis (GeneCards). No pseudogenes have been identified. Furthermore, IL1RN is present in numerous cancers such as gastric cancer (Iizuka et al., 1999), cervical Protein cancer (Fujiwaki et al., 2003), lymphoblastic (Hulkkonen et al., 2000) and myelogenous (Estrov Note et al., 1992) leukemias, breast cancer (Miller et al., The IL1RN precursor protein consists of 177 amino 2000), endometrial cancer (Van Le et al., 1991), acids and has a molecular weight of 20055 Daltons. bladder cancer (Ahirwar et al., 2009), colorectal The IL1RN cDNA encodes a 152 amino acid cancer (Viet et al., 2005), lung cancer (Lind et al., protein preceded by a 25 amino acid secretory 2005) and brain tumors (Oelmann et al., 1997; Ilyin leader sequence indicating that this protein takes a et al., 1998). more straightforward pathway out of the cell than IL1. Localisation IL1RN is found extracellularly in its mature form There are four isoforms of IL1RN. The IL1RN without requiring extracellular cleavage to its isoform 1 is secreted, and the other three, IL1RN2, mature form. The mature protein consists in ~159 IL1RN3 and IL1RN4 have localization into amino acids (Arend, 1991; Haskill et al., 1991). cytoplasm (Arend and Guthridge, 2000).

Table of four IL1RN isoforms, showing the amino acid sequences and other protein characteristics.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 747 IL1RN (interleukin 1 receptor antagonist) Gómez-Flores-Ramos L, et al.

When IL1 binds to IL1-receptor induces proinflammatory reaction and gene expression. Blocking of the receptor by IL1RN prevents this response.

Function Mutations The protein binds to interleukin 1 receptor (IL1R1) and inhibits the binding of interleukin 1 alpha and Note beta (IL1A and IL1B) (Arend, 1991; Arend and Allelic variants Gabay, 2000), modulating the immune response Germinal (Dinarello, 2011). IL1RN competes with IL1 for binding two IL1 cell The most common variation in the IL1RN gene is surface receptors type I and type II (IL1RtI and the penta allelic variable number of tandem repeat IL1RtII), however, when it occupies the receptor it of 86 base pair located in intron 2 which results in a does not trigger the cellular responses typical of IL1 short allele with two repeats (IL1RN*2), and long which includes the production of secondary alleles (IL1RN*L): allele 1 (four repeats), allele 3 substances that mediate inflammatory responses (five repeats), allele 4 (three repeats) and allele 5 and tissue remodeling (Dinarello, 2011). (six repeats). The most frequent allelic form is allele 1 followed Homology by allele 2, the rest of the alleles are very rare. Homologs of IL1RN protein are highly conserved It has been reported that the allele 2 causes a 10- in different species (NCBI). fold increased seric IL1RN (Danis et al., 1995). Rattus norvegicus: Il1rn (178 amino acids). Furthermore, Redlitz and cols, found that allele 1 Mus musculus: Il1rn (159 aa). has a 4-fold increase of the production of icIL1RN Equus caballus: IL1RN (177 aa). compared to allele 1 (Redlitz et al., 2004). Bos taurus: IL1RN (174 aa). Two other germline mutations: Gln57Ter Canis lupus familiaris: IL1RN (176 aa). (rs121913162) and Glu80Ter (rs121913161) have Tursiops truncatus: IL1RN (177 aa). been associated with the deficiency of IL1RN Gallus gallus: IL1RN (163 aa). leaning to an autoinflammatory (Aksentijevich et Macaca fascicularis: IL1RN (177 aa). al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 748 IL1RN (interleukin 1 receptor antagonist) Gómez-Flores-Ramos L, et al.

Somatic The short allele IL1RN*2, is associated with increased levels of IL1B, which could probably The somatic mutation rs148026279 producing the have a significant effect on increased inflammatory protein change Phe148Val has been associated with damage (Santtila et al., 1998). malignant melanoma (Wei et al., 2011). It has also been described that IL1B inhibits gastric secretion (Sugimoto et al., 2009), and it is 100 Implicated in times more potent than proton pump inhibitor Various cancers (Wolfe and Nompleggi, 1992), which favors the corpus colonization, causing atrophic gastritis that Note may evolve to gastric carcinoma. El-Omar and The IL1 cluster has been strongly associated with cols., demonstrated an increased risk of different types of cancer. Multiple studies have hypochlorhydria when IL1RN*2 allele is present in shown that IL1RN, included in this cluster is homozygous form (El-Omar et al., 2000). altered in cancer development. IL1RN plays a central role in the response to pathogens associated Cervical cancer with cancer etiopathogenesis (Roberge et al., 1996; Oncogenesis Hurme and Helminen, 1998; Wang et al., 2003; Cervical cancer is associated with the infection by Queiroz et al., 2004; Rocha et al., 2005) and human papillomavirus (HPV), however, although chronic inflammation, well described as an millions of women are infected with high-risk HPV important risk factor in cancer development subtypes, only a subset of them develop cervical (Hanahan and Weinberg, 2011; Baniyash et al., cancer, reveling an important role of host immunity 2014; Khatami, 2014), thus, cytokines such as in cervical carcinogenesis. Various studies have IL1RN could be used as risk and progression observed a significant contribution of IL1RN*2 markers in the future. allele to increase risk of cervical cancer (Sehouli et In the meta-analysis performed by Zhang and cols., al., 2002; Mustea et al., 2003; Tamandani et al., which included 71 studies of multiple cancers, with 2008; Sousa et al., 2012). Moreover, Sousa and 14854 cases and 19337 controls, the research group cols, found that IL1RN*2 correlated not only with found a consistent association with gastric cancer. cervical cancer but with cervical lesions and earlier IL1RN polymorphisms frequency is significantly onset of cases with cervical lesion and cancer in different across ethnicities; the frequency of allele 2 patients homozygous IL1RN*2 (Sousa et al., 2012). is significantly lower in Asian controls (11.14%) Tamandani and cols, showed a protective compared to Caucasian controls (26%) (Zhang et association of heterozygous IL1RN*1*2 and al., 2011). homozygous IL1RN*2 and HPV 16 and 18 subtypes but a risk association with Gastric cancer adenocarcinoma (Tamandani et al., 2008). Note Gastric cancer after H. pylori infection Breast cancer susceptibility has been linked with IL1RN gene. Prognosis Studies of genetic association have shown an In Caucasian women it has been described that increased risk of gastric cancer with the allele IL1RN*2 is associated with shortened disease free IL1RN*2 across different populations (El-Omar et survival and overall survival (Grimm et al., 2009). al., 2000; Furuta et al., 2002; Alpizar-Alpizar et al., In this study, Grimm and cols reported that only 2005; Garza-Gonzalez et al., 2005; Palli et al., 80% of women positive to IL1RN*2 survived after 2005; Morgan et al., 2006; Oliveira et al., 2012). 12 months, and 30% had died after 48 months; the However, IL1RN*2 has been also been associated disease-free survival was only of 40% in women independently of H. pylori infection (Mattar et al., with IL1RN*2 compared with 80% in women with 2013). the wild allele (Grimm et al., 2009). In respect to Oncogenesis the long alleles of IL1RN gene, allele *2 has been The inflammatory response after H. pylori infection reported to be modify the binding on the IL1 has been linked to the IL1 gene cluster. The receptor, leading to less efficient inhibition of IL1a infection induces the synthesis of IL1B which binds and IL1b (Tarlow et al., 1993), this might result in a to its target receptor and starts the inflammatory proinflammatory status and enhanced tumor response against the pathogen (Sierra et al., 2008). aggressiveness, which is likely to result in a The IL1RN competitively binds to the IL1 receptor shortened survival of women with breast cancer with the same affinity as IL1 without activating the (Grimm et al., 2009). inflammation cascade, modulating the effects of Oncogenesis IL1B. The severity of damage caused by Breast cancer oncogenesis has been associated with inflammatory response in mucosal tissue is polymorphisms in different cytokines (Gomez- regulated by the balance between these cytokines. Flores-Ramos et al., 2013; Dinarello, 2006) and it

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 749 IL1RN (interleukin 1 receptor antagonist) Gómez-Flores-Ramos L, et al.

has been widely discuss the participation of chronic abundant in colon (Viet et al., 2005). Other inflammation in breast carcinogenesis (Honma et polymorphic sites have been associated with al., 2002). Different research groups have studied colorectal oncogenesis. Burada and cols, linked the the association of IL1RN and breast cancer risk. polymorphism IL1RN +2018C>T with colorectal Lee and cols, found a decreased breast cancer risk cancer, allele C was found to be enriched in patients with the short allele (*2) and a higher risk of cancer with cancer compared to controls. This study in women with the long allele and higher body described that this association was limited to early mass index (Lee et al., 2006). Zhang and cols, stage I and II (Burada et al., 2013). performed a meta-analysis study and found a In attempt to find markers for colorectal cancer similar trend with allele IL1RN*2 (Zhang et al., disease, serum cytokines levels have been studied; 2011), however, with this apparent diminish in risk Iwagaki and cols, found that patients with for breast cancer, other studies have found an colorectal cancer present reduced level of IL1Ra elevated risk of earlier recurrence of breast cancer relative to normal controls, indicating that cancer in women with IL1RN*2 allele (Grimm et al., patients have an immunologic disorder (Iwagaki et 2009). al., 1997). Bladder cancer Lung cancer Oncogenesis Oncogenesis Significant association with higher risk of bladder Tobacco smoking is the main risk factor for lung cancer has been described to Il1RN*2 allele (Bid et cancer, however, only 10-15% of smokers develop al., 2006; Ahirwar et al., 2009). This allele has been lung cancer, suggesting that genetic factors are proposed as a potential marker for genetic important in individual susceptibility for this susceptibility to bladder cancer (Ahirwar et al., disease (Ridge et al., 2013). Lind and cols, found 2009). Studies have showed that IL1RN*2 that individuals homozygous for IL1RN*1 in increases the production of IL1B significantly combination with the allele IL1B-31T had an (Santtila et al., 1998; Nazarenko et al., 2008) and it increased risk of non-small cell lung cancer and a can induce angiogenesis via upregulation of COX-2 two-fold higher level of bulky/hydrophobic DNA or inducible nitric oxide and vascular endothelial adducts in the long in patients with IL1RN*1 (Lind growth factor which may contribute to tumor et al., 2005). These data were confirmed in Chinese growth (Rahman et al., 2001). patients, with a decreased risk of 32% in patients Colorectal cancer with IL1RN*2 allele (Hu et al., 2006). On the other hand, Lim and cols, found a 5-fold-time increased Prognosis risk in lung cancer in never-smokers patients with IL1B and IL1RN have been shown to play an the IL1RN*2 (Lim et al., 2011), but these results important role in angiogenesis of early onset are not consistent, since Hu and cols, found a tumors, Viet and cols, found that allele *1 was reduced risk in non-smokers with squamous cell more frequent in patients with localized disease carcinoma (Hu et al., 2006). compared with disseminated disease, being allele *2 associated with dissemination of the disease Brain cancer (Viet et al., 2005). The study of Lurje and cols, Oncogenesis showed that patients with IL1RN VNTR had a Inflammatory status of brain tumors has been significant six-fold increment in relative risk of studied, and it has been shown that IL1 cluster is developing tumor recurrence compared to those important in development and progression of patients with the wild allele. The IL1RN neoplasia. Ilyin and cols, investigated the levels of homozygous *2/*2 genotype had a median time-to- IL1 and IL1Ra in pediatric astrocytomas, recurrence of 5.7 years, compared with 10.7 years ependymomas and primitive neuroectodermal for those with *1/*1 genotype (Lurje et al., 2009). tumors. The results demonstrated a significant Serum levels of IL1Ra have been studies as different profile among tumors. Pilocytic, prognostic factors as well, in colorectal cancer nonpilocytic and anaplastic astrocytomas had a patients, low preoperative IL1Ra was associated significant increase of mRNA of IL1 beta and its with postoperative infection (Miki et al., 2005). receptor, but low levels of IL1Ra mRNA, Oncogenesis suggesting an imbalance between stimulatory and Colorectal cancer has been widely associated in inhibitory cytokines in brain tumors growth and epidemiological and experimental studies with development via autocrine/paracrine mechanisms chronic inflammation. Viet and cols, found that the (Ilyin et al., 1998). allele IL1RN*3 of VNTR variant was significantly Oelmann and cols, performed a study in cell lines increased in patients compared with controls, and of glioblastoma showed that IL1Ra modulates the allelic distribution of this VNTR differed glioblastoma growth. Experimental addition of between colon and rectum, being allele *3 more neutralizing antibody against IL1Ra down-

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 750 IL1RN (interleukin 1 receptor antagonist) Gómez-Flores-Ramos L, et al.

regulated growth of IL1 and IL1Ra producing variable numbers of an 86-bp tandem repeat. Hum Genet. glioblastoma, the authors suggest that an autocrine 1993 May;91(4):403-4 production of IL1Ra can counteract IL1 function Danis VA, Millington M, Hyland VJ, Grennan D. Cytokine and represent a basic escape mechanism malignant production by normal human monocytes: inter-subject variation and relationship to an IL-1 receptor antagonist growth in some glioblastomas (Oelmann et al., (IL-1Ra) gene polymorphism. Clin Exp Immunol. 1995 1997). Feb;99(2):303-10 Septic shock in pediatric population Roberge CJ, Poubelle PE, Beaulieu AD, Heitz D, Gosselin with acute lymphoblastic leukemia J. The IL-1 and IL-1 receptor antagonist (IL-1Ra) response of human neutrophils to EBV stimulation. Preponderance Prognosis of IL-Ra detection. J Immunol. 1996 Jun 15;156(12):4884- The presence of IL1RN*2 allele was associated 91 with significant susceptibility to septic shock in Gabay C, Smith MF, Eidlen D, Arend WP. Interleukin 1 pediatric patients with acute lymphoblastic receptor antagonist (IL-1Ra) is an acute-phase protein. J leukemia by (Zapata-Tarres et al., 2013). The Clin Invest. 1997 Jun 15;99(12):2930-40 patients studied by Zapata-Tarres and cols, were Iwagaki H, Hizuta A, Tanaka N. Interleukin-1 receptor susceptible to septic shock. antagonists and other markers in colorectal cancer The association between sepsis and IL1RN*2 has patients. Scand J Gastroenterol. 1997 Jun;32(6):577-81 been reported previously, Fang and cols, reported Oelmann E, Kraemer A, Serve H, Reufi B, Oberberg D, an increased relative risk of sepsis in patients Patt S, Herbst H, Stein H, Thiel E, Berdel WE. Autocrine interleukin-1 receptor antagonist can support malignant homozygous IL1RN*2 as well heterozygous growth of glioblastoma by blocking growth-inhibiting patients (Fang et al., 1999). Arnalich and cols autocrine loop of interleukin-1. Int J Cancer. 1997 Jun reported a significant increase in the risk of death 11;71(6):1066-76 after severe sepsis in patients with IL1RN*2 and Hurme M, Helminen M. Polymorphism of the IL-1 gene that the allele is associated with decreased complex in Epstein-Barr virus seronegative and production of IL1Ra in culture but higher seropositive adult blood donors. Scand J Immunol. 1998 concentrations of the protein in serum (Arnalich et Sep;48(3):219-22 al., 2002). Ilyin SE, González-Gómez I, Gilles FH, Plata-Salamán CR. Interleukin-1 alpha (IL-1 alpha), IL-1 beta, IL-1 receptor type I, IL-1 receptor antagonist, and TGF-beta 1 mRNAs in References pediatric astrocytomas, ependymomas, and primitive neuroectodermal tumors. Mol Chem Neuropathol. 1998 Carter DB, Deibel MR Jr, Dunn CJ, Tomich CS, Laborde Feb;33(2):125-37 AL, Slightom JL, Berger AE, Bienkowski MJ, Sun FF, McEwan RN. Purification, cloning, expression and Santtila S, Savinainen K, Hurme M. Presence of the IL- biological characterization of an interleukin-1 receptor 1RA allele 2 (IL1RN*2) is associated with enhanced IL- antagonist protein. Nature. 1990 Apr 12;344(6267):633-8 1beta production in vitro. Scand J Immunol. 1998 Mar;47(3):195-8 Eisenberg SP, Evans RJ, Arend WP, Verderber E, Brewer MT, Hannum CH, Thompson RC. Primary structure and Fang XM, Schröder S, Hoeft A, Stüber F. Comparison of functional expression from complementary DNA of a two polymorphisms of the interleukin-1 gene family: human interleukin-1 receptor antagonist. Nature. 1990 Jan interleukin-1 receptor antagonist polymorphism contributes 25;343(6256):341-6 to susceptibility to severe sepsis. Crit Care Med. 1999 Jul;27(7):1330-4 Arend WP. Interleukin 1 receptor antagonist. A new member of the interleukin 1 family. J Clin Invest. 1991 Iizuka N, Hazama S, Hirose K, Abe T, Tokuda N, Nov;88(5):1445-51 Fukumoto T, Tangoku A, Oka M. Interleukin-1 receptor antagonist mRNA expression and the progression of Haskill S, Martin G, Van Le L, Morris J, Peace A, Bigler gastric carcinoma. Cancer Lett. 1999 Aug 3;142(2):179-84 CF, Jaffe GJ, Hammerberg C, Sporn SA, Fong S. cDNA cloning of an intracellular form of the human interleukin 1 Arend WP, Gabay C. Physiologic role of interleukin-1 receptor antagonist associated with epithelium. Proc Natl receptor antagonist. Arthritis Res. 2000;2(4):245-8 Acad Sci U S A. 1991 May 1;88(9):3681-5 Arend WP, Guthridge CJ. Biological role of interleukin 1 Van Le L, Haskill S, Jaffe GJ, Fowler WC Jr. Expression of receptor antagonist isoforms. Ann Rheum Dis. 2000 interleukin-1 and interleukin-1 receptor antagonists in Nov;59 Suppl 1:i60-4 endometrial cancer. Gynecol Oncol. 1991 Aug;42(2):161-4 El-Omar EM, Carrington M, Chow WH, McColl KE, Bream Estrov Z, Kurzrock R, Estey E, Wetzler M, Ferrajoli A, JH, Young HA, Herrera J, Lissowska J, Yuan CC, Harris D, Blake M, Gutterman JU, Talpaz M. Inhibition of Rothman N, Lanyon G, Martin M, Fraumeni JF Jr, Rabkin acute myelogenous leukemia blast proliferation by CS. Interleukin-1 polymorphisms associated with interleukin-1 (IL-1) receptor antagonist and soluble IL-1 increased risk of gastric cancer. Nature. 2000 Mar receptors. Blood. 1992 Apr 15;79(8):1938-45 23;404(6776):398-402 Wolfe MM, Nompleggi DJ. Cytokine inhibition of gastric Hulkkonen J, Vilpo J, Vilpo L, Koski T, Hurme M. acid secretion--a little goes a long way. Gastroenterology. Interleukin-1 beta, interleukin-1 receptor antagonist and 1992 Jun;102(6):2177-8 interleukin-6 plasma levels and cytokine gene polymorphisms in chronic lymphocytic leukemia: Tarlow JK, Blakemore AI, Lennard A, Solari R, Hughes correlation with prognostic parameters. Haematologica. HN, Steinkasserer A, Duff GW. Polymorphism in human 2000 Jun;85(6):600-6 IL-1 receptor antagonist gene intron 2 is caused by

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 751 IL1RN (interleukin 1 receptor antagonist) Gómez-Flores-Ramos L, et al.

