Human MED6 ORF Mammalian Expression Plasmid, N-His Tag
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
AVILA-DISSERTATION.Pdf
LOGOS EX MACHINA: A REASONED APPROACH TOWARD CANCER by Andrew Avila, B. S., M. S. A Dissertation In Biological Sciences Submitted to the Graduate Faculty of Texas Tech University in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Approved Lauren Gollahon Chairperson of the Committee Rich Strauss Sean Rice Boyd Butler Richard Watson Peggy Gordon Miller Dean of the Graduate School May, 2012 c 2012, Andrew Avila Texas Tech University, Andrew Avila, May 2012 ACKNOWLEDGEMENTS I wish to acknowledge the incredible support given to me by my major adviser, Dr. Lauren Gollahon. Without your guidance surely I would not have made it as far as I have. Furthermore, the intellectual exchange I have shared with my advisory committee these long years have propelled me to new heights of inquiry I had not dreamed of even in the most lucid of my imaginings. That their continual intellectual challenges have provoked and evoked a subtle sense of natural wisdom is an ode to their efficacy in guiding the aspirant to the well of knowledge. For this initiation into the mysteries of nature I cannot thank my advisory committee enough. I also wish to thank the Vice President of Research for the fellowship which sustained the initial couple years of my residency at Texas Tech. Furthermore, my appreciation of the support provided to me by the Biology Department, financial and otherwise, cannot be understated. Finally, I also wish to acknowledge the individuals working at the High Performance Computing Center, without your tireless support in maintaining the cluster I would have not have completed the sheer amount of research that I have. -
MED6 (NM 005466) Human Untagged Clone – SC317351 | Origene
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC317351 MED6 (NM_005466) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: MED6 (NM_005466) Human Untagged Clone Tag: Tag Free Symbol: MED6 Synonyms: ARC33; NY-REN-28 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >NCBI ORF sequence for NM_005466, the custom clone sequence may differ by one or more nucleotides ATGGCGGCGGTGGATATCCGAGACAATCTGCTGGGAATTTCTTGGGTTGACAGCTCTTGGATCCCTATTT TGAACAGTGGTAGTGTCCTGGATTACTTTTCAGAAAGAAGTAATCCTTTTTATGACAGAACATGTAATAA TGAAGTGGTCAAAATGCAGAGGCTAACATTAGAACACTTGAATCAGATGGTTGGAATCGAGTACATCCTT TTGCATGCTCAAGAGCCCATTCTTTTCATCATTCGGAAGCAACAGCGGCAGTCCCCTGCCCAAGTTATCC CACTAGCTGATTACTATATCATTGCTGGAGTGATCTATCAGGCACCAGACTTGGGATCAGTTATAAACTC TAGAGTGCTTACTGCAGTGCATGGTATTCAGTCAGCTTTTGATGAAGCTATGTCATACTGTCGATATCAT CCTTCCAAAGGGTATTGGTGGCACTTCAAAGATCATGAAGAGCAAGATAAAGTCAGACCTAAAGCCAAAA GGAAAGAAGAACCAAGCTCTATTTTTCAGAGACAACGTGTGGATGCTTTACTTTTAGACCTCAGACAAAA ATTTCCACCCAAATTTGTGCAGCTAAAGCCTGGAGAAAAGCCTGTTCCAGTGGATCAAACAAAGAAAGAG GCAGAACCTATACCAGAAACTGTAAAACCTGAGGAGAAGGAGACCACAAAGAATGTACAACAGACAGTGA GTGCTAAAGGCCCCCCTGAAAAACGGATGAGACTTCAGTGA Restriction Sites: SgfI-MluI ACCN: NM_005466 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete -
MED21 Polyclonal Antibody
PRODUCT DATA SHEET Bioworld Technology,Inc. MED21 polyclonal antibody Catalog: BS61042 Host: Rabbit Reactivity: Human,Mouse,Rat BackGround: Q13503 In mammalian cells, transcription is regulated in part by Purification&Purity: high molecular weight co-activating complexes that me- The antibody was affinity-purified from rabbit antiserum diate signals between transcriptional activators and RNA by affinity-chromatography using epitope-specific im- polymerase. These complexes include the SMCC (SRB munogen and the purity is > 95% (by SDS-PAGE). and MED protein cofactor complex), which consists of Applications: various subunits that share homology with several com- WB: 1:500~1:1000 ponents of the yeast transcriptional mediator complexes Storage&Stability: and including the human proteins Srb7, Med6 (also des- Store at 4°C short term. Aliquot and store at -20°C long ignated DRIP33) and Med7 (also designated DRIP34). term. Avoid freeze-thaw cycles. SMCC associates with the RNAPII (RNA polymerase II) Specificity: holoenzyme through Srb7 and, in turn, enhances MED21 polyclonal antibodydetects endogenous levels of gene-specific activation or repression induced by MED21 protein. DNA-binding transcription factors. Med6 and Med7, as DATA: well as other components of SMCC, associate with co-activator proteins from the TRAP (thyroid hormone receptor-activating protein) complex and DRIP (for vita- min D receptor interacting protein) complex to facilitate steroid receptor dependent transcriptional activation. Ad- ditionally, SMCC associates with PC4 (positive cofactor 4) to repress basal transcription independent of RNAPII activity. Western blot (WB) analysis of MED21 polyclonal antibody at 1:500 di- Product: lution Rabbit IgG, 1mg/ml in PBS with 0.02% sodium azide, Lane1:CT26 whole cell lysate(40ug) 50% glycerol, pH7.2 Lane2:HEK293T whole cell lysate(40ug) Molecular Weight: Lane3:HCT116 whole cell lysate(40ug) ~ 15 kDa Note: Swiss-Prot: For research use only, not for use in diagnostic procedure. -
