DOCSLIB.ORG

AVILA-DISSERTATION.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
AVILA-DISSERTATION.Pdf LOGOS EX MACHINA: A REASONED APPROACH TOWARD CANCER by Andrew Avila, B. S., M. S. A Dissertation In Biological Sciences Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved Lauren Gollahon Chairperson of the Committee Rich Strauss Sean Rice Boyd Butler Richard Watson Peggy Gordon Miller Dean of the Graduate School May, 2012 c 2012, Andrew Avila Texas Tech University, Andrew Avila, May 2012 ACKNOWLEDGEMENTS I wish to acknowledge the incredible support given to me by my major adviser, Dr. Lauren Gollahon. Without your guidance surely I would not have made it as far as I have. Furthermore, the intellectual exchange I have shared with my advisory committee these long years have propelled me to new heights of inquiry I had not dreamed of even in the most lucid of my imaginings. That their continual intellectual challenges have provoked and evoked a subtle sense of natural wisdom is an ode to their efficacy in guiding the aspirant to the well of knowledge. For this initiation into the mysteries of nature I cannot thank my advisory committee enough. I also wish to thank the Vice President of Research for the fellowship which sustained the initial couple years of my residency at Texas Tech. Furthermore, my appreciation of the support provided to me by the Biology Department, financial and otherwise, cannot be understated. Finally, I also wish to acknowledge the individuals working at the High Performance Computing Center, without your tireless support in maintaining the cluster I would have not have completed the sheer amount of research that I have. To my parents there is nothing I can say that would enunciate my feelings of appreciation. Your ongoing love and support is remarkable if not extraordinary. Truly, I am thankful to have you. ii Texas Tech University, Andrew Avila, May 2012 TABLE OF CONTENTS ACKNOWLEDGEMENTS . ii ABSTRACT . vi LIST OF TABLES . viii LIST OF FIGURES . x LIST OF ABBREVIATIONS . xiii I. INTRODUCTION . 1 Background and Significance . 1 Hypotheses . 6 Chapter Summaries . 7 Bibliography . 8 II. DEVELOPMENT OF AN ABSTRACT LOGICAL MODEL FOR EX- PRESSING GENETIC RELATIONSHIPS . 9 Introduction . 9 Boolean Networks .......................... 10 Bayesian Networks .......................... 11 Knowledge Based Approaches .................... 11 Answer Set Programming and Action Languages . 12 Summary ............................... 15 Materials and Methods . 16 Results . 16 Discussion . 17 Bibliography . 22 iii Texas Tech University, Andrew Avila, May 2012 Appendix A . 26 Appendix B . 28 III. AUTOMATION OF LOGICAL MODEL GENERATION AND ANAL- YSIS FOR HOMO SAPIENS ...................... 30 Introduction . 30 Public Genetic and Biochemical Databases . 30 Representation Formats ....................... 34 Summary ............................... 37 Materials and Methods . 37 Results . 40 Discussion . 42 Bibliography . 49 Appendix A . 55 IV. ANALYSIS OF DIFFERENTIALLY EXPRESSED GENES IN HU- MAN CANCER CELL LINES . 99 Introduction . 99 Microarray Meta-Analyses of Cancer . 99 Summary ............................... 102 Materials and Methods . 102 Results . 105 Discussion . 106 Bibliography . 112 Appendix A . 152 iv Texas Tech University, Andrew Avila, May 2012 V. ANALYSIS OF DIFFERENTIALLY EXPRESSED GENES IN TISSUE SAMPLES OF BREAST CANCER . 156 Introduction . 156 Breast Cancer Initiation per the SMT . 156 Oncogenesis Via Chromothripsis . 158 Tumor Virology . 159 The Tissue Organization Field Theory of Cancer . 160 Summary ............................... 161 Materials and Methods . 162 Results . 164 Discussion . 166 Bibliography . 171 VI. CONCLUSIONS . 