Miller LJ, Kurtzman SH, Anderson K, Wang Y, Stankus M, polymorphism and risk of lung cancer: a possible Renna M, Lindquist R, Barrows G, Kreutzer DL. interaction with polymorphisms in the interleukin 1 beta Interleukin-1 family expression in human breast cancer: gene. Lung Cancer. 2005 Dec;50(3):285-90 interleukin-1 receptor antagonist. Cancer Invest. 2000;18(4):293-302 Miki C, Inoue Y, Toiyama Y, Ojima E, Kobayashi M, Hatada T, Araki T, Kusunoki M. Deficiency in systemic Rahman MA, Dhar DK, Yamaguchi E, Maruyama S, Sato interleukin-1 receptor antagonist production as an T, Hayashi H, Ono T, Yamanoi A, Kohno H, Nagasue N. operative risk factor in malnourished elderly patients with Coexpression of inducible nitric oxide synthase and COX-2 colorectal carcinoma. Crit Care Med. 2005 Jan;33(1):177- in hepatocellular carcinoma and surrounding liver: possible 80 involvement of COX-2 in the angiogenesis of hepatitis C virus-positive cases. Clin Cancer Res. 2001 Palli D, Saieva C, Luzzi I, Masala G, Topa S, Sera F, May;7(5):1325-32 Gemma S, Zanna I, D'Errico M, Zini E, Guidotti S, Valeri A, Fabbrucci P, Moretti R, Testai E, del Giudice G, Ottini L, Arnalich F, López-Maderuelo D, Codoceo R, Lopez J, Matullo G, Dogliotti E, Gomez-Miguel MJ. Interleukin-1 Solis-Garrido LM, Capiscol C, Fernandez-Capitán C, gene polymorphisms and gastric cancer risk in a high-risk Madero R, Montiel C. Interleukin-1 receptor antagonist Italian population. Am J Gastroenterol. 2005 gene polymorphism and mortality in patients with severe Sep;100(9):1941-8 sepsis. Clin Exp Immunol. 2002 Feb;127(2):331-6 Rocha GA, Guerra JB, Rocha AM, Saraiva IE, da Silva Furuta T, El-Omar EM, Xiao F, Shirai N, Takashima M, DA, de Oliveira CA, Queiroz DM. IL1RN polymorphic gene Sugimura H. Interleukin 1beta polymorphisms increase risk and cagA-positive status independently increase the risk of of hypochlorhydria and atrophic gastritis and reduce risk of noncardia gastric carcinoma. Int J Cancer. 2005 Jul duodenal ulcer recurrence in Japan. Gastroenterology. 10;115(5):678-83 2002 Jul;123(1):92-105 Viet HT, Wågsäter D, Hugander A, Dimberg J. Interleukin- Honma S, Shimodaira K, Shimizu Y, Tsuchiya N, Saito H, 1 receptor antagonist gene polymorphism in human Yanaihara T, Okai T. The influence of inflammatory colorectal cancer. Oncol Rep. 2005 Oct;14(4):915-8 cytokines on estrogen production and cell proliferation in human breast cancer cells. Endocr J. 2002 Jun;49(3):371- Bid HK, Manchanda PK, Mittal RD. Association of 7 interleukin-1Ra gene polymorphism in patients with bladder cancer: case control study from North India. Sehouli J, Mustea A, Könsgen D, Katsares I, Lichtenegger Urology. 2006 May;67(5):1099-104 W. Polymorphism of IL-1 receptor antagonist gene: role in cancer. Anticancer Res. 2002 Nov-Dec;22(6A):3421-4 Dinarello CA. The paradox of pro-inflammatory cytokines in cancer. Cancer Metastasis Rev. 2006 Sep;25(3):307-13 Fujiwaki R, Iida K, Nakayama K, Kanasaki H, Hata K, Katabuchi H, Okamura H, Miyazaki K. Clinical significance Hu Z, Shao M, Chen Y, Zhou J, Qian J, Xu L, Ma H, Wang of interleukin-1 receptor antagonist in patients with cervical X, Xu Y, Lu D, Shen H. Allele 2 of the interleukin-1 carcinoma. Gynecol Oncol. 2003 Apr;89(1):77-83 receptor antagonist gene (IL1RN*2) is associated with a decreased risk of primary lung cancer. Cancer Lett. 2006 Mustea A, Sehouli J, Könsgen D, Stengel D, Sofroni D, May 18;236(2):269-75 Lichtenegger W. Interleukin 1 receptor antagonist (IL-1RA) polymorphism in women with cervical cancer. Anticancer Lee KM, Park SK, Hamajima N, Tajima K, Choi JY, Noh Res. 2003 Mar-Apr;23(2A):1099-102 DY, Ahn SH, Yoo KY, Hirvonen A, Kang D. Genetic polymorphisms of interleukin-1 beta (IL-1B) and IL-1 Wang Y, Kato N, Hoshida Y, Yoshida H, Taniguchi H, Goto receptor antagonist (IL-1RN) and breast cancer risk in T, Moriyama M, Otsuka M, Shiina S, Shiratori Y, Ito Y, Korean women. Breast Cancer Res Treat. 2006 Omata M. Interleukin-1beta gene polymorphisms Mar;96(2):197-202 associated with hepatocellular carcinoma in hepatitis C virus infection. Hepatology. 2003 Jan;37(1):65-71 Morgan DR, Dominguez RL, Keku TO, Heidt PE, Martin CF, Galanko JA, Omofoye OA, Sandler RS. Gastric cancer Queiroz DM, Guerra JB, Rocha GA, Rocha AM, Santos A, and the high combination prevalence of host cytokine De Oliveira AG, Cabral MM, Nogueira AM, De Oliveira CA. genotypes and Helicobacter pylori in Honduras. Clin IL1B and IL1RN polymorphic genes and Helicobacter Gastroenterol Hepatol. 2006 Sep;4(9):1103-11 pylori cagA strains decrease the risk of reflux esophagitis. Gastroenterology. 2004 Jul;127(1):73-9 Nazarenko I, Marhaba R, Reich E, Voronov E, Vitacolonna M, Hildebrand D, Elter E, Rajasagi M, Apte RN, Zöller M. Redlitz KH, Yamshchikov VF, Cominelli F. Differential Tumorigenicity of IL-1alpha- and IL-1beta-deficient contribution of IL-1Ra isoforms to allele-specific IL-1Ra fibrosarcoma cells. Neoplasia. 2008 Jun;10(6):549-62 mRNA accumulation. J Interferon Cytokine Res. 2004 Apr;24(4):253-60 Sierra R, Une C, Ramirez V, Alpizar-Alpizar W, Gonzalez MI, Ramirez JA, De Mascarel A, Cuenca P, Perez-Perez Alpízar-Alpízar W, Pérez-Pérez GI, Une C, Cuenca P, G, Megraud F. Relation of atrophic gastritis with Sierra R. Association of interleukin-1B and interleukin-1RN Helicobacter pylori-CagA(+) and interleukin-1 gene polymorphisms with gastric cancer in a high-risk population polymorphisms. World J Gastroenterol. 2008 Nov of Costa Rica. Clin Exp Med. 2005 Dec;5(4):169-76 14;14(42):6481-7 Garza-González E, Bosques-Padilla FJ, El-Omar E, Hold Tamandani DM, Sobti RC, Shekari M, Kaur S, Huria A. G, Tijerina-Menchaca R, Maldonado-Garza HJ, Pérez- Impact of polymorphism in IL-1RA gene on the risk of Pérez GI. Role of the polymorphic IL-1B, IL-1RN and TNF- cervical cancer. Arch Gynecol Obstet. 2008 A genes in distal gastric cancer in Mexico. Int J Cancer. Jun;277(6):527-33 2005 Mar 20;114(2):237-41 Ahirwar DK, Agrahari A, Mandhani A, Mittal RD. Cytokine Lind H, Zienolddiny S, Ryberg D, Skaug V, Phillips DH, gene polymorphisms are associated with risk of urinary Haugen A. Interleukin 1 receptor antagonist gene bladder cancer and recurrence after BCG immunotherapy.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 752 IL1RN (interleukin 1 receptor antagonist) Gómez-Flores-Ramos L, et al.

Biomarkers. 2009 Jun;14(4):213-8 Oliveira JG, Duarte MC, Silva AE. IL-1ra anti-inflammatory cytokine polymorphism is associated with risk of gastric Aksentijevich I, Masters SL, Ferguson PJ, Dancey P, cancer and chronic gastritis in a Brazilian population, but Frenkel J, van Royen-Kerkhoff A, Laxer R, Tedgård U, the TNF-β pro-inflammatory cytokine is not. Mol Biol Rep. Cowen EW, Pham TH, Booty M, Estes JD, Sandler NG, 2012 Jul;39(7):7617-25 Plass N, Stone DL, Turner ML, Hill S, Butman JA, Schneider R, Babyn P, El-Shanti HI, Pope E, Barron K, Sousa H, Santos AM, Catarino R, Pinto D, Moutinho J, Bing X, Laurence A, Lee CC, Chapelle D, Clarke GI, Canedo P, Machado JC, Medeiros R. IL-1RN VNTR Ohson K, Nicholson M, Gadina M, Yang B, Korman BD, polymorphism and genetic susceptibility to cervical cancer Gregersen PK, van Hagen PM, Hak AE, Huizing M, in Portugal. Mol Biol Rep. 2012 Dec;39(12):10837-42 Rahman P, Douek DC, Remmers EF, Kastner DL, Goldbach-Mansky R. An autoinflammatory disease with Burada F, Dumitrescu T, Nicoli R, Ciurea ME, Angelescu deficiency of the interleukin-1-receptor antagonist. N Engl C, Mixich F, Ioana M. IL-1RN +2018T>C polymorphism is J Med. 2009 Jun 4;360(23):2426-37 correlated with colorectal cancer. Mol Biol Rep. 2013 Apr;40(4):2851-7 Grimm C, Kantelhardt E, Heinze G, Polterauer S, Zeillinger R, Kölbl H, Reinthaller A, Hefler L. The prognostic value of Gómez Flores-Ramos L, Escoto-De Dios A, Puebla-Pérez four interleukin-1 gene polymorphisms in Caucasian AM, Figuera-Villanueva LE, Ramos-Silva A, Ramírez- women with breast cancer: a multicenter study. BMC Patiño R, Delgado-Saucedo JI, Salas-González E, Zúñiga- Cancer. 2009 Mar 6;9:78 González GM, Alonzo-Rojo A, Gutiérrez-Hurtado I, Gallegos-Arreola MP. Association of the tumor necrosis Lurje G, Hendifar AE, Schultheis AM, Pohl A, Husain H, factor-alpha -308G>A polymorphism with breast cancer in Yang D, Manegold PC, Ning Y, Zhang W, Lenz HJ. Mexican women. Genet Mol Res. 2013 Nov 18;12(4):5680- Polymorphisms in interleukin 1 beta and interleukin 1 93 receptor antagonist associated with tumor recurrence in stage II colon cancer. Pharmacogenet Genomics. 2009 Mattar R, Marques SB, Dos Santos AF, do Socorro Feb;19(2):95-102 Monteiro M, Iriya K, Carrilho FJ. A possible role of IL-1RN gene polymorphism in the outcome of gastrointestinal Sugimoto M, Furuta T, Yamaoka Y. Influence of diseases associated with H. pylori infection. Clin Exp inflammatory cytokine polymorphisms on eradication rates Gastroenterol. 2013;6:35-41 of Helicobacter pylori. J Gastroenterol Hepatol. 2009 Nov;24(11):1725-32 Ridge CA, McErlean AM, Ginsberg MS. Epidemiology of lung cancer. Semin Intervent Radiol. 2013 Jun;30(2):93-8 Dinarello CA. Interleukin-1 in the pathogenesis and treatment of inflammatory diseases. Blood. 2011 Apr Zapata-Tarrés M, Arredondo-García JL, Rivera-Luna R, 7;117(14):3720-32 Klünder-Klünder M, Mancilla-Ramírez J, Sánchez-Urbina R, Vázquez-Cruz MY, Juárez-Villegas LE, Palomo-Colli Hanahan D, Weinberg RA. Hallmarks of cancer: the next MA. Interleukin-1 receptor antagonist gene polymorphism generation. Cell. 2011 Mar 4;144(5):646-74 increases susceptibility to septic shock in children with acute lymphoblastic leukemia. Pediatr Infect Dis J. 2013 Lim WY, Chen Y, Ali SM, Chuah KL, Eng P, Leong SS, Feb;32(2):136-9 Lim E, Lim TK, Ng AW, Poh WT, Tee A, Teh M, Salim A, Seow A. Polymorphisms in inflammatory pathway genes, Baniyash M, Sade-Feldman M, Kanterman J. Chronic host factors and lung cancer risk in Chinese female never- inflammation and cancer: suppressing the suppressors. smokers. Carcinogenesis. 2011 Apr;32(4):522-9 Cancer Immunol Immunother. 2014 Jan;63(1):11-20 Wei X, Walia V, Lin JC, Teer JK, Prickett TD, Gartner J, Khatami M. Chronic Inflammation: Synergistic Interactions Davis S, Stemke-Hale K, Davies MA, Gershenwald JE, of Recruiting Macrophages (TAMs) and Eosinophils (Eos) Robinson W, Robinson S, Rosenberg SA, Samuels Y. with Host Mast Cells (MCs) and Tumorigenesis in CALTs. Exome sequencing identifies GRIN2A as frequently M-CSF, Suitable Biomarker for Cancer Diagnosis! Cancers mutated in melanoma. Nat Genet. 2011 May;43(5):442-6 (Basel). 2014 Jan 27;6(1):297-322

Zhang B, Beeghly-Fadiel A, Long J, Zheng W. Genetic This article should be referenced as such: variants associated with breast-cancer risk: comprehensive research synopsis, meta-analysis, and Gómez-Flores-Ramos L, Torres-Flores J, Gallegos-Arreola epidemiological evidence. Lancet Oncol. 2011 MP. IL1RN (interleukin 1 receptor antagonist). Atlas Genet May;12(5):477-88 Cytogenet Oncol Haematol. 2014; 18(10):746-753.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 753

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(10;17)(p15;q21) ZMYND11/MBTD1 Etienne De Braekeleer, Nathalie Douet-Guilbert, Audrey Basinko, Marie-Josée Le Bris, Frédéric Morel, Marc De Braekeleer Cytogenetics Laboratory, Faculty of Medicine, University of Brest, France (EDB, NDG, AB, MJLB, FM, MDB)

Published in Atlas Database: March 2014 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t1017p15q21ID1234.html DOI: 10.4267/2042/54138 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

consolidation therapy leading to complete Abstract remission, then relapse and second complete Short communication on on t(10;17)(p15;q21) remission, then bone marrow transplantation. ZMYND11/MBTD1, with data on clinics, and the Evolution genes implicated. (P1) alive in complete remission 71 months following diagnosis; (P2) died 37 months following Clinics and pathology the initial diagnosis. Another patient reported in the Disease literature was in complete remission at 42 months after diagnosis. Acute myeloid leukemia (AML), poorly differentiated, AML without maturation or with Cytogenetics minimal maturation (AML-M0, and AML-M1) Epidemiology Note The t(10;17)(p15;q21) involves two genes that were This is a rare chromosomal rearrangement, only not previously reported to form a putative fusion reported in four cases of AML without or with gene. minimal maturation, without molecular characterization (Pollak and Hagemeijer, 1987; Cytogenetics morphological Shah et al., 2001; Barjesteh van Waalwijk et al., t(10;17)(p15;q21) is identified by banding 2003; Dicker et al., 2007). cytogenetics. We add two cases with molecular cytogenetic Cytogenetics molecular studies (Tempescul et al., 2007; De Braekeleer et al., 2014).There were 2 cases of AML-M0 and 4 To determine the position of the breakpoints on cases of AML-M1. chromosomes 10 and 17, BACs located in the bands of interest were used as probes in FISH Clinics experiments. Analysis with RP11-387K19 showed Patients were aged 11, 13, 16 and 40 years. There that one signal hybridized to the normal were 3 male and 3 female patients. chromosome 10, and the other split and hybridized to both der(10) and der(17). Analysis with RP11- Treatment 326B24 showed that one signal hybridized to the Treatments of the patients reported in Tempescul et normal chromosome 17, and the other split and al. 2007, De Braekeleer et al. 2014 were the hybridized to both der(17) and der(10). Co- following: (P1) induction therapy followed by three hybridization with both BAC clones showed two consolidation courses leading to complete fusion signals. RP11-387K19 contains the remission; (P2) induction therapy followed by ZMYND11 gene and RP11-326B24 the MBTD1 gene.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 754 t(10;17)(p15;q21) ZMYND11/MBTD1 De Braekeleer E, et al.

FISH with BACs RP11-387K19 (spectrum orange, located in 10p15 and containing ZMYND11) and RP11-326B24 (spectrum green, located in 17q21 and containing MBTD1) showing co-hybridization.

Genes involved and Protein MBTD1 localizes to the nucleus and contains a proteins FCS-type zinc finger at the N-terminus with putative regulatory function and four MBT ZMYND11 (malignant brain tumor) repeats at the C-terminus. Location MBTD1 is a putative Polycomb group protein, 10p15.3 (according to UCSC Genome Browser on which are known to maintain the transcriptionally Human Feb. 2009 (GRCh37/hg19) Assembly) repressive state of genes, probably via chromatin DNA/RNA remodeling (Nady et al., 2012). The ZMYND11 gene contains 15 exons, of which 14 are coding, spanning 120 kb. Different isoforms References are generated by seven alternatively spliced transcript variants (Hateboer et al., 1995). Pollak C, Hagemeijer A. Abnormalities of the short arm of chromosome 9 with partial loss of material in Protein hematological disorders. Leukemia. 1987 Jul;1(7):541-8 The protein localizes to the nucleus and contains 3 Hateboer G, Gennissen A, Ramos YF, Kerkhoven RM, motifs involved in transcription regulation: a PHD Sonntag-Buck V, Stunnenberg HG, Bernards R. BS69, a finger and bromodomain in its N-terminal half, and novel adenovirus E1A-associated protein that inhibits E1A a MYND domain (conserved 2-zinc finger motif) at transactivation. EMBO J. 1995 Jul 3;14(13):3159-69 its C terminus. The MYND domain interacts with Masselink H, Bernards R. The adenovirus E1A binding the N-CoR/mSin3/HDAC1 complex that causes protein BS69 is a corepressor of transcription through transcriptional repression (Masselink and Bernards, recruitment of N-CoR. Oncogene. 2000 Mar 16;19(12):1538-46 2000). Shah D, Bond M, Kilby AM, Patterson KG. Widespread MBTD1 bone disease in acute myeloid leukaemia. Leuk Location Lymphoma. 2001 Nov-Dec;42(6):1309-14 17q21.33 Barjesteh van Waalwijk van Doorn-Khosrovani S, Erpelinck C, van Putten WL, Valk PJ, van der Poel-van de DNA/RNA Luytgaarde S, Hack R, Slater R, Smit EM, Beverloo HB, The MBTD1 gene contains 17 exons, of which 15 Verhoef G, Verdonck LF, Ossenkoppele GJ, Sonneveld P, are coding, spanning 82 kb. Seven transcript de Greef GE, Löwenberg B, Delwel R. High EVI1 variants are known (Eryilmaz et al., 2009). expression predicts poor survival in acute myeloid

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 755 t(10;17)(p15;q21) ZMYND11/MBTD1 De Braekeleer E, et al.

leukemia: a study of 319 de novo AML patients. Blood. Nady N, Krichevsky L, Zhong N, Duan S, Tempel W, 2003 Feb 1;101(3):837-45 Amaya MF, Ravichandran M, Arrowsmith CH. Histone recognition by human malignant brain tumor domains. J Dicker F, Haferlach C, Kern W, Haferlach T, Schnittger S. Mol Biol. 2012 Nov 9;423(5):702-18 Trisomy 13 is strongly associated with AML1/RUNX1 mutations and increased FLT3 expression in acute myeloid De Braekeleer E, Auffret R, Douet-Guilbert N, Basinko A, leukemia. Blood. 2007 Aug 15;110(4):1308-16 Le Bris MJ, Morel F, De Braekeleer M. Recurrent translocation (10;17)(p15;q21) in acute poorly Tempescul A, Guillerm G, Douet-Guilbert N, Morel F, Le differentiated myeloid leukemia likely results in ZMYND11- Bris MJ, De Braekeleer M. Translocation (10;17)(p15;q21) MBTD1 fusion. Leuk Lymphoma. 2014 May;55(5):1189-90 is a recurrent anomaly in acute myeloblastic leukemia. Cancer Genet Cytogenet. 2007 Jan 1;172(1):74-6 This article should be referenced as such: Eryilmaz J, Pan P, Amaya MF, Allali-Hassani A, Dong A, De Braekeleer E, Douet-Guilbert N, Basinko A, Le Bris MJ, Adams-Cioaba MA, Mackenzie F, Vedadi M, Min J. Morel F, De Braekeleer M. t(10;17)(p15;q21) Structural studies of a four-MBT repeat protein MBTD1. ZMYND11/MBTD1. Atlas Genet Cytogenet Oncol PLoS One. 2009 Oct 20;4(10):e7274 Haematol. 2014; 18(10):754-756.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 756

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(9;12)(p24;p13) ETV6/JAK2 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH) Published in Atlas Database: March 2014 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/1122t0912.html DOI: 10.4267/2042/54139 This article is an update of : Huret JL. t(9;12)(p24;p13). Atlas Genet Cytogenet Oncol Haematol 1998;2(2):54.

Abstract Cytogenetics Short communication on t(9;12)(p24;p13) Cytogenetics morphological ETV6/JAK2, with data on clinics, and the genes The t(9;12)(p24;p13) was the sole abnormality in implicated. three cases, accompanied with a t(3;12) Clinics and pathology ETV6/MECOM in one case, with numerical abnormalities in one case, and part of a complex Disease karyotype in one case (the MDS case). Del(6q) was Myeloproliferative disease in transformation, found in two cases. myelodysplastic syndrome (MDS), B-cell acute leukemia (B-ALL), and T-cell acute leukemia (T- Genes involved and ALL). proteins Phenotype/cell stem origin JAK2 One B-ALL was CD10+, the two others were not Location otherwise specified. 9p24.1 The myeloproliferative disease was an atypical chronic myelogenous leukemia (a-CML). DNA/RNA 24 exons. Epidemiology Protein Seven patients to date: 5 male and 2 female 1132 amino acids (aa); from N-term to C-term, patients. Median age was 26 years (range 1.5-80), JAK2 contains: an interaction region with with two children cases (one B-ALL and one T- cytokine/interferon/growth hormone receptors: aa ALL), and four cases were found in young adults 1-239, a FERM domain: aa 37-380, a SH2 domain: (aged 25, 26, 32, 33) (Lacronique et al., 1997; aa 401-482, two protein kinase domains: aa 545- Peeters et al., 1997; Najfeld et al. 2007; Zhou et al., 809 and 849-1124, an ATP nucleotide binding site: 2012). aa 855-863, and a loop structure: aa 1056-1078 Prognosis (JAK2 kinase insertion loop). JAK homology domains are the following: JH7: aa 25-137; JH6: aa Three patients did not reach complete remission 144-284; JH5: aa 288-309; JH4: aa 322-440; JH3: (two B-ALL and one T-ALL); one patient died 6 aa 451-538; JH2: aa 543-824; JH1: 836-1123. months after diagnosis (the a-CML case), and one Phosphotyrosines are located at aa 119, 372, 373, patient achieved CR, relapsed; a second CR was 523, 813, 868, 966, 972, 1007, and 1008 (Harpur et diagnosis (a B-ALL case). obtained and the patient al., 1992; Saltzman et al., 1998; Lucet et al., 2006). was alive 31 months after

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 757 t(9;12)(p24;p13) ETV6/JAK2 Huret JL

ETV6/JAK2 fusion protein.