Anti-MED6 Antibody (ARG66412)
Product datasheet [email protected] ARG66412 Package: 100 μl anti-MED6 antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes MED6 Tested Reactivity Hu Tested Application IHC-P Host Rabbit Clonality Polyclonal Isotype IgG Target Name MED6 Antigen Species Human Immunogen Full length fusion protein of Human MED6. Conjugation Un-conjugated Alternate Names Activator-recruited cofactor 33 kDa component; Renal carcinoma antigen NY-REN-28; NY-REN-28; hMed6; Mediator of RNA polymerase II transcription subunit 6; ARC33; Mediator complex subunit 6 Application Instructions Application table Application Dilution IHC-P 1:25 - 1:100 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control IHC-P: Human brain; WB: HeLa, PC3, 231 and Human esophagus cancer tissue Calculated Mw 28 kDa Properties Form Liquid Purification Affinity purification with immunogen. Buffer PBS (pH 7.4), 0.05% Sodium azide and 40% Glycerol. Preservative 0.05% Sodium azide Stabilizer 40% Glycerol Concentration 1.8 mg/ml Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. Note For laboratory research only, not for drug, diagnostic or other use. www.arigobio.com 1/2 Bioinformation Gene Symbol MED6 Gene Full Name mediator complex subunit 6 Function Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. -
WO 2013/064702 A2 10 May 2013 (10.05.2013) P O P C T
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2013/064702 A2 10 May 2013 (10.05.2013) P O P C T (51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12Q 1/68 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, (21) International Application Number: HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, PCT/EP2012/071868 KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, (22) International Filing Date: ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, 5 November 20 12 (05 .11.20 12) NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, (25) Filing Language: English TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, (26) Publication Language: English ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 1118985.9 3 November 201 1 (03. 11.201 1) GB kind of regional protection available): ARIPO (BW, GH, 13/339,63 1 29 December 201 1 (29. 12.201 1) US GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, (71) Applicant: DIAGENIC ASA [NO/NO]; Grenseveien 92, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, N-0663 Oslo (NO). -
Structure–System Correlation Identifies a Gene Regulatory Mediator
Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION Structure–system correlation Mediator subunits reside in different modules named identifies a gene regulatory head, middle, tail, and kinase modules (Dotson et al. Mediator submodule 2000; Kang et al. 2001). Apparently the Mediator mod- ules are required for the regulation of different subsets of Laurent Larivière,1,4 Martin Seizl,1,4 genes. Gene deletion studies implicated the middle mod- 2 1 ule in regulating HSP genes and low-iron response genes, Sake van Wageningen, Susanne Röther, the tail module in regulating HSP and OXPHOS genes, 2 1 Loes van de Pasch, Heidi Feldmann, and the kinase module in regulating genes required dur- Katja Sträßer,1 Steve Hahn,3 Frank C.P. Holstege,2 ing nutrient starvation (Holstege et al. 1998; Beve et al. and Patrick Cramer1,5 2005; van de Peppel et al. 2005; Singh et al. 2006). The Mediator head module is important for initiation 1Gene Center Munich and Center for Integrated Protein complex assembly, stimulates basal transcription, and is Science CIPSM, Department of Chemistry and Biochemistry, necessary for activated transcription (Ranish et al. 1999; Ludwig-Maximilians-Universität München, 81377 Munich, Takagi et al. 2006). The head module contains subunits Germany; 2Department of Physiological Chemistry, Med6, Med8, Med11, Med17, Med18, Med20, and University Medical Center Utrecht, 3584 CG Utrecht, The Med22, which are conserved from yeast to human. Head Netherlands; 3Division of Basic Sciences, Fred Hutchinson subunits are essential for yeast viability, except for Cancer Research Center, Seattle, Washington 98109, USA Med18 and Med20 (Koleske et al. -