188 v Texas Tech University, Andrew Avila, May 2012 ABSTRACT Limitations in our current ability to integrate a diverse spectrum of genetic information in an effort to elucidate the underlying causes of cancer has spawned the need for a novel cancer modeling approach. Public repositories of biological pathways and gene expression experiments were combined in order to provide a systems biology approach toward cancer. Furthermore, by unifying these sources of knowledge, the ability to predict expression levels of unmeasured genes was developed. This technique was then applied to a variety of cancer types in order to resolve commonalities between heretofore divergent (or disparate) cancers. The results generated in this manner revealed characteristics that challenge the current prevailing paradigm of cancer. Specifically, the predicted results, according to the Somatic Mutation Theory of Cancer, of a significant upregulation of oncogenes and a significant downregulation of tumor suppressor genes was not found. In contrast, it was found that oncogenes were significantly downregulated and tumor suppressor genes were upregulated among the cancers examined. Furthermore, the results demonstrate the differential expression, in cancer cells, of genes involved in the cellular differentiation and wound healing processes. These results were used as a springboard to develop a novel oncogenesis hypothesis, named Umbracesis. In short, the Umbracesis hypothesis proposes that disruption of the wound healing process via carcinogens, occurs in such a way as to prevent organismic homeostasis from being recovered or prevent full re-differentiation of dedifferentiated cells. The former concept is implicated in inflammatory cancers. Whereas the latter concept, is implicated in cancers that show characteristics associated with embryonic tissues. It vi Texas Tech University, Andrew Avila, May 2012 was concluded, that the instrumental use of the modeling approach, developed within this study, has implications beyond cancer and may be of use within other areas of biomedical concern. vii Texas Tech University, Andrew Avila, May 2012 LIST OF TABLES 2.1 The individual relationships of an instance of a model that was imple- mented in Appendix B. 23 2.2 The application of a variety of initial conditions to the model listed in Appendix B and their solutions. 23 4.1 Genes that are significantly underexpressed in cancer (cervical, breast, and mesothelioma); sorted from most significant to least significant based on distribution mean. 117 4.2 Genes that are significantly overexpressed in cancer (cervical, breast, and mesothelioma); sorted from most significant to least significant based on distribution mean. 117 4.3 Genes that are significantly underexpressed in cervical cancer (GEO Dataset GDS3233 ); sorted from most significant to least significant based on distribution mean. 117 4.4 Genes that are significantly overexpressed in cervical cancer (GEO Dataset GDS3233 ); sorted from most significant to least significant based on distribution mean. 124 4.5 Genes that are significantly underexpressed in breast cancer (GEO Dataset GDS820 ); sorted from most significant to least significant based on distribution mean. 130 4.6 Genes that are significantly overexpressed in breast cancer (GEO Dataset GDS820 ); sorted from most significant to least significant based on dis- tribution mean. 131 viii Texas Tech University, Andrew Avila, May 2012 4.7 Genes that are significantly underexpressed in mesothelioma (GEO Dataset GDS1220 ); sorted from most significant to least significant based on distribution mean. 132 4.8 Genes that are significantly overexpressed in mesothelioma (GEO Dataset GDS1220 ); sorted from most significant to least significant based on distribution mean. 138 5.1 Genes that are significantly underexpressed in breast cancer (GEO Dataset GDS3324 ); sorted from most significant to least significant based on distribution mean. 175 5.2 Genes that are significantly overexpressed in breast cancer (GEO Dataset GDS3324 ); sorted from most significant to least significant based on distribution mean. 179 ix Texas Tech University, Andrew Avila, May 2012 LIST OF FIGURES 2.1 The network representing the causal relationship between the variables (a through i). Different arrows are used for edges leading to e in order to signify that they uniquely imply e and are not co-dependent. The relationship between a and i is of a non-direct, inverse type. 25 3.1 A gene cluster focusing on the gene IL1R1 and related elements. This is from the HeLa cervical cancer cell line (GEO dataset GDS3233 ). 51 3.2 An expansion upon Figure 3.1 with a recursive depth of one. Any gene (or related element) that connects to a gene (or related element) in Figure 3.1 has been added to the figure. 52 3.3 An expansion upon Figure 3.1 with a recursive depth of two. Any gene (or related element) that connects to a gene (or related element) in Figure 3.2 has been added to the figure. 