Protein tyrosine kinase of the non-receptor type that Fusion protein associates with the intracellular domains of cytokine receptors; mediates signaling transduction. Description The HLH domain of ETV6 is fused to the protein ETV6 kinase domain(s), the ATP nucleotide binding, and Location the loop structure of JAK2; according to the 12p13.2 different possible breakpoints, the resulting protein DNA/RNA contains 475, 654, or 876 amino acids. 9 exons; alternate splicing. Furthermore, other products result from splicing (Peeters et al., 1997). The reciprocal JAK2-ETV6 Protein may not be expressed. 452 amino acids. ETV6 is composed of a HLH domain responsible for hetero- and Oncogenesis homodimerization in N-term, and an ETS domain It may be speculated that the HLH domain of ETV6 responsible for sequence specific DNA-binding in induces oligomerization, resulting in constitutive C-term (binds to the DNA sequence 5'- activation of the kinase domain of JAK2. CCGGAAGT-3'). Transcriptional regulator; tumor suppressor. Involved in bone marrow References hematopoiesis. Harpur AG, Andres AC, Ziemiecki A, Aston RR, Wilks AF. JAK2, a third member of the JAK family of protein tyrosine Result of the chromosomal kinases. Oncogene. 1992 Jul;7(7):1347-53 Lacronique V, Boureux A, Valle VD, Poirel H, Quang CT, anomaly Mauchauffé M, Berthou C, Lessard M, Berger R, Ghysdael J, Bernard OA. A TEL-JAK2 fusion protein with constitutive Hybrid gene kinase activity in human leukemia. Science. 1997 Nov Description 14;278(5341):1309-12 5' ETV6 - 3' JAK2. Three different hybrids have Peeters P, Raynaud SD, Cools J, Wlodarska I, been found: fusion of ETV6 exon 4 to JAK2 exon Grosgeorge J, Philip P, Monpoux F, Van Rompaey L, Baens M, Van den Berghe H, Marynen P. Fusion of TEL, 17 (Peeters et al., 1997), fusion of ETV6 exon 5 to the ETS-variant gene 6 (ETV6), to the receptor-associated JAK2 exon 17 (Lacronique et al., 1997), and fusion kinase JAK2 as a result of t(9;12) in a lymphoid and of ETV6 exon 5 to JAK2 exon 12 (Peeters et al., t(9;15;12) in a myeloid leukemia. Blood. 1997 Oct 1997). 1;90(7):2535-40

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 758 t(9;12)(p24;p13) ETV6/JAK2 Huret JL

Saltzman A, Stone M, Franks C, Searfoss G, Munro R, identified by FISH, characterize both JAK2617V>F-positive Jaye M, Ivashchenko Y. Cloning and characterization of and -negative patients with Ph-negative MPD, human Jak-2 kinase: high mRNA expression in immune myelodysplasia, and B-lymphoid neoplasms. Exp Hematol. cells and muscle tissue. Biochem Biophys Res Commun. 2007 Nov;35(11):1668-76 1998 May 29;246(3):627-33 Zhou MH, Gao L, Jing Y, Xu YY, Ding Y, Wang N, Wang Lucet IS, Fantino E, Styles M, Bamert R, Patel O, W, Li MY, Han XP, Sun JZ, Wang LL, Yu L. Detection of Broughton SE, Walter M, Burns CJ, Treutlein H, Wilks AF, ETV6 gene rearrangements in adult acute lymphoblastic Rossjohn J. The structural basis of Janus kinase 2 leukemia. Ann Hematol. 2012 Aug;91(8):1235-43 inhibition by a potent and specific pan-Janus kinase inhibitor. Blood. 2006 Jan 1;107(1):176-83 This article should be referenced as such: Najfeld V, Cozza A, Berkofsy-Fessler W, Prchal J, Scalise Huret JL. t(9;12)(p24;p13) ETV6/JAK2. Atlas Genet A. Numerical gain and structural rearrangements of JAK2, Cytogenet Oncol Haematol. 2014; 18(10):757-759.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 759

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Leukaemia Section Short Communication t(9;9)(p13;p24) PAX5/JAK2 del(9)(p13p24) PAX5/JAK2 inv(9)(p13p24) PAX5/JAK2 Jean-Loup Huret Genetics, Dept Medical Information, University of Poitiers, CHU Poitiers Hospital, F-86021 Poitiers, France (JLH)

Published in Atlas Database: March 2014 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/t0909p13p24ID1559.html DOI: 10.4267/2042/54140 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Cytogenetics Short communication on t(9;9)(p13;p24) Cytogenetics morphological PAX5/JAK2, with data on clinics, and the genes Additional chromosome abnormalities were noted implicated. in the two cases with complete data on the Clinics and pathology karyotypes. Disease Genes involved and B-cell acute lymphoblastic leukemia (B-ALL) proteins Phenotype/cell stem origin JAK2 Three cases were CD10+, and one case was C µ. Location Embryonic origin 9p24.1 Only four cases to date (Nebral et al., 2009; Coyaud Protein et al., 2010; Roberts et al., 2012). 1132 amino acids (aa); from N-term to C-term, JAK2 contains: an interaction region with Epidemiology cytokine/interferon/growth hormone receptors: aa This chromosome abnormality has only been found 1-239, a FERM domain: aa 37-380, a SH2 domain: so far in childhood B-ALL: there were 2 male and 2 aa 401-482, two protein kinase domains: aa 545- female patients, aged 7, 10, 13 and 14 years. 809 and 849-1124, an ATP nucleotide binding site: aa 855-863, and a loop structure: aa 1056-1078 Prognosis (JAK2 kinase insertion loop). Two of three patients were considered as being at JAK homology domains are the following: JH7: aa high risk, and one at intermediate risk. 25-137; JH6: aa 144-284; JH5: aa 288-309; JH4: aa One patient was in complete remission (CR) 65 322-440; JH3: aa 451-538; JH2: aa 543-824; JH1: months after diagnosis, and another one was in a 836-1123. second CR at 10 months+ (Nebral et al., 2009).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 760 t(9;9)(p13;p24) PAX5/JAK2 Huret JL

PAX5/JAK2 fusion protein.

Phosphotyrosines are located at aa 119, 372, 373, 2004; Johnson et al., 2004; Zhang et al., 2006; 523, 813, 868, 966, 972, 1007, and 1008 (Harpur et Cobaleda et al., 2007; Medvedovic et al., 2011). al., 1992; Saltzman et al., 1998; Lucet et al., 2006). Protein tyrosine kinase of the non-receptor type that Result of the chromosomal associates with the intracellular domains of cytokine receptors; Mediates signaling anomaly transduction. Hybrid gene PAX5 Description Location Fusion of PAX5 exon 5 to JAK2 exon 19 in each 9p13.2 case. Opposite direction is noted by Coyaud et al., 2010. Protein 391 amino acids; from N-term to C-term, PAX5 Fusion protein contains: a paired domain (aa: 16-142); an Description octapeptide (aa: 179-186); a partial homeodomain 522 amino acids (201 from PAX5 and 321 from (aa: 228-254); a transactivation domain (aa: 304- JAK2). 359); and an inhibitory domain (aa: 359-391). The predicted fusion protein contains the DNA Lineage-specific transcription factor; recognizes the binding paired domain of PAX5 and the Protein concensus recognition sequence kinase 2 domain from JAK2 (breakpoint at aa 811 GNCCANTGAAGCGTGAC, where N is any or 812 in JAK2). nucleotide. Involved in B-cell differentiation. Entry of common References lymphoid progenitors into the B cell lineage depends on E2A, EBF1, and PAX5; activates B-cell Harpur AG, Andres AC, Ziemiecki A, Aston RR, Wilks AF. JAK2, a third member of the JAK family of protein tyrosine specific genes and repress genes involved in other kinases. Oncogene. 1992 Jul;7(7):1347-53 lineage commitments. Activates the surface cell receptor CD19 and Saltzman A, Stone M, Franks C, Searfoss G, Munro R, Jaye M, Ivashchenko Y. Cloning and characterization of repress FLT3. human Jak-2 kinase: high mRNA expression in immune Pax5 physically interacts with the RAG1/RAG2 cells and muscle tissue. Biochem Biophys Res Commun. complex, and removes the inhibitory signal of the 1998 May 29;246(3):627-33 lysine-9-methylated histone H3, and induces V-to- Fuxa M, Skok J, Souabni A, Salvagiotto G, Roldan E, DJ rearrangements. Busslinger M. Pax5 induces V-to-DJ rearrangements and Genes repressed by PAX5 expression in early B locus contraction of the immunoglobulin heavy-chain gene. cells are restored in their function in mature B cells Genes Dev. 2004 Feb 15;18(4):411-22 and plasma cells, and PAX5 repressed (Fuxa et al., Johnson K, Pflugh DL, Yu D, Hesslein DG, Lin KI, Bothwell AL, Thomas-Tikhonenko A, Schatz DG, Calame K. B cell-

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 761 t(9;9)(p13;p24) PAX5/JAK2 Huret JL

specific loss of histone 3 lysine 9 methylation in the V(H) C, Mozziconacci MJ, Lafage-Pochitaloff M, Antoine-Poirel locus depends on Pax5. Nat Immunol. 2004 Aug;5(8):853- H, Charrin C, Perot C, Terre C, Brousset P, Dastugue N, 61 Broccardo C. Wide diversity of PAX5 alterations in B-ALL: Lucet IS, Fantino E, Styles M, Bamert R, Patel O, a Groupe Francophone de Cytogenetique Hematologique Broughton SE, Walter M, Burns CJ, Treutlein H, Wilks AF, study. Blood. 2010 Apr 15;115(15):3089-97 Rossjohn J. The structural basis of Janus kinase 2 inhibition by a potent and specific pan-Janus kinase Medvedovic J, Ebert A, Tagoh H, Busslinger M. Pax5: a inhibitor. Blood. 2006 Jan 1;107(1):176-83 master regulator of B cell development and leukemogenesis. Adv Immunol. 2011;111:179-206 Zhang Z, Espinoza CR, Yu Z, Stephan R, He T, Williams GS, Burrows PD, Hagman J, Feeney AJ, Cooper MD. Roberts KG, Morin RD, Zhang J, Hirst M, Zhao Y, Su X, Transcription factor Pax5 (BSAP) transactivates the RAG- Chen SC, Payne-Turner D, Churchman ML, Harvey RC, mediated V(H)-to-DJ(H) rearrangement of immunoglobulin Chen X, Kasap C, Yan C, Becksfort J, Finney RP, genes. Nat Immunol. 2006 Jun;7(6):616-24 Teachey DT, Maude SL, Tse K, Moore R, Jones S, Mungall K, Birol I, Edmonson MN, Hu Y, Buetow KE, Chen Cobaleda C, Schebesta A, Delogu A, Busslinger M. Pax5: IM, Carroll WL, Wei L, Ma J, Kleppe M, Levine RL, Garcia- the guardian of B cell identity and function. Nat Immunol. Manero G, Larsen E, Shah NP, Devidas M, Reaman G, 2007 May;8(5):463-70 Smith M, Paugh SW, Evans WE, Grupp SA, Jeha S, Pui CH, Gerhard DS, Downing JR, Willman CL, Loh M, Hunger Nebral K, Denk D, Attarbaschi A, König M, Mann G, Haas SP, Marra MA, Mullighan CG. Genetic alterations OA, Strehl S. Incidence and diversity of PAX5 fusion activating kinase and cytokine receptor signaling in high- genes in childhood acute lymphoblastic leukemia. risk acute lymphoblastic leukemia. Cancer Cell. 2012 Aug Leukemia. 2009 Jan;23(1):134-43 14;22(2):153-66 Coyaud E, Struski S, Prade N, Familiades J, Eichner R, Quelen C, Bousquet M, Mugneret F, Talmant P, Pages This article should be referenced as such: MP, Lefebvre C, Penther D, Lippert E, Nadal N, Taviaux S, Huret JL. t(9;9)(p13;p24) PAX5/JAK2. Atlas Genet Poppe B, Luquet I, Baranger L, Eclache V, Radford I, Barin Cytogenet Oncol Haematol. 2014; 18(10):760-762.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 762

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Deep Insight Section

Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) Peter C McKeown Genetics & Biotechnology Lab, Plant & AgriBiosciences Research Centre (PABC), School of Natural Sciences, National University of Ireland, Galway, Ireland (PCM)

Published in Atlas Database: March 2014 Online updated version : http://AtlasGeneticsOncology.org/Deep/NoRCID20134.html DOI: 10.4267/2042/54141 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Protein synthesis in living cells requires functional ribosomes which are composed of ribosomal proteins and ribosomal RNA (rRNA) molecules. rRNA is transcribed from tandemly repeated ribosomal DNA (rDNA) which is organised into a nuclear compartment termed the nucleolus in S-phase cells. It is essential that rDNA transcription is properly regulated in order to meet the cell's requirements for ribosomes and hence protein synthesis without wasting metabolic energy. In the last twenty years many proteins involved in regulating this process have been identified, suggesting that most organisms contain multiple protein complexes that regulate rDNA packaging and transcription. Importantly, it has become clear that errors in the function of these proteins can permit aberrant cellular growth, including in several classes of cancer. In this review, I discuss the history of how protein complexes such as the Nucleolar Remodelling Complex (NoRC) were discovered, using examples from humans and from model research organisms from different biological groups. I will discuss recent discoveries of the critical roles of rDNA-binding complexes in nucleolar assembly, the widespread occurrence of regulatory non-coding RNAs which interact with these complexes, and the pathways which regulate rDNA transcription in response to cellular energy status. Finally, I will review the growing evidence that misregulation of rDNA transcription not only allows the growth of cancerous cells, but can trigger oncogenesis itself.

Introduction with, and often prognostic for, the occurrence of cancer. Control of transcription at rDNA has also All living cells have an essential requirement to been used as a paradigm for understanding transcribe rRNA genes (rDNA) to produce rRNA eukaryotic gene expression in general. for use in ribosome synthesis. Ribosome production In this deep insight, key mechanisms that determine is necessary to support translation of mRNA and how rDNA transcription is controlled will be consumes a significant proportion of the energy discussed. There is a particular focus on the available to a typical living cell. rDNA pathways which act in mammalian cells, including transcription, which is performed in eukaryotes by those which have been implicated in RNA polymerase I, must be correctly regulated in tumourigenesis. However, reference is also made to order to ensure that the cellular requirement for some of the many insights into rDNA regulation ribosomal subunits is met. Studies in many groups revealed in other model biological systems, such as of organisms have revealed the existence of mutagenesis screens for loss of rDNA silencing in multiple interacting pathways which ensure this yeast, and some of the many epigenetic aspects of regulation by up- or down-regulate total rRNA rDNA regulation discovered in hybrid plants of the synthesis via activation or silencing of rDNA, Arabidopsis genus. As rRNA synthesis, the respectively. It has also become clear that organisation of rDNA into nucleoli and the dysregulation of these pathways is associated with subsequent formation of ribosomes are all highly many pathologies, and in mammals is associated complex topics, this account will necessarily deal

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 763 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

only with certain key discoveries, together with 20-40 rRNA genes are required to meet the some highlights of the recent literature. The reader production levels of rRNA in a typical dividing cell will be referred to many excellent reviews from the (Sollner-Webb et al., 1985). Furthermore, most last few years for further details where appropriate. eukaryotes contain many more rRNA genes than In terms of organisation, this deep insight will this (usually in the range of 50-500) and under most begin with a general discussion of how RNA conditions, only a subset of the total are actively polymerase I acts to generate nascent rRNA transcribed while the others are silenced by a molecules as precursors to ribosome biosynthesis, dosage-control mechanism (Dammann et al., 1993; before turning to how this process is controlled. I Russell and Zomerdijk, 2005). A consequence of will discuss the characteristics of rDNA regulation this is that rRNA synthesis can be up- or down- networks with particular biological or medical regulated either by varying the number of active significance from different systems, before turning genes or by altering the transcription rate per gene, to aspects of how rDNA transcription has been although the relative importance of these two linked to cancer. pathways may vary between organisms (Dammann a) the mammalian NoRC complex and other et al., 1993; French et al., 2003). Both processes are complexes which interact with or oppose its controlled by cellular signalling pathways of some activity; complexity (Schmelzle and Hall, 2000; Stefanovsky b) the links between rRDNA transcription and et al., 2001; Grummt, 2003; Kim et al., 2003; Moss, cellular energy status; 2004). c) other multi-protein complexes in plants and yeast The inactive rRNA genes are maintained in a which shed light on other aspects of rRNA transcriptionally silent, inactive state which requires transcription control; the interaction of many cellular processes (McStay d) misregulation of rDNA regulation complexes and Grummt, 2008). This silencing ensures that the and their links with cancer and other pathologies. cell's energy is not expended on unnecessary rRNA rDNA chromatin and the synthesis, that rRNA genes which have accumulated mutations or become pseudogenic are organisation of the nucleolus not transcribed, and that the activity of other RNA Ribosomal RNA (rRNA) synthesis occurs in the polymerases within the rDNA is prevented nucleolus which assembles during the packaging (Dammann et al., 1993). As we will see, preventing and transcription of ribosomal DNA. In the aberrant rRNA transcription may also be an nucleolus, tandemly repeated 45S ribosomal RNA important barrier to tumour formation in mammals, genes (or rDNA) are transcribed to form 45S and failure to repress aberrant may trigger nascent pre-rRNA (Ballal et al., 1977). Each pre- oncogenesis under some circumstances. Finally, rRNA is cleaved and processed to form the 18S, classic studies demonstrated that the cells of hybrid 5.8S and 25S rRNA molecules which are essential organisms generally silence the entire rDNA for the formation of ribosomes (Shaw and Jordan, inherited from one parental species and activate that 1995). The nucleolus is not bound by any from the other (Navashin, 1934). This phenomenon membrane but self-assembles during the processes is now known as nucleolar dominance and has been of rRNA transcription and subsequent processing used to illustrate many of the pathways that regulate (Mélèse and Xue, 1995). Nucleoli are stable enough rDNA activity. to be extracted from culture cells (Andersen et al., A key issue for understanding rRNA transcription 2002; McKeown et al., 2008) and studies in plants is therefore to understand the mechanistic basis of and animals have used mass spectrometry to the switch between transcriptionally active and identify proteins involved in the production of transcriptionally repressed rDNA. It was shown rRNA (Andersen et al., 2002; Pendle et al., 2005). several decades ago that rDNA exists in two Such studies have suggested that in many distinct conformations (that is, physical states organisms nucleoli have also acquired additional within the nucleus), and that these can be stably cellular functions in stress response, splicing and inherited through mitosis (Conconi et al., 1989; small RNA biosynthesis (Pendle et al., 2005; Raška Birch and Zomerdijk, 2008). The two forms of et al., 2006; Boisvert et al., 2007; Boulon et al., rDNA correspond to rRNA genes which are 2010), although these will not be considered further organised into different forms of chromatin, the here. DNA-protein superstructure into which DNA is In most eukaryotes, the rDNA locus consists of 'packaged' following binding by histone octamers several hundred tandemly repeated rRNA genes, (Prior et al., 1983). separated by linker regions. These are located at The two forms of rDNA chromatin can be one or more large loci, which are also termed distinguished on the basis of their differential nucleolar organizing regions (NORs). The tandem accessibility to the DNA-crosslinking drug, repetition of rRNA genes is necessary as at least psoralen.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 764 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Figure 1. Generalized model for the three chromatin states in which eukaryote rRNA genes may form. A) constitutively silent rDNA repeats organised into heterochromatin; B) rDNA repeats organised into euchromatin and actively transcribed by RNA Pol I (shown as a schematic core polymerase core and transcription factor; see text for details); C) 'poised' rDNA accessible to transcription machinery but not actively transcribed.