Structure of the Mammalian Mediator
bioRxiv preprint doi: https://doi.org/10.1101/2020.10.05.326918; this version posted October 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Structure of the Mammalian Mediator Haiyan Zhao1.#, Natalie Young1,#, Jens Kalchschmidt2,#, Jenna Lieberman2, Laila El Khattabi3, Rafael Casellas2,4 and Francisco J. Asturias1,* 1Department of Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical School, Aurora CO 80045, USA 2Lymphocyte Nuclear Biology, NIAMS, NIH, Bethesda, MD 20892, USA 3Institut Cochin Laboratoire de Cytogénétique Constitutionnelle Pré et Post Natale, 75014 Paris France 4Center for Cancer Research, NCI, NIH, Bethesda, MD 20892, USA #,*These authors contributed equally to this work *Correspondence should be addressed to F.J.A. ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.10.05.326918; this version posted October 6, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The Mediator complex plays an essential and multi-faceted role in regulation of RNA polymerase II transcription in all eukaryotes. Structural analysis of yeast Mediator has provided an understanding of the conserved core of the complex and its interaction with RNA polymerase II but failed to reveal the structure of the Tail module that contains most subunits targeted by activators and repressors. Here we present a molecular model of mammalian (Mus musculus) Mediator, derived from a 4.0 Å resolution cryo-EM map of the complex. -
Topic 1.1 Nuclear Receptor Superfamily: Principles of Signaling*
Pure Appl. Chem., Vol. 75, Nos. 11–12, pp. 1619–1664, 2003. © 2003 IUPAC Topic 1.1 Nuclear receptor superfamily: Principles of signaling* Pierre Germain1, Lucia Altucci2, William Bourguet3, Cecile Rochette-Egly1, and Hinrich Gronemeyer1,‡ 1IGBMC - B.P. 10142, F-67404 Illkirch Cedex, C.U. de Strasbourg, France; 2Dipartimento di Patologia Generale, Seconda Università di Napoli, Vico Luigi De Crecchio 7, I-80138 Napoli, Italia; 3CBS, CNRS U5048-INSERM U554, 15 av. C. Flahault, F-34039 Montpellier, France Abstract: Nuclear receptors (NRs) comprise a family of 49 members that share a common structural organization and act as ligand-inducible transcription factors with major (patho)physiological impact. For some NRs (“orphan receptors”), cognate ligands have not yet been identified or may not exist. The principles of DNA recognition and ligand binding are well understood from both biochemical and crystal structure analyses. The 3D structures of several DNA-binding domains (DBDs), in complexes with a variety of cognate response elements, and multiple ligand-binding domains (LBDs), in the absence (apoLBD) and pres- ence (holoLBD) of agonist, have been established and reveal canonical structural organiza- tion. Agonist binding induces a structural transition in the LBD whose most striking feature is the relocation of helix H12, which is required for establishing a coactivator complex, through interaction with members of the p160 family (SRC1, TIF2, AIB1) and/or the TRAP/DRIP complex. The p160-dependent coactivator complex is a multiprotein complex that comprises histone acetyltransferases (HATs), such as CBP, methyltransferases, such as CARM1, and other enzymes (SUMO ligase, etc.). The agonist-dependent recruitment of the HAT complex results in chromatin modification in the environment of the target gene pro- moters, which is requisite to, or may in some cases be sufficient for, transcription activation. -
The Role of Cyclin-Dependent Kinase 8 in Vascular Disease Desiree Leach University of South Carolina
University of South Carolina Scholar Commons Theses and Dissertations Fall 2017 The Role Of Cyclin-Dependent Kinase 8 In Vascular Disease Desiree Leach University of South Carolina Follow this and additional works at: https://scholarcommons.sc.edu/etd Part of the Biomedical and Dental Materials Commons Recommended Citation Leach, D.(2017). The Role Of Cyclin-Dependent Kinase 8 In Vascular Disease. (Doctoral dissertation). Retrieved from https://scholarcommons.sc.edu/etd/4523 This Open Access Dissertation is brought to you by Scholar Commons. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. THE ROLE OF CYCLIN -DEPENDENT KINASE 8 IN VASCULAR DISEASE by Desiree Leach Bachelor of Science Coastal Carolina University, 2010 Submitted in Partial Fulfillment of the Requirements For the Degree of Doctor of Philosophy in Biomedical Science School of Medicine University of South Carolina 2017 Accepted by: Taixing Cui, Major Professor Wayne Carver, Committee Member Joseph Janicki, Committee Member Igor Roninson, Committee Member Udai Singh, Committee Member Cheryl L Addy, Vice Provost and Dean of the Graduate School © Copyright by Desiree Leach, 2017 All Rights Reserved. ii ACKNOWLEDGEMENTS I would like to thank my mentor, Dr. Taixing Cui, for all his guidance and support. Thank you for supplying me with the knowledge and techniques to grow as a scientist. I would also like to thank my committee members: Dr. Wayne Carver, Dr. Igor Roninson, Dr. Udai Singh and Dr. Joseph Janicki. I appreciate all of your constructive criticism and your efforts to help me grow as a scientist. -