53 3.4 A network demonstrating the ability to deduce the expression level of protein complexes from the expression levels of genes. Specifically, this network demonstrates the binding of FASL to the FAS Receptor in order to produce the FASL FAS Receptor Monomer. The deduction of the expression level of the FASL FAS Receptor Trimer is deduced from the FASL FAS Receptor Monomer. 54 4.1 A graph showing the differential expression of genes in cervical cancer (GEO Dataset GDS3233 ); specifically focusing on Semaphorin 5A and connected elements. 146 x Texas Tech University, Andrew Avila, May 2012 4.2 A graph showing the differential expression of genes in cervical cancer (GEO Dataset GDS3233 ); specifically focusing on Semaphorin 6D and connected elements. 147 4.3 A graph showing the differential expression of genes in breast cancer (GEO Dataset GDS820 ); specifically focusing on MED12 and con- nected elements. 148 4.4 A graph showing
Load more

Recommended publications
  • Supplementary Table 1: Adhesion Genes Data Set
    Supplementary Table 1: Adhesion genes data set PROBE Entrez Gene ID Celera Gene ID Gene_Symbol Gene_Name 160832 1 hCG201364.3 A1BG alpha-1-B glycoprotein 223658 1 hCG201364.3 A1BG alpha-1-B glycoprotein 212988 102 hCG40040.3 ADAM10 ADAM metallopeptidase domain 10 133411 4185 hCG28232.2 ADAM11 ADAM metallopeptidase domain 11 110695 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 195222 8038 hCG40937.4 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 165344 8751 hCG20021.3 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 189065 6868 null ADAM17 ADAM metallopeptidase domain 17 (tumor necrosis factor, alpha, converting enzyme) 108119 8728 hCG15398.4 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 117763 8748 hCG20675.3 ADAM20 ADAM metallopeptidase domain 20 126448 8747 hCG1785634.2 ADAM21 ADAM metallopeptidase domain 21 208981 8747 hCG1785634.2|hCG2042897 ADAM21 ADAM metallopeptidase domain 21 180903 53616 hCG17212.4 ADAM22 ADAM metallopeptidase domain 22 177272 8745 hCG1811623.1 ADAM23 ADAM metallopeptidase domain 23 102384 10863 hCG1818505.1 ADAM28 ADAM metallopeptidase domain 28 119968 11086 hCG1786734.2 ADAM29 ADAM metallopeptidase domain 29 205542 11085 hCG1997196.1 ADAM30 ADAM metallopeptidase domain 30 148417 80332 hCG39255.4 ADAM33 ADAM metallopeptidase domain 33 140492 8756 hCG1789002.2 ADAM7 ADAM metallopeptidase domain 7 122603 101 hCG1816947.1 ADAM8 ADAM metallopeptidase domain 8 183965 8754 hCG1996391 ADAM9 ADAM metallopeptidase domain 9 (meltrin gamma) 129974 27299 hCG15447.3 ADAMDEC1 ADAM-like,
    [Show full text]
  • Essential Genes and Their Role in Autism Spectrum Disorder
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2017 Essential Genes And Their Role In Autism Spectrum Disorder Xiao Ji University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Bioinformatics Commons, and the Genetics Commons Recommended Citation Ji, Xiao, "Essential Genes And Their Role In Autism Spectrum Disorder" (2017). Publicly Accessible Penn Dissertations. 2369. https://repository.upenn.edu/edissertations/2369 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/2369 For more information, please contact [email protected]. Essential Genes And Their Role In Autism Spectrum Disorder Abstract Essential genes (EGs) play central roles in fundamental cellular processes and are required for the survival of an organism. EGs are enriched for human disease genes and are under strong purifying selection. This intolerance to deleterious mutations, commonly observed haploinsufficiency and the importance of EGs in pre- and postnatal development suggests a possible cumulative effect of deleterious variants in EGs on complex neurodevelopmental disorders. Autism spectrum disorder (ASD) is a heterogeneous, highly heritable neurodevelopmental syndrome characterized by impaired social interaction, communication and repetitive behavior. More and more genetic evidence points to a polygenic model of ASD and it is estimated that hundreds of genes contribute to ASD. The central question addressed in this dissertation is whether genes with a strong effect on survival and fitness (i.e. EGs) play a specific oler in ASD risk. I compiled a comprehensive catalog of 3,915 mammalian EGs by combining human orthologs of lethal genes in knockout mice and genes responsible for cell-based essentiality.