One form has a highly compact psoralen- nucleolar organisation and its relationship with inaccessible organisation corresponding to densely- rDNA packaging, rRNA gene transcription and pre- staining heterochromatin, and which is expected to rRNA processing in different taxa (Nierras et al., be refractory to rRNA gene transcription. 1997; Raška et al., 2006; McStay and Grummt, The other is a more dispersed, psoralen-accessible 2008; Shaw and McKeown, 2011; Shaw and form which corresponds to the lightly-stained Brown, 2012). euchromatin and is expected to be permissive for Early evidence on the nature of the molecular transcription (Conconi et al., 1989; Dammann et al., differences between active and inactive rRNA 1993). This suggests a basic conceptual model in genes was suggested by the chemical manipulation which the activation level of rRNA genes depends of nucleolar dominance by aza-dC and trichostatin upon a switch between two different chromatin A, DNA methylation and histone deacetylation states, which either repress transcription by Pol I or inhibitors, respectively (Reeder, 1985; Thompson induce it, respectively. This also corresponds with and Flavell, 1988; Pikaard, 2000). As these electron microscopy investigations which confirm pharmacological treatments altered the extent of that rDNA can be present in one of two forms nucleolar dominance, it was concluded that both within the cell, one of which is indeed densely DNA methylation and histone modification might compacted in the manner of heterochromatin, while differ between rDNA chromatin states in a manner the second is less dense in the manner of related to the control of their transcription (Chen euchromatin. and Pikaard, 1997; Pikaard, 1999; McStay, 2006). Under the microscope, heterochromatin is visible Elucidating the details of what these modifications within nucleoli as fibrillar centres or as 'knobs' might be has been greatly accelerated by the arranged around the nucleolar periphery, while development of the chromatin immunoprecipitation euchromatin may be present throughout the body of (ChIP) technique. For example, it has been shown the nucleolus. Many lines of evidence support the that mammalian rRNA genes can be associated supposition that the compacted heterochromatic with either of two sets of covalent chromatin rDNA is typically inactive, while that which more modifications, which correlate with their level of loosely organised is euchromatic and likely to be transcriptional activity (Santoro et al., 2002). DNA undergoing transcription (Raška et al., 2006). of silenced rRNA genes is highly methylated at Understanding the features of these two chromatin cytosine residues, and is bound by histone octamers states, and the protein complexes which induce which are methylated at H3K9 (Figure 1A). Active transitions between them, is thus essential for rRNA genes are instead distinguished by DNA understanding how rRNA transcription is controlled hypomethylation, and are bound to histone (Gerbi et al., 2003). Various reviews describe our octamers incorporating H3K4 marks and current understanding of the importance of widespread acetylation of many H3 and H4 lysine

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 765 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

residues (Figure 1B). It has also been proposed that essential for activating rDNA transcription as its rDNA can also exist in a third, intermediate state, in binding initiates an open chromatin conformation which the chromatin of the rRNA genes is (Längst et al., 1997; Längst et al., 1998). This open decondensed but they remain transcriptionally chromatin structure is stabilised by the HMG-box silent (Figure 1C). protein, UBF, which binds ubiquitously across the This is characterised by the simultaneous presence entire rDNA locus (Roussel et al., 1993). The of histone modifications associated with importance of UBF for supporting RNA Pol I- euchromatin and heterochromatin on different sites transcription is suggested by the fact that it largely and may correspond to a 'poised' euchromatic state supplants the histone octamer-based nucleosome as (McKeown and Shaw, 2009; Xie et al., 2012). the basic subunit of chromatin at active rRNA Much research has therefore concentrated on genes (Zatsepina et al., 1993; O'Sullivan et al., determining what roles these chromatin 2002; Mais et al., 2005). UBF plays a particularly modifications play at the molecular level, and to critical role at the rRNA gene promoter, where it what extent they are causal for determining the serves as a scaffold for the binding of RNA Pol I activity of the rRNA genes with which they transcription factors and other processing proteins associate. Such studies have made use of many (Mais et al., 2005; Prieto and McStay, 2007). As different biological systems and have exploited this facilitates RNA Pol I promoter escape (Panov genetic, biochemical and cell biological techniques, et al., 2006), UBF therefore orchestrates the level of including cell culture models for different human rRNA transcription at active rRNA genes cancers and other diseases. (O'Mahony and Rothblum, 1991; O'Sullivan et al., These studies have demonstrated that while the 2002; Chen et al., 2004; Sanij et al., 2008). UBF proteins which control rDNA chromatin typically activity is itself tightly regulated (Sanij and vary between different groups of eukaryotic Hannan, 2009), including by post-translational organisms, the regulatory networks in which they modifications, which control how UBF reactivates act also have various key features in common. In rRNA transcription after it has temporarily ceased the following section, the control of rDNA during mitosis (Voit et al., 1999; Meraner et al., transcription in humans (and certain model 2006). Recent work has demonstrated that the systems) will be described. control of RNA Pol I activity is both necessary and rDNA silencing I - control of sufficient for the formation of the nucleolus in human cells (Grob et al., 2014). human RNA Pol I transcription by RNA Pol I function also requires a complex termed protein complexes FACT, ( fa cilitates chromatin transcription), which In eukaryote, 45S pre-rRNA is synthesised by a can be co-precipitated with RNA Pol I (Birch et al., dedicated transcriptional system centred on the 2009). In contrast to UBF which regulates the multimeric protein complex, RNA Polymerase I initiation of transcription, FACT is specifically (hereafter RNA Pol I). RNA Pol I only catalyzed required for the efficient passage of polymerases the transcription of rDNA, which is in turn not through nucleosomes. In this way, FACT facilitates transcribed by any other polymerase system under transcription by RNA Pol I, II and III and is thus normal conditions. For a general review of the essential for transcriptional elongation throughout biochemical structure of RNA Pol I, see (Vannini, the nucleus (its relationship with other RNA 2013). In addition to the core subunits of RNA Pol I polymerases present in plants remains to be itself, its polymerase activity requires the action of ascertained). FACT contains two core subunits, several other proteins and protein complexes, many SSRP1 and Spt16. In accordance with the essential of which have regulatory potential. nature of FACT for transciption, cells in which These RNA Pol I cofactors and transcription factors either subunit is down-regulated display reduced (TF) allow RNA Pol I to effect transcription at transcription at the 3' regions of the rRNA genes active rRNA genes and to determine the level of (Birch et al., 2009). this. Both initiation and elongation can be co-ordinately In humans, the principal RNA Pol I TFs consist of regulated independently of UBF and FACT by the Upstream Binding Factor (UBF), the promoter another large (2-3 MDa) complex, this time selectivity factor (SL1, (Comai et al., 1992)) and involved in maintaining an open chromatin the transcription termination factor (TTF-I, structure throughout active rDNA repeats. This (Grummt, 2003)). These complexes remain third key complex has been termed B-WICH and its associated with rDNA during the cell cycle, even core subunits include WSTF, SNF2h and myosin1 during mitosis when rRNA gene transcription is (Percipalle et al., 2006); the complex takes its name silenced but are maintained in an inactivate state from the Williams syndrome transcription factor until transcription resumes in telophase (O'Mahony (WSTF). B-WICH was first reported to be required and Rothblum, 1991). Of these proteins, TTF-I is for efficient transcriptional activity of RNA Pol II.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 766 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

When its subunits are knocked down, the positioning of a key nucleosome. Notably, this abundance of Pol III transcripts is also reduced, complex is also tightly regulated with respect to the indicating that its role is not specific for control of growth status of the mammalian cells in question, rDNA activity (Cavellán et al., 2006; Percipalle et via pathways as yet unknown. The trend established al., 2006). WSTF is also a component of other by UBF and other complexes is that rDNA activity transcriptional complexes, leading to pleiotropic is regulated by the activity of multi-protein phenotypes when it is disrupted, and most of these complexes, many with chromatin-modifying also includes ncRNA molecules (Cavellán et al., activities. These complexes, and doubtless more 2006). The B-WICH complex appears to be which remain to be discovered, are presumed to required for the recruitment of some, but not all, of ensure RNA Pol I transcription occurs at an the histone acetyltransferases present at active appropriate level via multiple, subtle interactions. rDNA (Vintermist et al., 2011) which presumably This has been argued to be the main mode of rRNA explains its mode of action. synthesis in mammals under normal circumstances The B-WICH complex physically interacts with the (Stefanovsky and Moss, 2006). Cockayne's syndrome protein (CSB) protein, which also has multiple roles in controlling RNA Pol II Control of rDNA transcription II - transcription and DNA repair. CSB is itself required the role of silencing complexes for RNA Pol I transcription, including performing While UBF determines the activity of RNA Pol I at ATP-dependent chromatin remodelling at active rRNA genes with a suitably open chromatin rDNA repeats (Lebedev et al., 2008). organisation, it is not responsible for determining CSB can additionally act in an ATP-independent the proportion of rRNA genes which are organised manner within another complex, termed CSB in this transcriptionally-permissive manner. In IP/150. This complex also includes XPG (a protein human cells, the principal determinant of the ratio disrupted in certain cases of the human condition, of active and inactive rRNA genes is the multi- Xeroderma Pigmentosum), RNA Pol I itself, and a protein complex NoRC ( nucle olar remodelling transcription factor complex, TFIIH (Bradsher et complex) which silences rRNA genes the al., 2002). TFIIH was originally described as a Pol transcriptional of which is not required. NoRC was II-specific TF, but has subsequently been shown to discovered in the 1990s and was initially described activate Pol I transcription in yeast and mouse as as a complex of Snf2h/Smarca5 and the large (205 well (Iben et al., 2002). kDa) DNA-binding protein, Tip5 (transcription In human cells, CSB IP/150 performs this termination factor 1 (Ttf1)-interacting protein 5) - activation by recruiting a further histone see Figure 2. acetyltransferase, PCAF, which leads to At the sub-cellular level, NoRC was found to transcriptional initiation at rRNA genes which have colocalise at the NORs. already adopted an open, poised chromatin state Since its discovery, it has been established that (Shen et al., 2013). Curiously, CSB/TFIIH also NoRC is essential both for blocking RNA Pol I recruits a histone methyltrasferase, G9a, which transcription at these inactive rDNA loci, and induces H3K9me2, which is generally considered a moreover for catalyzing the assembly of rRNA repressive chromatin mark (Yuan et al., 2007). The genes into a heterochromatic conformation association of CSB with RNA Pol I within CSB (Strohner et al., 2001). IP/150 appears to be disrupted by mutations in the In other words, it regulates the level of rDNA other components of the complex (Bradsher et al., transcription by decreasing the ratio of 2002). This may be involved in the onset of active:inactive rRNA genes, and is therefore Cockayne Syndrome, a recessive disorder complementary to the Pol I transcription factors associated with premature aging and neural which reduce or increase transcription at rRNA degeneration. genes which are already active. NoRC therefore As further evidence of the complexity of RNA Pol I seems to play an antagonistic role to complexes transcriptional control, a further such complex has such as B-WICH and CSB IP/150 (see above), been reported from human cells rather recently (in although whether these complexes are capable of 2012). directly regulating NoRC is unclear. This time, the complex was associated with the It has been suggested that complexes associated establishment of 'poised' or transcription-ready with euchromatic and heterochromatic rDNA might rRNA genes and was named 'nucleosome be recruited to rDNA at different stages during remodelling and deacetylation' complex (NuRD) nuclear division, as active and inactive rRNA genes (Xie et al., 2012). When cellular growth is undergo replication at different timepoints (Yuan et attenuated and transcription at rDNA reduced, al., 2007). NuRD is enriched at rRNA gene promoters which The possibility of cross-talk occurring between are unmethylated, associated with RNA Pol I these complexes merits further investigation. transcription factors, yet kept silent by the

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 767 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Figure 2. Predicted model for the control of rDNA silencing by the Nucleolar Remodelling Complex (NoRC). NoRC consists of Tip5 and Snf2h. Tip5 is recruited to rRNA by transcription of a non-coding RNA termed pRNA (bold line). Binding of NoRC to rRNA genes leads to TTF-I dependent recruitment of chromatin remodelling enzymes (gray) and repression of rRNA transcription. Binding of NoRC to rDNA may require, or be stabilised by, Heterochromatin Protein 1 (HP1) and acetylated H4K16 residues (not shown).

The key role of NoRC in control of human rDNA methylation in vivo (Santoro et al., 2002). As transcription was first indicated by in vitro expected, treatment with the DNA methylation experiments showing that it was able to induce inhibitor 5-azacytidine reversed this effect (Santoro nucleosome sliding (of the sort required for rRNA et al., 2002). NoRC is therefore responsible for gene silencing) along isolated DNA. This activity inducing the methylation of rRNA gene promoters was dependent upon ATP, and the N-terminal tail in mammalian cells. Importantly, the NoRC of histone H4 (Strohner et al., 2001), indicating a component Tip5 also acts as a binding site for the direct affect upon nucleosome organisation. Based transcription termination factor TTF-I (Németh et on its chromatin-remodelling capabilities and al., 2004) which had previously been shown to be colocalisation with UBF in the nucleolus, NoRC essential for repressive chromatin remodelling at was therefore recognised as a candidate regulator of the promoter of silenced rRNA genes (Längst et al., rDNA transcription control. This hypothesis was 1997; Längst et al., 1998). It is therefore believed proven shortly afterwards with the demonstration that NoRC establishes and maintains the that association of NoRC with rDNA repeats heterochromatic organisation of inactive rDNA caused rRNA genes to become heterochromatic and repeats via recruitment of TTF-I and other enzymes transcriptionally silent (Santoro et al., 2002). The which induce DNA methylation and the deposition biochemical nature of this heterochromatic DNA of repressive histone modifications. was indicated by the discovery that methylated These include H3K9 methylation and H4 rDNA genes could be immunoprecipitated in hypoacetylation (Santoro et al., 2002) and may be conjunction with the two components of NoRC mediated by Tip5 binding to H4K16ac via a (Tip5, Snf2). These proteins are additionally co- bromodomain, which appears to stimulate immunoprecipitated with hypoacetylated and recruitment of chromatin-remodelling enzymes hypermethylated histones, and with such as HDAC1, DNMT1, DNMT3, and SNF2h to heterochromatin protein 1 (HP1). This indicated the rDNA (Zhou and Grummt, 2005), as shown in again that NoRC was a complex specifically Figure 2. As an additional level of control, the associated with methylated, inactive rDNA, and binding of NoRC can be countered by an abundant that the rRNA genes in this rDNA was likely to be nucleolar protein, nucleolin, which reduces the organised into heterochromatin. NoRC was ability of TTF-I to bind to its target terminator therefore established as a key element of the region and thus reduces Tip5 recruitment (Cong et heterochromatic fraction of rDNA previously al., 2012). identified in microscopy-based studies (Santoro et Although initially described as a complex of al., 2002). proteins, it was subsequently discovered that NoRC The study of Santoro et al. furthermore determined also contains an essential RNA component. A non- that the role of NoRC in heterochromatic rDNA coding RNA is produced from transcription of the was likely to be causal rather than correlative. rRNA gene promoter, termed pRNA, which binds Over-expression of Tip5 caused a transfected rDNA to Tip5 and is required for targeting of the complex reporter plasmid to become resistant to cleavage by to the rDNA promoter. pRNA binding mediates the methylation-sensitive restriction enzyme HpaII, DNMT3b association with the rRNA gene promoter indicating that NoRC was able to induce DNA (Bierhoff et al., 2011).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 768 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Figure 3. The regulation of rRNA gene transcription in response to cellular energy status. The eNOSC complex consists of NML (nucleomethylin), SuV (SUV39H1) and SIRT1 (sirtuin 1), and responds to signals indicating low cellular energy status by silencing rRNA genes and repressing ribosomal RNA production. At least one other pathway, involving mammalian Target Of Rapamycin (mTOR) operates in parallel. For details, and possible interaction of NMP with NMNAT1, see text.

pRNA-binding is dependent upon the acetylation of sensitive to cellular energy status (Fritze et al., Tip5 by an interacting acetyltransferase, MOF 1997). Amongst other targets, Sir2 is able to (Males Absent on the First), which occurs only on deacetylate histones, removing H3-acetyl marks lysine residue K633 and is essential for the gene- associated with open, transcriptionally active silencing activity of NoRC (Zhou et al., 2009). The chromatin and potentially allowing the addition of pRNA also acts to allow the binding of poly(ADP- H3-methyl marks, which are associated with ribose)-polymerase-1 (PARP1) which is essential transcriptionally inactive heterochromatin, Sir2 is for NoRC to silence RNA Pol I and subsequent known to be able to regulate rDNA transcription by heterochromatinization of silent rDNA (Guetg et RNA Pol I, and it has been proposed that this is al., 2012). linked to its histone/protein deacetylation rDNA silencing III - regulation of capabilities (Fritze et al., 1997; Smith et al., 1998; Straight et al., 1999; Blander and Guarente, 2004; RNA Pol I silencing by cellular Machín et al., 2004; Ford et al., 2006). The energy status ramifications of the role of Sir2 and related proteins The manner in which the numerous complexes (the so-called sirtuins) for human health is a topic described above interact to control RNA Pol I of intense scientific debate, as several lines of activity remains a difficult issue, but the overall evidence suggest that Sir2 is a key regulator of purpose of this complexity is clearly to allow rDNA ageing and longevity in yeast, nematodes and activity to be attuned to the environment. One metazoans. This may occur through mimicking the cellular condition to which rDNA appears to be effects of caloric restriction. It has been claimed, particularly sensitive is the energetic status of the for example, that increased cellular dosage of Sir2p cell, which can (in mammals) regulate rRNA in S. cerevisiae can expand yeast life span by transcription by several different signalling suppressing genotoxic recombination between pathways. This is unsurprising given the high rDNA repeats of the sort discussed below (Lin et demand that rRNA synthesis makes on the cell's al., 2000). Here I will focus specifically on the role ATP reserves, sometimes estimated as half of the of Sir2 and related proteins in the direct control of cell's energetic output (Sollner-Webb et al., 1985; transcription at the rDNA locus. For the details of Grummt and Voit, 2010). Therefore, rDNA the ongoing debate over the more controversial transcription must occur at a level suitable to meet claims made for these proteins, the reader is the translational demand of the cell, while also referred to dedicated commentaries (Finkel et al., taking account of the ATP available in the cell at 2009; Lempiäinen and Shore, 2009; Imai and that time. Guarente, 2010; Sebastián et al., 2012). The importance of this link, and its wide-ranging Sirtuins share the common feature that they use impacts on the healthy functioning of an organism, NAD+ as a cofactor in the deacetylation of peptide have been most widely established by studies of the targets, which may make them particularly suitable budding yeast ( Saccharomyces cerevisiae ) protein, as sensors of cellular energy levels. The closest Silent information regulator 2 (Sir2). Sir2 is an human homolog of ScSir2p is SIRTUIN 1 (SIRT1), NAD +-dependent protein deacetylase which is which binds throughout rDNA repeats regardless of

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 769 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

their transcriptional state, although the majority of activator of RNA Pol I (Ford et al., 2006). Although it is distributed in other parts of the nucleoplasm still relatively understudied, it has been shown that (Michishita et al., 2005).The importance of the SIRT7 physically interacts with UBF and remains links between rDNA transcriptional activity and stably associated with both UBF and rDNA during cellular metabolic status was underlined by the mitosis (Grob et al., 2009; Tsai et al., 2012). After discovery that SIRT1 is part of a protein complex mitosis, SIRT7 is essential for the resumption of termed eNoSC within human cells (Murayama et rRNA gene transcription during telophase, al., 2008). This complex contains the H3K9me2- following a phosphorylation-induced conformation binding protein, Nucleomethylin (NML), SIRT1 change performed by an unknown kinase (Grob et and SUV39H1 (Figure 3). NML had previously al., 2009). SIRT7 acts in vivo as an NAD +- been shown to be at least partially localised in the dependent deacetylatase of the transcription- nucleolus (Andersen et al., 2005) and was identified permissive histone modification H3K18Ac at gene by MS-ChIP to be bound to H3K9me2 at promoters, thus reducing transcription (Barber et transcriptionally inactive rDNA (Murayama et al., al., 2012). Misregulation of this activity has been 2008). In vivo over-expression of NML reduced the linked with several aspects of tumour progression accumulation of nascent rRNA, an effect ablated by in human cells and in mice, and a significant knock-down of SIRT1 (Murayama et al., 2008). increase in SIRT7 expression in breast cancer The authors of this study proposed a model of 'co- samples has been reported (Ashraf et al., 2006; ordinate binding' of NML and SIRT1 occurring Barber et al., 2012). No link between these specifically at silenced rRNA genes, with SIRT1 correlations and the control of RNA Pol I has been triggering H3K9 hypoacetylation and subsequent reported, and the control of rDNA by SIRT7 has methylation at the same site. Methylation of been suggested to be cell- or tissue-specific (Barber hypoacetylated H3K9 was found to be at least et al., 2012), although links between rDNA partially due to the methyltransferase activity of misregulation, SIRT7 and oncogenesis could easily SUV39H1, which also participates in the same remain to be discovered. Likewise, the requirement complex. This suggests a model in which for NAD+, which varies in availability with a cell's SUV39H1 and SIRT1 compete for modification of energy status, may represent a significant link the same lysine residue. Many aspects of the between to control of rRNA transcription in the regulation of SIRT1 within eNoSC remain unclear: same way that has been claimed for SIRT1. two potentially significant points are that In several eukayotic cells, another energy-sensing nucleomethylin (NML) interacts with a NAD+ pathway based around signalling by Target of synthesis enzyme called NMNAT1, which also Rapamycin (TOR), which is a major component in contributes to the silencing of rDNA (Song et al., the nutrient signalling machinery (Figure 3, right 2013) and physically associates with SIRT1 (see hand side), has been argued to control to the Figure 3); and that SIRT1 may be able to acetylate transcription of rRNA (Schmelzle and Hall, 2000; SUV39H1 in a manner that disrupts their binding. Kim et al., 2002). This pathway controls RNA Pol I As a further complication, there is some evidence transcription via chromatin remodelling at rDNA that NML - which has a methyltransferase-like (Tsang et al., 2003), perhaps directly as TOR itself domain - may act via methylation of some binds to rRNA gene promoters (Tsang et al., 2010). downstream target (Murayama et al., 2008). In yeast, TOR assists rDNA stability by increasing Although most commonly associated with core Sir2p association with rDNA (Ha and Huh, 2011) histones, many other proteins can be subject to and also affects Rrn3p levels (Philippi et al., 2010). methylation. eNoSC binding at rDNA is increased Whether mammalian TOR (mTOR) is able to in HeLa cells under conditions that reduce available interact with any of the sirtuins is not currently cellular energy (glucose starvation) and this has clear (Blagosklonny, 2010). Interestingly, the been found to protect such cells from energy NuRD complex may also be regulated with regard deprivation-induced apoptosis. As the discovers of to cellular energy status, as ATP is required to eNoSC point out, rDNA-silencing may be critical reverse the associated silencing (Xie et al., 2012). for this although interaction with other apoptosis- Again, the biological significance of this fact inducing pathways cannot be excluded (Murayama remains to be fully established. et al., 2008). eNoSC does not, however, appear to The discovery of the presence of these multiple act on, or alter the methylation of, p53. complexes poses several intriguing questions. One Other human sirtuins have different sub-cellular which remains to be resolved is the issue of how the distributions, including the cytoplasm and different complexes which regulate rDNA function mitochondria, while SIRT6 and SIRT7 are also in human cell lines interact with one another. nuclear. The only evidence for strong nucleolar Another is why such a complex system is required enrichment was for SIRT7 (Michishita et al., 2005). to accomplish this regulation. The authors of SIRT7 is also of considerable interest for regulation Murayama et al., 2008 suggest an intriguing model of mammalian rDNA as it can also function as an in which NoRC is required for initiating silencing