Structure of the Mediator Head Module Bound to the Carboxy-Terminal Domain of RNA Polymerase II
Structure of the Mediator Head module bound to the carboxy-terminal domain of RNA polymerase II Philip J. J. Robinsona, David A. Bushnella, Michael J. Trnkab, Alma L. Burlingameb, and Roger D. Kornberga,1 aDepartment of Structural Biology, Stanford University School of Medicine, Stanford, CA 94305; and bDepartment of Pharmaceutical Chemistry, University of California, San Francisco, CA 94158 Contributed by Roger D. Kornberg, September 9, 2012 (sent for review August 26, 2012) The X-ray crystal structure of the Head module, one-third of the Despite biochemical and genetic evidence for Mediator–CTD Mediator of transcriptional regulation, has been determined as a interaction, the molecular details of the complex are largely complex with the C-terminal domain (CTD) of RNA polymerase II. unknown. A failure of genetic experiments to identify mutations The structure reveals multiple points of interaction with an ex- in individual Mediator genes causing disruption of the complex tended conformation of the CTD; it suggests a basis for regulation suggests an extensive interaction surface involving multiple Me- by phosphorylation of the CTD. Biochemical studies show a re- diator components, but the subunit identity and the basis of quirement for Mediator–CTD interaction for transcription. molecular specificity remain to be determined. Furthermore, the importance of Mediator–CTD interaction in the regulatory role transcriptional initiation | X-ray crystallography | cross-linking | yeast of CTD phosphorylation has not been addressed. Here we investigate structural aspects of Mediator–CTD in- ediator, a megaDalton multiprotein complex, enables the teraction, defining the path of the CTD across a highly conserved Mregulation of transcription (reviewed in refs 1 and 2); it surface of the Mediator Head module and suggesting a basis for bridges between gene activator proteins at enhancers and RNA binding, which involves several important interactions with CTD polymerase II (pol II) at promoters. -
The TRAP Mediator Coactivator Complex Interacts Directly with Estrogen Receptors and Through the TRAP220 Subunit and Directly En
The TRAP͞Mediator coactivator complex interacts directly with estrogen receptors ␣ and  through the TRAP220 subunit and directly enhances estrogen receptor function in vitro Yun Kyoung Kang, Mohamed Guermah, Chao-Xing Yuan*, and Robert G. Roeder† Laboratory of Biochemistry and Molecular Biology, The Rockefeller University, New York, NY 10021 Contributed by Robert G. Roeder, December 31, 2001 Target gene activation by nuclear hormone receptors, including The possibility that TRAP͞Mediator might function with class I estrogen receptors (ERs), is thought to be mediated by a variety of (steroid hormone) nuclear receptors in addition to class II nuclear interacting cofactors. Here we identify a number of nuclear extract- receptors such as TR and VDR was suggested first by the obser- derived proteins that interact with immobilized ER ligand binding vation of a ligand-dependent interaction of intact TRAP220 with domains in a 17-estradiol-dependent manner. The most prominent estrogen receptor (ER)␣ (6). In support of this notion, subsequent of these are components of the thyroid hormone receptor-associated studies confirmed physical interactions of TRAP220 with ER␣ protein (TRAP)͞Mediator coactivator complex, which interacts with (15–17), demonstrated inhibitory effects of an ER-interacting frag- ER␣ and ER in both unfractionated nuclear extracts and purified ment of TRAP220 (16) and an anti-TRAP220 antibody (18) on form. Studies with extracts from TRAP220؊͞؊ fibroblasts reveal that ER␣ function in transfected cells, and established the presence of these interactions depend on TRAP220, a TRAP͞Mediator subunit TRAP220 on the promoters of endogenous estrogen-responsive previously shown to interact with ER and other nuclear receptors in genes (19). -
Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.