    [Show full text]
  • Supplementary Materials
    Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine
    [Show full text]
  • MED6 (NM 005466) Human Untagged Clone – SC317351 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC317351 MED6 (NM_005466) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: MED6 (NM_005466) Human Untagged Clone Tag: Tag Free Symbol: MED6 Synonyms: ARC33; NY-REN-28 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_005466, the custom clone sequence may differ by one or more nucleotides ATGGCGGCGGTGGATATCCGAGACAATCTGCTGGGAATTTCTTGGGTTGACAGCTCTTGGATCCCTATTT TGAACAGTGGTAGTGTCCTGGATTACTTTTCAGAAAGAAGTAATCCTTTTTATGACAGAACATGTAATAA TGAAGTGGTCAAAATGCAGAGGCTAACATTAGAACACTTGAATCAGATGGTTGGAATCGAGTACATCCTT TTGCATGCTCAAGAGCCCATTCTTTTCATCATTCGGAAGCAACAGCGGCAGTCCCCTGCCCAAGTTATCC CACTAGCTGATTACTATATCATTGCTGGAGTGATCTATCAGGCACCAGACTTGGGATCAGTTATAAACTC TAGAGTGCTTACTGCAGTGCATGGTATTCAGTCAGCTTTTGATGAAGCTATGTCATACTGTCGATATCAT CCTTCCAAAGGGTATTGGTGGCACTTCAAAGATCATGAAGAGCAAGATAAAGTCAGACCTAAAGCCAAAA GGAAAGAAGAACCAAGCTCTATTTTTCAGAGACAACGTGTGGATGCTTTACTTTTAGACCTCAGACAAAA ATTTCCACCCAAATTTGTGCAGCTAAAGCCTGGAGAAAAGCCTGTTCCAGTGGATCAAACAAAGAAAGAG GCAGAACCTATACCAGAAACTGTAAAACCTGAGGAGAAGGAGACCACAAAGAATGTACAACAGACAGTGA GTGCTAAAGGCCCCCCTGAAAAACGGATGAGACTTCAGTGA Restriction Sites: SgfI-MluI ACCN: NM_005466 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete
    [Show full text]
  • GWAS) Focusing on Patients with Mood Or Anxiety Disorders and Co-Occurring Alcohol-Use Disorders
    diagnostics Review Genetic Basis of Dual Diagnosis: A Review of Genome-Wide Association Studies (GWAS) Focusing on Patients with Mood or Anxiety Disorders and Co-Occurring Alcohol-Use Disorders Kaloyan Stoychev 1,* , Dancho Dilkov 2, Elahe Naghavi 3 and Zornitsa Kamburova 4 1 Department of Psychiatry, Medical University Pleven, 5800 Pleven, Bulgaria 2 Department of Psychiatry, Military Medical Academy Sofia, 1606 Sofia, Bulgaria; [email protected] 3 Medical University Pleven, 5800 Pleven, Bulgaria; [email protected] 4 Department of Medical Genetics, Medical University Pleven, 5800 Pleven, Bulgaria; [email protected] * Correspondence: [email protected]; Tel.: +359-64-886-867 Abstract: (1) Background: Comorbidity between Alcohol Use Disorders (AUD), mood, and anxiety disorders represents a significant health burden, yet its neurobiological underpinnings are elusive. The current paper reviews all genome-wide association studies conducted in the past ten years, sampling patients with AUD and co-occurring mood or anxiety disorder(s). (2) Methods: In keeping with PRISMA guidelines, we searched EMBASE, Medline/PUBMED, and PsycINFO databases (January 2010 to December 2020), including references of enrolled studies. Study selection was based on predefined criteria and data underwent a multistep revision process. (3) Results: 15 studies were included. Some of them explored dual diagnoses phenotypes directly while others employed Citation: Stoychev, K.; Dilkov, D.; correlational analysis based on polygenic risk score approach. Their results support the significant Naghavi, E.; Kamburova, Z. Genetic overlap of genetic factors involved in AUDs and mood and anxiety disorders. Comorbidity risk Basis of Dual Diagnosis: A Review of seems to be conveyed by genes engaged in neuronal development, connectivity, and signaling Genome-Wide Association Studies although the precise neuronal pathways and mechanisms remain unclear.