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 770 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

(following its binding to the transcriptional roles as downstream effectors of chromatin terminator element of rDNA via TTF-I - see regulation at rDNA, acting to reinforce the open Strohner et al., 2001) - but it is eNoSC, which chromatin structure induced by nucleolin, and appears to bind ubiquitously to rDNA throughout thereby helping to maintain rRNA transcription at the nucleolus, that ensures chromatin silencing is active rDNA repeats. As other histone chaperones propagated. This suggests coordinate regulation by have also been shown to control the activity of different complexes might occur, or that different rDNA in human cells (Kuzuhara and Horikoshi, complexes might act to reinforce each other's 2004) and more recently in Arabidopsis (Li and activities in order to ensure that regulation of rRNA Luan, 2010), histone chaperone activity may have transcription and silencing are both robust and more general roles in controlling the balance responsive. between transcribed and silenced rRNA genes. Roles for histone modification in Although covalent modifications at the H3K4 and H3K9 residues are well-known regulators of controlling RNA Pol I transcription and other cellular processes (Iizuka transcription and Smith, 2003), additional histone modifications As noted above, the control of rDNA by NoRC is may also control rRNA transcription or other initiated when the complex binds to nucleosomes nucleolar functions, and it is possible that some are containing H4K16ac via a bromodomain in the enriched or specific in the nucleolus (McKeown Tip5 protein (Zhou and Grummt, 2005). This leads and Shaw, 2009). In mammals, for example, RNA to the subsequent recruitment of multiple histone Pol I transcription is encouraged via H3K56 deacetylases and histone methyltransferases which acetylation (Chen et al., 2012), and as noted above induce a heterochromatic organisation at the locus H3K18 acetylation may be involved in regulation and suggests a model in which different histone of rDNA by SIRT7. modifications direct various stages of euchromatin Active histone demethylation has also been and heterochromatin formation at the rDNA locus. implicated in rDNA control: JHDM1B is an As testament to this, pharmacological inhibition of evolutionarily conserved protein demethylase histone-modifying enzymes commonly leads to which regulates animal growth and may act as a altered rRNA expression levels and nucleolar tumour suppressor in mice (see Frescas et al., 2007 morphology, and changes to nucleolar dominance. and references therein). JHDM1B binds to human The association between H4 and NoRC is not the rRNA genes in a stable manner reminiscent of only instance in which a major regulatory cascade UBF, and silences rRNA expression via requires binding to histones. H3/H4 dimer was demethylation of H3K4me3. This effect has an identified as a core component of the major S. absolute requirement for its JmjC domain and cerevisiae RNA Pol I TF, Upstream Activating appears to be a direct effect as H3K9me2 remains Factor (UAF) (Keener et al., 1997), in addition to unaffected. four non-histone protein components. Reduction of Reduced expression of JHDM1B is associated with H3 synthesis inhibited rRNA transcription and was increased rRNA synthesis and accelerated cell associated with reduced efficiency of multiple growth, and has been reported to occur in brain processes including initiation/elongation, and rRNA tumour cells (Frescas et al., 2007). processing, although in some cases these were Epigenetic control of RNA Pol I indirect effects (Nomura et al., 2004; Tongaonkar et silencing and the importance of al., 2005; Jones et al., 2007). In mammalian cells, too, classic biochemical feedback studies have shown that the H1 linker histone acts In the preceding sections, some of the protein as a binding site for the abundant rDNA-associated complexes which regulate the silencing of rDNA in protein, nucleolin (Erard et al., 1988) which is itself mammalian and yeast cells have been described. It now known to have nucleosome chaperone activity has however been made clear that important details (Angelov et al., 2006). Nucleolin has an affinity for about how the different regulatory components unmethylated rRNA gene promoters and appears to interact with each other remain to be determined. ensure deposition of H3K4me3 and other histone An important conceptual contribution to this modifications associated with a transcription- problem comes from research in plant hybrids, permissive state. On the other hand, nucleolin which has suggested that epigenetic regulators are depletion causes H3K9me2 to accumulate (Cong et able to establish 'self-reinforcing loops' at active al., 2012). The B-WICH complex also triggers and inactive rRNA genes. altered rDNA activity, this time by recruitment of The details of how these loops are established, and histone acetyltransferases (Vintermist et al., 2011). their wider relevance, are discussed in the following Hence, suitably modified nucleosomes also have section.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 771 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Figure 4. The regulation of rRNA gene transcription in the model plant, Arabidopsis thaliana . As in human cells, recruitment of rRNA silencing machinery is effected by production of non coding RNA from the rDNA repeats (e.g. 24 nt-siRNAs; short black lines); these lead to recruitment of DNA methyltransferases and methyl-binding domain proteins (MDB6, MDB10) and histone deacetylases (HDA6) which maintain silencing of rRNA genes by chromatin remodelling. Compared with rRNA gene regulation in humans, there is no NoRC, and no role has been reported for the plant ortholog of HP1.

In hybrid organisms, it commonly occurs that a point in common between animals and plants, as a chromatin remodelling of NORs inherited from long ncRNA plays a similar role in mouse (Mayer different progenitors ensures that only the rDNA et al., 2006; Mayer et al., 2008). On the other hand, inherited from one parent is transcribed while the no role has been reported for shorter RNA in the other remains silenced (so-called nucleolar silencing of inactive rDNA in mammals (as far as is dominance). The establishment of active or known), nor for long ncRNA in plants. A further repressed states at the two sets of NORs in point regarding comparisons between different interspecific hybrids within the Arabidopsis genus eukaryote taxa is that there is no obvious ortholog involves differential DNA methylation reinforced or even functional analog of Tip5 in Arabidopsis, by remodelling of the rRNA gene promoter by a suggesting that there is no direct equivalent of complex involving the histone deacetylase HDA6, a NoRC in plants. Physical association with the histone deacetylase-like HDT protein, and an siRNA/epigenetic machinery might be possible H3/H4 dimer (Lawrence et al., 2004; Earley et al., however - supported by colocalisation within Cajal 2006). bodies which may lie within the nucleolus (Pontes The same loop may also control differences in et al., 2006) and could also therefore allow physical expression between different rRNA genes within association with rDNA. Curiously, antisense the same NOR. hda6 mutants show aberrant transcription of human rDNA can also occur, this accumulation of rDNA-encoded small RNAs, time acting to promote H4K20me3, a repressive leading to the suggestion that siRNA-triggered chromatin mark (Bierhoff et al., 2011). It can be pathways might also be involved in this chromatin concluded that effects of non-coding RNA (whether remodelling loop as in animals. Furthermore, two siRNAs or lncRNAs) on RNA Pol I transcription mutants defective in siRNA biogenesis ( dcl3, rdr2 ) are likely to be widespread, although the details of disrupt the normal patterns of nucleolar dominance how they act are likely to vary between species, and when crossed in an inter-specific manner (Preuss et interact with other regulators in complex ways. al., 2008). The promoters and intergenic spacers of Nucleolar dominance also depends on an the silenced rRNA genes derived from A. thaliana Arabidopsis methylcytosine binding domain were associated with the production of 24nt- protein, MBD6, being localised to silenced rRNA siRNAs from both DNA strands, which were lost if by the de novo DNA methyltransferase DRM2 DCL3 activity was ablated. In agreement with this, (Preuss et al., 2008). This pathway also includes nucleolar dominance in Arabidopsis requires Pol IV other effectors of RNAi (DCL3, RDR2) and leads and Pol V (Pontes 2006); exactly how these siRNA to methylation of the sequence, and subsequent direct DRM2-mediated methylation, or even if they binding of MBD6 (Figure 4). This change is are causative for silencing at all, remains unclear. coincident with association with heterochromatic The model proposed by Preuss et al., 2008 was that histone marks and DNA condensation, which are transcription (possibly from promoter-like presumed to ensure that silencing spreads across the sequences in the intergenic spacers) directs 24-nt entire NOR and is maintained in a robust manner. siRNA production from one of the rRNA alleles This study also demonstrated that mutants and/or (Figure 4). RNAi knock-downs of genes encoding many other The demonstration that noncoding RNA (ncRNA) DNA methyltransferases, RDR proteins and DCL is involved in rDNA silencing in Arabidopsis marks proteins did not affect nucleolar dominance (Preuss

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 772 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

et al., 2008). Therefore, epigenetic regulation of Silencing of aberrant RNA Pol II rDNA activity is under the control of a particular subset of siRNA and chromatin-modifying transcription in nucleoli pathways, at least in the A. thaliana X A. arenosa A further role for the rDNA silencing pathways system being studied. discussed above came from Saccharomyces The precise role of MBD6 was not clear at this time cerevisiae and concerned the mechanisms which - when knocked down, it caused siRNA levels to ensure that sequences at the rDNA locus are not increase slightly, suggesting that it might be promiscuously transcribed by RNA Pol II. RNA Pol responsible for negative feedback within this loop I is the most specific of the RNA polymerases of the system. found in eukaryotes, being solely responsible for Presumably, the complex pathways which control transcription of rDNA. rDNA transcription is in rDNA silencing in Arabidopsis are necessary to turn specific for RNA Pol I, and is not transcribed ensure that its chromatin state - and hence the by RNA Pol II machinery (Grummt, 2003). It has epigenetic regulation of rRNA transcription - is been known for some years that this is because of stable both temporally and spatially. Its self- chromatin-related pathways which act to prevent reinforcing nature means that it can act across very Pol II transcription from occurring and hence large genomic regions (many megabases in length), ensure polymerase fidelity. Accordingly, if an and be transmitted with fidelity through nuclear rRNA gene is cloned into a different genomic divisions, regardless of cell differentiation. It location, then transcription by Pol II can instead should however be added that the actual purpose of occur. nucleolar dominance remains unclear, although a In S. cerevisiae, repression of RNA Pol II likely hypothesis is that it prevents the production transcription within the rDNA repeats requires the of hybrid ribosomes which might function with HDAC Sir2p (Smith and Boeke, 1997; Smith et al., reduced efficiency. This leads to the important 1998). The repressive activity of Sir2p requires the conclusion that nucleolar dominance represents a structural chromatin protein, condensin which modification of endogenous rRNA control, albeit in causes rDNA to adopt the correct chromatin a hybrid background, with many regulatory features organisation and is essential for ensuring that preserved. However, nucleolar dominance does sufficient Sir2p levels is retained at the rDNA locus differ in other ways (e.g. the differing requirements (Smith et al., 1998; Machín et al., 2004). ScSir2 is a for de novo DNA methylation (Preuss et al., 2008; component of another rDNA-silencing complex Earley et al., 2010)), perhaps because it has evolved which has been termed RENT ( re gulator of to effect a stable silencing effect, rather than nucleolar silencing and telophase exit (Straight et allowing environmental response. al., 1999)) which is anchored to rDNA by the An interesting recent report identified that the component protein Net1 (the name derives from the rRNA genes of Arabidopsis thaliana are not as essential role of RENT in coordinating mitotic exit uniform as previously thought. and the resumption of rRNA transcription (Cockell Rather, they include at least four variants forms, and Gasser, 1999)). Yeast mutant screens have which show distinct features in their regulation suggested that Set1p is also essential for blocking (Pontvianne et al., 2010). RNA Pol II transcription in the rDNA locus, this The possibility of rRNA gene variants being time acting via deposition of H3K4me3 which in functionally distinct (either under wild-type this instance is associated with transcriptional conditions, or following tumourigenesis) would be silencing (Briggs et al., 2001). This activity is an interesting question to address. In Arabidopsis, it independent of Sir2, and hence of the RENT has been shown that different H3K9 and K27 complex (Bryk et al., 2002), and presumably acts to histone methyltransferases are responsible for reinforce the repression of RNA Pol II activity. The control of expression of these rRNA gene variants role of histone modifications in preventing RNA in A. thaliana and in nucleolar dominance between Pol II transcription at rDNA in mammals is not different rDNA from different parents in A. clear, although there is evidence that rDNA thaliana X A. arenosa hybrids (Pontvianne et al., methylation is required (Gagnon-Kugler et al., 2012). 2009) which indicates that correct chromatin This again suggests that silencing of rDNA during organisation is again essential. nucleolar dominance is in some respects a guide to The repression of Pol II-mediated transcription rDNA control in non-hybrid organisms, and in from the intergenic spacers of rDNA is another other respects is different. Curiously, mutation of important function of HDA6 in Arabidopsis certain histone methyltransferases also leads to thaliana , and an hda6 allele was found to produce preferential replication of certainly variants Pol II-transcribed RNA from cryptic promoters (Pontvianne et al., 2012), implicating the covalent throughout the rDNA. This in turn leads to siRNA modification of histones in preventing replication production, which normally causes induction of slippage as well . heterochromatin but does not appear to do so in this

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 773 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

case (Earley et al., 2010). Instead, the rDNA in stability throughout eukaryotic nuclei. Its ability to question was found to be associated with histone bind and stabilise heterochromatin repeats is for modifications permissive for transcription such as example essential for genomic integrity at H3K9ac, H3K14ac, H4K16ac. This indicates that centromeric repeats (Guetg et al., 2010) and siRNA production does not necessarily lead to the suggests that its role at rDNA has evolved to induction of repressive, heterochromatin-forming exploit its chromatin remodelling capabilities. loops (Earley et al., 2010). This lead to the authors Disruption of rDNA silencing and proposing a model in which HDA6 directly regulates Pol I and Pol II transcription, completely cancer prognosis blocking the latter within the rDNA. In the most Nucleoli have long been observed to exhibit altered simple scenario, it could achieve this via morphologies in different classes of cancer cell deacetylation of histones. In this model, DNA (Derenzini et al., 2000; Boisvert et al., 2007; methylation acts in a reinforcing role, perhaps by Montanaro et al., 2008). In fact, such changes have ensuring that the HDA6 protein remains been used as diagnostic and prognostic indicators concentrated at rDNA. since the early twentieth century (Shiue et al., Before concluding this section, it is interesting to 2010). The first report of such a link appears to note that correct chromatin organisation of the have been by Pianese in 1896 (recorded in Donati et rDNA repeats may be required not only for al., 2012) and was well-established by the later part regulating their transcriptional activity, but also for of the twentieth century (Gani, 1976). This led to their stability (Peng and Karpen, 2006). This report the hypothesis that there might be a correlation demonstrated that, in Drosophila melanogaster, between tumourigenesis and the levels of chromatin-regulation pathways (including an RNAi rRNA/ribosome synthesis within the cell. At the pathway involving Dicer-2 and Su(var)3-9, and molecular level, it has been noted that at least seven those responsible for dimethylation of H3K9) are proto-oncogenes and/or tumour suppressors can necessary to prevent the occurrence of inter-repeat alter overall levels of translation (Ruggero and recombination. This ligase-mediated Pandolfi, 2003). Furthermore, multiple ribosomal recombination, to which tandemly repeated DNA proteins are also found to be over-expressed in sequences are always prone, has the potential to many different tumour types. Correlations between liberate genotoxic circular DNA molecules, which elevated rRNA levels and malignant transformation were termed extrachromosomal circular repeat have also been observed (Ruggero and Pandolfi, DNA (eccDNA). This may explain why so many 2003; White, 2008). This correlation has been pathways have evolved to prevent unregulated Pol shown to be consistent in a study of six different II to occur at rDNA repeats. How chromatin tumour types, and intriguingly tends to become actually prevents inter-repeat recombination stronger with advancing cancer stage (Williamson between repeated DNA sequences is not clear, et al., 2006). rRNA has also been found to be over- although in human cells an analogous process is expressed in many prostate cancer cell lines known to involve the TTF-I complex (Guetg et al., (Uemura et al., 2012). 2010). Increased copy-number of certain rRNA Such studies provide convincing evidence that the gene variants is observed in histone changes to nucleolar morphology observed in many methyltransferase mutants in Arabidopsis, which cancers are likely to be due to increased rRNA may suggest that correct histone modification also synthesis within these cells. This also seems to be contributes to rDNA stability in plants (Pontvianne correlated with enhanced translational capacity at et al., 2012). In mammals, too, recent work has the ribosome. However, most commentators suggested that NoRC, or at least one of its traditionally considered this to be a simple component proteins, is important for the overall consequence of the altered metabolic state of chromatin organisation of the rDNA repeats. The tumour cells following the resumption of authors indicate that over-expression of Tip5 causes proliferative growth (Donati et al., 2012). In other general changes to DNaseI accessibility (Zillner et words, the activation level of the rDNA and al., 2013), a standard measure of chromatin associated nucleolar changes are analogous to the compaction. This need not, however, be a direct effects observed in non-cancerous cells when they effect. Given that a similar effect is mimicked by are actively growing (e.g. in S-phase of the cell serum starvation, it is possible that there the eNoSC cycle). As cancer cells typically display elevated complex may also influence this process, although metabolic rates and hence have greater translational the direct physical association of Tip5 with the requirements compared with non-cancer cells, this nuclear matrix reported here (Zillner et al., 2013) could potentially explain the correlation between could be an additional way of amplifying local altered nucleolar morphology/rDNA transcription chromatin remodelling into an rDNA-wide effect. levels in cancer. Altered nucleolar organisation and As an interesting aside, TTF-I may also have more levels of ribosome components have therefore been general functions in maintaining heterochromatin regarded as useful prognostic markers, but have not

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 774 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

been considered from the perspective of cancer possibly by preventing SL-1 binding (Hannan et al., causation. 2000). Studies such as these indicate that rDNA misregulation during tumourigenesis, either by Cancer causation and RNA Pol I increased transcription by RNA Pol I at active misregulation rRNA genes, re-activation of previously silenced As described above, RNA Pol I activity is rRNA genes, or both. associated with rapid cell growth and division The human TF complex, c-Myc, is of particular during cancer, leading to changes to nucleolar interest in the study of eukaryote transcription as it morphology of potential prognostic use. However, is able to regulate RNA Pol I, II and III (Gomez- some researchers have argued that there may also Roman et al., 2006). It has therefore been proposed be a causal relationship between misregulation of to coordinate rDNA transcription with the rDNA and the occurrence of cancer (Ruggero and biosynthesis of other ribosome components Pandolfi, 2003; White, 2008; Montanaro et al., (reviewed (Lempiäinen and Shore, 2009)) i.e. the 2012). In support of this, a recent study by Bywater ribosomal proteins (translated from mRNA et al. has demonstrated that aberrant hyperactivation transcribed by RNA Pol II) and the 5S rRNA of Pol I is causally required for malignancy in (transcribed by RNA Pol III). The gene encoding c- several tumours (see Bywater et al., 2012; Myc is considered a proto-oncogene, which may be associated commentary (Hannan et al., 2012)) and due to far-reaching effects of c-Myc on many oncogenic and tumour-prevention pathways transcription. In principle, c-Myc could be able to upregulate RNA Pol I transcription at rDNA. One single-handedly increase the concentration of immediate consequent of this is that RNA Pol I has ribosomes within a cell and so drive growth and emerged as a potential chemotherapy target. One tumourigenesis (Arabi et al., 2005; Grandori et al., drug which may have important therapeutic 2005; van Riggelen et al., 2010). For example, potential in this regard is quarfloxin, a specific rRNA upregulation in prostate cancer lines closely RNA Pol I-inhibitor which has been investigated correlates with levels c-Myc levels. c-Myc may be for use in the treatment of neuroendocrine particularly important for aberrant activity of the carcinoma (Drygin et al., 2009). Quarfloxin appears Pol I complex during tumourigenesis (Uemura et to confirm the relationship between altered rRNA al., 2012) although it should be noted that probably transcription and prognosis of certain cancer types induces many pleiotropic effects on other cellular and has also been proposed for use in clinical trials processes as well. This may make it difficult to for treatment of lymphoma and leukemia. describe the precise nature of the link and is one If RNA Pol I can be causative for cancer reason why c-Myc has not been successfully progression, this also suggests that there should targeted by chemotherapy. Identification of some of exist cellular mechanisms which regulate rRNA its functional partners may help to resolve these transcriptionas a means of tumour prevention. complications (Chan et al., 2011). One possible part rRNA synthesis is generally limited by tumour of this network is the kinase ERK, which is able to supressors such as p53, ARF, pRB and PTEN via a stabilise c-Myc by phosphorylation and can also combination of direct and indirect mechanisms activate both UBF and RRN3 in the same way, (Budde and Grummt, 1999; Zhai and Comai, 2000; providing simultaneous routes to rDNA activation White, 2008; Wang et al., 2013). For example, in (Stefanovsky et al., 2001). As a final point, it has cell lines derived from gastric cancers which had been reported SIRT7, a potential rRNA gene lost expression of the tumour suppressor ZNF545, regulator associated with tumour progression (see restoration of its expression suppressed cell above) may also regulate the expression of proliferation and induced apoptosis due to ribosomal proteins (Barber et al., 2012). It is inhibition of rRNA transcription. Importantly, this possible that certain other rDNA regulators, silencing was linked to restoration of the normal including sirtuins, might also have be able to alter heterochromatin marks at the promoters, including cellular translation in a concerted way reminiscent HP1 β binding and H3K4 hypomethylation (Wang of c-Myc. et al., 2013). Direct regulators of RNA Pol I Another route to aberrant rRNA transcription (this transcription activity act by various mechanisms, time independent of c-Myc and ERK) is mediated including promoter remodelling, PIC formation, by the growth factor receptor ErbB2, which acts as and elevated elongation rates. Such regulators a TF for RNA Pol I. ErbB2 is upregulated in many include known oncogenes such as AML1-ETO and cancers and is associated with increased metastasis the tumor suppressors p53, pRb, and p14ARF and other aggressive traits. It appears to act by (Hannan et al., 2012). Various lines of evidence increasing the binding affinity of the polymerase to indicate that these pathways often target RNA Pol I rDNA at transcription sites within the nucleolus, regulators/TFs such as UBF or RRN3. For example, identified by visualisation of BrUTP incorporation the Retinoblastoma protein is required for sites (Li et al., 2011). Co-immunoprecipitation suppression of UBF (Cavanaugh et al., 1995), experiments indicated that ErbB2 binds to RNA Pol

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 775 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

I as part of a complex with β-actin, and this binding This would indicate that hypoxia can directly leads to increased transcription levels in vivo (Li et reduce ribosome production via pH-sensitive al., 2011). Over-expression of ErbB2 lead to protein-protein interactions as well as via adverse increased protein synthesis, indicating that RNA affects on cellular energy status and is an additional Pol I up-regulation can indeed remove the limiting pathway of relevance for disrupted response of the factors on total cellular translation. rRNA gene RNA Pol I machinery during tumourigenesis. silencing can also act to limit tumourigenesis via The sirtuin HDACs have also been proposed to play the tumour suppressor ARF, which triggers TTF-I roles in cancer. HsSIRT1, for example, has been nucleolar exit and thus reduced rRNA transcription. implicated in different forms of human cancer ARF and one of its target proteins, MDM2 (which although determining precisely what role it is has E3 ubiquitin ligase activity) compete for playing is not always clear (Deng, 2009). It has the binding to TTF-I at overlapping sites. When levels potential to play a key part in cancer progression of ARF are artificially ablated, MDM2 due to its interactions with p53 and other tumour accumulates, binds to TTF-I at increased levels and supressors. The regulation of SIRT1 is catalyzes its ubiquitinylation. This reduces the correspondingly complex, as reviewed elsewhere concentration of TTF-I in the cell via by targeting it (Liu et al., 2009), so its activities - and their for proteosomic degradation (Lessard et al., 2012). significance to rDNA silencing - will only be To understand the cellular networks that are briefly summarised here. SIRT1 is able to proposed to link RNA Pol I regulation to cancer, it deacetylate p53 and physically interacts in vivo with is also necessary to consider in more detail why several other proteins which regulate this misregulation might be associated with tumour deacetylation ability. Its expression is in turn progression, beyond the observation that cancer controlled by p53 via two binding sites in its cells have high metabolic requirements. One fact promoter, which repress its expression; SIRT1 can which may be critical is the discovery that the key also repress its own expression via an oncogene p53, which as noted above may regulate autoregulatory loop as part of a complex with HIC1 RNA Pol I activity, might also be partially (Chen et al., 2005). A particularly intriguing controlled by it. It has been reported that the possibility is that SIRT1 might contribute to cancer relative levels of ribosomal RNA (transcribed by development through a positive feedback loop on c- RNA Pol I) and the rate of ribosomal protein MYC expression. It has been proposed that this synthesis can lead to changes in p53 levels in could perpetuate aberrant upregulation of c-MYC mammalian cells (Donati et al., 2011a). The likely and suppression of apoptosis during colorectal complexity of any such interactions is demonstrated cancer, for example (Menssen et al., 2012). Given by research from the same group suggesting that its many interactions, and the fact that SIRT1 is Pol I can also control cellular proliferation via a present in in different domains of the nucleus, the p53-independent pathway. This pathway may issue of how these different roles are integrated instead involve E2F-1 (Donati et al., 2011b). remains an open question. Nor is it clear what role Sensing of reduced cellular energy status in the its control of rRNA transcription might play in its nucleolus by eNoSC has been proposed to play a other cellular activities. For a discussion of sirtuin key role in p53 accumulation, eventually leading to inhibitors as candidates for use in chemotherapy see apoptosis or cell cycle arrest (Kumazawa et al., (Liu et al., 2009). 2011). This is argued to occur via reduced rRNA rDNA silencing and further links synthesis which leads to release of Myb-binding protein 1a (MYBBP1A) from the nucleolus. This to disease protein catalyzes acetylation of p53, which is a key A degree of care is needed as even when genes or element in causing it to accumulate and function pathways have been implicated in misregulating (Kumazawa et al., 2011). Conversely, failure to RNA Pol I, it is not necessarily the case that this is down-regulate RNA Pol I could therefore block p53 related to their oncogenic potential. It is likely that hypomethylation as MYBBP1A would remain the significance of altered rDNA silencing may associated with the nucleolus even under pro- vary between cancer types and stages, and may be apoptopic conditions. This mechanism provides an causative in some instances but a downstream attractive explanation of how p53-mediated cell consequence of malignant transformation in others. cycle arrest could rely upon correct transcription of Such considerations should be borne in mind when rRNA genes, and a route towards therapeutic evaluating the therapeutic potential of altering intervention (Donati et al., 2012). It has previously rRNA gene expression in any given case. Many been argued that hypoxia-induced acidification of chemotherapy agents affect RNA Pol I human culture cells can promote the binding of transcription, although of their nature most of these rDNA to von Hippel-Lindau tumor suppressor affect many other cellular processes as well so how protein (VHL) which in turn reduces the RNA Pol critical their effects on the rDNA are remains I-activating capacity of UBF (Mekhail et al., 2006). unclear (Drygin et al., 2010).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 776 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Given what has been said previously concerning the Elucidation of how misregulation of rDNA potential genotoxic nature of recombination at transcription of this kind contributes to the repeated DNA, it is finally possible that mediators initiation and maintenance of cancer cell growth of rDNA silencing - such as those which control its will be the focus of future research initiatives. organisation at the chromatin level - may also act as Within this area, a particular question that will need oncogenes under some circumstances. For example, to be addressed is the extent to which normalizing the risk of rDNA which has deviated from their rRNA gene expression is able to restrict the growth chromatin organisation producing DNA minicircles of human cell lines and, if so, the nature of the by inter-repeat recombination has been argued to molecular mechanisms which regulate this. have potentially carcinogenic effects (Peng and Karpen, 2007). References The NML-interacting protein NMNAT1 may also Navashin M.. Chromosome alterations caused by have roles in preventing DNA breakage, and is hybridization and their bearing upon certain general correlated with increased DNA damage in lung genetic problems. Cytologia. 1934; 5: 169-203. cancer (Song et al., 2013), although whether this is Gani R.. The nucleoli of cultured human lymphocytes. I. linked to its role in down-regulating rRNA Nucleolar morphology in relation to transformation and the transcription is uncertain. NoRC also plays a role in DNA cycle. Exp Cell Res. 1976 Feb;97(2):249-58. preventing potentially carcinogenic chromosome- Ballal NR, Choi YC, Mouche R, Busche H.. Fidelity of breakage events during nuclear division by synthesis of preribosomal RNA in isolated nucleoli and maintaining cellular heterochromatin (Postepska- nucleolar chromatin. Proc Natl Acad Sci U S A. 1977 Igielska et al., 2013). However, this has been Jun;74(6):2446-50. argued to be principally due to its roles in Prior CP, Cantor CR, Johnson EM, Littau VC, Allfrey VG.. stabilising heterochromatin at the centromeres, Reversible changes in nucleosome structure and histone telomeres and associated chromosomal regions, H3 accessibility in transcriptionally active and inactive states of rDNA chromatin. Cell. 1983 Oct;34(3):1033-42. rather than at the rDNA locus (Postepska-Igielska et al., 2013). On the other hand, general effects on Reeder RH.. Mechanisms of nucleolar dominance in animals and plants. J Cell Biol. 1985 Nov;101(5 Pt genome stability may involve its association with 1):2013-6. (REVIEW) rDNA as well as other tandemly repeated regions. Although they will not be considered in detail here, Sollner-Webb B, Tower J.. Transcription of cloned eukaryotic ribosomal RNA genes. Annu Rev Biochem. it should be noted that misregulation of rDNA 1986;55:801-30. (REVIEW) transcription has also been observed various other human pathologies, and may be causal in at least Erard MS, Belenguer P, Caizergues-Ferrer M, Pantaloni A, Amalric F.. A major nucleolar protein, nucleolin, induces some cases. These disorders often occur due to chromatin decondensation by binding to histone H1. Eur J disruption of the epigenetic pathways which Biochem. 1988 Aug 15;175(3):525-30. regulate RNA Pol I activity and include various Thompson WF, Flavell RB.. DNase I sensitivity of hypertrophies and atrophies (Hannan et al., 2012). ribosomal RNA genes in chromatin and nucleolar Such diseases may share common pathways with dominance in wheat. J Mol Biol. 1988 Dec 5;204(3):535- cancer in that they are typically associated with 48. altered cellular growth rates. Defects in components Conconi A, Widmer RM, Koller T, Sogo JM.. Two different of the RNA Pol I machinery itself are also causative chromatin structures coexist in ribosomal RNA genes for a range of rare congenital pathologies throughout the cell cycle. Cell. 1989 Jun 2;57(5):753-61. collectively termed ribosomopathies (Narla and O'Mahony DJ, Rothblum LI.. Identification of two forms of Ebert, 2010). the RNA polymerase I transcription factor UBF. Proc Natl Acad Sci U S A. 1991 Apr 15;88(8):3180-4. Summary and conclusion Comai L, Tanese N, Tjian R.. The TATA-binding protein

and associated factors are integral components of the the exact level of transcription depends upon RNA polymerase I transcription factor, SL1. Cell. 1992 Mar complexes with TF-activity, and especially UBF. 6;68(5):965-76. The interactions between the various complexes Dammann R, Lucchini R, Koller T, Sogo JM.. Chromatin which can activate or silence rRNA gene structures and transcription of rDNA in yeast transcription are still only poorly understood, but it Saccharomyces cerevisiae. Nucleic Acids Res. 1993 May is clear that they represent the components of a 25;21(10):2331-8. sophisticated regulatory network. Roussel P, Andre C, Masson C, Geraud G, Hernandez- One key function is to link rRNA production to a Verdun D.. Localization of the RNA polymerase I cell's metabolic requirements and to the its energy transcription factor hUBF during the cell cycle. J Cell Sci. 1993 Feb;104 ( Pt 2):327-37. reserves. Perturbation of these regulatory networks is Zatsepina OV, Voit R, Grummt I, Spring H, Semenov MV, Trendelenburg MF.. The RNA polymerase I-specific therefore detrimental for the cell's function and has transcription initiation factor UBF is associated with been linked to various pathologies.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 777 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

transcriptionally active and inactive ribosomal genes. Hannan KM, Hannan RD, Smith SD, Jefferson LS, Lun M, Chromosoma. 1993 Nov;102(9):599-611. Rothblum LI.. Rb and p130 regulate RNA polymerase I transcription: Rb disrupts the interaction between UBF and Cavanaugh AH, Hempel WM, Taylor LJ, Rogalsky V, SL-1. Oncogene. 2000 Oct 12;19(43):4988-99. Todorov G, Rothblum LI.. Activity of RNA polymerase I transcription factor UBF blocked by Rb gene product. Lin SJ, Defossez PA, Guarente L.. Requirement of NAD Nature. 1995 Mar 9;374(6518):177-80. and SIR2 for life-span extension by calorie restriction in Saccharomyces cerevisiae. Science. 2000 Sep Melese T, Xue Z.. The nucleolus: an organelle formed by 22;289(5487):2126-8. the act of building a ribosome. Curr Opin Cell Biol. 1995 Jun;7(3):319-24. (REVIEW) Pikaard CS.. The epigenetics of nucleolar dominance. Trends Genet. 2000 Nov;16(11):495-500. (REVIEW) Shaw PJ, Jordan EG.. The nucleolus. Annu Rev Cell Dev Biol. 1995;11:93-121. (REVIEW) Schmelzle T, Hall MN.. TOR, a central controller of cell growth. Cell. 2000 Oct 13;103(2):253-62. (REVIEW) Chen ZJ, Pikaard CS.. Epigenetic silencing of RNA polymerase I transcription: a role for DNA methylation and Zhai W, Comai L.. Repression of RNA polymerase I histone modification in nucleolar dominance. Genes Dev. transcription by the tumor suppressor p53. Mol Cell Biol. 1997 Aug 15;11(16):2124-36. 2000 Aug;20(16):5930-8. Fritze CE, Verschueren K, Strich R, Easton Esposito R.. Briggs SD, Bryk M, Strahl BD, Cheung WL, Davie JK, Dent Direct evidence for SIR2 modulation of chromatin structure SY, Winston F, Allis CD.. Histone H3 lysine 4 methylation in yeast rDNA. EMBO J. 1997 Nov 3;16(21):6495-509. is mediated by Set1 and required for cell growth and rDNA silencing in Saccharomyces cerevisiae. Genes Dev. 2001 Keener J, Dodd JA, Lalo D, Nomura M.. Histones H3 and Dec 15;15(24):3286-95. H4 are components of upstream activation factor required for the high-level transcription of yeast rDNA by RNA Stefanovsky VY, Pelletier G, Hannan R, Gagnon-Kugler T, polymerase I. Proc Natl Acad Sci U S A. 1997 Dec Rothblum LI, Moss T.. An immediate response of 9;94(25):13458-62. ribosomal transcription to growth factor stimulation in mammals is mediated by ERK phosphorylation of UBF. Langst G, Blank TA, Becker PB, Grummt I.. RNA Mol Cell. 2001 Nov;8(5):1063-73. polymerase I transcription on nucleosomal templates: the transcription termination factor TTF-I induces chromatin Strohner R, Nemeth A, Jansa P, Hofmann-Rohrer U, remodeling and relieves transcriptional repression. EMBO Santoro R, Langst G, Grummt I.. NoRC--a novel member J. 1997 Feb 17;16(4):760-8. of mammalian ISWI-containing chromatin remodeling machines. EMBO J. 2001 Sep 3;20(17):4892-900. Nierras CR, Liebman SW, Warner JR.. Does Saccharomyces need an organized nucleolus? Andersen JS, Lyon CE, Fox AH, Leung AK, Lam YW, Chromosoma. 1997 Jun;105(7-8):444-51. Steen H, Mann M, Lamond AI.. Directed proteomic analysis of the human nucleolus. Curr Biol. 2002 Jan Smith JS, Boeke JD.. An unusual form of transcriptional 8;12(1):1-11. silencing in yeast ribosomal DNA. Genes Dev. 1997 Jan 15;11(2):241-54. Bradsher J, Auriol J, Proietti de Santis L, Iben S, Vonesch JL, Grummt I, Egly JM.. CSB is a component of RNA pol I Langst G, Becker PB, Grummt I.. TTF-I determines the transcription. Mol Cell. 2002 Oct;10(4):819-29. chromatin architecture of the active rDNA promoter. EMBO J. 1998 Jun 1;17(11):3135-45. Bryk M, Briggs SD, Strahl BD, Curcio MJ, Allis CD, Winston F.. Evidence that Set1, a factor required for Smith JS, Brachmann CB, Pillus L, Boeke JD.. Distribution methylation of histone H3, regulates rDNA silencing in S. of a limited Sir2 protein pool regulates the strength of yeast cerevisiae by a Sir2-independent mechanism. Curr Biol. rDNA silencing and is modulated by Sir4p. Genetics. 1998 2002 Jan 22;12(2):165-70. Jul;149(3):1205-19. Iben S, Tschochner H, Bier M, Hoogstraten D, Hozak P, Budde A, Grummt I.. p53 represses ribosomal gene Egly JM, Grummt I.. TFIIH plays an essential role in RNA transcription. Oncogene. 1999 Jan 28;18(4):1119-24. polymerase I transcription. Cell. 2002 May 3;109(3):297- Cockell MM, Gasser SM.. The nucleolus: nucleolar space 306. for RENT. Curr Biol. 1999 Jul 29-Aug 12;9(15):R575-6. Kim DH, Sarbassov DD, Ali SM, King JE, Latek RR, (REVIEW) Erdjument-Bromage H, Tempst P, Sabatini DM.. mTOR Pikaard CS.. Nucleolar dominance and silencing of interacts with raptor to form a nutrient-sensitive complex that signals to the cell growth machinery. Cell. 2002 Jul 26;110(2):163-75. transcription. Trends Plant Sci. 1999 Dec;4(12):478-483. O'Sullivan AC, Sullivan GJ, McStay B.. UBF binding in vivo is not restricted to regulatory sequences within the Straight AF, Shou W, Dowd GJ, Turck CW, Deshaies RJ, vertebrate ribosomal DNA repeat. Mol Cell Biol. 2002 Johnson AD, Moazed D.. Net1, a Sir2-associated nucleolar protein required for rDNA silencing and nucleolar integrity. Jan;22(2):657-68. Cell. 1999 Apr 16;97(2):245-56. Santoro R, Li J, Grummt I.. The nucleolar remodeling Voit R, Hoffmann M, Grummt I.. Phosphorylation by G1- complex NoRC mediates heterochromatin formation and specific cdk-cyclin complexes activates the nucleolar silencing of ribosomal gene transcription. Nat Genet. 2002 transcription factor UBF. EMBO J. 1999 Apr 1;18(7):1891- Nov;32(3):393-6. Epub 2002 Oct 7. 9. French SL, Osheim YN, Cioci F, Nomura M, Beyer AL.. In Derenzini M, Trere D, Pession A, Govoni M, Sirri V, Chieco exponentially growing Saccharomyces cerevisiae cells, P.. Nucleolar size indicates the rapidity of cell proliferation rRNA synthesis is determined by the summed RNA in cancer tissues. J Pathol. 2000 Jun;191(2):181-6. polymerase I loading rate rather than by the number of active genes. Mol Cell Biol. 2003 Mar;23(5):1558-68.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 778 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Gerbi SA, Borovjagin AV, Lange TS.. The nucleolus: a site Grandori C, Gomez-Roman N, Felton-Edkins ZA, of ribonucleoprotein maturation. Curr Opin Cell Biol. 2003 Ngouenet C, Galloway DA, Eisenman RN, White RJ.. c- Jun;15(3):318-25. (REVIEW) Myc binds to human ribosomal DNA and stimulates transcription of rRNA genes by RNA polymerase I. Nat Cell Grummt I.. Life on a planet of its own: regulation of RNA Biol. 2005 Mar;7(3):311-8. polymerase I transcription in the nucleolus. Genes Dev. 2003 Jul 15;17(14):1691-702. (REVIEW) Mais C, Wright JE, Prieto JL, Raggett SL, McStay B.. UBF- binding site arrays form pseudo-NORs and sequester the Iizuka M, Smith MM.. Functional consequences of histone RNA polymerase I transcription machinery. Genes Dev. modifications. Curr Opin Genet Dev. 2003 Apr;13(2):154- 2005 Jan 1;19(1):50-64. Epub 2004 Dec 14. 60. (REVIEW) Michishita E, Park JY, Burneskis JM, Barrett JC, Horikawa Kim DH, Sarbassov DD, Ali SM, Latek RR, Guntur KV, I.. Evolutionarily conserved and nonconserved cellular Erdjument-Bromage H, Tempst P, Sabatini DM.. GbetaL, a localizations and functions of human SIRT proteins. Mol positive regulator of the rapamycin-sensitive pathway Biol Cell. 2005 Oct;16(10):4623-35. Epub 2005 Aug 3. required for the nutrient-sensitive interaction between raptor and mTOR. Mol Cell. 2003 Apr;11(4):895-904. Pendle AF, Clark GP, Boon R, Lewandowska D, Lam YW, Andersen J, Mann M, Lamond AI, Brown JW, Shaw PJ.. Ruggero D, Pandolfi PP.. Does the ribosome translate Proteomic analysis of the Arabidopsis nucleolus suggests cancer? Nat Rev Cancer. 2003 Mar;3(3):179-92. novel nucleolar functions. Mol Biol Cell. 2005 (REVIEW) Jan;16(1):260-9. Epub 2004 Oct 20. Tsang CK, Bertram PG, Ai W, Drenan R, Zheng XF.. Russell J, Zomerdijk JC.. RNA-polymerase-I-directed Chromatin-mediated regulation of nucleolar structure and rDNA transcription, life and works. Trends Biochem Sci. RNA Pol I localization by TOR. EMBO J. 2003 Nov 2005 Feb;30(2):87-96. (REVIEW) 17;22(22):6045-56. Tongaonkar P, French SL, Oakes ML, Vu L, Schneider Blander G, Guarente L.. The Sir2 family of protein DA, Beyer AL, Nomura M.. Histones are required for deacetylases. Annu Rev Biochem. 2004;73:417-35. transcription of yeast rRNA genes by RNA polymerase I. (REVIEW) Proc Natl Acad Sci U S A. 2005 Jul 19;102(29):10129-34. Chen D, Belmont AS, Huang S.. Upstream binding factor Epub 2005 Jul 7. association induces large-scale chromatin Zhou Y, Grummt I.. The PHD finger/bromodomain of decondensation. Proc Natl Acad Sci U S A. 2004 Oct NoRC interacts with acetylated histone H4K16 and is 19;101(42):15106-11. Epub 2004 Oct 11. sufficient for rDNA silencing. Curr Biol. 2005 Aug Kuzuhara T, Horikoshi M.. A nuclear FK506-binding 9;15(15):1434-8. protein is a histone chaperone regulating rDNA silencing. Angelov D, Bondarenko VA, Almagro S, Menoni H, Nat Struct Mol Biol. 2004 Mar;11(3):275-83. Epub 2004 Mongelard F, Hans F, Mietton F, Studitsky VM, Hamiche Feb 8. A, Dimitrov S, Bouvet P.. Nucleolin is a histone chaperone Lawrence RJ, Earley K, Pontes O, Silva M, Chen ZJ, with FACT-like activity and assists remodeling of Neves N, Viegas W, Pikaard CS.. A concerted DNA nucleosomes. EMBO J. 2006 Apr 19;25(8):1669-79. Epub methylation/histone methylation switch regulates rRNA 2006 Apr 6. gene dosage control and nucleolar dominance. Mol Cell. Ashraf N, Zino S, Macintyre A, Kingsmore D, Payne AP, 2004 Feb 27;13(4):599-609. George WD, Shiels PG.. Altered sirtuin expression is Machin F, Paschos K, Jarmuz A, Torres-Rosell J, Pade C, associated with node-positive breast cancer. Br J Cancer. Aragon L.. Condensin regulates rDNA silencing by 2006 Oct 23;95(8):1056-61. Epub 2006 Sep 26. modulating nucleolar Sir2p. Curr Biol. 2004 Jan Cavellan E, Asp P, Percipalle P, Farrants AK.. The WSTF- 20;14(2):125-30. SNF2h chromatin remodeling complex interacts with Moss T.. At the crossroads of growth control; making several nuclear proteins in transcription. J Biol Chem. 2006 ribosomal RNA. Curr Opin Genet Dev. 2004 Jun 16;281(24):16264-71. Epub 2006 Apr 9. Apr;14(2):210-7. (REVIEW) Earley K, Lawrence RJ, Pontes O, Reuther R, Enciso AJ, Nemeth A, Strohner R, Grummt I, Langst G.. The Silva M, Neves N, Gross M, Viegas W, Pikaard CS.. chromatin remodeling complex NoRC and TTF-I cooperate Erasure of histone acetylation by Arabidopsis HDA6 in the regulation of the mammalian rRNA genes in vivo. mediates large-scale gene silencing in nucleolar Nucleic Acids Res. 2004 Aug 3;32(14):4091-9. Print 2004. dominance. Genes Dev. 2006 May 15;20(10):1283-93. Epub 2006 Apr 28. Nomura M, Nogi Y, Oakes M.. Transcription of rDNA in the yeast Saccharomyces cerevisiae. Molecular Biology Ford E, Voit R, Liszt G, Magin C, Grummt I, Guarente L.. Intelligence Unit. 2004; The Nucleolus, 128-153. Mammalian Sir2 homolog SIRT7 is an activator of RNA polymerase I transcription. Genes Dev. 2006 May Andersen JS, Lam YW, Leung AK, Ong SE, Lyon CE, 1;20(9):1075-80. Epub 2006 Apr 17. Lamond AI, Mann M.. Nucleolar proteome dynamics. Nature. 2005 Jan 6;433(7021):77-83. Gomez-Roman N, Felton-Edkins ZA, Kenneth NS, Goodfellow SJ, Athineos D, Zhang J, Ramsbottom BA, Arabi A, Wu S, Ridderstrale K, Bierhoff H, Shiue C, Fatyol Innes F, Kantidakis T, Kerr ER, Brodie J, Grandori C, K, Fahlen S, Hydbring P, Soderberg O, Grummt I, Larsson White RJ.. Activation by c-Myc of transcription by RNA LG, Wright AP.. c-Myc associates with ribosomal DNA and polymerases I, II and III. Biochem Soc Symp. activates RNA polymerase I transcription. Nat Cell Biol. 2006;(73):141-54. (REVIEW) 2005 Mar;7(3):303-10. Epub 2005 Feb 20. Mayer C, Schmitz KM, Li J, Grummt I, Santoro R.. Chen WY, Wang DH, Yen RC, Luo J, Gu W, Baylin SB.. Intergenic transcripts regulate the epigenetic state of rRNA Tumor suppressor HIC1 directly regulates SIRT1 to genes. Mol Cell. 2006 May 5;22(3):351-61. modulate p53-dependent DNA-damage responses. Cell. 2005 Nov 4;123(3):437-48.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 779 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