    [Show full text]
  • Genetic Signatures of High-Altitude Adaptation and Geographic
    www.nature.com/scientificreports OPEN Genetic signatures of high‑altitude adaptation and geographic distribution in Tibetan sheep Jianbin Liu1,2*, Chao Yuan1,2, Tingting Guo1,2, Fan Wang3, Yufeng Zeng1, Xuezhi Ding1, Zengkui Lu1,2, Dingkao Renqing4, Hao Zhang5, Xilan Xu6, Yaojing Yue1,2, Xiaoping Sun1,2, Chune Niu1,2, Deqing Zhuoga7* & Bohui Yang1,2* Most sheep breeding programs designed for the tropics and sub‑tropics have to take into account the impacts of environmental adaptive traits. However, the genetic mechanism regulating the multiple biological processes driving adaptive responses remains unclear. In this study, we applied a selective sweep analysis by combing 1% top values of Fst and ZHp on both altitude and geographic subpopulations (APS) in 636 indigenous Tibetan sheep breeds. Results show that 37 genes were identifed within overlapped genomic regions regarding Fst signifcantly associated with APS. Out of the 37 genes, we found that 8, 3 and 6 genes at chromosomes (chr.) 13, 23 and 27, respectively, were identifed in the genomic regions with 1% top values of ZHp. We further analyzed the INDEL variation of 6 genes at chr.27 (X chromosome) in APS together with corresponding orthologs of 6 genes in Capra, Pantholops, and Bos Taurus. We found that an INDEL was located within 5′UTR region of HAG1 gene. This INDEL of HAG1 was strongly associated with the variation of APS, which was further confrmed by qPCR. Sheep breeds carrying “C‑INDEL” of HAG1 have signifcantly greater body weight, shear amount, corpuscular hemoglobin and globulin levels, but lower body height, than those carrying “CA‑INDEL” of HAG1.
    [Show full text]
  • Amanda Tábita Da Silva Albanaz
    Amanda Tábita da Silva Albanaz Entendendo os Mecanismos Moleculares de Mutações que causam Esclerose Lateral Amiotrófica Universidade Federal de Minas Gerais Belo Horizonte Fevereiro de 2019 Amanda Tábita da Silva Albanaz Entendendo os Mecanismos Moleculares de Mutações que causam Esclerose Lateral Amiotrófica Dissertação apresentada ao Programa Interunidades de Pós-graduação em Bioinformática do Instituto de Ciências Biológicas da Universidade Federal de Minas Gerais como requisito para obtenção do título de Mestre em Bioinformática. Orientador: Douglas Eduardo Valente Pires Co-orientador: David Benjamin Ascher Programa Interunidades de Pós-Graduação em Bioinformática Universidade Federal de Minas Gerais - UFMG Instituto de Ciências Biológicas Belo Horizonte, Fevereiros de 2019 Agradecimentos Gostaria de expressar minha gratidão aos meus orientadores. Ao Dr. Douglas Pires, por todo o apoio, incentivo e imensa compreensão, durante cada etapa do meu desenvolvimento acadêmico sob sua orientação. Ao Dr. David Ascher, que apesar da grande distância tem sido indispensável ao meu desenvolvimento e sempre se lembra de detalhes e materiais importantes. Obrigada à ambos pela oportunidade de aprender com vocês. Agradeço também ao Instituto de Ciências Biológicas da UFMG, à todos os professores e equipes de suporte acadêmico, à pós-graduação em Bioinformática, imprescindíveis à formação acadêmica. Ao Instituto René Rachou – Fiocruz Minas, obrigada pela oportunidade de aprendizado e crescimento. Sou grata aos colegas da Plataforma de Bioinformática, sem exceção àqueles que buscaram novos desafios em outras instituições e países. Agradeço à todos e em especial à Joicy, por todas as contribuições e suporte durante essa jornada. Minha eterna gratidão aos meus pais, Vander e Marlene, à minha irmã Júlia e ao meu companheiro, João.