McStay B.. Nucleolar dominance: a model for rRNA gene Aug;36(Pt 4):619-24. doi: 10.1042/BST0360619. silencing. Genes Dev. 2006 May 15;20(10):1207-14. (REVIEW) (REVIEW) Lebedev A, Scharffetter-Kochanek K, Iben S.. Truncated Mekhail K, Rivero-Lopez L, Khacho M, Lee S.. Restriction Cockayne syndrome B protein represses elongation by of rRNA synthesis by VHL maintains energy equilibrium RNA polymerase I. J Mol Biol. 2008 Oct 3;382(2):266-74. under hypoxia. Cell Cycle. 2006 Oct;5(20):2401-13. Epub doi: 10.1016/j.jmb.2008.07.018. Epub 2008 Jul 16. 2006 Oct 16. Mayer C, Neubert M, Grummt I.. The structure of NoRC- Meraner J, Lechner M, Loidl A, Goralik-Schramel M, Voit associated RNA is crucial for targeting the chromatin R, Grummt I, Loidl P.. Acetylation of UBF changes during remodelling complex NoRC to the nucleolus. EMBO Rep. the cell cycle and regulates the interaction of UBF with 2008 Aug;9(8):774-80. doi: 10.1038/embor.2008.109. RNA polymerase I. Nucleic Acids Res. 2006 Mar Epub 2008 Jul 4. 31;34(6):1798-806. Print 2006. McKeown P, Pendle AF, Shaw PJ.. Preparation of Panov KI, Friedrich JK, Russell J, Zomerdijk JC.. UBF Arabidopsis nuclei and nucleoli. Methods Mol Biol. activates RNA polymerase I transcription by stimulating 2008;463:67-75. doi: 10.1007/978-1-59745-406-3_5. promoter escape. EMBO J. 2006 Jul 26;25(14):3310-22. Epub 2006 Jul 6. McStay B, Grummt I.. The epigenetics of rRNA genes: from molecular to chromosome biology. Annu Rev Cell Percipalle P, Fomproix N, Cavellan E, Voit R, Reimer G, Dev Biol. 2008;24:131-57. doi: Kruger T, Thyberg J, Scheer U, Grummt I, Farrants AK.. 10.1146/annurev.cellbio.24.110707.175259. (REVIEW) The chromatin remodelling complex WSTF-SNF2h interacts with nuclear myosin 1 and has a role in RNA Montanaro L, Trere D, Derenzini M.. Nucleolus, ribosomes, polymerase I transcription. EMBO Rep. 2006 and cancer. Am J Pathol. 2008 Aug;173(2):301-10. doi: May;7(5):525-30. Epub 2006 Mar 3. 10.2353/ajpath.2008.070752. Epub 2008 Jun 26. (REVIEW) Pontes O, Li CF, Costa Nunes P, Haag J, Ream T, Vitins A, Jacobsen SE, Pikaard CS.. The Arabidopsis chromatin- Murayama A, Ohmori K, Fujimura A, Minami H, Yasuzawa- modifying nuclear siRNA pathway involves a nucleolar Tanaka K, Kuroda T, Oie S, Daitoku H, Okuwaki M, RNA processing center. Cell. 2006 Jul 14;126(1):79-92. Nagata K, Fukamizu A, Kimura K, Shimizu T, Yanagisawa J.. Epigenetic control of rDNA loci in response to Raska I, Shaw PJ, Cmarko D.. Structure and function of intracellular energy status. Cell. 2008 May 16;133(4):627- the nucleolus in the spotlight. Curr Opin Cell Biol. 2006 39. doi: 10.1016/j.cell.2008.03.030. Jun;18(3):325-34. Epub 2006 May 9. (REVIEW) Preuss SB, Costa-Nunes P, Tucker S, Pontes O, Stefanovsky V, Moss T.. Regulation of rRNA synthesis in Lawrence RJ, Mosher R, Kasschau KD, Carrington JC, human and mouse cells is not determined by changes in Baulcombe DC, Viegas W, Pikaard CS.. Multimegabase active gene count. Cell Cycle. 2006 Apr;5(7):735-9. Epub silencing in nucleolar dominance involves siRNA-directed 2006 Apr 1. DNA methylation and specific methylcytosine-binding proteins. Mol Cell. 2008 Dec 5;32(5):673-84. doi: Williamson D, Lu YJ, Fang C, Pritchard-Jones K, Shipley 10.1016/j.molcel.2008.11.009. J.. Nascent pre-rRNA overexpression correlates with an adverse prognosis in alveolar rhabdomyosarcoma. Genes Sanij E, Poortinga G, Sharkey K, Hung S, Holloway TP, Chromosomes Cancer. 2006 Sep;45(9):839-45. Quin J, Robb E, Wong LH, Thomas WG, Stefanovsky V, Moss T, Rothblum L, Hannan KM, McArthur GA, Pearson Boisvert FM, van Koningsbruggen S, Navascues J, RB, Hannan RD.. UBF levels determine the number of Lamond AI.. The multifunctional nucleolus. Nat Rev Mol active ribosomal RNA genes in mammals. J Cell Biol. 2008 Cell Biol. 2007 Jul;8(7):574-85. (REVIEW) Dec 29;183(7):1259-74. doi: 10.1083/jcb.200805146. Epub Frescas D, Guardavaccaro D, Bassermann F, Koyama- 2008 Dec 22. Nasu R, Pagano M.. JHDM1B/FBXL10 is a nucleolar White RJ.. RNA polymerases I and III, non-coding RNAs protein that represses transcription of ribosomal RNA and cancer. Trends Genet. 2008 Dec;24(12):622-9. doi: genes. Nature. 2007 Nov 8;450(7167):309-13. 10.1016/j.tig.2008.10.003. Epub 2008 Nov 6. (REVIEW) Jones HS, Kawauchi J, Braglia P, Alen CM, Kent NA, Birch JL, Tan BC, Panov KI, Panova TB, Andersen JS, Proudfoot NJ.. RNA polymerase I in yeast transcribes Owen-Hughes TA, Russell J, Lee SC, Zomerdijk JC.. dynamic nucleosomal rDNA. Nat Struct Mol Biol. 2007 FACT facilitates chromatin transcription by RNA Feb;14(2):123-30. Epub 2007 Jan 28. polymerases I and III. EMBO J. 2009 Apr 8;28(7):854-65. Peng JC, Karpen GH.. H3K9 methylation and RNA doi: 10.1038/emboj.2009.33. Epub 2009 Feb 12. interference regulate nucleolar organization and repeated Deng CX.. SIRT1, is it a tumor promoter or tumor DNA stability. Nat Cell Biol. 2007 Jan;9(1):25-35. Epub suppressor? Int J Biol Sci. 2009;5(2):147-52. Epub 2009 2006 Dec 10. Jan 21. (REVIEW) Prieto JL, McStay B.. Recruitment of factors linking Drygin D, Siddiqui-Jain A, O'Brien S, Schwaebe M, Lin A, transcription and processing of pre-rRNA to NOR Bliesath J, Ho CB, Proffitt C, Trent K, Whitten JP, Lim JK, chromatin is UBF-dependent and occurs independent of Von Hoff D, Anderes K, Rice WG.. Anticancer activity of transcription in human cells. Genes Dev. 2007 Aug CX-3543: a direct inhibitor of rRNA biogenesis. Cancer 15;21(16):2041-54. Res. 2009 Oct 1;69(19):7653-61. doi: 10.1158/0008- Yuan X, Feng W, Imhof A, Grummt I, Zhou Y.. Activation of 5472.CAN-09-1304. Epub 2009 Sep 8. RNA polymerase I transcription by cockayne syndrome Finkel T, Deng CX, Mostoslavsky R.. Recent progress in group B protein and histone methyltransferase G9a. Mol the biology and physiology of sirtuins. Nature. 2009 Jul Cell. 2007 Aug 17;27(4):585-95. 30;460(7255):587-91. doi: 10.1038/nature08197. Birch JL, Zomerdijk JC.. Structure and function of (REVIEW) ribosomal RNA gene chromatin. Biochem Soc Trans. 2008

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 780 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Gagnon-Kugler T, Langlois F, Stefanovsky V, Lessard F, Imai S, Guarente L.. Ten years of NAD-dependent SIR2 Moss T.. Loss of human ribosomal gene CpG methylation family deacetylases: implications for metabolic diseases. enhances cryptic RNA polymerase II transcription and Trends Pharmacol Sci. 2010 May;31(5):212-20. doi: disrupts ribosomal RNA processing. Mol Cell. 2009 Aug 10.1016/j.tips.2010.02.003. Epub 2010 Mar 11. (REVIEW) 28;35(4):414-25. doi: 10.1016/j.molcel.2009.07.008. Li H, Luan S.. AtFKBP53 is a histone chaperone required Grob A, Roussel P, Wright JE, McStay B, Hernandez- for repression of ribosomal RNA gene expression in Verdun D, Sirri V.. Involvement of SIRT7 in resumption of Arabidopsis. Cell Res. 2010 Mar;20(3):357-66. doi: rDNA transcription at the exit from mitosis. J Cell Sci. 2009 10.1038/cr.2010.22. Epub 2010 Feb 9. Feb 15;122(Pt 4):489-98. doi: 10.1242/jcs.042382. Epub 2009 Jan 27. Narla A, Ebert BL.. Ribosomopathies: human disorders of ribosome dysfunction. Blood. 2010 Apr 22;115(16):3196- Lempiainen H, Shore D.. Growth control and ribosome 205. doi: 10.1182/blood-2009-10-178129. Epub 2010 Mar biogenesis. Curr Opin Cell Biol. 2009 Dec;21(6):855-63. 1. (REVIEW) doi: 10.1016/j.ceb.2009.09.002. Epub 2009 Sep 30. (REVIEW) Philippi A, Steinbauer R, Reiter A, Fath S, Leger-Silvestre I, Milkereit P, Griesenbeck J, Tschochner H.. TOR- Liu T, Liu PY, Marshall GM.. The critical role of the class III dependent reduction in the expression level of Rrn3p histone deacetylase SIRT1 in cancer. Cancer Res. 2009 lowers the activity of the yeast RNA Pol I machinery, but Mar 1;69(5):1702-5. doi: 10.1158/0008-5472.CAN-08- does not account for the strong inhibition of rRNA 3365. Epub 2009 Feb 24. (REVIEW) production. Nucleic Acids Res. 2010 Sep;38(16):5315-26. doi: 10.1093/nar/gkq264. Epub 2010 Apr 25. McKeown PC, Shaw PJ.. Chromatin: linking structure and function in the nucleolus. Chromosoma. 2009 Pontvianne F, Abou-Ellail M, Douet J, Comella P, Matia I, Feb;118(1):11-23. doi: 10.1007/s00412-008-0184-2. Epub Chandrasekhara C, Debures A, Blevins T, Cooke R, 2008 Oct 17. (REVIEW) Medina FJ, Tourmente S, Pikaard CS, Saez-Vasquez J.. Nucleolin is required for DNA methylation state and the Sanij E, Hannan RD.. The role of UBF in regulating the expression of rRNA gene variants in Arabidopsis thaliana. structure and dynamics of transcriptionally active rDNA PLoS Genet. 2010 Nov 24;6(11):e1001225. doi: chromatin. Epigenetics. 2009 Aug 16;4(6):374-82. Epub 10.1371/journal.pgen.1001225. 2009 Aug 6. (REVIEW) Shiue CN, Arabi A, Wright AP.. Nucleolar organization, Zhou Y, Schmitz KM, Mayer C, Yuan X, Akhtar A, Grummt growth control and cancer. Epigenetics. 2010 Apr I.. Reversible acetylation of the chromatin remodelling 1;5(3):200-5. Epub 2010 Apr 1. complex NoRC is required for non-coding RNA-dependent silencing. Nat Cell Biol. 2009 Aug;11(8):1010-6. doi: Tsang CK, Liu H, Zheng XF.. mTOR binds to the 10.1038/ncb1914. Epub 2009 Jul 5. promoters of RNA polymerase I- and III-transcribed genes. Cell Cycle. 2010 Mar 1;9(5):953-7. Epub 2010 Mar 7. Bierhoff H, Schmitz K, Maass F, Ye J, Grummt I.. Noncoding transcripts in sense and antisense orientation van Riggelen J, Yetil A, Felsher DW.. MYC as a regulator regulate the epigenetic state of ribosomal RNA genes. of ribosome biogenesis and protein synthesis. Nat Rev Cold Spring Harb Symp Quant Biol. 2010;75:357-64. doi: Cancer. 2010 Apr;10(4):301-9. doi: 10.1038/nrc2819. 10.1101/sqb.2010.75.060. Epub 2011 Apr 18. (REVIEW) Blagosklonny MV.. Linking calorie restriction to longevity Chan JC, Hannan KM, Riddell K, Ng PY, Peck A, Lee RS, through sirtuins and autophagy: any role for TOR. Cell Hung S, Astle MV, Bywater M, Wall M, Poortinga G, Death Dis. 2010;1:e12. doi: 10.1038/cddis.2009.17. Jastrzebski K, Sheppard KE, Hemmings BA, Hall MN, Johnstone RW, McArthur GA, Hannan RD, Pearson RB.. Boulon S, Westman BJ, Hutten S, Boisvert FM, Lamond AKT promotes rRNA synthesis and cooperates with c-MYC AI.. The nucleolus under stress. Mol Cell. 2010 Oct to stimulate ribosome biogenesis in cancer. Sci Signal. 22;40(2):216-27. doi: 10.1016/j.molcel.2010.09.024. 2011 Aug 30;4(188):ra56. doi: 10.1126/scisignal.2001754. (REVIEW) Donati G, Bertoni S, Brighenti E, Vici M, Trere D, Volarevic Drygin D, Rice WG, Grummt I.. The RNA polymerase I S, Montanaro L, Derenzini M.. The balance between rRNA transcription machinery: an emerging target for the and ribosomal protein synthesis up- and downregulates treatment of cancer. Annu Rev Pharmacol Toxicol. the tumour suppressor p53 in mammalian cells. 2010;50:131-56. doi: Oncogene. 2011a Jul 21;30(29):3274-88. doi: 10.1146/annurev.pharmtox.010909.105844. (REVIEW) 10.1038/onc.2011.48. Epub 2011 Mar 14. Earley KW, Pontvianne F, Wierzbicki AT, Blevins T, Tucker Donati G, Brighenti E, Vici M, Mazzini G, Trere D, S, Costa-Nunes P, Pontes O, Pikaard CS.. Mechanisms of Montanaro L, Derenzini M.. Selective inhibition of rRNA HDA6-mediated rRNA gene silencing: suppression of transcription downregulates E2F-1: a new p53- intergenic Pol II transcription and differential effects on independent mechanism linking cell growth to cell maintenance versus siRNA-directed cytosine methylation. proliferation. J Cell Sci. 2011b Sep 1;124(Pt 17):3017-28. Genes Dev. 2010 Jun 1;24(11):1119-32. doi: doi: 10.1242/jcs.086074. 10.1101/gad.1914110. Ha CW, Huh WK.. Rapamycin increases rDNA stability by Grummt I, Voit R.. Linking rDNA transcription to the cellular enhancing association of Sir2 with rDNA in energy supply. Cell Cycle. 2010 Jan 15;9(2):225-6. Epub Saccharomyces cerevisiae. Nucleic Acids Res. 2011 2010 Jan 12. Mar;39(4):1336-50. doi: 10.1093/nar/gkq895. Epub 2010 Guetg C, Lienemann P, Sirri V, Grummt I, Hernandez- Oct 14. Verdun D, Hottiger MO, Fussenegger M, Santoro R.. The Kumazawa T, Nishimura K, Kuroda T, Ono W, Yamaguchi NoRC complex mediates the heterochromatin formation C, Katagiri N, Tsuchiya M, Masumoto H, Nakajima Y, and stability of silent rRNA genes and centromeric repeats. Murayama A, Kimura K, Yanagisawa J.. Novel nucleolar EMBO J. 2010 Jul 7;29(13):2135-46. doi: pathway connecting intracellular energy status with p53 10.1038/emboj.2010.17. Epub 2010 Feb 18. activation. J Biol Chem. 2011 Jun 10;286(23):20861-9. doi: 10.1074/jbc.M110.209916. Epub 2011 Apr 6.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 781 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Li LY, Chen H, Hsieh YH, Wang YN, Chu HJ, Chen YH, Jan;1825(1):101-10. doi: 10.1016/j.bbcan.2011.10.006. Chen HY, Chien PJ, Ma HT, Tsai HC, Lai CC, Sher YP, Epub 2011 Nov 3. (REVIEW) Lien HC, Tsai CH, Hung MC.. Nuclear ErbB2 enhances translation and cell growth by activating transcription of Pontvianne F, Blevins T, Chandrasekhara C, Feng W, ribosomal RNA genes. Cancer Res. 2011 Jun Stroud H, Jacobsen SE, Michaels SD, Pikaard CS.. 15;71(12):4269-79. doi: 10.1158/0008-5472.CAN-10-3504. Histone methyltransferases regulating rRNA gene dose Epub 2011 May 9. and dosage control in Arabidopsis. Genes Dev. 2012 May 1;26(9):945-57. doi: 10.1101/gad.182865.111. Shaw PJ, McKeown PC.. The structure of rDNA chromatin. In The Nucleolus. Protein Reviews Volume 15, 2011, pp Sebastian C, Satterstrom FK, Haigis MC, Mostoslavsky R.. 43-55. From sirtuin biology to human diseases: an update. J Biol Chem. 2012 Dec 14;287(51):42444-52. doi: Vintermist A, Bohm S, Sadeghifar F, Louvet E, Mansen A, 10.1074/jbc.R112.402768. Epub 2012 Oct 18. (REVIEW) Percipalle P, Ostlund Farrants AK.. The chromatin remodelling complex B-WICH changes the chromatin Shaw P, Brown J.. Nucleoli: composition, function, and structure and recruits histone acetyl-transferases to active dynamics. Plant Physiol. 2012 Jan;158(1):44-51. doi: rRNA genes. PLoS One. 2011 Apr 29;6(4):e19184. doi: 10.1104/pp.111.188052. Epub 2011 Nov 14. (REVIEW) 10.1371/journal.pone.0019184. Tsai YC, Greco TM, Boonmee A, Miteva Y, Cristea IM.. Barber MF, Michishita-Kioi E, Xi Y, Tasselli L, Kioi M, Functional proteomics establishes the interaction of SIRT7 Moqtaderi Z, Tennen RI, Paredes S, Young NL, Chen K, with chromatin remodeling complexes and expands its role Struhl K, Garcia BA, Gozani O, Li W, Chua KF.. SIRT7 in regulation of RNA polymerase I transcription. Mol Cell links H3K18 deacetylation to maintenance of oncogenic Proteomics. 2012 May;11(5):60-76. doi: transformation. Nature. 2012 Jul 5;487(7405):114-8. doi: 10.1074/mcp.A111.015156. 10.1038/nature11043. Uemura M, Zheng Q, Koh CM, Nelson WG, Bywater MJ, Poortinga G, Sanij E, Hein N, Peck A, Yegnasubramanian S, De Marzo AM.. Overexpression of Cullinane C, Wall M, Cluse L, Drygin D, Anderes K, Huser ribosomal RNA in prostate cancer is common but not N, Proffitt C, Bliesath J, Haddach M, Schwaebe MK, linked to rDNA promoter hypomethylation. Oncogene. Ryckman DM, Rice WG, Schmitt C, Lowe SW, Johnstone 2012 Mar 8;31(10):1254-63. doi: 10.1038/onc.2011.319. RW, Pearson RB, McArthur GA, Hannan RD.. Inhibition of Epub 2011 Aug 8. RNA polymerase I as a therapeutic strategy to promote Xie W, Ling T, Zhou Y, Feng W, Zhu Q, Stunnenberg HG, cancer-specific activation of p53. Cancer Cell. 2012 Jul Grummt I, Tao W.. The chromatin remodeling complex 10;22(1):51-65. doi: 10.1016/j.ccr.2012.05.019. NuRD establishes the poised state of rRNA genes Chen H, Fan M, Pfeffer LM, Laribee RN.. The histone H3 characterized by bivalent histone modifications and altered lysine 56 acetylation pathway is regulated by target of nucleosome positions. Proc Natl Acad Sci U S A. 2012 rapamycin (TOR) signaling and functions directly in May 22;109(21):8161-6. doi: 10.1073/pnas.1201262109. ribosomal RNA biogenesis. Nucleic Acids Res. 2012 Epub 2012 May 8. Aug;40(14):6534-46. doi: 10.1093/nar/gks345. Epub 2012 Hannan KM, Sanij E, Rothblum LI, Hannan RD, Pearson May 2. RB.. Dysregulation of RNA polymerase I transcription Cong R, Das S, Ugrinova I, Kumar S, Mongelard F, Wong during disease. Biochim Biophys Acta. 2013 Mar- J, Bouvet P.. Interaction of nucleolin with ribosomal RNA Apr;1829(3-4):342-60. doi: 10.1016/j.bbagrm.2012.10.014. genes and its role in RNA polymerase I transcription. Epub 2012 Nov 12. (REVIEW) Nucleic Acids Res. 2012 Oct;40(19):9441-54. doi: Postepska-Igielska A1, Krunic D, Schmitt N, Greulich-Bode 10.1093/nar/gks720. Epub 2012 Aug 2. KM, Boukamp P, Grummt I.. The chromatin remodelling Donati G, Montanaro L, Derenzini M.. Ribosome complex NoRC safeguards genome stability by biogenesis and control of cell proliferation: p53 is not heterochromatin formation at telomeres and centromeres. alone. Cancer Res. 2012 Apr 1;72(7):1602-7. doi: EMBO Rep. 2013 Aug;14(8):704-10. doi: 10.1158/0008-5472.CAN-11-3992. Epub 2012 Jan 26. 10.1038/embor.2013.87. Epub 2013 Jun 25. Guetg C, Scheifele F, Rosenthal F, Hottiger MO, Santoro Shen M, Zhou T, Xie W, Ling T, Zhu Q, Zong L, Lyu G, R.. Inheritance of silent rDNA chromatin is mediated by Gao Q, Zhang F, Tao W.. The chromatin remodeling factor PARP1 via noncoding RNA. Mol Cell. 2012 Mar CSB recruits histone acetyltransferase PCAF to rRNA 30;45(6):790-800. doi: 10.1016/j.molcel.2012.01.024. Epub gene promoters in active state for transcription initiation. 2012 Mar 8. PLoS One. 2013 May 7;8(5):e62668. doi: 10.1371/journal.pone.0062668. Print 2013. Lessard F, Stefanovsky V, Tremblay MG, Moss T.. The cellular abundance of the essential transcription Vannini A.. A structural perspective on RNA polymerase I termination factor TTF-I regulates ribosome biogenesis and RNA polymerase III transcription machineries. Biochim and is determined by MDM2 ubiquitinylation. Nucleic Acids Biophys Acta. 2013 Mar-Apr;1829(3-4):258-64. doi: Res. 2012 Jul;40(12):5357-67. doi: 10.1093/nar/gks198. 10.1016/j.bbagrm.2012.09.009. Epub 2012 Sep 29. Epub 2012 Mar 1. (REVIEW) Menssen A, Hydbring P, Kapelle K, Vervoorts J, Diebold J, Wang S, Cheng Y, Du W, Lu L, Zhou L, Wang H, Kang W, Luscher B, Larsson LG, Hermeking H.. The c-MYC Li X, Tao Q, Sung JJ, Yu J.. Zinc-finger protein 545 is a oncoprotein, the NAMPT enzyme, the SIRT1-inhibitor novel tumour suppressor that acts by inhibiting ribosomal DBC1, and the SIRT1 deacetylase form a positive RNA transcription in gastric cancer. Gut. 2013 feedback loop. Proc Natl Acad Sci U S A. 2012 Jan Jun;62(6):833-41. doi: 10.1136/gutjnl-2011-301776. Epub 24;109(4):E187-96. doi: 10.1073/pnas.1105304109. Epub 2012 May 12. 2011 Dec 21. Zillner K, Filarsky M, Rachow K, Weinberger M, Langst G, Montanaro L, Trere D, Derenzini M.. Changes in ribosome Nemeth A.. Large-scale organization of ribosomal DNA biogenesis may induce cancer by down-regulating the cell chromatin is regulated by Tip5. Nucleic Acids Res. 2013 tumor suppressor potential. Biochim Biophys Acta. 2012 May 1;41(10):5251-62. doi: 10.1093/nar/gkt218. Epub 2013 Apr 10.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 782 Mechanisms of rDNA silencing and the Nucleolar Remodelling Complex (NoRC) McKeown PC

Grob A, Colleran C, McStay B.. Construction of synthetic This article should be referenced as such: nucleoli in human cells reveals how a major functional nuclear domain is formed and propagated through cell McKeown PC. Mechanisms of rDNA silencing and the division. Genes Dev. 2014 Feb 1;28(3):220-30. doi: Nucleolar Remodelling Complex (NoRC). Atlas Genet 10.1101/gad.234591.113. Epub 2014 Jan 21. Cytogenet Oncol Haematol. 2014; 18(10):763-783.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 783

Atlas of Genetics and Cytogenetics

in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Case Report Section Paper co-edited with the European LeukemiaNet

AML with t(7;21)(p22;q22) and 5q abnormality, a case report Jianling Ji, Eric Loo, Carlos A Tirado Department of Pathology and Laboratory Medicine, David Geffen UCLA School of Medicine, Los Angeles, CA, USA (JJ, EL, CAT)

Published in Atlas Database: March 2014 Online updated version : http://AtlasGeneticsOncology.org/Reports/t0721p22q22JiID100077.html DOI: 10.4267/2042/54142 This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2014 Atlas of Genetics and Cytogenetics in Oncology and Haematology

Abstract Rearranged Ig Tcr Not performed. Case report and literature review on AML with Pathology t(7;21)(p22;q22) and 5q abnormality. Acute myeloid leukemia, not otherwise specified Clinics (AML, NOS), with monocytic differentiation. Electron microscopy Age and sex Not performed. 57 years old female patient. Diagnosis Previous history Acute myeloid leukemia, not otherwise specified No preleukemia, no previous malignancy, no inborn (AML, NOS); Acute myelomonocytic leukemia condition of note, no main items. subtype. Organomegaly No hepatomegaly, no splenomegaly, no enlarged Survival lymph nodes, no central nervous system Date of diagnosis: 02-2013 involvement. Treatment Blood Following diagnosis, the patient was seen at an outside institution for treatment and was placed on 9 WBC: 2.32 X 10 /l Revlimid therapy as opposed to induction HB: 6.9g/dl chemotherapy for about 5 months without 9 Platelets: 170X 10 /l improvement or significant deterioration of her Blasts: 0% blood counts. She was referred to our institution to Bone marrow: 25% be evaluated for allogenic stem-cell transplantation. A repeat bone marrow biopsy (~6-7 months post Cyto-Pathology diagnosis) confirmed persistent AML, and the Classification cytogenetic studies were performed. The patient was then started on 7+3 AML induction Immunophenotype (Cytarabine 320 mg IV continuous days 1-7, CD10 (partial), CD11b (partial), CD13, CD14 Idarubicin 19 mg IV on days 3-6). A day 16 repeat (partial), CD15 (partial), CD16 (partial), CD22 bone marrow biopsy showed persistent presence of (partial), CD34 (partial), CD36 (partial), CD38, abnormal myeloblasts. Biopsy about 6 weeks CD56 (partial), CD64 (partial), CD117 (partial), following induction therapy showed remission with HLA-DR (bright), icCD22 (partial), and MPO no excess or abnormal myeloblasts. She was (partial) with aberrant expression of CD7 (partial). subsequently admitted and completed her first cycle

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 784 AML with t(7;21)(p22;q22) and 5q abnormality, a case report Ji J, et al.

of consolidation chemotherapy with high-dose interphase nuclei (three green signals) in 235/300 cytarabine (3 gm/m2 IV q 12 hours on days 1, 3, 5 nuclei, and 5q deletion was detected (two green one for 6 doses). orange signal pattern) in 19/300 nuclei. Complete remission was obtained. Subsequent metaphase FISH on previously G- Treatment related death: no banded slides was performed by using Relapse: no. RUNX1/RUNXT1 and 7p sub-telomere probe. Status: Alive. Last follow up: 12-2013. The cryptic translocation t(7;21) was identified. Based on the metaphase FISH study, the final ISCN Survival: 9 months was characterized as: 46,XX,add(5)(q13)[5]/46,XX[15].ish Karyotype t(7;21)(p22;q22)(RUNX1+; VIJyRM2185+)[2]. Sample: Bone marrow aspirate Culture time: 24h without stimulating agents Other Molecular Studies Banding: GPG Technics: Results DNA was isolated by routine methods and Analysis of 20 metaphase cells revealed an subjected to quantitative real-time polymerase chain abnormal female karyotype with additional material reaction using allele-specific primers of unknown origin at 5q13 leading to partial complementary to the mutated and wild-type deletion of 5q in 5/20 metaphase cells examined. sequences of the JAK2 gene. The karyotype was described as: Results: 46,XX,add(5)(q13)[5]/46,XX[15]. Negative for JAK2 mutation V617F. Other molecular cytogenetics technics Fluorescence in situ hybridization (FISH) using the Other Findings LSI RUNX1(AML1)/RUNXT1(ETO) Dual Color Note: Translocation Probe and LSI EGR1/D5S23, The previous FISH studies on G-banded D5S721 Dual Color Probe Set (Abbott Molecular, metaphases showed that the AML1 signal was split USA) were performed. and moved to 7p, and the subtelomeric probes for Other molecular cytogenetics results 7p/q showed that the 7p signal moved to 21q, thus, Split of the RUNX1 gene was detected in the establishing the t(7;12).

Interphase FISH with three signals of RUNX1 (green) and two signals of RUNXT1 (orange).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 785 AML with t(7;21)(p22;q22) and 5q abnormality, a case report Ji J, et al.

Interphase FISH with two signals of 5p15.2 region (green) and one signal of EGR1 (orange) suggests loss of 5q.

Karyotype on the bone marrow aspirate showing additional material of unknown origin attached at 5q13 leading to 5q loss.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 786 AML with t(7;21)(p22;q22) and 5q abnormality, a case report Ji J, et al.

The sequential FISH study on a previously G-banded metaphase with LSI RUNX1/RUNXT1 probe showing the green signals of RUNX1 on der(7), der(21) and normal chromosome 21, respectively. Two normal orange of RUNXT1 are seen on the chromosomes 8.

FISH with TelVysion 7p (green, on the sub-telomere region of 7p), 7q (orange, on the sub-telomere region of 7q) and chromosome 14 (yellow and aqua) showing one green signal of 7p on der(21), and the der(7) is missing a green signal. Two normal chromosomes 14 are seen as indicated by the signal pattern (one yellow and one aqua signals on two normal chromosomes 14 respectively).

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 787 AML with t(7;21)(p22;q22) and 5q abnormality, a case report Ji J, et al.

Comments References We present a new case of AML, NOS with Paulsson K, Békássy AN, Olofsson T, Mitelman F, monocytic differentiation (myelomonocytic Johansson B, Panagopoulos I. A novel and cytogenetically cryptic t(7;21)(p22;q22) in acute myeloid leukemia results leukemia) which was shown to carry a cryptic in fusion of RUNX1 with the ubiquitin-specific protease t(7;21)(p22;q22) and 5q loss. gene USP42. Leukemia. 2006 Feb;20(2):224-9 The cryptic translocation t(7;21)(p22;q22) Foster N, Paulsson K, Sales M, Cunningham J, Groves M, involving RUNX1 and presumably USP42 is a rare O'Connor N, Begum S, Stubbs T, McMullan DJ, Griffiths recurrent abnormality in AML (Paulsson et al., M, Pratt N, Tauro S. Molecular characterisation of a 2006) and shows association with 5q abnormalities. recurrent, semi-cryptic RUNX1 translocation t(7;21) in myelodysplastic syndrome and acute myeloid leukaemia. RUNX1 codes for a transcription factor in the 'Runt Br J Haematol. 2010 Mar;148(6):938-43 domain' gene family and is a regulator of hematopoiesis. Giguère A, Hébert J. Microhomologies and topoisomerase II consensus sequences identified near the breakpoint The gene USP42 is involved in the ubiquitin junctions of the recurrent t(7;21)(p22;q22) translocation in pathway, and is fused to the 3' region of the acute myeloid leukemia. Genes Chromosomes Cancer. RUNX1 gene in this translocation. 2011 Apr;50(4):228-38 A recent study evaluated 397 consecutive AML Gindina T, Barkhatov I, Boychenko E, Garbuzova I, patients with RUNX1 FISH probes and identified 3 Vlasova M, Nikolaeva E, Petrova I, Ovechkina V, patients with t(7;21)(p22;q22), suggesting a relative Shorstova T.. A new case of Acute Myeloid Leukemia with incidence in about 1% of AML cases (Jeandidier et semi-cryptic t(7;21)(p22;q22). Atlas Genet Cytogenet Oncol Haematol. April 2012. URL: al., 2012). http://AtlasGeneticsOncology.org/Reports/t721p22q22Gind Nine previously reported cases have been identified inaID100064.html. on literature review (see references below) with a Jeandidier E, Gervais C, Radford-Weiss I, Zink E, broad age of onset (7-68 years, median 39), many Gangneux C, Eischen A, Galoisy AC, Helias C, Dano L, with monocytic differentiation, frequently aberrant Cammarata O, Jung G, Harzallah I, Guerin E, Martzolff L, immunophenotypic antigen expression (often with Drenou B, Lioure B, Tancredi C, Rimelen V, Mauvieux L.. A cytogenetic study of 397 consecutive acute myeloid CD7 and/or CD56), and generally poor response to leukemia cases identified three with a t(7;21) associated induction chemotherapy. with 5q abnormalities and exhibiting similar clinical and Long term survival data are limited at present. biological features, suggesting a new, rare acute myeloid Our presented case also had evidence of persistent leukemia entity. Cancer Genet. 2012 Jul-Aug;205(7- leukemia after 6 months of initial treatment with 8):365-72. doi: 10.1016/j.cancergen.2012.04.007. Revlimid (at another institution), but achieved Panagopoulos I, Gorunova L, Brandal P, Garnes M, complete remission by morphology, flow, and Tierens A, Heim S.. Myeloid leukemia with t(7;21)(p22;q22) and 5q deletion. Oncol Rep. 2013 cytogenetics after standard 7+3 AML induction Oct;30(4):1549-52. doi: 10.3892/or.2013.2623. Epub 2013 chemotherapy. Jul 18. She has since completed her first cycle of consolidation chemotherapy (high-dose Cytarabine) This article should be referenced as such: without incident. She is alive and in remission as of Ji J, Loo E, Tirado CA. AML with t(7;21)(p22;q22) and 5q 9 months from diagnosis. abnormality, a case report. Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10):784-788.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 788 Atlas of Genetics and Cytogenetics in Oncology and Haematology

OPEN ACCESS JOURNAL INIST -CNRS

Instructions to Authors Manuscripts submitted to the Atlas must be submitted solely to the Atlas. Iconography is most welcome: there is no space restriction. The Atlas publishes "cards", "deep insights", "case reports", and "educational items". Cards are structured review articles. Detailed instructions for these structured reviews can be found at: http://AtlasGeneticsOncology.org/Forms/Gene_Form.html for reviews on genes, http://AtlasGeneticsOncology.org/Forms/Leukaemia_Form.html for reviews on leukaemias, http://AtlasGeneticsOncology.org/Forms/SolidTumour_Form.html for reviews on solid tumours, http://AtlasGeneticsOncology.org/Forms/CancerProne_Form.html for reviews on cancer-prone diseases. According to the length of the paper, cards are divided, into "reviews" (texts exceeding 2000 words), "mini reviews" (between), and "short communications" (texts below 400 words). The latter category may not be accepted for indexing by bibliographic databases. Deep Insights are written as traditional papers, made of paragraphs with headings, at the author's convenience. No length restriction. Case Reports in haematological malignancies are dedicated to recurrent -but rare- chromosomes abnormalities in leukaemias/lymphomas. Cases of interest shall be: 1- recurrent (i.e. the chromosome anomaly has already been described in at least 1 case), 2- rare (previously described in less than 20 cases), 3- with well documented clinics and laboratory findings, and 4- with iconography of chromosomes. It is mandatory to use the specific "Submission form for Case reports": see http://AtlasGeneticsOncology.org/Reports/Case_Report_Submission.html. Educational Items must be didactic, give full information and be accompanied with iconography. Translations into French, German, Italian, and Spanish are welcome.

Subscription : The Atlas is FREE !

Corporate patronage, sponsorship and advertising Enquiries should be addressed to [email protected].

Rules, Copyright Notice and Disclaimer Conflicts of Interest: Authors must state explicitly whether potential conflicts do or do not exist. Reviewers must disclose to editors any conflicts of interest that could bias their opinions of the manuscript. The editor and the editorial board members must disclose any potential conflict. Privacy and Confidentiality – Iconography: Patients have a right to privacy. Identifying details should be omitted. If complete anonymity is difficult to achieve, informed consent should be obtained. Property: As "cards" are to evolve with further improvements and updates from various contributors, the property of the cards belongs to the editor, and modifications will be made without authorization from the previous contributor (who may, nonetheless, be asked for refereeing); contributors are listed in an edit history manner. Authors keep the rights to use further the content of their papers published in the Atlas, provided that the source is cited. Copyright: The information in the Atlas of Genetics and Cytogenetics in Oncology and Haematology is issued for general distribution. All rights are reserved. The information presented is protected under international conventions and under national laws on copyright and neighbouring rights. Commercial use is totally forbidden. Information extracted from the Atlas may be reviewed, reproduced or translated for research or private study but not for sale or for use in conjunction with commercial purposes. Any use of information from the Atlas should be accompanied by an acknowledgment of the Atlas as the source, citing the uniform resource locator (URL) of the article and/or the article reference, according to the Vancouver convention. Reference to any specific commercial products, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favouring. The views and opinions of contributors and authors expressed herein do not necessarily state or reflect those of the Atlas editorial staff or of the web site holder, and shall not be used for advertising or product endorsement purposes. The Atlas does not make any warranty, express or implied, including the warranties of merchantability and fitness for a particular purpose, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, and shall not be liable whatsoever for any damages incurred as a result of its use. In particular, information presented in the Atlas is only for research purpose, and shall not be used for diagnosis or treatment purposes. No responsibility is assumed for any injury and/or damage to persons or property for any use or operation of any methods products, instructions or ideas contained in the material herein. See also: "Uniform Requirements for Manuscripts Submitted to Biomedical Journals: Writing and Editing for Biomedical Publication - Updated October 2004": http://www.icmje.org.

http://AtlasGeneticsOncology.org

AML with t(7;21)(p22;q22) and 5q abnormality, a case report Ji J, et al.

Atlas Genet Cytogenet Oncol Haematol. 2014; 18(10) 790