    [Show full text]
  • MED21 Polyclonal Antibody
    PRODUCT DATA SHEET Bioworld Technology,Inc. MED21 polyclonal antibody Catalog: BS61042 Host: Rabbit Reactivity: Human,Mouse,Rat BackGround: Q13503 In mammalian cells, transcription is regulated in part by Purification&Purity: high molecular weight co-activating complexes that me- The antibody was affinity-purified from rabbit antiserum diate signals between transcriptional activators and RNA by affinity-chromatography using epitope-specific im- polymerase. These complexes include the SMCC (SRB munogen and the purity is > 95% (by SDS-PAGE). and MED protein cofactor complex), which consists of Applications: various subunits that share homology with several com- WB: 1:500~1:1000 ponents of the yeast transcriptional mediator complexes Storage&Stability: and including the human proteins Srb7, Med6 (also des- Store at 4°C short term. Aliquot and store at -20°C long ignated DRIP33) and Med7 (also designated DRIP34). term. Avoid freeze-thaw cycles. SMCC associates with the RNAPII (RNA polymerase II) Specificity: holoenzyme through Srb7 and, in turn, enhances MED21 polyclonal antibodydetects endogenous levels of gene-specific activation or repression induced by MED21 protein. DNA-binding transcription factors. Med6 and Med7, as DATA: well as other components of SMCC, associate with co-activator proteins from the TRAP (thyroid hormone receptor-activating protein) complex and DRIP (for vita- min D receptor interacting protein) complex to facilitate steroid receptor dependent transcriptional activation. Ad- ditionally, SMCC associates with PC4 (positive cofactor 4) to repress basal transcription independent of RNAPII activity. Western blot (WB) analysis of MED21 polyclonal antibody at 1:500 di- Product: lution Rabbit IgG, 1mg/ml in PBS with 0.02% sodium azide, Lane1:CT26 whole cell lysate(40ug) 50% glycerol, pH7.2 Lane2:HEK293T whole cell lysate(40ug) Molecular Weight: Lane3:HCT116 whole cell lysate(40ug) ~ 15 kDa Note: Swiss-Prot: For research use only, not for use in diagnostic procedure.
    [Show full text]
  • Crystal Structure of a Variant PAM2 Motif of LARP4B Bound to the MLLE Domain of PABPC1
    biomolecules Article Crystal Structure of a Variant PAM2 Motif of LARP4B Bound to the MLLE Domain of PABPC1 Clemens Grimm *, Jann-Patrick Pelz, Cornelius Schneider, Katrin Schäffler and Utz Fischer Department of Biochemistry, Theodor Boveri Institute, Biocenter of the University of Würzburg, 97070 Würzburg, Germany; [email protected] (J.-P.P.); [email protected] (C.S.); katrin.schaeffl[email protected] (K.S.); utz.fi[email protected] (U.F.) * Correspondence: [email protected] Received: 3 April 2020; Accepted: 4 June 2020; Published: 6 June 2020 Abstract: Eukaryotic cells determine the protein output of their genetic program by regulating mRNA transcription, localization, translation and turnover rates. This regulation is accomplished by an ensemble of RNA-binding proteins (RBPs) that bind to any given mRNA, thus forming mRNPs. Poly(A) binding proteins (PABPs) are prominent members of virtually all mRNPs that possess poly(A) tails. They serve as multifunctional scaffolds, allowing the recruitment of diverse factors containing a poly(A)-interacting motif (PAM) into mRNPs. We present the crystal structure of the variant PAM motif (termed PAM2w) in the N-terminal part of the positive translation factor LARP4B, which binds to the MLLE domain of the poly(A) binding protein C1 cytoplasmic 1 (PABPC1). The structural analysis, along with mutational studies in vitro and in vivo, uncovered a new mode of interaction between PAM2 motifs and MLLE domains. Keywords: PAM2w; PAM2; PABC1; MLLE domain; PABP; Poly(A) binding protein 1. Introduction In higher eukaryotes, posttranscriptional mechanisms contribute significantly to gene expression. The mRNA, which is translated into proteins by the ribosomes, has first to undergo several maturation steps, from the primary pre-mRNA transcript to the mature mRNA.
    [Show full text]
  • Novelty Indicator for Enhanced Prioritization of Predicted Gene Ontology Annotations
    IEEE/ACM TRANSACTIONS ON COMPUTATIONAL BIOLOGY AND BIOINFORMATICS, VOL. X, NO. X, MONTHXXX 20XX 1 Novelty Indicator for Enhanced Prioritization of Predicted Gene Ontology Annotations Davide Chicco, Fernando Palluzzi, and Marco Masseroli Abstract—Biomolecular controlled annotations have become pivotal in computational biology, because they allow scientists to analyze large amounts of biological data to better understand their test results, and to infer new knowledge. Yet, biomolecular annotation databases are incomplete by definition, like our knowledge of biology, and may contain errors and inconsistent information. In this context, machine-learning algorithms able to predict and prioritize new biomolecular annotations are both effective and efficient, especially if compared with the time-consuming trials of biological validation. To limit the possibility that these techniques predict obvious and trivial high-level features, and to help prioritizing their results, we introduce here a new element that can improve the accuracy and relevance of the results of an annotation prediction and prioritization pipeline. We propose a novelty indicator able to state the level of ”newness” (or ”originality”) of the annotations predicted for a specific gene to Gene Ontology terms, and to help prioritizing the most novel and interesting annotations predicted. We performed a thorough biological functional analysis of the prioritized annotations predicted with high accuracy by using this indicator and our previously proposed prediction algorithms. The relevance
    [Show full text]
  • Clinical Impact of Copy Number Variation Changes in Bladder Cancer Samples
    EXPERIMENTAL AND THERAPEUTIC MEDICINE 22: 901, 2021 Clinical impact of copy number variation changes in bladder cancer samples VICTORIA SPASOVA1, BORIS MLADENOV2, SIMEON RANGELOV3, ZORA HAMMOUDEH1, DESISLAVA NESHEVA1, DIMITAR SERBEZOV1, RADA STANEVA1,4, SAVINA HADJIDEKOVA1,4, MIHAIL GANEV1, LUBOMIR BALABANSKI1,5, RADOSLAVA VAZHAROVA5,6, CHAVDAR SLAVOV3, DRAGA TONCHEVA1 and OLGA ANTONOVA1 1Department of Medical Genetics, Medical University‑Sofia, 1431 Sofia;2 Department of Urology, UMBALSM N.I. Pirogov, 1606 Sofia; 3Department of Urology, Tsaritsa Yoanna University Hospital, 1527 Sofia; 4Medical Genetics Laboratory, Nadezhda Women's Health Hospital, 1373 Sofia; 5Medical Genetics Laboratory, GARH Malinov, 1680 Sofia; 6Department of Biology, Medical Genetics and Microbiology, Faculty of Medicine, Sofia University St. Kliment Ohridski, 1407 Sofia, Bulgaria Received November 30, 2019; Accepted February 18, 2021 DOI: 10.3892/etm.2021.10333 Abstract. The aim of the present study was to detect copy uroepithelial tumours may lay a foundation for implementing number variations (CNVs) related to tumour progression and molecular CNV profiling of bladder tumours as part of a metastasis of urothelial carcinoma through whole‑genome routine progression risk estimation strategy, thus expanding scanning. A total of 30 bladder cancer samples staged from the personalized therapeutic approach. pTa to pT4 were included in the study. DNA was extracted from freshly frozen tissue via standard phenol‑chloroform extraction Introduction and CNV analysis was performed on two alternative platforms (CytoChip Oligo aCGH, 4x44K and Infinium OncoArray‑500K The most successful approach to treating a disease has BeadChip; Illumina, Inc.). Data were analysed with BlueFuse always been etiological therapy. In the case of bladder Multi software and Karyostudio, respectively.
    [Show full text]
  • Anti-MED6 Antibody (ARG66412)
    Product datasheet [email protected] ARG66412 Package: 100 μl anti-MED6 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes MED6 Tested Reactivity Hu Tested Application IHC-P Host Rabbit Clonality Polyclonal Isotype IgG Target Name MED6 Antigen Species Human Immunogen Full length fusion protein of Human MED6. Conjugation Un-conjugated Alternate Names Activator-recruited cofactor 33 kDa component; Renal carcinoma antigen NY-REN-28; NY-REN-28; hMed6; Mediator of RNA polymerase II transcription subunit 6; ARC33; Mediator complex subunit 6 Application Instructions Application table Application Dilution IHC-P 1:25 - 1:100 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control IHC-P: Human brain; WB: HeLa, PC3, 231 and Human esophagus cancer tissue Calculated Mw 28 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (pH 7.4), 0.05% Sodium azide and 40% Glycerol. Preservative 0.05% Sodium azide Stabilizer 40% Glycerol Concentration 1.8 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol MED6 Gene Full Name mediator complex subunit 6 Function Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes.
    [Show full text]